Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Dual phase multiplex polymerase chain reaction
Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL
2008-10-07
Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.
Wang, F; Zhang, Y Q; Ding, J; Yu, L X
2017-10-18
To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions
Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik
2006-02-01
The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.
Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu
2011-09-01
To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
Huang, Shu-Huan; Lin, Yi-Fang; Tsai, Ming-Han; Yang, Shuan; Liao, Mei-Ling; Chao, Shao-Wen; Hwang, Cheng-Cheng
2018-06-01
Conventional methods for identifying gastroenteritis pathogens are time consuming, more likely to result in a false-negative, rely on personnel with diagnostic expertise, and are dependent on the specimen status. Alternatively, molecular diagnostic methods permit the rapid, simultaneous detection of multiple pathogens with high sensitivity and specificity. The present study compared conventional methods with the Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for the diagnosis of infectious gastroenteritis in northern Taiwan. From July 2015 to April 2016, 217 clinical fecal samples were collected from patients with suspected infectious gastroenteritis. All specimens were tested using conventional diagnostic techniques following physicians' orders as well as with the xTAG GPP. The multiplex polymerase chain reaction (PCR) approach detected significantly more positive samples with bacterial, viral, and/or parasitic infections as compared to conventional analysis (55.8% vs 40.1%, respectively; P < .001). Moreover, multiplex PCR could detect Escherichia coli O157, enterotoxigenic E coli, Shiga-like toxin-producing E coli, Cryptosporidium, and Giardia, which were undetectable by conventional methods. Furthermore, 48 pathogens in 23 patients (10.6%) with coinfections were identified only using the multiplex PCR approach. Of which, 82.6% were from pediatric patients. Because the detection rates using multiplex PCR are higher than conventional methods, and some pediatric pathogens could only be detected by multiplex PCR, this approach may be useful in rapidly diagnosing diarrheal disease in children and facilitating treatment initiation. Further studies are necessary to determine if multiplex PCR improves patient outcomes and reduces costs.
Huang, Shu-Huan; Lin, Yi-Fang; Tsai, Ming-Han; Yang, Shuan; Liao, Mei-Ling; Chao, Shao-Wen; Hwang, Cheng-Cheng
2018-01-01
Abstract Conventional methods for identifying gastroenteritis pathogens are time consuming, more likely to result in a false-negative, rely on personnel with diagnostic expertise, and are dependent on the specimen status. Alternatively, molecular diagnostic methods permit the rapid, simultaneous detection of multiple pathogens with high sensitivity and specificity. The present study compared conventional methods with the Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for the diagnosis of infectious gastroenteritis in northern Taiwan. From July 2015 to April 2016, 217 clinical fecal samples were collected from patients with suspected infectious gastroenteritis. All specimens were tested using conventional diagnostic techniques following physicians’ orders as well as with the xTAG GPP. The multiplex polymerase chain reaction (PCR) approach detected significantly more positive samples with bacterial, viral, and/or parasitic infections as compared to conventional analysis (55.8% vs 40.1%, respectively; P < .001). Moreover, multiplex PCR could detect Escherichia coli O157, enterotoxigenic E coli, Shiga-like toxin-producing E coli, Cryptosporidium, and Giardia, which were undetectable by conventional methods. Furthermore, 48 pathogens in 23 patients (10.6%) with coinfections were identified only using the multiplex PCR approach. Of which, 82.6% were from pediatric patients. Because the detection rates using multiplex PCR are higher than conventional methods, and some pediatric pathogens could only be detected by multiplex PCR, this approach may be useful in rapidly diagnosing diarrheal disease in children and facilitating treatment initiation. Further studies are necessary to determine if multiplex PCR improves patient outcomes and reduces costs. PMID:29879060
Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe
2017-02-01
Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.
de Andrade, Caroline P.; Machado, Verônica S. L.; Bianchi, Matheus V.; Rolim, Veronica M.; Cruz, Raquel A. S.; Driemeier, David
2018-01-01
Enterotoxigenic Escherichia coli (ETEC) causes diarrhea in pigs, referred to as colibacillosis. The aim of this study was to optimize multiplex polymerase chain reaction (PCR) and immunohistochemistry (IHC) analyses of paraffin-embedded material to detect pathogenic E. coli strains causing colibacillosis in pigs. Multiplex PCR was optimized for fimbriae (F18, F4, F6, F5, and F41) and toxins (types A and B heat-stable toxins [STaP and STb], heat-labile toxin [LT], and type 2 Shiga toxin [STx2e]), and IHC was optimized for an anti-E. coli polyclonal antibody. Samples (132) from pigs received between 2006 and 2014 with clinical and histopathological diagnoses of colibacillosis were analyzed. E. coli was detected by IHC in 78.7%, and at least one virulence factor gene was detected in 71.2%. Pathogenic strains of ETEC with at least one fimbria and one toxin were detected in 40% of the samples in multiplex PCR. The most frequent virulence types were F18-STaP (7.5%), F18-STaP-STb (5.7%), and F4-STaP (3.8%). A statistically significant association was noted between virulence factors F4, F18, STaP, and STb and positive immunostaining results. Colibacillosis diagnosis through multiplex PCR and IHC of paraffin-embedded tissues is a practical approach, as samples can be fixed and stored for long periods before analysis. PMID:28693311
Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana
2015-08-18
Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.
Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; von Stetten, Felix
2016-03-01
Multiplexing in polymerase chain reaction (PCR) is a technique widely used to save cost and sample material and to increase sensitivity compared to distributing a sample to several singleplex reactions. One of the most common methods to detect the different amplification products is the use of fluorogenic probes that emit at different wavelengths (colors). To reduce the number of detection channels, several methods for monochrome multiplexing have been suggested. However, they pose restrictions to the amplifiable target length, the sequence, or the melting temperature. To circumvent these limitations, we suggest a novel approach that uses different fluorophores with the same emission maximum. Discrimination is achieved by their different fluorescence stability during photobleaching. Atto488 (emitting at the same wavelength as 6-carboxyfluorescein, FAM) and Atto467N (emitting at the same wavelength as cyanine 5, Cy5) were found to bleach significantly less than FAM and Cy5; i.e., the final fluorescence of Atto dyes was more than tripled compared to FAM and Cy5. We successfully applied this method by performing a 4-plex PCR targeting antibiotic resistance genes in S. aureus using only 2 color channels. Confidence of discrimination between the targets was >99.9% at high copy initial copy numbers of 100 000 copies. Cases where both targets were present could be discriminated with equal confidence for Cy5 channel and reduced levels of confidence (>68%) for FAM channel. Moreover, a 2-plex digital PCR reaction in 1 color channel was shown. In the future, the degree of multiplexing may be increased by adding fluorogenic probe pairs with other emission wavelengths. The method may also be applied to other probe and assay formats, such as Förster resonance energy transfer (FRET) probes and immunoassays.
Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H
2013-04-01
Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.
Kawamura, Masaki; Kobayashi, Naomi; Inaba, Yutaka; Choe, Hyonmin; Tezuka, Taro; Kubota, So; Saito, Tomoyuki
2017-11-01
A new multiplex real-time polymerase chain reaction (PCR) assay was developed to detect methicillin-resistant Staphylococcus (MRS) and to distinguish between gram-positive and gram-negative bacteria. In this study, we validated the sensitivity and specificity of this assay with periprosthetic joint infections (PJIs) and evaluated the utility of PCR for culture-negative PJI. Forty-five samples from 23 infectious PJI cases and 106 samples from 64 non-infectious control cases were analyzed by real-time PCR using a LightCycler Nano ® system. Twenty-eight clinical samples, comprising bacteria of known species isolated consecutively in the microbiological laboratory of our hospital, were used to determine the spectrum of bacterial species that could be detected using the new multiplex primers and probes. The sensitivity and specificity of the MRS- and universal-PCR assays were 92% and 99%, and 91% and 88%, respectively. Twenty-eight species of clinically isolated bacteria were detected using this method and the concordance rate for the identification of gram-positive or gram-negative organisms was 96%. Eight samples were identified as PCR-positive despite a culture-negative result. This novel multiplex real-time PCR system has acceptable sensitivity and specificity and several advantages; therefore, it has potential use for the diagnosis of PJIs, particularly in culture-negative cases.
Nakhaie, Mohsen; Soleimanjahi, Hoorieh; Mollaie, Hamid Reza; Arabzadeh, Seyed Mohamad Ali
2018-01-01
Background and objective: Millions of people in developing countries lose their lives due to acute respiratory infections, such as Influenza A & B and Adeno viruses. Given the importance of rapid identification of the virus, in this study the researchers attempted to design a method that enables detection of influenza A, B, and adenoviruses, quickly and simultaneously. The Multiplex RT PCR method was the preferred method for the detection of influenza A, B, and adenoviruses in clinical specimens because it is rapid, sensitive, specific, and more cost-effective than alternative methods Methods: After collecting samples from patients with respiratory disease, virus genome was extracted, then Monoplex PCR was used on positive samples and Multiplex RT-PCR on clinical specimens. Finally, by comparing the bands of these samples, the type of virus in the clinical samples was determined. Results: Performing Multiplex RT-PCR on 50 samples of respiratory tract led to following results; flu A: 12.5%, fluB: 50%, adeno: 27.5%, negative: 7.5%, and 2.5% contamination. Conclusion: Reverse transcription-multiplex Polymerase Chain Reaction (PCR) technique, a rapid diagnostic tool, has potential for high-throughput testing. This method has a significant advantage, which provides simultaneous amplification of numerous viruses in a single reaction. This study concentrates on multiplex molecular technologies and their clinical application for the detection and quantification of respiratory pathogens. The improvement in diagnostic testing for viral respiratory pathogens effects patient management, and leads to more cost-effective delivery of care. It limits unnecessary antibiotic use and improves clinical management by use of suitable treatment. PMID:29731796
Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila
2015-01-01
Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940
Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M
1993-01-01
A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.
Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov
2014-01-01
A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J
2016-12-07
The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray ® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. © The American Society of Tropical Medicine and Hygiene.
Latha, C.; Anu, C. J.; Ajaykumar, V. J.; Sunil, B.
2017-01-01
Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR) method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349), chicken (n=325), pork (n=310), chevon (n=50), and meat products (n=100) were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7%) was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost. PMID:28919685
ESTRELA, Cyntia Rodrigues de Araújo; PIMENTA, Fabiana Cristina; de ALENCAR, Ana Helena Gonçalves; RUIZ, Luis Fernando Naldi; ESTRELA, Carlos
2010-01-01
Objective The aim of this study was to detect the prevalence of selected bacterial species in intraoral sites of patients with chronic periodontitis (CP) using multiplex polymerase chain reaction (PCR). Methodology Samples were collected from the tongue dorsum, buccal mucosa, supragingival and subgingival plaque and saliva of 30 patients with untreated CP. Multiplex PCR was used to determine prevalence rates, which were then compared using a chi-square test. Significance level was set at p<0.05. Mean and standard deviation values were used to evaluate variations in prevalence according to site. Results The prevalence of S. mutans was 70% in saliva; 60% in samples collected from the tongue dorsum; 50% in samples collected from the buccal mucosa; 56.5% in the supragingival plaque; and 53.5% in the subgingival plaque. The prevalence of E. faecalis ranged from 3.5% to 13.5% in all intraoral microenvironment. The highest prevalence of P. gingivalis was found in subgingival plaque (53.5%), and of P. intermedia in supragingival plaque (33.5%), subgingival plaque (30%) and tongue dorsum (33.5%). The prevalence of bacteria did not vary significantly among the intraoral sites. Conclusions All studied bacteria were identified in intraoral sites. S. mutans, P. gingivalis and P. intermedia had high prevalence rates, but the prevalence of E. faecalis was low. Multiplex PCR proved to be an adequate method for epidemiological studies. PMID:20835581
Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee
2017-10-01
Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.
Lee, Chi-Tsung; Hsiao, Kuang-Ming; Chen, Jin-Cherng; Su, Cheng-Chuan
2015-11-01
Acute bacterial meningitis causes high morbidity and mortality; the associated clinical symptoms often are insensitive or non-specific; and the pathogenic bacteria are geographically diverse. Clinical diagnosis requires a rapid and accurate methodology. This study aimed to develop a new multiplex polymerase chain reaction (mPCR) assay to detect simultaneously six major bacteria that cause adult bacterial meningitis in Taiwan: Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus pneumoniae, Staphylococcus aureus, Escherichia coli, and Acinetobacter baumannii. Species-specific primers for the six bacteria were developed using reference strains. The specificities of the mPCRs for these bacteria were validated, and the sensitivities were evaluated via serial dilutions. The mPCR assay specifically detected all of the six pathogens, particularly with sensitivities of 12 colony forming units (CFU)/mL, 90 CFU/mL, and 390 CFU/mL for E. coli, S. pneumoniae, and K. pneumoniae, respectively. This mPCR assay is a rapid and specific tool to detect the six major bacterial pathogens that cause acute adult meningitis in Taiwan, particularly sensitive for detecting E. coli, S. pneumoniae, and K. pneumoniae. The assay may facilitate early diagnosis and guidance for antimicrobial therapy for adult patients with this deadly disease in Taiwan. © 2015 APMIS. Published by John Wiley & Sons Ltd.
Kim, Ji Yeun; Lee, Jung-Lim
2014-10-01
This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL⁻¹ in pure culture and seawater, and 10 CFU g⁻¹ in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry.
Kim, Ji Yeun; Lee, Jung-Lim
2014-01-01
Background This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. Results The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL−1 in pure culture and seawater, and 10 CFU g−1 in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Conclusion Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:24752974
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria
2003-12-15
Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.
Bej, A K; McCarty, S C; Atlas, R M
1991-01-01
Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116
Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep
2012-02-01
Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®
Denison, Amy M.; Amin, Bijal D.; Nicholson, William L.; Paddock, Christopher D.
2015-01-01
Background Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari are the most common causes of spotted fever group rickettsioses indigenous to the United States. Infected patients characteristically present with a maculopapular rash, often accompanied by an inoculation eschar. Skin biopsy specimens are often obtained from these lesions for diagnostic evaluation. However, a species-specific diagnosis is achieved infrequently from pathologic specimens because immunohistochemical stains do not differentiate among the causative agents of spotted fever group rickettsiae, and existing polymerase chain reaction (PCR) assays generally target large gene segments that may be difficult or impossible to obtain from formalin-fixed tissues. Methods This work describes the development and evaluation of a multiplex real-time PCR assay for the detection of these 3 Rickettsia species from formalin-fixed, paraffin-embedded (FFPE) skin biopsy specimens. Results The multiplex PCR assay was specific at discriminating each species from FFPE controls of unrelated bacterial, viral, protozoan, and fungal pathogens that cause skin lesions, as well as other closely related spotted fever group Rickettsia species. Conclusions This multiplex real-time PCR demonstrates greater sensitivity than nested PCR assays in FFPE tissues and provides an effective method to specifically identify cases of Rocky Mountain spotted fever, rickettsialpox, and R. parkeri rickettsiosis by using skin biopsy specimens. PMID:24829214
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
Nadal, Anna; Esteve, Teresa; Pla, Maria
2009-01-01
A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.
Kim, Hyun-Joong; Ryu, Ji-Oh; Song, Ji-Yeon; Kim, Hae-Yeong
2017-07-01
In the detection of Shigella species using molecular biological methods, previously known genetic markers for Shigella species were not sufficient to discriminate between Shigella species and diarrheagenic Escherichia coli. The purposes of this study were to screen for genetic markers of the Shigella genus and four Shigella species through comparative genomics and develop a multiplex polymerase chain reaction (PCR) for the detection of shigellae and Shigella species. A total of seven genomic DNA sequences from Shigella species were subjected to comparative genomics for the screening of genetic markers of shigellae and each Shigella species. The primer sets were designed from the screened genetic markers and evaluated using PCR with genomic DNAs from Shigella and other bacterial strains in Enterobacteriaceae. A novel Shigella quintuplex PCR, designed for the detection of Shigella genus, S. dysenteriae, S. boydii, S. flexneri, and S. sonnei, was developed from the evaluated primer sets, and its performance was demonstrated with specifically amplified results from each Shigella species. This Shigella multiplex PCR is the first to be reported with novel genetic markers developed through comparative genomics and may be a useful tool for the accurate detection of the Shigella genus and species from closely related bacteria in clinical microbiology and food safety.
Safari Foroshani, Nargess; Karami, Ali; Pourali, Fatemeh
2013-01-01
Background Salmonella typhi, Bacillus anthracis, and Yersinia pestis are some serious human pathogens, which their early diagnosis is of great importance. Salmonella typhi, Bacillus anthracis, and Yersinia pestis cause typhoid fever, anthrax, and plague respectively. These bacteria can be used to make biologic weapons. Objectives In this study, we designed a new and rapid diagnostic method based on Uniplex and Multiplex PCR method. Materials and Methods Uniplex and multiplex Polymerase Chain Reaction (PCR) were conducted on virulent genes of hp and invA of Salmonella typhimurium, Pa and chr of Bacillus anthracis, and pla of Yersinia pestis. A genome from other bacteria was used to study the specificity of the primer and the PCR test. Results Standard strains used in this study showed that primers were specific. As for sensitivity, it was shown that this method can diagnose 1-10 copies of the genome, or 1-10 Colony Forming Units (CFU) for each of the bacteria. All pieces except anthrax were sequenced in PCR to validate the product. DNA fragment resulted from Bacillus anthracis was confirmed by restriction enzyme digestions. Conclusion The designed methods are accurate, rapid, and inexpensive to find and differentiate these bacteria from similar bacteria. They can be applied for rapid diagnosis of these agents in different specimens, and bioterrorism cases. PMID:24719692
Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K
2016-11-01
Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.
Lee, Yuan-Ming; Chen, Yen-Ju; Lee, Cheng-Ming; Kuo, Lou-Hui; Wong, Wing-Wai; Chen, Yi-Ming Arthur
2011-12-01
In the past few years, many new subtypes in hepatitis C virus (HCV) genotype 6 have been identified. The aim of this study was to modify the multiplex real-time polymerase chain reaction (RT-PCR) protocol and use it to determine the HCV subtypes of a group of Taiwanese injection drug users (IDUs). We used 76 serum specimens collected in northern Taiwan in 2008. Multiplex RT-PCR was used for HCV subtyping among those serum samples having anti-HCV antibodies. Twenty cases were randomly selected for comparison with subtyping results from Inno-LiPa II tests and phylogenetic tree analysis using NS5B sequences. Multiplex RT-PCR assays showed that 60.5% (46/76) of IDUs had single HCV infection. Three out of 76 (3.9%) had double HCV infection (1b/6a, 2a/2b and 2b/6a). Besides this, 27.6% (21/76) had no HCV signal. One IDU had subtype 6n and two had subtype 6w infection. Inno-LiPa II tests misclassified all 6n and 6w cases as 1b subtype. Our modified multiplex RT-PCR protocol can be used to support molecular epidemiological studies and laboratory diagnoses of different HCV subtypes including genotype 6. Copyright © 2011. Published by Elsevier B.V.
Jiang, Chao; Luo, Yu-Qing; Yuan, Yuan; Huang, Lu-Qi; Jin, Yan; Zhao, Yu-Yang
2017-04-01
To achieve a molecular method to identify Panax ginseng, P. notoginseng,P. quinquefolius and their admixture. The ITS,18S and matK sequences of Panax genus were analyzed to develop species-specific SNP marker. Three pairs of species-specific primers were designed to establish a multiplex allele-specific polymerase chain reaction (MAS-PCR) and the samples from different region were tested. The results showed that when the annealing temperature was 60 ℃ and the cycle number was 35, approximately 250, 500,1 000 bp specific band were obtained from P. ginseng, P. notoginseng and P. quinquefolius obtain, respectively. This method could also be used to authentificate admixture samples and could detect 0.5% percent of P. notoginseng or P. quinquefolius adulterated in P. ginseng, or 0.5% percent of P. ginseng or P. quinquefolius adulterated in P. notoginseng. The detect limit of P. ginseng in P. quinquefolius was 0.5% and P. notoginseng in P. quinquefolius was 1%. This results showed that the present method could be used as a promise method to identify Panax ginseng, P. notoginseng, P. quinquefolius and their admixture. Copyright© by the Chinese Pharmaceutical Association.
Denison, Amy M; Amin, Bijal D; Nicholson, William L; Paddock, Christopher D
2014-09-01
Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari are the most common causes of spotted fever group rickettsioses indigenous to the United States. Infected patients characteristically present with a maculopapular rash, often accompanied by an inoculation eschar. Skin biopsy specimens are often obtained from these lesions for diagnostic evaluation. However, a species-specific diagnosis is achieved infrequently from pathologic specimens because immunohistochemical stains do not differentiate among the causative agents of spotted fever group rickettsiae, and existing polymerase chain reaction (PCR) assays generally target large gene segments that may be difficult or impossible to obtain from formalin-fixed tissues. This work describes the development and evaluation of a multiplex real-time PCR assay for the detection of these 3 Rickettsia species from formalin-fixed, paraffin-embedded (FFPE) skin biopsy specimens. The multiplex PCR assay was specific at discriminating each species from FFPE controls of unrelated bacterial, viral, protozoan, and fungal pathogens that cause skin lesions, as well as other closely related spotted fever group Rickettsia species. This multiplex real-time PCR demonstrates greater sensitivity than nested PCR assays in FFPE tissues and provides an effective method to specifically identify cases of Rocky Mountain spotted fever, rickettsialpox, and R. parkeri rickettsiosis by using skin biopsy specimens. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C
2013-06-01
Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.
Inazawa, Natsuko; Hori, Tsukasa; Hatakeyama, Naoki; Yamamoto, Masaki; Yoto, Yuko; Nojima, Masanori; Suzuki, Nobuhiro; Shimizu, Norio; Tsutsumi, Hiroyuki
2015-08-01
Viral reactivations following hematopoietic stem cell transplantation are thought to result from the breakdown of both cell-mediated and humoral immunity. As a result, many viruses could be reactivated individually or simultaneously. Using a multiplex polymerase chain reaction (PCR), we prospectively examined many kinds of viral DNAs at a time in 105 patients who underwent allogeneic hematopoietic stem cell transplantation. In total, 591 whole blood samples were collected weekly from pre- to 42 days post-transplantation and the following 13 viruses were tested; herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpes virus 6 (HHV-6), HHV-7, HHV-8, adenovirus, BK virus (BKV), JC virus (JCV), parvovirus B19, and hepatitis B virus (HBV). Several viral DNAs were detected in 12 patients before hematopoietic stem cell transplantation. The detection rate gradually increased after transplantation and peaked at 21 days. The most frequently detected virus was HHV-6 (n = 63; 60.0%), followed by EBV (n = 11; 10.5%), CMV (n = 11; 10.5%), and HHV-7 (n = 9; 8.6%). Adenovirus and HBV were each detected in one patient (1.0%). Detection of HHV-6 DNA was significantly more common among patients undergoing cord blood transplantation or with steroid treatment. EBV DNA tended to be more common in patients treated with anti-thymocyte globulin. Multiplex PCR was useful for detecting many viral reactivations after hematopoietic stem cell transplantation, simultaneously. Cord blood transplantation, steroid treatment, or anti-thymocyte globulin use was confirmed to be risk factors after transplantation. © 2015 Wiley Periodicals, Inc.
Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko
2009-11-01
To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.
Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2018-05-01
As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.
Chen, Yen-Ling; Shih, Chi-Jen; Ferrance, Jerome; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei
2009-02-13
A gold nanoparticle-filled capillary electrophoresis method combined with three multiplex polymerase chain reactions (PCRs) was established for simultaneous diagnosis of five common alpha-thalassemia deletions, including the -alpha(3.7) deletion, -alpha(4.2) deletion, Southeast Asian (--(SEA)), Filipino (--(FIL)) and Thai (--(THAI)) deletions. Gold nanoparticles (GNPs) were used as a pseudostationary phase to improve the resolution between DNA fragments in a low-viscosity polymer. To achieve the best CE separation, several parameters were evaluated for optimizing the separation conditions, including the capillary coating, the concentrations of polymer sieving matrix, the sizes and concentrations of GNPs, the buffer concentrations, and the pH. The final CE method for separating a 200-base pair (bp) DNA ladder and alpha-thalassemia deletions used a DB-17 capillary, 0.6% poly(ethylene oxide) (PEO) prepared in a mixture of GNP(32nm) solution and glycine buffer (25mM, pH 9.0) (80:20, v/v) as the sieving matrix with 1microM YO-PRO-1 for fluorescence detection; the applied voltage was -10kV (detector at anode side) and the separation temperature was 25 degrees C. Under these optimal conditions, 15 DNA fragments with sizes ranging from 0.2kb to 3.0kb were resolved within 11.5min. The RSDs of migration times were less than 2.81%. A total of 21 patients with alpha-thalassemia deletions were analyzed using this method, and all results showed good agreement with those obtained by gel electrophoresis.
Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo
2011-07-01
Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.
Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui
2016-11-22
Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.
USDA-ARS?s Scientific Manuscript database
A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...
Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe
2009-04-01
The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.
Polymerase chain reaction system
Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.
2004-03-02
A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
New primers for the detection Leishmania species by multiplex polymerase chain reaction.
Conter, Carolina Cella; Lonardoni, Maria Valdrinez Campana; Aristides, Sandra Mara Alessi; Cardoso, Rosilene Fressatti; Silveira, Thaís Gomes Verzignassi
2018-02-01
Leishmaniasis is caused by protozoa of the Leishmania genus, which is divided into subgenus Viannia and Leishmania. In humans, the course of infection largely depends on the host-parasite relationship and primarily of the infective species. The objective of the present study was to design specific primers to the identification of Leishmania species using multiplex PCR. Four primers were designed, based on the GenBank sequences of the kDNA minicircle, amplifying 127 bp for subgenus Viannia, 100 bp for L. amazonensis, and 60 bp for Leishmania donovani complex and L. major. None of the primers amplified Trypanosoma cruzi or L. mexicana. The limit of detection of multiplex PCR was 2 × 10 -5 parasites for L. braziliensis, 2 x 10 -3 parasites for L. amazonensis, and 1.4 × 10 -3 parasites for L. infantum. The high sensitivity of multiplex PCR was confirmed by the detection of parasites in different biological samples, including lesion scrapings, spleen imprinting of a hamster, sandflies, and blood. The multiplex PCR that was developed herein presented good performance with regard to detecting and identifying the parasite in different biological samples and may thus be useful for diagnosis, decision making with regard to the proper therapeutic approach, and determining the geographic distribution of Leishmania species.
Green, Tina M; Jensen, Andreas K; Holst, René; Falgreen, Steffen; Bøgsted, Martin; de Stricker, Karin; Plesner, Torben; Mourits-Andersen, Torben; Frederiksen, Mikael; Johnsen, Hans E; Pedersen, Lars M; Møller, Michael B
2016-09-01
We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de novo DLBCL patients treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, prednisone). Including International Prognostic Index (IPI) as a variable in a penalized Cox regression, we investigated the association with disease progression for single genes or gene combinations in four models. The best model was validated in data from an online available R-CHOP treated cohort. With progression-free survival (PFS) as primary endpoint, the best performing IPI independent model incorporated the LMO2 and HLADQA1 as well as gene interactions for GCSAMxMIB1, GCSAMxCTGF and FOXP1xPDE4B. This model assigned 33% of patients (n = 60) to poor outcome with an estimated 3-year PFS of 40% vs. 87% for low risk (n = 61) and intermediate (n = 60) risk groups (P < 0·001). However, a simpler, IPI independent model incorporated LMO2 and BCL2 and assigned 33% of the patients with a 3-year PFS of 35% vs. 82% for low risk group (P < 0·001). We have documented the impact of a few single genes added to IPI for assignment in new drug trials. © 2016 John Wiley & Sons Ltd.
Zhu, X-B; Gong, Y-H; He, J; Guo, A-L; Zhi, E-L; Yao, J-E; Zhu, B-S; Zhang, A-J; Li, Z
2017-06-01
Azoospermia factor (AZF) genes on the long arm of the human Y chromosome are involved in spermatogenesis, and microdeletions in the AZF region have been recognised to be the second major genetic cause of spermatogenetic failure resulting in male infertility. While screening for these microdeletions can avoid unnecessary medical and surgical treatments, current methods are generally time-consuming. Therefore, we established a new method to detect and analyse microdeletions in the AZF region quickly, safely and efficiently. In total, 1,808 patients with spermatogenetic failure were recruited from three hospitals in southern China, of which 600 patients were randomly selected for screening for Y chromosome microdeletions in AZF regions employing real-time polymerase chain reaction with a TaqMan probe. In our study, of 1,808 infertile patients, 150 (8.3%) were found to bear microdeletions in the Y chromosome using multiplex PCR, while no deletions were found in the controls. Among the AZF deletions detected, two were in AZFa, three in AZFb, 35 in AZFc, three in AZFb+c and two in AZFa+b+c. Our method is fast-it permits the scanning of DNA from a patient in one and a half hours-and reliable, minimising the risk of cross-contamination and false-positive and false-negative results. © 2016 Blackwell Verlag GmbH.
Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora
2010-01-01
A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454
Multiplex polymerase chain reaction on FTA cards vs. flow cytometry for B-lymphocyte clonality.
Dictor, Michael; Skogvall, Ingela; Warenholt, Janina; Rambech, Eva
2007-01-01
Two-colour flow cytometry was compared with multiplex PCR with capillary electrophoresis for clonality determination in specific categories of B-cell lymphoma. FTA cards were evaluated for preserving DNA from node imprints and expediting molecular analysis. A single-tube multiplex PCR targeted IGH and lymphoma-specific translocations in DNA extracted from 180 frozen lymphoid tissues and DNA bound to FTA cards from 192 fresh tissues and 137 aspirates. PCR results were compared with flow cytometry in the extracted and aspirated samples. Overall, single-tube multiplex PCR sensitivity was equivalent in the sample groups (intergroup range 79%-91%). False negatives were associated with tumour origin in the follicle centre. Multiplex PCR and flow cytometry were equally sensitive and together detected 98% of B-cell lymphomas. Additional two-tube targeting of IGK suggested an overall molecular sensitivity >90%. False positive (pseudoclonal) single-tube multiplex PCR was associated with necrosis and sparse lymphocytes. Multiplex PCR using template DNA bound to an FTA card effectively detects B-lymphocyte clonality, obviates DNA extraction and refrigeration, and can be used without diminished sensitivity in fine needle aspirates or node imprints as a replacement for or complement to flow cytometry at any point in the diagnostic work-up.
Mertz, K J; Weiss, J B; Webb, R M; Levine, W C; Lewis, J S; Orle, K A; Totten, P A; Overbaugh, J; Morse, S A; Currier, M M; Fishbein, M; St Louis, M E
1998-10-01
In 1994, an apparent outbreak of atypical genital ulcers was noted by clinicians at the sexually transmitted disease clinic in Jackson, Mississippi. Of 143 patients with ulcers tested with a multiplex polymerase chain reaction (PCR) assay, 56 (39%) were positive for Haemophilus ducreyi, 44 (31%) for herpes simplex virus, and 27 (19%) for Treponema pallidum; 12 (8%) were positive for > 1 organism. Of 136 patients tested for human immunodeficiency virus (HIV) by serology, 14 (10%) were HIV-seropositive, compared with none of 200 patients without ulcers (P < .001). HIV-1 DNA was detected by PCR in ulcers of 6 (50%) of 12 HIV-positive patients. Multivariate analysis indicated that men with chancroid were significantly more likely than male patients without ulcers to report sex with a crack cocaine user, exchange of money or drugs for sex, and multiple sex partners. The strong association between genital ulcers and HIV infection in this population highlights the urgency of preventing genital ulcers in the southern United States.
Chromá, Magdaléna; Hricová, Kristýna; Kolář, Milan; Sauer, Pavel; Koukalová, Dagmar
2011-11-01
A total of 78 bacterial strains with known β-lactamases were used to optimize a rapid detection system consisting of multiplex polymerase chain reaction and melting curve analysis to amplify and identify blaTEM, blaSHV, and blaCTX-M genes in a single reaction. Additionally, to evaluate the applicability of this method, 32 clinical isolates of Escherichia coli displaying an extended-spectrum β-lactamase phenotype from patients hospitalized at intensive care units were tested. Results were analyzed by the Rotor-Gene operating software and Rotor-Gene ScreenClust HRM Software. The individual melting curves differed by a temperature shift or curve shape, according to the presence of β-lactamase genes. With the use of this method and direct sequencing, blaCTX-M-15-like was identified as the most prevalent β-lactamase gene. In conclusion, this novel detection system seems to be a suitable tool for rapid detection of present β-lactamase genes and their characterization. Copyright © 2011 Elsevier Inc. All rights reserved.
Wei, Hui-Ling; Bai, Gui-Rong; Mweene, Aaron S; Zhou, Ying-Chun; Cong, Yan-Long; Pu, Juan; Wang, Shuai; Kida, Hiroshi; Liu, Jin-Hua
2006-06-01
Outbreaks of H5N1 highly pathogenic avian influenza (HPAI) virus caused great economic losses to the poultry industry and resulted in human deaths in Thailand and Viet Nam in 2004. Rapid typing and subtyping of H5N1 viruses, especially from clinical specimens, are desirable for taking prompt control measures to prevent the spread of the disease. Here, we developed a set of oligonucleotide primers able to detect, type and subtype H5 and N1 influenza viruses in a single step multiplex reverse transcription-polymerase chain reaction (RT-PCR). RNA was extracted from allantoic fluid or from specimens with guanidinium isothiocyanate reagent. Reverse transcription and PCR were carried out with a mixture of primers specific for influenza viruses of type A, subtype H5 and N1 in a single reaction system under identical conditions. The amplified DNA fragments were analyzed by agarose gel electrophoresis. All the H5N1 viruses tested in the study and the experimental specimens presented three specific bands by the method established here. The results presented here suggest that the method described below is rapid and specific and, therefore, could be valuable in the rapid detection of H5N1 influenza viruses in clinics.
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Review of Detection of Brucella sp. by Polymerase Chain Reaction
Yu, Wei Ling; Nielsen, Klaus
2010-01-01
Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083
Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P
2002-12-01
The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at <10(5) CFU/g of cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.
Huang, Shr-Wei; Ho, Chia-Fang; Chan, Kun-Wei; Cheng, Min-Chung; Shien, Jui-Hung; Liu, Hung-Jen; Wang, Chi-Young
2014-11-01
Infectious bronchitis virus (IBV; Avian coronavirus) causes acute respiratory and reproductive and urogenital diseases in chickens. Following sequence alignment of IBV strains, a combination of selective primer sets was designed to individually amplify the IBV wild-type and vaccine strains using a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) approach. This system was shown to discriminate the IBV wild-type and vaccine strains. Moreover, an ARMS real-time RT-PCR (ARMS qRT-PCR) was combined with a high-resolution analysis (HRMA) to establish a melt curve analysis program. The specificity of the ARMS RT-PCR and the ARMS qRT-PCR was verified using unrelated avian viruses. Different melting temperatures and distinct normalized and shifted melting curve patterns for the IBV Mass, IBV H120, IBV TW-I, and IBV TW-II strains were detected. The new assays were used on samples of lung and trachea as well as virus from allantoic fluid and cell culture. In addition to being able to detect the presence of IBV vaccine and wild-type strains by ARMS RT-PCR, the IBV Mass, IBV H120, IBV TW-I, and IBV TW-II strains were distinguished using ARMS qRT-PCR by their melting temperatures and by HRMA. These approaches have acceptable sensitivities and specificities and therefore should be able to serve as options when carrying out differential diagnosis of IBV in Taiwan and China. © 2014 The Author(s).
Price, D K; Clontz, D R; Woodard, W L; Kaufman, J S; Daniels, J M; Stolzenberg, S J; Teigland, C M
1998-08-01
To determine if circulating prostate cells are detectable subsequent to transrectal ultrasound (TRUS)-guided biopsy, and if so, whether cells remain in circulation for up to 4 weeks. Blood samples were drawn from 90 patients with elevated serum prostate-specific antigen (PSA) levels and/or abnormal digital rectal examination. Two samples were drawn from all patients immediately prior to TRUS and 30 minutes postbiopsy. Blood samples were also obtained 1 week postbiopsy from 83 patients, and 1 month postbiopsy from 61 patients. Multiplex nested reverse transcription polymerase chain reaction assay (RT-PCR) for PSA and prostate-specific membrane antigen (PSM) was performed on total ribonucleic acid (RNA) from each sample. Results were reported as positive if at least one of the targets was detected. Of 45 patients with biopsy-proven adenocarcinoma, 22 were RT-PCR positive prebiopsy and all remained positive 30 minutes postbiopsy. Of 23 patients with adenocarcinoma who were RT-PCR negative prebiopsy, 5 (22%) converted to positive 30 minutes postbiopsy (P < 0.001). Four of these 5 patients returned to negative after 1 week or 1 month. Of 45 patients without cancer at biopsy, 32 were RT-PCR negative prebiopsy and 6 (19%) converted to positive 30 minutes postbiopsy (P < 0.001). Although four of six available samples were still positive at 1 week, all four samples available 1 month postbiopsy were negative. Detection of circulating prostate cells subsequent to biopsy occurred in 11 of 55 (20%) previously RT-PCR negative patients, a proportion twice that reported in the literature. We attribute this higher proportion to the simultaneous detection of PSA and PSM mRNA in our multiplex assay. Conversion rates were similar in patients regardless of biopsy result. Testing of serial postbiopsy blood demonstrates clearing of these cells by 4 weeks in most patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nasarabadi, Shanavaz
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less
Constructing STR multiplex assays.
Butler, John M
2005-01-01
Multiplex polymerase chain reaction (PCR) refers to the simultaneous amplification of multiple regions of deoxyribonucleic acid (DNA) using PCR. Commercial short tandem repeat (STR) assays that can coamplify as many as 16 different loci have become widely used in forensic DNA typing. This chapter will focus on some of the aspects of constructing robust STR multiplex assays, including careful design and quality control of PCR primers. Examples from the development of a cat STR 12plex and a human Y chromosome STR 20plex are used to illustrate the importance of various parts of the protocol. Primer design parameters and Internet-accessible resources are discussed, as are solutions to problems with residual dye artifacts that result from impure primers.
Problem-Solving Test: Real-Time Polymerase Chain Reaction
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2009-01-01
Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…
Janku, F; Huang, H J; Fujii, T; Shelton, D N; Madwani, K; Fu, S; Tsimberidou, A M; Piha-Paul, S A; Wheler, J J; Zinner, R G; Naing, A; Hong, D S; Karp, D D; Cabrilo, G; Kopetz, E S; Subbiah, V; Luthra, R; Kee, B K; Eng, C; Morris, V K; Karlin-Neumann, G A; Meric-Bernstam, F
2017-03-01
Cell-free DNA (cfDNA) from plasma offers easily obtainable material for KRAS mutation analysis. Novel, multiplex, and accurate diagnostic systems using small amounts of DNA are needed to further the use of plasma cfDNA testing in personalized therapy. Samples of 16 ng of unamplified plasma cfDNA from 121 patients with diverse progressing advanced cancers were tested with a KRASG12/G13 multiplex assay to detect the seven most common mutations in the hotspot of exon 2 using droplet digital polymerase chain reaction (ddPCR). The results were retrospectively compared to mutation analysis of archival primary or metastatic tumor tissue obtained at different points of clinical care. Eighty-eight patients (73%) had KRASG12/G13 mutations in archival tumor specimens collected on average 18.5 months before plasma analysis, and 78 patients (64%) had KRASG12/G13 mutations in plasma cfDNA samples. The two methods had initial overall agreement in 103 (85%) patients (kappa, 0.66; ddPCR sensitivity, 84%; ddPCR specificity, 88%). Of the 18 discordant cases, 12 (67%) were resolved by increasing the amount of cfDNA, using mutation-specific probes, or re-testing the tumor tissue, yielding overall agreement in 115 patients (95%; kappa 0.87; ddPCR sensitivity, 96%; ddPCR specificity, 94%). The presence of ≥ 6.2% of KRASG12/G13 cfDNA in the wild-type background was associated with shorter survival (P = 0.001). Multiplex detection of KRASG12/G13 mutations in a small amount of unamplified plasma cfDNA using ddPCR has good sensitivity and specificity and good concordance with conventional clinical mutation testing of archival specimens. A higher percentage of mutant KRASG12/G13 in cfDNA corresponded with shorter survival. © The Author 2016. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Tafelski, Sascha; Nachtigall, Irit; Adam, Thomas; Bereswill, Stefan; Faust, Jana; Tamarkin, Andrey; Trefzer, Tanja; Deja, Maria; Idelevich, Evgeny A; Wernecke, Klaus-Dieter; Becker, Karsten; Spies, Claudia
2015-06-01
To determine whether a multiplex polymerase chain reaction (PCR)-based test could reduce the time required for initial pathogen identification in patients in an intensive care unit (ICU) setting. This double-blind, parallel-group randomized controlled trial** enrolled adults with suspected pulmonary or abdominal sepsis caused by an unknown pathogen. Both the intervention and control groups underwent the standard blood culture (BC) testing, but additional pathogen identification, based on the results of a LightCycler® SeptiFast PCR test, were provided in the intervention group. The study enrolled 37 patients in the control group and 41 in the intervention group. Baseline clinical and demographic characteristics were similar in both groups. The PCR-based test identified a pathogen in 10 out of 41 (24.4%) patients in the intervention group, with a mean duration from sampling to providing the information to the ICU of 15.9 h. In the control group, BC results were available after a significantly longer period (38.1 h). The LightCycler® SeptiFast PCR test demonstrated a significant reduction in the time required for initial pathogen identification, compared with standard BC. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.
Hui, Yiang; Manna, Pradip; Ou, Joyce J; Kerley, Spencer; Zhang, Cunxian; Sung, C James; Lawrence, W Dwayne; Quddus, M Ruhul
2015-09-01
High-risk human papillomavirus infection usually is seen at one anatomic site in an individual. Rarely, infection at multiple anatomic sites of the female lower genital tract in the same individual is encountered either simultaneously and/or at a later date. The current study identifies the various subtypes of high-risk human papillomavirus infection in these scenarios and analyzes the potential significance of these findings. High-risk human papillomavirus infection involving 22 anatomic sites from 7 individuals was identified after institutional review board approval. Residual paraffin-embedded tissue samples were retrieved, and all 15 high-risk human papillomavirus were identified and viral load quantified using multiplex real-time polymerase chain reaction-based method. Multiple high-risk human papillomavirus subtypes were identified in 32% of the samples and as many as 5 different subtypes of high-risk human papillomavirus infection in a single anatomic site. In general, each anatomic site has unique combination of viral subtypes, although one individual showed overlapping subtypes in the vagina, cervix, and vulvar samples. Higher viral load and rare subtypes are more frequent in younger patients and in dysplasia compared with carcinoma. Follow-up ranging from 3 to 84 months revealed persistent high-risk human papillomavirus infection in 60% of cases. Copyright © 2015 Elsevier Inc. All rights reserved.
Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko
2013-05-01
Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Polymerase chain displacement reaction.
Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang
2013-02-01
Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.
Meena, Ram Prasnna; Baranwal, V K
2016-09-01
Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.
Mawu, Ferra O; Davies, Stephen C; McKechnie, Michelle; Sedyaningsih, Endang R; Widihastuti, Asti; Hillman, Richard J
2011-03-01
Sexually transmissible infections (STIs) remain highly prevalent, and HIV is increasing, among female sex workers (FSWs) in Indonesia. Our aim was to determine the prevalence of, and risk factors for, STIs among FSWs in Manado, Indonesia. We recruited FSWs mainly at their workplace: they completed a questionnaire and provided a urine sample and self-collected vaginal swab. Samples were tested using multiplex polymerase chain reaction, followed by reverse line blot hybridisation. We recruited 221 FSWs, (median age: 25 years). During the previous 3 months, 30% reported never using condoms; only 2.7% always used condoms. Of 217 women with urine samples, 49% had a 'curable STI': 10.6% with gonorrhoea, 26.7% with chlamydia, 12.4% with Mycoplasma genitalium and 22.6% with trichomoniasis. Independent risk factors for gonorrhoea were: domiciled outside North Sulawesi (P = 0.001) and age 16-25 years (P = 0.02); for chlamydia: no prior history of STI symptoms (P = 0.003) and age 16-25 years (P = 0.02); for Mycoplasma genitalium: number of clients on last day of sex work (P = 0.004); for trichomoniasis: number of clients per week (P = 0.04). When these four infections were grouped as any 'curable STI', independent associations were: number of clients on the last day of sex work (P = 0.001), age 16-25 years (P = 0.02) and sex working for fewer than 2 years (P = 0.03). This is the first report of M. genitalium infection in Indonesia. The high prevalence of STIs and low condom use among these FSWs suggest their vulnerability to the HIV epidemic in Indonesia. They need enhanced interventions, including outreach screening, and periodic presumptive treatment.
Vanni, Irene; Ugolotti, Elisabetta; Raso, Alessandro; Di Marco, Eddi; Melioli, Giovanni; Biassoni, Roberto
2012-07-01
The clinical applications of in vitro manipulated cultured cells and their precursors are often made use of in therapeutic trials. However, tissue cultures can be easily contaminated by the ubiquitous Mollicutes micro-organisms, which can cause various and severe alterations in cellular function. Thus methods able to detect and trace Mollicutes impurities contaminating cell cultures are required before starting any attempt to grow cells under good manufacturing practice (GMP) conditions. We developed a multiplex quantitative polymerase chain reaction (qPCR) assay specific for the 16S-23S rRNA intergenic spacer regions, for the Tuf and P1 cytoadhesin genes, able to detect contaminant Mollicutes species in a single tube reaction. The system was validated by analyzing different cell lines and the positive samples were confirmed by 16S and P1 cytoadhesin gene dideoxy sequencing. Our multiplex qPCR detection system was able to reach a sensitivity, specificity and robustness comparable with the culture and the indicator cell culture method, as required by the European Pharmacopoeia guidelines. We have developed a multiplex qPCR method, validated following International Conference on Harmonization (ICH) guidelines, as a qualitative limit test for impurities, assessing the validation characteristics of limit of detection and specificity. It also follows the European Pharmacopoeia guidelines and Food and Drug Administration (FDA) requirements.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Determining Annealing Temperatures for Polymerase Chain Reaction
ERIC Educational Resources Information Center
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie
2007-09-01
Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.
Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.
Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum
2012-12-01
The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.
2010-01-01
A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759
Garg, Pankaj
2017-07-01
Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.
Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.
Chen, Y T; Mercer, G O; Chen, Y
1993-11-01
Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.
Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.
Makeyev, E V; Bamford, D H
2001-05-01
Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.
Field Demonstration of a Multiplexed Point-of-Care Diagnostic Platform for Plant Pathogens.
Lau, Han Yih; Wang, Yuling; Wee, Eugene J H; Botella, Jose R; Trau, Matt
2016-08-16
Effective disease management strategies to prevent catastrophic crop losses require rapid, sensitive, and multiplexed detection methods for timely decision making. To address this need, a rapid, highly specific and sensitive point-of-care method for multiplex detection of plant pathogens was developed by taking advantage of surface-enhanced Raman scattering (SERS) labeled nanotags and recombinase polymerase amplification (RPA), which is a rapid isothermal amplification method with high specificity. In this study, three agriculturally important plant pathogens (Botrytis cinerea, Pseudomonas syringae, and Fusarium oxysporum) were used to demonstrate potential translation into the field. The RPA-SERS method was faster, more sensitive than polymerase chain reaction, and could detect as little as 2 copies of B. cinerea DNA. Furthermore, multiplex detection of the three pathogens was demonstrated for complex systems such as the Arabidopsis thaliana plant and commercial tomato crops. To demonstrate the potential for on-site field applications, a rapid single-tube RPA/SERS assay was further developed and successfully performed for a specific target outside of a laboratory setting.
Polymerase Chain Reaction for Detection of Systemic Plant Pathogens
USDA-ARS?s Scientific Manuscript database
This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...
Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.
Igarashi, T; Yamamoto, A; Goto, N
1996-10-01
Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.
Trends and advances in food analysis by real-time polymerase chain reaction.
Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin
2016-05-01
Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.
Kunthalert, Duangkamol; Henghiranyawong, Kritsada; Sistayanarain, Anchalee; Khoothiam, Krissana
2013-02-01
The critically high prevalence of bacterial otitis media worldwide has prompted a proper disease management. While vaccine development for otitis media is promising, the reliable and effective methods for diagnosis of such etiologic agents are of importance. We developed a multiplex polymerase chain reaction assay for simultaneous detection and differentiation of nontypeable and serotypeable Haemophilus influenzae, Moraxella catarrhalis and Streptococcus pneumoniae. Five primer pairs targeting genes fumarate reductase (H. influenzae), outer membrane protein B (M. catarrhalis), major autolysin (S. pneumoniae), capsulation-associated BexA protein (all encapsulated H. influenzae) and 16S rRNA were incorporated in this single-step PCR. Validation of the multiplex PCR was also performed on clinical isolates. The developed multiplex PCR was highly specific, enabling the detection of the target pathogens in a specific manner, either individually or as a mixture of all target organisms. The assay was also found to be sensitive with the lowest detection limit of 1 ng of bacterial DNA. When applied to clinical isolates from diverse specimen sources, the multiplex PCR developed in this study correctly identified each microorganism individually or in a combination of two or more target organisms. All results matched with conventional culture identification. In addition, the ability of such assay to differentiate H. influenzae encapsulation from the study clinical isolates was 100%. Our multiplex PCR provides a rapid and accurate diagnostic tool for detection of the 4 target organisms. Such assay would serve as a useful tool for clinicians and epidemiologists in their efforts to the proper treatment and disease management caused by these organisms. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Roy, Avijit; Ananthakrishnan, G; Hartung, John S; Brlansky, R H
2010-10-01
The emerging diversity of Citrus tristeza virus (CTV) genotypes has complicated detection and diagnostic measures and prompted the search for new differentiation methods. To simplify the identification and differentiation of CTV genotypes, a multiplex reverse-transcription polymerase chain reaction (RT-PCR) technique for the screening of CTV isolates was developed. Variable regions within the open reading frame (ORF)-1a of diverse CTV genotypes were identified to develop first a simplex (S) and then a hexaplex (H) RT-PCR. CTV isolates have been grouped previously into five genotypes (namely, T3, T30, T36, VT, and B165) based on the nucleotide sequence comparisons and phylogenetic analyses. Nucleotide sequences from GenBank were used to design species and genotype-specific primers (GSPs). The GSPs were initially used for reliable detection of all CTV genotypes using S-RT-PCR. Furthermore, detection of all five recognized CTV genotypes was established using the H-RT-PCR. Six amplicons, one generic to all CTV isolates and one for each of the five recognized genotypes, were identified on the basis of their size and were confirmed by sequence analysis. In all, 175 CTV isolates from 29 citrus-growing countries were successfully analyzed by S- and H-RT-PCR. Of these, 97 isolates contained T36 genotypes, 95 contained T3 genotypes, 76 contained T30 genotypes, 71 contained VT genotypes, and 24 contained B165 genotype isolates. In total, 126 isolates contained mixed infections of 2 to 5 of the known CTV genotypes. Two of the CTV isolates could not be assigned to a known genotype. H-RT-PCR provides a sensitive, specific, reliable, and rapid way to screen for CTV genotypes compared with other methods for CTV genotype detection. Efficient identification of CTV genotypes will facilitate a better understanding of CTV isolates, including the possible interaction of different genotypes in causing or preventing diseases. The methods described can also be used in virus-free citrus
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy
2015-01-01
Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier
Code of Federal Regulations, 2014 CFR
2014-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2013 CFR
2013-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2012 CFR
2012-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Lindsey, Rebecca L; Garcia-Toledo, L; Fasulo, D; Gladney, L M; Strockbine, N
2017-09-01
Escherichia coli, Escherichia albertii, and Escherichia fergusonii are closely related bacteria that can cause illness in humans, such as bacteremia, urinary tract infections and diarrhea. Current identification strategies for these three species vary in complexity and typically rely on the use of multiple phenotypic and genetic tests. To facilitate their rapid identification, we developed a multiplex PCR assay targeting conserved, species-specific genes. We used the Daydreamer™ (Pattern Genomics, USA) software platform to concurrently analyze whole genome sequence assemblies (WGS) from 150 Enterobacteriaceae genomes (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other species) and design primers for the following species-specific regions: a 212bp region of the cyclic di-GMP regulator gene (cdgR, AW869_22935 from genome K-12 MG1655, CP014225) for E. coli/Shigella; a 393bp region of the DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025) for E. albertii; and a 575bp region of the palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158) for E. fergusonii. We incorporated the species-specific primers into a conventional multiplex PCR assay and assessed its performance with a collection of 97 Enterobacteriaceae strains. The assay was 100% sensitive and specific for detecting the expected species and offers a quick and accurate strategy for identifying E. coli, E. albertii, and E. fergusonii in either a single reaction or by in silico PCR with sequence assemblies. Published by Elsevier B.V.
Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis.
Hallur, V; Sehgal, R; Khurana, S
2015-01-01
The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young
2014-07-01
A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
Identification of Brucella spp. by using the polymerase chain reaction.
Herman, L; De Ridder, H
1992-01-01
The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903
Detection of Listeria monocytogenes by using the polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bessesen, M.T.; Luo, Q.; Blaser, M.J.
1990-09-01
A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.
Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A
2015-03-01
African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. © 2015 The Author(s).
Detection of Trypanosoma cruzi by Polymerase Chain Reaction.
Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz
2016-01-01
American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.
Multiplex Detection of Aspergillus Species.
Martínez-Culebras, Pedro; Selma, María Victoria; Aznar, Rosa
2017-01-01
Multiplex real-time polymerase chain reaction (PCR) provides a fast and accurate DNA-based tool for the simultaneous amplification of more than one target sequence in a single reaction. Here a duplex real-time PCR assay is described for the simultaneous detection of Aspergillus carbonarius and members of the Aspergillus niger aggregate, which are the main responsible species for ochratoxin A (OTA) contamination in grapes. This single tube reaction targets the beta-ketosynthase and the acyl transferase domains of the polyketide synthase of A. carbonarius and the A. niger aggregate, respectively.Besides, a rapid and efficient fungi DNA extraction procedure is described suitable to be applied in wine grapes. It includes a pulsifier equipment to remove conidia from grapes which prevents releasing of PCR inhibitors.
Kim, Na Young; Lee, Hwan Young; Park, Sun Joo; Yang, Woo Ick; Shin, Kyoung-Jin
2013-05-01
Two multiplex polymerase chain reaction (PCR) systems (Midiplex and Miniplex) were developed for the amplification of the mitochondrial DNA (mtDNA) control region, and the efficiencies of the multiplexes for amplifying degraded DNA were validated using old skeletal remains. The Midiplex system consisted of two multiplex PCRs to amplify six overlapping amplicons ranging in length from 227 to 267 bp. The Miniplex system consisted of three multiplex PCRs to amplify 10 overlapping short amplicons ranging in length from 142 to 185 bp. Most mtDNA control region sequences of several 60-year-old and 400-500-year-old skeletal remains were successfully obtained using both PCR systems and consistent with those previously obtained by monoplex amplification. The multiplex system consisting of smaller amplicons is effective for mtDNA sequence analyses of ancient and forensic degraded samples, saving time, cost, and the amount of DNA sample consumed during analysis. © 2013 American Academy of Forensic Sciences.
Cowan, Ashley F; Elkins, Kelly M
2017-12-01
Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.
Multiplex Droplet Digital PCR Protocols for Quantification of GM Maize Events.
Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Štebih, Dejan; Morisset, Dany; Holst-Jensen, Arne; Žel, Jana
2018-01-01
The standard-curve based simplex quantitative polymerase chain reaction (qPCR) has been the gold standard for DNA target quantification for more than a decade. The large and growing number of individual analyses needed to test for genetically modified organisms (GMOs) is reducing the cost-effectiveness of qPCR. Droplet digital PCR (ddPCR) enables absolute quantification without standard curves, avoids the amplification efficiency bias observed with qPCR, allows more accurate estimations at low target copy numbers and, in combination with multiplexing, significantly improves cost efficiency. Here we describe two protocols for multiplex quantification of GM maize events: (1) nondiscriminating, with multiplex quantification of targets as a group (12 GM maize lines) and (2) discriminating, with multiplex quantification of individual targets (events). The first enables the quantification of twelve European Union authorized GM maize events as a group with only two assays, but does not permit determination of the individual events present. The second protocol enables the quantification of four individual targets (three GM events and one endogene) in a single reaction. Both protocols can be modified for quantification of any other DNA target.
Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Ali, Md Eaqub
2015-01-01
Food forgery has posed considerable risk to public health, religious rituals, personal budget and wildlife. Pig, dog, cat, rat and monkey meat are restricted in most religions, but their sporadic adulteration are rampant. Market controllers need a low-cost but reliable technique to track and trace suspected species in the food chain. Considering the need, here we documented a lab-on-a-chip-based multiplex polymerase chain reaction (PCR) assay for the authentication of five non-halal meat species in foods. Using species-specific primers, 172, 163, 141, 129 and 108-bp sites of mitochondrial ND5, ATPase 6 and cytochrome b genes were amplified to detect cat, dog, pig, monkey and rat species under complex matrices. Species-specificity was authenticated against 20 different species with the potential to be used in food. The targets were stable under extreme sterilisation (121°C at 45 psi for 2.5 h) which severely degrades DNA. The assay was optimised under the backgrounds of various commercial meat products and validated for the analysis of meatballs, burgers and frankfurters, which are popular fast food items across the globe. The assay was tested to detect 0.1% suspected meats under commercial backgrounds of marketed foods. Instead of simplex PCR which detects only one species at a time, such a multiplex platform can reduce cost by at least fivefolds by detecting five different species in a single assay platform.
Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase
McInerney, Peter; Adams, Paul; Hadi, Masood Z.
2014-01-01
As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less
Development of new microsatellite loci and multiplex reactions for muskellunge (Esox masquinongy)
Sloss, Brian L.; Franckowiak, R.P.; Murphy, E.L.
2008-01-01
The muskellunge (Esox masquinongy) is a valued fisheries species throughout its native range. Numerous studies have documented performance and phenotypic differences among muskellunge populations, but genetic markers for assessment have been lacking. We characterized 14 microsatellite loci and developed five multiplex polymerase chain reactions. Successful amplification of northern pike (Esox lucius) was observed for seven loci. These microsatellites will be useful for analysing population structure, performance characteristics of propagated strains, and helping to develop and monitor hatchery management guidelines for muskellunge. ?? 2008 Blackwell Publishing Ltd.
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less
Adewale, B; Mafe, M A; Oyerinde, J P O
2005-01-01
Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
Quddus, M Ruhul; Manna, Pradip; Sung, C James; Kerley, Spencer; Steinhoff, Margaret M; Lawrence, W Dwayne
2014-02-01
Human papillomavirus (HPV) 16 and 18 are the types most commonly found in cervical adenosquamous carcinoma. Multiple HPV types have been found in cervical adenocarcinoma but not in the adenosquamous variant. Type-specific detection of high-risk (HR) HPV allows the detection of co-infection by multiple HPV types and assessment of viral load per cell. Our aim was to identify and quantify all HR HPV types in cervical adenosquamous carcinoma and to correlate viral loads with prognosis-related histologic features. All 15 HR HPV types were tested for by multiplex real-time polymerase chain reaction, and standard curves were created for each type. Viral loads were determined retrospectively. Prognosis-related histologic features were correlated with specific HPV types and the viral loads. A total of 80% of the tumors examined expressed HPV. Types 16/18 were detected in 86% of these cases, whereas the remaining 14% of the positive cases were infected by other types. A single type of virus was detected in 67% of cases, 2 in 29%, and 3 in 4%. Poor prognostic features were seen in 84.6% of the tumors infected with HPV 16, 46% of those infected with HPV 18, and 100% of those infected with other types. As expected, HPV 16, HPV 18, or both were the most frequent viral types; HPV 73 was the next most frequent type. Multiple HPV types were detected in 33% of the tumors. Non-HPV 16/18 cases had low viral loads, but all of these had poor prognosis-related histologic features. Two of the three recurrent cases had multiple viral types. © 2014 Elsevier Inc. All rights reserved.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Pittet, Laure F.; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M.
2014-01-01
Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001−, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447
Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M
2014-01-01
Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
Final Report Nucleic Acid System - Hybrid PCR and Multiplex Assay Project Phase 2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koopman, R P; Langlois, R G; Nasarabadi, S
2002-04-17
This report covers phase 2 (year 2) of the Nucleic Acid System--Hybrid PCR and Multiplex Assay project. The objective of the project is to reduce to practice the detection and identification of biological warfare pathogens by the nucleic acid recognition technique of PCR (polymerase chain reaction) in a multiplex mode using flow cytometry. The Hybrid instrument consists of a flow-through PCR module capable of handling a multiplexed PCR assay, a hybridizing module capable of hybridizing multiplexed PCR amplicons and beads, and a flow cytometer module for bead-based identification, all controlled by a single computer. Multiplex immunoassay using bead-based Luminex flowmore » cytometry is available, allowing rapid screening for many agents. PCR is highly specific and complements and verifies immunoassay. It can also be multiplexed and detection provided using the bead-based Luminex flow cytometer. This approach allows full access to the speed and 100-fold multiplex capability of flow cytometry for rapid screening as well as the accuracy and specificity of PCR. This project has two principal activities: (1) Design, build and test a prototype hybrid PCR/flow cytometer with the basic capabilities for rapid, broad spectrum detection and identification, and (2) Develop and evaluate multiplex flow analysis assay protocols and reagents for the simultaneous detection of PCR products. This project requires not only building operationally functional instrumentation but also developing the chemical assays for detection of priority pathogens. This involves development and evaluation of multiplex flow analysis assay protocols and reagents for the simultaneous detection of PCR products.« less
Hassan, Muhammad Adeel; Liu, Junlong; Sajid, Muhammad Sohail; Rashid, Muhammad; Mahmood, Altaf; Abbas, Qamar; Guan, Guiquan; Yin, Hong; Luo, Jianxun
2018-05-01
Theileriosis is a disease of domesticated animals in tropical and subtropical countries and causes significant reductions in livestock productivity. The arid region of Punjab in Pakistan is notorious for the presence of the vector tick (Acari: Ixodidae) and tick-borne diseases, such as theileriosis and babesiosis. The distribution of Theileria annulata and T. orientalis in the Chakwal district of Punjab was determined by developing a multiplex recombinase polymerase amplification (RPA) assay as a scientific basis for formulating control strategies for bovine theileriosis. Specificity was evaluated using DNA from related piroplasm species, while analytical sensitivity was calculated using a long fragment of the enolase gene. A total of 188 blood samples were collected on FTA cards (Whatman ® ) from tick-infested asymptomatic breeds of cattle (Bos indicus, Bos taurus, and Bos indicus × Bos taurus) in the study district. Finally, infections with of T. annulata and T. orientalis were detected using the multiplex RPA and compared with the conventional multiplex polymerase chain reaction (PCR). The multiplex RPA specifically amplified 282-bp and 229-bp fragments of the enolase gene from T. annulata and T. orientalis and had no cross-reaction with other piroplasm species. It was determined that 45 (23.9%) and 5 (2.6%) out of 188 blood samples were positive for T. annulata and T. orientalis, respectively, when examined using RPA. Multiplex PCR detection indicated that 32 (17.0%) and 3 (1.6%) blood samples were positive for T. annulata and T. orientalis, respectively. In the present study, a specific RPA method was developed for simultaneous differentiation and detection of T. annulata and T. orientalis infections and used for the first time for the detection of the two bovine Theileria infections. Copyright © 2018 Elsevier GmbH. All rights reserved.
Nadin-Davis, S A; Huang, W; Wandeler, A I
1996-03-01
Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.
Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori
2016-08-01
On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.
Tan, Thean Yen; Zou, Hao; Ong, Danny Chee Tiong; Ker, Khor Jia; Chio, Martin Tze Wei; Teo, Rachael Yu Lin; Koh, Mark Jean Aan
2013-12-01
Herpes simplex virus (HSV) and varicella zoster virus (VZV) are related members of the Herpesviridae family and are well-documented human pathogens causing a spectrum of diseases, from mucocutaneous disease to infections of the central nervous system. This study was carried out to evaluate and validate the performance of a multiplex real-time polymerase chain reaction (PCR) assay in detecting and differentiating HSV1, HSV2, and VZV from clinical samples. Consensus PCR primers for HSV were designed from the UL30 component of the DNA polymerase gene of HSV, with 2 separate hydrolysis probes designed to differentiate HSV1 and HSV2. Separate primers and a probe were also designed against the DNA polymerase gene of VZV. A total of 104 clinical samples were available for testing by real-time PCR, conventional PCR, and viral culture. The sensitivity and specificity of the real-time assay was calculated by comparing the multiplex PCR result with that of a combined standard of virus culture and conventional PCR. The sensitivity of the real-time assay was 100%, with specificity ranging from 98% to 100% depending on the target gene. Both PCR methods detected more positive samples for HSV or VZV, compared with conventional virus culture. This multiplex PCR assay provides accurate and rapid diagnostic capabilities for the diagnosis and differentiation of HSV1, HSV2, and VZV infections, with the presence of an internal control to monitor for inhibition of the PCR reaction.
MiniX-STR multiplex system population study in Japan and application to degraded DNA analysis.
Asamura, H; Sakai, H; Kobayashi, K; Ota, M; Fukushima, H
2006-05-01
We sought to evaluate a more effective system for analyzing X-chromosomal short tandem repeats (X-STRs) in highly degraded DNA. To generate smaller amplicon lengths, we designed new polymerase chain reaction (PCR) primers for DXS7423, DXS6789, DXS101, GATA31E08, DXS8378, DXS7133, DXS7424, and GATA165B12 at X-linked short tandem repeat (STR) loci, devising two miniX-multiplex PCR systems. Among 333 Japanese individuals, these X-linked loci were detected in amplification products ranging in length from 76 to 169 bp, and statistical analyses of the eight loci indicated a high usefulness for the Japanese forensic practice. Results of tests on highly degraded DNA indicated the miniX-STR multiplex strategies to be an effective system for analyzing degraded DNA. We conclude that analysis by the current miniX-STR multiplex systems offers high effectiveness for personal identification from degraded DNA samples.
Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik
2007-08-31
Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.
Multiplex pyrosequencing of InDel markers for forensic DNA analysis.
Bus, Magdalena M; Karas, Ognjen; Allen, Marie
2016-12-01
The capillary electrophoresis (CE) technology is commonly used for fragment length separation of markers in forensic DNA analysis. In this study, pyrosequencing technology was used as an alternative and rapid tool for the analysis of biallelic InDel (insertion/deletion) markers for individual identification. The DNA typing is based on a subset of the InDel markers that are included in the Investigator ® DIPplex Kit, which are sequenced in a multiplex pyrosequencing analysis. To facilitate the analysis of degraded DNA, the polymerase chain reaction (PCR) fragments were kept short in the primer design. Samples from individuals of Swedish origin were genotyped using the pyrosequencing strategy and analysis of the Investigator ® DIPplex markers with CE. A comparison between the pyrosequencing and CE data revealed concordant results demonstrating a robust and correct genotyping by pyrosequencing. Using optimal marker combination and a directed dispensation strategy, five markers could be multiplexed and analyzed simultaneously. In this proof-of-principle study, we demonstrate that multiplex InDel pyrosequencing analysis is possible. However, further studies on degraded samples, lower DNA quantities, and mixtures will be required to fully optimize InDel analysis by pyrosequencing for forensic applications. Overall, although CE analysis is implemented in most forensic laboratories, multiplex InDel pyrosequencing offers a cost-effective alternative for some applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Um, Keehong; Yoo, Sooyeup
2013-10-01
Protocol for digital multiplex with 512 pieces of information is increasingly adopted in the design of illumination systems. In conventional light-emitting diode systems, the receivers are connected in parallel and each of the receiving units receives all the data from the master dimmer console, but each receiving unit operates by recognizing as its own data that which corresponds to the assigned number of the receiver. Because the serial numbers of illumination devices are transmitted in binary code, synchronization is too complicated to be used properly. In order to improve the protocol of illumination control systems, we propose an algorithm of protocol reception to install and manage the system in a simpler and more convenient way. We propose the systems for controlling the light-emitting diode illumination of simplified receiver slaves adopting the digital multiplex-512 protocol where master console and multiple receiver slaves are connected in a daisy chain fashion. The digital multiplex-512 data packet is received according to the sequence order of their locations from the console, without assigning the sequence number of each channel at the receiving device. The purpose of this paper is to design a simple and small-sized controller for the control systems of lamps and lighting adopting the digital multiplex-512 network.
Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."
ERIC Educational Resources Information Center
Phelps, Tara L.; And Others
1996-01-01
Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…
Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred
2007-03-01
We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.
Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin
2016-04-01
Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M
Multiplex qPCR for serodetection and serotyping of hepatitis viruses: A brief review.
Irshad, Mohammad; Gupta, Priyanka; Mankotia, Dhananjay Singh; Ansari, Mohammad Ahmad
2016-05-28
The present review describes the current status of multiplex quantitative real time polymerase chain reaction (qPCR) assays developed and used globally for detection and subtyping of hepatitis viruses in body fluids. Several studies have reported the use of multiplex qPCR for the detection of hepatitis viruses, including hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), and hepatitis E virus (HEV). In addition, multiplex qPCR has also been developed for genotyping HBV, HCV, and HEV subtypes. Although a single step multiplex qPCR assay for all six hepatitis viruses, i.e., A to G viruses, is not yet reported, it may be available in the near future as the technologies continue to advance. All studies use a conserved region of the viral genome as the basis of amplification and hydrolysis probes as the preferred chemistries for improved detection. Based on a standard plot prepared using varying concentrations of template and the observed threshold cycle value, it is possible to determine the linear dynamic range and to calculate an exact copy number of virus in the specimen. Advantages of multiplex qPCR assay over singleplex or other molecular techniques in samples from patients with co-infection include fast results, low cost, and a single step investigation process.
Multiplex qPCR for serodetection and serotyping of hepatitis viruses: A brief review
Irshad, Mohammad; Gupta, Priyanka; Mankotia, Dhananjay Singh; Ansari, Mohammad Ahmad
2016-01-01
The present review describes the current status of multiplex quantitative real time polymerase chain reaction (qPCR) assays developed and used globally for detection and subtyping of hepatitis viruses in body fluids. Several studies have reported the use of multiplex qPCR for the detection of hepatitis viruses, including hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), and hepatitis E virus (HEV). In addition, multiplex qPCR has also been developed for genotyping HBV, HCV, and HEV subtypes. Although a single step multiplex qPCR assay for all six hepatitis viruses, i.e., A to G viruses, is not yet reported, it may be available in the near future as the technologies continue to advance. All studies use a conserved region of the viral genome as the basis of amplification and hydrolysis probes as the preferred chemistries for improved detection. Based on a standard plot prepared using varying concentrations of template and the observed threshold cycle value, it is possible to determine the linear dynamic range and to calculate an exact copy number of virus in the specimen. Advantages of multiplex qPCR assay over singleplex or other molecular techniques in samples from patients with co-infection include fast results, low cost, and a single step investigation process. PMID:27239109
Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten
2005-03-01
We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.
deWit, D; Wootton, M; Allan, B; Steyn, L
1993-01-01
A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752
Taniuchi, Mami; Verweij, Jaco J.; Noor, Zannatun; Sobuz, Shihab U.; van Lieshout, Lisette; Petri, William A.; Haque, Rashidul; Houpt, Eric R.
2011-01-01
Polymerase chain reaction (PCR) assays for intestinal parasites are increasingly being used on fecal DNA samples for enhanced specificity and sensitivity of detection. Comparison of these tests against microscopy and copro-antigen detection has been favorable, and substitution of PCR-based assays for the ova and parasite stool examination is a foreseeable goal for the near future. One challenge is the diverse list of protozoan and helminth parasites. Several existing real-time PCR assays for the major intestinal parasites—Cryptosporidium spp., Giardia intestinalis, Entamoeba histolytica, Ancylostoma duodenale, Ascaris lumbricoides, Necator americanus, and Strongyloides stercoralis—were adapted into a high throughput protocol. The assay involves two multiplex PCR reactions, one with specific primers for the protozoa and one with specific primers for the helminths, after which PCR products are hybridized to beads linked to internal oligonucleotide probes and detected on a Luminex platform. When compared with the parent multiplex real-time PCR assays, this multiplex PCR-bead assay afforded between 83% and 100% sensitivity and specificity on a total of 319 clinical specimens. In conclusion, this multiplex PCR-bead protocol provides a sensitive diagnostic screen for a large panel of intestinal parasites. PMID:21292910
Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev
2011-12-01
Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.
Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...
2010-01-01
Background The aim of this study was to determine the prevalence of human papillomavirus (HPV) and 15 species that cause sexually transmitted infections (STIs) in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR) with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection. PMID:20920170
Single cell digital polymerase chain reaction on self-priming compartmentalization chip.
Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying
2017-01-01
Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.
Single cell digital polymerase chain reaction on self-priming compartmentalization chip
Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying
2017-01-01
Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267
Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli
2014-05-30
Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.
Nested methylation-specific polymerase chain reaction cancer detection method
Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM
2007-05-08
A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.
Polymerase chain reaction with phase change as intrinsic thermal control
NASA Astrophysics Data System (ADS)
Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei
2013-04-01
This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Song, Yunke; Zhang, Yi; Wang, Tza-Huei
2013-04-08
Gene point mutations present important biomarkers for genetic diseases. However, existing point mutation detection methods suffer from low sensitivity, specificity, and a tedious assay processes. In this report, an assay technology is proposed which combines the outstanding specificity of gap ligase chain reaction (Gap-LCR), the high sensitivity of single-molecule coincidence detection, and the superior optical properties of quantum dots (QDs) for multiplexed detection of point mutations in genomic DNA. Mutant-specific ligation products are generated by Gap-LCR and subsequently captured by QDs to form DNA-QD nanocomplexes that are detected by single-molecule spectroscopy (SMS) through multi-color fluorescence burst coincidence analysis, allowing for multiplexed mutation detection in a separation-free format. The proposed assay is capable of detecting zeptomoles of KRAS codon 12 mutation variants with near 100% specificity. Its high sensitivity allows direct detection of KRAS mutation in crude genomic DNA without PCR pre-amplification. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo
2005-05-18
To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.
Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di
2010-06-01
To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.
Bridge, Julia A
2017-01-01
The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.
Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli
2014-01-01
Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV. PMID:24886818
De, Abhishek; Hasanoor Reja, Abu Hena; Aggarwal, Ishad; Sen, Sumit; Sil, Amrita; Bhattacharya, Basudev; Sharma, Nidhi; Ansari, Asad; Sarda, Aarti; Chatterjee, Gobinda; Das, Sudip
2017-01-01
Pure neural leprosy (PNL) still remains a diagnostic challenge because of the absence of sine qua non skin lesions of leprosy and a confirmatory diagnostic method. The authors had earlier described a simple yet objective technique of combining fine needle aspiration cytology (FNAC) coupled with a multiplex polymerase chain reaction (PCR) in a pilot study, wherein the technique showed promise of a reliable diagnostic tool. In the pursuit of further evidence, the authors carried out a 4-year study with PNL cases to find the efficacy and reliability of the said method in a larger sample size. This study was conducted to find the efficacy, reliability, and reproducibility of FNAC coupled with multiplex PCR and Ziehl-Neelsen (ZN) staining in identifying the cases of PNL. All cases that were suspected to be suffering from PNL, following evaluation by two independent observers were included in the study and were subjected to FNAC from the affected nerve, and the aspirates were evaluated for cytology, ZN staining, and multiplex PCR for Mycobacterium leprae genome. In addition, serum anti-PGL1 levels were also performed in all the study subjects. Fifteen non-PNL cases were also included in the control arm. A total of 47 cases were included in the test arm and subjected to FNAC. Conventional ZN staining could demonstrate acid-fast bacilli (AFB) in only 15 out of 47 cases (31.91%) while M. leprae DNA could be elicited in 37 (78.72%) cases by the multiplex PCR. Only 13 (27.65%) out of 47 cases showed anti-PGLI-1 antibody positivity. On cytological examination of the nerve aspirates, only 11 (23.40%) cases showed epithelioid cells whereas nonspecific inflammation was seen in 26 (75.60%) cases. The results of this study conducted over a larger sample size corroborate with the findings of our pilot study. In a resource poor set up, FNAC in combination with ZN staining and multiplex PCR is a rapid, simple, and easily performed test, which can give a reproducible and objective
Ahberg, Christian D.; Manz, Andreas; Neuzil, Pavel
2015-01-01
Since its invention in 1985 the polymerase chain reaction (PCR) has become a well-established method for amplification and detection of segments of double-stranded DNA. Incorporation of fluorogenic probe or DNA intercalating dyes (such as SYBR Green) into the PCR mixture allowed real-time reaction monitoring and extraction of quantitative information (qPCR). Probes with different excitation spectra enable multiplex qPCR of several DNA segments using multi-channel optical detection systems. Here we show multiplex qPCR using an economical EvaGreen-based system with single optical channel detection. Previously reported non quantitative multiplex real-time PCR techniques based on intercalating dyes were conducted once the PCR is completed by performing melting curve analysis (MCA). The technique presented in this paper is both qualitative and quantitative as it provides information about the presence of multiple DNA strands as well as the number of starting copies in the tested sample. Besides important internal control, multiplex qPCR also allows detecting concentrations of more than one DNA strand within the same sample. Detection of the avian influenza virus H7N9 by PCR is a well established method. Multiplex qPCR greatly enhances its specificity as it is capable of distinguishing both haemagglutinin (HA) and neuraminidase (NA) genes as well as their ratio. PMID:26088868
Bonnet, A; Thévenon, S; Maudet, F; Maillard, J C
2002-10-01
Thirty bovine and eight ovine microsatellite primer pairs were tested on four tropical deer species: Eld's and Swamp deer (highly threatened) and Rusa and Vietnamese Sika deer (economically important). Thirty markers gave an amplified product in all four species (78.9%). The number of polymorphic microsatellite markers varied among the species from 14 in Eld's deer (47%) to 20 in Swamp deer (67%). Among them, 11 microsatellite loci were multiplexed in three polymerase chain reactions (PCRs) and labelled with three different fluorochromes that can be loaded in one gel-lane. To test the efficiency of the multiplex, primary genetic studies (mean number of alleles, expected heterozygosities and Fis values) were carried out on four deer populations. Parentage exclusion probability and probability of identity were computed and discussed on a Swamp deer population. These multiplexes PCRs were also tested on several other deer species and subspecies. The aim of this study is to establish a tool useful for genetic studies of population structure and diversity in four tropical deer species which with few modifications can be applied to other species of the genus Cervus.
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
Integrated polymerase chain reaction/electrophoresis instrument
Andresen, Brian D.
2000-01-01
A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.
Szuhai, Károly; Sandhaus, Emily; Kolkman-Uljee, Sandra M.; Lemaître, Marc; Truffert, Jean-Christophe; Dirks, Roeland W.; Tanke, Hans J.; Fleuren, Gert Jan; Schuuring, Ed; Raap, Anton K.
2001-01-01
Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for formaldehyde-fixed samples a strategy that, in a homogenous, real-time fluorescence polymerase chain reaction (PCR)-based assay, accomplishes general HPV detection by SybrGreen reporting of HPV-DNA amplicons, and genotyping of seven prevalent HPV types (HPV-6, -11, -16, -18, -31, -33, -45) by real-time molecular beacon PCR. The false-positive rate of the HPV SybrGreen-PCR was 4%, making it well suited as a prescreening, general HPV detection technology. The type specificity of the seven selected HPV molecular beacons was 100% and double infections were readily identified. The multiplexing capacity of the HPV molecular beacon PCR was analyzed and up to three differently labeled molecular beacons could be used in one PCR reaction without observing cross talk. The inherent quantitation capacities of real-time fluorescence PCR allowed the determination of average HPV copy number per cell. We conclude that the HPV SybrGreen-PCR in combination with the HPV molecular beacon PCR provides a robust, sensitive, and quantitative general HPV detection and genotyping methodology. PMID:11696426
Kim, S A; Park, S H; Lee, S I; Ricke, S C
2017-12-01
The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in
Khumalo, Jermaine; Nicol, Mark; Hardie, Diana; Muloiwa, Rudzani; Mteshana, Phindile; Bamford, Colleen
2017-01-01
Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR) assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children. We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis. From 292 samples, bacterial DNA was detected in 12 (4.1%) and viral nucleic acids in 94 (32%). Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10%) of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR. In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation.
Khumalo, Jermaine; Nicol, Mark; Hardie, Diana; Muloiwa, Rudzani; Mteshana, Phindile
2017-01-01
Introduction Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR) assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children. Methods We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis. Results From 292 samples, bacterial DNA was detected in 12 (4.1%) and viral nucleic acids in 94 (32%). Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10%) of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR. Discussion In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation. PMID:28346504
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Langerak, A W; Molina, T J; Lavender, F L; Pearson, D; Flohr, T; Sambade, C; Schuuring, E; Al Saati, T; van Dongen, J J M; van Krieken, J H J M
2007-02-01
Lymphoproliferations are generally diagnosed via histomorphology and immunohistochemistry. Although mostly conclusive, occasionally the differential diagnosis between reactive lesions and malignant lymphomas is difficult. In such cases molecular clonality studies of immunoglobulin (Ig)/T-cell receptor (TCR) rearrangements can be useful. Here we address the issue of clonality assessment in 106 histologically defined reactive lesions, using the standardized BIOMED-2 Ig/TCR multiplex polymerase chain reaction (PCR) heteroduplex and GeneScan assays. Samples were reviewed nationally, except 10% random cases and cases with clonal results selected for additional international panel review. In total 75% (79/106) only showed polyclonal Ig/TCR targets (type I), whereas another 15% (16/106) represent probably polyclonal cases, with weak Ig/TCR (oligo)clonality in an otherwise polyclonal background (type II). Interestingly, in 10% (11/106) clear monoclonal Ig/TCR products were observed (types III/IV), which prompted further pathological review. Clonal cases included two missed lymphomas in national review and nine cases that could be explained as diagnostically difficult cases or probable lymphomas upon additional review. Our data show that the BIOMED-2 Ig/TCR multiplex PCR assays are very helpful in confirming the polyclonal character in the vast majority of reactive lesions. However, clonality detection in a minority should lead to detailed pathological review, including close interaction between pathologist and molecular biologist.
Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio
2017-05-01
Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.
Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio
2017-01-01
BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses. PMID:28403327
Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.
Lee, Seong-Hun
2014-11-01
There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.
Rapid multiplexed genotyping for hereditary thrombophilia by SELDI-TOF mass spectrometry.
Yang, Shangbin; Xu, Lihui; Wu, Haifeng M
2010-03-01
Approximately 50% of patients with venous thromboembolism also present with hereditary predisposition. The most common genetic factors are single nucleotide polymorphisms (SNPs) of factor V Leiden, prothrombin G20210A, and methylenetetrahydrofolate reductase C677T. Genotyping these SNPs helps clinicians to correctly diagnose the disease and properly manage patients. In this study, we report a novel method using surface-enhanced laser desorption and ionization time of flight mass spectrometry to rapidly genotype, in a multiplex fashion, 3 SNPs that predispose patients to thrombosis. First, patient DNA samples were subjected to polymerase chain reaction to amplify and extend the DNA products with masses corresponding to specific genotypes. Polymerase chain reaction products were then applied to Q10 anionic protein chips, undergoing on-chip sample enrichment and clean-up. Finally, the genotypes of the SNPs were determined by surface-enhanced laser desorption and ionization time of flight mass spectrometry. This method offers a rapid turnaround time of less than 5 hours from sample collection to result reporting. The analytical accuracy of each SNP genotyping result has been confirmed by DNA sequencing. In addition, the genotype results produced by this method were validated by comparing them with results obtained by the approved method in the clinical reference laboratory. This novel method is fast, accurate, and reproducible, and thus provides an excellent platform to promote personalized medicine in the management of clotting disorders.
Choi, Goro; Jung, Jae Hwan; Park, Byung Hyun; Oh, Seung Jun; Seo, Ji Hyun; Choi, Jong Seob; Kim, Do Hyun; Seo, Tae Seok
2016-06-21
In this study, we developed a centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria contaminated milk samples. The microdevice was designed to contain identical triplicate functional units and each unit has four reaction chambers, thereby making it possible to perform twelve direct-RPA reactions simultaneously. The integrated microdevice consisted of two layers: RPA reagents were injected in the top layer, while spiked milk samples with food poisoning bacteria were loaded into sample reservoirs in the bottom layer. For multiplex bacterial detection, the target gene-specific primers and probes were dried in each reaction chamber. The introduced samples and reagents could be equally aliquoted and dispensed into each reaction chamber by centrifugal force, and then the multiplex direct-RPA reaction was executed. The target genes of bacteria spiked in milk could be amplified at 39 °C without a DNA extraction step by using the direct-RPA cocktails, which were a combination of a direct PCR buffer and RPA enzymes. As the target gene amplification proceeded, the increased fluorescence signals coming from the reaction chambers were recorded in real-time at an interval of 2 min. The entire process, including the sample distribution, the direct-RPA reaction, and the real-time analysis, was accomplished with a custom-made portable genetic analyzer and a miniaturized optical detector. Monoplex, duplex, and triplex food poisoning bacteria (Salmonella enterica, Escherichia coli O157:H7, and Vibrio parahaemolyticus) detection was successfully performed with a detection sensitivity of 4 cells per 3.2 μL of milk samples within 30 min. By implementing the direct-PRA on the miniaturized centrifugal microsystem, the on-site food poisoning bacteria analysis would be feasible with high speed, sensitivity, and multiplicity.
Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H
2002-07-01
Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.
Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee
2012-07-09
Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin
2015-01-01
To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p<0.05). Patients with early EOC had markedly lower serum CA125 than those with advanced EOC (p<0.05), but there was no significant difference in free DNA methylation (p>0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (p<0.05). In the detection of patients with advanced EOC, the PPV of CA125 detection was obviously lower than that of multiplex nested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.
USDA-ARS?s Scientific Manuscript database
Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...
Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun
2015-07-01
Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.
Time Division Multiplexing of Semiconductor Qubits
NASA Astrophysics Data System (ADS)
Jarratt, Marie Claire; Hornibrook, John; Croot, Xanthe; Watson, John; Gardner, Geoff; Fallahi, Saeed; Manfra, Michael; Reilly, David
Readout chains, comprising resonators, amplifiers, and demodulators, are likely to be precious resources in quantum computing architectures. The potential to share readout resources is contingent on realising efficient means of time-division multiplexing (TDM) schemes that are compatible with quantum computing. Here, we demonstrate TDM using a GaAs quantum dot device with multiple charge sensors. Our device incorporates chip-level switches that do not load the impedance matching network. When used in conjunction with frequency multiplexing, each frequency tone addresses multiple time-multiplexed qubits, vastly increasing the capacity of a single readout line.
Nishiwaki, Morie; Fujimuro, Masahiro; Teishikata, Yasuhiro; Inoue, Hisanori; Sasajima, Hitoshi; Nakaso, Kazuhiro; Nakashima, Kenji; Sadanari, Hidetaka; Yamamoto, Tomohiro; Fujiwara, Yoshie; Ogawa, Naoki; Yokosawa, Hideyoshi
2006-12-01
A multiplex polymerase chain reaction (PCR) has been developed for the simultaneous detection of Epstein-Barr virus (EBV), cytomegalovirus (CMV), and Kaposi's sarcoma-associated herpesvirus (KSHV) in a clinical sample. Primers of multiplex PCR were designed to amplify specific regions of the EBV EBNA1, CMV IE2, and KSHV LANA genes. This multiplex PCR assay was found to have detection sensitivities of 1-10 copies of purified viral DNA cloned into the plasmid. To assess diagnostic and pre-clinical applications with this method, we utilized KSHV-positive primary effusion lymphoma (PEL) cells, EBV-positive Burkitt's lymphoma cells, CMV-infected fibroblast cells, and clinically prepared peripheral blood leukocytes (PBLs) that had been infected with viruses. We found that this multiplex PCR assay has high sensitivity and specificity for simultaneous detection of EBV, CMV, and KSHV genomes in a single amplification from a clinical material. Using this multiplex PCR assay, we investigated the prevalence of EBV, CMV, and KSHV in PBL samples from normal Japanese randomly selected. KSHV, EBV, and CMV genomes were detected in samples from 2 (0.2%), 377 (39.5%), and 27 (2.8%) of the 953 blood donors, respectively. Interestingly, both EBV and CMV genomes were detected in samples from all KSHV-positive donors. (c) 2006 Wiley-Liss, Inc.
Polymerase chain reaction: A molecular diagnostic tool in periodontology
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822
Polymerase chain reaction: A molecular diagnostic tool in periodontology.
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.
De, Abhishek; Hasanoor Reja, Abu Hena; Aggarwal, Ishad; Sen, Sumit; Sil, Amrita; Bhattacharya, Basudev; Sharma, Nidhi; Ansari, Asad; Sarda, Aarti; Chatterjee, Gobinda; Das, Sudip
2017-01-01
Background: Pure neural leprosy (PNL) still remains a diagnostic challenge because of the absence of sine qua non skin lesions of leprosy and a confirmatory diagnostic method. The authors had earlier described a simple yet objective technique of combining fine needle aspiration cytology (FNAC) coupled with a multiplex polymerase chain reaction (PCR) in a pilot study, wherein the technique showed promise of a reliable diagnostic tool. In the pursuit of further evidence, the authors carried out a 4-year study with PNL cases to find the efficacy and reliability of the said method in a larger sample size. Aim: This study was conducted to find the efficacy, reliability, and reproducibility of FNAC coupled with multiplex PCR and Ziehl-Neelsen (ZN) staining in identifying the cases of PNL. Materials and Methods: All cases that were suspected to be suffering from PNL, following evaluation by two independent observers were included in the study and were subjected to FNAC from the affected nerve, and the aspirates were evaluated for cytology, ZN staining, and multiplex PCR for Mycobacterium leprae genome. In addition, serum anti-PGL1 levels were also performed in all the study subjects. Fifteen non-PNL cases were also included in the control arm. Results: A total of 47 cases were included in the test arm and subjected to FNAC. Conventional ZN staining could demonstrate acid-fast bacilli (AFB) in only 15 out of 47 cases (31.91%) while M. leprae DNA could be elicited in 37 (78.72%) cases by the multiplex PCR. Only 13 (27.65%) out of 47 cases showed anti-PGLI-1 antibody positivity. On cytological examination of the nerve aspirates, only 11 (23.40%) cases showed epithelioid cells whereas nonspecific inflammation was seen in 26 (75.60%) cases. Conclusion: The results of this study conducted over a larger sample size corroborate with the findings of our pilot study. In a resource poor set up, FNAC in combination with ZN staining and multiplex PCR is a rapid, simple, and easily
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Identification of duck plague virus by polymerase chain reaction.
Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.
Cybulski, Zefiryn; Schmidt, Katarzyna; Grabiec, Alicja; Talaga, Zofia; Bociąg, Piotr; Wojciechowicz, Jacek; Roszak, Andrzej; Kycler, Witold
2013-01-01
Background The objective of this study was: i) to compare the results of urine culture with polymerase chain reaction (PCR) -based detection of microorganisms using two commercially available kits, ii) to assess antimicrobial susceptibility of urine isolates from cancer patients to chosen antimicrobial drugs and, if necessary, to update the recommendation of empirical therapy. Materials and methods. A one-year hospital-based prospective study has been conducted in Greater Poland Cancer Centre and Genetic Medicine Laboratory CBDNA Research Centre in 2011. Urine cultures and urine PCR assay from 72 patients were examined Results Urine cultures and urine PCR assay from 72 patients were examined. Urine samples were positive for 128 strains from which 95 (74%) were identical in both tests. The most frequently isolated bacteria in both culture and PCR assay were coliform organisms and Enterococcus spp. The Gram negative bacilli were most resistant to cotrimoxazol. 77.2% of these bacilli and 100% of E. faecalis and S. agalactiae were sensitive to amoxicillin-clavulanic acid. 4.7% of Gram positive cocci were resistant to nitrofurantoin. Conclusions The PCR method quickly finds the causative agent of urinary tract infection (UTI) and, therefore, it can help with making the choice of the proper antimicrobial therapy at an early stage. It appears to be a viable alternative to the recommendations made in general treatment guidelines, in cases where diversified sensitivity patterns of microorganisms have been found. PMID:24133395
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Mohamed, Moemen A; Mohamed, Mohamed-Wael A; Ahmed, Ahmed I; Ibrahim, Awad A; Ahmed, Mohamed S
2012-01-01
The prevalence of Pasteurella multocida strains among 275 backyard chickens from different regions of Upper Egypt was studied. A total of 21 isolates of P. multocida were recovered in 21 out of 275 chickens tested (7.6%) and were confirmed using phenotypic characterisation. Somatic serotyping of the 21 isolates resulted in 12 isolates being classed as serotype A:1 (57.14%), 4 as serotype A:3 (19.05%) and 5 could not be typed (23.8%). Capsular typing, using multiplex polymerase chain reaction (PCR), demonstrated that 18 strains were capsular type A (85.7%), and 3 were type D (14.3%). The present findings suggest that a multiplex capsular PCR could be valuable for the rapid identification of P. multocida in cases of fowl cholera infection. A total of 5 isolates of P. multocida were selected to study their pathogenicity in embryonated chicken eggs instead of conducting a study in mature chickens. The results showed a variation in pathogenicity between the strains tested, namely: serotype A:1 strains caused 80% mortality, in contrast to 20% mortality by type D strains. Pathological findings included severe congestion of the entire embryo, haemorrhaging of the skin, feather follicles and toe, and ecchymotic haemorrhages on the liver of the inoculated embryos. The observations in this study indicate that P. multocida serogroup A could be highly pathogenic for mature chickens and therefore might be a cause of considerable economic losses in commercial production. A total of 10 isolates were subjected to antimicrobial susceptibility to determine the minimal inhibitory concentration of 7 antimicrobials. All isolates were susceptible to ciprofloxacin, florfenicol, streptomycin and sulphamethoxazol with trimethoprim and with varying degrees of sensitivity to the other agents.
Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan
2013-05-01
This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.
Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng
2015-02-01
Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.
Mansour, Asmaa Samy; Wagih, Gad El-Said; Morgan, Sabry D; Elhariri, Mahmoud; El-Shabrawy, Mona A; Abuelnaga, Azza S M; Elgabry, E A
2017-08-01
This review gives an outline of the assessment of enterotoxigenic Staphylococcus aureus tainting levels in raw milk from different sources in Egypt and characterization of enterotoxigenic strains utilizing a technique in light of PCR to identify genes coding for the production of staphylococcal enterotoxin (SE). The obtained data were compared with results from the application of the reversed passive latex. Multiplex PCR and reversed passive latex agglutination (RPLA) were used. A total of 141 samples of raw milk (cow's milk=33, buffalo's milk=58, and bulk tank milk=50) were investigated for S. aureus contamination and tested for enterotoxin genes presence and toxin production. S. aureus was detected in 23 (16.3%) samples phenotypically and genotypically by amplification of nuc gene. The S. aureus isolates were investigated for SEs genes ( sea to see ) by multiplex PCR and the toxin production by these isolates was screened by RPLA. SEs genes were detected in six isolates (26.1%) molecularly; see was the most observed gene where detected in all isolates, two isolates harbored seb , and two isolates harbored sec . According to RPLA, three isolates produced SEB and SEC. The study revealed the widespread of S. aureus strains caring genes coding for toxins. The real significance of the presence of these strains or its toxins in raw milk and their possible impact a potential hazard for staphylococcal food poisoning by raw milk consumption. Therefore, detection of enterotoxigenic S. aureus strains in raw milk is necessary for consumer safety.
NASA Astrophysics Data System (ADS)
Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel
2010-12-01
Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.
Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R
2001-03-01
A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.
The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...
Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas
2010-01-01
Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158
ERIC Educational Resources Information Center
Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary
2006-01-01
We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…
Detection of human Pneumocystis carinii by the polymerase chain reaction.
Becker-Hapak, M; Liberator, P; Graves, D
1991-01-01
Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus
Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.
2004-01-01
A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703
Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.
Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda
2018-06-01
Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton
2017-01-01
Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691
Schrell, Adrian M.; Roper, Michael G.
2014-01-01
A frequency-modulated fluorescence encoding method was used as a means to increase the number of fluorophores monitored during infrared-mediated polymerase chain reaction. Laser lines at 488-nm and 561-nm were modulated at 73- and 137-Hz, respectively, exciting fluorescence from the dsDNA intercalating dye, EvaGreen, and the temperature insensitive dye, ROX. Emission was collected in a color-blind manner using a single photomultiplier tube for detection and demodulated by frequency analysis. The resulting frequency domain signal resolved the contribution from the two fluorophores as well as the background from the IR lamp. The detection method was successfully used to measure amplification of DNA samples containing 104 – 107 starting copies of template producing an amplification efficiency of 96%. The utility of this methodology was further demonstrated by simultaneous amplification of two genes from human genomic DNA using different color TaqMan probes. This method of multiplexing fluorescence detection with IR-qPCR is ideally suited as it allowed isolation of the signals of interest from the background in the frequency domain and is expected to further reduce the complexity of multiplexed microfluidic IR-qPCR instrumentation. PMID:24448431
Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.
Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael
2009-01-01
A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.
Zhou, Lingying; Gan, Ning; Wu, Yongxiang; Hu, Futao; Lin, Jianyuan; Cao, Yuting; Wu, Dazhen
2018-05-29
Recently, it has been crucial to be able to detect and quantify small molecular targets simultaneously in biological samples. Herein, a simple and conventional double-T type microchip electrophoresis (MCE) based platform for the multiplex detection of quality indicator molecule targets in urine, using ampicillin (AMPI), adenosine triphosphate (ATP) and estradiol (E2) as models, was developed. Several programmable hairpin probes (PHPs) were designed for detecting different targets and triggering isothermal polymerase-catalyzed target recycling (IPCTR) for signal amplification. Based on the target-responsive aptamer structure of PHP (Domain I), target recognition can induce PHP conformational transition and produce extension duplex DNA (dsDNA), assisted by primers & Bst polymerase. Afterwards, the target can be displaced to react with another PHP and initiate the next cycle. After several rounds of reaction, the dsDNA can be produced in large amounts by IPCTR. Three targets can be simultaneously converted to dsDNA fragments with different lengths, which can be separated and detected using MCE. Thus, a simple double-T type MCE based platform was successfully built for the homogeneous detection of multiplex targets in one channel. Under optimal conditions, the assay exhibited high throughput (48 samples per hour at most, not including reaction time) and sensitivity to three targets in urine with a detection limit of 1 nM (ATP), 0.05 nM (AMPI) and 0.1 nM (E2) respectively. The multiplex assay was successfully employed for the above three targets in several urine samples and combined the advantages of the high specificity of programmable hairpin probes, the excellent signal amplification of IPCTR, and the high through-put of MCE which can be employed for screening in biochemical analysis.
Møller, Jens Kjølseth
2012-01-01
Rapid clinical and laboratory diagnoses are the foundation for a successful management of serious infections with Neisseria meningitidis. A species-specific multiplex polymerase chain reaction (PCR) coupled with fluidic microarrays using microbeads (the Luminex xMAP™ Technology) can detect pathogens most frequently found in the cerebrospinal fluid of patients. The Luminex suspension array system uniquely combines flow cytometry, microspheres, laser technology, digital signal processing, and traditional chemistry. In this method, the reaction is carried out in one vessel, in which distinctly color-coded bead sets, each conjugated with a different specific nucleic acid reactant, are hybridized with the PCR products, and a reporter molecule is used to quantify the interaction. The flow-based Luminex array reader identifies each reaction (bead set) after excitation by a red classification laser. Reporter signals from each reaction are simultaneously quantified by fluorescence generated by a green reporter laser. This nonculture, multiplex assay may prove to be an important tool for optimal laboratory diagnosis, not only of meningococcal meningitis, but also of meningitis caused by other bacterial or viral pathogens.
Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh
2016-01-01
This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834
Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo
2005-01-01
Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159
Valeriani, Federica; Agodi, Antonella; Casini, Beatrice; Cristina, Maria Luisa; D'Errico, Marcello Mario; Gianfranceschi, Gianluca; Liguori, Giorgio; Liguori, Renato; Mucci, Nicolina; Mura, Ida; Pasquarella, Cesira; Piana, Andrea; Sotgiu, Giovanni; Privitera, Gaetano; Protano, Carmela; Quattrocchi, Annalisa; Ripabelli, Giancarlo; Rossini, Angelo; Spagnolo, Anna Maria; Tamburro, Manuela; Tardivo, Stefano; Veronesi, Licia; Vitali, Matteo; Romano Spica, Vincenzo
2018-02-01
Reprocessing of endoscopes is key to preventing cross-infection after colonoscopy. Culture-based methods are recommended for monitoring, but alternative and rapid approaches are needed to improve surveillance and reduce turnover times. A molecular strategy based on detection of residual traces from gut microbiota was developed and tested using a multicenter survey. A simplified sampling and DNA extraction protocol using nylon-tipped flocked swabs was optimized. A multiplex real-time polymerase chain reaction (PCR) test was developed that targeted 6 bacteria genes that were amplified in 3 mixes. The method was validated by interlaboratory tests involving 5 reference laboratories. Colonoscopy devices (n = 111) were sampled in 10 Italian hospitals. Culture-based microbiology and metagenomic tests were performed to verify PCR data. The sampling method was easily applied in all 10 endoscopy units and the optimized DNA extraction and amplification protocol was successfully performed by all of the involved laboratories. This PCR-based method allowed identification of both contaminated (n = 59) and fully reprocessed endoscopes (n = 52) with high sensibility (98%) and specificity (98%), within 3-4 hours, in contrast to the 24-72 hours needed for a classic microbiology test. Results were confirmed by next-generation sequencing and classic microbiology. A novel approach for monitoring reprocessing of colonoscopy devices was developed and successfully applied in a multicenter survey. The general principle of tracing biological fluids through microflora DNA amplification was successfully applied and may represent a promising approach for hospital hygiene. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Polymerase chain reaction technology as analytical tool in agricultural biotechnology.
Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping
2005-01-01
The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Jankowski, Stéphane; Currie-Fraser, Erica; Xu, Licen; Coffa, Jordy
2008-09-01
Annotated DNA samples that had been previously analyzed were tested using multiplex ligation-dependent probe amplification (MLPA) assays containing probes targeting BRCA1, BRCA2, and MMR (MLH1/MSH2 genes) and the 9p21 chromosomal region. MLPA polymerase chain reaction products were separated on a capillary electrophoresis platform, and the data were analyzed using GeneMapper v4.0 software (Applied Biosystems, Foster City, CA). After signal normalization, loci regions that had undergone deletions or duplications were identified using the GeneMapper Report Manager and verified using the DyeScale functionality. The results highlight an easy-to-use, optimal sample preparation and analysis workflow that can be used for both small- and large-scale studies.
A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...
Vuran, Emre; Karaarslan, Aydın; Karasartova, Djursun; Turegun, Buse; Sahin, Fikret
2014-02-01
Despite the fact that a range of molecular methods have been developed as tools for the diagnosis of Malassezia species, there are several drawbacks associated with them, such as inefficiency of differentiating all the species, high cost, and questionable reproducibility. In addition, most of the molecular methods require cultivation to enhance sensitivity. Therefore, alternative methods eliminating cultivation and capable of identifying species with high accuracy and reliability are needed. Herein, a multiplex polymerase chain reaction (PCR)-based method was especially developed for the detection of eleven Malassezia species. The multiplex PCR was standardized by incorporating a consensus forward primer, along with Malassezia species-specific reverse primers considering the sizes of the PCR products. In the method, the multiplex-PCR primer content is divided into three parts to circumvent the problem of increased nonspecific background resulting from the use of a large number of primers. DNA extraction protocol described by Harju and colleagues was modified using liquid nitrogen instead of -80 °C to break down the yeast membrane. By a modified extraction procedure followed by multiplex PCR and electrophoresis, the method enables identification and differentiation of Malassezia species from both of the samples obtained directly from skin and yeast colonies grown in culture. Fifty-five patients who were confirmed with pityriasis versicolor were enrolled in the study. Multiplex PCR detected and differentiated all 55 samples obtained directly from the patients' skin. However, 50 out of 55 samples yielded Malassezia colony in the culture. In addition, eight of 50 colonies were misdiagnosed or not completely differentiated by conventional methods based on the sequence analysis of eight colonies. The method is capable of identifying species with high accuracy and reliability. In addition, it is simple, quick, and cost-effective. More importantly, the method works
Codner, Gemma F; Lindner, Loic; Caulder, Adam; Wattenhofer-Donzé, Marie; Radage, Adam; Mertz, Annelyse; Eisenmann, Benjamin; Mianné, Joffrey; Evans, Edward P; Beechey, Colin V; Fray, Martin D; Birling, Marie-Christine; Hérault, Yann; Pavlovic, Guillaume; Teboul, Lydia
2016-08-05
Karyotypic integrity is essential for the successful germline transmission of alleles mutated in embryonic stem (ES) cells. Classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. As part of the International Mouse Phenotyping Consortium, we gathered data from over 1,500 ES cell clones and found that the germline transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triage of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germline transmission potential. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germline transmission and reducing the number of animals used in failed microinjection attempts. This method can be applied to any other experiments that require accurate analysis of the genome for
Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng
2014-09-19
Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.
Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N
2009-01-01
A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.
Boonsuk, Pitirat; Payungporn, Sunchai; Chieochansin, Thaweesak; Samransamruajkit, Rujipat; Amonsin, Alongkorn; Songserm, Thaweesak; Chaisingh, Arunee; Chamnanpood, Pornchai; Chutinimitkul, Salin; Theamboonlers, Apiradee; Poovorawan, Yong
2008-07-01
Infections with influenza virus type A and B present serious public health problems on a global scale. However, only influenza A virus has been reported to cause fatal pandemic in many species. To provide suitable clinical management and prevent further virus transmission, efficient and effective clinical diagnosis is essential. Therefore, we developed multiplex PCR assays for detecting influenza types A and B and the subtypes of influenza A virus (H1, H3 and H5). Upon performing multiplex PCR assays with type-specific primer sets, the clearly distinguishable products representing influenza A and B virus were separated by agarose gel electrophoresis. In addition, the subtypes of influenza A virus (H1, H3 and H5), which are most common in humans, can be readily distinguished by PCR with subtype-specific primer sets, yielding PCR products of different sizes depending on which subtype has been amplified. This method was tested on 46 influenza virus positive specimens of avian and mammalian (dog and human) origins collected between 2006 and 2008. The sensitivity of this method, tested against known concentrations of each type and subtype specific plasmid, was established to detect 10(3) copies/microl. The method's specificity was determined by testing against other subtypes of influenza A virus (H2, H4 and H6-H15) and respiratory pathogens commonly found in humans. None of them could be amplified, thus excluding cross reactivity. In conclusion, the multiplex PCR assays developed are advantageous as to rapidity, specificity, and cost effectiveness.
Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E
2013-08-01
Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.
Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh
2016-01-01
This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.
Profiling biomarkers in gingival crevicular fluid using multiplex bead immunoassay.
Shimada, Yasuko; Tabeta, Koichi; Sugita, Noriko; Yoshie, Hiromasa
2013-06-01
Biomarkers in gingival crevicular fluid (GCF) have been investigated; however, measurements were limited by the small sample volume available. The aim of this study was to determine the levels of 40 different cytokines and chemokines in GCF samples. Eleven patients with generalised chronic periodontitis participating in a supportive periodontal therapy programme with remaining probing pocket depths (PDs) of >5mm were enrolled. One healthy and two diseased sites were sampled in each subject. Forty biomarkers in GCF were examined using a multiplex bead immunoassay. Porphyromonas gingivalis from the diseased sites was quantified by real-time polymerase chain reaction. Twenty-six biomarkers were detected in the GCF samples using the multiplex bead immunoassay. The levels of nine biomarkers were significantly different between the diseased and healthy sites after adjustment with Bonferroni's correction. The level of 26 biomarkers in diseased sites was compared between bleeding on probing (BOP)-positive and BOP-negative sites. Interleukin (IL)-1β and interferon-inducible protein (IP)-10 levels were significantly higher in BOP-positive diseased sites than BOP-negative diseased sites after adjustment for multiple comparisons (IL-1β, p=0.0007, IP-10; p=0.0009). In addition, the levels of IL-1β in GCF were found to be strongly correlated with the P. gingivalis ratio (r=0.646, p=0.0012). IL-1β levels in GCF correlate with the PDs, BOP and the presence of P. gingivalis in subgingival plaque. Multiplex bead assays can be useful in GCF studies. These findings can help in identifying new diagnostic methods in the diagnosis of periodontal disease. Copyright © 2012 Elsevier Ltd. All rights reserved.
Rapid microfluidic analysis of a Y-STR multiplex for screening of forensic samples.
Gibson-Daw, Georgiana; Albani, Patricia; Gassmann, Marcus; McCord, Bruce
2017-02-01
In this paper, we demonstrate a rapid analysis procedure for use with a small set of rapidly mutating Y chromosomal short tandem repeat (Y-STR) loci that combines both rapid polymerase chain reaction (PCR) and microfluidic separation elements. The procedure involves a high-speed polymerase and a rapid cycling protocol to permit PCR amplification in 16 min. The resultant amplified sample is next analysed using a short 1.8-cm microfluidic electrophoresis system that permits a four-locus Y-STR genotype to be produced in 80 s. The entire procedure takes less than 25 min from sample collection to result. This paper describes the rapid amplification protocol as well as studies of the reproducibility and sensitivity of the procedure and its optimisation. The amplification process utilises a small high-speed thermocycler, microfluidic device and compact laptop, making it portable and potentially useful for rapid, inexpensive on-site genotyping. The four loci used for the multiplex were selected due to their rapid mutation rates and should proved useful in preliminary screening of samples and suspects. Overall, this technique provides a method for rapid sample screening of suspect and crime scene samples in forensic casework. Graphical abstract ᅟ.
Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.
Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry
2012-11-16
The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.
Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L
2018-05-25
The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.
Osman, Fatima; Dang, Tyler; Bodaghi, Sohrab; Vidalakis, Georgios
2017-07-01
A one-step multiplex reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR) based on species-specific minor groove binding (MGB) probes, was developed for the simultaneous detection, identification, and quantification of three citrus viroids belonging to different genera. Citrus exocortis viroid (Pospiviroid), Hop stunt viroid (Hostuviroid), and Citrus bark cracking viroid (Cocadviroid) cause a variety of maladies in agriculturally significant crops. Therefore, reliable assays for their detection are essential tools for various government and industry organizations implementing disease management programs. Singleplex qPCR primers and MGB probes were designed individually for the detection of the three targeted viroids, and subsequently combined in a one-step multiplex RT-qPCR reaction. A wide host range of woody plants, including citrus, grapevines, apricots, plums and herbaceous plants such as tomato, cucumber, eggplant and chrysanthemum different world regions were used to validate the assay. Single, double and triple viroid infections were identified in the tested samples. The developed multiplex RT-qPCR assay was compared with a previously reported SYBR Green I RT-qPCR for the universal detection of citrus viroids. Both assays accurately identified all citrus viroid infected samples. The multiplex assay complemented the SYBR Green I universal detection assay by differentiating among citrus viroid species in the positive samples. The developed multiplex RT-qPCR assay has the potential to simultaneously detect each targeted viroid and could be used in high throughput screenings for citrus viroids in field surveys, germplasm banks, nurseries and other viroid disease management programs. Copyright © 2017. Published by Elsevier B.V.
Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora
2018-02-01
Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Srienc, Friedrich; Jackson, John K.; Somers, David A.
A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.
Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine
2007-02-01
In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.
Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo
2018-04-01
Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.
Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C
2012-09-27
We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.
Siqueira, José F; Rôças, Isabela N
2003-08-01
Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
Detection of four important Eimeria species by multiplex PCR in a single assay.
You, Myung-Jo
2014-06-01
The oocysts of some of the recognized species of chicken coccidiosis are difficult to distinguish morphologically. Diagnostic laboratories are increasingly utilizing DNA-based technologies for the specific identification of Eimeria species. This study reports a multiplex polymerase chain reaction (PCR) assay based on internal transcribed spacer-1 (ITS-1) for the simultaneous diagnosis of the Eimeria tenella, Eimeria acervulina, Eimeria maxima, and Eimeria necatrix species, which infect domestic fowl. Primer pairs specific to each species were designed in order to generate a ladder of amplification products ranging from 20 to 25 bp, and a common optimum annealing temperature for these species was determined to be 52.5 °C. Sensitivity tests were performed for each species, showing a detection threshold of 1-5 pg. All the species were amplified homogeneously, and a homogenous band ladder was observed, indicating that the assay permitted the simultaneous detection of all the species in a single-tube reaction. In the phylogenic study, there was a clear species clustering, which was irrespective of geographical location, for all the ITS-1 sequences used. This multiplex PCR assay represents a rapid and potential cost-effective diagnostic method for the detection of some key Eimeria species that infect domestic fowl. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Jankowski, Stéphane; Currie-Fraser, Erica; Xu, Licen; Coffa, Jordy
2008-01-01
Annotated DNA samples that had been previously analyzed were tested using multiplex ligation-dependent probe amplification (MLPA) assays containing probes targeting BRCA1, BRCA2, and MMR (MLH1/MSH2 genes) and the 9p21 chromosomal region. MLPA polymerase chain reaction products were separated on a capillary electrophoresis platform, and the data were analyzed using GeneMapper v4.0 software (Applied Biosystems, Foster City, CA). After signal normalization, loci regions that had undergone deletions or duplications were identified using the GeneMapper Report Manager and verified using the DyeScale functionality. The results highlight an easy-to-use, optimal sample preparation and analysis workflow that can be used for both small- and large-scale studies. PMID:19137113
Identifying of meat species using polymerase chain reaction (PCR)
NASA Astrophysics Data System (ADS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-11-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P
2012-12-01
Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Choi, Su Mi; Kim, Seung-Han; Kim, Hee-Jung; Lee, Dong-Gun; Choi, Jung-Hyun; Yoo, Jin-Hong; Kang, Jin-Han; Shin, Wan-Shik; Kang, Moon-Won
2003-01-01
We developed multiplex polymerase chain reaction (PCR) to detect aac(6 ')/aph(2 "), aph(3 ')-IIIa, and ant(4 ')-Ia, the genes encoding the most clinically relevant amino-glycoside modifying enzymes (AME), and simultaneously, the methicillin resistant gene, mecA, in Staphylococcus species. Clinical isolates of 45 S. aureus and 47 coagulase negative staphylococci (CNS) from tertiary university hospitals were tested by conventional susceptibility testing, using the agar dilution method and by multiplex PCR. Of a total of 92 isolates, 61 isolates were found to be methicillin-resistant. Of these, 54 isolates (89%) were found to be harboring mecA. Seventy-five percent of the 92 isolates demonstrated resistance to at least one of the aminoglycosides tested. Moreover, resistance to aminoglycosides was closely associated with methicillin-resistance (p<0.05). The most prevalent AME gene was aac(6 ')/aph(2 ") which was found in 65% of the isolates, and ant(4 ')-Ia and aph(3 ')-IIIa were present in 41% and 9% of the isolates, respectively. The concordance between methicillin-resistance and the presence of mecA gene was 98% in S. aureus and 81% in CNS. The concordance between gentamicin resistance and the presence of aac(6 ')/aph(2 ") gene was 100% in S. aureus and 85% in CNS. The multiplex PCR method that we developed appears to be both a more rapid and reliable than conventional method. PMID:14555812
Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D
2011-11-01
The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.
Eichmann, Cordula; Parson, Walther
2008-09-01
The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.
[Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].
Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng
2004-11-01
To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun
2018-04-01
Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Electrochemical product detection of an asymmetric convective polymerase chain reaction.
Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe
2009-10-15
For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.
Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K
2000-06-15
Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.
Brault, Aaron C.; Fang, Ying; Reisen, William K.
2015-01-01
Following the introduction of West Nile virus into California during the summer of 2003, public health and vector control programs expanded surveillance efforts and were in need of diagnostics capable of rapid, sensitive, and specific detection of arbovirus infections of mosquitoes to inform decision support for intervention. Development of a multiplex TaqMan or real-time semiquantitative reverse transcription polymerase chain reaction (RT-PCR) assay in which three virus specific primer–probe sets were used in the same reaction is described herein for the detection of western equine encephalomyelitis, St. Louis encephalitis and West Nile viral RNA. Laboratory validation and field data from 10 transmission seasons are reported. The comparative sensitivity and specificity of this multiplex assay to singleplex RT-PCR as well as an antigen detection (rapid analyte measurement platform) and standard plaque assays indicate this assay to be rapid and useful in providing mosquito infection data to estimate outbreak risk. PMID:26334826
Garrido-Bailón, Encarna; Higes, Mariano; Martínez-Salvador, Amparo; Antúnez, Karina; Botías, Cristina; Meana, Aránzazu; Prieto, Lourdes; Martín-Hernández, Raquel
2013-01-01
The microorganisms Ascosphaera apis, Paenibacillus larvae and Melissococcus plutonius are the three most important pathogens that affect honeybee brood. The aim of the present study was to evaluate the prevalence of these pathogens in honeybee colonies and to elucidate their role in the honeybee colony losses in Spain. In order to get it, a multiplex polymerase chain reaction (PCR) assay was developed to simultaneously amplify the16S ribosomal ribonucleic acid (rRNA) gene of P. larvae and M. plutonius, and the 5.8S rRNA gene of A. apis. The multiplex PCR assay provides a quick and specific tool that successfully detected the three infectious pathogens (P. larvae, M. plutonius and A. apis) in brood and adult honeybee samples without the need for microbiological culture. This technique was then used to evaluate the prevalence of these pathogens in Spanish honeybee colonies in 2006 and 2007, revealing our results a low prevalence of these pathogens in most of the geographic areas studied. PMID:23919248
Jangampalli Adi, Pradeepkiran; Naidu, Jagadish R; Matcha, Bhaskar
2017-09-01
Escherichia coli (E. coli), Salmonella typhi and Vibrio cholera harmful pathogens, which causes various diseases in humans. Rapid diagnosis of bacterial infection is an important for patient management and appropriate therapy during the early phase of the bacterial infected diseases. Among the existing techniques for identifying pathogens were less sensitive and time-consuming processes. In the present study total, 48 clinical 31 blood and 17 urine samples of patients suspected with the infections were collected from SVRR Hospital and used to detect the pathogens. Multiplex polymerase chain reaction (PCR) assay was set to design for the identification of Escherichia coli, Salmonella typhi and Vibrio cholera from the different clinical samples. Rapid diagnosis of Escherichia coli (E. coli), Salmonella and Vibrio cholera pathogens can be done with simultaneously in a single multiplex PCR assay by using specific primers with adjusted PCR conditions. Through this approach, the results represented with out of 31 blood samples 1-15 shows the positive with E. coli and remaining 14 only 11 were correlated with multiplex results of Vibrio cholera, remaining the urine samples all are positive with 17 samples correlate with the Salmonella typhi. Through the high specificity benefits of excellent sensitivity, with high resolution and reproducibility. This method of results proved and illustrates the best potential system for diagnosing the infectious disease with modern trendy. Copyright © 2017 Elsevier Ltd. All rights reserved.
Multiplex congruence network of natural numbers.
Yan, Xiao-Yong; Wang, Wen-Xu; Chen, Guan-Rong; Shi, Ding-Hua
2016-03-31
Congruence theory has many applications in physical, social, biological and technological systems. Congruence arithmetic has been a fundamental tool for data security and computer algebra. However, much less attention was devoted to the topological features of congruence relations among natural numbers. Here, we explore the congruence relations in the setting of a multiplex network and unveil some unique and outstanding properties of the multiplex congruence network. Analytical results show that every layer therein is a sparse and heterogeneous subnetwork with a scale-free topology. Counterintuitively, every layer has an extremely strong controllability in spite of its scale-free structure that is usually difficult to control. Another amazing feature is that the controllability is robust against targeted attacks to critical nodes but vulnerable to random failures, which also differs from ordinary scale-free networks. The multi-chain structure with a small number of chain roots arising from each layer accounts for the strong controllability and the abnormal feature. The multiplex congruence network offers a graphical solution to the simultaneous congruences problem, which may have implication in cryptography based on simultaneous congruences. Our work also gains insight into the design of networks integrating advantages of both heterogeneous and homogeneous networks without inheriting their limitations.
Multiplex congruence network of natural numbers
NASA Astrophysics Data System (ADS)
Yan, Xiao-Yong; Wang, Wen-Xu; Chen, Guan-Rong; Shi, Ding-Hua
2016-03-01
Congruence theory has many applications in physical, social, biological and technological systems. Congruence arithmetic has been a fundamental tool for data security and computer algebra. However, much less attention was devoted to the topological features of congruence relations among natural numbers. Here, we explore the congruence relations in the setting of a multiplex network and unveil some unique and outstanding properties of the multiplex congruence network. Analytical results show that every layer therein is a sparse and heterogeneous subnetwork with a scale-free topology. Counterintuitively, every layer has an extremely strong controllability in spite of its scale-free structure that is usually difficult to control. Another amazing feature is that the controllability is robust against targeted attacks to critical nodes but vulnerable to random failures, which also differs from ordinary scale-free networks. The multi-chain structure with a small number of chain roots arising from each layer accounts for the strong controllability and the abnormal feature. The multiplex congruence network offers a graphical solution to the simultaneous congruences problem, which may have implication in cryptography based on simultaneous congruences. Our work also gains insight into the design of networks integrating advantages of both heterogeneous and homogeneous networks without inheriting their limitations.
Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki
2018-05-15
A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.
Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho
2018-01-01
Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.
Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu
2014-04-01
The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means ofmore » rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.« less
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
NASA Astrophysics Data System (ADS)
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Polymerase chain reaction for detection of Leptospira spp. in clinical samples.
Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I
1992-01-01
A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983
NASA Astrophysics Data System (ADS)
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Kakuda, Tsuneo; Shojo, Hideki; Tanaka, Mayumi; Nambiar, Phrabhakaran; Minaguchi, Kiyoshi; Umetsu, Kazuo; Adachi, Noboru
2016-01-01
Mitochondrial DNA (mtDNA) serves as a powerful tool for exploring matrilineal phylogeographic ancestry, as well as for analyzing highly degraded samples, because of its polymorphic nature and high copy numbers per cell. The recent advent of complete mitochondrial genome sequencing has led to improved techniques for phylogenetic analyses based on mtDNA, and many multiplex genotyping methods have been developed for the hierarchical analysis of phylogenetically important mutations. However, few high-resolution multiplex genotyping systems for analyzing East-Asian mtDNA can be applied to extremely degraded samples. Here, we present a multiplex system for analyzing mitochondrial single nucleotide polymorphisms (mtSNPs), which relies on a novel amplified product-length polymorphisms (APLP) method that uses inosine-flapped primers and is specifically designed for the detailed haplogrouping of extremely degraded East-Asian mtDNAs. We used fourteen 6-plex polymerase chain reactions (PCRs) and subsequent electrophoresis to examine 81 haplogroup-defining SNPs and 3 insertion/deletion sites, and we were able to securely assign the studied mtDNAs to relevant haplogroups. Our system requires only 1×10−13 g (100 fg) of crude DNA to obtain a full profile. Owing to its small amplicon size (<110 bp), this new APLP system was successfully applied to extremely degraded samples for which direct sequencing of hypervariable segments using mini-primer sets was unsuccessful, and proved to be more robust than conventional APLP analysis. Thus, our new APLP system is effective for retrieving reliable data from extremely degraded East-Asian mtDNAs. PMID:27355212
Kakuda, Tsuneo; Shojo, Hideki; Tanaka, Mayumi; Nambiar, Phrabhakaran; Minaguchi, Kiyoshi; Umetsu, Kazuo; Adachi, Noboru
2016-01-01
Mitochondrial DNA (mtDNA) serves as a powerful tool for exploring matrilineal phylogeographic ancestry, as well as for analyzing highly degraded samples, because of its polymorphic nature and high copy numbers per cell. The recent advent of complete mitochondrial genome sequencing has led to improved techniques for phylogenetic analyses based on mtDNA, and many multiplex genotyping methods have been developed for the hierarchical analysis of phylogenetically important mutations. However, few high-resolution multiplex genotyping systems for analyzing East-Asian mtDNA can be applied to extremely degraded samples. Here, we present a multiplex system for analyzing mitochondrial single nucleotide polymorphisms (mtSNPs), which relies on a novel amplified product-length polymorphisms (APLP) method that uses inosine-flapped primers and is specifically designed for the detailed haplogrouping of extremely degraded East-Asian mtDNAs. We used fourteen 6-plex polymerase chain reactions (PCRs) and subsequent electrophoresis to examine 81 haplogroup-defining SNPs and 3 insertion/deletion sites, and we were able to securely assign the studied mtDNAs to relevant haplogroups. Our system requires only 1×10-13 g (100 fg) of crude DNA to obtain a full profile. Owing to its small amplicon size (<110 bp), this new APLP system was successfully applied to extremely degraded samples for which direct sequencing of hypervariable segments using mini-primer sets was unsuccessful, and proved to be more robust than conventional APLP analysis. Thus, our new APLP system is effective for retrieving reliable data from extremely degraded East-Asian mtDNAs.
Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.
Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P
2000-01-01
Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].
[Polymerase chain reaction applied for detection of Toxoplasma gondii in lymph nodes].
Liu, C; Ouyang, K; Tan, D
1998-01-01
In order to investigate the morbidity of toxoplasmic lymphadenitis, polymerase chain reaction (PCR) was used to detect DNA of Toxoplasma gondii within lymph nodes in 3 groups of 120 patients with different diseases. After extracting the DNA of each sample, PCR was employed to amplify toxoplasma DNA. The results showed that the amplification product of 210 bp was confirmed in 7 patients: 3 cases of Hodgkin's disease (HD), 2 cases of non-Hodgkin's lymphoma (NHL) and 2 cases of chronic lymphadenitis (CL). Each PCR product was then subjected to Southern blot hybridization. Besides the 7 cases proved by PCR, 1 case of CL was found positive. The positive percentages of HD, NHL and CL were 9.38% (3/32), 4.88% (2/41), and 6.38% (3/47), respectively. The total positive rate was 6.67% (8/120).
Gopaul, Krishna K; Sells, Jessica; Lee, Robin; Beckstrom-Sternberg, Stephen M; Foster, Jeffrey T; Whatmore, Adrian M
2014-12-11
The zoonosis brucellosis causes economically significant reproductive problems in livestock and potentially debilitating disease of humans. Although the causative agent, organisms from the genus Brucella, can be differentiated into a number of species based on phenotypic characteristics, there are also significant differences in genotype that are concordant with individual species. This paper describes the development of a five target multiplex assay to identify five terrestrial Brucella species using real-time polymerase chain reaction (PCR) and subsequent high resolution melt curve analysis. This technology offers a robust and cost effective alternative to previously described hydrolysis-probe Single Nucleotide Polymorphism (SNP)-based species defining assays. Through the use of Brucella whole genome sequencing five species defining SNPs were identified. Individual HRM assays were developed to these target these changes and, following optimisation of primer concentrations, it was possible to multiplex all five assays in a single tube. In a validation exercise using a panel of 135 Brucella strains of terrestrial and marine origin, it was possible to distinguish the five target species from the other species within this panel. The HRM multiplex offers a number of diagnostic advantages over previously described SNP-based typing approaches. Further, and uniquely for HRM, the successful multiplexing of five assays in a single tube allowing differentiation of five Brucella species in the diagnostic laboratory in a cost-effective and timely manner is described. However there are possible limitations to using this platform on DNA extractions direct from clinical material.
Marzipan: polymerase chain reaction-driven methods for authenticity control.
Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus
2011-11-23
According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.
Identifying of meat species using polymerase chain reaction (PCR)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Foong, Chow Ming; Sani, Norrakiah Abdullah
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less
One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.
Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung
2016-06-01
Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.
Tang, Dong-ling; Li, Yan; Zhou, Xin; Li, Xia; Zheng, Fang
2009-05-01
To develop a fluorescent polymerase chain reaction (PCR) assay for the detection of circulating fetal DNA in maternal plasma and use the established multiplex in noninvasive prenatal genetic diagnosis and its further applications in forensic casework. The DNA template was extracted from 47 pregnant women and the whole blood samples from the stated biological fathers were used to detect genotype. Using multiplex fluorescent PCR at 16 different polymorphic short tandem repeat (STR) loci, maternal DNA extracted from plasma samples at early pregnancy, medium pregnancy and late pregnancy were used to detect genotype. Their husbands' DNA was also used for fetal genotype ascertainment. Multiplex fluorescent PCR with 16 polymorphic short tandem repeats revealed the presence of fetal DNA in all cases. Every pregnant women/husband pair was informative in at least 3 of 16 loci. The chances of detecting paternally inherited fetal alleles ranged from 66.67 to 94.12%. They are 66.67% in early pregnancy, 85.71% in medium pregnancy and 94.12% in late pregnancy. The accuracy of Multiplex PCR assay to detect fetal DNA was 100%. Circulating fetal DNA analysis can be used as a possible alternative tool in routine laboratory prenatal diagnosis in the near future; this highly polymorphic STR multiplex has greatly improved the chances of detecting paternally inherited fetal alleles compared with other fetal DNA detection systems that use fetus-derived Y sequences to detect only male fetal DNA in maternal plasma. Our proposed technique can be applied to both female and male fetuses, which provides a sensitive, accurate and efficient method for noninvasive prenatal genetic diagnosis and forensic casework.
A recombinase polymerase amplification assay for the diagnosis of atypical pneumonia.
Kersting, Sebastian; Rausch, Valentina; Bier, Frank F; von Nickisch-Rosenegk, Markus
2018-04-18
Pneumonia is one of the most common and potentially lethal infectious conditions worldwide. Streptococcus pneumoniae is the pathogen most frequently associated with bacterial community-acquired pneumonia, while Legionella pneumophila is the major cause for local outbreaks of legionellosis. Both pathogens can be difficult to diagnose since signs and symptoms are nonspecific and do not differ from other causes of pneumonia. Therefore, a rapid diagnosis within a clinically relevant time is essential for a fast onset of the proper treatment. Although methods based on polymerase chain reaction significantly improved the identification of pathogens, they are difficult to conduct and need specialized equipment. We describe a rapid and sensitive test using isothermal recombinase polymerase amplification and detection on a disposable test strip. This method does not require any special instrumentation and can be performed in less than 20 min. The analytical sensitivity in the multiplex assay amplifying specific regions of S. pneumoniae and L. pneumophila simultaneously was 10 CFUs of genomic DNA per reaction. In cross detection studies with closely related strains and other bacterial agents the specificity of the RPA was confirmed. The presented method is applicable for near patient and field testing with a rather simple routine and the possibility for a read out with the naked eye. Copyright © 2018. Published by Elsevier Inc.
Yan, Hainian; Yagyu, Fumihiro; Okitsu, Shoko; Nishio, Osamu; Ushijima, Hiroshi
2003-12-01
A reverse transcription (RT) single-round multiplex polymerase chain reaction (smPCR) assay was developed to detect simultaneously Norovirus genogroup I and II, Sapovirus and astrovirus. A total of 377 diarrhea stool samples (screened for rotavirus- and adenorivus-negative) from four regions in Japan during July 2000 to June 2001 were examined by RT-smPCR. The positive rate was 16.4% (62 out of 377 stool samples). Norovirus, Sapovirus and astrovirus were detected in 42, 16, 4 of 60 positive samples, respectively. Coinfection was not found in these samples. Infections occurred mainly in November, December and January. The key elements of the RT-smPCR are (i) the cDNA synthesis with the Superscript RTII and random primer at 42 degrees C for 1 h, at 99 degrees C for 5 min, and (ii) single-round multiplex PCR by using Taq polymerase mixed together with a mixture of four different primer pairs (G1-SKF/G1-SKR for Norovirus genogroup I, COG2F/G2-SKR for Norovirus genogroup II, SLV5317/SLV5749 for Sapovirus, PreCAP1/82b for astrovirus). All of the four primer pairs amplify the capsid region of target viral genome, produce four size-specific amplicons of 330, 387, 434, 719 bp for Norovirus genogroup I and II, Sapovirus and astrovirus, respectively. This assay provides a more rapid and efficient way to detect these viruses from fecal samples in a single test, and also offers the potential for their molecular detection in food and environmental samples.
2012-01-01
Background Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. Methods A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. Results The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. Conclusions The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa. PMID:22682065
Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai
2012-06-10
Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Bjourson, A J; Stone, C E; Cooper, J E
1992-01-01
A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166
Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh
2015-05-01
Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.
Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z
2017-03-01
The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.
Analog bus driver and multiplexer
NASA Technical Reports Server (NTRS)
Pain, Bedabrata (Inventor); Hancock, Bruce (Inventor); Cunningham, Thomas J. (Inventor)
2012-01-01
For a source-follower signal chain, the ohmic drop in the selection switch causes unacceptable voltage offset, non-linearity, and reduced small signal gain. For an op amp signal chain, the required bias current and the output noise rises rapidly with increasing the array format due to a rapid increase in the effective capacitance caused by the Miller effect boosting up the contribution of the bus capacitance. A new switched source-follower signal chain circuit overcomes limitations of existing op-amp based or source follower based circuits used in column multiplexers and data readout. This will improve performance of CMOS imagers, and focal plane read-out integrated circuits for detectors of infrared or ultraviolet light.
Multiplex digital PCR: breaking the one target per color barrier of quantitative PCR.
Zhong, Qun; Bhattacharya, Smiti; Kotsopoulos, Steven; Olson, Jeff; Taly, Valérie; Griffiths, Andrew D; Link, Darren R; Larson, Jonathan W
2011-07-07
Quantitative polymerase chain reactions (qPCR) based on real-time PCR constitute a powerful and sensitive method for the analysis of nucleic acids. However, in qPCR, the ability to multiplex targets using differently colored fluorescent probes is typically limited to 4-fold by the spectral overlap of the fluorophores. Furthermore, multiplexing qPCR assays requires expensive instrumentation and most often lengthy assay development cycles. Digital PCR (dPCR), which is based on the amplification of single target DNA molecules in many separate reactions, is an attractive alternative to qPCR. Here we report a novel and easy method for multiplexing dPCR in picolitre droplets within emulsions-generated and read out in microfluidic devices-that takes advantage of both the very high numbers of reactions possible within emulsions (>10(6)) as well as the high likelihood that the amplification of only a single target DNA molecule will initiate within each droplet. By varying the concentration of different fluorogenic probes of the same color, it is possible to identify the different probes on the basis of fluorescence intensity. Adding multiple colors increases the number of possible reactions geometrically, rather than linearly as with qPCR. Accurate and precise copy numbers of up to sixteen per cell were measured using a model system. A 5-plex assay for spinal muscular atrophy was demonstrated with just two fluorophores to simultaneously measure the copy number of two genes (SMN1 and SMN2) and to genotype a single nucleotide polymorphism (c.815A>G, SMN1). Results of a pilot study with SMA patients are presented. This journal is © The Royal Society of Chemistry 2011
On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)
NASA Astrophysics Data System (ADS)
Persat, Alexandre; Santiago, Juan
2008-11-01
We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.
Diagnosis of duck plague in waterfowl by polymerase chain reaction
Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.
2000-01-01
A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-20
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-01-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
NASA Astrophysics Data System (ADS)
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.
Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng
2017-04-15
Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.
Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction
Chen, Xian; Gupta, Goutam; Bradbury, E. Morton
2001-01-01
Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.
Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook
2014-07-01
A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
STR-typing of ancient skeletal remains: which multiplex-PCR kit is the best?
Harder, Melanie; Renneberg, Rebecca; Meyer, Patrick; Krause-Kyora, Ben; von Wurmb-Schwark, Nicole
2012-01-01
Aim To comparatively test nine commercially available short tandem repeat (STR)-multiplex kits (PowerPlex 16, 16HS, ES, ESI17, ESX17, S5 [all Promega]; AmpFiSTR Identifiler, NGM and SEfiler [all Applied Biosystems]) for their efficiency and applicability to analyze ancient and thus highly degraded DNA samples. Methods Fifteen human skeletal remains from the late medieval age were obtained and analyzed using the nine polymerase chain reaction assays with slightly modified protocols. Data were systematically compared to find the most meaningful and sensitive assay. Results The ESI, ESX, and NGM kits showed the best overall results regarding amplification success, detection rate, identification of heterozygous alleles, sex determination, and reproducibility of the obtained data. Conclusion Since application of these three kits enables the employment of different primer sequences for all the investigated amplicons, a combined application is recommended for best possible and – most importantly – reliable genetic analysis of ancient skeletal material or otherwise highly degraded samples, eg, from forensic cases. PMID:23100203
Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H
2018-04-25
In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P
2012-05-01
A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Lee, H.K.; Flanders, D.J.
The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei
2018-06-01
The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8 copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4 copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1 copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.
Fully integrated multiplexed lab-on-a-card assay for enteric pathogens
NASA Astrophysics Data System (ADS)
Weigl, B. H.; Gerdes, J.; Tarr, P.; Yager, P.; Dillman, L.; Peck, R.; Ramachandran, S.; Lemba, M.; Kokoris, M.; Nabavi, M.; Battrell, F.; Hoekstra, D.; Klein, E. J.; Denno, D. M.
2006-01-01
Under this NIH-funded project, we are developing a lab-on-a-card platform to identify enteric bacterial pathogens in patients presenting with acute diarrhea, with special reference to infections that might be encountered in developing countries. Component functions that are integrated on this platform include on-chip immunocapture of live or whole pathogens, multiplexed nucleic acid amplification and on-chip detection, sample processing to support direct use of clinical specimens, and dry reagent storage and handling. All microfluidic functions are contained on the lab card. This new diagnostic test will be able to rapidly identify and differentiate Shigella dysenteriae serotype 1, Shigella toxin-producing Escherichia coli, E. coli 0157, Campylobacter jejuni, and Salmonella and Shigella species. This presentation will report on progress to date on sample and bacteria processing methodologies, identification and validation of capture antibodies and strategy for organism immunocapture, identification and validation of specific polymerase chain reaction (PCR) primer sequences for over 200 clinical isolates of enteric pathogens, and implementation of on-chip nucleic acid extraction for a subset of those pathogens.
Kaigala, Govind V; Hoang, Viet N; Backhouse, Christopher J
2008-07-01
Microvalves are key in realizing portable miniaturized diagnostic platforms. We present a scalable microvalve that integrates well with standard lab on a chip (LOC) implementations, yet which requires essentially no external infrastructure for its operation. This electrically controlled, phase-change microvalve is used to integrate genetic amplification and analysis via capillary electrophoresis--the basis of many diagnostics. The microvalve is actuated using a polymer (polyethylene glycol, PEG) that exhibits a large volumetric change between its solid and liquid phases. Both the phase change of the PEG and the genetic amplification via polymerase chain reaction (PCR) are thermally controlled using thin film resistive elements that are patterned using standard microfabrication methods. By contrast with many other valve technologies, these microvalves and their control interface scale down in size readily. The novelty here lies in the use of fully integrated microvalves that require only electrical connections to realize a portable and inexpensive genetic analysis platform.
The actin multigene family and livestock speciation using the polymerase chain reaction.
Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G
1998-01-01
Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.
Identification of 29 Rat Genetic Markers by Arbitrarily Primed Polymerase Chain Reaction
Canzian, Federico; Toyota, Minoru; Hosoya, Yoko; Sugimura, Takashi; Nagao, Minako
1996-01-01
The number of genetic markers for the rat is still limited, in spite of its wide use in cancer research. To facilitate accurate mapping of both established and novel rat genetic markers, we constructed a linkage map by genotyping 105 F2 rats from ACI/N (ACI) and BUF/Nac (BUF) crosses. This map consists of 120 genetic markers that had been previously reported, mainly by two research groups, but had not been integrated. To find new genetic markers, the arbitrarily primed polymerase chain reaction (AP‐PCR) was applied to detect polymorphic bands between ACI and BUF rats. After testing 56 single primers and 12 combinations of primers, we found 36 bands produced by 16 single primers and two combinations to be reliably polymorphic between ACI and BUF rats. The 36 bands were typed in the 105 F2 rats, and 29 of them could be linkage‐mapped. AP‐PCR is thus useful to detect new genetic markers in laboratory strains of rats. PMID:8698613
Amebic Liver Abscess Diagnosed by Polymerase Chain Reaction in 14 Returning Travelers
Vallois, Dorothée; Epelboin, Loïc; Touafek, Feriel; Magne, Denis; Thellier, Marc; Bricaire, François; Caumes, Eric
2012-01-01
Amebic liver abscesses (ALA) are not commonly described in travelers. The ALA diagnosis is usually based on serology and Entamoeba histolytica polymerase chain reaction (PCR) is a new tool. We retrospectively reviewed all ALA cases diagnosed by PCR on the liver abscess pus aspirate of patients admitted in French hospitals between 2007 and 2011. Fourteen cases (10 male, median age 48 years) were included. The median lag time between return and onset of symptoms was 23 days (interquartile range [IQ] 18–24). All patients had an elevated cardiopulmonary resuscitation level, and 11 had leukocytosis. The ALA was multiple in five patients, localized in the right lobe in 12, and higher than 5 cm in 11. Serology was initially negative in one patient, whereas PCR was positive. There was bacterial co-infection in one patient. The outcome was good. Liver puncture allows a rapid diagnosis of ALA with PCR and helps identify the association with a bacterial dual infection. PMID:23033402
Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.
Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi
2018-04-17
We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310
Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves
2009-01-01
Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Brault, Aaron C; Fang, Ying; Reisen, William K
2015-05-01
Following the introduction of West Nile virus into California during the summer of 2003, public health and vector control programs expanded surveillance efforts and were in need of diagnostics capable of rapid, sensitive, and specific detection of arbovirus infections of mosquitoes to inform decision support for intervention. Development of a multiplex TaqMan or real-time semiquantitative reverse transcription polymerase chain reaction (RT-PCR) assay in which three virus specific primer-probe sets were used in the same reaction is described herein for the detection of western equine encephalomyelitis, St. Louis encephalitis and West Nile viral RNA. Laboratory validation and field data from 10 transmission seasons are reported. The comparative sensitivity and specificity of this multiplex assay to singleplex RT-PCR as well as an antigen detection (rapid analyte measurement platform) and standard plaque assays indicate this assay to be rapid and useful in providing mosquito infection data to estimate outbreak risk. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.
Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing
2015-06-15
Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Typing of mutans streptococci by arbitrarily primed polymerase chain reaction.
Saarela, M; Hannula, J; Mättö, J; Asikainen, S; Alaluusua, S
1996-01-01
The discriminative power of the arbitrarily primed polymerase chain reaction (AP-PCR) in differentiating between Streptococcus mutans and Strep. sobrinus species, serotypes and clones was investigated. Mutans streptococcal isolates (12(7)) obtained from 65 individuals (1-10 isolates per individual) were AP-PCR typed separately with two random primers, OPA-05 and OPA-13. Bacterial cell lysates were used as a template in PCR reactions, which made AP-PCR easy and fast to perform. Eighty-one isolates from 19 individuals were also ribotyped to compare the discriminative ability of ribotyping and AP-PCR techniques. AP-PCR performed with the two primers differentiated between Strep. mutans and Strep. sobrinus isolates, but neither primer detected serotype-specific amplification products. OPA-05 distinguished two main AP-PCR patterns among Strep. mutans isolates and one main pattern among Strep. sobrinus isolates, whereas OPA-13 found one main AP-PCR pattern among Strep. mutans isolates and two main patterns among Strep. sobrinus isolates. Ribotyping and AP-PCR revealed 40 and 33 different types among 81 selected isolates, respectively. Both techniques detected intra-individual heterogeneity in 16 out of 19 participants. The results indicate that AP-PCR has good discriminative ability in differentiating between mutans streptococcal clones and that the technique is suitable for epidemiological studies on mutans streptococci.
Multiplex PCR assay discriminates rabbit, rat and squirrel meat in food chain.
Ahamad, Mohammad Nasir Uddin; Ali, Md Eaqub; Hossain, M A Motalib; Asing, Asing; Sultana, Sharmin; Jahurul, M H A
2017-12-01
Rabbit meat is receiving increasing attention because it contains a high level of proteins with relatively little fat. On the other hand, squirrel meat is served in upper-class meals in certain countries, so is sold at higher prices. The other side of the coin is rat meat, which has family ties with rabbit and squirrel but poses substantial threats to public health because it is a potential carrier of several zoonotic organisms. Recently, rat meat was mislabelled and sold as lamb after chemical modification. Thus, the chances of rabbit and squirrel meat substitution by rat meat cannot be ruled out. For the first time, a multiplex PCR assay was developed in Malaysia for the discriminatory identification of rat, rabbit and squirrel in the food chain. Rabbit (123 bp), rat (108 bp) and squirrel (243 bp) targets were amplified from ATP6 and cytb genes, along with a eukaryotic internal control (141bp). The products were sequenced and cross-tested against 22 species. A total of 81 reference samples and 72 meatball specimens were screened to validate the assay. Analyte stability was evaluated through boiling, autoclaving and micro-oven cooking. The tested lower limits of detection were 0.01 ng DNA for pure meat and 0.1% for meatballs.
Circulating polymerase chain reaction chips utilizing multiple-membrane activation
NASA Astrophysics Data System (ADS)
Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin
2007-02-01
This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.
2011-01-01
Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.
Phan, T G; Nguyen, T A; Yan, H; Okitsu, S; Ushijima, H
2005-06-01
A novel reverse transcription-multiplex polymerase chain reaction (RT-multiplex PCR) assay that can detect enteroviruses, hepatitis A and E viruses and influenza A virus from various hosts (avian species, human, swine and horse) was developed. The identification of that group of viruses was performed with the mixture of four pairs of published specific primers (F1 and R1, P3 and P4, 2s and 2as, MMU42 and MMU43) for amplifying viral genomes and specifically generated four different amplicon sizes of 440, 267, 146 and 219 bp for enteroviruses, hepatitis A and E viruses and influenza A virus, respectively. A total of 276 fecal specimens (previously screened for rotavirus, adenovirus, norovirus, sapovirus and astrovirus-negative) from infants and children admitted into hospital with acute gastroenteritis in Ho Chi Minh city, Vietnam during October 2002 and September 2003 were collected and further tested for the presence of those viruses by RT-multiplex PCR. Enteroviruses were identified in 27 specimens and this represented 9.8%. No hepatitis A and E viruses and influenza A virus was found among these subjects. The sensitivity and specificity of RT-multiplex PCR were also assessed and demonstrated the strong validation against RT-monoplex PCR. Taken together, the findings clearly indicated that this novel RT-multiplex PCR is a simple and potential assay for rapid, sensitive, specific and cost-effective laboratory diagnosis to investigate molecular epidemiology of acute gastroenteritis caused by enteroviruses, hepatitis A and E viruses and influenza A virus. This report is the first, to our knowledge, detecting these kinds of viruses in diarrheal feces from infants and children in Vietnam.
Zhu, Jianjie; Chen, Lanxin; Mao, Yong; Zhou, Huan
2013-01-01
Allele-specific amplification on the basis of polymerase chain reaction (PCR) has been widely used for single-nucleotide polymorphism (SNP) genotyping. However, the extraction of PCR-compatible genomic DNA from whole blood is usually required. This process is complicated and tedious, and is prone to cause cross-contamination between samples. To facilitate direct PCR amplification from whole blood without the extraction of genomic DNA, we optimized the pH value of PCR solution and the concentrations of magnesium ions and facilitator glycerol. Then, we developed multiplex allele-specific amplifications from whole blood and applied them to a case–control study. In this study, we successfully established triplex, five-plex, and eight-plex allele-specific amplifications from whole blood for determining the distribution of genotypes and alleles of 14 polymorphisms in 97 gastric cancer patients and 141 healthy controls. Statistical analysis results showed significant association of SNPs rs9344, rs1799931, and rs1800629 with the risk of gastric cancer. This method is accurate, time-saving, cost-effective, and easy-to-do, especially suitable for clinical prediction of disease susceptibility. PMID:23072573
Davoudi, Arash; Seighalani, Ramin; Aleyasin, Seyed Ahmad; Tarang, Alireza; Salehi, Abdolreza Salehi; Tahmoressi, Farideh
2012-04-01
In order to establish a reliable non-invasive method for sex determination in a bovine fetus in a routine setting, the possibility of identifying specific sequence in the fetal X and Y-chromosomes has been evaluated in maternal plasma using conventional multiplex polymerase chain reaction (PCR) analysis. The aim of this study was to provide a rapid and reliable method for sexing bovine fetuses. In this experimental study, peripheral blood samples were taken from 38 pregnant heifers with 8 to 38 weeks of gestation. DNA template was extracted by phenol-chloroform method from 350 µl maternal plasma. Two primer pairs for bovine amelogenin gene (bAML) and BC1.2 were used to amplify fragments from X and Y chromosomes. A multiplex PCR reaction has been optimized for amplification of 467 bp and 341 bp fragments from X and Y bAML gene and a 190 bp fragment from BC1.2 related to Y chromosome. The 467 bp fragment was observed in all 38 samples. Both 341 and 190 bp fragments were detected only in 24 plasma samples from male calves. The sensitivity and specificity of test were 100% with no false negative or false positive results. The results showed that phenol-chloroform method is a simple and suitable method for isolation of fetal DNA in maternal plasma. The multiplex PCR method is an available non-invasive approach which is cost efficient and reliable for sexing bovine fetuses.
Sensitive detection of Treponema pallidum by using the polymerase chain reaction.
Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D
1991-01-01
We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis.
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.
Lo, Yat-Tung; Shaw, Pang-Chui
2017-10-25
Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.
Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis.
Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B
2003-01-01
To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive.
Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis
Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B
2003-01-01
Aim: To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. Methods: The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Results: Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. Conclusions: PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive. PMID:12488268
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Sim, Jeong Eun; Woo, Kwang Man; Kim, Do Hyun; Im, Sung Gap; Seo, Tae Seok
2016-04-15
A fully integrated slidable and valveless microsystem, which performs solid phase DNA extraction (SPE), micro-polymerase chain reaction (μPCR) and micro-capillary electrophoresis (μCE) coupled with a portable genetic analyser, has been developed for forensic genotyping. The use of a slidable chip, in which a 1 μL-volume of the PCR chamber was patterned at the center, does not necessitate any microvalves and tubing systems for fluidic control. The functional micro-units of SPE, μPCR, and μCE were fabricated on a single glass wafer by conventional photolithography, and the integrated microdevice consists of three layers: from top to bottom, a slidable chip, a channel wafer in which a SPE chamber, a mixing microchannel, and a CE microchannel were fabricated, and a Ti/Pt resistance temperature detector (RTD) wafer. The channel glass wafer and the RTD glass wafer were thermally bonded, and the slidable chip was placed on the designated functional unit. The entire process from the DNA extraction using whole human blood sample to identification of target Y chromosomal short tandem repeat (STR) loci was serially carried out with simply sliding the slidable chamber from one to another functional unit. Monoplex and multiplex detection of amelogenin and mini Y STR loci were successfully analysed on the integrated slidable SPE-μPCR-μCE microdevice by using 1 μL whole human blood within 60 min. The proposed advanced genetic analysis microsystem is capable of point-of-care DNA testing with sample-in-answer-out capability, more importantly, without use of complicated microvalves and microtubing systems for liquid transfer. Copyright © 2015 Elsevier B.V. All rights reserved.
Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir
2010-01-01
Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871
Mapping a multiplexed zoo of mRNA expression
Choi, Harry M. T.; Calvert, Colby R.; Husain, Naeem; Huss, David; Barsi, Julius C.; Deverman, Benjamin E.; Hunter, Ryan C.; Kato, Mihoko; Lee, S. Melanie; Abelin, Anna C. T.; Rosenthal, Adam Z.; Akbari, Omar S.; Li, Yuwei; Hay, Bruce A.; Sternberg, Paul W.; Patterson, Paul H.; Davidson, Eric H.; Mazmanian, Sarkis K.; Prober, David A.; van de Rijn, Matt; Leadbetter, Jared R.; Newman, Dianne K.; Readhead, Carol; Bronner, Marianne E.; Wold, Barbara; Lansford, Rusty; Sauka-Spengler, Tatjana; Fraser, Scott E.
2016-01-01
In situ hybridization methods are used across the biological sciences to map mRNA expression within intact specimens. Multiplexed experiments, in which multiple target mRNAs are mapped in a single sample, are essential for studying regulatory interactions, but remain cumbersome in most model organisms. Programmable in situ amplifiers based on the mechanism of hybridization chain reaction (HCR) overcome this longstanding challenge by operating independently within a sample, enabling multiplexed experiments to be performed with an experimental timeline independent of the number of target mRNAs. To assist biologists working across a broad spectrum of organisms, we demonstrate multiplexed in situ HCR in diverse imaging settings: bacteria, whole-mount nematode larvae, whole-mount fruit fly embryos, whole-mount sea urchin embryos, whole-mount zebrafish larvae, whole-mount chicken embryos, whole-mount mouse embryos and formalin-fixed paraffin-embedded human tissue sections. In addition to straightforward multiplexing, in situ HCR enables deep sample penetration, high contrast and subcellular resolution, providing an incisive tool for the study of interlaced and overlapping expression patterns, with implications for research communities across the biological sciences. PMID:27702788
Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji
2010-07-01
We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.
Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa
2017-08-01
A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.
Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong
2013-08-01
Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.
Nhantumbo, Aquino Albino; Cantarelli, Vlademir Vicente; Caireão, Juliana; Munguambe, Alcides Moniz; Comé, Charlotte Elizabeth; Pinto, Gabriela do Carmo; Zimba, Tomás Francisco; Mandomando, Inácio; Semá, Cynthia Baltazar; Dias, Cícero; Moraes, Milton Ozório; Gudo, Eduardo Samo
2015-01-01
In Sub-Saharan Africa, including Mozambique, acute bacterial meningitis (ABM) represents a main cause of childhood mortality. The burden of ABM is seriously underestimated because of the poor performance of culture sampling, the primary method of ABM surveillance in the region. Low quality cerebrospinal fluid (CSF) samples and frequent consumption of antibiotics prior to sample collection lead to a high rate of false-negative results. To our knowledge, this study is the first to determine the frequency of ABM in Mozambique using real-time polymerase chain reaction (qPCR) and to compare results to those of culture sampling. Between March 2013 and March 2014, CSF samples were collected at 3 regional hospitals from patients under 5 years of age, who met World Health Organization case definition criteria for ABM. Macroscopic examination, cytochemical study, culture, and qPCR were performed on all samples. A total of 369 CSF samples were collected from children clinically suspected of ABM. qPCR showed a significantly higher detection rate of ABM-causing pathogens when compared to culture (52.3% [193/369] versus 7.3% [27/369], p = 0.000). The frequency of Streptococcus pneumoniae, Haemophilus influenzae, group B Streptococci, and Neisseria meningitidis were 32.8% (121⁄369), 12.2%, (45⁄369), 3.0% (16⁄369) and 4.3% (11⁄369), respectively, significantly higher compared to that obtained on culture (p < 0.001 for each). Our findings demonstrate that culture is less effective for the diagnosis of ABM than qPCR. The common use of culture rather than qPCR to identify ABM results in serious underestimation of the burden of the disease, and our findings strongly suggest that qPCR should be incorporated into surveillance activities for ABM. In addition, our data showed that S. pneumoniae represents the most common cause of ABM in children under 5 years of age.
Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.
Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi
2018-02-01
Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.
2000-12-01
Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less
Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.
2001-07-05
Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less
Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu
2017-08-01
Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.
Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E
2009-06-01
To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.
Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam
2017-01-01
Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-01-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David
2017-08-17
Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.
D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I
1993-01-01
The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.
High-throughput microfluidic single-cell digital polymerase chain reaction.
White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L
2013-08-06
Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.
Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki
2015-08-25
Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.
Elkins, Kelly M; Perez, Anjelica C U; Quinn, Alicia A
2017-05-01
The international prevalence of "legal high" drugs necessitates the development of a method for their detection and identification. Herein, we describe the development and validation of a tetraplex multiplex real-time polymerase chain reaction (PCR) assay used to simultaneously identify morning glory, jimson weed, Hawaiian woodrose, and marijuana detected by high-resolution melt using LCGreen Plus ® . The PCR assay was evaluated based on the following: (i) specificity and selectivity-primers were tested on DNA extracted from 30 species and simulated forensic samples, (ii) sensitivity-serial dilutions of the target DNA were prepared, and (iii) reproducibility and reliability-sample replicates were tested and remelted on different days. The assay is ideal for cases in which inexpensive assays are needed to quickly detect and identify trace biological material present on drug paraphernalia that is too compromised for botanical microscopic identification and for which analysts are unfamiliar with the morphology of the emerging "legal high" species. © 2016 American Academy of Forensic Sciences.
Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma
2007-12-01
Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.
Bai, Yalong; Song, Minghui; Cui, Yan; Shi, Chunlei; Wang, Dapeng; Paoli, George C; Shi, Xianming
2013-07-17
A method based on amino-modified silica-coated magnetic nanoparticles (ASMNPs) and polymerase chain reaction (PCR) was developed to rapidly and sensitively detect foodborne pathogens in raw milk. After optimizing parameters such as pH, temperature, and time, a trace amount of genomic DNA of pathogens could be extracted directly from complex matrices such as raw milk using ASMNPs. The magnetically separated complexes of genomic DNA and ASMNPs were directly subjected to single PCR (S-PCR) or multiplex PCR (M-PCR) to detect single or multiple pathogens from raw milk samples. Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive) were used as model organisms to artificially contaminate raw milk samples. After magnetic separation and S-PCR, the detection sensitivities were 8 CFU mL(-1) and 13 CFU mL(-1) respectively for these two types of pathogens. Furthermore, this method was successfully used to detect multiple pathogens (S. Enteritidis and L. monocytogenes) from artificially contaminated raw milk using M-PCR at sensitivities of 15 CFU mL(-1) and 25 CFU mL(-1), respectively. This method has great potential to rapidly and sensitively detect pathogens in raw milk or other complex food matrices. Copyright © 2013 Elsevier B.V. All rights reserved.
Aprea, Giuseppe; Mullan, William Michael; Murru, Nicoletta; Fitzgerald, Gerald; Buonanno, Marialuisa; Cortesi, Maria Luisa; Prencipe, Vincenza Annunziata; Migliorati, Giacomo
2017-09-30
This work investigated bacteriophage induced starter failures in artisanal buffalo Mozzarella production plants in Southern Italy. Two hundred and ten samples of whey starter cultures were screened for bacteriophage infection. Multiplex polymerase chain reaction (PCR) revealed phage infection in 28.56% of samples, all showing acidification problems during cheese making. Based on DNA sequences, bacteriophages for Lactococcus lactis (L. lactis), Lactobacillus delbruekii (L. delbruekii) and Streptococcus thermophilus (S. thermophilus) were detected. Two phages active against L. lactis, ΦApr-1 and ΦApr-2, were isolated and characterised. The genomes, approximately 31.4 kb and 31 kb for ΦApr-1 and ΦApr-2 respectively, consisted of double-stranded linear DNA with pac-type system. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS‑PAGE) showed one major structural protein of approximately 32.5 kDa and several minor proteins. This is the first report of phage isolation in buffalo milk and of the use of multiplex PCR to screen and study the diversity of phages against Lactic Acid Bacteria (LAB) strains in artisanal Water Buffalo Mozzarella starters.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR.« less
Teixeira, M M; Campaner, M; Camargo, E P
1994-01-01
To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.
Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma
2015-03-01
Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.
Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore
2013-01-01
Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.
Hwa, Hsiao-Lin; Chang, Yih-Yuan; Lee, James Chun-I; Lin, Chun-Yen; Yin, Hsiang-Yi; Tseng, Li-Hui; Su, Yi-Ning; Ko, Tsang-Ming
2012-07-01
The analysis of autosomal short tandem repeat (STR) loci is a powerful tool in forensic genetics. We developed a multiplex system in which 15 non-Combined DNA Index System autosomal STRs (D3S1744, D4S2366, D8S1110, D10S2325, D12S1090, D13S765, D14S608, Penta E, D17S1294, D18S536, D18S1270, D20S470, D21S1437, Penta D, and D22S683) could be amplified in one single polymerase chain reaction. DNA samples from 1,098 unrelated subjects of nine population groups living in Taiwan, including Taiwanese Han, indigenous Taiwanese of Taiwan Island, Tao, mainland Chinese, Filipinos, Thais, Vietnamese, Indonesians, and Caucasians, were collected and analyzed using this system. The distributions of the allelic frequencies and the forensic parameters of each population group were presented. The combined discrimination power and the combined power of exclusion were high in all population groups tested in this study. A multidimensional scaling plot of these nine population groups based on the Reynolds' genetic distances calculated from 15 autosomal STRs was constructed, and the genetic substructure in this area was presented. In conclusion, this 15 autosomal STR multiplex system provides highly informative STR data and appears useful in forensic casework and parentage testing in different populations.
Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N
2007-01-01
To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach
Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej
2017-12-01
Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (< 5 h) and fully automated procedure. However, culture technique is still needed due to the low sensitivity and the need of comprehensive susceptibility testing. Modification of primers or inclusion of additional ones may improve the performance of PCR, especially of low-virulent organisms.
Sensitive detection of Treponema pallidum by using the polymerase chain reaction.
Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D
1991-01-01
We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis. Images PMID:1993770
Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.
Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L
1990-08-01
To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.
A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control
Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen
2009-01-01
This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
O'Neill, Hugh J; Wyatt, Dorothy E; Coyle, Peter V; McCaughey, Conall; Mitchell, Frederick
2003-12-01
One hundred forty-nine specimens were tested in a LightCycler nested multiplex polymerase chain reaction (LCnmPCR) for Herpes simplex virus (HSV)1, HSV2, and VZV. Eighty-one were from genitourinary medicine (GUM) patients and the other 68 specimens were from other patients with skin lesions. The results were compared to a conventional multiplex nested PCR (nmPCR) using agarose gel electrophoresis. Twenty-five specimens were positive in both assays for HSV1 and 29 were positive for VZV. For HSV2 there were 27 positive in the LCnmPCR and 26 positive in the nmPCR assay. The melting temperatures (Tms) of each target were different with a mean of 84.75 degrees C for HSV1, 88.57 degrees C for HSV2, and 83.62 degrees C for VZV. The melting curves of positive specimens directly overlaid the melting curves of the positive controls in the assay. The LCnmPCR assay is a convenient alternative to conventional PCR using agarose gel electrophoresis. It improves specimen turnaround time by eliminating the need for gel electrophoresis, transillumination, and gel photography. It also shows increased sensitivity for HSV2 over our standard assay. This LCnmPCR reduces further the possibility of amplicon contamination with nested PCR protocols. Copyright 2003 Wiley-Liss, Inc.
Law, Dennis K S; Tsang, Raymond S W
2013-05-01
A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.
Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua
2009-03-01
A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.
Bullard, K M; Hietpas, P B; Ewing, A G
1998-01-01
Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.
Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H
2007-03-01
A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.
Mapping a multiplexed zoo of mRNA expression.
Choi, Harry M T; Calvert, Colby R; Husain, Naeem; Huss, David; Barsi, Julius C; Deverman, Benjamin E; Hunter, Ryan C; Kato, Mihoko; Lee, S Melanie; Abelin, Anna C T; Rosenthal, Adam Z; Akbari, Omar S; Li, Yuwei; Hay, Bruce A; Sternberg, Paul W; Patterson, Paul H; Davidson, Eric H; Mazmanian, Sarkis K; Prober, David A; van de Rijn, Matt; Leadbetter, Jared R; Newman, Dianne K; Readhead, Carol; Bronner, Marianne E; Wold, Barbara; Lansford, Rusty; Sauka-Spengler, Tatjana; Fraser, Scott E; Pierce, Niles A
2016-10-01
In situ hybridization methods are used across the biological sciences to map mRNA expression within intact specimens. Multiplexed experiments, in which multiple target mRNAs are mapped in a single sample, are essential for studying regulatory interactions, but remain cumbersome in most model organisms. Programmable in situ amplifiers based on the mechanism of hybridization chain reaction (HCR) overcome this longstanding challenge by operating independently within a sample, enabling multiplexed experiments to be performed with an experimental timeline independent of the number of target mRNAs. To assist biologists working across a broad spectrum of organisms, we demonstrate multiplexed in situ HCR in diverse imaging settings: bacteria, whole-mount nematode larvae, whole-mount fruit fly embryos, whole-mount sea urchin embryos, whole-mount zebrafish larvae, whole-mount chicken embryos, whole-mount mouse embryos and formalin-fixed paraffin-embedded human tissue sections. In addition to straightforward multiplexing, in situ HCR enables deep sample penetration, high contrast and subcellular resolution, providing an incisive tool for the study of interlaced and overlapping expression patterns, with implications for research communities across the biological sciences. © 2016. Published by The Company of Biologists Ltd.
Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen
2007-06-01
Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.
A New Multiplex Assay of 17 Autosomal STRs and Amelogenin for Forensic Application
Zhang, Suhua; Tian, Huaizhou; Wu, Jun; Zhao, Shumin; Li, Chengtao
2013-01-01
This paper describes a newly devised autosomal short tandem repeat (STR) multiplex polymerase chain reaction (PCR) systems for 17 autosomal loci (D1S1656, D2S441, D3S1358, D3S3045, D6S477, D7S3048, D8S1132, D10S1435, D10S1248, D11S2368, D13S325, D14S608, D15S659, D17S1290, D18S535, D19S253 and D22-GATA198B05) and Amelogenin. Primers for the loci were designed and optimized so that all of the amplicons were distributed from 50 base pairs (bp) to less than 500 bp within a five-dye chemistry design with the fifth dye reserved for the sizing standard. Strategies were developed to overcome challenges that encountered in creating the final assay. The limits of the multiplex were tested, resulting in the successful amplification of genomic DNA range from 0.25–4 ng with 30 PCR cycles. A total of 681 individuals from the Chinese Han population were studied and forensic genetic data were present. No significant deviations from Hardy–Weinberg equilibrium were observed. A total of 180 alleles were detected for the 17 autosomal STRs. The cumulative mean exclusion chance in duos (CMECD) was 0.999967, and cumulative mean exclusion chance in trios (CMECT) was 0.99999995. We conclude that the present 17plex autosomal STRs assay provides an additional powerful tool for forensic applications. PMID:23451235
Li, Jiandong; Qu, Jing; He, Chengcheng; Zhang, Shuo; Li, Chuan; Zhang, Quanfu; Liang, Mifang; Li, Dexin
2014-01-01
Background Viral hemorrhagic fevers (VHFs) are a group of animal and human illnesses that are mostly caused by several distinct families of viruses including bunyaviruses, flaviviruses, filoviruses and arenaviruses. Although specific signs and symptoms vary by the type of VHF, initial signs and symptoms are very similar. Therefore rapid immunologic and molecular tools for differential diagnosis of hemorrhagic fever viruses (HFVs) are important for effective case management and control of the spread of VHFs. Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assay is one of the reliable and desirable methods for specific detection and quantification of virus load. Multiplex PCR assay has the potential to produce considerable savings in time and resources in the laboratory detection. Results Primers/probe sets were designed based on appropriate specific genes for each of 28 HFVs which nearly covered all the HFVs, and identified with good specificity and sensitivity using monoplex assays. Seven groups of multiplex one-step real-time qRT-PCR assays in a universal experimental system were then developed by combining all primers/probe sets into 4-plex reactions and evaluated with serial dilutions of synthesized viral RNAs. For all the multiplex assays, no cross-reactivity with other HFVs was observed, and the limits of detection were mainly between 45 and 150 copies/PCR. The reproducibility was satisfactory, since the coefficient of variation of Ct values were all less than 5% in each dilution of synthesized viral RNAs for both intra-assays and inter-assays. Evaluation of the method with available clinical serum samples collected from HFRS patients, SFTS patients and Dengue fever patients showed high sensitivity and specificity of the related multiplex assays on the clinical specimens. Conclusions Overall, the comprehensive multiplex one-step real-time qRT-PCR assays were established in this study, and proved to be specific, sensitive
NASA Astrophysics Data System (ADS)
Mates, J. A. B.; Becker, D. T.; Bennett, D. A.; Dober, B. J.; Gard, J. D.; Hays-Wehle, J. P.; Fowler, J. W.; Hilton, G. C.; Reintsema, C. D.; Schmidt, D. R.; Swetz, D. S.; Vale, L. R.; Ullom, J. N.
2017-08-01
The number of elements in most cryogenic sensor arrays is limited by the technology available to multiplex signals from the arrays into a smaller number of wires and readout amplifiers. The largest demonstrated arrays of transition-edge sensor (TES) microcalorimeters contain roughly 250 detectors and use time-division multiplexing with Superconducting Quantum Interference Devices (SQUIDs). The bandwidth limits of this technology constrain the number of sensors per amplifier chain, a quantity known as the multiplexing factor, to several 10s. With microwave SQUID multiplexing, we can expand the readout bandwidth and enable much larger multiplexing factors. While microwave SQUID multiplexing of TES microcalorimeters has been previously demonstrated with small numbers of detectors, we now present a fully scalable demonstration in which 128 TES detectors are read out on a single pair of coaxial cables.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee
2017-08-15
The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Koppelman, M H G M; van Swieten, P; Cuijpers, H T M
2011-06-01
European regulations require testing of manufacturing plasma for parvovirus B19 (B19) DNA to limit the load of this virus to a maximum acceptable level of 10 IU/µL. To meet this requirement, most manufacturers introduced a test algorithm to identify and eliminate high-load donations before making large manufacturing pools of plasma units. Sanquin screens all donations using a commercial assay from Roche and an in-house assay. Between 2006 and 2009, 6.2 million donations were screened using two different polymerase chain reaction (PCR) assays targeting B19 DNA. Donations with B19 DNA loads of greater than 1 × 10(6) IU/mL showing significant differences in viral load between the two assays were further analyzed by sequencing analysis. A total of 396 donations with B19 DNA loads of greater than 1 × 10(6) IU/mL were identified. Fifteen samples (3.8%) had discordant test results; 10 samples (2.5%) were underquantified by the Roche assay, two samples (0.5%) were underquantified by the in-house assay, and three samples (0.8%) were not detected by the Roche assay. Sequencing analysis revealed mismatches in primer and probe-binding regions. Phylogenetic analysis showed that 12 samples were B19 Genotype 1. The three samples not detected by the Roche assay were B19 Genotype 2. This study shows that 3.8% of the viremic B19 DNA-positive donations are not quantified correctly by the Roche or in-house B19 DNA assays. B19 Genotype 1 isolates showing incorrect test results are more common than B19 Genotype 2 or 3 isolates. Newly designed B19 PCR assays for blood screening should preferably have multiplexed formats targeting multiple regions of the B19 genome. © 2010 American Association of Blood Banks.
Basic quantitative polymerase chain reaction using real-time fluorescence measurements.
Ares, Manuel
2014-10-01
This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.
Yu, Qian; Huang, Fei; Zhang, Meilin; Ji, Haiying; Wu, Shenchao; Zhao, Ying; Zhang, Chunyan; Wu, Jiong; Wang, Beili; Pan, Baisheng; Zhang, Xin; Guo, Wei
2017-08-01
To explore the possible diagnostic value of liquid biopsy, two multiplex panels using picoliter-droplet digital polymerase chain reaction (ddPCR) were established to quantitatively assess the epidermal growth factor receptor (EGFR) mutations in cell‑free DNA (cfDNA) extracted from the plasma of advanced non‑small cell lung cancer (NSCLC) patients. Plasma samples derived from 22 patients with stage IIIB/IV NSCLC harboring EGFR mutations in matched tumor tissues confirmed by amplification refractory mutation system (ARMS) analysis were subjected to two multiplex ddPCR panels to assess the abundance of tyrosine kinase inhibitor (TKI) ‑sensitive (19DEL, L858R) and TKI‑resistant (T790 M) mutations. Fluctuations in EGFR mutant abundance were monitored by either of the multiplex ddPCR panels for three patients undergoing EGFR‑TKI treatment, with serial plasma sample collections over 2 months. The multiplex ddPCR panels applied to plasma cfDNA from advanced NSCLC patients achieved a total concordance rate of 80% with the EGFR mutation profiles obtained by ARMS from matched biopsy tumor specimens (90% for 19DEL, 95% for L858R, 95% for T790M, respectively) and revealed additional mutant alleles in two subjects. The respective sensitivity and specificity were 90.9 and 88.9% for 19DEL, 87.5 and 100% for L858R, 100 and 93.8% for T790M. The fluctuations of EGFR mutant abundance in serial plasma cfDNA were in accordance with the changes in tumor size as assessed by imaging scans. The authors demonstrated the utility of multiplex ddPCR panels with ultra‑sensitivity for quantitative analysis of EGFR mutations in plasma cfDNA and obtained promising usefulness in EGFR‑TKI decision‑making for advanced NSCLC patients.
Yu, Qian; Huang, Fei; Zhang, Meilin; Ji, Haiying; Wu, Shenchao; Zhao, Ying; Zhang, Chunyan; Wu, Jiong; Wang, Beili; Pan, Baisheng; Zhang, Xin; Guo, Wei
2017-01-01
To explore the possible diagnostic value of liquid biopsy, two multiplex panels using picoliter-droplet digital polymerase chain reaction (ddPCR) were established to quantitatively assess the epidermal growth factor receptor (EGFR) mutations in cell-free DNA (cfDNA) extracted from the plasma of advanced non-small cell lung cancer (NSCLC) patients. Plasma samples derived from 22 patients with stage IIIB/IV NSCLC harboring EGFR mutations in matched tumor tissues confirmed by amplification refractory mutation system (ARMS) analysis were subjected to two multiplex ddPCR panels to assess the abundance of tyrosine kinase inhibitor (TKI) -sensitive (19DEL, L858R) and TKI-resistant (T790 M) mutations. Fluctuations in EGFR mutant abundance were monitored by either of the multiplex ddPCR panels for three patients undergoing EGFR-TKI treatment, with serial plasma sample collections over 2 months. The multiplex ddPCR panels applied to plasma cfDNA from advanced NSCLC patients achieved a total concordance rate of 80% with the EGFR mutation profiles obtained by ARMS from matched biopsy tumor specimens (90% for 19DEL, 95% for L858R, 95% for T790M, respectively) and revealed additional mutant alleles in two subjects. The respective sensitivity and specificity were 90.9 and 88.9% for 19DEL, 87.5 and 100% for L858R, 100 and 93.8% for T790M. The fluctuations of EGFR mutant abundance in serial plasma cfDNA were in accordance with the changes in tumor size as assessed by imaging scans. The authors demonstrated the utility of multiplex ddPCR panels with ultra-sensitivity for quantitative analysis of EGFR mutations in plasma cfDNA and obtained promising usefulness in EGFR-TKI decision-making for advanced NSCLC patients. PMID:29067441
Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S
2014-10-01
While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.
Drali, Rezak; Boutellis, Amina; Raoult, Didier; Rolain, Jean Marc; Brouqui, Philippe
2013-01-01
Body louse or head louse? Once removed from their environment, body and head lice are indistinguishable. Neither the morphological criteria used since the mid-18th century nor the various genetic studies conducted since the advent of molecular biology tools have allowed body lice and head lice to be differentiated. In this work, using a portion of the Phum_PHUM540560 gene from the body louse, we aimed to develop a multiplex real-time polymerase chain reaction (PCR) assay to differentiate between body and head lice in a single reaction. A total of 142 human lice were collected from mono-infested hosts from 13 countries on five continents. We first identified the louse clade using a cytochrome b (CYTB) PCR sequence alignment. We then aligned a fragment of the Phum_PHUM540560 gene amplified from head and body lice to design-specific TaqMan(©) FAM- and VIC-labeled probes. All the analyzed lice were Clade A lice. A total of 22 polymorphisms between the body and head lice were characterized. The multiplex real-time PCR analysis enabled the body and head lice to be distinguished in two hours. This method is simple, with 100% specificity and sensitivity. We confirmed that the Phum_PHUM540560 gene is a useful genetic marker for the study of lice.
Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon
2015-03-01
A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhang, Peipei; Liu, Yan; Liu, Wenwen; Massart, Sebastien; Wang, Xifeng
2017-11-01
Wheat dwarf virus (WDV), barley yellow striate mosaic virus (BYSMV), rice black-streaked dwarf virus (RBSDV) and northern cereal mosaic virus (NCMV) are four viruses infecting wheat and causing similar symptoms. In this paper, a multiplex reverse transcription polymerase chain reaction (m-RT-PCR) method has been developed for the simultaneous detection and discrimination of these viruses. The protocol uses specific primer set for each virus and produces four distinct fragments (273, 565, 783 and 1296bp), detecting the presence of RBSDV, BYSMV, WDV and NCMV, respectively. Annealing temperature, concentrations of dNTP, Taq polymerase and Mg 2+ were optimized for the m-RT-PCR. The detection limit of the assay was up to 10 -2 dilution. The amplification specificity of these primers was tested against a range of field samples from different regions of China, where RBSDV, BYSMV, WDV have been detected. This study fulfills the need for a rapid and specific wheat virus detection that also has the potential for investigating the epidemiology of these new viral diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†
Wickner, William; Kornberg, Arthur
1973-01-01
DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C
2002-01-01
Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources
Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam
2017-01-01
Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.
Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W
2014-12-01
We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Optimization of ultrahigh-speed multiplex PCR for forensic analysis.
Gibson-Daw, Georgiana; Crenshaw, Karin; McCord, Bruce
2018-01-01
In this paper, we demonstrate the design and optimization of an ultrafast PCR amplification technique, used with a seven-locus multiplex that is compatible with conventional capillary electrophoresis systems as well as newer microfluidic chip devices. The procedure involves the use of a high-speed polymerase and a rapid cycling protocol to permit multiplex PCR amplification of forensic short tandem repeat loci in 6.5 min. We describe the selection and optimization of master mix reagents such as enzyme, buffer, MgCl 2 , and dNTPs, as well as primer ratios, total volume, and cycle conditions, in order to get the best profile in the shortest time possible. Sensitivity and reproducibility studies are also described. The amplification process utilizes a small high-speed thermocycler and compact laptop, making it portable and potentially useful for rapid, inexpensive on-site genotyping. The seven loci of the multiplex were taken from conventional STR genotyping kits and selected for their size and lack of overlap. Analysis was performed using conventional capillary electrophoresis and microfluidics with fluorescent detection. Overall, this technique provides a more rapid method for rapid sample screening of suspects and victims. Graphical abstract Rapid amplification of forensic DNA using high speed thermal cycling followed by capillary or microfluidic electrophoresis.
Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A
2017-12-01
A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).
Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S; Pedersen, Susanne K; Leekitcharoenphon, Pimlapas; Hansen, Inge M; Guerra, Beatriz; Malorny, Burkhard; Borowiak, Maria; Hammerl, Jens Andre; Battisti, Antonio; Franco, Alessia; Alba, Patricia; Perrin-Guyomard, Agnes; Granier, Sophie A; De Frutos Escobar, Cristina; Malhotra-Kumar, Surbhi; Villa, Laura; Carattoli, Alessandra; Hendriksen, Rene S
2018-01-01
Background and aim Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriaceae was developed for surveillance or research purposes. Methods: We designed four new primer pairs to amplify mcr-1, mcr-2, mcr-3 and mcr-4 gene products and used the originally described primers for mcr-5 to obtain a stepwise separation of ca 200 bp between amplicons. The primer pairs and amplification conditions allow for single or multiple detection of all currently described mcr genes and their variants present in Enterobacteriaceae. The protocol was validated testing 49 European Escherichia coli and Salmonella isolates of animal origin. Results: Multiplex PCR results in bovine and porcine isolates from Spain, Germany, France and Italy showed full concordance with whole genome sequence data. The method was able to detect mcr-1, mcr-3 and mcr-4 as singletons or in different combinations as they were present in the test isolates. One new mcr-4 variant, mcr-4.3, was also identified. Conclusions: This method allows rapid identification of mcr-positive bacteria and overcomes the challenges of phenotypic detection of colistin resistance. The multiplex PCR should be particularly interesting in settings or laboratories with limited resources for performing genetic analysis as it provides information on the mechanism of colistin resistance without requiring genome sequencing. PMID:29439754
Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector
Kabadi, Ami M.; Ousterout, David G.; Hilton, Isaac B.; Gersbach, Charles A.
2014-01-01
Engineered DNA-binding proteins that manipulate the human genome and transcriptome have enabled rapid advances in biomedical research. In particular, the RNA-guided CRISPR/Cas9 system has recently been engineered to create site-specific double-strand breaks for genome editing or to direct targeted transcriptional regulation. A unique capability of the CRISPR/Cas9 system is multiplex genome engineering by delivering a single Cas9 enzyme and two or more single guide RNAs (sgRNAs) targeted to distinct genomic sites. This approach can be used to simultaneously create multiple DNA breaks or to target multiple transcriptional activators to a single promoter for synergistic enhancement of gene induction. To address the need for uniform and sustained delivery of multiplex CRISPR/Cas9-based genome engineering tools, we developed a single lentiviral system to express a Cas9 variant, a reporter gene and up to four sgRNAs from independent RNA polymerase III promoters that are incorporated into the vector by a convenient Golden Gate cloning method. Each sgRNA is efficiently expressed and can mediate multiplex gene editing and sustained transcriptional activation in immortalized and primary human cells. This delivery system will be significant to enabling the potential of CRISPR/Cas9-based multiplex genome engineering in diverse cell types. PMID:25122746
Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W
2017-04-01
There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.
Lefeuvre, P; Hoareau, M; Delatte, H; Reynaud, B; Lett, J-M
2007-09-01
Tomato yellow leaf curl virus (TYLCV) is one of the causal agents of tomato yellow leaf curl disease (TYLCD) and can cause up to 100% yield losses in tomato fields. As TYLCV continues to spread, many isolates have been described in different parts of the world. Recently two closely related but distinct TYLCV clades, called TYLCV and TYLCV-Mld, have been identified. Isolates from those two clades differ mainly in the nucleotide sequences of their replication associated protein genes but do not display significantly different symptomatology. In order to improve monitoring of the rapidly expanding worldwide TYLCD epidemic, a multiplex polymerase chain reaction assay (mPCR) was developed. A set of three primers were designed to detect and characterize the TYLCV and TYLCV-Mld clade isolates. The specificity and sensitivity of the mPCR were validated on TYLCV infected tomato plants and Bemisia tabaci whiteflies. Being cheap, fast and highly sensitive this new diagnostic tool should greatly simplify efforts to trace the global spread of TYLCV.
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Fitting, Catherine; Parlato, Marianna; Adib-Conquy, Minou; Memain, Nathalie; Philippart, François; Misset, Benoît; Monchi, Mehran; Cavaillon, Jean-Marc; Adrie, Christophe
2012-01-01
Fast and reliable assays to precisely define the nature of the infectious agents causing sepsis are eagerly anticipated. New molecular biology techniques are now available to define the presence of bacterial or fungal DNA within the bloodstream of sepsis patients. We have used a new technique (VYOO®) that allows the enrichment of microbial DNA before a multiplex polymerase chain reaction (PCR) for pathogen detection provided by SIRS-Lab (Jena, Germany). We analyzed 72 sepsis patients and 14 non-infectious systemic inflammatory response syndrome (SIRS) patients. Among the sepsis patients, 20 had a positive blood culture and 35 had a positive microbiology in other biological samples. Of these, 51.4% were positive using the VYOO® test. Among the sepsis patients with a negative microbiology and the non-infectious SIRS, 29.4% and 14.2% were positive with the VYOO® test, respectively. The concordance in bacterial identification between microbiology and the VYOO® test was 46.2%. This study demonstrates that these new technologies offer great hopes, but improvements are still needed.
Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.
Frank, K B; Cheng, Y C
1986-02-05
Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.
Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw
2011-05-01
A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)
Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon
2015-03-07
We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).
Ambroise, Jérôme; Butoescu, Valentina; Robert, Annie; Tombal, Bertrand; Gala, Jean-Luc
2015-06-25
Single Nucleotide Polymorphisms (SNPs) identified in Genome Wide Association Studies (GWAS) have generally moderate association with related complex diseases. Accordingly, Multilocus Genetic Risk Scores (MGRSs) have been computed in previous studies in order to assess the cumulative association of multiple SNPs. When several SNPs have to be genotyped for each patient, using successive uniplex pyrosequencing reactions increases analytical reagent expenses and Turnaround Time (TAT). While a set of several pyrosequencing primers could theoretically be used to analyze multiplex amplicons, this would generate overlapping primer-specific pyro-signals that are visually uninterpretable. In the current study, two multiplex assays were developed consisting of a quadruplex (n=4) and a quintuplex (n=5) polymerase chain reaction (PCR) each followed by multiplex pyrosequencing analysis. The aim was to reliably but rapidly genotype a set of prostate cancer-related SNPs (n=9). The nucleotide dispensation order was selected using SENATOR software. Multiplex pyro-signals were analyzed using the new AdvISER-MH-PYRO software based on a sparse representation of the signal. Using uniplex assays as gold standard, the concordance between multiplex and uniplex assays was assessed on DNA extracted from patient blood samples (n = 10). All genotypes (n=90) generated with the quadruplex and the quintuplex pyroquencing assays were perfectly (100 %) concordant with uniplex pyrosequencing. Using multiplex genotyping approach for analyzing a set of 90 patients allowed reducing TAT by approximately 75 % (i.e., from 2025 to 470 min) while reducing reagent consumption and cost by approximately 70 % (i.e., from ~229 US$ /patient to ~64 US$ /patient). This combination of quadruplex and quintuplex pyrosequencing and PCR assays enabled to reduce the amount of DNA required for multi-SNP analysis, and to lower the global TAT and costs of SNP genotyping while providing results as reliable as uniplex
Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.
Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R
2005-01-01
A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.
Brzezinski, Jennifer L
2006-01-01
The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.
Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna
2016-05-01
Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.
Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F
1996-05-01
Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.
Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu
2018-01-01
Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844
Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin
2013-09-15
We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.
Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T
2017-01-01
Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.
USDA-ARS?s Scientific Manuscript database
This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...
Four-channel magnetic resonance imaging receiver using frequency domain multiplexing.
He, Wang; Qin, Xu; Jiejing, Ren; Gengying, Li
2007-01-01
An alternative technique that uses frequency domain multiplexing to acquire phased array magnetic resonance images is discussed in detail. The proposed method has advantages over traditional independent receiver chains in that it utilizes an analog-to-digital converter and a single-chip multicarrier receiver with high performance to reduce the size and cost of the phased array receiver system. A practical four-channel digital receiver using frequency domain multiplexing was implemented and verified on a home-built 0.3 T magnetic resonance imaging system. The experimental results confirmed that the cross talk between each channel was below -60 dB, the phase fluctuations were about 1 degrees , and there was no obvious signal-to-noise ratio degradation. It is demonstrated that the frequency domain multiplexing is a valuable and economical technique, particularly for array coil systems where the multichannel receiver is indispensable and dynamic range is not a critical problem.
Detection of the aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction.
Pollard, D R; Johnson, W M; Lior, H; Tyler, S D; Rozee, K R
1990-01-01
Synthetic oligonucleotide primers were used in a polymerase chain reaction (PCR) technique to detect the gene for aerolysin in strains of Aeromonas hydrophila and to screen for identical genes in A. caviae, A. sobria, and A. veronii isolated from patients with diarrheal disease. Primers targeted a 209-bp fragment of the aer gene coding for the beta-hemolysin and detected template DNA only in the PCR using nucleic acid (NA) from hemolytic strains of A. hydrophila which were also cytotoxic to Vero and CHO cells and enterotoxic in suckling-mouse assays. PCR amplification of NA from hemolytic A. sobria or nonhemolytic A. hydrophila and A. caviae strains was consistently negative. Primer specificity was determined in the PCR by using NA extracted from 56 strains of bacteria, including hemolytic Escherichia coli and Listeria monocytogenes as well as several recognized enteric pathogens defined in terms of their toxigenicity. The detection limit for the aerolysin gene by PCR amplification was 1 ng of total NA. The PCR clearly identified aerolysin-producing strains of A. hydrophila and may have application as a species-specific virulence test because other hemolytic Aeromonas species tested were negative. Images PMID:2254423
Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T
2016-06-01
We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Background: Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor. PMID:29279831
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
An, S F; Fleming, K A
1991-11-01
A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.
Sharma, Shashi; Tandel, Kundan; Danwe, Surabhi; Bhatt, Puneet; Dash, P K; Ranjan, Praveer; Rathi, K R; Gupta, Rajiv Mohan; Parida, M M
2018-03-01
Four antigenically different dengue virus serotypes (DENV-1, DENV-2, DENV-3 and DENV-4) are known to cause infections in humans. Some of these are known to cause more severe disease than the others. Chances for developing Dengue hemorrhagic fever-dengue shock syndrome (DHF-DSS) increases significantly with history of previous infection with one of the four serotypes. Therefore, early diagnosis, serotyping and providing early warning of dengue fever epidemics to concerned authorities becomes very important for better patient outcome and to curb the rapid spread in the community. During the 2014 outbreak, a total of 100 samples from suspected cases of dengue were collected. NS1 antigen based rapid test was used for serological diagnosis. Dengue complex one step reverse transcription-polymerase chain reaction was performed to look for presence of viral RNA. Single tube multiplex RT-PCR was also performed to look for infecting serotype. CDC Dengue Multiplex Real Time PCR assay was performed for rapid diagnosis and simultaneous serotyping of the dengue virus. Out of the 100 samples screened, 69 were found to be positive by NS1Ag Rapid test. 34 samples were found positive by dengue consensus RT-PCR assay. 22 samples were found to be positive by single tube Dengue multiplex RT-PCR assay. Serotype DEN-2 was present in maximum numbers followed by DEN-3. 44 samples were found positive by DENV CDC Multiplex Real time PCR assay. DEN-2 was found in maximum numbers followed by DEN-1. Dengue remains to be an important health problem in India and across the globe. Few serotypes of dengue are more dangerous than the others. Rapid diagnosis and serotyping remains the key for better patient management and prevention of disease spreading in the community. Highly sensitive, specific and rapid CDC real time RT-PCR assay was found to be most promising tool among all available molecular diagnostic methods. This will serve a rapid and reliable simultaneous dengue virus detection as well
2010-01-01
Introduction Delays in adequate antimicrobial treatment contribute to high cost and mortality in sepsis. Polymerase chain reaction (PCR) assays are used alongside conventional cultures to accelerate the identification of microorganisms. We analyze the impact on medical outcomes and healthcare costs if improved adequacy of antimicrobial therapy is achieved by providing immediate coverage after positive PCR reports. Methods A mathematical prediction model describes the impact of PCR-based rapid adjustment of antimicrobial treatment. The model is applied to predict cost and medical outcomes for 221 sepsis episodes of 189 post-surgical and intensive care unit (ICU) sepsis patients with available PCR data from a prospective, observational trial of a multiplex PCR assay in five hospitals. While this trial demonstrated reduction of inadequate treatment days, data on outcomes associated with reduced inadequate initial antimicrobial treatment had to be obtained from two other, bigger, studies which involved 1,147 (thereof 316 inadequately treated) medical or surgical ICU patients. Our results are reported with the (5% to 95%) percentile ranges from Monte Carlo simulation in which the input parameters were randomly and independently varied according to their statistical characterization in the three underlying studies. The model allows predictions also for different patient groups or PCR assays. Results A total of 13.1% of PCR tests enabled earlier adequate treatment. We predict that cost for PCR testing (300 €/test) can be fully recovered for patients above 717 € (605 € to 1,710 €) daily treatment cost. A 2.6% (2.0 to 3.2%) absolute reduction of mortality is expected. Cost per incremental survivor calculates to 11,477 € (9,321 € to 14,977 €) and incremental cost-effectiveness ratio to 3,107 € (2,523 € to 4,055 €) per quality-adjusted life-year. Generally, for ICU patients with >25% incidence of inadequate empiric antimicrobial treatment, and at least 15
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana
2014-01-01
Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.
Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana
2014-01-01
Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791
Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A
2000-01-01
Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.
Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine
2018-04-04
Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.
Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito
2018-05-15
A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.
2001-01-01
Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675
Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer
2018-01-18
Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples
Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca
2015-01-01
Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713
McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y
2014-04-01
A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Maleewong, Wanchai
2009-01-01
We developed a single-step real-time fluorescence resonance energy transfer (FRET) multiplex polymerase chain reaction (PCR) merged with melting curve analysis for the detection of Wuchereria bancrofti and Brugia malayi DNA in blood-fed mosquitoes. Real-time FRET multiplex PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two families of repeated DNA elements: the 188 bp SspI repeated sequence, specific to W. bancrofti, and the 153-bp HhaI repeated sequence, specific to the genus Brugia and two pairs of specific fluorophore-labeled probes. Both W. bancrofti and B. malayi can be differentially detected in infected vectors by this process through their different fluorescence channel and melting temperatures. The assay could distinguish both human filarial DNAs in infected vectors from the DNAs of Dirofilaria immitis- and Plasmodium falciparum-infected human red blood cells and noninfected mosquitoes and human leukocytes. The technique showed 100% sensitivity and specificity and offers a rapid and reliable procedure for differentially identifying lymphatic filariasis. The introduced real-time FRET multiplex PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The test can be used to screen mosquito vectors in endemic areas and therefore should be a useful diagnostic tool for the evaluation of infection rate of the mosquito populations and for xenomonitoring in the community after eradication programs such as the Global Program to Eliminate Lymphatic Filariasis.
2016-01-01
Multiplex polymerase chain reaction (PCR) has been widely utilized for high-throughput pathogen identification. Often, a dye is used to intercalate the amplified DNA fragments, and identifications of the pathogens are carried out by DNA melting curve analysis or gel electrophoresis. Integrating DNA amplification and identification is a logic path toward maximizing the benefit of multiplex PCR. Although PCR and gel electrophoresis have been integrated, replenishing the gels after each run is tedious and time-consuming. In this technical note, we develop an approach to address this issue. We perform multiplex PCR inside a capillary, transfer the amplified fragments to a bare narrow capillary, and measure their lengths online using bare narrow capillary–hydrodynamic chromatography (BaNC-HDC), a new technique recently developed in our laboratory for free-solution DNA separation. To intercalate the DNA with YOYO-1 (a fluorescent dye) for BaNC-HDC, we flush the capillary column with a YOYO-1 solution; positively charged YOYO-1 is adsorbed (or charged) onto the negatively charged capillary wall. As DNA molecules are driven down the column for separation, they react with the YOYO-1 stored on the capillary wall and are online-intercalated with the dye. With a single YOYO-1 charging, the column can be used for more than 40 runs, although the fluorescence signal intensities of the DNA peaks decrease gradually. Although the dye-DNA intercalation occurs during the separation, it does not affect the retention times, separation efficiencies, or resolutions. PMID:25555111
Pankhurst, Louise; Macfarlane-Smith, Louissa; Buchanan, James; Anson, Luke; Davies, Kerrie; O'Connor, Lily; Ashwin, Helen; Pike, Graham; Dingle, Kate E; Peto, Timothy Ea; Wordsworth, Sarah; Walker, A Sarah; Wilcox, Mark H; Crook, Derrick W
2014-08-01
Every year approximately 5000-9000 patients are admitted to a hospital with diarrhoea, which in up to 90% of cases has a non-infectious cause. As a result, single rooms are 'blocked' by patients with non-infectious diarrhoea, while patients with infectious diarrhoea are still in open bays because of a lack of free side rooms. A rapid test for differentiating infectious from non-infectious diarrhoea could be very beneficial for patients. To evaluate MassCode multiplex polymerase chain reaction (PCR) for the simultaneous diagnosis of multiple enteropathogens directly from stool, in terms of sensitivity/specificity to detect four common important enteropathogens: Clostridium difficile, Campylobacter spp., Salmonella spp. and norovirus. A retrospective study of fixed numbers of samples positive for C. difficile (n = 200), Campylobacter spp. (n = 200), Salmonella spp. (n = 100) and norovirus (n = 200) plus samples negative for all these pathogens (n = 300). Samples were sourced from NHS microbiology laboratories in Oxford and Leeds where initial diagnostic testing was performed according to Public Health England methodology. Researchers carrying out MassCode assays were blind to this information. A questionnaire survey, examining current practice for infection control teams and microbiology laboratories managing infectious diarrhoea, was also carried out. MassCode assays were carried out at Oxford University Hospitals NHS Trust. Further multiplex assays, carried out using Luminex, were run on the same set of samples at Leeds Teaching Hospitals NHS Trust. The questionnaire was completed by various NHS trusts. Sensitivity and specificity to detect C. difficile, Campylobacter spp., Salmonella spp., and norovirus. Nucleic acids were extracted from 948 clinical samples using an optimised protocol (200 Campylobacter spp., 199 C. difficile, 60 S. enterica, 199 norovirus and 295 negative samples; some samples contained more than one pathogen). Using the Mass
Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun
2012-06-01
A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.
Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T
2002-03-01
Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.
2008-01-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M
2008-09-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J
2005-01-01
To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.
Dynamical Interplay between Awareness and Epidemic Spreading in Multiplex Networks
NASA Astrophysics Data System (ADS)
Granell, Clara; Gómez, Sergio; Arenas, Alex
2013-09-01
We present the analysis of the interrelation between two processes accounting for the spreading of an epidemic, and the information awareness to prevent its infection, on top of multiplex networks. This scenario is representative of an epidemic process spreading on a network of persistent real contacts, and a cyclic information awareness process diffusing in the network of virtual social contacts between the same individuals. The topology corresponds to a multiplex network where two diffusive processes are interacting affecting each other. The analysis using a microscopic Markov chain approach reveals the phase diagram of the incidence of the epidemics and allows us to capture the evolution of the epidemic threshold depending on the topological structure of the multiplex and the interrelation with the awareness process. Interestingly, the critical point for the onset of the epidemics has a critical value (metacritical point) defined by the awareness dynamics and the topology of the virtual network, from which the onset increases and the epidemics incidence decreases.
Dynamical interplay between awareness and epidemic spreading in multiplex networks.
Granell, Clara; Gómez, Sergio; Arenas, Alex
2013-09-20
We present the analysis of the interrelation between two processes accounting for the spreading of an epidemic, and the information awareness to prevent its infection, on top of multiplex networks. This scenario is representative of an epidemic process spreading on a network of persistent real contacts, and a cyclic information awareness process diffusing in the network of virtual social contacts between the same individuals. The topology corresponds to a multiplex network where two diffusive processes are interacting affecting each other. The analysis using a microscopic Markov chain approach reveals the phase diagram of the incidence of the epidemics and allows us to capture the evolution of the epidemic threshold depending on the topological structure of the multiplex and the interrelation with the awareness process. Interestingly, the critical point for the onset of the epidemics has a critical value (metacritical point) defined by the awareness dynamics and the topology of the virtual network, from which the onset increases and the epidemics incidence decreases.
Xu, Qing; Zhu, Yazhen; Bai, Yali; Wei, Xiumin; Zheng, Xirun; Mao, Mao; Zheng, Guangjuan
2015-01-01
Background Two types of epidermal growth factor receptor (EGFR) mutations in exon 19 and exon 21 (ex19del and L858R) are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M) has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR)-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR) method in detecting the three EGFR mutations in patients with lung cancer. Methods Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR. Results The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect patient samples that the qPCR method failed to detect. About 49% of this patient cohort had EGFR mutations (L858R, 15.4%; ex19del, 29.5%; T790M, 6.4%). Two patients with the ex19del mutation also had a naïve T790M mutation. Conclusion These data suggest that the ddPCR method could be useful in the personalized treatment of patients with lung cancer. PMID:26124670
Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon
2010-09-01
This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights
Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum.
Tan, Ching Giap; Ideris, Aini; Omar, Abdul R; Yii, Chen Pei; Kleven, Stanley H
2014-09-02
The present study was based on the reverse transcription polymerase chain reaction (RT-PCR) of the 16S ribosomal nucleic acid (rRNA) of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20-25 h at 37 °C, 22-25 h at 16 °C, and 23-27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h). The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.
Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M
2011-04-01
Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.
Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P
2010-11-01
Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.
Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.
Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca
2015-03-01
Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.
McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.
2014-01-01
A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178
The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...
USDA-ARS?s Scientific Manuscript database
Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...
Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A
2014-02-01
Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.
Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S
2012-02-01
Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.
Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.
Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A
2008-04-01
To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.
Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong
2011-01-01
Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.
Golbang, N; Burnie, J P; Matthews, R C
1999-01-01
AIM: To develop a polymerase chain reaction enzyme immunoassay (PCR-EIA) to measure levels of circulating aspergillus DNA in invasive aspergillosis caused by Aspergillus fumigatus. METHODS: The PCR reaction was based on primers from the 18s rRNA gene. Binding of the product to a streptavidin coated microtitration plate was mediated by a biotinylated capture probe. The product was digoxigenylated during PCR and this was the tag to which antibody was bound in the subsequent EIA. RESULTS: The optical density (OD) endpoint was < 0.1 in 10 sera from neutropenic patients with no evidence of invasive aspergillosis, and in 10 sera from nonneutropenic patients with bacterial pneumonia (group 1). The OD from five of 12 patients with allergic bronchopulmonary aspergillosis (ABPA) (group 2), three with an aspergilloma (group 3), and five with possible invasive aspergillosis (group 4) was > or = 0.1. In 63 sera from 33 cases of proven invasive aspergillosis (group 5) an OD > or = 0.1 was achieved in 48 sera from 30 patients. The maximum OD was 0.510. The level fell in survivors and gradually rose in fatal cases. CONCLUSIONS: This assay validated the concept of diagnosing invasive aspergillosis by measuring levels of circulating fungal DNA in serum. PMID:10562808
Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana
2007-01-01
Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael
2016-12-01
This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.
Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li
2015-07-01
Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh
2016-11-01
Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016
Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh
2016-01-01
Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real
Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip
2017-01-01
Abstract Background Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. Methods We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Results Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Conclusion Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. PMID:28973672
Five years' experience of classical swine fever polymerase chain reaction ring trials in France.
Po, F; Le Dimna, M; Le Potier, M F
2011-12-01
Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.
Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping
2014-01-01
The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.
Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping
2014-01-01
The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404
Ataseven, Veysel S; Dağalp, Seval B; Güzel, Murat; Başaran, Zeynep; Tan, Mehmet T; Geraghty, Bob
2009-04-01
In this report we examined the presence of specific antibodies against equine herpesvirus type 1 (EHV-1), and equine herpesvirus type 4 (EHV-4) in several equidae, including mules, donkeys, horses. The presence of EHV-1 and EHV-4 in respiratory diseases of equids, and ability of multiplex nested polymerase chain reaction (PCR) screening in simultaneous diagnosis of horses acutely infected by EHV-1 and EHV-4 were also investigated. Sera from 504 horses, mules and donkeys sampled were tested for the presence of EHV-1 and EHV-4 specific antibodies. Blood samples taken from 21 symptomatic horses and nasal swabs taken from 40 symptomatic horses were tested for the presence of EHV-1 and EHV-4 by a multiplex nested PCR. A total of 14.3% (3/21) of buffy coat samples and 32.5% (13/40) nasal swab samples were found to contain EHV-1 DNA, while 19% (4/21) buffy coat samples and 22.5% (9/40) nasal swab samples were found to be positive for EHV-4 DNA. By species, 14.5% of horses, 37.2% of mules and 24.2% of donkeys tested were EHV-1 seropositive. EHV-4 specific antibodies were detected in 237 (81.7%) of 290 horse sera tested. Results from this investigation demonstrate that EHV-1 and EHV-4 are prevalent throughout the equid population, and that donkeys and mules might also represent an important source of infection for other equids. We also showed that the multiplex nested PCR assay might be useful for diagnosis of mixed respiratory infections in horses due to EHV-1 and EHV-4.
Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun
2015-09-15
During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. Copyright © 2015 Elsevier B.V. All rights reserved.
Saksono, Budi; Dewi, Beti Ernawati; Nainggolan, Leonardo; Suda, Yasuo
2015-01-01
We propose a novel method of detecting trace amounts of dengue virus (DENVs) from serum. Our method is based on the interaction between a sulfated sugar chain and a DENV surface glycoprotein. After capturing DENV with the sulfated sugar chain-immobilized gold nanoparticles (SGNPs), the resulting complex is precipitated and viral RNA content is measured using the reverse-transcription quantitative polymerase chain reaction SYBR Green I (RT-qPCR-Syb) method. Sugar chains that bind to DENVs were identified using the array-type sugar chain immobilized chip (Sugar Chip) and surface plasmon resonance (SPR) imaging. Heparin and low-molecular-weight dextran sulfate were identified as binding partners, and immobilized on gold nanoparticles to prepare 3 types of SGNPs. The capacity of these SGNPs to capture and concentrate trace amounts of DENVs was evaluated in vitro. The SGNP with greatest sensitivity was tested using clinical samples in Indonesia in 2013-2014. As a result, the novel method was able to detect low concentrations of DENVs using only 6 μL of serum, with similar sensitivity to that of a Qiagen RNA extraction kit using 140 μL of serum. In addition, this method allows for multiplex-like identification of serotypes of DENVs. This feature is important for good healthcare management of DENV infection in order to safely diagnose the dangerous, highly contagious disease quickly, with high sensitivity.
Wu, Wenming; Loan, Kieu The Loan; Lee, Nae Yoon
2012-05-07
Consistent temperature control in an on-chip flow-through polymerase chain reaction (PCR) employing two or more heaters is one of the main obstacles for device miniaturization and integration when realizing micro total analysis systems (μTAS), and also leads to operational complexity. In this study, we propose a qiandu (right triangular prism)-shaped polydimethylsiloxane (PDMS) microdevice with serpentine microchannels fabricated on its slanted plane, and apply the device for an on-chip flow-through PCR employing a single heater. The inclined nature of the qiandu-shaped microdevice enables the formation of a surface temperature gradient along the slanted plane of the microdevice in a height-dependent manner by the use of a single heater, and enables liquid to traverse over wide ranges of temperatures, including the three temperature zones--denaturation, annealing, and extension temperatures--required in a typical PCR. The feasibility of the qiandu-shaped PDMS microdevice as a versatile platform for performing a flow-through PCR was examined by employing multiple templates and varying the inclination angle of the device. In addition, the potential of performing a multiplex PCR using a single qiandu-shaped PDMS microdevice was explored. A 409 bp long gene fragment effective as a marker for diagnosing lung cancer and a 230 bp long gene fragment from a plasmid vector were simultaneously amplified in less than 25 min on a single microdevice, paving the way for a microscale, multiplex PCR on a single device employing a single heater.
Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A
1994-04-01
To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease.
Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A
1994-01-01
AIMS--To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. METHODS--Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. RESULTS--There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. CONCLUSIONS--These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease. Images PMID:8027375
Detection of hepatitis "C" virus in formalin-fixed liver tissue by nested polymerase chain reaction.
Sallie, R; Rayner, A; Portmann, B; Eddleston, A L; Williams, R
1992-08-01
Interpretation of antibody to hepatitis C virus (HCV) in patients with liver disease is difficult due to false-positive reactivity in some conditions. To evaluate the feasibility of HCV in archival material, HCV was sought in formalin-fixed, paraffin-embedded liver biopsy specimens. Nested polymerase chain reaction was used to detect hepatitis C virus in formalin-fixed, paraffin-embedded liver biopsy specimens after total RNA was extracted from tissue by proteinase K digestion and phenol/chloroform purification. The relative efficiency of amplification of HCV RNA from formalin-fixed material was estimated semiquantitatively by serial dilution of cDNA synthesised from RNA extracted from fresh and formalin-fixed sections from the same liver. Although HCV RNA could be detected in formalin-fixed liver tissue by nested PCR in 5/5 cases in which HCV was detected in serum, amplification was approximately 5-fold less efficient than when HCV was amplified from fresh tissue. Nevertheless, nested PCR of HCV from formalin-fixed liver tissue represents a useful technique in addressing some important questions related to the pathogenesis of liver disease.
Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph
2013-01-01
The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993
USDA-ARS?s Scientific Manuscript database
The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...
Prenatal diagnosis using polymerase chain reaction on amniotic fluid for congenital toxoplasmosis.
Romand, S; Wallon, M; Franck, J; Thulliez, P; Peyron, F; Dumon, H
2001-02-01
To evaluate sensitivity, specificity, and predictive values of a prenatal amniotic fluid (AF) polymerase chain reaction (PCR) test for diagnosis of congenital toxoplasmosis. A multicenter prospective study was done on 271 women with proved primary Toxoplasma infection during pregnancy and who had amniocentesis for prenatal diagnosis by PCR. Live-born infants were eligible for analysis only if a serologic follow-up could assess a definitive infection status. Of the 270 evaluable cases, 75 were congenitally infected, 48 of whom had a positive PCR at prenatal diagnosis. Overall sensitivity of PCR on AF was estimated at 64% (95% confidence interval [CI] 53.1%, 74.9%), negative predictive value of 87.8% (95% CI 83.5%, 92.1%), whereas specificity and positive predictive value were 100% (95% CIs 98%, 100% and 92.3%, 100%, respectively). Among cases with congenital toxoplasmosis, there were no significant differences between those with positive or negative PCR with regard to median gestational age at maternal infection, interval between maternal infection and amniocentesis, or duration of treatment before amniocentesis. However, sensitivity of PCR was found to be significantly higher for maternal infections that occurred between 17 and 21 weeks' gestation (P <.02). A negative PCR of AF cannot rule out congenital infection. In this case, continuation of treatment with spiramycin combined with ultrasonographic follow-up and postnatal follow-up are warranted. Our results also suggest presumptive treatment combining pyrimethamine and sulfonamides in case of maternal infection occurring late in pregnancy.
Identification of duck plague virus by polymerase chain reaction
Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto
Equivalence of time-multiplexed and frequency-multiplexed signals in digital communications.
NASA Technical Reports Server (NTRS)
Timor, U.
1972-01-01
In comparing different techniques for multiplexing N binary data signals into a single channel, time-division multiplexing (TDM) is known to have a theoretic efficiency of 100 percent (neglecting sync power) and thus seems to outperform frequency-division multiplexing systems (FDM). By considering more general FDM systems, we will show that both TDM and FDM are equivalent and have an efficiency of 100 percent. The difference between the systems is in the multiplexing and demultiplexing subsystems, but not in the performance or in the generated waveforms.
Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L
2000-03-01
Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.
USDA-ARS?s Scientific Manuscript database
Polymerase chain reaction (PCR) is particularly useful for plant pathogen detection. In the present study, multiplex PCR and SYBR green real-time PCR were developed to facilitate simultaneous detection of three important rice pathogens, Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, and Bur...
Self-calibrating multiplexer circuit
Wahl, Chris P.
1997-01-01
A time domain multiplexer system with automatic determination of acceptable multiplexer output limits, error determination, or correction is comprised of a time domain multiplexer, a computer, a constant current source capable of at least three distinct current levels, and two series resistances employed for calibration and testing. A two point linear calibration curve defining acceptable multiplexer voltage limits may be defined by the computer by determining the voltage output of the multiplexer to very accurately known input signals developed from predetermined current levels across the series resistances. Drift in the multiplexer may be detected by the computer when the output voltage limits, expected during normal operation, are exceeded, or the relationship defined by the calibration curve is invalidated.
Fernández, Angel L; Varela, Eduardo; Martínez, Lucía; Martínez, Amparo; Sierra, Juan; González-Juanatey, José R; Regueiro, Benito
2010-10-01
With a novel real-time multiplex polymerase chain reaction test, the LightCycler SeptiFast® test, 25 bacterial and fungal species can be identified directly in blood. The SeptiFast® test has been used for rapid etiologic diagnosis in infectious endocarditis using blood samples but has not been evaluated directly on cardiac vegetations in patients being treated for infectious endocarditis. We prospectively analyzed 15 samples of heart valve tissue with active infectious endocarditis using the SeptiFast® test and compared the test's sensitivity with that of blood culture, valve tissue culture, and the SeptiFast® test in blood. The sensitivity of the SeptiFast test in heart valve tissue was 100%. The test results confirmed the diagnosis obtained using blood culture in 13 cases and identified the pathogen in 2 cases where blood culture tested negative. The sensitivity of the SeptiFast® test in heart valve tissue was greater than that obtained with conventional culture of vegetations or with the SeptiFast test in blood.
Halu, Arda; Mondragón, Raúl J; Panzarasa, Pietro; Bianconi, Ginestra
2013-01-01
Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.
Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2013-01-01
A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.
Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo
2011-01-03
In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.
Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş
2018-03-15
To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (p<0.0001). The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.
Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.
2004-01-01
We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Mirzoyan, R.; Cortina, J.; Lorenz, E.; Martinez, M.; Ostankov, A.; Paneque, D.
2002-10-01
Ultrafast Flash amplitude-to-digital converters (FADCs) are still very expensive. Here we propose a multiplexing scheme allowing one in common trigger mode to read out multiple signal sources by using a single FADC channel. Usual coaxial cables can be used in the multiplexer as analog signal delay elements. The limited bandwidth of the coaxial cable, depending on its type and length will set an upper limit to the number of multiplexed channels. Better bandwidth and the correspondingly higher number of multiplexed channels one can obtain when using the technique of transmission of analog signals via optical fibers. Low-cost vertical cavity surface emitting laser (VCSEL) diodes can be used as converters of fast electrical signals into near infrared light. Multiplexing can be an economically priced solution when one needs ultrafast digitization of hundreds of fast signal channels.
Multiplexity and multireciprocity in directed multiplexes.
Gemmetto, Valerio; Squartini, Tiziano; Picciolo, Francesco; Ruzzenenti, Franco; Garlaschelli, Diego
2016-10-01
Real-world multilayer networks feature nontrivial dependencies among links of different layers. Here we argue that if links are directed, then dependencies are twofold. Besides the ordinary tendency of links of different layers to align as the result of "multiplexity," there is also a tendency to antialign as a result of what we call "multireciprocity," i.e., the fact that links in one layer can be reciprocated by opposite links in a different layer. Multireciprocity generalizes the scalar definition of single-layer reciprocity to that of a square matrix involving all pairs of layers. We introduce multiplexity and multireciprocity matrices for both binary and weighted multiplexes and validate their statistical significance against maximum-entropy null models that filter out the effects of node heterogeneity. We then perform a detailed empirical analysis of the world trade multiplex (WTM), representing the import-export relationships between world countries in different commodities. We show that the WTM exhibits strong multiplexity and multireciprocity, an effect which is, however, largely encoded into the degree or strength sequences of individual layers. The residual effects are still significant and allow us to classify pairs of commodities according to their tendency to be traded together in the same direction and/or in opposite ones. We also find that the multireciprocity of the WTM is significantly lower than the usual reciprocity measured on the aggregate network. Moreover, layers with low (high) internal reciprocity are embedded within sets of layers with comparably low (high) mutual multireciprocity. This suggests that, in the WTM, reciprocity is inherent to groups of related commodities rather than to individual commodities. We discuss the implications for international trade research focusing on product taxonomies, the product space, and fitness and complexity metrics.
Trotta, Michele; Schönhuth, Susana; Pepe, Tiziana; Cortesi, M Luisa; Puyet, Antonio; Bautista, José M
2005-03-23
Mitochondrial 16S rRNA sequences from morphological validated grouper (Epinephelus aeneus, E. caninus, E. costae, and E. marginatus; Mycteroperca fusca and M. rubra), Nile perch (Lates niloticus), and wreck fish (Polyprion americanus) were used to develop an analytical system for group diagnosis based on two alternative Polymerase Chain Reaction (PCR) approaches. The first includes conventional multiplex PCR in which electrophoretic migration of different sizes of bands allowed identification of the fish species. The second approach, involving real-time PCR, produced a single amplicon from each species that showed different Tm values allowing the fish groups to be directly identified. Real-time PCR allows the quick differential diagnosis of the three groups of species and high-throughput screening of multiple samples. Neither PCR system cross-reacted with DNA samples from 41 common marketed fish species, thus conforming to standards for species validation. The use of these two PCR-based methods makes it now possible to discriminate grouper from substitute fish species.
Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.
Hamlet, Stephen M
2010-01-01
The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.
Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer
NASA Astrophysics Data System (ADS)
Madadelahi, M.; Kalan, K.; Shamloo, A.
2018-05-01
Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
2014-01-01
Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675
Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E
1999-01-01
A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.
Estes, Matthew D; Yang, Jianing; Duane, Brett; Smith, Stan; Brooks, Carla; Nordquist, Alan; Zenhausern, Frederic
2012-12-07
This study reports the design, prototyping, and assay development of multiplexed polymerase chain reaction (PCR) on a plastic microfluidic device. Amplification of 17 DNA loci is carried out directly on-chip as part of a system for continuous workflow processing from sample preparation (SP) to capillary electrophoresis (CE). For enhanced performance of on-chip PCR amplification, improved control systems have been developed making use of customized Peltier assemblies, valve actuators, software, and amplification chemistry protocols. Multiple enhancements to the microfluidic chip design have been enacted to improve the reliability of sample delivery through the various on-chip modules. This work has been enabled by the encapsulation of PCR reagents into a solid phase material through an optimized Solid Phase Encapsulating Assay Mix (SPEAM) bead-based hydrogel fabrication process. SPEAM bead technology is reliably coupled with precise microfluidic metering and dispensing for efficient amplification and subsequent DNA short tandem repeat (STR) fragment analysis. This provides a means of on-chip reagent storage suitable for microfluidic automation, with the long shelf-life necessary for point-of-care (POC) or field deployable applications. This paper reports the first high quality 17-plex forensic STR amplification from a reference sample in a microfluidic chip with preloaded solid phase reagents, that is designed for integration with up and downstream processing.
Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K
1991-10-01
Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.
Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R
2013-07-23
Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.
2012-01-01
Background In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR) targeting 16S ribosomal RNA of Entamoeba species. Methods Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR) targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences) program for Windows version 17 (SPSS, Chicago, IL, USA). Results Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426). Females (19.1%) were more commonly infected compared to males (15.9%). Comparison by age groups showed that adults (23.9%) had higher infection rates than children (15.3%). The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52) was the most common, followed by E. dispar (30.8%; 18/52) and E. moshkovskii (5.8%; 3/52). Of these, 33 (63.5%) were shown to contain only E. histolytica, 10 (19.2%) contained E. dispar and 3 (5.8%) contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5%) samples. Conclusions The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The presence of E
Horváth, Ádám; Pető, Zoltán; Urbán, Edit; Vágvölgyi, Csaba; Somogyvári, Ferenc
2013-12-23
Polymerase chain reaction (PCR)-based techniques are widely used to identify fungal and bacterial infections. There have been numerous reports of different, new, real-time PCR-based pathogen identification methods although the clinical practicability of such techniques is not yet fully clarified.The present study focuses on a novel, multiplex, real-time PCR-based pathogen identification system developed for rapid differentiation of the commonly occurring bacterial and fungal causative pathogens of bloodstream infections. A multiplex, real-time PCR approach is introduced for the detection and differentiation of fungi, Gram-positive (G+) and Gram-negative (G-) bacteria. The Gram classification is performed with the specific fluorescence resonance energy transfer (FRET) probes recommended for LightCycler capillary real-time PCR. The novelty of our system is the use of a non-specific SYBR Green dye instead of labelled anchor probes or primers, to excite the acceptor dyes on the FRET probes. In conjunction with this, the use of an intercalating dye allows the detection of fungal amplicons.With the novel pathogen detection system, fungi, G + and G- bacteria in the same reaction tube can be differentiated within an hour after the DNA preparation via the melting temperatures of the amplicons and probes in the same tube. This modified FRET technique is specific and more rapid than the gold-standard culture-based methods. The fact that fungi, G + and G- bacteria were successfully identified in the same tube within an hour after the DNA preparation permits rapid and early evidence-based management of bloodstream infections in clinical practice.
A Spread-Spectrum SQUID Multiplexer
NASA Astrophysics Data System (ADS)
Irwin, K. D.; Chaudhuri, S.; Cho, H.-M.; Dawson, C.; Kuenstner, S.; Li, D.; Titus, C. J.; Young, B. A.
2018-06-01
The transition-edge sensor (TES) is a mature, high-resolution x-ray spectrometer technology that provides a much higher efficiency than dispersive spectrometers such as gratings and crystal spectrometers. As larger arrays are developed, time-division multiplexing schemes operating at MHz frequencies are being replaced by microwave SQUID multiplexers using frequency-division multiplexing at GHz frequencies. However, the multiplexing factor achievable with microwave SQUIDs is limited by the high slew rate on the leading edge of x-ray pulses. In this paper, we propose a new multiplexing scheme for high-slew-rate TES x-ray calorimeters: the spread-spectrum SQUID multiplexer, which has the potential to enable higher multiplexing factors, especially in applications with lower photon-arrival rates.
Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong
2018-02-01
Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.
Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D
1997-01-01
To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131
Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip
2017-11-27
Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.
Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A
2002-10-01
ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.
Zhang, D F; Zhang, Q Q; Li, A H
2014-11-01
Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This m
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit
2017-01-01
To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.
Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre
2002-01-01
Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.
relA-dependent RNA polymerase activity in Escherichia coli.
Ryals, J; Bremer, H
1982-01-01
Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501
Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.
2006-01-01
Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430
Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C
2000-09-01
The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.