Science.gov

Sample records for multiplex polymerase chain

  1. Thermally multiplexed polymerase chain reaction.

    PubMed

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel. PMID:26339317

  2. Thermally multiplexed polymerase chain reaction

    PubMed Central

    Phaneuf, Christopher R.; Pak, Nikita; Saunders, D. Curtis; Holst, Gregory L.; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L.; Jerris, Robert; Forest, Craig R.

    2015-01-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously—each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel. PMID:26339317

  3. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  4. Multiplex polymerase chain reaction tests for detection of pathogens associated with gastroenteritis.

    PubMed

    Zhang, Hongwei; Morrison, Scott; Tang, Yi-Wei

    2015-06-01

    A wide range of enteric pathogens can cause infectious gastroenteritis. Conventional diagnostic algorithms are time-consuming and often lack sensitivity and specificity. Advances in molecular technology have provided new clinical diagnostic tools. Multiplex polymerase chain reaction (PCR)-based testing has been used in gastroenterology diagnostics in recent years. This article presents a review of recent laboratory-developed multiplex PCR tests and current commercial multiplex gastrointestinal pathogen tests. It focuses on two commercial syndromic multiplex tests: Luminex xTAG Gastrointestinal Pathogen Panel and BioFire FilmArray gastrointestinal test. Multiplex PCR tests have shown superior sensitivity to conventional methods for detection of most pathogens.

  5. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  6. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction.

    PubMed

    Khamlor, Trisadee; Pongpiachan, Petai; Sangsritavong, Siwat; Chokesajjawatee, Nipa

    2014-10-01

    Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR) assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP) gene and sex-determining region Y (SRY) were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99%) comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05). The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90%) as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen. PMID:25178292

  7. Multiplex nested reverse transcription-polymerase chain reaction for respiratory viruses in acute otitis media.

    PubMed

    Ishibashi, Toshio; Monobe, Hiroko; Nomura, Yuka; Shinogami, Masanobu; Yano, Jun

    2003-03-01

    Because respiratory viruses play an important role in the causation and pathogenesis of acute otitis media (AOM), determining which virus has infected a child is important with respect to vaccines and antiviral drugs. In some instances, this information might be used to prevent the occurrence of AOM. We used a rapid, economical, and sensitive diagnostic system involving a multiplex nested reverse transcription-polymerase chain reaction (RT-PCR) assay to detect various respiratory viruses in clinical specimens of middle ear fluid (MEF) from children with AOM in our hospital. Multiplex RT-PCR was completed on 40 MEF samples from 28 infants and children less than 6 years old with AOM. Viral RNA was detected in 17 MEF samples (43%). Respiratory syncytial virus type A was present in 12 samples, adenovirus in 3, rhinovirus in 2, and influenza A (H3N2) in 1. The multiplex RT-PCR assay is recommended to clinical laboratories that are considering adoption of a molecular technique for viral diagnosis.

  8. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    PubMed

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice.

  9. Genotyping by multiplex polymerase chain reaction for detection of endemic hepatitis B virus transmission.

    PubMed Central

    Repp, R; Rhiel, S; Heermann, K H; Schaefer, S; Keller, C; Ndumbe, P; Lampert, F; Gerlich, W H

    1993-01-01

    A nested polymerase chain reaction (PCR) protocol was developed for rapid genotyping of hepatitis B virus (HBV). During the first PCR round, a universal HBV primer pair was used to amplify the entire pre-S region of the HBV genome. Within the pre-S region, many nucleotide exchanges are observed. These are partly correlated to the serological hepatitis B surface antigen subtypes. Five additional subtype-specific primers were selected from that region which, together with two universal non-group-specific primers, generated specific combinations of two to four DNA fragments of defined sizes. By this approach, 55 hepatitis B surface antigen-positive patients from a pediatric oncology unit in Germany were analyzed. Fifty-four patients who had been infected within 2 years had an identical pattern in the multiplex PCR, suggesting a common source of infection and person-to-person transmission within the unit. One child who was infected 5 years later had a different PCR pattern and, therefore, must have been infected from a different source. Furthermore, 109 serum samples taken from pregnant Cameroonian women and 25 serum samples from their babies taken 6 months after birth were analyzed. In one case, mother-to-infant transmission of the virus was demonstrated. Apart from its role in epidemiological studies on HBV, multiplex PCR may also be a useful tool for rapid genetic analysis in other fields if there is a moderate degree of sequence variation which enables the design of specific primers. Images PMID:8501209

  10. An evaluation of serotyping of Avibacterium paragallinarum by use of a multiplex polymerase chain reaction.

    PubMed

    Morales-Erasto, Vladimir; Posadas-Quintana, José de Jesús; Fernández-Díaz, Manolo; Saravia, Luis E; Martínez-Castañeda, José Simón; Blackall, Patrick J; Soriano-Vargas, Edgardo

    2014-03-01

    In the present study, the ability of a recently proposed multiplex polymerase chain reaction (mPCR) to determine the serogroups (A, B, and C) of Avibacterium paragallinarum was evaluated. A total of 12 reference strains and 69 field isolates of Av. paragallinarum from Ecuador, Mexico, Panama, and Peru were included in the study. With some exceptions (which were serotyped in the current study), all of the isolates and strains had been previously examined by 2 serotyping schemes (Page and Kume) or were the formal reference strains for the schemes. Three of 6 (50%) reference strains of serogroup A, 2 (100%) of serogroup B, and 1 of 4 (25%) reference strains of serogroup C were correctly serotyped by the mPCR. With the field isolates, the mPCR correctly recognized 16 of the 17 serogroup A isolates, 10 of the 12 serogroup B isolates, and 18 of the 37 serogroup C isolates. Overall, the specificity and sensitivity of the PCR test was as follows: 82.6% and 87.3% (serogroup A), 85.7% and 71.9% (serogroup B), and 46.3% and 100% (serogroup C). The poor performance of the mPCR in terms of recognition of serogroup C isolates (low sensitivity of 46.3%) and the relatively high level of uncertainty about the accuracy of the serogroup A and B results (specificity of 87.3% and 71.9%, respectively) means that the assay cannot be recommended as a replacement for conventional serotyping. PMID:24590665

  11. Multiplex polymerase chain reaction assay developed to diagnose adult bacterial meningitis in Taiwan.

    PubMed

    Lee, Chi-Tsung; Hsiao, Kuang-Ming; Chen, Jin-Cherng; Su, Cheng-Chuan

    2015-11-01

    Acute bacterial meningitis causes high morbidity and mortality; the associated clinical symptoms often are insensitive or non-specific; and the pathogenic bacteria are geographically diverse. Clinical diagnosis requires a rapid and accurate methodology. This study aimed to develop a new multiplex polymerase chain reaction (mPCR) assay to detect simultaneously six major bacteria that cause adult bacterial meningitis in Taiwan: Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus pneumoniae, Staphylococcus aureus, Escherichia coli, and Acinetobacter baumannii. Species-specific primers for the six bacteria were developed using reference strains. The specificities of the mPCRs for these bacteria were validated, and the sensitivities were evaluated via serial dilutions. The mPCR assay specifically detected all of the six pathogens, particularly with sensitivities of 12 colony forming units (CFU)/mL, 90 CFU/mL, and 390 CFU/mL for E. coli, S. pneumoniae, and K. pneumoniae, respectively. This mPCR assay is a rapid and specific tool to detect the six major bacterial pathogens that cause acute adult meningitis in Taiwan, particularly sensitive for detecting E. coli, S. pneumoniae, and K. pneumoniae. The assay may facilitate early diagnosis and guidance for antimicrobial therapy for adult patients with this deadly disease in Taiwan. PMID:26332098

  12. Rapid discrimination of rabies viruses isolated from various host species in Brazil by multiplex reverse transcription-polymerase chain reaction.

    PubMed

    Sato, Go; Tanabe, Hitomi; Shoji, Youko; Itou, Takuya; Ito, Fumio H; Sato, Tetsuo; Sakai, Takeo

    2005-08-01

    Rabies is carried mainly by mammalian carnivores and vampire bats in Latin America. However, rabies virus (RV) has been isolated in recent years from not only vampire bats in rural areas but also from several non-vampire bat species in urban areas, respectively. Therefore, rapid molecular screening is necessary for efficient epidemiology of these RVs. In this study, we investigated the usefulness of multiplex reverse transcription-polymerase chain reaction (RT-PCR) for determining the origins of 54 RV isolates from various host species in Brazil. And to evaluate the multiplex RT-PCR as a potential diagnostic tool, we investigated the sensitivity of this method. In addition, we compared the results with a phylogenetic tree developed from sequences of the RV glycoprotein (G protein) gene. Multiplex RT-PCR products showed five different sizes of products, whereas the phylogenic tree showed six groups. Of these six groups, four corresponded with the four sizes of the multiplex RT-PCR products. The other two groups showed correspondance with another one size of the multiplex RT-PCR products, indicating that multiplex RT-PCR results reflected the lineage of the 54 isolates. This study also showed that this method can detect trace amounts of RNA. In conclusion, this multiplex RT-PCR method allows the rapid, specific, and simultaneous detection of RVs isolated from various host species in Brazil. PMID:16036175

  13. A multiplex reverse transcription-polymerase chain reaction assay for Newcastle disease virus and avian pneumovirus (Colorado strain).

    PubMed

    Ali, A; Reynolds, D L

    2000-01-01

    Newcastle disease virus (NDV) and avian pneumovirus (APV) cause Newcastle disease and rhinotracheitis respectively, in turkeys. Both of these viruses infect the respiratory system. A one-tube, multiplex, reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of both NDV and Colorado strain of APV (APV-Col) was developed and evaluated. The primers, specific for each virus, were designed from the matrix protein gene of APV-Col and the fusion protein gene of NDV to amplify products of 631 and 309 nucleotides, respectively. The multiplex RT-PCR assay, for detecting both viruses simultaneously, was compared with the single-virus RT-PCR assays for its sensitivity and specificity. The specific primers amplified products of predicted size from each virus in the multiplex as well as the single-virus RT-PCR assays. The multiplex RT-PCR assay was determined to be equivalent to the single-virus RT-PCR assays for detecting both NDV and APV-Col. This multiplex RT-PCR assay proved to be a sensitive method for the simultaneous and rapid detection of NDV and APV-Col. This assay has the potential for clinical diagnostic applications.

  14. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  15. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain. PMID:26169291

  16. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.

  17. Identification of co-occurring Branchinecta fairy shrimp species from encysted embryos using multiplex polymerase chain reaction

    USGS Publications Warehouse

    Vandergast, A.G.; Wood, D.A.; Simovich, M.; Bohonak, A.J.

    2009-01-01

    Morphological identification of many fairy shrimp species is difficult because distinguishing characters are restricted to adults. We developed two multiplex polymerase chain reaction assays that differentiate among three Branchinecta fairy shrimp with distributional overlap in southern California vernal pools. Two of the species are federally listed as threatened. Molecular identification of Branchinecta from cysts allows for species surveys to be conducted during the dry season, expanding the timeframe for population assessment and providing a less intrusive method of sampling sensitive vernal pool habitats. ?? Published 2009. This article is a US Government work and is in the public domain in the USA.

  18. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    PubMed

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  19. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    PubMed

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  20. Validation and Identification of Invasive Salmonella Serotypes in Sub-Saharan Africa by Multiplex Polymerase Chain Reaction.

    PubMed

    Al-Emran, Hassan M; Krumkamp, Ralf; Dekker, Denise Myriam; Eibach, Daniel; Aaby, Peter; Adu-Sarkodie, Yaw; Ali, Mohammad; Rubach, Mathew P; Bjerregaard-Andersen, Morten; Crump, John A; Cruz Espinoza, Ligia Maria; Løfberg, Sandra Valborg; Gassama Sow, Amy; Hertz, Julian T; Im, Justin; Jaeger, Anna; Kabore, Leon Parfait; Konings, Frank; Meyer, Christian G; Niang, Aissatou; Pak, Gi Deok; Panzner, Ursula; Park, Se Eun; Rabezanahary, Henintsoa; Rakotozandrindrainy, Raphaël; Raminosoa, Tiana Mirana; Razafindrabe, Tsiriniaina Jean Luco; Sampo, Emmanuel; Schütt-Gerowitt, Heidi; Sarpong, Nimako; Soura, Abdramane Bassiahi; Tall, Adama; von Kalckreuth, Vera; Wierzba, Thomas F; May, Jürgen; Marks, Florian

    2016-03-15

    Salmonella enterica serovar Typhi and nontyphoidal Salmonella (NTS) cause the majority of bloodstream infections in sub-Saharan Africa; however, serotyping is rarely performed. We validated a multiplex polymerase chain reaction (PCR) assay with the White-Kauffmann-Le Minor (WKLM) scheme of serotyping using 110 Salmonella isolates from blood cultures of febrile children in Ghana and applied the method in other Typhoid Fever Surveillance in Africa Program study sites. In Ghana, 47 (43%) S. Typhi, 36 (33%) Salmonella enterica serovar Typhimurium, 14 (13%) Salmonella enterica serovar Dublin, and 13 (12%) Salmonella enterica serovar Enteritidis were identified by both multiplex PCR and the WKLM scheme separately. Using the validated multiplex PCR assay, we identified 42 (66%) S. Typhi, 14 (22%) S. Typhimurium, 2 (3%) S. Dublin, 2 (3%) S. Enteritidis, and 4 (6%) other Salmonella species from the febrile patients in Burkina Faso, Guinea-Bissau, Madagascar, Senegal, and Tanzania. Application of this multiplex PCR assay in sub-Saharan Africa could advance the knowledge of serotype distribution of Salmonella.

  1. Validation and Identification of Invasive Salmonella Serotypes in Sub-Saharan Africa by Multiplex Polymerase Chain Reaction.

    PubMed

    Al-Emran, Hassan M; Krumkamp, Ralf; Dekker, Denise Myriam; Eibach, Daniel; Aaby, Peter; Adu-Sarkodie, Yaw; Ali, Mohammad; Rubach, Mathew P; Bjerregaard-Andersen, Morten; Crump, John A; Cruz Espinoza, Ligia Maria; Løfberg, Sandra Valborg; Gassama Sow, Amy; Hertz, Julian T; Im, Justin; Jaeger, Anna; Kabore, Leon Parfait; Konings, Frank; Meyer, Christian G; Niang, Aissatou; Pak, Gi Deok; Panzner, Ursula; Park, Se Eun; Rabezanahary, Henintsoa; Rakotozandrindrainy, Raphaël; Raminosoa, Tiana Mirana; Razafindrabe, Tsiriniaina Jean Luco; Sampo, Emmanuel; Schütt-Gerowitt, Heidi; Sarpong, Nimako; Soura, Abdramane Bassiahi; Tall, Adama; von Kalckreuth, Vera; Wierzba, Thomas F; May, Jürgen; Marks, Florian

    2016-03-15

    Salmonella enterica serovar Typhi and nontyphoidal Salmonella (NTS) cause the majority of bloodstream infections in sub-Saharan Africa; however, serotyping is rarely performed. We validated a multiplex polymerase chain reaction (PCR) assay with the White-Kauffmann-Le Minor (WKLM) scheme of serotyping using 110 Salmonella isolates from blood cultures of febrile children in Ghana and applied the method in other Typhoid Fever Surveillance in Africa Program study sites. In Ghana, 47 (43%) S. Typhi, 36 (33%) Salmonella enterica serovar Typhimurium, 14 (13%) Salmonella enterica serovar Dublin, and 13 (12%) Salmonella enterica serovar Enteritidis were identified by both multiplex PCR and the WKLM scheme separately. Using the validated multiplex PCR assay, we identified 42 (66%) S. Typhi, 14 (22%) S. Typhimurium, 2 (3%) S. Dublin, 2 (3%) S. Enteritidis, and 4 (6%) other Salmonella species from the febrile patients in Burkina Faso, Guinea-Bissau, Madagascar, Senegal, and Tanzania. Application of this multiplex PCR assay in sub-Saharan Africa could advance the knowledge of serotype distribution of Salmonella. PMID:26933026

  2. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    PubMed Central

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  3. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  4. A novel multiplexing, polymerase chain reaction-based assay for the analysis of chromosome 18q status in colorectal cancer.

    PubMed

    Erill, Nadina; Colomer, Anna; Calvo, Miquel; Vidal, August; Román, Ruth; Verdú, Montse; Cordón-Cardó, Carlos; Puig, Xavier

    2005-10-01

    Chromosome 18q allelic loss has been reported to have prognostic significance in stage II colorectal carcinoma. We have developed a fluorescent multiplex polymerase chain reaction assay to analyze five microsatellite markers (D18S55, D18S58, D18S61, D18S64, and D18S69) for allelic loss at the long arm of chromosome 18. Amplicon detection and evaluation was accomplished by capillary electrophoresis using an ABI 310 genetic analyzer. Robustness of the assay when performed on DNA extracted from formalin-fixed, paraffin-embedded tissue sections was confirmed by analyzing its repeatability and reproducibility. Allelic loss was assessed in 61 stage II colorectal tumors and was detected in 58% (31 of 53) of tumors not showing instability. As part of the study, results of 207 previous polymerase chain reaction/polyacrylamide-based assays were re-evaluated by two independent observers to determine the degree of concordance of visual evaluation. In the case of stage II colorectal tumors, when electropherogram results were compared with those obtained from visual evaluation of the same markers after polyacrylamide gel electrophoresis, discrepancies between observers were detected in 16.4% of determinations. In conclusion, we have developed a robust and reliable assay for multiplexed loss of heterozygosity determination that improves assessment of chromosome 18q allelic loss in colorectal tumors processed as routine formalin-fixed, paraffin-embedded specimens.

  5. A novel multiplexing, polymerase chain reaction-based assay for the analysis of chromosome 18q status in colorectal cancer.

    PubMed

    Erill, Nadina; Colomer, Anna; Calvo, Miquel; Vidal, August; Román, Ruth; Verdú, Montse; Cordón-Cardó, Carlos; Puig, Xavier

    2005-10-01

    Chromosome 18q allelic loss has been reported to have prognostic significance in stage II colorectal carcinoma. We have developed a fluorescent multiplex polymerase chain reaction assay to analyze five microsatellite markers (D18S55, D18S58, D18S61, D18S64, and D18S69) for allelic loss at the long arm of chromosome 18. Amplicon detection and evaluation was accomplished by capillary electrophoresis using an ABI 310 genetic analyzer. Robustness of the assay when performed on DNA extracted from formalin-fixed, paraffin-embedded tissue sections was confirmed by analyzing its repeatability and reproducibility. Allelic loss was assessed in 61 stage II colorectal tumors and was detected in 58% (31 of 53) of tumors not showing instability. As part of the study, results of 207 previous polymerase chain reaction/polyacrylamide-based assays were re-evaluated by two independent observers to determine the degree of concordance of visual evaluation. In the case of stage II colorectal tumors, when electropherogram results were compared with those obtained from visual evaluation of the same markers after polyacrylamide gel electrophoresis, discrepancies between observers were detected in 16.4% of determinations. In conclusion, we have developed a robust and reliable assay for multiplexed loss of heterozygosity determination that improves assessment of chromosome 18q allelic loss in colorectal tumors processed as routine formalin-fixed, paraffin-embedded specimens. PMID:16237217

  6. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  7. Identification of Listeria Spp. Strains Isolated from Meat Products and Meat Production Plants by Multiplex Polymerase Chain Reaction

    PubMed Central

    Mazza, Roberta; Ladu, Daniela; Putzolu, Miriam; Consolati, Simonetta Gianna; Mazzette, Rina

    2015-01-01

    Listeriosis is a foodborne disease caused by Listeria monocytogenes and is considered as a serious health problem, due to the severity of symptoms and the high mortality rate. Recently, other Listeria species have been associated with disease in human and animals. The aim of this study was to develop a multiplex polymerase chain reaction (PCR) in order to simultaneously detect six Listeria species (L. grayi, L. welshimeri, L. ivanovii, L. monocytogenes, L. seeligeri, L. innocua) in a single reaction. One hundred eighteen Listeria spp. strains, isolated from meat products (sausages) and processing plants (surfaces in contact and not in contact with meat), were included in the study. All the strains were submitted to biochemical identification using the API Listeria system. A multiplex PCR was developed with the aim to identify the six species of Listeria. PCR allowed to uniquely identify strains that had expressed a doubtful profile with API Listeria The results suggest that the multiplex PCR could represent a rapid and sensitive screening test, a reliable method for the detection of all Listeria species, both in contaminated food and in clinical samples, and also a tool that could be used for epidemiological purposes in food-borne outbreaks. A further application could be the development of a PCR that can be directly applied to the pre-enrichment broth. PMID:27800422

  8. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  9. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination. PMID:24793853

  10. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction.

    PubMed

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y

    2002-05-01

    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  11. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    PubMed Central

    Mishra, Raghavendra Prasad; Jain, Udit; Singh, Rakesh Kumar

    2016-01-01

    Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC) in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR). Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  12. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    PubMed Central

    Mishra, Raghavendra Prasad; Jain, Udit; Singh, Rakesh Kumar

    2016-01-01

    Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC) in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR). Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health. PMID:27651685

  13. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    PubMed Central

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL–1 of Dickeya sp. genomic DNA, and down to 0.1 ng µL–1 of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 101 cfu mL–1 plant extract (102 cfu g–1 plant tissue), 102 cfu mL–1 plant extract (103 cfu g–1 plant tissue), 103 cfu mL–1 plant extract (104 cfu g–1 plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland. PMID:25506085

  14. One-step multiplex reverse transcription-polymerase chain reaction for the simultaneous detection of three rice viruses.

    PubMed

    Cho, Sang-Yun; Jeong, Rae-Dong; Yoon, Young-Nam; Lee, Su-Heon; Shin, Dong Bum; Kang, Hang-Won; Lee, Bong Choon

    2013-11-01

    Rice stripe virus (RSV), Rice black-streaked dwarf virus (RBSDV), and Rice dwarf virus (RDV) are major rice-infecting viruses in Korea that can cause serious crop losses. A one-step multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for the simultaneous detection of these rice viruses. Three sets of specific primers targeted to the capsid protein coding genes of RSV, RBSDV, and RDV were used to amplify fragments that were 703 bp, 485 bp, and 252 bp, respectively. The one-step mRT-PCR assay proved to be a sensitive and rapid method for detecting the three rice viruses. This method could be used to facilitate better control of rice viruses.

  15. Simultaneous detection of seven sexually transmitted agents in human immunodeficiency virus-infected Brazilian women by multiplex polymerase chain reaction.

    PubMed

    Souza, Raquel P; de Abreu, André L P; Ferreira, Érika C; Rocha-Brischiliari, Sheila C; de B Carvalho, Maria D; Pelloso, Sandra M; Bonini, Marcelo G; Gimenes, Fabrícia; Consolaro, Marcia E L

    2013-12-01

    We determined the prevalence of seven clinically important pathogens that cause sexually transmitted infections (STIs) (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, herpes simplex virus 1 [HSV-1], HSV-2, and Treponema pallidum), by using a multiplex polymerase chain reaction (M-PCR) in samples from Brazilian woman infected with human immunodeficiency virus 1 (HIV-1) and uninfected Brazilian women (controls). The M-PCR assay identified all STIs tested for and surprisingly, occurred association between the control and STIs. This association was probably caused by excellent HIV infection control and regular monitoring in these women established by public health strategies in Brazil to combat HIV/acquired immunodeficiency syndrome. Studies using this M-PCR in different populations may help to better elucidate the roles of STIs in several conditions.

  16. Simultaneous detection of seven sexually transmitted agents in human immunodeficiency virus-infected Brazilian women by multiplex polymerase chain reaction.

    PubMed

    Souza, Raquel P; de Abreu, André L P; Ferreira, Érika C; Rocha-Brischiliari, Sheila C; de B Carvalho, Maria D; Pelloso, Sandra M; Bonini, Marcelo G; Gimenes, Fabrícia; Consolaro, Marcia E L

    2013-12-01

    We determined the prevalence of seven clinically important pathogens that cause sexually transmitted infections (STIs) (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, herpes simplex virus 1 [HSV-1], HSV-2, and Treponema pallidum), by using a multiplex polymerase chain reaction (M-PCR) in samples from Brazilian woman infected with human immunodeficiency virus 1 (HIV-1) and uninfected Brazilian women (controls). The M-PCR assay identified all STIs tested for and surprisingly, occurred association between the control and STIs. This association was probably caused by excellent HIV infection control and regular monitoring in these women established by public health strategies in Brazil to combat HIV/acquired immunodeficiency syndrome. Studies using this M-PCR in different populations may help to better elucidate the roles of STIs in several conditions. PMID:24080632

  17. Comparison between Culture and a Multiplex Quantitative Real-Time Polymerase Chain Reaction Assay Detecting Ureaplasma urealyticum and U. parvum

    PubMed Central

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR. PMID:25047036

  18. Rapid detection of mecA and nuc genes in staphylococci by real-time multiplex polymerase chain reaction.

    PubMed

    Costa, Anna-Maria; Kay, Ian; Palladino, Silvano

    2005-01-01

    A multiplex real-time polymerase chain reaction (RT-PCR) targeting the mecA and nuc genes was developed for the detection of methicillin resistance and identification of Staphylococcus aureus. Novel mecA and nuc primers and fluorescence resonance energy transfer hybridization probes specific for the mecA and nuc genes were evaluated. The assay was performed using the LightCycler system (Roche Molecular Biochemicals, Mannheim, Germany) and evaluated against the traditional gel-based multiplex PCR (PCR-gel) method currently used at Royal Perth Hospital. Clinical isolates (n = 222) and isolates from a culture collection library (n = 206) were tested by both assays in parallel. The RT-PCR assay was 100% sensitive and specific for the detection of methicillin resistance and for the identification of S. aureus when compared with the PCR-gel assay. Results from the RT-PCR assay showed 5 isolates with lower efficiency fluorescence curves for the nuc gene PCR fragment. DNA sequencing showed mutations within the region of the probe-binding sites compared with the reference strain. The results of the RT-PCR assay were available within 2 h. This rapid mecA/nuc RT-PCR assay is a suitable and practical tool for the routine detection of methicillin resistance and identification of S. aureus, which can be easily incorporated into the diagnostic molecular microbiology laboratory work flow.

  19. Development of a multiplex polymerase chain reaction method for simultaneous detection of eight events of genetically modified maize.

    PubMed

    Onishi, Mari; Matsuoka, Takeshi; Kodama, Takashi; Kashiwaba, Koichi; Futo, Satoshi; Akiyama, Hiroshi; Maitani, Tamio; Furui, Satoshi; Oguchi, Taichi; Hino, Akihiro

    2005-12-14

    In this study, we developed a novel multiplex polymerase chain reaction (PCR) method for simultaneous detection of up to eight events of genetically modified (GM) maize within a single reaction. The eight detection primer pairs designed to be construct specific for eight respective GM events (i.e., Bt11, Event176, GA21, MON810, MON863, NK603, T25, and TC1507) and a primer pair for an endogenous reference gene, ssIIb, were included in the nonaplex(9plex) PCR system, and its amplified products could be distinguished by agarose gel and capillary electrophoreses based on their different lengths. The optimal condition enabled us to reliably amplify two fragments corresponding to a construct specific sequence and a taxon specific ssIIb in each of the eight events of GM maize and all of nine fragments in a simulated GM mixture containing as little as 0.25% (w/w) each of eight events of GM maize. These results indicate that this multiplex PCR method could be an effective qualitative detection method for screening GM maize. PMID:16332120

  20. Detection of Salmonella enterica serovar Dublin by polymerase chain reaction in multiplex format.

    PubMed

    Zhai, Ligong; Kong, Xiaohan; Lu, Zhaoxin; Lv, Fengxia; Zhang, Chong; Bie, Xiaomei

    2014-05-01

    S. Dublin has caused widespread concerns in cattle produce. Using a comparative genomic method, two specific targets like SeD_A1118 and SeD_A2283 for S. Dublin identification were firstly obtained. An efficient multiplex PCR for S. Dublin detection based on the two novel specific genes and invA was therefore developed.

  1. Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction.

    PubMed

    Ewers, Christa; Janssen, Traute; Kiessling, Sabine; Philipp, Hans-C; Wieler, Lothar H

    2005-06-01

    Based on recently published prevalence data of virulence-associated factors in avian pathogenic Escherichia coli (APEC) and their roles in the pathogenesis of colibacillosis, we developed a multiplex polymerase chain reaction (PCR) as a molecular tool supplementing current diagnostic schemes that mainly rely on serological examination of strains isolated from diseased birds. Multiple isolates of E. coli from clinical cases of colibacillosis known to possess different combinations of eight genes were used as sources of template DNA to develop the multiplex PCR protocol, targeting genes for P-fimbriae (papC), aerobactin (iucD), iron-repressible protein (irp2), temperature-sensitive hemagglutinin (tsh), vacuolating autotransporter toxin (vat), enteroaggregative toxin (astA), increased serum survival protein (iss), and colicin V plasmid operon genes (cva/cvi). In order to verify the usefulness of this diagnostic tool, E. coli strains isolated from fecal samples of clinically healthy chickens were also included in this study, as were uropathogenic (UPEC), necrotoxigenic, and diarrhegenic E. coli strains. The application of the multiplex PCR protocol to 14 E. coli strains isolated from septicemic poultry showed that these strains harbored four to eight of the genes mentioned above. In contrast, those isolates that have been shown to be nonpathogenic for 5-wk-old chickens possessed either none or, at most, three of these genes. We found only one enterohemorrhagic (EHEC), one enteropathogenic (EPEC), and two enterotoxic (ETEC) E. coli strains positive for irp2, and another two ETEC strains positive for astA. As expected, UPEC isolates yielded different combinations of the genes iss, papC, iucD, irp2, and a sequence similar to vat. However, neither the colicin V operon genes cva/cvi nor tsh were amplified in UPEC isolates. The multiplex PCR results were compared with those obtained by DNA-DNA-hybridization analyses to validate the specificity of oligonucleotide primers, and

  2. Multiplex time-reducing quantitative polymerase chain reaction assay for determination of telomere length in blood and tissue DNA.

    PubMed

    Jiao, Jingjing; Kang, Jing X; Tan, Rui; Wang, Jingdong; Zhang, Yu

    2012-04-01

    In this paper we describe a multiplex time-reducing quantitative polymerase chain reaction (qPCR) method for determination of telomere length. This multiplex qPCR assay enables two pairs of primers to simultaneously amplify telomere and single copy gene (albumin) templates, thus reducing analysis time and labor compared with the previously established singleplex assay. The chemical composition of the master mix and primers for the telomere and albumin were systematically optimized. The thermal cycling program was designed to ensure complete separation of the melting processes of the telomere and albumin. Semi-log standard curves of DNA concentration versus cycle threshold (C (t)) were established, with a linear relationship over an 81-fold DNA concentration range. The well-performed intra-assay (RSD range 2.4-4.7%) and inter-assay (RSD range: 3.1-5.0%) reproducibility were demonstrated to ensure measurement stability. Using wild-type, Lewis lung carcinoma and H22 liver carcinoma C57BL/6 mouse models, significantly different telomere lengths among different DNA samples were not observed in wild-type mice. However, the relative telomere lengths of the tumor DNA in the two strains of tumor-bearing mice were significantly shorter than the lengths in the surrounding non-tumor DNA of tumor-bearing mice and the tissue DNA of wild-type mice. These results suggest that the shortening of telomere lengths may be regarded as an important indicator for cancer control and prevention. Quantification of telomere lengths was further confirmed by the traditional Southern blotting method. This method could be successfully used to reduce the time needed for rapid, precise measurement of telomere lengths in biological samples.

  3. The genotyping of infectious bronchitis virus in Taiwan by a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction.

    PubMed

    Huang, Shr-Wei; Ho, Chia-Fang; Chan, Kun-Wei; Cheng, Min-Chung; Shien, Jui-Hung; Liu, Hung-Jen; Wang, Chi-Young

    2014-11-01

    Infectious bronchitis virus (IBV; Avian coronavirus) causes acute respiratory and reproductive and urogenital diseases in chickens. Following sequence alignment of IBV strains, a combination of selective primer sets was designed to individually amplify the IBV wild-type and vaccine strains using a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) approach. This system was shown to discriminate the IBV wild-type and vaccine strains. Moreover, an ARMS real-time RT-PCR (ARMS qRT-PCR) was combined with a high-resolution analysis (HRMA) to establish a melt curve analysis program. The specificity of the ARMS RT-PCR and the ARMS qRT-PCR was verified using unrelated avian viruses. Different melting temperatures and distinct normalized and shifted melting curve patterns for the IBV Mass, IBV H120, IBV TW-I, and IBV TW-II strains were detected. The new assays were used on samples of lung and trachea as well as virus from allantoic fluid and cell culture. In addition to being able to detect the presence of IBV vaccine and wild-type strains by ARMS RT-PCR, the IBV Mass, IBV H120, IBV TW-I, and IBV TW-II strains were distinguished using ARMS qRT-PCR by their melting temperatures and by HRMA. These approaches have acceptable sensitivities and specificities and therefore should be able to serve as options when carrying out differential diagnosis of IBV in Taiwan and China.

  4. Viral detection using a multiplex polymerase chain reaction-based assay in outpatients with upper respiratory infection.

    PubMed

    Leekha, Surbhi; Irish, Cole L; Schneider, Susan K; Fernholz, Emily C; Espy, Mark J; Cunningham, Scott A; Patel, Robin; Juhn, Young J; Pritt, Bobbi; Smith, Thomas F; Sampathkumar, Priya

    2013-02-01

    We evaluated a commercial multiplex polymerase chain reaction (PCR) assay in a cross-sectional study among 81 adult and pediatric outpatients-40 cases with upper respiratory infection symptoms and 41 asymptomatic controls-from February to April 2008. Two specimens (throat swab and nasal swab) from each participant were tested using the EraGen MultiCode-PLx Respiratory Virus Panel that detects 17 viral targets. Throat swabs were also tested for Group A Streptococcus (GAS) by PCR. Respiratory viruses were detected in 22/40 (55%) cases and in 3/41 (7%) controls (P < 0.001). GAS was detected in 10 (25%) cases; GAS and respiratory virus co-infection was found in 4 (10%). Agreement between nasal and throat swabs for viral detection was 69% in cases and 95% in controls. Of 22 cases with a detectable virus, 12 (54%) were picked up by only 1 (throat or nasal) specimen, and the detection rate was increased by combining results of nasal and throat swab testing. PMID:23182565

  5. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    PubMed

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  6. Detection of target site resistance to pyrethroids and organophosphates in the horn fly using multiplex polymerase chain reaction.

    PubMed

    Foil, L D; Guerrero, F D; Bendele, K G

    2010-09-01

    The horn fly, Haematobia irritans L., is an obligate blood-feeding fly and the primary insect pest parasitizing cattle in the United States. Pesticide resistance has become a substantial problem for cattle producers, and although several mechanisms of resistance are possible, target site resistance is the most important mechanism preventing control of this fly in the United States and possibly other countries. We developed a multiplex polymerase chain reaction assay to detect the known target site, pyrethroid resistance-associated mutation in the horn fly and a recently reported G262A mutation in the horn fly acetylcholinesterase, the target site for organophosphates. As expected, the pyrethroid resistance target site mutation was found in fly populations from Texas, Louisiana, Washington, Georgia, Mexico, and Brazil. This mutation was found to have a gender bias as it was more prevalent in females than males. The G262A acetylcholinesterase mutation was found in Texas, Louisiana, Washington, Georgia, and Mexico, but not Brazil. There was no gender bias in the occurrence of this mutation, and there was no correlation between the occurrence of the kdr and the G262A mutations. Unlike the case with the pyrethroid target site mutation, the presence of G262A did not appear to exclusively provide the level of resistance required to account for bioassay results. It is likely an additional mutation(s) occurs in the target site and/or a metabolic resistance mechanism exists in organophosphate-resistant horn fly populations.

  7. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    PubMed Central

    Han, Jae-Ik; Chang, Dong-Woo

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 µL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  8. Autonomous detection of aerosolized biological agents by multiplexed immunoassay with polymerase chain reaction confirmation.

    PubMed

    Hindson, Benjamin J; McBride, Mary T; Makarewicz, Anthony J; Henderer, Bruce D; Setlur, Ujwal S; Smith, Sally M; Gutierrez, Dora M; Metz, Thomas R; Nasarabadi, Shanavaz L; Venkateswaran, Kodumudi S; Farrow, Stephen W; Colston, Bill W; Dzenitis, John M

    2005-01-01

    The autonomous pathogen detection system (APDS) is an automated, podium-sized instrument that continuously monitors the air for biological threat agents (bacteria, viruses, and toxins). The system has been developed to warn of a biological attack in critical or high-traffic facilities and at special events. The APDS performs continuous aerosol collection, sample preparation, and detection using multiplexed immunoassay followed by confirmatory PCR using real-time TaqMan assays. We have integrated completely reusable flow-through devices that perform DNA extraction and PCR amplification. The fully integrated system was challenged with aerosolized Bacillus anthracis, Yersinia pestis, Bacillus globigii, and botulinum toxoid. By coupling highly selective antibody- and DNA-based assays, the probability of an APDS reporting a false positive is extremely low. PMID:15623307

  9. Randomized Trial of Rapid Multiplex Polymerase Chain Reaction–Based Blood Culture Identification and Susceptibility Testing

    PubMed Central

    Banerjee, Ritu; Teng, Christine B.; Cunningham, Scott A.; Ihde, Sherry M.; Steckelberg, James M.; Moriarty, James P.; Shah, Nilay D.; Mandrekar, Jayawant N.; Patel, Robin

    2015-01-01

    Background. The value of rapid, panel-based molecular diagnostics for positive blood culture bottles (BCBs) has not been rigorously assessed. We performed a prospective randomized controlled trial evaluating outcomes associated with rapid multiplex PCR (rmPCR) detection of bacteria, fungi, and resistance genes directly from positive BCBs. Methods. A total of 617 patients with positive BCBs underwent stratified randomization into 3 arms: standard BCB processing (control, n = 207), rmPCR reported with templated comments (rmPCR, n = 198), or rmPCR reported with templated comments and real-time audit and feedback of antimicrobial orders by an antimicrobial stewardship team (rmPCR/AS, n = 212). The primary outcome was antimicrobial therapy duration. Secondary outcomes were time to antimicrobial de-escalation or escalation, length of stay (LOS), mortality, and cost. Results. Time from BCB Gram stain to microorganism identification was shorter in the intervention group (1.3 hours) vs control (22.3 hours) (P < .001). Compared to the control group, both intervention groups had decreased broad-spectrum piperacillin-tazobactam (control 56 hours, rmPCR 44 hours, rmPCR/AS 45 hours; P = .01) and increased narrow-spectrum β-lactam (control 42 hours, rmPCR 71 hours, rmPCR/AS 85 hours; P = .04) use, and less treatment of contaminants (control 25%, rmPCR 11%, rmPCR/AS 8%; P = .015). Time from Gram stain to appropriate antimicrobial de-escalation or escalation was shortest in the rmPCR/AS group (de-escalation: rmPCR/AS 21 hours, control 34 hours, rmPCR 38 hours, P < .001; escalation: rmPCR/AS 5 hours, control 24 hours, rmPCR 6 hours, P = .04). Groups did not differ in mortality, LOS, or cost. Conclusions. rmPCR reported with templated comments reduced treatment of contaminants and use of broad-spectrum antimicrobials. Addition of antimicrobial stewardship enhanced antimicrobial de-escalation. Clinical Trials Registration. NCT01898208. PMID:26197846

  10. Detection and genotyping of vancomycin-resistant Enterococcus spp. by multiplex polymerase chain reaction in Korean aquatic environmental samples.

    PubMed

    Nam, Sehee; Kim, Min-jeong; Park, Chulmin; Park, Jong-Geun; Maeng, Pil Jae; Lee, Gyu-Cheol

    2013-07-01

    The distribution characteristics of Enterococcus spp., which are indicators of fecal pollution, were investigated at 33 sites within the 3 major water systems of Korea. Enterococci were detected at concentrations ranging from 1 to 37 CFU/100mL in 41 of 132 samples (31.1%) from the 3 major water systems. The overall average detected concentration was 1.2 CFU/100mL, while the average concentration for all detection sites was 5.3 CFU/100mL. After optimized multiplex polymerase chain reaction (PCR) was performed with newly developed VanA, VanB, VanC-1, and VanC-2/3 primers, concentrations of vancomycin-resistant Enterococcus spp. (VRE) ranging from 1 to 23 CFU/100mL were detected in 17 of 132 samples (12.9%). Of 216 individual enterococcal colonies, 64 (29.6%) displayed the VanC genotype. The results of a susceptibility test to vancomycin showed that the range of the minimal inhibitory concentration (MIC), an indicator of bacterial resistance, was 4 to 24μg/mL, with the average MIC at 9.2±4.5μg/mL. Of the bacterial isolates, 1 colony with the VanC-1 genotype was identified as E. gallinarum by 16S rDNA sequencing, whereas the other 63 colonies had the VanC-2/3 genotype and were identified as E. casseliflavus. Although these results imply that the major head bays of Korea are not contaminated with the highly vancomycin-resistant VanA- or VanB-type VREs, the misuse of antibiotics should be prohibited to minimize the presence of VREs and to maintain a safe water supply for protecting the health of the general population. Based on the study results, we also recommend the implementation of a continuous, broad-spectrum inspection program for Enterococcus spp. and VRE contamination in the major head bays. Furthermore, the multiplex PCR method described in this study can be used effectively for this purpose.

  11. Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

    PubMed Central

    Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

    2010-01-01

    A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

  12. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

  13. Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples.

    PubMed

    Tramuta, Clara; Lacerenza, Daniela; Zoppi, Simona; Goria, Mariella; Dondo, Alessandro; Ferroglio, Ezio; Nebbia, Patrizia; Rosati, Sergio

    2011-07-01

    The current study describes the development of a set of 5 multiplex polymerase chain reaction (mPCR) assays for the simultaneous detection of abortive infection agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mPCR1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mPCR2); Coxiella burnetii and Chlamydophila psittaci (mPCR3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mPCR4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mPCR5). The protocol was tested on different tissue samples collected from 50 aborted bovine fetuses, and it showed that out of the 50 fetuses, 7 (14%, mPCR2) were PCR-positive for N. caninum, 4 (8%, mPCR5) were PCR-positive for BVDV, and 2 (4%, mPCR4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Moreover, all multiplex PCR assays on clinical samples were compared with reference methods, obtaining a perfect accordance in all samples and confirming the validity of the set of multiplex PCR assays. The proposed set of multiplex PCR assays is, therefore, suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion.

  14. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary. PMID:19610365

  15. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.

    PubMed

    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R

    2001-06-01

    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  16. Multiplex Real-time Polymerase Chain Reaction Assays for Simultaneous Detection of Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio vulnificus

    PubMed Central

    Park, Jie Yeun; Jeon, Semi; Kim, Jun Young; Park, Misun; Kim, Seonghan

    2013-01-01

    Objectives A multiplex real-time polymerase chain reaction (RT-PCR) method was developed for the identification of three Vibrio species: Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio vulnificus. Methods Specific primers and probes targeting the hlyA, tlh, and vvhA genes were selected and used for multiplex real-time PCR to confirm the identification of V. cholerae, V. parahaemolyticus, and V. vulnificus, respectively. This method was applied to screen Vibrio species from environmental samples and combining it with a culture-based method, its effectiveness was evaluated in comparison with culture-based methods alone. Results Specific PCR fragments were obtained from isolates belonging to the target species, indicating a high specificity of this multiplex real-time PCR. No cross-reactivity with the assay was observed between the tested bacteria. The sensitivity of the multiplex real-time PCR was found to have a lower limit of 104 colony-forming units/reaction for all three Vibrio species. The combination strategy raised the isolation ratio of all three Vibrio species 1.26- to 2.75-fold. Conclusion This assay provides a rapid, sensitive, and specific technique to detect these three Vibrio species in the environment. PMID:24159544

  17. Systematic multiplex polymerase chain reaction and reverse transcription-polymerase chain reaction analyses of changes in copy number and expression of proto-oncogenes and tumor suppressor genes in cancer tissues and cell lines.

    PubMed

    Yamamoto, Miyako; Metoki, Rikiya; Yamamoto, Fumiichiro

    2004-10-01

    Systematic multiplex reverse transcription-polymerase chain reaction (SM RT-PCR) is distinguishable from other multiplex RT-PCR methods by (i) utilization of primers that amplify sequences that fall within a single exon of the genes, (ii) utilization of genomic DNA as a calibration standard, and (iii) optimized PCR conditions that allow amplification of bands of similar intensity using genomic DNA template. We previously developed the human experimental systems of 68 glycosyltransferase genes, 39 Hox genes, and 26 integrin subunit genes, and analyzed the expression of those genes in human adult tissues. Here we report the establishment of an SM RT-PCR system of proto-oncogenes and tumor suppressor genes and the analysis of gene expression in human cancer tissues and cell lines. We also demonstrate that the SM RT-PCR system, which was developed for cDNA expression analysis, could also be used successfully for more exquisite analysis of copy number changes in genomic DNA. We observed a decrease in band intensity of HRAS, TP73, CDKN2A, and CDKN2B genes in most of the breast and prostate cancer cell lines examined. The decrease in copy number of HRAS proto-oncogene leads us to suspect the presence of tumor suppressor genes in the vicinity of this gene on chromosome 11p15.5.

  18. Simultaneous detection of porcine circovirus type 2, classical swine fever virus, porcine parvovirus and porcine reproductive and respiratory syndrome virus in pigs by multiplex polymerase chain reaction.

    PubMed

    Jiang, Yonghou; Shang, Hanwu; Xu, Hui; Zhu, Liangjun; Chen, Weijie; Zhao, Lingyan; Fang, Li

    2010-02-01

    A multiplex polymerase chain reaction (PCR) was designed for the simultaneous detection of four viruses involved in reproductive and respiratory failure in pigs: porcine circovirus type 2 (PCV-2), porcine parvovirus (PPV), classical swine fever virus (CSFV) and porcine reproductive and respiratory syndrome virus (PRRSV). Each of the four pairs of oligonucleotide primers exclusively amplified the targeted fragment of the specific viruses. The sensitivity of the multiplex PCR using purified plasmid constructs containing the specific viral target fragments was 2.58x10(7), 2.64x10(5), 2.66x10(7) and 2.73x10(5) copies for PRRSV, PCV-2, CSFV and PPV, respectively. Using the multiplex PCR, co-infections with these four viruses were identified in 26/76 (34.2%) piglets born from sows with reproductive failure in China. This method is a rapid, sensitive and cost-effective diagnostic tool for the routine surveillance of viral infections in pigs.

  19. Detection of Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari in Skin Biopsy Specimens Using a Multiplex Real-time Polymerase Chain Reaction Assay

    PubMed Central

    Denison, Amy M.; Amin, Bijal D.; Nicholson, William L.; Paddock, Christopher D.

    2015-01-01

    Background Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari are the most common causes of spotted fever group rickettsioses indigenous to the United States. Infected patients characteristically present with a maculopapular rash, often accompanied by an inoculation eschar. Skin biopsy specimens are often obtained from these lesions for diagnostic evaluation. However, a species-specific diagnosis is achieved infrequently from pathologic specimens because immunohistochemical stains do not differentiate among the causative agents of spotted fever group rickettsiae, and existing polymerase chain reaction (PCR) assays generally target large gene segments that may be difficult or impossible to obtain from formalin-fixed tissues. Methods This work describes the development and evaluation of a multiplex real-time PCR assay for the detection of these 3 Rickettsia species from formalin-fixed, paraffin-embedded (FFPE) skin biopsy specimens. Results The multiplex PCR assay was specific at discriminating each species from FFPE controls of unrelated bacterial, viral, protozoan, and fungal pathogens that cause skin lesions, as well as other closely related spotted fever group Rickettsia species. Conclusions This multiplex real-time PCR demonstrates greater sensitivity than nested PCR assays in FFPE tissues and provides an effective method to specifically identify cases of Rocky Mountain spotted fever, rickettsialpox, and R. parkeri rickettsiosis by using skin biopsy specimens. PMID:24829214

  20. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials.

  1. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. PMID:27501408

  2. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  3. Development of Multiplex Real-Time Polymerase Chain Reaction for Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in Clinical Specimens

    PubMed Central

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-01-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas. PMID:20889890

  4. Development of multiplex real-time polymerase chain reaction for detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in clinical specimens.

    PubMed

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-10-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas.

  5. Simultaneous detection of Chlamydia spp., Coxiella burnetii, and Neospora caninum in abortion material of ruminants by multiplex real-time polymerase chain reaction.

    PubMed

    Reisberg, Kerstin; Selim, Abdelfattah M; Gaede, Wolfgang

    2013-09-01

    Chlamydia spp., Coxiella burnetii, and Neospora caninum are responsible for reproductive diseases and are closely linked with high abortion rates in ruminants. Furthermore, C. burnetii and Chlamydia spp. have zoonotic potential. A real-time polymerase chain reaction (PCR) assay was developed for the simultaneous detection of Chlamydia spp., C. burnetii, and N. caninum. The detection of beta-actin as internal control in the same PCR reaction provides additional information about sample quality by detecting the presence of PCR inhibitors. The multiplex real-time PCR developed in the current study shows a greater sensitivity compared to previously used single-target PCR reactions with a reproducible detection limit of 0.13 plasmid copies per PCR for each target. Additional parallel amplification of all detectable pathogens did not adversely impact sensitivity. This new multiplex PCR allows the highly sensitive, cost-effective, and rapid detection of 3 important pathogens and has the potential to be a useful time-saving tool in the routine diagnosis of abortion cases in ruminants.

  6. Multiplex polymerase chain reaction analysis of Glu-1 high-molecular-mass glutenin genes from wheat by capillary electrophoresis with laser-induced fluorescence detection.

    PubMed

    Salmanowicz, Boleslaw P; Moczulski, Marcin

    2004-04-01

    The unique bread-making properties of wheat are closely correlated with composition and quantity of high-molecular-mass (HMW) glutenin subunits encoded by the Glu-1 genes. We report the development of a multiplex polymerase chain reaction (PCR) method to identify bread wheat genotypes carrying HMW glutenin allele composition of Glu-1 complex loci (Glu-A1, Glu-B1 and Glu-D1) by capillary electrophoresis(CE) with laser-induced fluorescence (LIF) detection. Two triplex primer sets of HMW glutenin subunit genes were examined. An automated and rapid CE-LIF technique is helpful in the multiplex PCR optimization process. Two fluorescent intercalating dyes (EnhanCE, and YO-PRO-1) are compared for detection of DNA fragments. Amplified DNA fragments of HMW glutenin Glu-1 genes were well separated both by agarose slab-gel electrophoresis and CE, and revealed minor differences between the sequences of 1Ax2*, 1Axnull, 1Bx6, 1Bx7, 1Bx17 and 1Dx5 genes. Moreover, CE technique requires samples of smaller volumes in comparison to slab-gel electrophoresis, and data can be obtained in less than 20 min. There was a very high concordance in the assessment of the molecular size of PCR-generated DNA markers. Fast and accurate identification of molecular markers of Glu-1 genes by CE-LIF can be an efficient alternative to standard procedure separation for early selection of useful wheat genotypes with good bread-making quality.

  7. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    PubMed Central

    Bhat, M. Mansoor; Salahuddin, Mir; Mantoo, Imtiyaz A.; Adil, Sheikh; Jalal, Henna; Pal, M. Ashraf

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materials and Methods: Three experimental trials were conducted wherein the products were prepared from pure mutton, beef and buffalo meat, and their admixtures in the ratios of 60:20:20, 80:10:10, 90:05:05 and 98:01:01, respectively. Results: The primers used in the study amplified the cyt b gene fragments of sizes 124 bp, 472 bp and 585 bp for buffalo, cattle and sheep, respectively. It was possible to detect cattle and buffalo meat at the level of 1% in the mixed meat cooked Rista. The multiplex PCR successfully amplified cyt b gene fragments of mtDNA of the target species and thus produced characteristic band pattern for each species. The band intensities of cattle and buffalo in the mixed meat Rista progressively decreased corresponding to their decreasing level from 20% to 1%. Processing, cooking (moist heating) and non-meat formulation ingredients had no effect on detection of meat species adulteration. Conclusion: The multiplex PCR procedure standardized and developed in this study is simple, efficient, sensitive, reliable and highly specific for detecting falsification of cooked mutton product with beef and buffalo meat up to 1% level. PMID:27057103

  8. Quantitation of Bt-176 maize genomic sequences by surface plasmon resonance-based biospecific interaction analysis of multiplex polymerase chain reaction (PCR).

    PubMed

    Feriotto, Giordana; Gardenghi, Sara; Bianchi, Nicoletta; Gambari, Roberto

    2003-07-30

    Surface plasmon resonance (SPR) based biosensors have been described for the identification of genetically modified organisms (GMO) by biospecific interaction analysis (BIA). This paper describes the design and testing of an SPR-based BIA protocol for quantitative determinations of GMOs. Biotinylated multiplex Polymerase Chain Reaction (PCR) products from nontransgenic maize as well as maize powders containing 0.5 and 2% genetically modified Bt-176 sequences were immobilized on different flow cells of a sensor chip. After immobilization, different oligonucleotide probes recognizing maize zein and Bt-176 sequences were injected. The results obtained were compared with Southern blot analysis and with quantitative real-time PCR assays. It was demonstrated that sequential injections of Bt-176 and zein probes to sensor chip flow cells containing multiplex PCR products allow discrimination between PCR performed using maize genomic DNA containing 0.5% Bt-176 sequences and that performed using maize genomic DNA containing 2% Bt-176 sequences. The efficiency of SPR-based BIA in discriminating material containing different amounts of Bt-176 maize is comparable to real-time quantitative PCR and much more reliable than Southern blotting, which in the past has been used for semiquantitative purposes. Furthermore, the approach allows the BIA assay to be repeated several times on the same multiplex PCR product immobilized on the sensor chip, after washing and regeneration of the flow cell. Finally, it is emphasized that the presented strategy to quantify GMOs could be proposed for all of the SPR-based, commercially available biosensors. Some of these optical SPR-based biosensors use, instead of flow-based sensor chips, stirred microcuvettes, reducing the costs of the experimentation.

  9. Isolation and characterization of Shiga toxigenic Escherichia coli of animal and bird origin by multiplex polymerase chain reaction

    PubMed Central

    Neher, S.; Hazarika, A. K.; Barkalita, L. M.; Borah, P.; Bora, D. P.; Sharma, R. K.

    2016-01-01

    Aim: The purpose of this study was to determine the virulence genes and serotype of Shiga toxin producing Escherichia coli (STEC) strains isolated from animals and birds. Materials and Methods: A total of 226 different samples viz., fecal, intestinal content, rectal swab and heart blood were collected from different clinically affected/healthy animals and birds and were streaked on McConkeys’ lactose agar and eosin methylene blue agar for isolation of E. coli, confirmed by staining characteristics and biochemical tests. By polymerase chain reaction (PCR) all the E. coli isolates were screened for certain virulence genes, viz., Shiga toxin 1 (stx1), stx2 and eae and enterohemolytic (Ehly) phenotype was observed in washed sheep blood agar plate. All the isolated E. coli strains were forwarded to the National Salmonella and Escherichia Centre, Central Research Institute, Kasauli (Himachal Pradesh) for serotyping. Results: Out of 226 samples 138 yielded E. coli. All the isolates were screened for molecular detection of different virulent genes, viz. stx1, stx2 and eae, based on which 36 (26.08%) were identified as STEC. Among those STEC isolates, 15 (41.67%), 14 (38.89%), 1 (2.78%) exhibited eae, stx2, stx1 alone, respectively, whereas 4 (11.11%) and 2 (5.56%) carried both stx1 and stx2, stx2 and eae, respectively. Among the STEC isolates 22 were belonged to 15 different sero-groups, viz., O2, O20, O22, O25, O43, O60, O69, O90, O91, O95, O106, O118, O130, O162 and O170 and others were untypable. Ehly phenotype was observed in 10 (27.78%) the STEC isolates. Conclusion: The present study concluded that STEC could be isolated from both clinically affected as well as healthy animals and birds. Regular monitoring of more samples from animal and bird origin is important to identify natural reservoir of STEC to prevent zoonotic infection. PMID:27051196

  10. Simultaneous detection of Pyrethroid, Organophosphate and Cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex Polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The horn fly, Haematobia irritans irritans (Linnaeus, 1758), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex...

  11. Rapid Identification of Mycobacterium Species with the Aid of Multiplex Polymerase Chain Reaction (PCR) From Clinical Isolates

    PubMed Central

    Gupta, Siddhartha; Bandyopadhyay, Debasis; Paine, Suman Kalyan; Gupta, Soma; Banerjee, Surajita; Bhattacharya, Sujata; Gachhui, Ratan; Bhattacharya, Basudev

    2010-01-01

    Mycobacteria are aerobic, nonspore forming, non-motile,single-cell bacteria.Of more than 40 currently recognized species of mycobacteria, Mycobacterium tuberculosis, the causative agent of human TB is the commonest pathogen for pulmonary and extra pulmonary tuberculosis cases. The other members of the Mycobacterium tuberculosis complex (MTC) or the nontubercular mycobacterium (NTM) produces similar diseases which cannot be differentiated from tuberculosis by clinical symptoms and signs. But this differentiation is important as the chemotherapy varies widely according to the strain of mycobacterium. The burden of morbidity and mortality of tuberculosis is rapidly growing worldwide, particularly with the HIV/AIDS epidemic. The strain identification of Mycobacterium remains a cumbersome, labor intensive and expensive procedure, which requires 3 to 12 weeks of time. The conventional methods of strain identification lack proper standardization and precise diagnosis. The prime objective of this study is to overcome these problems. A multiplex PCR using 3 amplicons of 165,365, and 541 base pair target sequences was done with a total number of 165 clinical isolates of suspected Koch’s patients. Strain identification was compared both by conventional methods and multiplex PCR. The results of the study show that this multiplex PCR is supposed to be less complicated, less time consuming, cost-effective and superior to the conventional methods. It is also applicable for culture negative samples where strain identification is not possible by conventional approach. PMID:21258579

  12. An improved method for absolute quantification of mRNA using multiplex polymerase chain reaction: determination of renin and angiotensinogen mRNA levels in various tissues.

    PubMed

    Dostal, D E; Rothblum, K N; Baker, K M

    1994-12-01

    We have developed a multiplex, competitive, reverse-transcriptase polymerase chain reaction (RT-PCR) method which measures absolute levels of renin, angiotensinogen, and the housekeeping transcript elongation factor-1 alpha (EF-1 alpha) mRNA. Sample RNA was simultaneously titrated with serial dilutions of renin, angiotensinogen, and EF-1 alpha competitor RNAs which flanked the endogenous concentrations of target transcripts. The samples were coreverse transcribed in the presence of random primers and resulting first-strand cDNA was coamplified for 10-15 cycles with [32P]-dCTP and primers for renin angiotensinogen, after which EF-1 alpha primers were added. Amplified DNA was separated by electrophoresis on polyacrylamide gel and radioactivity in the bands was quantified by direct radioanalytical scanning. Three conditions were necessary to obtain absolute quantification of renin and angiotensinogen mRNA levels: (a) exogenous competitor RNA was used to control for tube-to-tube variability in the efficiencies of reverse transcription and amplification; (b) Sample RNA was titrated with flanking concentrations of competitor RNA to correct for intraassay differences in the efficiency of amplification due to concentration differences between competitor and target templates; and (c) a housekeeping transcript EF-1 alpha was used to control for tube-to-tube differences in RNA loading and/or degradation. We show that the multiplex RT-PCR method is precise and accurate over approximately three logs of transcript concentration and sensitive to less than 5 and 0.5 fg for renin and angiotensinogen mRNA, respectively. This method will be useful for absolute quantification of target mRNAs, especially when the amount of sample RNA is limited or unknown and/or the gene expression is low. PMID:7887470

  13. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections

    PubMed Central

    Torres, Luciene de Fátima Costa; Ribeiro, Dayana; Hirata, Raphael; Pacheco, Luis Gustavo Carvalho; Souza, Monica Cristina; dos Santos, Louisy Sanches; dos Santos, Cíntia Silva; Salah, Mohammad; da Costa, Mateus Matiuzzi; Ribeiro, Marcio Garcia; Selim, Salah A; Azevedo, Vasco Ariston de Carvalho; Mattos-Guaraldi, Ana Luiza

    2013-01-01

    Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR) assay that can simultaneously identify and determine the toxigenicity of these corynebacterial species with zoonotic potential was developed. This assay uses five primer pairs targeting the following genes: rpoB (Corynebacterium spp), 16S rRNA (C. ulcerans and C. pseudotuberculosis), pld (C. pseudotuberculosis), dtxR (C. diphtheriae) and tox [diphtheria toxin (DT) ]. In addition to describing this assay, we review the literature regarding the diseases caused by these pathogens. Of the 213 coryneform strains tested, the mPCR results for all toxigenic and non-toxigenic strains of C . diphtheriae, C. ulcerans and C. pseudotuberculosis were in 100% agreement with the results of standard biochemical tests and PCR-DT. As an alternative to conventional methods, due to its advantages of specificity and speed, the mPCR assay used in this study may successfully be applied for the diagnosis of human and/or animal diseases caused by potentially toxigenic corynebacterial species. PMID:23778659

  14. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections.

    PubMed

    Torres, Luciene de Fátima Costa; Ribeiro, Dayana; Hirata Jr, Raphael; Pacheco, Luis Gustavo Carvalho; Souza, Monica Cristina; dos Santos, Louisy Sanches; dos Santos, Cíntia Silva; Salah, Mohammad; Costa, Mateus Matiuzzi da; Ribeiro, Marcio Garcia; Selim, Salah A; Azevedo, Vasco Ariston de Carvalho; Mattos-Guaraldi, Ana Luiza

    2013-05-01

    Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR) assay that can simultaneously identify and determine the toxigenicity of these corynebacterial species with zoonotic potential was developed. This assay uses five primer pairs targeting the following genes: rpoB (Corynebacterium spp), 16S rRNA (C. ulcerans and C. pseudotuberculosis), pld (C. pseudotuberculosis), dtxR (C. diphtheriae) and tox [diphtheria toxin (DT) ]. In addition to describing this assay, we review the literature regarding the diseases caused by these pathogens. Of the 213 coryneform strains tested, the mPCR results for all toxigenic and non-toxigenic strains of C . diphtheriae, C. ulcerans and C. pseudotuberculosis were in 100% agreement with the results of standard biochemical tests and PCR-DT. As an alternative to conventional methods, due to its advantages of specificity and speed, the mPCR assay used in this study may successfully be applied for the diagnosis of human and/or animal diseases caused by potentially toxigenic corynebacterial species.

  15. A Multiplex Allele Specific Polymerase Chain Reaction (MAS-PCR) for the Detection of Factor V Leiden and Prothrombin G20210A

    PubMed Central

    Bagheri, Morteza; Rad, Isa Abdi

    2011-01-01

    ABSTRACT Introduction: In order to determine the frequencies of factor V Leiden and prothrombin G20210A point mutations in the Iranian population with Azeri Turkish origin. Material and methods: 120 unrelated individuals from general population randomly selected and were examined for factor V Leiden and prothrombin G20210A mutations using a multiplex allele specific polymerase chain reaction (MAS-PCR) assay Outcomes: The frequency of prothrombin G20210A mutation was 2.08%, which means 5 chromosomes out of 240 chromosomes had prothrombin G20210A mutation. The distribution of prothrombin 20210 GG, GA, AA genotypes and prothrombin 20210A allele were 37(92.5%), 3(7.5%), 0(0%) and 3(3.75%) in males and 78(97.5%), 2(2.5%), 0(0%) and 2(1.25%) in females, respectively. Factor V Leiden was not found in our tested group (zero chromosomes out of 240 chromosomes). Analysis of the observed frequencies in the studied groups indicates that there is no statistically significant difference between females and males, regarding prothrombin G20210A mutation (p value>0.05). Conclusions: This is the first study in its own kind in this population and implies that the frequency of Factor V Leiden G1691A (R506Q, FV-Leiden) allele is extremely low but the prothrombin G20210A mutation is more frequent in the tested group. PMID:21977183

  16. Detection of β-globin Gene Mutations Among β-thalassaemia Carriers and Patients in Malaysia: Application of Multiplex Amplification Refractory Mutation System–Polymerase Chain Reaction

    PubMed Central

    Hassan, Syahzuwan; Ahmad, Rahimah; Zakaria, Zubaidah; Zulkafli, Zefarina; Abdullah, Wan Zaidah

    2013-01-01

    Background: β-thalassaemia is one of the most common single-gene disorders worldwide. Each ethnic population has its own common mutations, accounting for the majority of cases, with a small number of mutations for the rarer alleles. Due to the heterogeneity of β-thalassaemia and the multi-ethnicity of Malaysians, molecular diagnostics may be expensive and time consuming. Methods: A simple polymerase chain reaction (PCR) approach involving a multiplex amplification refractory mutation system (MARMS) and one amplification refractory mutation system (ARMS), consisting of 20 β-globin gene mutations, were designed and employed to investigate β-thalassaemia patients and carriers. Results: Out of 169 carriers tested with the MARMS, Cd 41/42 (–TTCT), Cd 26 (A–G) HbE, IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 78.1%. Among the Malays, Cd 26 (A–G) HbE, Cd 41/42 (–TTCT), IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 81.4%, whereas Cd 41/42 (–TTCT) and IVS 2–654 (C–T) were most common among the Chinese (79.1%). Conclusion: We propose the use of this cheap, easy to interpret, and simple system for the molecular diagnostics of β-thalassaemia among Malaysians at the Institute for Medical Research (IMR). PMID:23613656

  17. An investigation of genital ulcers in Jackson, Mississippi, with use of a multiplex polymerase chain reaction assay: high prevalence of chancroid and human immunodeficiency virus infection.

    PubMed

    Mertz, K J; Weiss, J B; Webb, R M; Levine, W C; Lewis, J S; Orle, K A; Totten, P A; Overbaugh, J; Morse, S A; Currier, M M; Fishbein, M; St Louis, M E

    1998-10-01

    In 1994, an apparent outbreak of atypical genital ulcers was noted by clinicians at the sexually transmitted disease clinic in Jackson, Mississippi. Of 143 patients with ulcers tested with a multiplex polymerase chain reaction (PCR) assay, 56 (39%) were positive for Haemophilus ducreyi, 44 (31%) for herpes simplex virus, and 27 (19%) for Treponema pallidum; 12 (8%) were positive for > 1 organism. Of 136 patients tested for human immunodeficiency virus (HIV) by serology, 14 (10%) were HIV-seropositive, compared with none of 200 patients without ulcers (P < .001). HIV-1 DNA was detected by PCR in ulcers of 6 (50%) of 12 HIV-positive patients. Multivariate analysis indicated that men with chancroid were significantly more likely than male patients without ulcers to report sex with a crack cocaine user, exchange of money or drugs for sex, and multiple sex partners. The strong association between genital ulcers and HIV infection in this population highlights the urgency of preventing genital ulcers in the southern United States.

  18. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

    PubMed

    Meena, Ram Prasnna; Baranwal, V K

    2016-09-01

    Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. PMID:27208471

  19. High-risk human papillomavirus infection involving multiple anatomic sites of the female lower genital tract: a multiplex real-time polymerase chain reaction-based study.

    PubMed

    Hui, Yiang; Manna, Pradip; Ou, Joyce J; Kerley, Spencer; Zhang, Cunxian; Sung, C James; Lawrence, W Dwayne; Quddus, M Ruhul

    2015-09-01

    High-risk human papillomavirus infection usually is seen at one anatomic site in an individual. Rarely, infection at multiple anatomic sites of the female lower genital tract in the same individual is encountered either simultaneously and/or at a later date. The current study identifies the various subtypes of high-risk human papillomavirus infection in these scenarios and analyzes the potential significance of these findings. High-risk human papillomavirus infection involving 22 anatomic sites from 7 individuals was identified after institutional review board approval. Residual paraffin-embedded tissue samples were retrieved, and all 15 high-risk human papillomavirus were identified and viral load quantified using multiplex real-time polymerase chain reaction-based method. Multiple high-risk human papillomavirus subtypes were identified in 32% of the samples and as many as 5 different subtypes of high-risk human papillomavirus infection in a single anatomic site. In general, each anatomic site has unique combination of viral subtypes, although one individual showed overlapping subtypes in the vagina, cervix, and vulvar samples. Higher viral load and rare subtypes are more frequent in younger patients and in dysplasia compared with carcinoma. Follow-up ranging from 3 to 84 months revealed persistent high-risk human papillomavirus infection in 60% of cases.

  20. Capillary electrophoresis of a multiplex reverse transcription-polymerase chain reaction to target messenger RNA markers for body fluid identification.

    PubMed

    Haas, Cordula; Hanson, Erin; Ballantyne, Jack

    2012-01-01

    The analysis of cell-specific mRNA expression is a promising new method for the identification of body fluids. A number of mRNA markers have been identified for the forensically most relevant body fluids: blood, saliva, semen, vaginal secretions, and menstrual blood. Apart from a significant improvement in specificity compared to conventional protein-based methods, other important advantages of body fluid identification by mRNA profiling include the possibility of simultaneously isolating RNA and DNA from the same piece of stain and the ability to multiplex numerous RNA markers for the identification of one or several body fluids. RNA profiling can be incorporated into current DNA analysis pipelines.

  1. Polymerase chain reaction

    SciTech Connect

    Arnhelm, N. ); Levenson, C.H. )

    1990-10-01

    This paper discusses the polymerase chain reaction (PCR) an in-vitro method of amplifying DNA sequences. Beginning with DNA of any origin- bacterial, viral, plant, or animal- PCR can increase the amount of a DNA sequence hundreds of millions to billions of times. The procedure can amplify a targeted sequence even when it makes up less than one part in a million of the total initial sample. PCR is an enzymatic process that is carried out in discrete cycles of amplification, each of which can double the amount of target DNA in the sample. Thus, n cycles can produce 2{sup n} times as much target as was present to begin with. This paper discusses how PCR has had an impact on molecular biology, human genetics, infectious and genetic disease diagnosis, forensic science, and evolutionary biology.

  2. Pathotypic and Phylogenetic Study of Diarrheagenic Escherichia coli and Uropathogenic E. coli Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Salmani, Hamzeh; Azarnezhad, Asaad; Fayazi, Mohammad Reza; Hosseini, Arshad

    2016-01-01

    Background: Acute diarrheal disease and urinary tract infection are leading causes of childhood morbidity and mortality in the developing world. Diarrheagenic Escherichia coli (DEC) has been identified as a major etiologic agent of diarrhea worldwide, and urinary tract infection (UTI) caused by uropathogenic Escherichia coli (UPEC) is one of the most common bacterial infections among human beings. Quick and precise detection of these bacteria help provide more effective intervention and management of infection. Objectives: In this study we present a precise and sensitive typing and phylogenetic study of UPEC and DEC using multiplex PCR in order to simplify and improve the intervention and management of diarrheal and UT infections. Materials and Methods: In total, 100 urinary tract infection samples (UTI) and 200 specimens from children with diarrhea, which had been diagnosed with E. coli as the underlying agent by differential diagnosis using MacConkey’s agar and biochemical study, were submitted for molecular detection. Pathotyping of E. coli pathotypes causing urinary tract infection and diarrhea were examined using a two set multiplex PCR, targeting six specific genes. Phylogenetic typing was done by targeting three genes, including ChuA, YjaA and TspE4C2. Results: Overall, 88% of DEC and 54% of UTI isolates were positive for one or more of the six genes encoding virulence factors. Prevalence of the genes encoding virulence factors for DEC were 62%, 25%, 24%, 13%, 7% and 5% for ST (ETEC), LT (ETEC), aggR (EAggEC), daaD (DAEC), invE (EIEC) and eae (EPEC), respectively; whereas, the prevalence rates for the UTI samples were 23%, 14%, 6%, 6% and 4% for aggR (EAggEC), LT (ETEC), daaD (DAEC), invE (EIEC) and ST (ETEC), respectively. No coding virulence factors were detected for eae (EPEC). Group B2 was the most prevalent phylogroup and ST was the most frequently detected pathotype in all phylogroups. Conclusions: ETEC and EAggEC were the most detected E. coli among

  3. Isolation of toxigenic Clostridium difficile from ready-to-eat salads by multiplex polymerase chain reaction in Isfahan, Iran

    PubMed Central

    Yamoudy, Mahire; Mirlohi, Maryam; Isfahani, Bahram Nasr; Jalali, Mohammad; Esfandiari, Zahra; Hosseini, Nafiseh Sadat

    2015-01-01

    Background: Since 2003, the incidence of community associated Clostridium difficile infection (CA-CDI) has increased; different types of food have been supposed to be the vectors of C. difficile strains. The purpose of this study is to investigate the occurrence of C. difficile strains in ready-to-eat salads distributed in food services. Materials and Methods: A total of 106 ready-made salad specimens were sampled from different restaurants and food services located in Isfahan, in the center of Iran. Positive isolates of C. difficile were identified and confirmed for the existence of three genes including tpi, tcdA and tcdB by multiplex PCR. Results: A total of six (5.66%) samples were positive for C. difficile strains. Of which, one strain (16.6%) was positive for A and B toxins. Conclusion: The existence of toxigenic C. difficile in ready-made salads could be a caution for public health. Further investigation is required to assess the relationship between the isolated strains in our study and those from diarrheic patients through molecular typing. PMID:26015913

  4. Environmental monitoring for biological threat agents using the autonomous pathogen detection system with multiplexed polymerase chain reaction.

    PubMed

    Regan, John F; Makarewicz, Anthony J; Hindson, Benjamin J; Metz, Thomas R; Gutierrez, Dora M; Corzett, Todd H; Hadley, Dean R; Mahnke, Ryan C; Henderer, Bruce D; Breneman, John W; Weisgraber, Todd H; Dzenitis, John M

    2008-10-01

    We have developed and field-tested a now operational civilian biodefense capability that continuously monitors the air in high-risk locations for biological threat agents. This stand-alone instrument, called the Autonomous Pathogen Detection System (APDS), collects and selectively concentrates particles from the air into liquid samples and analyzes the samples using multiplexed PCR amplification coupled with microsphere array detection. During laboratory testing, we evaluated the APDS instrument's response to Bacillus anthracis and Yersinia pestis by spiking the liquid sample stream with viable spores and cells, bead-beaten lysates, and purified DNA extracts. APDS results were also compared to a manual real-time PCR method. Field data acquired during 74 days of continuous operation at a mass-transit subway station are presented to demonstrate the specificity and reliability of the APDS. The U.S. Department of Homeland Security recently selected the APDS reported herein as the first autonomous detector component of their BioWatch antiterrorism program. This sophisticated field-deployed surveillance capability now generates actionable data in one-tenth the time of manual filter collection and analysis. PMID:18763806

  5. Genotyping of Pseudomonas aeruginosa Type III Secretion System Using Magnetic Enrichment Multiplex Polymerase Chain Reaction and Chemiluminescence.

    PubMed

    Tang, Yongjun; Li, Bo; Dai, Jianguo; Dai, Jianfang; Wang, Xinhui; Si, Jing; Ali, Zeeshan; Li, Taotao; He, Nongyue

    2016-04-01

    The pathologic characteristics and toxicity mechanism of Pseudomonas aeruginosa are different in strains with different Type III secretion system (T3SS) genes. The T3SS gene based genotyping of P. aeruginosa strains is important to understand its virulence and predict the clinical outcomes. In this study, a rapid and automatable method for T3SS genotyping was developed using magnetic enrichment multiplex PCR and chemiluminescence. Three P. aeruginosa standard strains were analyzed using this method. The results showed that the chemiluminescent intensity of exoT, exoY, and exoS of these strains were 10 times greater than that of the control, and that their Q values were greater than 2.1. These results were consistent with the regular PCR and electrophoresis results, indicating that the method was reliable. Out of the 22 clinical isolates tested using this method, 100%, 72.7%, 95.5%, and 4.5% of the isolates contained exoT, exoY, exoS, and exoU genes, respectively. The isolates harbored either exoS or exoU gene, but not both. All genotyping results of the isolates were consistent with the information obtained using regular PCR and electrophoresis. PMID:27301202

  6. Multiplex polymerase chain reaction analysis of UV-A- and UV-B-induced delayed and early mutations in V79 Chinese hamster cells.

    PubMed

    Dahle, Jostein; Noordhuis, Paul; Stokke, Trond; Svendsrud, Debbie Hege; Kvam, Egil

    2005-01-01

    We previously reported that approximately 10% of V79 Chinese hamster fibroblast populations clonally derived from single cells immediately after irradiation with either ultraviolet B (UV-B, 290-320 nm, mainly 311 nm) or ultraviolet A (UV-A, 320-400 nm, mainly 350-390 nm) radiation exhibit genomic instability. The instability is revealed by relatively high mutation frequencies in the hypoxanthine phosphoribosyl transferase (hprt) gene up to 23 cell generations after irradiation. These delayed mutant clones exhibited higher levels of oxidative stress than normal cells. Therefore, persistently increased oxidative stress has been proposed as a mechanism for UV-induced genomic instability. This study investigates whether this mechanism is reflected in the deletion spectrum of delayed mutant clones. Eighty-eight percent of the delayed mutant clones derived from UV-A-irradiated populations were found to have total deletion of the hprt gene. Correspondingly, 81% of UV-A-induced early mutations (i.e. detected shortly after irradiation) also had total deletions. Among delayed UV-B-induced mutant clones, 23% had total deletions and 8% had deletion of one exon, whereas all early UV-B events were either point mutations or small deletions or insertions. In conclusion, the multiplex polymerase chain reaction deletion screen showed that there were explicit differences in the occurrence of large gene alterations between early and delayed mutations induced by UV-B radiation. For UV-A radiation the deletion spectra were similar for delayed and early mutations. UV-A radiation is, in contrast to UV-B radiation, only weakly absorbed by DNA and probably induces mutation almost solely via production of reactive oxygen species. Therefore, the present results support the hypothesis that persistent increase in oxidative stress is involved in the mechanism of UV-induced genomic instability.

  7. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-01

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences.

  8. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-01

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences. PMID:26669715

  9. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    PubMed

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  10. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    PubMed

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  11. A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

    PubMed

    Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

    2009-11-01

    To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

  12. Fixed nuclei as alternative template of BIOMED-2 multiplex polymerase chain reaction for immunoglobulin gene clonality testing in B-cell malignancies.

    PubMed

    Tang, Yuan; Chen, Jie; Wang, Jianchao; Zheng, Ke; Liao, Dianying; Liao, Xiaomei; Liu, Weiping; Wang, Lin

    2015-01-01

    Evaluation of immunoglobulin (Ig) gene rearrangements with BIOMED-2 multiplex PCR has become a standard detection of clonality in mature B cell malignancies. Conventionally, this method is relatively labor-intensive and time-consuming, as it requires DNA isolation from bone marrow aspirates (BM) or peripheral blood (PB) in patients with BM or PB involvement. On the other hand, fluorescence in situ hybridization (FISH) is routinely used as genetic screening in B cell malignancies, but the surplus fixed nuclei initially prepared for FISH usually turn useless afterwards. We sought to use these surplus nuclei after FISH as a template to perform PCR-based Ig gene clonality testing. Templates of 12 patients with mature B cell malignancies, which consisted of both DNA isolated with commercial DNA isolation kit from fresh BM or PB (DNA group) and the fixed nuclei initially prepared for FISH (nuclei group) from the same individuals, were subjected to PCR with BIOMED-2 primer sets for immunoglobulin heavy chain and kappa light chain under recommended conditions. Our result, for the first time, showed a high consistency between the two groups in detecting B cell clonality, which indicates that nuclei for FISH can function as a reliable template comparable to fresh tissue-isolated DNA in PCR based Ig clonality testing. This offers a simple, rapid and more economical alternative to standard Ig testing based on regular DNA.

  13. Scanning copy number and gene expression on the 16p13.3-13.2 chromosomal region by the systematic multiplex polymerase chain reaction and reverse transcription-polymerase chain reaction methods.

    PubMed

    Yamamoto, Miyako; Ahn, Ray Hyungjoo; Yamamoto, Fumiichiro

    2006-07-01

    We developed the systematic multiplex reverse transcription-PCR (SM RT-PCR) method that is distinguishable from other multiplex RT-PCR methods by optimized PCR conditions allowing amplification of sequences that fall within a single exon of genes of similar band intensity using genomic DNA template as a calibration standard. Using an SM RT-PCR system of proto-oncogenes and tumor suppressor genes, we previously showed that the SM RT-PCR system, which was developed for cDNA expression analysis, could also be used for a more exquisite analysis of copy number changes in genomic DNA. Here we report that the SM PCR method semiquantitatively detected less than a two-fold difference in copy number. Furthermore, we also report the results of subchromosomal scanning of copy number and expression using the SM PCR and SM RT-PCR methods. We identified and characterized the novel homozygous deletion that spans over 12-plus genes on 16p13.3-13.2 in the MDA-MB-468 breast cancer cell line.

  14. Usability application of multiplex polymerase chain reaction in the diagnosis of microorganisms isolated from urine of patients treated in cancer hospital

    PubMed Central

    Cybulski, Zefiryn; Schmidt, Katarzyna; Grabiec, Alicja; Talaga, Zofia; Bociąg, Piotr; Wojciechowicz, Jacek; Roszak, Andrzej; Kycler, Witold

    2013-01-01

    Background The objective of this study was: i) to compare the results of urine culture with polymerase chain reaction (PCR) -based detection of microorganisms using two commercially available kits, ii) to assess antimicrobial susceptibility of urine isolates from cancer patients to chosen antimicrobial drugs and, if necessary, to update the recommendation of empirical therapy. Materials and methods. A one-year hospital-based prospective study has been conducted in Greater Poland Cancer Centre and Genetic Medicine Laboratory CBDNA Research Centre in 2011. Urine cultures and urine PCR assay from 72 patients were examined Results Urine cultures and urine PCR assay from 72 patients were examined. Urine samples were positive for 128 strains from which 95 (74%) were identical in both tests. The most frequently isolated bacteria in both culture and PCR assay were coliform organisms and Enterococcus spp. The Gram negative bacilli were most resistant to cotrimoxazol. 77.2% of these bacilli and 100% of E. faecalis and S. agalactiae were sensitive to amoxicillin-clavulanic acid. 4.7% of Gram positive cocci were resistant to nitrofurantoin. Conclusions The PCR method quickly finds the causative agent of urinary tract infection (UTI) and, therefore, it can help with making the choice of the proper antimicrobial therapy at an early stage. It appears to be a viable alternative to the recommendations made in general treatment guidelines, in cases where diversified sensitivity patterns of microorganisms have been found. PMID:24133395

  15. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    PubMed

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations. PMID:23345271

  16. A novel nested multiplex polymerase chain reaction (PCR) assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    PubMed Central

    Khairnar, Krishna; Parija, Subhash C

    2007-01-01

    Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive) that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific). The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens. PMID:17524135

  17. Multiplex PCR (polymerase chain reaction) assay for detection of E. coli O157:H7, Salmonella sp., Vibrio cholerae and Vibrio parahaemolyticus in spiked shrimps (Penaeus monodon).

    PubMed

    Fakruddin, M D; Sultana, Mahmuda; Ahmed, Monzur Morshed; Chowdhury, Abhijit; Choudhury, Naiyyum

    2013-03-15

    The coastal aquaculture mainly shrimps constitute major export sector in Bangladesh and is increasingly shaped by international trade conditions and by national responses to those stringent quality and safety standards. PCR based validated methods for detection of major bacterial pathogens in shrimp might be very useful tool for ensuring quality and safety standards of exportable shrimps. The objective of this study was to evaluate overall performance (sensitivity and specificity) of the multiplex PCR assay for detection of Vibrio cholerae, Vibrio parahaemolyticus, Salmonella sp. and Escherichia coli O157:H7 from spiked shrimp samples. The targeted genes were ompW for V. cholerae, tdh for V. parahaemolyticus, sefA for Salmonella spp. and hlyEHEC for E. coli O157:H7. The genomic DNA was extracted by using standard method and amplified accordingly. Sensitivity of the assay was tested by inoculating the shrimp homogenate with viable cells of laboratory references strains (target pathogens). The genes were amplified individually both from culture homogenate and spiked samples. Twenty different uniplex and multiplex PCR assay were performed; the results showed that the sensitivity and specificity of multiplex PCR are comparable to that of the results of uniplex PCR for the samples. DNA extracted from shrimp samples spiked with non-target pathogen (Bacillus cereus, Shigella flexneri and Staphylococcus aureus) yielded negative results. PMID:24498789

  18. Simultaneous confirmatory analysis of different transgenic maize (zea mays) lines using multiplex polymerase chain reaction-restriction analysis and capillary gel electrophoresis with laser induced fluorescence detection.

    PubMed

    García-Cañas, Virginia; Cifuentes, Alejandro

    2008-09-24

    A novel analytical procedure based on the combination of multiplex PCR, restriction analysis, and CGE-LIF to unambiguosly and simultaneously confirm the presence of multiple lines of genetically modified corn is proposed. This methodology is based on the amplification of event-specific DNA regions by multiplex PCR using 6-FAM-labeled primers. Subsequently, PCR products are digested by a mixture containing specific restriction endonucleases. Thus, restriction endonucleases selectively recognize DNA target sequences contained in the PCR products and cleave the double-stranded DNA at a given cleavage site. Next, the restriction digest is analyzed by CGE-LIF corroborating the length of the expected restriction fragments, confirming (or not) the existence of GMOs. For accurate size determination of the DNA fragments by CGE-LIF a special standard DNA mixture was produced in this laboratory for calibration. The suitability of this mixture for size determination of labeled DNA fragments is also demonstrated. The usefulness of the proposed methodology is demonstrated through the simultaneous detection and confirmatory analysis of samples containing 0.5% of GA21 and MON863 maize plus an endogenous gene of maize as control.

  19. A Rapid and Sensitive Method to Identify and Differentiate Salmonella enterica Serotype Typhimurium and Salmonella enterica Serotype 4,[5],12:i:- by Combining Traditional Serotyping and Multiplex Polymerase Chain Reaction

    PubMed Central

    Barco, Lisa; Lettini, Antonia Anna; Ramon, Elena; Longo, Alessandra; Saccardin, Cristina; Pozza, Maria Cristina Dalla

    2011-01-01

    Abstract Salmonella enterica subspecies enterica serotype 4,[5],12:i:- is an emerging serovar considered as a monophasic variant of Salmonella enterica serotype Typhimurium. The antigenic and genetic similarity between Salmonella 4,[5],12:i:- and Salmonella Typhimurium suggests that they may behave in a similar way and represent a comparable threat to public health. As serotyping alone does not necessarily provide for identification of Salmonella 4,[5],12:i:- and its differentiation from Salmonella Typhimurium, a method that combines traditional serotyping and a multiplex polymerase chain reaction has been tested on 208 strains serotyped as Salmonella 4,[5],12:i:-, Salmonella Typhimurium, and similar serovars of serogroup B sharing the same phase-1 antigen “i.” For 191 strains, the combined method fully confirmed the results provided by traditional serotyping, whereas for 17 strains of Salmonella 4,[5],12:i:- and Salmonella Typhimurium some inconsistencies emerged between the two methods. The combined method resulted in a more accurate and faster identification of these two relevant serovars. PMID:21247297

  20. Universal primer-multiplex-polymerase chain reaction (UP-M-PCR) and capillary electrophoresis-laser-induced fluorescence analysis for the simultaneous detection of six genetically modified maize lines.

    PubMed

    Zhang, Chunjiao; Xu, Wentao; Zhai, Zhifang; Luo, Yunbo; Yan, Xinghua; Zhang, Nan; Huang, Kunlun

    2011-05-25

    To meet the labeling and traceability requirement of genetically modified (GM) maize and their products for trade and regulation, it is essential to develop a specific detection method for monitoring the presence of GM content. In this work, six GM maize lines, including GA21, Bt11, NK603, Bt176, Mir604, and Mon810, were simultaneously detected by universal primer-multiplex-polymerase chain reaction (UP-M-PCR), and the amplicons for the six event-specific genes as well as the endogenous Ivr gene were successfully separated by the method of capillary electrophoresis-laser-induced fluorescence (CE-LIF). The UP-M-PCR method overcame the disadvantages in conventional M-PCR, such as complex manipulation, lower sensitivity, amplification disparity resulting from different primers, etc., and in combination with CE-LIF, it obtained a high sensitivity of 0.1 ng for both single and mixed DNA samples. The established method can be widely used for the qualitative identification of the GM maize lines.

  1. Multiplex Polymerase Chain Reaction Identification of Single Individuals of the Longidorid Nematodes Xiphinema index, X. diversicaudatum, X. vuittenezi, and X. italiae Using Specific Primers from Ribosomal Genes.

    PubMed

    Wang, Xinrong; Bosselut, Nathalie; Castagnone, Chantal; Voisin, Roger; Abad, Pierre; Esmenjaud, Daniel

    2003-02-01

    ABSTRACT The species X. index, X. diversicaudatum, X. vuittenezi, and X. italiae are established (E) or putative (P) vectors of Grapevine fanleaf virus (GFLV) (E), Arabis mosaic virus (E), Grapevine chrome mosaic virus (P), and GFLV (P) nepoviruses of grapevine, respectively. All four species are very closely related taxonomically and their low field densities make them difficult to identify from morphological and morphometrical diagnostic characters when only single or few individuals are detected. To improve diagnostic accuracy, a simple method was developed. The internal transcribed spacer 1 (ITS1) region spanning the 18S and 5.8S ribosomal genes was sequenced in one population of each species using two conserved primers from these genes. The ITS1 fragments were 1,132 bp (X. vuittenezi), 1,153 bp (X. index), 1,175 bp (X. diversicaudatum), and 1,190 bp (X. italiae), i.e., a difference of over 5% between the extremes. The sequence variability made it possible to design species-specific internal sense primers that amplified, in combination with the same antisense ITS1 primer, a single signature fragment (340 bp for X. index, 414 bp for X. italiae, 591 bp for X. vuittenezi, and 813 bp for X. diversicaudatum). Tests with DNA from a single adult or juvenile nematode confirmed the specificity of the primers from diverse isolates or populations. The primers were successfully used in a multiplex test for the reliable detection of two to four mixed species, each represented by a single individual. This multiplex-based diagnostic tool will be particularly useful for successful nematode management practices in vineyards.

  2. A multiplex allele-specific real-time polymerase chain reaction assay for HLA-B*13:01 genotyping in four Chinese populations.

    PubMed

    Liu, Z; Chen, G; Kang, X; Han, M; Chen, R; Chen, C; Wang, H

    2016-10-01

    Human leukocyte antigen HLA-B*13:01 is identified currently as a marker of individual susceptibility to drug-induced hypersensitivity reaction, such as dapsone-induced hypersensitivity reactions (DIHRs) and trichloroethylene-induced dermatitis. Therefore, screening for the HLA-B*13:01 allele can assist clinics in identifying patients at risk of developing DIHRs. By combining the allele-specific primers with TaqMan probes, we established a single tube, triplex real-time PCR to detect HLA-B*13:01. The reliability of this assay was validated by the comparison of genotyping results with those by sequence-based typing (SBT). With this assay, the distribution of HLA-B*13:01 in a total of 350 blood samples from four ethnic groups: Han, Tibetan, Uighur, and Buyei were determined. A 100% concordance was observed between the results with the established real-time PCR and SBT in 100 samples. The detection limit of this assay was 0.016 ng genomic DNA. The prevalence of HLA-B*13:01 carriers were 11%, 8%, 1%, and 2% in the Buyei (n = 100), Northern Han (n = 100), Tibetan (n = 100), and Uighur (n = 50) populations, respectively. The multiplex real-time PCR assay provided a fast and reliable method for accurate detection of HLA-B*13:01 allele prior to dapsone administration in clinical practice and onset of the reaction after exposure to trichloroethylene.

  3. The prevalence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs in Nueva Ecija, Philippines based on multiplex polymerase chain reaction (mPCR) assay.

    PubMed

    Corales, Joyce Marielle I; Viloria, Victoria V; Venturina, Virginia M; Mingala, Claro N

    2014-01-01

    The aim of the study was to determine the prevalence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs. It describes the practice of veterinarians in detecting tick-borne diseases in Nueva Ecija, Philippines. Seventy blood samples were collected and were subjected to multiplex PCR for the detection of E. canis, Babesia spp. and A. platys. The prevalence of babesiosis is the highest in Cabanatuan City (2/10), while a 10% prevalence (1/10) was observed in Science City of Muñoz, Talavera and Sta. Rosa. E. canis were only detected in Cabanatuan City. However, no anaplasmosis was detected in any area. The prevalence of babesiosis and ehrlichiosis in Nueva Ecija is 7.14% (5/70) and 2.85% (2/70) respectively. In addition, 70% (7/10) of the Nueva Ecija veterinary practitioners encountered cases of suspected ehrlichiosis in their practice. The diagnosis of ehrlichiosis is based primarily on presented clinical signs and complete blood counts, which include a platelet count. Of the 10 respondents, half utilized test kits while 90% interpreted blood samples. Meanwhile, only 60% of the respondents used an ELISA test kit for ehrlichiosis. For some practitioners, the main reason for not utilizing a kit is the high cost. None of the respondents had previously attended cases of suspected anaplasmosis. Only one respondent diagnosed a case of babesiosis by blood smear microscopy. PMID:25706424

  4. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

    PubMed

    Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

    2015-03-01

    African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. PMID:25776540

  5. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

    PubMed

    Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

    2015-03-01

    African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations.

  6. Widely expressed transcripts for chemokine receptor CXCR1 in identified glutamatergic, gamma-aminobutyric acidergic, and cholinergic neurons and astrocytes of the rat brain: a single-cell reverse transcription-multiplex polymerase chain reaction study.

    PubMed

    Danik, M; Puma, C; Quirion, R; Williams, S

    2003-10-15

    Increasing evidence suggests that the chemokine interleukin (IL)-8/CXCL8 plays important roles in CNS development, neuronal survival, modulation of excitability, and neuroimmune response. Recently, we have shown that CXCL8 can acutely modulate ion channel activity in septal neurons expressing receptors CXCR1 and/or CXCR2. This was a surprising finding, insofar as CXCR1 expression had not been described for the mammalian brain. Here we investigated whether CXCR1 transcripts are present in other brain regions, whether they are expressed at the single-cell level in molecularly identified neurons and astrocytes, and how they are regulated during early postnatal development. In addition, possible cellular colocalization of CXCR1 and CXCR2 transcripts was examined. Semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) revealed that CXCR1 mRNAs were expressed in the septum, striatum, hippocampus, cerebellum, and cortex (temporoparietal and entorhinal) at different levels and appeared to be regulated independently from CXCR2 during development. By using RT multiplex PCR on acutely dissociated cells from these brain regions, we show that CXCR1 transcripts were expressed in 83% of 84 sampled neurons displaying cholinergic (choline acetyltransferase mRNAs), gamma-aminobutyric acidergic (glutamic acid decarboxylases 65 and 67 mRNAs), or glutamatergic (vesicular glutamate transporters 1 and 2 mRNAs) phenotypes. CXCR1 and CXCR2 transcripts were colocalized in 45% of neurons sampled and also were present in some glial fibrillary acidic protein mRNA-expressing astrocytes. This is the first study to demonstrate the widespread expression of CXCR1 transcripts in the brain and suggests that CXCR1 may have hitherto unsuspected roles in neuromodulation and inflammation. PMID:14515358

  7. Prevalence, distribution, and viral burden of all 15 high-risk human papillomavirus types in adenosquamous carcinoma of the uterine cervix: a multiplex real-time polymerase chain reaction-based study.

    PubMed

    Quddus, M Ruhul; Manna, Pradip; Sung, C James; Kerley, Spencer; Steinhoff, Margaret M; Lawrence, W Dwayne

    2014-02-01

    Human papillomavirus (HPV) 16 and 18 are the types most commonly found in cervical adenosquamous carcinoma. Multiple HPV types have been found in cervical adenocarcinoma but not in the adenosquamous variant. Type-specific detection of high-risk (HR) HPV allows the detection of co-infection by multiple HPV types and assessment of viral load per cell. Our aim was to identify and quantify all HR HPV types in cervical adenosquamous carcinoma and to correlate viral loads with prognosis-related histologic features. All 15 HR HPV types were tested for by multiplex real-time polymerase chain reaction, and standard curves were created for each type. Viral loads were determined retrospectively. Prognosis-related histologic features were correlated with specific HPV types and the viral loads. A total of 80% of the tumors examined expressed HPV. Types 16/18 were detected in 86% of these cases, whereas the remaining 14% of the positive cases were infected by other types. A single type of virus was detected in 67% of cases, 2 in 29%, and 3 in 4%. Poor prognostic features were seen in 84.6% of the tumors infected with HPV 16, 46% of those infected with HPV 18, and 100% of those infected with other types. As expected, HPV 16, HPV 18, or both were the most frequent viral types; HPV 73 was the next most frequent type. Multiple HPV types were detected in 33% of the tumors. Non-HPV 16/18 cases had low viral loads, but all of these had poor prognosis-related histologic features. Two of the three recurrent cases had multiple viral types.

  8. Presence of Shiga toxin-producing Escherichia coli O-groups in small and very-small beef-processing plants and resulting ground beef detected by a multiplex polymerase chain reaction assay.

    PubMed

    Svoboda, Amanda L; Dudley, Edward G; Debroy, Chitrita; Mills, Edward W; Cutter, Catherine N

    2013-09-01

    Shiga toxin-producing Escherichia coli (STEC) are associated with foodborne illnesses, including hemolytic uremic syndrome in humans. Cattle and consequently, beef products are considered a major source of STEC. E. coli O157:H7 has been regulated as an adulterant in ground beef since 1996. The United States Department of Agriculture Food Safety and Inspection Service began regulating six additional STEC (O145, O121, O111, O103, O45, and O26) as adulterants in beef trim and raw ground beef in June 2012. Little is known about the presence of STEC in small and very-small beef-processing plants. Therefore, we propose to determine whether small and very-small beef-processing plants are a potential source of non-O157:H7 STEC. Environmental swabs, carcass swabs, hide swabs, and ground beef from eight small and very-small beef-processing plants were obtained from October 2010 to December 2011. A multiplex polymerase chain reaction assay was used to determine the presence of STEC O-groups: O157, O145, O121, O113, O111, O103, O45, and O26 in the samples. Results demonstrated that 56.6% (154/272) of the environmental samples, 35.0% (71/203) of the carcass samples, 85.2% (23/27) of the hide samples, and 17.0% (20/118) of the ground beef samples tested positive for one or more of the serogroups. However, only 7.4% (20/272) of the environmental samples, 4.4% (9/203) of the carcass samples, and 0% (0/118) ground beef samples tested positive for both the serogroup and Shiga toxin genes. Based on this survey, small and very-small beef processors may be a source of non-O157:H7 STEC. The information from this study may be of interest to regulatory officials, researchers, public health personnel, and the beef industry that are interested in the presence of these pathogens in the beef supply. PMID:23742295

  9. Polymerase Chain Reaction for Educational Settings.

    ERIC Educational Resources Information Center

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  10. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  11. The polymerase chain reaction (PCR): general methods.

    PubMed

    Waters, Daniel L E; Shapter, Frances M

    2014-01-01

    The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter introduces the principles of PCR and discusses practical considerations from target sequence definition through to optimization and application.

  12. Colony Polymerase Chain Reaction with Schizosaccharomyces pombe.

    PubMed

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-01-01

    When screening a large number of individual Schizosaccharomyces pombe strains by polymerase chain reaction (PCR), a rapid "colony PCR" approach may be used. Numerous colony PCR protocols are available, and fundamental to them all is that the colony must be fresh (grown overnight) and that as few cells as possible are used. In this protocol, we present three reliable methods for preparing S. pombe cells for colony PCR.

  13. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE PAGES

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  14. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase.

    PubMed

    McInerney, Peter; Adams, Paul; Hadi, Masood Z

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  15. Polymerase Chain Reaction on a Viral Nanoparticle.

    PubMed

    Carr-Smith, James; Pacheco-Gómez, Raúl; Little, Haydn A; Hicks, Matthew R; Sandhu, Sandeep; Steinke, Nadja; Smith, David J; Rodger, Alison; Goodchild, Sarah A; Lukaszewski, Roman A; Tucker, James H R; Dafforn, Timothy R

    2015-12-18

    The field of synthetic biology includes studies that aim to develop new materials and devices from biomolecules. In recent years, much work has been carried out using a range of biomolecular chassis including α-helical coiled coils, β-sheet amyloids and even viral particles. In this work, we show how hybrid bionanoparticles can be produced from a viral M13 bacteriophage scaffold through conjugation with DNA primers that can template a polymerase chain reaction (PCR). This unprecedented example of a PCR on a virus particle has been studied by flow aligned linear dichroism spectroscopy, which gives information on the structure of the product as well as a new protototype methodology for DNA detection. We propose that this demonstration of PCR on the surface of a bionanoparticle is a useful addition to ways in which hybrid assemblies may be constructed using synthetic biology.

  16. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    ERIC Educational Resources Information Center

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  17. Integrated polymerase chain reaction/electrophoresis instrument

    DOEpatents

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  18. Methylation-sensitive polymerase chain reaction.

    PubMed

    Moore, Hannah R; Meehan, Richard R; Young, Lorraine E

    2006-01-01

    Here, we describe a robust and reproducible methylation-sensitive polymerase chain reaction (MS-PCR) method to detect the percentage methylation in repeat sequences of individual pre-implantation ovine embryos produced by different embryo technologies. This method allows the comparison of embryos produced by nuclear transfer with other production and embryo culture methods, accounting for the heterogeneity between embryos within a single treatment. DNA extracted from single embryos is digested with a methylation-sensitive restriction enzyme to determine the percentage methylation after PCR amplification in comparison with an undigested control. The undigested control represents 100% methylation because methylation-sensitive enzymes do not cut methylated DNA, allowing the entire sample to be amplified by PCR. Image analysis quantification of the digested subsample PCR product on an ethidium bromide-stained agarose gel is proportional to the amount of methylated DNA in each embryo. By comparing quadruplicate values obtained for each embryo against a standard curve, we are able to ensure the validity of our results for each individual embryo. Compared with bisulphite sequencing methods, the method described is rapid, inexpensive, and relatively high-throughput. PMID:16761730

  19. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  20. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    PubMed

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  1. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients

    PubMed Central

    Seekhuntod, Sirirat; Thavarungkul, Paninee; Chaichanawongsaroj, Nuntaree

    2016-01-01

    Background Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR) inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC). The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR) assay to detect KRAS mutations. Methods We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D). We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE) colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay. Results Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%), G12D (25.83%) and G12V (12.50%) in codon 12. Conclusion The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues. PMID:26812617

  2. Multiplexed miRNA northern blots via hybridization chain reaction

    PubMed Central

    Schwarzkopf, Maayan; Pierce, Niles A.

    2016-01-01

    Northern blots enable detection of a target RNA of interest in a biological sample using standard benchtop equipment. miRNAs are the most challenging targets as they must be detected with a single short nucleic acid probe. With existing approaches, it is cumbersome to perform multiplexed blots in which several RNAs are detected simultaneously, impeding the study of interacting regulatory elements. Here, we address this shortcoming by demonstrating multiplexed northern blotting based on the mechanism of hybridization chain reaction (HCR). With this approach, nucleic acid probes complementary to RNA targets trigger chain reactions in which fluorophore-labeled DNA hairpins self-assemble into tethered fluorescent amplification polymers. The programmability of HCR allows multiple amplifiers to operate simultaneously and independently within a blot, enabling straightforward multiplexing. We demonstrate simultaneous detection of three endogenous miRNAs in total RNA extracted from 293T and HeLa cells. For a given target, HCR signal scales linearly with target abundance, enabling relative and absolute quantitation. Using non-radioactive HCR, sensitive and selective miRNA detection is achieved using 2′OMe-RNA probes. The HCR northern blot protocol takes ∼1.5 days independent of the number of target RNAs. PMID:27270083

  3. Multiplexed miRNA northern blots via hybridization chain reaction.

    PubMed

    Schwarzkopf, Maayan; Pierce, Niles A

    2016-09-01

    Northern blots enable detection of a target RNA of interest in a biological sample using standard benchtop equipment. miRNAs are the most challenging targets as they must be detected with a single short nucleic acid probe. With existing approaches, it is cumbersome to perform multiplexed blots in which several RNAs are detected simultaneously, impeding the study of interacting regulatory elements. Here, we address this shortcoming by demonstrating multiplexed northern blotting based on the mechanism of hybridization chain reaction (HCR). With this approach, nucleic acid probes complementary to RNA targets trigger chain reactions in which fluorophore-labeled DNA hairpins self-assemble into tethered fluorescent amplification polymers. The programmability of HCR allows multiple amplifiers to operate simultaneously and independently within a blot, enabling straightforward multiplexing. We demonstrate simultaneous detection of three endogenous miRNAs in total RNA extracted from 293T and HeLa cells. For a given target, HCR signal scales linearly with target abundance, enabling relative and absolute quantitation. Using non-radioactive HCR, sensitive and selective miRNA detection is achieved using 2'OMe-RNA probes. The HCR northern blot protocol takes ∼1.5 days independent of the number of target RNAs. PMID:27270083

  4. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  5. [The contamination under polymerase chain reaction studies: problems and solutions].

    PubMed

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  6. A noncontact temperature measurement method in polymerase chain reaction reactors

    NASA Astrophysics Data System (ADS)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  7. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  8. Mathematics analysis of polymerase chain reaction kinetic curves.

    PubMed

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  9. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOEpatents

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  10. Use of polymerase chain reaction for rapid diagnosis of tuberculosis.

    PubMed Central

    Cousins, D V; Wilton, S D; Francis, B R; Gow, B L

    1992-01-01

    A DNA amplification assay using the polymerase chain reaction technique designed for the rapid identification of Mycobacterium bovis organisms was used to test 211 human mycobacterial isolates and 177 clinical specimens previously submitted for routine mycobacterial culture. The procedures described could be used by routine or specialist laboratories for identification of M. tuberculosis complex organisms in 4 h and/or as a rapid screening method for the direct detection of M. tuberculosis complex organisms in specimens. Images PMID:1734065

  11. Design and optimization of molecular beacon real-time polymerase chain reaction assays.

    PubMed

    Vet, Jacqueline A M; Marras, Salvatore A E

    2005-01-01

    During the last few years, several innovative technologies have become available for performing sensitive and accurate genetic analyses. These techniques use fluorescent detection strategies in combination with nucleic acid amplification protocols. Most commonly used is the real-time polymerase chain reaction (PCR). To achieve the maximum potential of a real-time PCR assay, several parameters must be evaluated and optimized independently. This chapter describes the different steps necessary for establishing a molecular beacon real-time PCR assay: (1) target design, (2) primer design, (3) optimization of the amplification reaction conditions using SYBR Green, (4) molecular beacon design, and (5) molecular beacon synthesis and characterization. The last section provides an example of a multiplex quantitative real-time PCR.

  12. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  13. Methods in molecular cardiology: the polymerase chain reaction

    PubMed Central

    Sonnemans, D.G.P.; de Windt, L.J.; de Muinck, E.D.; Doevendans, P.A.

    2002-01-01

    Several polymerase chain reaction (PCR) techniques are described in this review to give insight into the potential applications for cardiovascular research. Although PCR can be performed in several ways, all applications are based on the same general principle, the amplification of DNA or RNA by the enzyme polymerase. This amplification provides the opportunity to detect, identify and multiply a single copy of DNA or RNA, in or outside the cell. This powerful technique can be used in several directions of DNA and RNA research resulting in the ability to specifically detect the presence and activity of genes. The use of these techniques in cardiovascular research is discussed here. ImagesFigure 1Figure 2Figure 4Figure 5Figure 6Figure 7Figure 8Figure 9 PMID:25696037

  14. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  15. Simultaneous Removal of Multiple DNA Segments by Polymerase Chain Reactions.

    PubMed

    Krishnamurthy, Vishnu; Zhang, Kai

    2017-01-01

    Precise DNA manipulation is a key enabling technology for synthetic biology. Approaches based on restriction digestion are often limited by the presence of certain restriction enzyme recognition sites. Recent development of restriction-free cloning approaches has greatly enhanced the flexibility and speed of molecular cloning. Most restriction-free cloning methods focus on DNA assembly. Much less work has been dedicated towards DNA removal. Here we introduce a protocol that allows simultaneous removal of multiple DNA segments from a plasmid using polymerase chain reactions (PCR). Our approach will be beneficial to applications in multiple sites mutagenesis, DNA library construction, genetic and protein engineering, and synthetic biology. PMID:27671942

  16. Automated polymerase chain reaction in capillary tubes with hot air.

    PubMed

    Wittwer, C T; Fillmore, G C; Hillyard, D R

    1989-06-12

    We describe a simple, compact, inexpensive thermal cycler that can be used for the polymerase chain reaction. Based on heat transfer with air to samples in sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The temperature is regulated via thermocouple input to a programmable set-point process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter. Temperature-time profiles and amplification results approximate those obtained using water baths and microfuge tubes.

  17. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    PubMed

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  18. Diagnostic challenges of tuberculous lymphadenitis using polymerase chain reaction analysis: a case study.

    PubMed

    Taniguchi, Hirokazu; Nakamura, Masahiko; Shimokawa, Kazuki; Kamiseki, Fumi; Ishizawa, Shin; Abo, Hitoshi; Furuse, Hideaki; Tsuda, Takeshi; Masaki, Yasuaki; Suzuki, Kensuke

    2015-01-01

    This report presents a case of tuberculous lymphadenitis that was difficult to diagnose using polymerase chain reaction analysis. An 80-year-old Japanese female was hospitalized due to swollen cervical lymph nodes. Her lymph node tests revealed paradoxical polymerase chain reaction results. Polymerase chain reaction analysis of two biopsy tissues using the Cobas TaqMan revealed a positive result for Mycobacterium avium and a negative result for Mycobacterium tuberculosis. However, polymerase chain reaction analysis of a cultured colony of acid-fast bacteria from biopsy tissue using the Cobas TaqMan and an alternative polymerase chain reaction analysis of biopsy tissue yielded discordant results. The patient was diagnosed as having tuberculous lymphadenitis. She was treated with antitubercular drugs and subsequently had a reduction in cervical lymph node swelling. Polymerase chain reaction analysis is not 100% accurate; hence, its use as a diagnostic tool for mycobacterial infection requires increased attention.

  19. Identification of duck plague virus by polymerase chain reaction.

    PubMed

    Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. PMID:10216766

  20. Convective polymerase chain reaction around micro immersion heater

    NASA Astrophysics Data System (ADS)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  1. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    PubMed

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  2. Quantification of chicken anaemia virus by competitive polymerase chain reaction.

    PubMed

    Yamaguchi, S; Kaji, N; Munang'andu, H M; Kojima, C; Mase, M; Tsukamoto, K

    2000-08-01

    A quantitative method for chicken anaemia virus (CAV) was developed using competitive polymerase chain reaction (PCR). Competitive template was constructed by deletion of 33 nucleotides from a wildtype DNA clone of CAV. Quantification of CAV DNA molecules by the competitive PCR was rapid and highly reproducible when compared with conventional infectivity titration methods. The ratios of the viral DNA molecules and infectivity titres in MDCC-MSB1 cells varied between 1.3 and 3.55 log(10) among several isolates, suggesting the existence of different infection efficiencies to MDCC-MSB1 cells by isolates. The competitive PCR will be useful for studying CAV infection in vivo and/or in vitro.

  3. Rapid electrochemiluminescence assays of polymerase chain reaction products.

    PubMed

    Kenten, J H; Casadei, J; Link, J; Lupold, S; Willey, J; Powell, M; Rees, A; Massey, R

    1991-09-01

    We demonstrate the first use of an electrochemiluminescent (ECL) label, [4-(N-succimidyloxycarbonylpropyl)-4'-methyl-2,2'- bipyridine]ruthenium(II) dihexafluorophosphate (Origen label; IGEN Inc.), in DNA probe assays. This label allows rapid (less than 25 min) quantification and detection of polymerase chain reaction (PCR)-amplified products from oncogenes, viruses, and cloned genes. For the PCR, we used labeled oligonucleotide primers complementary to human papiloma virus and the Ha-ras oncogene. These samples were followed by ECL analysis or hybridization with specific, Origen-labeled oligonucleotide probes. These studies demonstrate the speed, specificity, and effectiveness of the new ECL labels, compared with 32P, for nucleic acid probe applications. We describe formats involving conventional methodologies and a new format that requires no wash step, allowing simple and rapid sample analysis. These rapid assays also reduce PCR contamination, by requiring less sample handling. Improvements in ECL detectability are currently under investigation for use in DNA probe assays without amplification.

  4. Use of polymerase chain reaction for detection of Chlamydia trachomatis.

    PubMed

    Ostergaard, L; Birkelund, S; Christiansen, G

    1990-06-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved amplified sequences, Southern hybridization, or dot blot analysis. The PCR assay was optimized and, after 40 cycles of amplification with primer set II, demonstrated a sensitivity of 10(-17) g of DNA, which corresponds to the detection of one copy of the plasmid. Because of the high sensitivity, we developed a closed system in which airborne contamination was minimized. Analysis of 228 clinical samples tested by cell culture, IDEIA enzyme immunosorbent assay (Medico-Nobel, Boots-Celltech Ltd., Berkshire, United Kingdom), and PCR showed a sensitivity of 100%, a specificity of 93% when PCR was compared with cell culture, and a corrected specificity of 99% when PCR was compared with cell culture or IDEIA.

  5. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  6. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    PubMed Central

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  7. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    PubMed

    Lorenz, Todd C

    2012-01-01

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  8. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    PubMed

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  9. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    PubMed

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  10. Taylor dispersion in polymerase chain reaction in a microchannel

    NASA Astrophysics Data System (ADS)

    Lee, Jinkee; Kulla, Elejdis; Chauhan, Anuj; Tripathi, Anubhav

    2008-09-01

    Polymerase chain reaction (PCR) is commonly used for a wide range of DNA applications such as disease detection, genetic fingerprinting, and paternity testing. The importance of PCR has led to an increased interest in performing PCR in a microfluidic platform with a high throughput while using very small DNA quantities. In this paper we solve convection-diffusion equations for the DNA and deoxynucleoside triphosphate (dNTP) under conditions suitable for PCR operation in a microchip. These include pressure driven flow accompanied by temporal temperature changes that lead to an amplification reaction, which is modeled as a first order reaction. The convection-diffusion-reaction equations are solved by using the method of multiple time scales to yield average equations that can be solved to obtain the long time evolution of the concentration profiles. The results obtained by solving the averaged equations agree well with full numerical solutions. The averaged equations are also solved to simulate the PCR to illustrate some interesting aspects of this operation in a microfluidic device. It is shown that insufficient nucleotide concentrations can lead to complete depletion of NTP at certain axial locations, which leads to termination of DNA amplification at these locations, resulting in formation of a plateau in DNA concentration.

  11. Integrated reverse transcription polymerase chain reaction systems for virus detection.

    PubMed

    Lien, Kang-Yi; Lee, Wan-Chi; Lei, Huan-Yao; Lee, Gwo-Bin

    2007-03-15

    The current study reports on an integrated microreverse transcription polymerase chain reaction (RT-PCR) system for molecular diagnosis of microorganisms automatically. By using antibodies-conjugated superparamagnetic beads, the developed system can detect viruses with higher sensitivity and specificity when compared with traditional biological diagnosis methods using a ribonucleic acid (RNA) extraction kit. The target viruses were first captured by the conjugated antibodies on the magnetic beads, and were enriched using a magnetic field generated by micro-electromagnets or permanent magnets. With this approach, the virus can be purified and concentrated first, then the virus RNA was extracted and transcripted to complementary deoxyribonucleic acid (cDNA), followed by a nucleic acid amplification process using a micro-RT-PCR module. The integrated microfluidic chip can perform the whole process automatically with the aid of integrated micropumps and microvalves. This study successfully performs the specific detection of two different types of viruses, Dengue virus serotype 2 and enterovirus (EV) 71 using this developed integrated system. Comparable to a large-scale apparatus, the integrated microsystem can perform mixing, incubation, purification, transportation, and nucleic acid amplification of virus, possibly making it a crucial platform for future diagnosis applications.

  12. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    NASA Astrophysics Data System (ADS)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  13. Polymerase chain reaction preparation of template for massively parallel pyrosequencing.

    PubMed

    Whetten, Ross W; Sofía, Valenzuela A; Frampton, John

    2009-04-01

    Massively parallel pyrosequencing of DNA fragments immobilized on beads has been applied to genome survey sequencing and transcriptome analysis of a variety of eukaryotic organisms, including laboratory model species, agricultural crops and livestock, and species of interest to population biologists and ecologists. Preparation of sufficient high-quality template for sequencing has been an obstacle to sequence analysis of nucleic acids from tissues or cell types available in limited quantities. We report that the use of a biotinylated primer for polymerase chain reaction amplification allows removal of excess primer and poly(A) tract fragments from the sequencing templates, providing much higher yields of useful sequence information from pyrosequencing of amplified templates. This advance allows deep sequencing analysis of nucleic acids isolated from very small tissue samples. Massively parallel pyrosequencing is particularly useful for preliminary investigations of species that have not yet been the subject of significant genomic research, as genomic survey sequences and catalogs of expressed genes provide a means of linking the biology of less intensively studied species to that of more intensively studied model organisms. We obtained over 220 Mb of transcript DNA sequences from Abies fraseri (Pursh) Poir., a conifer species native to the southern Appalachian Mountains of eastern North America. Comparison of the resulting assembled putative transcripts with similar data obtained by other sequencing methods from other conifers demonstrates the utility of the improved sequencing template preparation. PMID:19503624

  14. Preparation of samples for polymerase chain reaction in situ.

    PubMed

    Nuovo, G J

    1996-01-01

    The purpose of this paper is to describe the key variables in sample and reagent preparation needed for successful polymerase chain reaction (PCR) in situ. Tissue or cell preparations should be fixed in a cross linking fixative, such as 10% buffered formalin, preferably from 15 to 48 hours. Tissues should be embedded in paraffin; cell preparations can be fixed when near confluence, then physically removed and processed. When possible three samples (4 microM tissue sections or 1-5000 cells) should be placed on silane coated glass slides. Digestion in pepsin (2 mg/ml) for 30 min is adequate for DNA detection by PCR in situ hybridization whereas optimal protease digestion time is variable and related to formalin fixation time for reverse transcriptase (RT) in situ PCR. RT in situ PCR requires an overnight digestion with DNase. The amplifying solution should contain 4.5 mM MgCl2, 0.05% bovine serum albumin, and, for RNA analysis, the reporter nucleotide. A false positive signal would be evident with incorporation of the reporter nucleotide for DNA targets due to DNA repair; this can be avoided with frozen, fixed tissues and the hot start maneuver. Otherwise, one needs to use a labeled probe and a hybridization step to detect amplified DNA targets in paraffin embedded tissues.

  15. Fluorescence-based temperature control for polymerase chain reaction.

    PubMed

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  16. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    PubMed

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents.

  17. Rapid retrovirus titration using competitive polymerase chain reaction.

    PubMed

    Tafuro, S; Zentilin, L; Falaschi, A; Giacca, M

    1996-08-01

    A quantitative polymerase chain reaction (PCR) procedure has been developed for rapid retrovirus titration. This procedure, which is based on the simultaneous amplification of the sample with known amounts of a competitor DNA fragment (competitive PCR), was used for the quantification of viral RNA genomes in retrovirus-producing cell clone supernatants and of proviral DNA molecules formed at 24 h after infection of different reference cell lines. The results obtained from the analysis of several samples indicated that proviral DNA quantification is in complete agreement with the number of selectable colonies in a standard colony assay. Conversely, the number of viral RNA genomes in the producer cell clone supernatants is a poor predictor of the actual efficiency of infection. Repeated competitive PCR experiments for provirus copy number determination at different times after transduction indicated that the number of proviral DNA molecules remains stable over time, suggesting stable integration into the host genome. The developed procedure is rapid and simple, is applicable to retroviral constructs not containing a selectable gene and can be used to directly measure the efficiency of infection of any target cell type, thus overcoming the problem of the dependency of retroviral titer determination on the rate of expression of a selectable gene and on the efficiency of colony formation of a reference cell line.

  18. Detection of flaviviruses by reverse-transcriptase polymerase chain reaction.

    PubMed

    Eldadah, Z A; Asher, D M; Godec, M S; Pomeroy, K L; Goldfarb, L G; Feinstone, S M; Levitan, H; Gibbs, C J; Gajdusek, D C

    1991-04-01

    RNA sequences of five flaviviruses were detected by a modified polymerase chain reaction (PCR) that incorporated a reverse transcriptase and RNase inhibitor. Oligonucleotide primer pairs were synthesized to amplify sequences from St. Louis encephalitis (SLE), Japanese encephalitis (JBE), yellow fever (YF), dengue 2 (DEN-2), and dengue 4 (DEN-4) viruses. The amplified products were visualized as bands of appropriate size on ethidium bromide-stained agarose gels. The identity of these products was confirmed by restriction endonuclease cleavage to generate fragments of predicted lengths. The reverse-transcriptase PCR (RT-PCR) successfully amplified flavivirus sequences from cell cultures, frozen brain tissue, and formalin-fixed, paraffin-embedded brain tissue. The reactions were highly specific, and the method compared favorably to two conventional assays of viral infectivity. RT-PCR followed by PCR with nesting primers (N-PCR) was 1,000-fold more sensitive in detecting virus than classical infectivity titration by intracerebral inoculation of suckling mice and nearly 1,000-fold more sensitive than amplification of virus in cell culture followed by inoculation of mice.

  19. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    SciTech Connect

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  20. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  1. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    PubMed

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  2. The Future of Digital Polymerase Chain Reaction in Virology.

    PubMed

    Vynck, Matthijs; Trypsteen, Wim; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2016-10-01

    Driven by its potential benefits over currently available methods, and the recent development of commercial platforms, digital polymerase chain reaction (dPCR) has received increasing attention in virology research and diagnostics as a tool for the quantification of nucleic acids. The current technologies are more precise and accurate, but may not be much more sensitive, compared with quantitative PCR (qPCR) applications. The most promising applications with the current technology are the analysis of mutated sequences, such as emerging drug-resistant mutations. Guided by the recent literature, this review focuses on three aspects that demonstrate the potential of dPCR for virology researchers and clinicians: the applications of dPCR within both virology research and clinical virology, the benefits of the technique over the currently used real-time qPCR, and the importance and availability of specific data analysis approaches for dPCR. Comments are provided on current drawbacks and often overlooked pitfalls that need further attention to allow widespread implementation of dPCR as an accurate and precise tool within the field of virology.

  3. Diagnosis of duck plague in waterfowl by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  4. Nanogold-assisted multi-round polymerase chain reaction (PCR).

    PubMed

    Pan, Jiakui; Li, Haikuo; Cao, Xueyan; Huang, Jiehuan; Zhang, Xiaodong; Fan, Chunhai; Hu, Jun

    2007-12-01

    We have previously demonstrated that nanogold effectively enhances the specificity and yield of error-prone two-round polymerase chain reaction (PCR). Here we reported that, with the assistance of nanogold, we could perform multi-round PCR. In the presence of appropriate amount of 10 nm nanogold, we could obtain the target product even after six rounds of PCR, as manifested by a single bright band in gel electrophoresis (1% agarose). In fact, we could still observe the target band even at the 7th round of PCR, which nevertheless was accompanied by smearing bands (non-specific amplification). In contrast, in the absence of nanogold, the target band was completely lost only after four rounds of amplification. This marked difference in the performance of multi-round PCR clearly showed that nanogold was a powerful enhancer for PCR. More importantly, with this nanogold-assisted multi-round PCR, it might be possible to produce a large amount of target DNA, or to amply very low copies of genomic DNA from rare sources.

  5. Identification of toxigenic Clostridium difficile by the polymerase chain reaction.

    PubMed Central

    Kato, N; Ou, C Y; Kato, H; Bartley, S L; Brown, V K; Dowell, V R; Ueno, K

    1991-01-01

    Toxigenic strains of Clostridium difficile are causative agents of pseudomembranous colitis and antimicrobial agent-associated diarrhea and colitis. The toxigenicity is routinely assayed by using highly sensitive cell cultures. We used a simple and rapid polymerase chain reaction (PCR) assay to differentiate toxigenic and nontoxigenic strains of C. difficile. Two sets of oligonucleotide primer pairs derived from nonrepeating sequences of the toxin A gene were used to amplify 546- and 252-bp DNA fragments. A primer pair derived from repeating sequences of the toxin A gene was used to amplify a 1,266-bp DNA product. Amplified products were visualized by polyacrylamide gel electrophoresis followed by ethidium bromide staining. All 35 cytotoxic strains of C. difficile tested generated the expected amplified DNA. In contrast, none of the 26 noncytotoxic strains tested gave positive results. Although the toxins of C. difficile have been demonstrated to cross-react serologically with the toxins of Clostridium sordellii, we did not detect any amplified DNA in two cytotoxic strains or seven noncytotoxic strains of C. sordellii. PCR was negative in all 30 strains of 20 other Clostridium species. Southern hybridization of HindIII-digested genomic DNA by use of subgenomic probes showed a single hybridization band in toxigenic strains but not in nontoxigenic strains. PCR appears to be a sensitive and specific assay for the rapid identification of toxigenic C. difficile. Nontoxigenic C. difficile appeared to lack the C. difficile toxin A gene. Images PMID:1993763

  6. Analysis of human cytomegalovirus using the polymerase chain reaction.

    PubMed

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  7. Detection of Francisella tularensis by the polymerase chain reaction.

    PubMed

    Junhui, Z; Ruifu, Y; Jianchun, L; Songle, Z; Meiling, C; Fengxiang, C; Hong, C

    1996-12-01

    Francisella tularensis is the causative agent of tularaemia. Effective antibiotic treatment of tularaemia is now available, but the early diagnosis of tularaemia remains a problem. Four primers (three pairs) were designed to detect F. tularensis by the polymerase chain reaction (PCR), based on the previously published nucleotide sequence of T-cell epitopes of a F. tularensis membrane protein. Amplification of purified F. tularensis chromosomal DNA with the three pairs of primers resulted in three different products with sizes consistent with those predicted from sequence data (211 bp, 347 bp and 568 bp). The specificity of the PCR was confirmed as no amplification was detected with a range of other bacteria. The sensitivity of the PCR was determined with limiting dilution PCR and viable counts. The preliminary application of the PCR to the detection of F. tularensis in aerosols and experimentally infected mice was investigated. Comparison of the results with those from traditional culture indicated that PCR was more sensitive. The animal challenge test showed that, 24 h after inoculation with 15 cfu of F. tularensis, 38 (82.6%) of 46 blood samples were positive by PCR, whereas only 22 (47.8%) were positive by culture. The results showed that PCR is a helpful tool for the detection of F. tularensis in blood, liver and spleen which should enable the rapid confirmation of clinical diagnoses of tularaemia. PMID:8958253

  8. Identifying of meat species using polymerase chain reaction (PCR)

    SciTech Connect

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  9. Detection of hog cholera virus and differentiation from other pestiviruses by polymerase chain reaction.

    PubMed

    Wirz, B; Tratschin, J D; Müller, H K; Mitchell, D B

    1993-05-01

    Reverse transcription coupled with the polymerase chain reaction (RT-PCR) was used for the detection and differentiation of pestiviruses. For this purpose, one primer pair was selected from a highly conserved region of the genome of pestiviruses. Using these primers (PEST 1-PEST 2), DNA fragments of between 72 and 74 bp could be amplified from all pestivirus isolates tested. In order to differentiate hog cholera virus (HCV) from bovine viral diarrhea virus (BVDV) and border disease virus (BDV), we selected a primer pair from a conserved region in the genome of HCV strains that differed from that sequenced in the genome of BVDV strains. By using these primers (HCV 1-HCV 2), a DNA fragment of 478 bp could be specifically amplified from HCV isolates. By these means, viral RNA was detected in extracts of lymph node, spleen, tonsil, and lung. Such extracts were used directly for RT-PCR without prior RNA isolation. We also performed multiplex PCR by using both the PEST 1-PEST 2 and HCV 1-HCV 2 primer pairs in a single reaction. This allowed the differentiation of HCV from BVDV and BDV in one step. To assess the sensitivity of the method, RT-PCR was compared with virus propagation in tissue culture and subsequent detection by immunofluorescence staining. The results show that RT-PCR is useful for the rapid detection and differentiation of pestiviruses. PMID:8388887

  10. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    PubMed

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  11. Polymerase chain reaction-based analysis to detect terrestrial animal protein in fish meal.

    PubMed

    Bellagamba, Federica; Valfrè, Franco; Panseri, Sara; Moretti, Vittorio M

    2003-04-01

    The recent European bovine spongiform encephalopathy crisis has focused attention on the importance of adopting stringent control measures to avoid the risk of the diffusion of mad cow disease through meat meal-based animal feedstuffs. Potential adulteration of such feedstuffs with bone particles from terrestrial animals is determined by microscopic examination by law before the release of these feedstuffs for free circulation in the European Community. This study describes a DNA monitoring method to examine fish meal for contamination with mammalian and poultry products. A polymerase chain reaction (PCR) method based on the nucleotide sequence variation in the 12S ribosomal RNA gene of mitochondrial DNA was developed and evaluated. Three species-specific primer pairs were designed for the identification of ruminant, pig, and poultry DNA. The specificity of the primers used in the PCR was tested by comparison with DNA samples for several vertebrate species and confirmed. The PCR specifically detected mammalian and poultry adulteration in fish meals containing 0.125% beef, 0.125% sheep, 0.125% pig, 0.125% chicken, and 0.5% goat. A multiplex PCR assay for ruminant and pig adulteration was optimized and had a detection limit of 0.25%. PMID:12696697

  12. Trends and advances in food analysis by real-time polymerase chain reaction.

    PubMed

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  13. Trends and advances in food analysis by real-time polymerase chain reaction.

    PubMed

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  14. A diagnostic polymerase chain reaction assay for Zika virus.

    PubMed

    Balm, Michelle N D; Lee, Chun Kiat; Lee, Hong Kai; Chiu, Lily; Koay, Evelyn S C; Tang, Julian W

    2012-09-01

    Zika virus (ZIKV) is a mosquito-borne flavivirus. Infection results in a dengue-like illness with fever, headache, malaise, and a maculopapular rash. Nearly all cases are mild and self-limiting but in 2007, a large outbreak of ZIKV was reported from the island of Yap (in Micronesia, northwest of Indonesia). Singapore is already endemic for dengue, and its impact on public health and economic burden is significant. Other dengue-like infections (e.g., Chikungunya virus) are present. Yet only 10% of reported dengue cases have laboratory confirmation. The identification and control of other dengue-like, mosquito-transmitted infections is thus important for the health of Singapore's population, as well as its economy. Given that ZIKV shares the same Aedes mosquito vector with both dengue and Chikungunya, it is possible that this virus is present in Singapore and causing some of the mild dengue-like illness. A specific and sensitive one-step, reverse transcription polymerase chain reaction (RT-PCR) with an internal control (IC) was designed and tested on 88 archived samples of dengue-negative, Chikungunya-negative sera from patients presenting to our hospital with a dengue-like illness, to determine the presence of ZIKV in Singapore. The assay was specific for detection of ZIKV and displayed a lower limit of detection (LoD) of 140 copies viral RNA/reaction when tested on synthetic RNA standards prepared using pooled negative patient plasma. Of the 88 samples tested, none were positive for ZIKV RNA, however, the vast majority of these were from patients admitted to hospital and further study may be warranted in community-based environments.

  15. Detection of Chlamydia pneumoniae by polymerase chain reaction.

    PubMed

    Campbell, L A; Perez Melgosa, M; Hamilton, D J; Kuo, C C; Grayston, J T

    1992-02-01

    While criteria for serodiagnosis of Chlamydia pneumoniae infection are well established, isolation of the organism is often difficult. To increase detection of this organism, C. pneumoniae-specific sequences were identified to permit amplification of C. pneumoniae by polymerase chain reaction (PCR). A cloned C. pneumoniae 474-bp PstI fragment was shown by dot blot and Southern hybridization to differentiate C. pneumoniae from the other Chlamydia spp., react with all C. pneumoniae isolates tested, and not recognize DNA from normal throat flora or common respiratory tract agents. This cloned fragment was sequenced and primers for use in PCR were chosen on the bases of GenBank analysis, G + C ratio, and absence of secondary structure. All C. pneumoniae isolates tested were amplified by the HL-1-HR-1 primer pair or the HM-1-HR-1 primer pair, producing the expected 437- and 229-bp amplification products, respectively. None of the Chlamydia trachomatis serovars (B/TW-5/OT, C/TW-3/OT, D/UW-3/Cx, E/UW-5/Cx, F/UW-6/Cx, H/UW-4/Cx, I/UW-12/Ur, and L2/434/Bu), Chlamydia psittaci strains (Mn, 6BC, GPIC, FP, and OA), HeLa cells, or other organisms tested were amplified. Reaction conditions including MgCl2, oligonucleotides, and primer concentrations and temperature were optimized before application to clinical samples. Clinical specimens from patients from whom C. pneumoniae was isolated were also positive by PCR, while samples from patients with known C. trachomatis or C. psittaci infection were not amplified by PCR.

  16. [Detection of bacterial DNA using the polymerase chain reaction (PCR)].

    PubMed

    Höfler, G

    1994-01-01

    Enzymatic amplification of DNA using the polymerase chain reaction (PCR) is a very sensitive and rapid way of detecting specific DNA sequences. Bacterial DNA can be detected in a wide variety of samples provided at least partial sequence information is available. For a great number of bacteria PCR detection methods have been published. Most important for the pathologist are mycobacteriae (M. tuberculosis, avium, etc.). Borellia burgdorferi, Listeria monozytogenes and chlamydiae (Ce. trachomatis, C. psittaci). Fresh or fixed paraffin embedded tissues, exfoliated cells, whole blood, serum, sputum, urine, ascites or pleural fluid etc. can be analyzed. The time needed to perform the analysis varies between 5 hours and 2 days mostly depending on the DNA extraction method. Several potential pitfalls have to be avoided. The most common problem is contamination of reagents with target DNA. Amplification of DNA from biological samples may be prevented by enzyme inhibitors (salts, proteins). This problem can at least partially be avoided by changing the DNA purification method. Several additional problems may arise if bacterial DNA has to be amplified. Bacterial walls may have to be disrupted using heat or detergent for accessibility of target DNA. Positive results have to be judged carefully. Unlike the situation in retroviral infections with the virus sometimes present in the absence of disease, in the majority of bacterial infections the presence of bacteria signals manifest disease. A possible exception may be the finding of mycobacterial DNA in sarcoidosis patients who can be treated with steroids without provoking tuberculosis. PCR is especially useful in situations where rapid results are necessary or only fixed tissue is available.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7533972

  17. Diagnosis of equine influenza by the polymerase chain reaction.

    PubMed

    Donofrio, J C; Coonrod, J D; Chambers, T M

    1994-01-01

    Influenza A is a common respiratory infection of horses, and rapid diagnosis is important for its detection and control. Sensitive detection of influenza currently requires viral culture and is not always feasible. The polymerase chain reaction (PCR) was used to detect DNA produced by reverse transcription of equine influenza in stored nasal secretions, vaccines, and allantoic fluids. Primers directed at a target of 212 bp on conserved segment 7 (matrix gene) of human influenza A/Bangkok/1/79(H3N2) produced amplification products of appropriate size with influenza A/Equine/Prague/1/56 (H7N7), A/Equine/Miami/63 (H3N8), A/Equine/Kentucky/79 (H3N8), and A/Equine/Kentucky/2/91 (H3N8) in infected frozen allantoic fluids and in frozen extracts of nasal swabs of 2 horses with naturally acquired influenza. The products bound a 32P-labeled hybridization probe to an inner region of the target. Control samples, including nasal secretions from a horse infected with herpesvirus, were negative. In a prospective study, 2 ponies inhaled aerosols of influenza A/Equine/Kentucky/2/91 (H3N8), and thereafter supernatants of nasal swabs in transport medium were obtained daily for 10 days for culture and PCR. Amplification products were evaluated by size and binding of a 32P-labeled probe and also by dot-blotting and binding of a biotin-labeled probe. Culture detected influenza more consistently than did PCR in the first 2 days of infection, but PCR detected virus more often later in infection. Gels were the most sensitive, but radiometric and biotin-labeled probes gave specific results and were consistently positive from days 3-6. PCR is suitable for detection of equine influenza in clinical samples. PMID:8011780

  18. A circular ferrofluid driven microchip for rapid polymerase chain reaction.

    PubMed

    Sun, Y; Kwok, Y C; Nguyen, N T

    2007-08-01

    In the past few years, much attention has been paid to the development of miniaturized polymerase chain reaction (PCR) devices. After a continuous flow (CF) PCR chip was introduced, several CFPCR systems employing various pumping mechanisms were reported. However, the use of pumps increases cost and imposes a high requirement on microchip bonding integrity due to the application of high pressure. Other significant limitations of CFPCR devices include the large footprint of the microchip and the fixed cycle number which is dictated by the channel layout. In this paper, we present a novel circular close-loop ferrofluid driven microchip for rapid PCR. A small ferrofluid plug, containing sub-domain magnetic particles in a liquid carrier, is driven by an external magnet along the circular microchannel, which in turn propels the PCR mixture through three temperature zones. Amplification of a 500 bp lambda DNA fragment has been demonstrated on the polymethyl methacrylate (PMMA) PCR microchip fabricated by CO(2) laser ablation and bonded by a low pressure, high temperature technique. Successful PCR was achieved in less than 4 min. Effects of cycle number and cycle time on PCR products were investigated. Using a magnet as the actuator eliminates the need for expensive pumps and provides advantages of low cost, small power consumption, low requirement on bonding strength and flexible number of PCR cycles. Furthermore, the microchip has a much simpler design and smaller footprint compared to the rectangular serpentine CFPCR devices. To demonstrate its application in forensics, a 16-loci short tandem repeat (STR) sample was successfully amplified using the PCR microchip.

  19. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  20. Application of polymerase chain reaction to detect adulteration of sheep's milk with goats' milk.

    PubMed

    López-Calleja, I; González, I; Fajardo, V; Martín, I; Hernández, P E; García, T; Martín, R

    2005-09-01

    The polymerase chain reaction has been applied for the specific detection of goats' milk in sheep's milk using primers targeting the mitochondrial 12S ribosomal RNA gene. The use of goat-specific primers yielded a 122-bp fragment from goats' milk DNA, whereas no amplification signal was obtained in sheep's, cows', and water buffaloes' milk DNA. Polymerase chain reaction analysis of raw and heat-treated milk binary mixtures of sheep/goat enabled the specific detection of goats' milk with a sensitivity threshold of 0.1%. This study demonstrates the usefulness of the proposed polymerase chain reaction assay for authentication of milk products in routine analysis.

  1. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  2. Dataset for genotyping validation of cytochrome P450 2A6 whole-gene deletion (CYP2A6*4) by real-time polymerase chain reaction platforms

    PubMed Central

    Shimizu, Makiko; Koyama, Tomoki; Kishimoto, Izumi; Yamazaki, Hiroshi

    2015-01-01

    This data article contains a supplementary figure and validation data relating to the research article entitled “Genotyping of wild-type cytochrome P450 2A6 and whole-gene deletion using human blood samples and a multiplex real-time polymerase chain reaction method with dual-labeled probes” (Shimizu et al., Clinica Chimica Acta 441, 71–74, 2015), which presents a multiplex real-time polymerase chain reaction method with dual-labeled probes for human P450 2A6 wild-type and whole-gene deletion. Real-time methods have dramatically improved the speed of complex genetic diagnostics compared to conventional assays based on restriction enzyme digestion. Here, we show the basic assay validation data by single and multiplex determinations in comparison with commercial TaqMan copy number assays for P450 2A6. PMID:26958620

  3. Optimization of 6-carboxy-X-rhodamine concentration for real-time polymerase chain reaction using molecular beacon chemistry.

    PubMed

    Wang, Gehua; Becker, Erin; Mesa, Christine

    2007-03-01

    The optimal 6-carboxy-X-rhodamine (ROX) concentration, which is used as a passive reference dye for real-time quantitative polymerase chain reaction (PCR) with molecular beacon chemistry, was determined with the Mx4000 Multiplex Quantitative PCR System. Additionally, the effects of changing ROX concentrations on PCR reproducibility, Ct values, and efficiency were investigated with this system by using the PCR data obtained from amplification of the Escherichia coli shiga toxin 2 (stx2) gene and the Campylobacter jejuni luxS gene. This study indicated that different ROX concentrations influence many aspects of the real-time PCR reaction. ROX concentration variation could have consequences in the analysis of quantitative data and may lead to erroneous results. This study further indicated that the optimal ROX concentration is 60 nmol/L for real-time PCR, using molecular beacon chemistry for PCR assay of luxS and stx2 genes.

  4. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    PubMed

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  5. Detection of Copy Number Imbalance in Canine Urothelial Carcinoma With Droplet Digital Polymerase Chain Reaction.

    PubMed

    Mochizuki, H; Shapiro, S G; Breen, M

    2016-07-01

    Urothelial carcinoma (UC) is the most common neoplasm of the canine urinary tract. Clinical presentation of UC is shared with several other, more common urinary tract disorders, and this often delays diagnosis of the UC. Definitive diagnosis of UC requires histopathologic examination of a biopsy specimen, but the cost and invasiveness for these diagnostic tests often result in most diagnoses being made on the basis of clinical findings, diagnostic imaging, and cytologic examination of urine sediment. Regardless of the diagnostic process used, most UCs currently are not diagnosed until they are at an advanced clinical stage and so are associated with poor prognosis. Improved methods for earlier and less invasive detection are needed. In a previous study, the authors demonstrated the presence of highly recurrent DNA copy number aberrations (CNAs) in canine UC and hypothesized that detection of these CNAs in tumor cells can be used as a molecular diagnostic for UC. In this study, a multiplexed droplet digital polymerase chain reaction (ddPCR) assay was detected to detect and quantify CNAs of specific regions of canine chromosomes 8, 13, 19, and 36. The assay was effective at differentiating 31 neoplastic and 25 nonneoplastic bladder tissues based on copy number, with 100% sensitivity and specificity in tissue samples. CNAs were also detected by ddPCR in 67% (12 of 18) of urine DNA specimens derived from UC patients. The findings show that ddPCR is a useful molecular technique to detect CNAs and may be used as a noninvasive molecular diagnostic test for canine UC.

  6. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    PubMed

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  7. Evaluation of IgG anti-toxoplasma avidity and polymerase chain reaction in the postnatal diagnosis of congenital toxoplasmosis.

    PubMed

    Torres, Elizabeth; Rivera, Raul; Cardona, Nestor; Sanchez, Victor; Lora, Fabiana; Gómez-Marín, Jorge Enrique

    2013-06-01

    Confirmatory tests for congenital toxoplasmosis were evaluated in 23 infected and 31 uninfected newborns. Conventional polymerase chain reaction was better than real-time polymerase chain reaction, but did not identify additional cases. Avidity tests added 2 new cases that were not identified by other criteria. Overall sensitivity was 82.6%. Avidity assay, but not polymerase chain reaction, increased the sensitivity of confirmatory assays in congenital toxoplasmosis.

  8. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    PubMed Central

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  9. Analysis of Liver Connexin Expression Using Reverse Transcription Quantitative Real-Time Polymerase Chain Reaction.

    PubMed

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin RNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction, and data analysis. PMID:27207283

  10. Application of real-time polymerase chain reaction in the clinical genetic practice.

    PubMed

    Nagy, Bálint

    2013-03-01

    The development of polymerase chain reaction revolutionized the molecular genetics and diagnostics. Technical improvements helped to make more specific and sensitive target determinations. Introduction of real-time polymerase chain reaction makes possible several applications in clinical genetics like detection of gene mutations, single nucleotide polymorphisms, deletions, measurement of gene expressions, micro ribonucleic acids, free nucleic acids and microbial genomes. Here I discuss a few examples for specific applications in prenatal clinical genetic practice. These are the detection of microbial genomes, deletions, trisomies, mutations, single nucleotide polymorphisms and free nucleic acids. PMID:27625833

  11. Application of real-time polymerase chain reaction in the clinical genetic practice

    PubMed Central

    Nagy, Bálint

    2013-01-01

    The development of polymerase chain reaction revolutionized the molecular genetics and diagnostics. Technical improvements helped to make more specific and sensitive target determinations. Introduction of real-time polymerase chain reaction makes possible several applications in clinical genetics like detection of gene mutations, single nucleotide polymorphisms, deletions, measurement of gene expressions, micro ribonucleic acids, free nucleic acids and microbial genomes. Here I discuss a few examples for specific applications in prenatal clinical genetic practice. These are the detection of microbial genomes, deletions, trisomies, mutations, single nucleotide polymorphisms and free nucleic acids.

  12. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. PMID:25188346

  13. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  14. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  15. Predictors of Pertussis Polymerase Chain Reaction Positive Results in Minnesota, 2005-2009.

    PubMed

    McMahon, Melissa; Kulasingam, Shalini; Kenyon, Cynthia; Miller, Claudia; Ehresmann, Kristen

    2015-11-01

    Predictors of polymerase chain reaction (PCR) positivity for pertussis were assessed using Minnesota active surveillance data. Report of an exposure to pertussis and testing within the optimal time frame of ≤2 weeks were significantly associated with testing PCR positive, emphasizing the importance of asking about epidemiological factors when assessing patients for pertussis, and timely PCR testing.

  16. Determination of toxinotypes of environmental Clostridium perfringens by Polymerase Chain Reaction.

    PubMed

    Florence L, C H; Hakim, S L; Kamaluddin, M A; Thong, K L

    2011-04-01

    Toxinotype of Clostridium perfringens (CP) isolates collected from the Bernam River, Selangor River and Tengi Canal between April 2007 and January 2008 were determined by Polymerase Chain Reaction (PCR) using published primers. All the 147 isolates were toxinotype Type A, harbouring the alpha toxin gene. In addition, 5 of the isolates also had the enterotoxin (CPE) gene.

  17. An improved polymerase chain reaction assay for the detection of Tritrichomonas foetus in cattle

    PubMed Central

    Nickel, D. Douglas; Olson, Merle E.; Schultz, Gilbert A.

    2002-01-01

    An improved polymerase chain reaction test has been developed to detect Tritrichomonas foetus, the causative agent of trichomoniasis in cattle. The test amplifies a region of the 5.8S ribosomal RNA gene of T. foetus, and it is simple, sensitive, and specific when compared with traditional methods to examine field samples. PMID:11901595

  18. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  19. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  20. Detection of untreated mycobacteria by using polymerase chain reaction and specific DNA probes.

    PubMed Central

    Fries, J W; Patel, R J; Piessens, W F; Wirth, D F

    1991-01-01

    A method for specific identification of mycobacteria by using the polymerase chain reaction on organisms taken from liquid cultures, frozen suspensions, or colonies grown on Lowenstein-Jensen slants is presented. This direct detection of mycobacterial organisms has important implications for strain typing and diagnosis. Images PMID:1761699

  1. A Specific Qualitative Detection Method for Peanut (Arachis Hypogagea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A qualitative method for detection of peanuts in foods using polymerase chain reaction was developed. A universal primer pair CP 03-5 /CP 03-3 was designed to confirm the validity of the DNAs for PCR. The plant-specific amplified fragments were detected from 13 kinds of plants using the universal pr...

  2. A Specific Qualitative Detection Method for Peanut (Arachis Hypogaea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed a qualitative detection method for peanuts in foods using polymerase chain reaction (PCR). We designed a universal primer pair CP 03-5’/ CP 03-3’ to confirm the validity of the DNAs for PCR. The plant specific amplified fragments were detected from 13 kinds of plants using the universal...

  3. Single Quantum Dot Analysis Enables Multiplexed Point Mutation Detection by Gap Ligase Chain Reaction

    PubMed Central

    Song, Yunke; Zhang, Yi; Wang, Tza-Huei

    2014-01-01

    Gene point mutations present important biomarkers for genetic diseases. However, existing point mutation detection methods suffer from low sensitivity, specificity, and tedious assay processes. In this report, we propose an assay technology which combines the outstanding specificity of gap ligase chain reaction (Gap-LCR), the high sensitivity of single molecule coincidence detection and superior optical properties of quantum dots (QDs) for multiplexed detection of point mutations in genomic DNA. Mutant-specific ligation products are generated by Gap-LCR and subsequently captured by QDs to form DNA-QD nanocomplexes that are detected by single molecule spectroscopy (SMS) through multi-color fluorescence burst coincidence analysis, allowing for multiplexed mutation detection in a separation-free format. The proposed assay is capable of detecting zeptomoles of KRAS codon 12 mutation variants with near 100% specificity. Its high sensitivity allows direct detection of KRAS mutation in crude genomic DNA without PCR pre-amplification. PMID:23239594

  4. Detection of deoxyribonucleic acid (DNA) targets using polymerase chain reaction (PCR) and paper surface-enhanced Raman spectroscopy (SERS) chromatography.

    PubMed

    Hoppmann, Eric P; Yu, Wei W; White, Ian M

    2014-01-01

    Surface-enhanced Raman spectroscopy (SERS) enables multiplex detection of analytes using simple, portable equipment consisting of a single excitation source and detector. Thus, in theory, SERS is ideally suited to replace fluorescence in assays that screen for numerous deoxyribonucleic acid (DNA) targets, but in practice, SERS-based assays have suffered from complexity and elaborate processing steps. Here, we report an assay in which a simple inkjet-fabricated plasmonic paper device enables SERS-based detection of multiple DNA targets within a single polymerase chain reaction (PCR). In prior work, we demonstrated the principles of chromatographic separation and SERS-based detection on inkjet-fabricated plasmonic paper. The present work extends that capability for post-PCR gene sequence detection. In this design, hydrolysis DNA probes with 5' Raman labels are utilized; if the target is present, the probe is hydrolyzed during PCR, freeing the reporter. After applying the PCR sample to a paper SERS device, an on-device chromatographic separation and concentration is conducted to discriminate between hydrolyzed and intact probes. SERS is then used to detect the reporter released by the hydrolyzed probes. This simple separation and detection on paper eliminates the need for complex sample processing steps. In this work, we simultaneously detect the methicillin-resistant Staphylococcus aureus genes mecA and femB to illustrate the concept. We envision that this approach could contribute to the development of multiplex DNA diagnostic tests enabling screening for several target sequences within a single reaction, which is necessary for cases in which sample volume and resources are limited.

  5. A novel picoliter droplet array for parallel real-time polymerase chain reaction based on double-inkjet printing.

    PubMed

    Sun, Yingnan; Zhou, Xiaoguang; Yu, Yude

    2014-09-21

    We developed and characterized a novel picoliter droplet-in-oil array generated by a double-inkjet printing method on a uniform hydrophobic silicon chip specifically designed for quantitative polymerase chain reaction (qPCR) analysis. Double-inkjet printing was proposed to efficiently address the evaporation issues of picoliter droplets during array generation on a planar substrate without the assistance of a humidifier or glycerol. The method utilizes piezoelectric inkjet printing equipment to precisely eject a reagent droplet into an oil droplet, which had first been dispensed on a hydrophobic and oleophobic substrate. No evaporation, random movement, or cross-contamination was observed during array fabrication and thermal cycling. We demonstrated the feasibility and effectiveness of this novel double-inkjet method for real-time PCR analysis. This method can readily produce multivolume droplet-in-oil arrays with volume variations ranging from picoliters to nanoliters. This feature would be useful for simultaneous multivolume PCR experiments aimed at wide and tunable dynamic ranges. These double-inkjet-based picoliter droplet arrays may have potential for multiplexed applications that require isolated containers for single-cell cultures, single molecular enzymatic assays, or digital PCR and provide an alternative option for generating droplet arrays on planar substrates without chemical patterning. PMID:25070461

  6. A novel strategy for human papillomavirus detection and genotyping with SybrGreen and molecular beacon polymerase chain reaction.

    PubMed

    Szuhai, K; Sandhaus, E; Kolkman-Uljee, S M; Lemaître, M; Truffert, J C; Dirks, R W; Tanke, H J; Fleuren, G J; Schuuring, E; Raap, A K

    2001-11-01

    Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for formaldehyde-fixed samples a strategy that, in a homogeneous, real-time fluorescence polymerase chain reaction (PCR)-based assay, accomplishes general HPV detection by SybrGreen reporting of HPV-DNA amplicons, and genotyping of seven prevalent HPV types (HPV-6, -11, -16, -18, -31, -33, -45) by real-time molecular beacon PCR. The false-positive rate of the HPV SybrGreen-PCR was 4%, making it well suited as a prescreening, general HPV detection technology. The type specificity of the seven selected HPV molecular beacons was 100% and double infections were readily identified. The multiplexing capacity of the HPV molecular beacon PCR was analyzed and up to three differently labeled molecular beacons could be used in one PCR reaction without observing cross talk. The inherent quantitation capacities of real-time fluorescence PCR allowed the determination of average HPV copy number per cell. We conclude that the HPV SybrGreen-PCR in combination with the HPV molecular beacon PCR provides a robust, sensitive, and quantitative general HPV detection and genotyping methodology.

  7. A novel picoliter droplet array for parallel real-time polymerase chain reaction based on double-inkjet printing.

    PubMed

    Sun, Yingnan; Zhou, Xiaoguang; Yu, Yude

    2014-09-21

    We developed and characterized a novel picoliter droplet-in-oil array generated by a double-inkjet printing method on a uniform hydrophobic silicon chip specifically designed for quantitative polymerase chain reaction (qPCR) analysis. Double-inkjet printing was proposed to efficiently address the evaporation issues of picoliter droplets during array generation on a planar substrate without the assistance of a humidifier or glycerol. The method utilizes piezoelectric inkjet printing equipment to precisely eject a reagent droplet into an oil droplet, which had first been dispensed on a hydrophobic and oleophobic substrate. No evaporation, random movement, or cross-contamination was observed during array fabrication and thermal cycling. We demonstrated the feasibility and effectiveness of this novel double-inkjet method for real-time PCR analysis. This method can readily produce multivolume droplet-in-oil arrays with volume variations ranging from picoliters to nanoliters. This feature would be useful for simultaneous multivolume PCR experiments aimed at wide and tunable dynamic ranges. These double-inkjet-based picoliter droplet arrays may have potential for multiplexed applications that require isolated containers for single-cell cultures, single molecular enzymatic assays, or digital PCR and provide an alternative option for generating droplet arrays on planar substrates without chemical patterning.

  8. Polymerase chain reaction-based molecular diagnosis of cutaneous infections in dermatopathology.

    PubMed

    Swick, Brian L

    2012-12-01

    Conventional methods, including microscopy, culture, and serologic studies, are a mainstay in the diagnosis of cutaneous infection. However, owing to limitations associated with these techniques, such as low sensitivity for standard microscopy and in the case of culture delay in diagnosis, polymerase chain-reaction based molecular techniques have taken on an expanding role in the diagnosis of infectious processes in dermatopathology. In particular, these assays are a useful adjunct in the diagnosis of cutaneous tuberculosis, atypical mycobacterial infection, leprosy, Lyme disease, syphilis, rickettsioses, leishmaniasis, and some fungal and viral infections. Already in the case of tuberculosis and atypical mycobacterial infection, standardized polymerase chain-reaction assays are commonly used for diagnostic purposes. With time, additional molecular-based techniques will decrease in cost and gain increased standardization, thus delivering rapid diagnostic confirmation for many difficult-to-diagnose cutaneous infections from standard formalin-fixed paraffin-embedded tissue specimens.

  9. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  10. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    PubMed

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  11. Detection and genotyping of herpes simplex virus types 1 and 2 by polymerase chain reaction.

    PubMed

    Lucotte, G; Bathelier, C; Lespiaux, V; Bali, C; Champenois, T

    1995-10-01

    A simple and rapid polymerase chain reaction (PCR) procedure was developed for simultaneous detection and typing of herpes simplex virus (HSV) types 1 and 2. It was possible to detect and type HSV using two primers pairs in a simultaneous double PCR reaction, where the type of HSV present was determined on the basis of an ethidium-bromide-stained band after agarose gel electrophoresis. This PCR assay was tested on about 500 clinical specimens.

  12. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain).

    PubMed

    Ali, A; Reynolds, D L

    1999-01-01

    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  13. Polymerase Chain Reaction as a Diagnostic Tool for Six Sexually Transmitted Infections - Preliminary Results

    PubMed Central

    GRAD, ALECSANDRA IULIA; VICA, MIHAELA LAURA; MATEI, HOREA VLADI; GRAD, DORU LUCIAN; COMAN, IOAN; TATARU, DUMITRU ALEXANDRU

    2015-01-01

    Background and aim Sexually transmitted infections are a very frequent and under-diagnosed cause of illness worldwide. A high number of detection methods and a large range of specimens in which sexually transmitted infections can be determined are available at the moment. Polymerase chain reaction performed on first void urine offers the advantage of being non-invasive, self-collectable and has high sensitivity and specificity. We looked to determine the frequency of Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Mycoplasma hominis, Mycoplasma genitalium and Ureaplasma urealyticum in symptomatic and asymptomatic patients. Methods Six sexually transmitted infections were determined in the first void urine of 15 symptomatic and asymptomatic patients by polymerase chain reaction. We used “Epicenter MasterPure™ Complete DNA and RNA Purification Kit” for the DNA purification and “Seeplex® STD6 ACE Detection” for the DNA amplification. The results were examined in UV light. Results A number of 5 patients had positive results for Chlamydia trachomatis or Neisseria gonorrhoeae. Sexually transmitted infections are more frequent in men between 27 and 40 years old. Conclusions Polymerase chain reaction is a good diagnostic tool for sexually transmitted infections because it has a high sensitivity and specificity. Chlamydia trachomatis is the most frequent sexually transmitted infection, followed by Neisseria gonorrhoeae. PMID:26528045

  14. A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain.

    PubMed

    Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Ali, Md Eaqub

    2015-01-01

    Food forgery has posed considerable risk to public health, religious rituals, personal budget and wildlife. Pig, dog, cat, rat and monkey meat are restricted in most religions, but their sporadic adulteration are rampant. Market controllers need a low-cost but reliable technique to track and trace suspected species in the food chain. Considering the need, here we documented a lab-on-a-chip-based multiplex polymerase chain reaction (PCR) assay for the authentication of five non-halal meat species in foods. Using species-specific primers, 172, 163, 141, 129 and 108-bp sites of mitochondrial ND5, ATPase 6 and cytochrome b genes were amplified to detect cat, dog, pig, monkey and rat species under complex matrices. Species-specificity was authenticated against 20 different species with the potential to be used in food. The targets were stable under extreme sterilisation (121°C at 45 psi for 2.5 h) which severely degrades DNA. The assay was optimised under the backgrounds of various commercial meat products and validated for the analysis of meatballs, burgers and frankfurters, which are popular fast food items across the globe. The assay was tested to detect 0.1% suspected meats under commercial backgrounds of marketed foods. Instead of simplex PCR which detects only one species at a time, such a multiplex platform can reduce cost by at least fivefolds by detecting five different species in a single assay platform.

  15. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-01

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR).

  16. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  17. Novel vectors for the expression of antibody molecules using variable regions generated by polymerase chain reaction.

    PubMed

    Coloma, M J; Hastings, A; Wims, L A; Morrison, S L

    1992-07-31

    A new family of vectors has been produced which facilitates the cloning and expression of immunoglobulin variable regions cloned by polymerase chain reaction (PCR). The vectors are designed to express the cloned variable regions joined to human constant regions and take advantage of priming in the leader sequence so that no amino acid changes will be introduced into the mature antibody molecule. Both the heavy chain and light chain vectors utilize a murine VH promoter provided with an EcoRV restriction site so that the amplified variable regions can be directly cloned into a functional promoter. For the heavy chain an NheI restriction site has been generated at the first two amino acids of CH1 and the cloned leader and variable region are fused directly to the CH1 domain of the constant region. When the leader and variable regions of the light chain were fused directly to C kappa, no expression was observed. Therefore the light chain expression vector was designed with a SalI restriction site for cloning into a splice junction 3' of the variable region; VL then is joined to C kappa by splicing. Both vectors direct the expression of functional, fully assembled immunoglobulin molecules with the expected molecular weight. Use of redundant oligomers to prime the PCR permits the cloning and expression of recombinant antibodies without any prior information as to their sequence and makes it possible to rapidly generate recombinant antibodies from any monoclonal antibody producing cell line.

  18. Nested polymerase chain reaction for amplification of the Cryptosporidium oocyst wall protein gene.

    PubMed Central

    Pedraza-Díaz, S.; Amar, C.; Nichols, G. L.; McLauchlin, J.

    2001-01-01

    We developed a sensitive nested polymerase chain reaction procedure for the Cryptosporidium oocyst wall protein (COWP) gene. Amplification and genotyping were successful in 95.2% of 1,680 fecal samples, 77.6% by the unnested and 17.6% by the nested COWP procedure. The COWP gene was amplified from 2,128 fecal samples: 71 from livestock animals and 2,057 from humans. This series included 706 cases from seven drinking water-associated outbreaks and 51 cases from five swimming pool-associated outbreaks, as well as 1,300 sporadic cases. PMID:11266294

  19. [Identification of the causative agents of glanders and melioidosis by polymerase chain reaction].

    PubMed

    Tkachenko, G A; Antonov, V A; Zamaraev, V S; Iliukhin, V I

    2003-01-01

    Burkholderia mallei and B. pseudomallei are causative agents of glanders and melioidosis, respectively, i.e. severe and fatal infection diseases of man and animal. The computer-based analysis of the 23S rRNA gene sites was used for selecting the primers. Two pairs of primers were chosen for the identification of B. mallei and Bpseudomallei. DNAs from 48 B. pseudomallei and 15 strains of B. mallei, unlike from other geterological bacteria, were positively amplified. Therefore, the method of polymerase chain reaction can be used in laboratory diagnosis of glanders and melioidosis.

  20. Digital polymerase chain reaction in an array of femtoliter polydimethylsiloxane microreactors.

    PubMed

    Men, Yongfan; Fu, Yusi; Chen, Zitian; Sims, Peter A; Greenleaf, William J; Huang, Yanyi

    2012-05-15

    We developed a simple, compact microfluidic device to perform high dynamic-range digital polymerase chain reaction (dPCR) in an array of isolated 36-femtoliter microreactors. The density of the microreactors exceeded 20000/mm(2). This device, made from polydimethylsiloxane (PDMS), allows the samples to be loaded into all microreactors simultaneously. The microreactors are completely sealed through the deformation of a PDMS membrane. The small volume of the microreactors ensures a compact device with high reaction efficiency and low reagent and sample consumption. Future potential applications of this platform include multicolor dPCR and massively parallel dPCR for next generation sequencing library preparation. PMID:22482776

  1. Polymerase chain reaction-based serotyping of pathogenic bacteria in food.

    PubMed

    Salazar, Joelle K; Wang, Yun; Yu, Shuijing; Wang, Hui; Zhang, Wei

    2015-03-01

    Serotyping analysis of bacterial pathogens in food products is important for foodborne disease surveillance and outbreak investigations. Traditional immunological techniques are labor-intensive and time-consuming, whereas polymerase chain r eaction (PCR)-based techniques are more robust, consistent and rapid. PCR-based methods also provide easier standardization and better reproducibility. Here, we summarize some recent developments and applications of PCR-based serotyping for common foodborne pathogens, and provide a list of available bioinformatics tools for developing PCR-based serotyping assays.

  2. Preparative isolation of polymerase chain reaction products using mixed-mode chromatography.

    PubMed

    Matos, T; Silva, G; Queiroz, J A; Bülow, L

    2015-11-15

    The polymerase chain reaction (PCR) has become one of the most useful techniques in molecular biology laboratories around the world. The purification of the target DNA product is often challenging, however, and most users are restricted to employing available commercial kits. The recent developments in mixed-mode chromatography have shown higher selectivity for a variety of nucleic acid-containing samples. Capto Adhere is a mixed-mode chromatography resin that offers a high-selectivity ligand and is here applied for the purification of amplified DNAs from PCR mixtures in a 10-min single step, with yields above 95%, high linearity, and high precision for different concentrations.

  3. [Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

    PubMed

    Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

    2009-01-01

    A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

  4. Detection of biological warfare agents using the polymerase chain reaction. Final report, June-August 1991

    SciTech Connect

    Mann, B.J.

    1992-09-01

    The detection of biological warfare agents is an important mission for the U.S. Army. This report explores the feasibility of using the polymerase chain reaction as a means of rapid detection of biological warfare agents. Two levels of detection are proposed. The first level is group specific detection, using primers derived from 16S rDNA sequences, to detect various groups of pathogenic bacteria. The second level is species-specific detection using primers derived from DNA sequences, unique to each pathogenic organism targeted for detection. Specific examples of Vibrio cholerae, Francisella tularensis, Yersinia pestis, Staphylococcus aureus, and Bacillus anthracis are described.

  5. Specific detection of the toxic shock syndrome toxin-1 gene using the polymerase chain reaction.

    PubMed

    Jaulhac, B; Prevost, G; Piemont, Y

    1991-08-01

    A rapid and specific assay for toxic shock syndrome toxin-1 gene (tst gene) detection in Staphylococcus aureus was developed using the polymerase chain reaction. A two-primer set and an oligonucleotide detection probe were synthesized. After 40 cycles of amplification, detection of a 160-bp amplified DNA fragment was carried out by agarose gel electrophoresis and Southern blot hybridization. This assay was sensitive since it was able to detect 1-10 bacteria. It was also specific since no amplification was documented with DNAs from enterotoxigenic S. aureus or Gram-negative bacteria devoid of the tst gene.

  6. [Real-time polymerase chain reaction in the diagnosis of pulmonary tuberculosis].

    PubMed

    Salina, T Iu; Morozova, T I

    2008-01-01

    To enhance the efficiency of diagnosis of oligo- and abacillar pulmonary tuberculosis and its differential diagnosis with other lung diseases, the authors studied the informative value of real-time polymerase chain reaction (PCR) used in 62 patients with different clinical forms of tuberculosis and 108 differentially diagnostic patients. Real-time PCR has been ascertained to be a significantly more sensitive and highly specific tool in tuberculosis diagnosis, which considerably improves the specific recognition of the etiology of a pathogenetic process in oligo- and abacillar patients. Particularly encouraging results have been obtained when examining differentially diagnostic patients with the rounded shadows being formed in the lung. PMID:18710048

  7. Ultra sensitive detection of Listeria monocytogenes in milk by the polymerase chain reaction (PCR).

    PubMed

    Starbuck, M A; Hill, P J; Stewart, G S

    1992-12-01

    The polymerase chain reaction (PCR) has been used to detect Listeria monocytogenes in whole milk at a level of 0.1 cfu per 30 ml. This high degree of sensitivity has been achieved following enzymatic digestion, polysulphonone membrane filtration and amplification of a nucleotide sequence within the promoter region of hlyA. Key elements of the procedure are the absence of enrichment culture and a complete solubilization of the membrane filter, ensuring total nucleic acid recovery. The simplicity of the protocol coupled with high sample volumes and exquisite sensitivity extends the relevance of PCR within food and environmental microbiology. PMID:1368996

  8. A polymerase chain reaction protocol for the detection of various geographical isolates of white spot virus.

    PubMed

    Tapay, L M; Nadala, E C; Loh, P C

    1999-09-01

    Polymerase chain reaction (PCR) primers were designed based on the sequence of a cloned fragment of the white spot virus (WSV) genome and were used to detect at least four geographic isolates of WSV from both experimentally- and naturally-infected shrimp. In addition to high specificity, the one-step and two-step PCR protocols were determined to have sensitivities of 10-100 pg and 100 femtograms respectively. The two-step PCR protocol is recommended as a very sensitive and specific alternative protocol to Western blot assay for the detection of WSV.

  9. Advantage of a rapid extraction method of HIV1 DNA suitable for polymerase chain reaction.

    PubMed

    Vignoli, C; de Lamballerie, X; Zandotti, C; Tamalet, C; de Micco, P

    1995-01-01

    We describe a new protocol for extraction of DNA suitable for HIV1 gene amplification from clinical samples using "Chelex-100" chelating resin. Comparison was made with the classic proteinase K extraction method; 154 specimens were extracted with both methods and subjected to PCR (polymerase chain reaction). The Chelex-100 procedure optimized the yield of DNA recovery and minimized contamination due to sample manipulation. It decreased false negative results due to PCR inhibitors. A DNA sample suitable for use in PCR was obtained in 30 minutes. Chelex-100 treatment is a simple, rapid and low-cost method for DNA extraction in clinical laboratories.

  10. DNA from oral bacteria by sodium hydroxide-paper method suitable for polymerase chain reaction.

    PubMed

    Lefimil, Claudia; Lozano, Carla; Morales-Bozo, Irene; Plaza, Anita; Maturana, Cristian; Urzúa, Blanca

    2013-02-15

    In the oral cavity, we can find a complex mixture of microorganisms, commensals, and pathogens. The studies of normal oral microbiota, as well as the studies of much oral pathology (e.g., caries, periodontitis), involve the isolation and cultivation of these microorganisms and their molecular analysis. The aim of this study was to validate a quick, easy, efficient, and inexpensive DNA extraction method for the recovery of genomic DNA from gram-positive and gram-negative oral bacteria to be used in polymerase chain reaction amplification. This method worked great with all samples analyzed, providing an approach to extract DNA for different microorganisms.

  11. JC polyomavirus nephropathy confirmed by using an in-house polymerase chain reaction method.

    PubMed

    Querido, S; Jorge, C; Sousa, H; Birne, R; Matias, P; Weigert, A; Adragão, T; Bruges, M; Ramos, S; Santos, M; Paixão, P; Curran, M D; Machado, D

    2015-10-01

    We report the case of an isolated JC virus (JCV) infection, without co-infection by polyoma BK virus (BKV), associated with nephropathy 4 years after kidney transplantation. Clinical suspicion followed the observation of a decrease in estimated glomerular filtration rate (eGFR) and a renal allograft biopsy revealing polyomavirus-associated tubulointerstitial nephritis and positivity for SV40. An in-house real-time polymerase chain reaction assay, targeting the presence of JCV and the absence of BKV in biopsy tissue, confirmed diagnosis. Thirteen months after diagnosis, and following therapeutic measures, eGFR remains stable. PMID:26215933

  12. Detection of influenza B virus in throat swabs using the polymerase chain reaction.

    PubMed

    Yamada, A; Imanishi, J

    1992-05-01

    An assay protocol based on exploiting the polymerase chain reaction (PCR) for the direct detection of influenza B virus in throat swabs is described. By the use of PCR with nested primers, it was possible to detect the virus in throat swabs. Dilution experiments showed that as little as 1 plaque forming unit of virus was sufficient for detecting the HA gene by the PCR. All throat swab samples from which influenza B virus had been isolated by conventional methods were also positive by the PCR method.

  13. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique].

    PubMed

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V

    2001-01-01

    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  14. Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial

    PubMed Central

    2011-01-01

    Background Viral respiratory infections are common worldwide and range from completely benign disease to life-threatening illness. Symptoms can be unspecific, and an etiologic diagnosis is rarely established because of a lack of suitable diagnostic tools. Improper use of antibiotics is common in this setting, which is detrimental in light of the development of bacterial resistance. It has been suggested that the use of diagnostic tests could reduce antibiotic prescription rates. The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR) assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs) would have an impact on antibiotic prescription rate in primary care clinical settings. Methods Adult patients with symptoms of ARTI were prospectively included. Nasopharyngeal and throat swabs were analysed by using a multiplex real-time PCR method targeting thirteen viruses and two bacteria. Patients were recruited at 12 outpatient units from October 2006 through April 2009, and samples were collected on the day of inclusion (initial visit) and after 10 days (follow-up visit). Patients were randomised in an open-label treatment protocol to receive a rapid or delayed result (on the following day or after eight to twelve days). The primary outcome measure was the antibiotic prescription rate at the initial visit, and the secondary outcome was the total antibiotic prescription rate during the study period. Results A total sample of 447 patients was randomised. Forty-one were excluded, leaving 406 patients for analysis. In the group of patients randomised for a rapid result, 4.5% (9 of 202) of patients received antibiotics at the initial visit, compared to 12.3% (25 of 204) (P = 0.005) of patients in the delayed result group. At follow-up, there was no significant difference between the groups: 13.9% (28 of 202) in the rapid result group and 17.2% (35 of 204) in the delayed result group (P = 0

  15. A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

    EPA Science Inventory

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

  16. Development, optimization, and validation of a Classical swine fever virus real-time reverse transcription polymerase chain reaction assay.

    PubMed

    Eberling, August J; Bieker-Stefanelli, Jill; Reising, Monica M; Siev, David; Martin, Barbara M; McIntosh, Michael T; Beckham, Tammy R

    2011-09-01

    Classical swine fever (CSF) is an economically devastating disease of pigs. Instrumental to the control of CSF is a well-characterized assay that can deliver a rapid, accurate diagnosis prior to the onset of clinical signs. A real-time fluorogenic-probe hydrolysis (TaqMan) reverse transcription polymerase chain reaction (RT-PCR) for CSF was developed by the United States Department of Agriculture (USDA) at the Plum Island Animal Disease Center (CSF PIADC assay) and evaluated for analytical and diagnostic sensitivity and specificity. A well-characterized panel including Classical swine fever virus (CSFV), Bovine viral diarrhea virus (BVDV), and Border disease virus (BDV) isolates was utilized in initial feasibility and optimization studies. The assay was initially designed and validated for use on the ABI 7900HT using the Qiagen QuantiTect® Probe RT-PCR chemistry. However, demonstrating equivalency with multiple one-step RT-PCR chemistries and PCR platforms increased the versatility of the assay. Limit of detection experiments indicated that the Qiagen QuantiTect® Multiplex (NoROX) and the Invitrogen SuperScript® III RT-PCR kits were consistently the most sensitive one-step chemistries for use with the CSF PIADC primer/probe set. Analytical sensitivity of the CSF PIADC assay ranged from <1-2.95 log(10) TCID(50)/ml on both the ABI 7900HT and ABI 7500 platforms. The CSF PIADC assay had 100% diagnostic sensitivity and specificity when tested on a panel of 152 clinical samples from the Dominican Republic and Colombia. The ability to perform this newly developed assay in 96-well formats provides an increased level of versatility for use in CSF surveillance programs.

  17. Evaluation of Immunomagnetic Separation for the Detection of Salmonella in Surface Waters by Polymerase Chain Reaction

    PubMed Central

    Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

    2014-01-01

    Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection. PMID:25243887

  18. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  19. Amplification refractory mutation system polymerase chain reaction versus optimized polymerase chain reaction restriction-fragment length polymorphism for apolipoprotein E genotyping of majorly depressed patients.

    PubMed

    You, Hongmin; Chen, Jin; Zhou, Jingjing; Huang, Hua; Pan, Junxi; Wang, Ziye; Lv, Lin; Zhang, Lujun; Li, Juan; Qin, Bin; Yang, Yongtao; Xie, Peng

    2015-11-01

    Major depressive disorder (MDD) is a prevalent, debilitating mood disorder that has been associated with several genetic polymorphisms. One such polymorphism, namely that of apolipoprotein E (APOE), has three allelic forms (ε2, ε3 and ε4) that encode for six unique isoforms of the APOE protein. A growing number of techniques have been developed for APOE genotyping; however, not all polymerase chain reaction (PCR)‑based genotyping techniques are equally accurate or cost‑effective. In order to find a more accurate and cost‑effective APOE genotyping method for MDD screening in large populations, the present study comparatively evaluated two genotyping methods, amplification refractory mutation system PCR (ARMS‑PCR) and optimized PCR restriction‑fragment length polymorphism (PCR‑RFLP), in blood samples taken from a population of 708 MDD patients. Although either of the two methods were able to detect all six unique APOE genotypes, comparisons of the two methods with Sanger sequencing demonstrated that ARMS‑PCR (94%) was significantly more accurate than optimized PCR‑RFLP (82%). ARMS‑PCR should prove useful in quickly verifying ambiguous results obtained by other APOE genotyping methods and can be cost-effectively performed in the setting of a small laboratory or a population-based screening program.

  20. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  1. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler. PMID:27271319

  2. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    PubMed

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  3. Polymerase chain reaction-gene probe detection system specific for pathogenic strains of Yersinia enterocolitica.

    PubMed

    Ibrahim, A; Liesack, W; Stackebrandt, E

    1992-08-01

    The polymerase chain reaction technique was used to develop a rapid diagnostic assay for detection of pathogenic Yersinia enterocolitica strains. The assay targeted a stretch of 163 bp of the yst gene and could be applied to both pure cultures and crude DNA extracted from feces. The defined primer pair amplified the targeted sequence from only pathogenic strains and fecal samples seeded with the serotype O:3 strain of Y. enterocolitica, whereas neither nonpathogenic strains nor normal stools yielded any amplified fragments. Of the other Yersinia species and non-Yersinia species tested, only two strains of Y. kristensenii yielded the same amplified product. A 20-mer oligonucleotide probe specifically hybridized within the amplified yst fragment of Y. enterocolitica but did not hybridize with the amplified yst fragment of Y. kristensenii by Southern and dot blot hybridizations. This confirms the reliability of this diagnostic assay in both clinical and epidemiological studies. The availability of the extracted DNA for the polymerase chain reaction was checked by simultaneous amplification of a part of the 16S rDNA and the yst gene. The entire diagnostic assay, including a simplified technique for DNA extraction, the amplification process, and gel electrophoresis, could be completed within 1 working day, which is better than the time required for the time-consuming traditional techniques used in clinical laboratories.

  4. Detection of Enterococcus faecalis in Necrotic Teeth Root Canals by Culture and Polymerase Chain Reaction Methods

    PubMed Central

    Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Aksoy, Semiha C.; Eronat, Cemal

    2007-01-01

    Objectives The aim of this study was to investigate the presence of Enterococcus faecalis in endodontic infections in both deciduous and permanent teeth by culture and polymerase chain reaction (PCR) methods. Methods A total of 145 children aged 5–13 years old were involved in this study. The presence of E. faecalis in necrotic deciduous and permanent teeth root canals was studied using culture and polymerase chain reaction methods. Results Among 145 molar teeth, 57% (n=83) presented necrotic asymptomatic pulp tissues and were included in this study. Culture and PCR methods detected the test species in 18 and 22 of 83 teeth involved, respectively. E. faecalis was cultured from 8 (18%) of 45 necrotic deciduous teeth and from 10 (26%) of 38 necrotic permanent teeth. PCR detection identified the target species in 10 (22%) and 12 (32%) of necrotic deciduous and permanent teeth respectively. Statistically significant difference in the presence of E. faecalis in deciduous and permanent teeth was found by culture and PCR methods (P=0.03 and 0.02, respectively). The difference in the presence of E. faecalis between two different methods was not statistically significant (P>.05). Conclusions The results of the present study confirm that both culture and PCR methods are sensitive to detect E. faecalis in root canals. PMID:19212470

  5. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    PubMed Central

    Alexandrakis, G.; Jalali, S.; Gloor, P.

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In one rabbit the contralateral eye served as a control. From four to 28 days after inoculation, the corneas were scraped for culture, then scraped and swabbed for PCR analysis. The PCR was performed with primers directed against a portion of the Fusarium cutinase gene, and the presence or absence of this amplified target sequence was determined by agarose gel.
RESULTS—The amplified DNA sequence was detected in 25 of 28 samples from the corneas infected with Fusarium, for a sensitivity of 89%. Only three of the 14 samples from these eyes with Fusarium keratitis were positive by culture, for a sensitivity of 21%. Seven of eight control samples were negative by the PCR based test, for a specificity of 88%.
CONCLUSION—This PCR based test holds promise of being an effective method of diagnosing Fusarium keratitis as well as Fusarium infections at other sites.

 Keywords: keratitis; Fusarium; ulcer; cornea; polymerase chain reaction PMID:9602631

  6. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers.

    PubMed

    D'Souza, Doris H; Critzer, Faith J; Golden, David A

    2009-11-01

    Recent outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to help control the spread of disease. Reverse-transcriptase polymerase chain reaction (RT-PCR) can detect the presence of mRNA (shorter half-life than DNA) with greater potential for detecting viable pathogens. The chromosomally located invA gene required for host invasion by Salmonella is widely used for detection of this pathogen by PCR. Detection of Salmonella was undertaken by real-time RT-PCR (rt-RT-PCR) using newly designed invA gene primers to develop a sensitive and specific assay. Salmonella serovars Typhimurium and Enteritidis were grown (7.68 log(10) CFU/mL) in Luria-Bertani broth overnight at 37 degrees C, and RNA was extracted, followed by rt-RT-PCR with and without SYBR green I and agarose gel electrophoresis. All experiments were replicated at least thrice. Detection for both serovars using traditional RT-PCR was lower ( approximately 10(5) CFU/mL) than rt-RT-PCR (10(3) CFU/mL) by gel electrophoresis. Melt curve analysis showed melt temperatures at 87.5 degrees C with Ct values from 12 to 15 for up to 10(3) CFU/mL and improved to 10(2) CFU/mL after further optimization. Further, addition of RNA internal amplification control constructed using in vitro transcription with a T7 RNA polymerase promoter, to the RT-PCR assay also gave detection limits of 10(2) CFU/mL. Cross-reactivity was not observed against a panel of 21 non-Salmonella bacteria. Heat-inactivated (autoclaved) Salmonella showed faint or no detection by rt-RT-PCR or gel electrophoresis. This method has potential to be applied for the detection of Salmonella serovars in fresh produce and the simultaneous detection of foodborne viral (RNA viruses) and bacterial pathogens in a multiplex format.

  7. Rapid differentiation and identification of potential severe strains of Citrus tristeza virus by real-time reverse transcription-polymerase chain reaction assays.

    PubMed

    Yokomi, R K; Saponari, M; Sieburth, P J

    2010-04-01

    A multiplex Taqman-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to identify potential severe strains of Citrus tristeza virus (CTV) and separate genotypes that react with the monoclonal antibody MCA13. Three strain-specific probes were developed using intergene sequences between the major and minor coat protein genes (CPi) in a multiplex reaction. Probe CPi-VT3 was designed for VT and T3 genotypes; probe CPi-T36 for T36 genotypes; and probe CPi-T36-NS to identify isolates in an outgroup clade of T36-like genotypes mild in California. Total nucleic acids extracted by chromatography on silica particles, sodium dodecyl sulfate-potassium acetate, and CTV virion immunocapture all yielded high quality templates for real-time PCR detection of CTV. These assays successfully differentiated CTV isolates from California, Florida, and a large panel of CTV isolates from an international collection maintained in Beltsville, MD. The utility of the assay was validated using field isolates collected in California and Florida. PMID:20205535

  8. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    PubMed

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  9. α,β-D-Constrained Nucleic Acids Are Strong Terminators of Thermostable DNA Polymerases in Polymerase Chain Reaction

    PubMed Central

    Mahéo, Sabrina; Gross, Grégori; Bodin, Pierre; Teissié, Justin; Escudier, Jean-Marc; Paquereau, Laurent

    2011-01-01

    (SC5′, RP) α,β-D- Constrained Nucleic Acids (CNA) are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5′C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases. PMID:21991314

  10. Humic substances cause fluorescence inhibition in real-time polymerase chain reaction.

    PubMed

    Sidstedt, Maja; Jansson, Linda; Nilsson, Elin; Noppa, Laila; Forsman, Mats; Rådström, Peter; Hedman, Johannes

    2015-10-15

    Real-time polymerase chain reaction (qPCR) is the cornerstone of DNA analysis, enabling detection and quantification of minute nucleic acid amounts. However, PCR-based analysis is limited, in part, by the presence of inhibitors in the samples. PCR inhibition has been viewed solely as failure to efficiently generate amplicons, that is, amplification inhibition. Humic substances (HS) are well-known inhibitors of PCR amplification. Here we show that HS from environmental samples, specifically humic acid (HA), are very potent detection inhibitors, that is, quench the fluorescence signal of double-stranded DNA (dsDNA) binding dyes. HA quenched the fluorescence of the commonly used qPCR dyes EvaGreen, ResoLight, SYBR Green I, and SYTO 82, generating lowered amplification plots, although amplicon production was unaffected. For EvaGreen, 500 ng of HA quenched nearly all fluorescence, whereas 1000 ng of HA completely inhibited amplification when applying Immolase DNA polymerase with bovine serum albumin (BSA). Fluorescence spectroscopy measurements showed that HA quenching was either static or collisional and indicated that HA bound directly to the dye. Fulvic acid did not act as a qPCR detection inhibitor but inhibited amplification similarly to HA. Hydrolysis probe fluorescence was not quenched by HA. Detection inhibition is an overlooked phenomenon that needs to be considered to allow for development of optimal qPCR assays.

  11. Enzymatic amplification of platelet-specific messenger RNA using the polymerase chain reaction.

    PubMed Central

    Newman, P J; Gorski, J; White, G C; Gidwitz, S; Cretney, C J; Aster, R H

    1988-01-01

    Human platelets are derived from megakaryocytes as anucleate cells, and thus contain only vestigial amounts of RNA capable of being transcribed into protein. This has greatly hampered efforts to study directly platelet-specific gene products and their associated polymorphisms. In this report, we describe direct amplification, using the polymerase chain reaction, of platelet-derived mRNA in amounts sufficient to permit detailed analysis, such as restriction mapping and nucleotide sequencing. The ability to generate large amounts of cDNA from platelet-specific mRNA sequences should make possible direct molecular characterization of normal platelet proteins, and facilitate the investigation of a wide variety of inherited platelet disorders. Images PMID:3403726

  12. Prenatal diagnosis of alpha-thalassemia by polymerase chain reaction and dual restriction enzyme analysis.

    PubMed

    Lebo, R V; Saiki, R K; Swanson, K; Montano, M A; Erlich, H A; Golbus, M S

    1990-08-01

    Asian couples at risk for a fetus with homozygous alpha-thalassemia (hydrops fetalis) are often identified by their low erythrocyte mean corpuscular volume (MCV) and normal hemoglobin electrophoresis when little time remains to test their genotypes by restriction enzyme analysis. DNA analysis is performed directly on chorionic villi or amniocytes remaining after an aliquot is used to establish a backup cell culture. The polymerase chain reaction (PCR) protocol quickly determines whether the fetus has hydrops fetalis without waiting for cultured cells to grow. Previously, growing cultured fetal cells to obtain more fetal material to establish unambiguously the fetal genotype with two independent restriction enzyme digests absorbed a significant portion of the time remaining to complete prenatal diagnosis. A dual restriction enzyme digestion protocol was development using a 3' zeta-globin probe to clearly distinguish the most common alpha-thalassemia deletions that represent nearly all the alpha-thalassemia haplotypes in Southeast Asia.

  13. Assembling long heteroduplexes by asymmetric polymerase chain reaction and annealing the resulting single-stranded DNAs.

    PubMed

    Wang, Mugui; Wei, Chuchu; Ye, Xiufen; Liu, Jianping; Zhang, Cuicui; Chen, Hao; Zhang, Xiaobo; Tu, Jumin

    2015-04-15

    We developed an effective protocol for generating high-purity heteroduplexes via annealing single-stranded DNAs (ssDNAs) derived from plasmid DNA by asymmetric polymerase chain reaction (A-PCR). With the addition of dimethyl sulfoxide, a one-step A-PCR procedure can generate ssDNAs stably at a range of reaction temperatures. Several annealing buffers can anneal two ssDNAs into heteroduplexes effectively. We further developed a simple strategy to create d(GATC) hemimethylated heteroduplexes by annealing fully methylated homoduplexes in the presence of excessive unmethylated ssDNAs. The constructed heteroduplexes have been well tested as substrates for mismatch repair in Escherichia coli and, thus, can be used in various biotechnology applications. PMID:25575760

  14. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    PubMed

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  15. Culture-negative endocarditis diagnosed using 16S DNA polymerase chain reaction.

    PubMed

    Duffett, Stephen; Missaghi, Bayan; Daley, Peter

    2012-01-01

    16S DNA polymerase chain reaction (PCR) is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

  16. Epidemiological investigation of Salmonella tilene by pulsed-field gel electrophoresis and polymerase chain reaction

    PubMed Central

    Anand, Chandar M; Fonseca, Kevin; Longmore, Ken; Rennie, Robert; Chui, Linda; Lingley, Mike; Woodward, David

    1997-01-01

    Pulsed-field gel electrophoresis (PFGE) and DNA fingerprinting by the polymerase chain reaction (PCR) were performed on 11 isolates of Salmonella tilene. Five strains were from a cluster of human patients, six from sugar gliders and pygmy hedgehogs kept as family pets or from local pet retailers, and one isolate from the first North American case of S tilene described in Washington State in 1994. The PFGE restriction patterns showed all isolates to be similar. However, PCR using primers to the 16S and 23S rRNA genes of Escherichia coli demonstrated that the Washington State isolate differed from the rest of the other isolates, which were all similar based upon their DNA fingerprint. This study indicates that reliance on one technique alone may be insufficient to show nuances between strains that are, in many respects, closely related. PMID:22346526

  17. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  18. Real-time reverse-transcription polymerase chain reaction: technical considerations for gene expression analysis.

    PubMed

    Doak, Shareen H; Zaïr, Zoulikha M

    2012-01-01

    The reverse transcription - polymerase chain reaction (RT-PCR) is a sensitive technique for the quantification of steady-state mRNA levels, particularly in samples with limited quantities of extracted RNA, or for analysis of low level transcripts. The procedure amplifies defined mRNA transcripts by taking advantage of retroviral enzymes with reverse transcriptase (RT) activity, coupled to PCR. The resultant PCR product concentration is directly proportional to the initial starting quantity of mRNA, therefore allowing quantification of gene expression by incorporation of a fluorescence detector for the appropriate amplicons. In this chapter, we describe a number of the most popular techniques for performing RT-PCR and detail the subsequent analysis methodologies required to interpret the resultant data in either a relative manner or through absolute quantification of gene expression levels.

  19. Mapping a mutation in Caenorhabditis elegans using a polymerase chain reaction-based approach.

    PubMed

    Myers, Edith M

    2014-01-01

    Many single nucleotide polymorphisms (SNPs) have been identified within the Caenorhabditis elegans genome. SNPs present in the genomes of two isogenic C. elegans strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which undergraduate students use molecular biological techniques to map a mutation to a chromosome using a set of SNPs. Through this multi-week exercise, students perform genetic crosses, DNA extraction, polymerase chain reaction, restriction enzyme digests, agarose gel electrophoresis, and analysis of restriction fragment length polymorphisms. Students then analyze their results to deduce the chromosomal location of the mutation. Students also use bioinformatics websites to develop hypotheses that link the genotype to the phenotype. PMID:24615818

  20. DNA fragment length polymorphism analysis of Mycobacterium tuberculosis isolates by arbitrarily primed polymerase chain reaction.

    PubMed

    Palittapongarnpim, P; Chomyc, S; Fanning, A; Kunimoto, D

    1993-04-01

    Strain identification of Mycobacterium tuberculosis would prove whether transmission had occurred between individuals. A method to characterize strains of M. tuberculosis has been developed utilizing polymerase chain reaction (PCR). Purified chromosomal DNA of cultured clinical samples of M. tuberculosis were subjected to PCR using short (10-12 nucleotide) oligonucleotide primers. PCR products visualized after agarose gel electrophoresis and ethidium bromide staining demonstrated that different strains of M. tuberculosis give different banding patterns. This technique was used to confirm the relationship between cases of tuberculosis in several clusters, prove the lack of relationship between 2 isolates with the same antibiotic-resistance pattern, confirm a suspected mislabeling event, and suggest the source of infection in a case of tuberculous meningitis. This method is rapid and simple and does not require radioactive probes.

  1. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    PubMed

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  2. Detection of human astrovirus serotype 1 by the polymerase chain reaction.

    PubMed

    Jonassen, T O; Kjeldsberg, E; Grinde, B

    1993-09-01

    Astroviruses are small, plus-strand RNA viruses associated with diarrhoea, mostly in children. The diagnostic method commonly used is electron microscopy. We have designed a nested polymerase chain reaction (PCR) based on the recently reported nucleotide sequence of the 3' end of the genome of a human astrovirus serotype 1, the most common form. The PCR was positive for the ten serotype 1 samples tested, while being negative for all other viruses tested, including astrovirus type 2, 3, 4 and 5, calicivirus, rotavirus and picornaviruses. Fecal extracts from patients with diarrhoea were analysed directly or after isolation of RNA, the former method being at least as sensitive. Titration of fecal extracts by PCR indicated the presence of up to 10(11) viral particles per ml in feces.

  3. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  4. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  5. IDENTIFICATION OF MOSQUITO AVIAN-DERIVED BLOOD MEALS BY POLYMERASE CHAIN REACTION-HETERODUPLEX ANALYSIS

    PubMed Central

    LEE, JOON HAK; HASSAN, HASSAN; HILL, GEOFF; CUPP, EDDIE W.; HIGAZI, TARIG B.; MITCHELL, CARL J.; GODSEY, MARVIN S.; UNNASCH, THOMAS R.

    2008-01-01

    A polymerase chain reaction (PCR) heteroduplex assay (HDA) was developed to identify avian derived mosquito blood meals to the species level. The assay used primers amplifying a fragment of the cytochrome B gene from vertebrate but not invertebrate species. In Culex tarsalis fed on quail, PCR products derived from the quail cytochrome B gene were detected seven days post-engorgement. In an analysis of wild-caught mosquitoes, 85% of blood-fed mosquitoes produced detectable PCR products. Heteroduplex patterns obtained from bird-derived PCR products were found to permit the unambiguous identification of all species examined. No intraspecific variation in HDA patterns was found. The PCR-HDA was used to characterize blood meals in wild caught Cx. tarsalis. Of the 67 blood meals analyzed, 60% were derived from avian sources. Of the avian blood meals, 65% were derived from a single host, the common grackle. PMID:12201598

  6. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  7. Midtrimester fetal herpes simplex-2 diagnosis by serology, culture and quantitative polymerase chain reaction.

    PubMed

    Curtin, William M; Menegus, Marilyn A; Patru, Maria-Magdalena; Peterson, C Jeanne; Metlay, Leon A; Mooney, Robert A; Stanwood, Nancy L; Scheible, Amy L; Dorgan, Angela

    2013-01-01

    The acquisition of herpes simplex virus (HSV) in utero comprises a minority of neonatal herpes infections. Prenatal diagnosis is rare. We describe a midtrimester diagnosis of fetal HSV-2 infection. Ultrasound at 20 weeks for elevated maternal serum α-fetoprotein (MSAFP) showed lagging fetal growth, echogenic bowel, echogenic myocardium, and liver with a mottled pattern of echogenicity. Amniocentesis demonstrated normal karyotype, elevated AFP and positive acetylcholinesterase. Culture isolated HSV-2 with an aberrant growth pattern. Maternal serology was positive for HSV-2. Quantitative DNA polymerase chain reaction (PCR) showed 59 million copies/ml. Fetal autopsy demonstrated widespread tissue necrosis but only sparse HSV-2 inclusions. Fetal HSV-2 infection can be suspected when an elevated MSAFP accompanies ultrasound findings suggesting perinatal infection. Maternal HSV serology, amniotic fluid culture and quantitative PCR are recommended for diagnostic certainty and counseling.

  8. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  9. [Characterization of aldehyde dehydrogenase gene fragment from mung bean Vigna radiata using the polymerase chain reaction].

    PubMed

    Ponomarev, A G; Bubiakina, V V; Tatarinova, T D; Zelenin, S M

    1998-01-01

    Two degenerate oligonucleotide sequence primers and polymerase chain reactions on total DNA have been utilized to clone on 651--bp gene fragment coding the central part of amino acid sequence of an earlier unknown aldehyde dehydrogenase (ALDH) from mung bean. The deduced partial amino acid sequence for this aldehyde dehydrogenase shows about 65% sequence identity to ALDHs of Vibrio cholerae Rhodococcus sp., Alcaligenes eutrophus and about 45% sequence identity to mammalian ALDHs 1 and 2, ALDHs of Aspergillus niger and A, nidulans, the betain aldehyde dehydrogenase from spinach. Alignment of the mung bean aldehyde dehydrogenase partial amino acid sequence with the sequence of 16 NAD(P)(+)-dependent aldehyde dehydrogenases has demonstrated that all strictly conserved amino acid residues and all three conservative regions are identical. PMID:9778740

  10. Specific Polymerase Chain Reaction Primers for the Detection of Plasmodiophora brassicae in Soil and Water.

    PubMed

    Faggian, R; Bulman, S R; Lawrie, A C; Porter, I J

    1999-05-01

    ABSTRACT The development of specific oligonucleotide primers for Plasmodiophora brassicae has led to a nested polymerase chain reaction (PCR) detection method for P. brassicae in soil and water. Initially, the PCR was used to amplify a section of the rDNA repeat. The PCR products were sequenced and the data used to design primers that were directed at the ribosomal RNA genes and internal transcribed spacer regions. Specificity was tested against more than 40 common soil organisms, host plants, and spore suspension contaminants, as well as P. brassicae isolates from around Australia and the world. Sensitivity was determined to be 0.1 fentograms (fg; 10(-15) g) for pure template and as low as 1,000 spores per g of potting mix. In soil, P. brassicae was detected in all soils where the inoculum was sufficient to result in clubroot symptoms. Also outlined is a simple method of DNA extraction from soil. PMID:18944752

  11. The use of the polymerase chain reaction for the detection of human papillomavirus type 13.

    PubMed

    Williamson, A L; Dennis, S J

    1991-01-01

    Human papillomavirus type 13 (HPV-13) is associated with oral focal epithelial hyperplasia (FEH). The purpose of this study was to establish conditions for the application of polymerase chain reaction (PCR) to the specific detection and amplification of HPV-13 DNA. To design primers for HPV-13 a part of the HPV-13 genome was sequenced first: the smallest BamHI fragment (597 bp) of HPV-13 was subcloned and sequenced. The sequence was found to be part of a large open reading frame and had significant homology with the L1 gene of other HPVs. HPV-13 specific primers were designed to amplify a 240 bp fragment from the L1 gene by PCR. Conditions for PCR were standardized for this set of primers.

  12. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  13. Polymerase Chain Reaction Diagnosis of Leishmaniasis: A Species-Specific Approach.

    PubMed

    González-Marcano, Eglys; Kato, Hirotomo; Concepción, Juan Luis; Márquez, María Elizabeth; Mondolfi, Alberto Paniz

    2016-01-01

    Leishmaniasis is an infectious disease caused by protozoan parasites of the genus Leishmania which are transmitted to humans through bites of infected sand flies. The variable clinical manifestations and the evolution of the disease are determined by the infecting species. Recognition at a species level is of utmost importance since this greatly impacts therapy decision making as well as predicts outcome for the disease. This chapter describes the application of polymerase chain reaction (PCR) in the detection of Leishmania parasites across the disease spectrum, including protocols for sample collection and transportation, genomic material extraction, and target amplification methods with special emphasis on PCR amplification of the cytochrome b gene for Leishmania spp. species identification.

  14. Polymerase chain reaction in natural convection systems: A convection-diffusion-reaction model

    NASA Astrophysics Data System (ADS)

    Yariv, E.; Ben-Dov, G.; Dorfman, K. D.

    2005-09-01

    We present a rational scheme for modeling natural convection-driven polymerase chain reaction (PCR), where many copies of a DNA template are made by cycling between hot and cold regions via a circulatory, buoyancy-driven flow. This process is described here in the framework of multiple-species formulation, using evolution equations which govern the concentrations of the various DNA species in the carrying solution. In the intermediate asymptotic limit, where a stationary amplification rate is achieved, these equations provide an eigenvalue problem for computing the exponential amplification rate of double-stranded DNA. The scheme is demonstrated using a simplified model of a Rayleigh-Bénard cell. In contrast to what may have been anticipated, diffusion tends to enhance the growth rate. The present model, intended to be used as a template for more device-specific analyses, provides a starting point for understanding the effects of the competing mechanisms (reaction, convection and diffusion) upon the amplification efficiency.

  15. Polymerase chain reaction-based strain characterization of noncapsulate Haemophilus influenzae.

    PubMed Central

    Jordens, J Z; Leaves, N I; Anderson, E C; Slack, M P

    1993-01-01

    A polymerase chain reaction-based typing method for noncapsulate Haemophilus influenzae was developed. Randomly amplified polymorphic DNA fingerprints were generated from boiled supernatants prepared directly from bacterial colonies without the need for DNA extraction. The technique was applied to isolates obtained during putative outbreaks of chest infection and validated by comparison with sodium dodecyl sulfatepolyacrylamide gel electrophoresis analysis of outer membrane protein-enriched preparations and rRNA gene restriction analysis. There was complete concordance between the three techniques. The results show that randomly amplified polymorphic DNA analysis provides a highly discriminatory method of characterizing strains of noncapsulate H. influenzae which is eminently suitable as an epidemiological tool for the rapid investigation of outbreaks of infection. Images PMID:8263183

  16. How appropriate are cerebrospinal fluid polymerase chain reaction requests for suspected central nervous system infections?

    PubMed

    Mamoojee, Yaasir; Chadwick, David

    2011-12-01

    Cerebrospinal fluid (CSF) polymerase chain reaction (PCR) assays have become the main diagnostic tests for central nervous system viral infections in recent years. Previous studies have suggested algorithms based on CSF leukocyte count and total protein levels to determine when CSF PCR assays are indicated. Based on these criteria, 1,469 CSF PCR tests requested over a two-year period were reviewed. A proportion of positive PCR results were found in children with normal CSF, unlike in adults where such occurrences were extremely rare. The results suggest that applying a strategy of screening CSF specimens using leukocyte count, glucose and protein, at least in adults, may have avoided more than half of CSF PCR requests with little detriment to patient care and considerable cost savings. Larger prospective studies are needed to determine whether algorithms using standard CSF parameters and clinical information can optimise the use of CSF PCR assays in clinical practice. PMID:22268308

  17. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.

    PubMed

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G

    1991-02-01

    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day.

  18. Frequency of Borrelia in Morphea Lesion by Polymerase Chain Reaction in Northeast of Iran

    PubMed Central

    Yazdanpanah, Mohhamad Javad; Sharifi, Norieh; Khooei, Alireza; Banihashemi, Mahnaz; Khaje-Daluee, Mohammad; Shamsi, Azadeh; Ghazvini, Kiarash

    2015-01-01

    Background: The etiology of morphea is still unknown. Borrelia spp. as a causative agent of morphea has been discussed since 1985, but the relationship remains uncertain. Objectives: We aimed to find the frequency of Borrelia in morphea lesions by polymerase chain reaction (PCR) in northeast of Iran. Patients and Methods: Sixty six patients with morphea were prospectively included in the present study. For each patient, formalin-fixed, paraffin-embedded tissue blocks of skin lesion biopsies were examined for Borrelia spp. DNA using PCR. Results: No Borrelia DNA was detected by PCR in skin lesions of patients with morphea. Conclusions: The result of this study showed no relationship between Borrelia infection and morphea lesions and in other word indicated that morphea, at least in Iran, is not caused by Borrelia spp. PMID:26468360

  19. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    PubMed

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-06-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted.

  20. Specific and sensitive detection of Trichomonas tenax by the polymerase chain reaction.

    PubMed

    Kikuta, N; Yamamoto, A; Fukura, K; Goto, N

    1997-03-01

    A polymerase chain reaction (PCR) protocol was developed for specific detection of Trichomonas tenax by using a pair of primers designed for its 18S rRNA gene. The detection was specific for T. tenax, since no amplification was detected with DNAs from Trichomonas vaginalis, which belongs to the same genus as T. tenax, in addition to various species of oral protists, fungi and bacteria, and human leukocytes. This method had a detection limit of 100 fg for T. tenax genomic DNA and could detect T. tenax cells in dental plaque at a concentration of as low as 5 cells per PCR mixture. Direct detection from clinical dental plaque samples was also possible; therefore, the present PCR procedure could provide a simple and rapid detection method of T. tenax in dental plaque.

  1. G-quadruplex-generating polymerase chain reaction for visual colorimetric detection of amplicons.

    PubMed

    Bhadra, Sanchita; Codrea, Vlad; Ellington, Andrew D

    2014-01-15

    We have developed a self-reporting polymerase chain reaction (PCR) system for visual colorimetric gene detection and distinction of single nucleotide polymorphisms (SNPs). Amplification is performed using target-specific primers modified with a 5'-end tail that is complementary to a G-quadruplex deoxyribozyme-forming sequence. At end-point, G-quadruplexes are forced to fold from PCR-generated duplex DNA and then are used to colorimetrically report the successful occurrence of PCR by assaying their peroxidase activity using a chromogenic substrate. Furthermore, primer design considerations for the G-quadruplex-generating PCR system have allowed us to visually distinguish SNPs associated with Mycobacterium tuberculosis drug resistance alleles. PMID:24135653

  2. Detection of BCR-ABL using one step reverse transcriptase- polymerase chain reaction and microchip electrophoresis.

    PubMed

    Lin, Xuexia; Wu, Jing; Liu, Wu; Li, Haifang; Wang, Zhihua; Lin, Jin-Ming

    2013-12-15

    One-step reverse transcriptase polymerase chain reaction (RT-PCR) coupled with microchip electrophoresis (MCE) was established to analyze BCR-ABL fusion gene. The use of one-step RT-PCR could simplify the RT-PCR procedure and thus reduced the risk of contamination and sample consumption. This method also enhanced the sensitivity for amplified target DNA and dramatically shorted the analysis time. Moreover, this assay can simultaneously identify b2a2 and b3a2. Orthogonal array design, which can investigated mutual effects of PCR parameters, was used to optimize the reaction system. This approach was highly effective, reproducible and sensitive, and would be suitable for the determination of BCR-ABL in clinic diagnosis.

  3. Detection of hepatopancreatic parvovirus (HPV) in wild shrimp from India by nested polymerase chain reaction (PCR).

    PubMed

    Manjanaik, B; Umesha, K R; Karunasagar, Indrani; Karunasagar, Iddya

    2005-02-28

    The prevalence of hepatopancreatic parvovirus (HPV) in wild penaeid shrimp samples from India was studied by nested polymerase chain reaction (PCR) using primers designed in our laboratory. The virus could be detected in 9 out of 119 samples by non-nested PCR. However, by nested PCR 69 out of 119 samples were positive. The PCR results were confirmed by hybridization with digoxigenin-labelled DNA probe. Shrimp species positive by non-nested PCR included Penaeus monodon, Penaeus indicus and Penaeus semisulcatus and by nested PCR Parapenaeopsis stylifera, Penaeus japonicus, Metapenaeus monoceros, M. affinis, M. elegans, M. dobsoni, M. ensis and Solenocera choprai. This is the first report on the prevalence of HPV in captured wild shrimp from India. PMID:15819441

  4. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  5. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  6. Detection of influenza viruses in throat swab by using polymerase chain reaction.

    PubMed

    Yamada, A; Imanishi, J; Nakajima, E; Nakajima, K; Nakajima, S

    1991-01-01

    An assay protocol based on exploiting the polymerase chain reaction (PCR) for the direct detection of influenza virus in throat swab is described. By use of the mixture of H1 and H3 primers, it was possible to determine the subtype of the influenza A viruses simultaneously. No visible band was detected after PCR of influenza B or A (H2N2) viruses with a pair of H1 or H3 primers. The dilution experiment showed that the influenza viruses, as few as 1.3-6 plaque-forming units, were sufficient for detecting the HA gene by PCR. All throat swab samples from which influenza viruses had been isolated by conventional method were also positively detected by PCR method.

  7. Polymerase chain reaction assay for detection of sheep and goat meats.

    PubMed

    K Chikuni; T Tabata; M Kosugiyama; M Monma; M Saito

    1994-01-01

    Polymerase Chain Reaction (PCR) was applied to a qualitative differentiation between sheep, goat and bovine meats. Oligonucleotide primers were designed for the amplification of sheep satellite I DNA sequence. The PCR amplified 374 bp fragments from sheep and goat DNA, but no fragment from bovine, water buffalo, sika deer, pig, horse, rabbit and chicken DNA. Sheep DNA (10 pg) was detected by 4% agarose gel electrophoresis following PCR amplification. Althoug cooking of the sample meats reduced the PCR products, sheep DNA was detected in the meat heated at 120°C. In order to differentiate between sheep and goat meats, nucleotide sequences of the PCR products were determined directly by cycle sequencing. The sequence of PCR products showed 92% of homology between sheep and goat. They were differentiated by ApaI digestion of the PCR products because sheep had one ApaI site and goat had no site in the PCR products.

  8. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  9. Gene analysis of multiple oral bacteria by the polymerase chain reaction coupled with capillary polymer electrophoresis.

    PubMed

    Liu, Chenchen; Yamaguchi, Yoshinori; Sekine, Shinichi; Ni, Yi; Li, Zhenqing; Zhu, Xifang; Dou, Xiaoming

    2016-03-01

    Capillary polymer electrophoresis is identified as a promising technology for the analysis of DNA from bacteria, virus and cell samples. In this paper, we propose an innovative capillary polymer electrophoresis protocol for the quantification of polymerase chain reaction products. The internal standard method was modified and applied to capillary polymer electrophoresis. The precision of our modified internal standard protocol was evaluated by measuring the relative standard deviation of intermediate capillary polymer electrophoresis experiments. Results showed that the relative standard deviation was reduced from 12.4-15.1 to 0.6-2.3%. Linear regression tests were also implemented to validate our protocol. The modified internal standard method showed good linearity and robust properties. Finally, the ease of our method was illustrated by analyzing a real clinical oral sample using a one-run capillary polymer electrophoresis experiment. PMID:26648455

  10. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  11. DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction

    PubMed Central

    Elshawadfy, Ashraf M.; Keith, Brian J.; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A.

    2014-01-01

    The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the “forked-point” (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the “forked-point” and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms. PMID:24904539

  12. Multiplex detection of mutations.

    PubMed

    Perlin, David S; Balashov, Sergey; Park, Steven

    2008-01-01

    Rapid and reliable detection of mutations at the genetic level is an integral part of modern molecular diagnostics. These mutations can range from dominant single nucleotide polymorphisms within specific loci to codominant heterozygotic insertions and they present considerable challenges to investigators in developing rapid nucleic acid-based amplification assays that can distinguish wild-type from mutant alleles. The recent improvements of real-time polymerase chain reaction (PCR) using self-reporting fluorescence probes have given researchers a powerful tool in developing assays for mutation detection that can be multiplexed for high-throughput screening of multiple mutations and cost effectiveness. Here we describe an application of a multiplexed real-time PCR assay using Molecular Beacon probes for the detection of mutations in codon 54 of the CYP51A gene in Aspergillus fumigatus conferring triazole resistance.

  13. Physical isolation of nascent RNA chains transcribed by RNA polymerase II: evidence for cotranscriptional splicing.

    PubMed Central

    Wuarin, J; Schibler, U

    1994-01-01

    In order to examine whether splicing can occur cotranscriptionally in mammalian nuclei, we mapped exon-intron boundaries on nascent RNA chains transcribed by RNA polymerase II. A procedure that allows fractionation of nuclei into a chromatin pellet containing DNA, histones, and ternary transcription complexes and a supernatant containing the bulk of the nonhistone proteins and RNAs that are released from their DNA templates was developed. The transcripts of the genes encoding DBP, a transcriptional activator protein, and HMG coenzyme A reductase recovered from the chromatin pellet and the supernatant were analyzed by S1 nuclease mapping. The large majority of the RNA molecules from the pellet appeared to be nascent transcripts, since, in contrast to the transcripts present in the supernatant, they were not cleaved at the polyadenylation site but rather contained heterogeneous 3' termini encompassing this site. Splicing intermediates could be detected among nascent and released transcripts, suggesting that splicing occurs both cotranscriptionally and posttranscriptionally. Our results also indicate that polyadenylation is not required for the splicing of the last DBP intron. In addition to allowing detailed structural analysis of nascent RNA chains, the physical isolation of nascent transcripts also yields reliable measurements of relative transcription rates. Images PMID:7523861

  14. Colorimetric detection of lagomorphs' calicivirus genomic sequences by polymerase chain reaction incorporating digoxigenin dUTP.

    PubMed

    Psikal, I; Smíd, B; Kubalíková, R; Valícek, L; Rodák, L; Kosinová, E

    1997-06-30

    A method of reverse transcription followed by polymerase chain reaction (RT-PCR) has been implemented for the demonstration of the rabbit haemorrhagic disease virus (RHDV) genome in organ suspensions, leukocytes and excretions of infected rabbits. RT-PCR has been tested with 10 RHDV strains isolated at various geographic sites and times using a pair of primers coming from the gene region coding for the capsid protein VP60. The same primers were effective in the amplification of 4 of 5 European brown hare syndrome (EBHS) virus isolates. Non-radioactive labelling of PCR products with digoxigenin during the amplification and a system of colorimetric assessment of hybridization reactions between a biotin-labelled RHDV capture probe and the chains of labelled amplicons (PCR ELISA) were used for specific analyses of nucleic acid synthesis. The sensitivity of the alternative procedure of analysis of the dig-labelled PCR products with PCR ELISA was two logs10 higher than that of conventional electrophoresis in agarose gel stained with ethidium bromide. The results of the hybridization reactions, carried out under various stringency conditions, have confirmed the presumption that the genomic similarity between the amplified and the probed areas of the capsid protein VP60 gene was not uniform within all the tested caliciviruses. A higher degree of heterogeneity was observed between the isolates of EBHSV and RHDV.

  15. Detection and characterization of cry1Ac transgene construct in Bt cotton: multiple polymerase chain reaction approach.

    PubMed

    Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N

    2007-01-01

    To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach

  16. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis.

  17. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  18. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  19. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion.

  20. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  1. Development of a polymerase chain reaction test for specific identification of the urinary tract pathogen Aerococcus urinae.

    PubMed

    Aguirre, M; Collins, M D

    1993-05-01

    A polymerase chain reaction test was developed for identification of the gram-positive urinary tract pathogen Aerococcus urinae. Oligonucleotide primers were based on highly specific sequences within the small-subunit rRNA gene. A confirmatory test based on hybridization of the amplified products to a highly specific internal probe was also developed.

  2. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  3. A centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria.

    PubMed

    Choi, Goro; Jung, Jae Hwan; Park, Byung Hyun; Oh, Seung Jun; Seo, Ji Hyun; Choi, Jong Seob; Kim, Do Hyun; Seo, Tae Seok

    2016-06-21

    In this study, we developed a centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria contaminated milk samples. The microdevice was designed to contain identical triplicate functional units and each unit has four reaction chambers, thereby making it possible to perform twelve direct-RPA reactions simultaneously. The integrated microdevice consisted of two layers: RPA reagents were injected in the top layer, while spiked milk samples with food poisoning bacteria were loaded into sample reservoirs in the bottom layer. For multiplex bacterial detection, the target gene-specific primers and probes were dried in each reaction chamber. The introduced samples and reagents could be equally aliquoted and dispensed into each reaction chamber by centrifugal force, and then the multiplex direct-RPA reaction was executed. The target genes of bacteria spiked in milk could be amplified at 39 °C without a DNA extraction step by using the direct-RPA cocktails, which were a combination of a direct PCR buffer and RPA enzymes. As the target gene amplification proceeded, the increased fluorescence signals coming from the reaction chambers were recorded in real-time at an interval of 2 min. The entire process, including the sample distribution, the direct-RPA reaction, and the real-time analysis, was accomplished with a custom-made portable genetic analyzer and a miniaturized optical detector. Monoplex, duplex, and triplex food poisoning bacteria (Salmonella enterica, Escherichia coli O157:H7, and Vibrio parahaemolyticus) detection was successfully performed with a detection sensitivity of 4 cells per 3.2 μL of milk samples within 30 min. By implementing the direct-PRA on the miniaturized centrifugal microsystem, the on-site food poisoning bacteria analysis would be feasible with high speed, sensitivity, and multiplicity.

  4. A centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria.

    PubMed

    Choi, Goro; Jung, Jae Hwan; Park, Byung Hyun; Oh, Seung Jun; Seo, Ji Hyun; Choi, Jong Seob; Kim, Do Hyun; Seo, Tae Seok

    2016-06-21

    In this study, we developed a centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria contaminated milk samples. The microdevice was designed to contain identical triplicate functional units and each unit has four reaction chambers, thereby making it possible to perform twelve direct-RPA reactions simultaneously. The integrated microdevice consisted of two layers: RPA reagents were injected in the top layer, while spiked milk samples with food poisoning bacteria were loaded into sample reservoirs in the bottom layer. For multiplex bacterial detection, the target gene-specific primers and probes were dried in each reaction chamber. The introduced samples and reagents could be equally aliquoted and dispensed into each reaction chamber by centrifugal force, and then the multiplex direct-RPA reaction was executed. The target genes of bacteria spiked in milk could be amplified at 39 °C without a DNA extraction step by using the direct-RPA cocktails, which were a combination of a direct PCR buffer and RPA enzymes. As the target gene amplification proceeded, the increased fluorescence signals coming from the reaction chambers were recorded in real-time at an interval of 2 min. The entire process, including the sample distribution, the direct-RPA reaction, and the real-time analysis, was accomplished with a custom-made portable genetic analyzer and a miniaturized optical detector. Monoplex, duplex, and triplex food poisoning bacteria (Salmonella enterica, Escherichia coli O157:H7, and Vibrio parahaemolyticus) detection was successfully performed with a detection sensitivity of 4 cells per 3.2 μL of milk samples within 30 min. By implementing the direct-PRA on the miniaturized centrifugal microsystem, the on-site food poisoning bacteria analysis would be feasible with high speed, sensitivity, and multiplicity. PMID:27216297

  5. Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA-based detection of three bacterial pathogens.

    PubMed

    Kersting, Sebastian; Rausch, Valentina; Bier, Frank F; von Nickisch-Rosenegk, Markus

    2014-01-01

    We report on the development of an on-chip RPA (recombinase polymerase amplification) with simultaneous multiplex isothermal amplification and detection on a solid surface. The isothermal RPA was applied to amplify specific target sequences from the pathogens Neisseria gonorrhoeae, Salmonella enterica and methicillin-resistant Staphylococcus aureus (MRSA) using genomic DNA. Additionally, a positive plasmid control was established as an internal control. The four targets were amplified simultaneously in a quadruplex reaction. The amplicon is labeled during on-chip RPA by reverse oligonucleotide primers coupled to a fluorophore. Both amplification and spatially resolved signal generation take place on immobilized forward primers bount to expoxy-silanized glass surfaces in a pump-driven hybridization chamber. The combination of microarray technology and sensitive isothermal nucleic acid amplification at 38 °C allows for a multiparameter analysis on a rather small area. The on-chip RPA was characterized in terms of reaction time, sensitivity and inhibitory conditions. A successful enzymatic reaction is completed in <20 min and results in detection limits of 10 colony-forming units for methicillin-resistant Staphylococcus aureus and Salmonella enterica and 100 colony-forming units for Neisseria gonorrhoeae. The results show this method to be useful with respect to point-of-care testing and to enable simplified and miniaturized nucleic acid-based diagnostics. FigureThe combination of multiplex isothermal nucleic acid amplification with RPA and spatially-resolved signal generation on specific immobilized oligonucleotides.

  6. Detecting and Number Counting of Single Engineered Nanoparticles by Digital Particle Polymerase Chain Reaction.

    PubMed

    Paunescu, Daniela; Mora, Carlos A; Querci, Lorenzo; Heckel, Reinhard; Puddu, Michela; Hattendorf, Bodo; Günther, Detlef; Grass, Robert N

    2015-10-27

    The concentrations of nanoparticles present in colloidal dispersions are usually measured and given in mass concentration (e.g. mg/mL), and number concentrations can only be obtained by making assumptions about nanoparticle size and morphology. Additionally traditional nanoparticle concentration measures are not very sensitive, and only the presence/absence of millions/billions of particles occurring together can be obtained. Here, we describe a method, which not only intrinsically results in number concentrations, but is also sensitive enough to count individual nanoparticles, one by one. To make this possible, the sensitivity of the polymerase chain reaction (PCR) was combined with a binary (=0/1, yes/no) measurement arrangement, binomial statistics and DNA comprising monodisperse silica nanoparticles. With this method, individual tagged particles in the range of 60-250 nm could be detected and counted in drinking water in absolute number, utilizing a standard qPCR device within 1.5 h of measurement time. For comparison, the method was validated with single particle inductively coupled plasma mass spectrometry (sp-ICPMS).

  7. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    PubMed

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  8. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    PubMed

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  9. Polymerase chain reaction and real-time PCR for diagnosing of Leishmania infantum chagasi in dogs.

    PubMed

    Ramos, Rafael Antonio do Nascimento; Ramos, Carlos Alberto do Nascimento; Jusi, Márcia Mariza Gomes; de Araújo, Flábio Ribeiro; Machado, Rosangela Zacarias; Faustino, Maria Aparecida da Glória; Alves, Leucio Câmara

    2012-01-01

    The importance of dogs as a reservoir for Leishmania infantumchagasi in urban environments has stimulated numerous studies assessing diagnostic techniques. When performed properly, such procedures are an important step in preventing leishmaniasis in humans. Molecular methods have become prominent for this purpose. The aim of the present study was to determine the performance of the polymerase chain reaction (PCR) and real-time PCR (qPCR) for diagnosing of canine visceral leishmaniasis (CVL) using different biological samples. For this, 35 dogs from an area endemic for CVL were used. Bone marrow aspirate and lymph node and spleen fragments from these dogs were used for the molecular diagnosis. In the present study, qPCR was able to detect a greater number of positive animals than seen with PCR. Among the different biological samples used, there was no significant difference in L. infantumchagasi DNA detection between PCR and qPCR. However, considering that lymph nodes are easy to acquire, these can be considered to be the best samples for making molecular diagnoses of L. infantum chagasi infection.

  10. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods.

    PubMed

    Morinha, F; Cabral, J A; Bastos, E

    2012-09-01

    Accurate identification of sex in birds is important for the management and conservation of avian wildlife in several ways, namely in the development of population, behavioral and ecological studies, as well as in the improvement of ex situ captive breeding programs. In general, nestlings, juveniles and adult birds of a wide number of sexually monomorphic species cannot be sexed based on phenotypic traits. The development of molecular methodologies for avian sexing overcame these difficulties, allowing a reliable gender differentiation for these species. The polymerase chain reaction (PCR)-based methods have been widely applied in molecular sexing of birds, using a large diversity of sex-linked markers. During the last 15 yrs, there was a continuous improvement in the PCR-based protocols for bird sexing, increasing the accuracy, speed and high-throughput applicability of these techniques. The recent advances in real-time PCR platforms and whole genome analysis methods provided new resources for the detection and analysis of novel specific markers and protocols. This review presents a comparative guide of classical and recent advances in PCR-based methods for avian molecular sexing, highlighting its strengths and limitations. Future research opportunities in this field are also addressed.

  11. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification

    SciTech Connect

    Zietkiewicz, E.; Labuda, D. ); Rafalski, A. )

    1994-03-15

    Simple sequence repeats (SSR), or microsatellites, are ubiquitous in eukaryotic genomes. Here the authors demonstrate the utility of microsatellite-directed DNA fingerprinting by polymerase chain reaction (PCR) amplification of the interrepeat region. No sequencing is required to design the oligonucleotide primers. They tested primers anchored at 3[prime] or 5[prime] termini of the (A)[sub n] repeats, extended into the flanking sequence by 2 to 4 nucleotide residues [3[prime]-anchored primers: (CA)[sub 8]RG, (CA)[sub 8]RY, and (CA)[sub 7]RTCY; and 5[prime]-anchored primers: BDB(CA)[sub 7]C, DBDA(CA)[sub 7], VHVG(TG)[sub 7] and HVH(TG)[sub 7]T]. Radioactively labeled amplification products were analyzed by electrophoresis, revealing information on multiple genomic loci in a single gel lane. Complex, species-specific patterns were obtained from a variety of eukaryotic taxa. Intraspecies polymorphisms were also observed and shown to segregate as Mendelian markers. Inter-SSR PCR provides a novel fingerprinting approach applicable for taxonomic and phylogenetic comparisons and as a mapping tool in a wide range of organisms. This application of (CA)[sub n] repeats may be extended to different microsatellites and other common dispersed elements. 24 refs., 6 figs.

  12. Rapid and sensitive detection of peste des petits ruminants virus by a polymerase chain reaction assay.

    PubMed

    Couacy-Hymann, E; Roger, F; Hurard, C; Guillou, J P; Libeau, G; Diallo, A

    2002-02-01

    A rapid and specific test was developed for the diagnosis of peste des petits ruminants disease. This assay is based on the rapid purification of RNA on glass beads followed by the reverse transcription-polymerase chain reaction (RT-PCR). To that effect, a set of primers (NP3/NP4) was used to amplify specifically a fragment of about 350 bp in the 3' end of the RNA messenger that encodes the nucleocapsid protein of the peste des petits ruminants virus. The PCR-product was detected by UV illumination after electrophoresis on agarose gel or by hybridisation with a digoxigenin-11-dUTP labelled oligonucleotide probe after a blot transfer. In comparison with the conventional titration technique on Vero cells, this RT-PCR assay was 1000-fold more sensitive. Compared with the popular Chomczynski and Sacchi's method [Anal. Biochem. 162 (1987) 156], the purification of the RNA on the glass beads offers the advantage of being more rapid and also avoiding the use of solvents.

  13. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Souza, M T; Carvalho-Zilse, G A

    2014-07-25

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.

  14. Use of polymerase chain reaction in human African trypanosomiasis stage determination and follow-up.

    PubMed Central

    Truc, P.; Jamonneau, V.; Cuny, G.; Frézil, J. L.

    1999-01-01

    Stage determination of human African trypanosomiasis is based on the detection of parasites and measurements of biological changes in the cerebrospinal fluid (CSF) (concentration of white blood cells > 5 cells per mm3 and increased total protein levels). The patient is treated accordingly. Demonstration of the absence or presence of trypanosomes by the double centrifugation technique is still the only test available to clinicians for assessing treatment success. In this study, however, we evaluate the polymerase chain reaction (PCR) as a tool for assessing the disease stage of trypanosomiasis and for determining whether treatment has been successful. All 15 study patients considered to be in the advanced stage of the disease were PCR positive; however, trypanosomes were demonstrated by double centrifugation in only 11 patients. Of the five remaining patients, who were considered to be in the early stage, PCR and double centrifugation were negative. Following treatment, 13 of the 15 second-stage patients were found to be negative for the disease in at least two samples by PCR and double centrifugation. Two others were still positive by PCR immediately and one month after the treatment. Trypanosome DNA detection using PCR suggested that the two positive patients were not cured but that their possible relapse could not be identified by a search for parasites using the double centrifugation technique. Further evaluation of the PCR method is required, in particular to determine whether PCR assays could be used in studies on patients who fail to respond to melarsoprol, as observed in several foci. PMID:10534898

  15. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    PubMed

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing.

  16. Elimination of false-positive polymerase chain reaction results resulting from hole punch carryover contamination.

    PubMed

    Bonne, Nicolai; Clark, Phillip; Shearer, Patrick; Raidal, Shane

    2008-01-01

    The collection of biological material (e.g., blood) directly onto filter paper for subsequent use in laboratory assays such as polymerase chain reaction (PCR), has become a common practice. Dried cells or fluid on the paper can be readily rehydrated and retrieved into a standard volume of an appropriate elution buffer but introduces a dilution factor to the sample. The use of a common cutting instrument for excising a standard-sized piece of paper that contains the material also introduces the potential for transferring biological material from one sample to subsequent samples, causing false-positive results by PCR. In the present study, filter-paper-collected blood that contained beak and feather disease virus was used to determine if viral DNA could be transferred between samples by a hole punch used to excise sequential filter papers. It was determined that false-positive results could be obtained at least 13 times after a positive sample. Subsequently, the efficacy of 4 methods of hole punch disinfection, flaming, VirkonS, bleach, and a bleach-ethanol combination, was assessed. The only effective and practical method to destroy DNA was a method where the hole punch was agitated in commercial bleach, rinsed in water, the water was displaced with 100% ethanol and air-dried. This method was simple, cheap, and relatively rapid, and allowed for the use of a single hole punch for a series of samples, without carryover contamination and consequent false-positive results.

  17. A quantitative real-time polymerase chain reaction assay for the seagrass pathogen Labyrinthula zosterae.

    PubMed

    Bergmann, Nina; Fricke, Birgit; Schmidt, Martina C; Tams, Verena; Beining, Katrin; Schwitte, Hildegard; Boettcher, Anne A; Martin, Daniel L; Bockelmann, Anna-Christina; Reusch, Thorsten B H; Rauch, Gisep

    2011-11-01

    The protist Labyrinthula zosterae (Phylum Bigyra, sensu Tsui et al. 2009) has been identified as a causative agent of wasting disease in eelgrass (Zostera marina), of which the most intense outbreak led to the destruction of 90% of eelgrass beds in eastern North America and western Europe in the 1930s. Outbreaks still occur today, albeit at a smaller scale. Traditionally, L. zosterae has been quantified by measuring the necrotic area of Z. marina leaf tissue. This indirect method can however only lead to a very rough estimate of pathogen load. Here, we present a quantitative real-time polymerase chain reaction (qPCR) approach to directly detect and quantify L. zosterae in eelgrass tissue. Based on the internal transcribed spacer (ITS) sequences of rRNA genes, species-specific primers were designed. Using our qPCR, we were able to quantify accurately and specifically L. zosterae load both from culture and eelgrass leaves using material from Europe and North America. Our detection limit was less than one L. zosterae cell. Our results demonstrate the potential of this qPCR assay to provide rapid, accurate and sensitive molecular identification and quantification of L. zosterae. In view of declining seagrass populations worldwide, this method will provide a valuable tool for seagrass ecologists and conservation projects. PMID:21777400

  18. Analysis of polymorphism in the bovine casein genes by use of the polymerase chain reaction.

    PubMed

    Pinder, S J; Perry, B N; Skidmore, C J; Savva, D

    1991-01-01

    Methods have been devised for detecting polymorphisms in the bovine beta- and kappa-casein genes using the polymerase chain reaction (PCR) followed either by restriction enzyme digestion (to reveal a restriction fragment length polymorphism (RFLP] or by hybridization of an allele-specific oligonucleotide. These methods, as well as being faster and more sensitive than traditional RFLP methods, are of more general applicability since they can detect any change in DNA sequence. They require only a small sample of blood or semen and are applicable to animals of any age or sex. These methods make possible large-scale screening and thus selection for alleles at these loci. Typing of blood DNA can give erroneous results when the animal concerned is a twin; however, this can be overcome by retesting using milk or semen. Analysis of the kappa-casein genotype of Holstein-Friesian bulls gives frequencies for the A and B alleles of 0.80 and 0.20 respectively. Selection in favour of the B allele, which is superior for cheese production, could thus have a large effect. The A3 and B alleles at the beta-casein locus have been shown to be rare in the Holstein-Friesian population. Linkage disequilibrium exists between beta-casein B and kappa-casein B.

  19. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays.

    PubMed

    Bustin, S A

    2000-10-01

    The reverse transcription polymerase chain reaction (RT-PCR) is the most sensitive method for the detection of low-abundance mRNA, often obtained from limited tissue samples. However, it is a complex technique, there are substantial problems associated with its true sensitivity, reproducibility and specificity and, as a quantitative method, it suffers from the problems inherent in PCR. The recent introduction of fluorescence-based kinetic RT-PCR procedures significantly simplifies the process of producing reproducible quantification of mRNAs and promises to overcome these limitations. Nevertheless, their successful application depends on a clear understanding of the practical problems, and careful experimental design, application and validation remain essential for accurate quantitative measurements of transcription. This review discusses the technical aspects involved, contrasts conventional and kinetic RT-PCR methods for quantitating gene expression and compares the different kinetic RT-PCR systems. It illustrates the usefulness of these assays by demonstrating the significantly different levels of transcription between individuals of the housekeeping gene family, glyceraldehyde-3-phosphate-dehydrogenase (GAPDH).

  20. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    PubMed Central

    Spandidos, Athanasia; Wang, Xiaowei; Wang, Huajun; Dragnev, Stefan; Thurber, Tara; Seed, Brian

    2008-01-01

    Background Quantitative polymerase chain reaction (QPCR) is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays. PMID:19108745

  1. Detection and quantification of Citrobacter freundii and C. braakii by 5'-nuclease polymerase chain reaction.

    PubMed

    Kaclíková, Eva; Krascsenicsová, Klára; Pangallo, Domenico; Kuchta, Tomás

    2005-10-01

    A new 5'-nuclease polymerase chain reaction (PCR) system for the detection and quantification of Citrobacter freundii and C. braakii was developed with primers and the probe oriented to a specific region of the cfa gene encoding a cyclopropane fatty acid synthase. The qualitative variant of the method consisted of a conventional PCR with end-point fluorimetry or agarose gel electrophoresis, and the quantitative variant used kinetic real-time PCR measurement. The PCR system was specific for C. freundii and C. braakii, detecting neither other Citrobacter spp. nor other enteric bacteria (Escherichia coli, Salmonella enterica, and others). The detection limit of the qualitative variant of the method was 10(3) cfu/mL when the amplification was followed by fluorimetry and 10(4) cfu/mL when the amplification was followed by gel electrophoresis. The real-time PCR variant of the method facilitated quantification over a range of concentrations from 10(2) to 10(8) cfu/mL, with Escherichia coli (10(6) cfu/mL) and Salmonella enterica (10(6) cfu/mL) having no effect on the quantification.

  2. Ion-Mediated Polymerase Chain Reactions Performed with an Electronically Driven Microfluidic Device.

    PubMed

    Zhang, Yi; Li, Qian; Guo, Linjie; Huang, Qing; Shi, Jiye; Yang, Yang; Liu, Dongsheng; Fan, Chunhai

    2016-09-26

    The polymerase chain reaction (PCR) is a powerful method for exponentially amplifying very low amounts of target DNA from genetic, clinical, and forensic samples. However, the heating and cooling steps in PCR largely hamper the miniaturization of thermocyclers for on-site detection of pathogens and point-of-care tests. Herein, we devise an ion-mediated PCR (IM-PCR) strategy by exploiting ion-induced DNA denaturation/renaturation cycles. DNA duplexes are effectively denatured in alkaline solutions; whereas, the denatured single-stranded DNA strands readily reform duplexes at neutral pH. By using an integrated microchip that can programmably control the solution pH simply switching the potential in a range of several hundred millivolts, we can trigger IM-PCR at a constant temperature. Analogously to thermal cycling, 30 cycles of pH-induced denaturation/renaturation were used to amplify protein DNA fragments as confirmed by DNA sequencing. We anticipate that this portable, low-cost, and scalable IM-PCR holds great promise for widespread biological, clinical, and environmental applications. PMID:27611873

  3. Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis

    PubMed Central

    Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

    2003-01-01

    Aim: To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. Methods: The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Results: Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. Conclusions: PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive. PMID:12488268

  4. Genital infection caused by Entamoeba histolytica confirmed by polymerase chain reaction analyses.

    PubMed

    Asano, Hiroshi; Kaneuchi, Masanori; Furuta, Itsuko; Yamaya, Yukie; Hatanaka, Kanako C; Takeda, Mahito; Matsuno, Yoshihiro; Sakuragi, Noriaki

    2014-05-01

    Entamoeba histolytica is estimated to infect approximately 1% of the global population. In Japan, the prevalence of amebic dysentery has been increasing, with more than 800 patients newly diagnosed annually. However, genital infection with E. histolytica is uncommon even in endemic areas. We present a case of vaginitis caused by E. histolytica. A 50-year-old Japanese woman without history of overseas travel presented to a nearby clinic with increased vaginal discharge. She had hemorrhagic erosion at the uterine cervix with yellowish vaginal discharge, and was referred to our hospital for exclusion of malignancy. Cervical cytology revealed periodic acid-Schiff-positive protozoa not aggregating around squamous cells, and thus amebic vaginitis was suspected. We performed polymerase chain reaction (PCR) analyses and identified E. histolytica. The vaginitis was treated with metronidazole, and the disappearance of amebic protozoa was confirmed by cytology and PCR. Therefore, it may be important to obtain early diagnosis by cervical cytology and PCR.

  5. High sensitivity detection of active botulinum neurotoxin by glyco-quantitative polymerase chain-reaction.

    PubMed

    Kwon, Seok Joon; Jeong, Eun Ji; Yoo, Yung Choon; Cai, Chao; Yang, Gi-Hyeok; Lee, Jae Chul; Dordick, Jonathan S; Linhardt, Robert J; Lee, Kyung Bok

    2014-03-01

    The sensitive detection of highly toxic botulinum neurotoxin (BoNT) from Clostridium botulinum is of critical importance because it causes human illnesses if foodborne or introduced in wounds and as an iatrogenic substance. Moreover, it has been recently considered a possible biological warfare agent. Over the past decade, significant progress has been made in BoNT detection technologies, including mouse lethality assays, enzyme-linked immunosorbent assays, and endopeptidase assays and by mass spectrometry. Critical assay requirements, including rapid assay, active toxin detection, sensitive and accurate detection, still remain challenging. Here, we present a novel method to detect active BoNTs using a Glyco-quantitative polymerase chain-reaction (qPCR) approach. Sialyllactose, which interacts with the binding-domain of BoNTs, is incorporated into a sialyllactose-DNA conjugate as a binding-probe for active BoNT and recovered through BoNT-immunoprecipitation. Glyco-qPCR analysis of the bound sialyllactose-DNA is then used to detect low attomolar concentrations of BoNT and attomolar to femtomolar concentrations of BoNT in honey, the most common foodborne source of infant botulism.

  6. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    PubMed

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; Brito, Cristiana Ferreira Alves de; Carvalho, Luzia Helena

    2014-02-01

    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  7. Laboratory reporting accuracy of polymerase chain reaction testing for avian polyomavirus.

    PubMed

    Fitzgerald, Brenna; Olsen, Geoff; Speer, Brian

    2013-03-01

    Polymerase chain reaction (PCR) assays are available for detection of birds infected with avian polyomavirus (APV). Several laboratories offer this diagnostic assay in the United States, but little information is available regarding assay sensitivity, specificity, and accuracy. In this study, known APV-positive and APV-negative samples (each n = 10, 5 undiluted and 5 diluted) were sent to 5 commercial laboratories. A significant difference in reporting accuracy was found among laboratories, most notably for dilute APV-positive samples. Two out of 5 laboratories provided 100% accurate results, 1 had an accuracy of 90%, and 2 reported 80% and 75% accuracy, respectively. The accuracies of the last 2 laboratories were negatively affected by test sensitivities of 60% and 50%, respectively. These findings show that although accurate results were reported by most laboratories, both false-positive and false-negative results were reported by at least 3 laboratories, and false-negative results reported for dilute APV-positive samples predominated. These study findings illustrate a need for veterinary diagnostic laboratories to institute improved voluntary quality control measures.

  8. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    NASA Astrophysics Data System (ADS)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  9. Design, construction, and validation of a modular library of sequence diversity standards for polymerase chain reaction.

    PubMed

    Baum, Paul D; Young, Jennifer J; Zhang, Qianjun; Kasakow, Zeljka; McCune, Joseph M

    2011-04-01

    Methods to measure the sequence diversity of polymerase chain reaction (PCR)-amplified DNA lack standards for use as assay calibrators and controls. Here we present a general and economical method for developing customizable DNA standards of known sequence diversity. Standards ranging from 1 to 25,000 sequences were generated by directional ligation of oligonucleotide "words" of standard length and GC content and then amplified by PCR. The sequence accuracy and diversity of the library were validated using AmpliCot analysis (DNA hybridization kinetics) and Illumina sequencing. The library has the following features: (i) pools containing tens of thousands of sequences can be generated from the ligation of relatively few commercially synthesized short oligonucleotides; (ii) each sequence differs from all others in the library at a minimum of three nucleotide positions, permitting discrimination between different sequences by either sequencing or hybridization; (iii) all sequences have identical length, GC content, and melting temperature; (iv) the identity of each standard can be verified by restriction digestion; and (v) once made, the ends of the library may be cleaved and replaced with sequences to match any PCR primer pair. These standards should greatly improve the accuracy and reproducibility of sequence diversity measurements.

  10. Use of Polymerase Chain Reaction for Bivalve Pathogen Surveillance in the Yellow Clam Mesodesma mactroides.

    PubMed

    Carvalho, Yuri Bovi Morais; da Silva Santos, Juan Jethro; Raibenberg, Fernando C; Poersch, Luis Henrique; Romano, Luis Alberto

    2016-06-01

    The yellow clam Mesodesma mactroides is a valuable shellfish occurring from the southeastern coast of Brazil to the northern coast of Argentina. Populations of yellow clams are disappearing from their entire range, and the cause is still unknown. The objective of this paper was to search for World Organisation for Animal Health (OIE)-listed pathogens and their relatives in the genera Marteilia, Bonamia, and Perkinsus as well as Mikrocytos mackini and the virus OsHV-1 μ var the yellow clam population in southern Brazil using molecular techniques and classic histology protocols. A total of 180 clams were manually collected in the intertidal region at six sampling points covering the entire coast of Rio Grande do Sul State (length, 622 km) in 2013. Tissue samples were tested by OIE-recommended single-step conventional polymerase chain reaction assays. The screening showed no evidence of the specific sequences of the protistan parasites and viral pathogens at any site within the six zones under study. We recommend continuous monitoring of the mollusks in the region. Received July 3, 2015; accepted February 3, 2016. PMID:27221761

  11. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    NASA Astrophysics Data System (ADS)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  12. Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.

    PubMed Central

    Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D

    1997-01-01

    To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131

  13. Detection of Salmonella typhi in the blood of patients with typhoid fever by polymerase chain reaction.

    PubMed Central

    Song, J H; Cho, H; Park, M Y; Na, D S; Moon, H B; Pai, C H

    1993-01-01

    A polymerase chain reaction (PCR)-based test was developed for the detection of Salmonella typhi in the blood specimens from patients with typhoid fever. Two pairs of oligonucleotide primers were designed to amplify a 343-bp fragment of the flagellin gene of S. typhi. Amplified products were analyzed by agarose gel electrophoresis and Southern blot hybridization by using a 32P-labeled 40-base probe internal to the amplified DNA. The nested PCR with two pairs of primers could detect 10 organisms of S. typhi as determined by serial dilutions of DNA from S. typhi. The peripheral mononuclear cells from 11 of 12 patients with typhoid fever confirmed by blood culture were positive for DNA fragment of the flagellin gene of S. typhi, whereas 10 blood specimens of patients with other febrile diseases were negative. With the nested PCR, S. typhi DNAs were detected from blood specimens of four patients with suspected typhoid fever on the basis of clinical features but with negative cultures. We suggest that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases. Images PMID:8314983

  14. Detection of Trypanosoma congolense and Trypanosoma brucei subspecies by DNA amplification using the polymerase chain reaction.

    PubMed

    Moser, D R; Cook, G A; Ochs, D E; Bailey, C P; McKane, M R; Donelson, J E

    1989-08-01

    The nuclear DNA of Trypanosoma congolense contains a family of highly conserved 369 base pair (bp) repeats. The sequences of three cloned copies of these repeats were determined. An unrelated family of 177 bp repeats has previously been shown to occur in the nuclear DNA of Trypanosoma brucei brucei (Sloof et al. 1983a). Oligonucleotides were synthesized which prime the specific amplification of each of these repetitive DNAs by the polymerase chain reaction (PCR). Amplification of 10% of the DNA in a single parasite of T. congolense or T. brucei spp. produced sufficient amplified product to be visible as a band in an agarose gel stained with ethidium bromide. This level of detection, which does not depend on the use of radioactivity, is about 100 times more sensitive than previous detection methods based on radioactive DNA probes. The oligonucleotides did not prime the amplification of DNA sequences in other trypanosome species nor in Leishmania, mouse or human DNAs. Amplification of DNA from the blood of animals infected with T. congolense and/or T. brucei spp. permitted the identification of parasite levels far below that detectable by microscopic inspection. Since PCR amplification can be conducted on a large number of samples simultaneously, it is ideally suited for large-scale studies on the prevalence of African trypanosomes in both mammalian blood and insect vectors.

  15. Quantitative detection of Clostridium difficile in hospital environmental samples by real-time polymerase chain reaction.

    PubMed

    Mutters, R; Nonnenmacher, C; Susin, C; Albrecht, U; Kropatsch, R; Schumacher, S

    2009-01-01

    C. difficile-associated diarrhoea occurs commonly in hospitals and is a significant cause of morbidity and mortality. Hospital surfaces are often contaminated with nosocomial pathogens and may be responsible for cross-transmission, especially if hardy Gram-positive and spore-forming organisms are involved. The aim of this study was to quantify C. difficile in the hospital environment near C. difficile-positive and -negative patients using a quantitative real-time polymerase chain reaction. A total of 531 samples was collected from the clinical environment and classified into three groups according to patient and ward status for C. difficile. As expected, there were significantly higher counts of C. difficile on the floor and in the near environment of C. difficile patients. However, a significant correlation was found between C. difficile counts on the floor and on the hands of patients and healthcare workers (HCWs) in wards without evidence of C. difficile. This suggests that asymptomatic carriage among patients and HCWs can also contribute towards C. difficile transmission in hospitals. In conclusion, C. difficile can be transmitted via personal contact or via contaminated areas of the hospital environment.

  16. A simple RNA probe system for analysis of Listeria monocytogenes polymerase chain reaction products.

    PubMed Central

    Blais, B W; Phillippe, L M

    1993-01-01

    The synthesis of an RNA probe specific for the hlyA gene of Listeria monocytogenes by in vitro transcription from a polymerase chain reaction (PCR)-generated template incorporating bacteriophage T7 promoter sequences is described. This simple method produced a high yield of RNA which hybridized specifically with hlyA PCR products on a membrane, resulting in RNA-DNA hybrids which were detected by an immunoenzymatic assay with an anti-RNA-DNA hybrid antibody. The RNA probe hybridization system was more sensitive in the analysis of the PCR products than was the conventional agarose gel electrophoresis method. When applied to the analysis of PCR samples from cultures of various Listeria and non-Listeria organisms, the RNA probe was reactive in the assay of 62 different L. monocytogenes isolates but not other Listeria species. Among the non-Listeria organisms tested, only Enterococcus faecalis gave a weak positive reaction with more than 10(9) cells per ml. This reactivity disappeared at lower cell densities. This strategy for the synthesis and application of RNA probes should facilitate the analysis of PCR products in the detection of L. monocytogenes and possibly other food pathogens. Images PMID:8215354

  17. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hygridization and polymerase chain reaction

    SciTech Connect

    Palmer, L.M.; Colwell, R.R. )

    1991-05-01

    Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates. We have demonstrated that not only do some strains of V. cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V. cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe. Comparisons of the amino acid sequences of luciferase regions of amino acid identity. The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V. cholerae strains. The nucleotide sequence of this region was determined and reveals that nonluminescent V. cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V. cholerae by albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

  18. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    PubMed

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  19. Nested polymerase chain reaction assay for detection of Mycobacterium shottsii and M. pseudoshottsii in striped bass.

    PubMed

    Gauthier, D T; Vogelbein, W K; Rhodes, M W; Reece, K S

    2008-12-01

    Wild striped bass Morone saxatilis in Chesapeake Bay are experiencing a high prevalence of mycobacteriosis, which produces granulomatous lesions of the skin and visceral organs. Culture-based studies have indicated that the newly described species Mycobacterium shottsii and M. pseudoshottsii are the dominant isolates from diseased fish. The classical fish pathogen M. marinum is also found, albeit at much lower frequencies. Both M. shottsii and M. pseudoshottsii are extremely slow-growing on standard selective media, and up to 12 months may be required for isolation and characterization. Epidemiological studies of mycobacteriosis in Chesapeake Bay would therefore benefit from rapid molecular assays with which to detect these species in fish. In this paper, we describe the development of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays capable of detecting M. shottsii, M. pseudoshottsii, and, in most instances, coinfections thereof in striped bass tissues. In addition, PCR-RFLP assays were designed to detect M. marinum and other as-yet-undescribed Mycobacterium spp. present in Chesapeake Bay striped bass. Comparison of these molecular assays with culture-based techniques using splenic tissue from wild striped bass yielded generally concordant results and demonstrated the applicability of these techniques to the study of wild fish.

  20. Use of polymerase chain reaction to detect Brucella abortus biovar 1 in infected goats.

    PubMed

    Leal-Klevezas, D S; Martínez-Vázquez, I O; García-Cantú, J; López-Merino, A; Martínez-Soriano, J P

    2000-07-01

    The polymerase chain reaction (PCR) was used to diagnose goat brucellosis and compare its sensitivity against some of the most commonly used serological and bacteriological techniques. Twenty two female and one male out of 300 clinically healthy, mixed-breed goats were randomly chosen from a ranch located at Marín, Nuevo León, Mexico. Milk and blood samples were taken from each animal and used to obtain both microbiological cultures and DNA of the pathogen, and sera was tested against Rose Bengal antigen (RBT). Results showed that 86% of the blood samples were positive on the PCR test, while 60% were positive on the serological test. The pathogen was isolated from only one blood culture. Sixty four percent of the milk samples were positive on PCR tests, but failed to yield bacteria in culture. Biochemical and PCR specific assay demonstrated that Brucella abortus biovar 1 was associated with the infection. This study demonstrates the higher sensitivity of PCR over RBT and blood culture and its potential towards a rapid identification of Brucella strains.

  1. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    PubMed

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  2. Detection of Coxiella burnetti by DNA amplification using polymerase chain reaction.

    PubMed Central

    Stein, A; Raoult, D

    1992-01-01

    The polymerase chain reaction (PCR) was used for the detection of Coxiella burnetti, an obligate intracellular bacterium and the etiologic agent of Q fever. A pair of primers derived from the C. burnetii superoxide dismutase gene served to amplify a targeted 257-bp fragment of genomic DNA. These primers were chosen on the basis of GenBank analysis, G + C ratio, and absence of secondary structure. This technique allowed the detection of as few as 10 C. burnetii organisms. C. burnetti was detected in tissue culture and in specimens from patients (heart valves). In all, 8 reference isolates and 22 new isolates of C. burnetii from France were successfully amplified. No amplification products were found when PCR was performed with 25 bacterial species that had been isolated in a clinical laboratory from patients with clinically similar infections. Amplification products of C. burnetii were confirmed by restriction enzyme digestion and dot blot hybridization. The method used here, a combination of PCR and restriction analysis, is a faster and more sensitive assay for C. burnetii than standard culture techniques. Images PMID:1401016

  3. Polymerase chain reaction-based screening for the ceftriaxone-resistant Neisseria gonorrhoeae F89 strain.

    PubMed

    Goire, N; Lahra, M M; Ohnishi, M; Hogan, T; Liminios, A E; Nissen, M D; Sloots, T P; Whiley, D M

    2013-04-04

    Emergence and spread of Neisseria gonorrhoeae resistant to extended spectrum cephalosporins is a major problem threatening treatment of gonorrhoea and is further highlighted by the recent report of a second ceftriaxone-resistant N. gonorrhoeae strain (F89) in Europe, initially observed in France and subsequently identified in Spain. N. gonorrhoeae antimicrobial resistance (AMR) surveillance has acquired new importance and molecular tools have the potential to enhance bacterial culture-based methods. In this study, we established a polymerase chain reaction (PCR) protocol for direct detection of the F89 strain. A key component of this screening protocol was the development of a hybridisation probe-based melting curve analysis assay (mosaic501-hybPCR) to detect the presence of an A501P substitution on the N. gonorrhoeae mosaic penicillin binding protein 2 (PBP2) sequence, an important characteristic of the F89 strain. The mosaic501-hybPCR was evaluated using plasmid-derived positive controls (n=3) and characterised gonococcal (n=33) and non-gonococcal (n=58) isolates. The protocol was then applied to 159 clinical specimens from Sydney, Australia, collected during the first half of the year 2012 that were N. gonorrhoeae PCR-positive. Overall, the results indicate that the PCR-based protocol is suitable for direct detection of the N. gonorrhoeae F89 strain in non-cultured clinical samples. It therefore provides an additional tool to aid investigations into the potential spread of F89 strain throughout Europe and elsewhere.

  4. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant

    2004-09-01

    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  5. Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by polymerase chain reaction.

    PubMed

    Lu, Y; Wang, Y; Yu, Q; Aguirre, A A; Balazs, G H; Nerurkar, V R; Yanagihara, R

    2000-01-01

    An alpha-herpesvirus has been associated recently with green turtle fibropapilloma (FP). To further clarify the role of this newfound green turtle herpesvirus (GTHV) in the pathogenesis of FP, various normal-appearing tissues and organs (including skin, eye, brain, heart, liver, spleen, intestine, lung, kidney, nerve, gonad, tongue, gall bladder, urinary bladder, thyroid and peripheral blood mononuclear cells (PBMC) from blood) and tumor tissues from 19 green turtles (Chelonia mydas) with FP, and tissues from three green turtles without FP, collected during 1997 to 1999 in the Hawaiian Islands, were tested for GTHV sequences by nested polymerase chain reaction (PCR), using GTHV-specific oligonuclotide primers. GTHV sequences were detected in all tumors (51/51) and most tissues (133/167) of tumored turtles. By contrast, such sequences were undetectable in tissues (0/28) of three non-tumored turtles. Analysis of GTHV sequences detected in different tissues and tumors revealed a low degree of genetic diversity (<1%). The wide distribution of this newfound herpesvirus in tumors and tissues of tumored green turtles and its absence in tissues of non-tumored turtles, argues for an etiologic role in FP.

  6. Detection of Salmonella sp. in Dermanyssus gallinae using an FTA filter-based polymerase chain reaction.

    PubMed

    Moro, C Valiente; Desloire, S; Chauve, C; Zenner, L

    2007-06-01

    Salmonella spp. bacteria are responsible for some of the most important zoonoses worldwide. Because Dermanyssus gallinae (DeGeer) (Acari: Dermanyssidae) has been recently reported to be an experimental vector of Salmonella Enteritidis, it would be of benefit to evaluate the presence of this bacterium in mites. A molecular detection tool associating a simple filter-based DNA preparation with a specific 16S rDNA Salmonella sp. polymerase chain reaction (PCR) amplification was described. The limit of detection with this method was 2 x 10(4) bacteria per mite. To adapt this technique for large-scale studies, two sizes of mite pools were tested and a preliminary investigation was carried out on mites from 16 currently or previously contaminated farms. Mites sampled from one farm of each type were positive for Salmonella, suggesting that Dermanyssus could act as a reservoir between flocks. In further investigations, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

  7. Effect of reference database on frequency estimates of polymerase chain reaction (PCR)-based DNA profiles.

    PubMed

    Monson, K L; Budowle, B

    1998-05-01

    A variety of general, regional, ancestral and ethnic databases is available for the polymerase chain reaction (PCR)-based loci LDLR, GYPA, HBGG, D7S8, Gc, DQA1, and D1S80. Generally, we observed greater differences in frequency estimations of DNA profiles between racial groups than between ethnic or geographic subgroups. Analysis revealed few forensically significant differences within ethnic subgroups, particularly within general United States groups, and multi-locus frequency estimates typically differ by less than a factor of ten. Using a database different from the one to which a target profile belongs tends to overestimate rarity. Implementation of the general correction of homozygote frequencies for a population substructure, advised by the 1996 National Research Council report, The Evaluation of Forensic DNA Evidence, has a minimal effect on profile frequencies. Even when it is known that both the suspect and all possible perpetrators must belong to the same isolated population, the special correction for inbreeding, which was proposed by the 1996 National Research Council report for this special case, has a relatively modest effect, typically a factor of two or less for 1% inbreeding. The effect becomes more substantial (exceeding a factor of ten) for inbreeding of 3% or more in multi-locus profiles rarer than about one in a million. PMID:9608687

  8. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    NASA Astrophysics Data System (ADS)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  9. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    PubMed Central

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  10. Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.

    PubMed

    Hamlet, Stephen M

    2010-01-01

    The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.

  11. Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

    PubMed

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1) CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

  12. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  13. Gene Profiling Studies in Skeletal Muscle by Quantitative Real-Time Polymerase Chain Reaction Assay

    PubMed Central

    Bhatnagar, Shephali; Panguluri, Siva K.; Kumar, Ashok

    2012-01-01

    Summary Gene profiling is an excellent tool to identify the genetic mechanisms, networks, and molecular pathways involved in skeletal muscle development and muscular disorders. Oligonucleotide or cDNA microarray can be the first step to identify the global gene expression in the study of interest. As microarray techniques provide a large set of differentially expressed genes in a given comparison, the expression profile can be narrowed down by taking various parameters into consideration such as fold values, p-values, and their relevance to the study. Every technique has its own limitations. Therefore, further validation of the results with a different technique is always necessary. Quantitative real-time reverse-transcriptase polymerase chain reaction (qRT-PCR) is the most common technique to validate microarray data and to study the relative expression of specific genes in any experimental set-up. Here, we describe, the qRT-PCR technique, in detail, for -successful gene expression studies in skeletal muscle cells and tissues. PMID:22130845

  14. A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control

    PubMed Central

    Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen

    2009-01-01

    This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760

  15. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader

    NASA Astrophysics Data System (ADS)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng

    2007-11-01

    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  16. Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction

    PubMed Central

    Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404

  17. Ultra-rapid flow-through polymerase chain reaction microfluidics using vapor pressure.

    PubMed

    Fuchiwaki, Yusuke; Nagai, Hidenori; Saito, Masato; Tamiya, Eiichi

    2011-09-15

    A novel flow-through polymerase chain reaction (PCR) microfluidic system using vapor pressure was developed that can achieve ultra-rapid, small-volume DNA amplification on a chip. The 40-cycle amplification can be completed in as little as 120 s, making this device the fastest PCR system in the world. The chip device is made of a pressure-sensitive polyolefin (PSP) film and cyclo-olefin polymer (COP) substrate which was processed by cutting-work to fabricate the microchannel. The enclosed structure of the microchannel was fabricated solely by weighing the PSP film on the COP substrate, resulting in superior practical application. The vapor pressure in the denaturation zone of the destabilizing flow source was applied to the flow force, and ultra-rapid, efficient amplification was accomplished with a minimal amount of PCR reagents for detection. The flowing rhythm created by vapor pressure minimized the residual PCR products, leading to highly efficient amplification. For field test analysis, airborne dust was collected from a public place and tested for the presence of anthrax. The PCR chip had sufficient sensitivity for anthrax identification. The fastest time from aerosol sampling to detection was theoretically estimated as 8 min.

  18. Confirmation of presumptive Salmonella colonies contaminated with Proteus swarming using the polymerase chain reaction (PCR) method.

    PubMed

    Gutiérrez Rojo, Rosalba; Torres Chavolla, Edith

    2007-01-01

    In Mexico, zero tolerance regulation is practiced regarding Salmonella in food products. the presence of which is verified by the procedure described in NOM 114-SSA-1994. During the period between August 2002 and March 2003, 245 food samples were tested using this procedure in the Central Laboratories of the Department of Health for the State of Jalisco (CEESLAB). Of these 245 samples, 35 showed presumptive colonies contaminated with Proteus swarm cells even after selective isolation. These swarm cells make Salmonella recovery and biochemical identification difficult due to the occurance of atypical biochemical profiles which generally correspond to that of Proteus. Out of the 35 samples contaminated with Proteus, 65 presumptive colonies were isolated. These colonies were analyzed using both normative microbiological method and Polymerase Chain Reaction (PCR). The PCR method detected two positive samples while normative microbiological method was not able to identify. In order to determine the extent of interference of Proteus swarming on the Salmonella-specific PCR band amplification, Salmonella ser. Typhimurium was grown in the presence of Proteus swarming. These results show that Proteus swarming did not interfere with Salmonella PCR-amplification, although the appearance of Sanlmonella was altered such that the black precipitate was no observed in the presence of Proteus swarming. Ours result indicate that the PCR method used in this study may be successfully applied to confirm presumptive Salmnonella colonies contaminated with Proteus swarming.

  19. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    PubMed

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  20. A quantitative real-time polymerase chain reaction assay for the seagrass pathogen Labyrinthula zosterae.

    PubMed

    Bergmann, Nina; Fricke, Birgit; Schmidt, Martina C; Tams, Verena; Beining, Katrin; Schwitte, Hildegard; Boettcher, Anne A; Martin, Daniel L; Bockelmann, Anna-Christina; Reusch, Thorsten B H; Rauch, Gisep

    2011-11-01

    The protist Labyrinthula zosterae (Phylum Bigyra, sensu Tsui et al. 2009) has been identified as a causative agent of wasting disease in eelgrass (Zostera marina), of which the most intense outbreak led to the destruction of 90% of eelgrass beds in eastern North America and western Europe in the 1930s. Outbreaks still occur today, albeit at a smaller scale. Traditionally, L. zosterae has been quantified by measuring the necrotic area of Z. marina leaf tissue. This indirect method can however only lead to a very rough estimate of pathogen load. Here, we present a quantitative real-time polymerase chain reaction (qPCR) approach to directly detect and quantify L. zosterae in eelgrass tissue. Based on the internal transcribed spacer (ITS) sequences of rRNA genes, species-specific primers were designed. Using our qPCR, we were able to quantify accurately and specifically L. zosterae load both from culture and eelgrass leaves using material from Europe and North America. Our detection limit was less than one L. zosterae cell. Our results demonstrate the potential of this qPCR assay to provide rapid, accurate and sensitive molecular identification and quantification of L. zosterae. In view of declining seagrass populations worldwide, this method will provide a valuable tool for seagrass ecologists and conservation projects.

  1. Sample preparation and DNA extraction procedures for polymerase chain reaction identification of Listeria monocytogenes in seafoods.

    PubMed

    Agersborg, A; Dahl, R; Martinez, I

    1997-04-15

    Five grams of seafood products were inoculated with one to 500 viable or 10(9) heat-killed cells of Listeria monocytogenes. The presence of the pathogen was detected by the polymerase chain reaction (PCR) with primers specific for fragments of the listeriolysin O (hly) gene (two sets) and for the invasion-associated protein (iap) gene (one set). For DNA preparation, boiling, either alone or in combination with lysozyme and proteinase K treatment, was not always sufficient to lyse L. monocytogenes, while treatment with Triton X-100 produced consistently good DNA suitable for amplification. To avoid false-negative and false-positive results, 48 h incubations were necessary and a subculturing step after an initial 24 h incubation greatly improved the results. The primers that amplified regions of the listeriolysin O gene gave clearer and stronger products than primers for the invasion-associated protein gene. Using this method we were able to detect one to five L. monocytogenes cells in 5 g of product in a total of 55 h.

  2. Use of neuropathological tissue for molecular genetic studies: parameters affecting DNA extraction and polymerase chain reaction.

    PubMed

    Kösel, S; Graeber, M B

    1994-01-01

    Nuclear and mitochondrial DNA were extracted from gray matter of human cerebral cortex which had either been formalin-fixed and embedded into paraffin or stored in formalin for up to 26 years. Extraction conditions were optimized for proteinase K digestion, i.e., enzyme concentration, digestion temperature and incubation time. Using the polymerase chain reaction (PCR), DNA was successfully amplified from archival material and sequenced employing a direct nonradioactive cycle sequencing protocol. In general, tissue embedded into paraffin following brief fixation in formalin gave good quantitative results, i.e., up to 1 microgram DNA/mg tissue were extracted. This yield was at least one order of magnitude higher than that obtained with tissue stored in formalin. However, paraffin-embedded neuropathological material was found to contain an as-yet-unidentified PCR inhibitor, and a deleterious effect of long-term fixation in unbuffered low-grade formalin was clearly detectable. Importantly, both paraffin-embedded tissue blocks and human brain that had been stored in formalin for many years yielded DNA sufficient for qualitative analysis. The implications of these findings for the use of neuropathological material in molecular genetic studies are discussed.

  3. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

    PubMed

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-20

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  4. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  5. Polymerase chain reaction as a tool for developing stress protein probes

    SciTech Connect

    Cochrane, B.J.; Mattley, Y.D. . Dept. of Biology); Snell, T.W. . Div. of Biology)

    1994-08-01

    Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

  6. Analysis of adult otitis media: polymerase chain reaction versus culture for bacteria and viruses.

    PubMed

    Liederman, E M; Post, J C; Aul, J J; Sirko, D A; White, G J; Buchman, C A; Ehrlich, G D

    1998-01-01

    Recent studies using the polymerase chain reaction (PCR) have identified bacterial and viral genomic sequences in culture-negative pediatric middle ear effusions. To evaluate this technique in adults, 19 effusions were analyzed to compare bacterial and viral culture and PCR detection of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and adenovirus. Effusions from 4 subjects positive for human immunodeficiency virus (HIV) were analyzed by PCR for HIV virus. Three of 19 effusions were culture-positive for bacteria, and 0 of 19 for viruses. Fifteen of 19 effusions were PCR-positive for bacterial genomic sequences, and 0 of 19 for adenovirus. Thirteen of 15 PCR-positive specimens demonstrated S pneumoniae, 5 of 15 H influenzae, and 0 of 13 M catarrhalis. All 4 effusions from HIV-positive subjects were PCR-positive for HIV. No effusion was culture-positive and PCR-negative. These results confirm that culture-negative middle ear effusions contain genomic sequences from bacterial pathogens. Finding of HIV RNA and DNA in effusion from HIV-positives suggests replicating virus in this fluid.

  7. Gene-expression analysis of single cells-nested polymerase chain reaction after laser microdissection

    PubMed Central

    Shi, Xin; Kleeff, JÖrg; Zhu, Zhao-Wen; Schmied, Bruno; Tang, Wen-Hao; Zimmermann, Arthur; BÜchler, Markus W.; Friess, Helmut

    2003-01-01

    AIM: The structural and functional characteristics of cells are dependent on the specific gene expression profile. The ability to study and compare gene expression at the cellular level will therefore provide valuable insights into cell physiology and pathophysiology. METHODS: Individual cells were isolated from frozen colon tissue sections using laser microdissection. DNA as well as RNA were extracted, and total RNA was reversely transcribed to complementary DNA (cDNA). Both DNA and cDNA were analyzed by nested polymerase chain reaction (PCR). The quality of isolated DNA and RNA was satisfactory. RESULTS: Single cells were successfully microdissected using an ultraviolet laser micromanipulator. Nested PCR amplification products of DNA and cDNA of single cells could clearly be visualized by agarose gel electrophoresis. CONCLUSION: The combined use of laser microdissection and nested-PCR provides an opportunity to analyze gene expression in single cells. This method allows the analysis and identification of specific genes which are involved in physiological and pathophysiological processes in a complex of variable cell phenotypes. PMID:12800252

  8. Novel multi-targeted polymerase chain reaction for diagnosis of presumed tubercular uveitis

    PubMed Central

    2013-01-01

    Background The objective of this study was to report the use of multi-targeted polymerase chain reaction (PCR) in the diagnosis of presumed tubercular uveitis. Multi-targeted PCR using three targets specific for Mycobacterium tuberculosis, i.e., IS6110, MPB64, and protein b, was performed on intraocular fluid samples of 25 subjects. Nine had presumed tubercular uveitis, six had intraocular inflammation secondary to a nontubercular etiology (disease controls), and ten had no evidence of intraocular inflammation (normal controls). As described previously, response to antitubercular therapy was considered as the gold standard. Results Multi-targeted PCR was positive in seven out of nine patients with presumed tubercular uveitis and negative in all normal and disease controls. The sensitivity and specificity were 77.77% and 100%, respectively. For the diagnosis of presumed tubercular uveitis, multi-targeted PCR had a positive predictive value of 100% and a negative predictive value of 88.88%. Conclusion Multi-targeted PCR can be a valuable tool for diagnosing presumed tubercular uveitis. PMID:23514226

  9. Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction.

    PubMed

    Wilson, K H; Blitchington, R B; Greene, R C

    1990-09-01

    The sequence of small-subunit rRNA varies in an orderly manner across phylogenetic lines and contains segments that are conserved at the species, genus, or kingdom level. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, we amplified bacterial 16S ribosomal DNA sequences with the polymerase chain reaction. Priming sites were located at the extreme 5' end, the extreme 3' end, and the center of 16S ribosomal DNA. The isolates tested with these primers included members of the genera Staphylococcus, Coxiella, Rickettsia, Clostridium, Neisseria, Mycobacterium, Bilophila, Eubacterium, Fusobacterium, and Lactobacillus and the family Enterobacteriaceae. Initially, the yields from the reactions were erratic because the primers were self-complementary at the 3' ends. Revised primers that were not self-complementary gave more reproducible results. With the latter primers, 0.4 pg of Escherichia coli DNA consistently gave a visible band after amplification. This method should be useful for increasing the amounts of bacterial 16S ribosomal DNA sequences for the purposes of sequencing and probing. It should have a broad range of applications, including the detection and identification of known pathogens that are difficult to culture. This approach may make it possible to identify new, nonculturable bacterial pathogens.

  10. Ultra-rapid flow-through polymerase chain reaction microfluidics using vapor pressure.

    PubMed

    Fuchiwaki, Yusuke; Nagai, Hidenori; Saito, Masato; Tamiya, Eiichi

    2011-09-15

    A novel flow-through polymerase chain reaction (PCR) microfluidic system using vapor pressure was developed that can achieve ultra-rapid, small-volume DNA amplification on a chip. The 40-cycle amplification can be completed in as little as 120 s, making this device the fastest PCR system in the world. The chip device is made of a pressure-sensitive polyolefin (PSP) film and cyclo-olefin polymer (COP) substrate which was processed by cutting-work to fabricate the microchannel. The enclosed structure of the microchannel was fabricated solely by weighing the PSP film on the COP substrate, resulting in superior practical application. The vapor pressure in the denaturation zone of the destabilizing flow source was applied to the flow force, and ultra-rapid, efficient amplification was accomplished with a minimal amount of PCR reagents for detection. The flowing rhythm created by vapor pressure minimized the residual PCR products, leading to highly efficient amplification. For field test analysis, airborne dust was collected from a public place and tested for the presence of anthrax. The PCR chip had sufficient sensitivity for anthrax identification. The fastest time from aerosol sampling to detection was theoretically estimated as 8 min. PMID:21778045

  11. Combination of immunosensor detection with viability testing and confirmation using the polymerase chain reaction and culture.

    PubMed

    Johnson-White, Brandy; Lin, Baochuan; Ligler, Frances S

    2007-01-01

    Rapid and accurate differential determination of viable versus nonviable microbes is critical for formulation of an appropriate response after pathogen detection. Sensors for rapid bacterial identification can be used for applications ranging from environmental monitoring and homeland defense to food process monitoring, but few provide viability information. This study combines the rapid screening capability of the array biosensor using an immunoassay format with methods for determination of viability. Additionally, cells captured by the immobilized antibodies can be cultured following fluorescence imaging to further confirm viability and for cell population expansion for further characterization, e.g., strain identification or antibiotic susceptibility testing. Finally, we demonstrate analysis of captured bacteria using the polymerase chain reaction (PCR). PCR results for waveguide-captured cells were 3 orders of magnitude more sensitive than the fluorescence immunoassay and can also provide additional genetic information on the captured microbes. These approaches can be used to rapidly detect and distinguish viable versus nonviable and pathogenic versus nonpathogenic captured organisms, provide culture materials for further analysis on a shorter time scale, and assess the efficacy of decontamination or sterilization procedures. PMID:17194131

  12. On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)

    NASA Astrophysics Data System (ADS)

    Persat, Alexandre; Santiago, Juan

    2008-11-01

    We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.

  13. Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

    PubMed Central

    Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro

    2015-01-01

    The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238

  14. Detection of enteroviruses in shellfish by fluorogenic polymerase chain reaction integrated with 96-well microplate scanning.

    PubMed

    Shieh, Y Carol; Baric, Ralph S

    2002-01-01

    A one-step procedure was developed to confirm viral targets by using a fluorometric 96-well microplate scanner following polymerase chain reaction (PCR). The fluorogenic PCR, integrated with fluorometric scanning, measured the end point fluorescence of viral PCR amplicon/probe hybrids and permitted the use of nonfluorogenic PCR conditions with addition of a Cy3 fluorophore-labeled linear probe for viruses. This linear probe generated higher ratios of viral signal-to-noise than a comparative beacon probe. Detection efficiency with a Cy3/quencher linear probe was comparable with Southern analysis at the level > or = 0.27 plaque-forming units (PFU) of poliovirus/PCR. For the reaction containing < 0.27 PFU, the fluorometric measurements of the first-round PCR viral amplicon were not as sensitive as Southern analysis; however, equivalent sensitivities were achieved with fluorogenic nested PCR. Concentrates of 11 oyster samples exposed to municipal sewage were tested for enteroviruses; the fluorogenic detection correlated 100% with Southern analysis. This method using fluorometric scanning of viral amplicon is simple; it requires neither continuously monitoring equipment nor redesigning PCR primers; and it accurately detects enteroviruses in oyster sample concentrates in less time than classic spectrophotometry or Southern analysis.

  15. Molecular beacon polymerase chain reaction detection of Escherichia coli O157:H7 in milk.

    PubMed

    McKillip, J L; Drake, M

    2000-07-01

    A fluorescently labeled oligonucleotide probe (molecular beacon) was applied to detect Escherichia coli O157:H7 in artificially contaminated skim milk during polymerase chain reaction (PCR) amplification of extracted DNA. The probe was designed to hybridize with a region of the slt-II gene coding for the A subunit and to fluoresce when the hairpin-stem conformation was linearized upon hybridization to the target sequence. The molecular beacon was incorporated into PCR reactions containing DNA extracted from artificially contaminated skim milk. The degree of fluorescence was monitored in PCR reactions containing 10(3), 10(5), and 10(7) CFU of E. coli O157:H7 per ml and was found to correlate with the amount of template in each reaction. Fluorescence significantly increased above background levels by cycle 8, 14, or 14 in reactions containing DNA from the 10(7)-, 10(5)-, or 10(3)-CFU/ml template, respectively (P < 0.05). Molecular beacon PCR demonstrated positive results more rapidly than traditional agarose gel electrophoresis analysis of PCR products. Use of molecular beacons allows real-time monitoring of PCR reactions, and the closed-tube format allows simultaneous detection and confirmation of target amplicons without the need for agarose gel electrophoresis and/or Southern blotting. This is the first report of a stem-and-loop molecular beacon being applied for direct detection of a pathogen in food.

  16. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    PubMed Central

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130

  17. [Detection of enteric pathogenic bacteria from surface waters by quantitative polymerase chain reaction (QPCR)].

    PubMed

    Liu, Yong-Jun; Zhang, Chong-Miao; Wang, Xiao-Chang; Lü, Ying-Jun; Zuo, Li-Li

    2008-05-01

    A rapid quantitative polymerase chain reaction (QPCR) analysis method with universal primers was developed to detect cell densities of the enteric pathogenic bacteria from 5 surface water of Xi'an City for 4 months continuously. And the detection results by QPCR method were compared with counts of coliforms colony-forming units (CFU) determined by membrane filter (MF) analysis. The results showed that QPCR method had an estimated 94% confidence, and detection limit was 2.7 Escherichia coli cells per sample in undiluted DNA extracts. For five surface waters (N = 60), the geometric mean of pathogenic bacteria concentration determined by QPCR was 2.2-5 times of corresponding coliform CFU determined by MF analysis. Using QPCR analysis, these geometric means of pathogenic bacteria concentration ranged from 25 CCE/100 mL to 67 000 CCE/100 mL. Using MF culture analysis, coliforms ranged from 3 CFU/100 mL to 45 000 CFU/100 mL. Regression analysis showed that there was a significant positive correlation between pathogenic bacteria determined by QPCR method and coliforms determined by MF method, the correlation coefficient (r) was 0.983.

  18. Molecular diagnosis of dengue by reverse transcriptase-polymerase chain reaction.

    PubMed

    Vaughan, H E; George, A; Morris-Glasgow, V; Campione-Piccardo, J

    1999-09-01

    The techniques of reverse transcriptase-polymerase chain reaction (RT-PCR) and subsequent PCR were employed in the analysis of serum samples from a range of patients from the Caribbean Epidemiology Centre (CAREC) member countries. Results were compared with those from viral isolation and immunofluorescence. In the second part of the study, ten serum samples were stored for one week under four sets of conditions: -20 degrees C, 4 degrees C, 25 degrees C, and thawed (20 degrees C) and frozen (-20 degrees C) daily. After one week of each treatment the samples were analysed by RT-PCR and PCR. 90.4% of results from PCR agreed with results from viral isolation (VI) and fluorescent antibody (FA) detection. All PCR positive samples originated from sera collected within five days of the date of onset of fever. Frozen, refrigerated and repeat freeze-thawed samples gave consistent positive results by RT-PCR. After storage at 25 degrees C, however, half the dengue-positive samples were negative by RT-PCR. The results indicate the sensitivity and reliability of this rapid technique and its applicability in the Caribbean. It provides a preliminary assessment of its advantages and limitations under certain conditions of serum collection and storage.

  19. [Polymerase chain reaction for rapid detection and serotyping of dengue virus in clinical samples].

    PubMed

    Rosario, D; Alvarez, M; Díaz, J; Contreras, R; Rodríguez, R; Vázquez, S; Guzmán, M G

    1998-07-01

    This study describes the benefits of using reverse transcriptase polymerase chain reaction (RT-PCR) for the rapid detection and typing of dengue virus in clinical samples. Twenty-seven serum specimens from patients with dengue fever and dengue hemorrhagic fever in Colombia, Nicaragua, and Panama were directly subjected to RT-PCR for the detection of dengue virus. The resulting double-stranded DNA product was typed by a second round of PCR amplification (nested PCR) with type-specific primers, viral culture/indirect immunofluorescence (IIF), and enzyme-linked electroimmunoassay for IgM anti-dengue antibodies. The amplified virus genome was detected and typed within 8 hours. Nested RT-PCR, using viral culture and IIF as the gold standard, showed 100% sensitivity; 78% specificity; 69% positive predictive value, and 100% negative predictive value. It is noteworthy that two of the specimens whose results were positive with nested RT-PCR and negative with viral culture showed specific IgM antibodies. The results of the RT-PCR were in close agreement with those obtained through viral culture. This suggests PCR can greatly facilitate the rapid and early diagnosis of dengue infection.

  20. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Souza, M T; Carvalho-Zilse, G A

    2014-01-01

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  1. Molecular probes and the polymerase chain reaction for detection and typing of Leishmania species in Mexico.

    PubMed

    Monroy-Ostria, Amalia; Sanchez-Tejeda, Gustavo

    2002-04-01

    Leishmaniasis in Mexico is a public health problem because all the clinical forms have been recorded in most Mexican states. We studied patients showing clinical symptoms of any form of leishmaniasis, from several endemic areas. Bone marrow samples, aspirates or skin biopsies were taken and deoxyribonucleic acid (DNA) was extracted and amplified by the polymerase chain reaction (PCR) with universal primers AJS1 and DeB8, specific for the Leishmania subgenus Leishmania. The PCR products were then hybridized by dot- or Southern blotting and probed with probe 9.2, specific for the L. mexicana complex. If hybridization did not occur, the DNA was amplified with primers D1 and D2, specific for members of the L. donovani complex, and PCR products were hybridized with probe B4Rsa, also specific for the L. donovani complex. DNA was also amplified with primers B1 and B2, specific for the subgenus Viannia, and the PCR products were hybridized with probe B18, specific for the L. braziliensis complex. It was found that in Tabasco and Veracruz, Mexico, localized cutaneous leishmaniasis (LCL) is caused by infection with members of the L. mexicana complex, whereas in the states of Nayarit and Campeche it was due to infection with the L. mexicana and/or L. braziliensis complexes. Visceral leishmaniasis was caused by L. (L.) chagasi, mainly in the states of Chiapas and Guerrero, and by L. (L.) mexicana in one immunocompromised patient from Tabasco.

  2. Detection of human immunodeficiency virus DNA and RNA in semen by the polymerase chain reaction.

    PubMed

    Mermin, J H; Holodniy, M; Katzenstein, D A; Merigan, T C

    1991-10-01

    Peripheral blood mononuclear cells (PBMC) and semen of 23 men infected with human immunodeficiency virus (HIV) were examined for the presence of HIV DNA and RNA using the polymerase chain reaction (PCR) and a nonisotopic detection assay. None of the men was receiving antiretroviral therapy at the time of collection. Semen samples were separated into cell-free seminal fluid, nonspermatozoal mononuclear cells (NSMC), and spermatozoa. All of the PBMC samples, 17 (74%) of 23 NSMC samples, and none of the spermatozoal samples were positive for HIV gag gene DNA. Of 23 cell-free seminal fluid samples, 15 (65%) were positive for HIV gag gene RNA by PCR. Cell-free HIV RNA was more likely to be present in the semen of men with less than 400 than in those with greater than or equal to 400 cells/mm3 (P less than .04) and was present in all patient with p24 antigen in serum. The presence of HIV DNA in NSMC samples was not related to CD4 cell count, disease status, or the presence of p24 antigen in the serum. This study shows that HIV nucleic acid can be detected by PCR in either the cell-free seminal fluid or NSMC of 87% of semen samples but not in the DNA of spermatozoa from HIV-infected men.

  3. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    PubMed Central

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  4. Salmonellae in fish feces analyzed by in situ hybridization and quantitative polymerase chain reaction.

    PubMed

    Sha, Qiong; Forstner, Michael R J; Bonner, Timothy H; Hahn, Dittmar

    2013-09-01

    The potential of fish to transfer salmonellae from heterogeneous aquatic biofilms into feces was assessed in controlled aquarium studies with Suckermouth Catfish Hypostomus plecostomus and with biofilms inoculated with salmonellae. Neither the presence of catfish nor inoculation with salmonellae had detectable effects on the abundance of the microbial community. Densities of the microbial community were about 10(5) cells/mL in the water during a 1-week period, whereas densities of the microbial community increased 10-fold (10(6) to 10(7) cells/mg) in catfish feces during the same period. Salmonellae were detected by both quantitative polymerase chain reaction (qPCR) and situ hybridization in water samples immediately after inoculation, in numbers of about 10(4) cells/mL, representing up to 20% of the cells of the microbial community. Numbers decreased by three orders of magnitude within the first 3 d of the study, which represented only 0.01% of the community, and became undetectable after day 5. In catfish feces, numbers of Salmonella initially increased to up to 6% of the cells of the community but then declined. These results suggest that Salmonella are not biomagnified during gut passage, and thus, fish only provide a means for the translocation of this pathogen.

  5. Classification of mutations at the HLA-A locus by use of the polymerase chain reaction

    SciTech Connect

    Joseph, G.; Grist, S.; Firgaira, F.; Turner, D.; Morley, A. )

    1993-01-01

    The authors investigated whether the polymerase chain reaction (PCR) could be used to determine the mechanism of mutation in lymphocyte clones mutated at the HLA-A locus. Three polymorphisms, at Factor XIIIA, D6S109, and intron 3 of the HLA-A gene, were used to study a series of clones previously characterized by Southern blotting (SB) at multiple loci on chromosome 6. For detection of loss of heterozygosity, the results of PCR and SB were concordant in 140 of 141 clones when polymorphism in the Factor XIIIA region was studied and in 144 of 145 clones when polymorphism in the HLA-A gene was studied. For classification of the mechanism of mutation, PCR and SB gave the same result in 88 of 92 clones (96%) when a combination of the HLA-A and Factor XIIIA polymorphisms was used and in 46 of 47 clones (98%) when a combination of the HLA-A and D6S109 polymorphisms was used. The results indicate that PCR provides a simple and reliable method for categorizing mutations at the HLA-A locus as arising from mitotic recombination, deletion, or from presumptive minor changes within the gene. Rare events such as gene conversion, nondisjunction, or large deletions extending to the telomere will be misclassified. However, such events are rare for mutations at this locus. 9 refs., 2 figs., 5 tabs.

  6. Confirmation of presumptive Salmonella colonies contaminated with Proteus swarming using the polymerase chain reaction (PCR) method.

    PubMed

    Gutiérrez Rojo, Rosalba; Torres Chavolla, Edith

    2007-01-01

    In Mexico, zero tolerance regulation is practiced regarding Salmonella in food products. the presence of which is verified by the procedure described in NOM 114-SSA-1994. During the period between August 2002 and March 2003, 245 food samples were tested using this procedure in the Central Laboratories of the Department of Health for the State of Jalisco (CEESLAB). Of these 245 samples, 35 showed presumptive colonies contaminated with Proteus swarm cells even after selective isolation. These swarm cells make Salmonella recovery and biochemical identification difficult due to the occurance of atypical biochemical profiles which generally correspond to that of Proteus. Out of the 35 samples contaminated with Proteus, 65 presumptive colonies were isolated. These colonies were analyzed using both normative microbiological method and Polymerase Chain Reaction (PCR). The PCR method detected two positive samples while normative microbiological method was not able to identify. In order to determine the extent of interference of Proteus swarming on the Salmonella-specific PCR band amplification, Salmonella ser. Typhimurium was grown in the presence of Proteus swarming. These results show that Proteus swarming did not interfere with Salmonella PCR-amplification, although the appearance of Sanlmonella was altered such that the black precipitate was no observed in the presence of Proteus swarming. Ours result indicate that the PCR method used in this study may be successfully applied to confirm presumptive Salmnonella colonies contaminated with Proteus swarming. PMID:18693548

  7. Real-time polymerase chain reaction for the diagnosis of necrotizing herpes stromal keratitis

    PubMed Central

    Ma, Jun-Xin; Wang, Lin-Nong; Zhou, Ru-Xia; Yu, Yang; Du, Tong-Xin

    2016-01-01

    AIM To design, optimize and validate a rapid, internally controlled real-time polymerase chain reaction (RT-PCR) test for herpes simplex virus (HSV) in the diagnosis of necrotizing herpes stromal keratitis. METHODS Tears alone or together with corneal epithelium scrapings from 30 patients (30 eyes) suspected of necrotizing herpes stromal keratitis were tested for HSV DNA by RT-PCR. The samples were collected during the first visit and then on the subsequent 7, 14, 28, 42, and 56d. The symptoms of the patients were scored before treatment to determine the correlation between HSV concentration in the corneal epithelium scrapings and clinical scores. RESULTS The positive rate (46.4%) in the corneal epithelium group before the therapy was significantly higher than that (13.3%) in the tears group (P=0.006). There were 13 positive HSV patients before the therapy, the concentration of HSV DNA in corneal epithelium scrapings group was significantly higher than that in the tears group (paired t-test, P=0.0397). Multilevel mixed-effects model analysis showed that the difference between the corneal epithelium scrapings group and the tears group was statistically significant (P=0.0049). The Spearman rank correlation analysis indicated a positive correlation between the HSV concentration in the corneal epithelium scrapings and clinical scores before the treatment (r=0.844, P<0.0001). CONCLUSION RT-PCR appears to be a powerful molecular tool for the diagnosis of necrotizing herpes stromal keratitis. PMID:27275421

  8. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed

    Grabow, W O; Botma, K L; de Villiers, J C; Clay, C G; Erasmus, B

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection.

  9. Nested reverse transcriptase-polymerase chain reaction for the detection of group A rotaviruses.

    PubMed

    Elschner, M; Prudlo, J; Hotzel, H; Otto, P; Sachse, K

    2002-03-01

    Rotaviruses are important pathogens associated with diarrhoeal diseases in almost all species of mammals. In the present study, a nested reverse transcriptase-polymerase chain reaction (RT-PCR) for the detection of group A rotaviruses was developed, which is based on a target region in gene segment 6. Rotavirus strains of human, bovine, porcine, canine, feline, equine, and ovine origin were examined. Furthermore several faecal specimens, in which rotavirus had already been detected using other methods than PCR, were included in the study. A nested RT-PCR product was formed with all strains and faecal samples tested. The detection limit for virus-containing cell culture supernatant was 3 x 10(-2) [50% tissue culture infective dose (TCID50)] by RT-PCR and 3 x 10(-3) TCID50) by nested amplification. In order to examine the influence of the sample matrix on sensitivity, a rotavirus-negative faecal specimen was spiked with virus-containing cell culture suspension of the porcine rotavirus OSU. The detection limit of the present PCR procedure was approximately 1.6 x 10(2) TCID50 per g faeces and could be increased by one order of magnitude using nested PCR. The present method for detection and identification of group A rotaviruses represents a powerful diagnostic tool and was shown to be applicable to rotaviruses of different origin, including human sources. PMID:12002423

  10. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    PubMed Central

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction patterns generated with AluI, PacI, and PsiI restriction endonucleases. Results: Variations in the number and size of digested fragments were recorded from treated individuals compared with controls showing that the restriction enzymes created a cut at different locations. In addition, sequences of COII gene from control and treated individuals were also used to confirm the RFLP patterns. From the sequence alignment data, it was found that mutations caused the destruction and generation of restriction sites in the gene sequence of treated individuals. Conclusion: This study indicates that all the three pesticides had potential to induce mutations in the normal sequence of COII gene and also advocates the use of PCR-RFLP assay as an efficient, rapid, and sensitive technique to detect mutagenicity of pesticides. PMID:24403735

  11. Event-specific qualitative and quantitative polymerase chain reaction analysis for genetically modified canola T45.

    PubMed

    Yang, Litao; Pan, Aihu; Zhang, Haibo; Guo, Jinchao; Yin, Changsong; Zhang, Dabing

    2006-12-27

    Polymerase chain reaction (PCR) methods have been the main technical support for the detection of genetically modified organisms (GMOs). To date, GMO-specific PCR detection strategies have been developed basically at four different levels, such as screening-, gene-, construct-, and event-specific detection methods. Event-specific PCR detection method is the primary trend in GMO detection because of its high specificity based on the flanking sequence of exogenous integrant. GM canola, event T45, with tolerance to glufosinate ammonium is one of the commercial genetically modified (GM) canola events approved in China. In this study, the 5'-integration junction sequence between host plant DNA and the integrated gene construct of T45 canola was cloned and revealed by means of TAIL-PCR. Specific PCR primers and TaqMan probes were designed based upon the revealed sequence, and qualitative and quantitative TaqMan real-time PCR detection assays employing these primers and probe were developed. In qualitative PCR, the limit of detection (LOD) was 0.1% for T45 canola in 100 ng of genomic DNA. The quantitative PCR assay showed limits of detection and quantification (LOD and LOQ) of 5 and 50 haploid genome copies, respectively. In addition, three mixed canola samples with known GM contents were detected employing the developed real-time PCR assay, and expected results were obtained. These results indicated that the developed event-specific PCR methods can be used for identification and quantification of T45 canola and its derivates.

  12. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    PubMed

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  13. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction.

    PubMed

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E

    1996-12-01

    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  14. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed Central

    Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

  15. Multiplex detection of Solenopsis invicta viruses -1, -2, and -3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A multiplex polymerase chain reaction (PCR) method was developed to detect simultaneously Solenopsis invicta viruses -1, -2, and -3 in their host, the red imported fire ant, Solenopsis invicta. cDNA synthesis was conducted in a single reaction containing three oligonucleotide primers specific for ...

  16. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    NASA Astrophysics Data System (ADS)

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-12-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

  17. Real-time polymerase chain reaction method for detection of toxigenic Clostridium difficile from stools and presumptive identification of NAP1 clone.

    PubMed

    Jayaratne, Padman A; Monkman, Lori; Broukhanski, George; Pillai, Dillan R; Lee, Christine

    2013-02-01

    This study describes the development of a cost-effective, multiplex real-time polymerase chain reaction (RTPCR) method for detection of toxigenic Clostridium difficile from stools and presumptive identification of the NAP-1 strain. The diagnostic value of the new method is for the detection of toxigenic C. difficile which has the following performance characteristics: 99.8% specificity, 95.1% sensitivity, 97.5% positive predictive value, and 99.5% negative predictive value. Examination of 24 specimens presumptively identified as NAP1 strain by RTPCR with Pulsed-field gel electrophoresis performed on C. difficile isolated from those specimens showed 100% agreement. This RTPCR showed equivalent test performance characteristics as the 2 commercially available assays which were evaluated. The estimated cost per test is CAD$9.50 and which is significantly less than the commercial assays. The average turnaround time from setup to detection is 3.5 h. The RTPCR method described here is a cost-effective and highly sensitive test which can be implemented in a clinical laboratory to assist clinicians in establishing the diagnosis of C. difficile infection and indirectly determine the presence of the hypervirulent epidemic binary toxin (BI)/NAP 1 strain for prompt infection control interventions. PMID:23182075

  18. Use of duplex polymerase chain reaction (duplex-PCR) technique to identify bovine and water buffalo milk used in making mozzarella cheese.

    PubMed

    Rea, S; Chikuni, K; Branciari, R; Sangamayya, R S; Ranucci, D; Avellini, P

    2001-11-01

    Molecular biology techniques have been used for species identification in food of animal origin in relatively recent years. A polymerase chain reaction (PCR) based method, the multiplex PCR, was recently applied to species identification in meat and meat products. It allows co-amplification of separate regions of a single gene or specific fragments, each typical of a different animal species in a single PCR reaction, using different pairs of primers in the same reaction mix. In the present paper, the duplex-PCR technique is proposed to identify bovine and water buffalo DNA in a single PCR assay in milk and mozzarella cheese (a typical Italian cheese, originally made from pure water buffalo milk). Because of its lower cost, undeclared bovine milk is added to water buffalo milk for making different kinds of mozzarella cheese. The results of this experiment indicate the applicability of this method, which showed an absolute specificity for the two species and a high sensitivity even down to low DNA concentrations (1 pg). In bovine and water buffalo mixtures of both milk and mozzarella cheese, the minimum concentration tested was 1% of bovine in water buffalo milk and water buffalo in bovine milk. The importance of the somatic cell content in raw milk is also discussed with special reference to the evaluation of mixtures (milk or cheese) of the two species.

  19. Sex determination by polymerase chain reaction on mummies discovered at Taklamakan desert in 1912.

    PubMed

    Lin, Z; Kondo, T; Minamino, T; Ohtsuji, M; Nishigami, J; Takayasu, T; Sun, R; Ohshima, T

    1995-10-30

    Sex determination was performed by the polymerase chain reaction (PCR) on eight adult mummies and one child mummy which were discovered at Taklamakan desert in 1912 and now belong to the Lüshun Museum in China. Archaeologically, these mummies were humans living in the seventh century, that is, more than 1300 years ago. Putative sex determination was performed based on external morphology for six of the eight adults, but it was impossible for the other two adults and one child mummy due to marked destruction on the external morphology. Hair, muscle and skin samples were then collected from each adult mummy, and skin and rib samples from the child mummy. Forty PCR cycles were performed as follows: denaturation at 94 degrees C for 40 s, annealing at 55 degrees C for 30 s and extension at 72 degrees C for 1 min. The primer and PCR reaction mixture were prepared according to the report by Witt and Erickson (M. Witt and R. P. Erikson, A rapid method for detection of Y-chromosomal DNA from dried blood specimens by the polymerase chain reaction. Hum. Genet., 82 (1989) 271-274)). Two different pairs of primer were used. One was X1, X2 (X1: 5'-AATCATCAAATGGAGATTTG-3'; X2: 5'-GTTCAGCTCTGTGAGTGAAA-3') to flanking the 170 bp fragment of the alphoid repeats on the human X chromosome, and the other was Y11, Y22 (Y11: 5'-ATGATAGAAACGGAAATATG-3'; Y22: 5'-AGTAGAATGCAAAGGGCTC-3') to flanking the 130 bp fragment of the alphoid repeats on the human Y chromosome. Extracted DNA solutions from mummy samples was purified using a spin column (T. Yoshii, K. Tamura, T. Taniguchi, K. Akiyama and I. Ishiyama, Water-soluble eumelanin as a PCR-inhibitor and a simple method for its removal. Jpn. J. Legal Med., 47 (1993) 323-329 (in Japanese with English abstract) for removing PCR-inhibitors, and bovine serum albumin (BSA) was employed to inhibit the remaining impurities even after the purification with the column. In six adult cases where the putative sex was determined from external morphology

  20. Use of polymerase chain reaction in the quantitation of mdr-1 gene expression

    SciTech Connect

    Murphy, L.D.; Herzog, C.E.; Rudick, J.B.; Fojo, A.T.; Bates, S.E. )

    1990-11-01

    The ability of the polymerase chain reaction (PCR) to quantitate expression of mRNA was examined in the present study. The model chosen was expression of the multidrug resistance gene mdr-1/Pgp in two colon carcinoma cell lines which express mdr-1/Pgp at levels comparable to those found in many clinical samples. PCR was utilized to evaluate differences in mdr-1/Pgp expression in the two cell lines after modulation by sodium butyrate. Thus, comparisons were made across a range of mdr-1/Pgp expression as well as comparisons of small differences. The PCR was found to be both sensitive and quantitative. Accurate quantitation requires demonstration of an exponential range which varies among samples. The exponential range can be determined by carrying out the PCR for a fixed number of cycles on serial dilutions of the RNA reverse transcription product, or by performing the reaction with a varying number of cycles on a fixed quantity of cDNA. By quantitation of the difference in PCR product derived from a given amount of RNA from the sodium butyrate treated and untreated cells, the difference in mRNA expression between samples can be determined. Normalization of the results can be achieved by independent amplification of a control gene, such as {beta}{sub 2}-microglobulin, when the latter is also evaluated in the exponential range. Simultaneous amplification of the control and target genes results in lower levels of PCR products due to competition, which varies from sample to sample. The PCR is thus a labor-intensive but sensitive method of quantitating gene expression in small samples of RNA.

  1. Field application of polymerase chain reaction diagnosis and strain typing of Trypanosoma cruzi in Bolivian triatomines.

    PubMed

    Breniere, S F; Bosseno, M F; Telleria, J; Carrasco, R; Vargas, F; Yaksic, N; Noireau, F

    1995-08-01

    A new approach for direct identification and characterization of Trypanosoma cruzi stocks in biological samples was tested for field applicability on an extensive sample of feces collected from triatomine vectors from four different species found in Bolivia. The first step of the technique is polymerase chain reaction (PCR) amplification of the hypervariable region of kinetoplast DNA minicircles of T. cruzi parasites. In this report, 345 fecal samples were analyzed and the PCR results were compared with microscopic examination. For Triatoma infestans, the principal Bolivian vector, both techniques were in concordance 85.3% of the time. For the three other species, Rhodnius pictipes, Eratyrus mucronatus, and Triatoma sordida, the fecal samples were all negative by microscopic examination whereas PCR results showed several T. cruzi-infected insects in each species. The second step of the procedure is the characterization of the T. cruzi clones by means of hybridization of the PCR products with clone-specific probes generated by the PCR. We used two probes corresponding to major clones circulating in high frequency in Bolivia (as shown by previous population genetic studies using isoenzyme characterization). We obtained four primary results: 1) we confirm the importance of two major clones in Bolivia in two distinct regions; 2) we report high rates of mixed infections (multiple clones in a single vector) in Triatoma infestans, up to 22% and 35% in Cochabamba and La Paz departments, respectively; 3) the results favor the absence of interaction between different clones; and 4) we find, for the first time, evidence of the major clones circulating in three species of triatomines that are known as mainly sylvatic species.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7677221

  2. Absolute quantification of genetically modified MON810 maize (Zea mays L.) by digital polymerase chain reaction.

    PubMed

    Corbisier, Philippe; Bhat, Somanath; Partis, Lina; Xie, Vicki Rui Dan; Emslie, Kerry R

    2010-03-01

    Quantitative analysis of genetically modified (GM) foods requires estimation of the amount of the transgenic event relative to an endogenous gene. Regulatory authorities in the European Union (EU) have defined the labelling threshold for GM food on the copy number ratio between the transgenic event and an endogenous gene. Real-time polymerase chain reaction (PCR) is currently being used for quantification of GM organisms (GMOs). Limitations in real-time PCR applications to detect very low number of DNA targets has led to new developments such as the digital PCR (dPCR) which allows accurate measurement of DNA copies without the need for a reference calibrator. In this paper, the amount of maize MON810 and hmg copies present in a DNA extract from seed powders certified for their mass content and for their copy number ratio was measured by dPCR. The ratio of these absolute copy numbers determined by dPCR was found to be identical to the ratios measured by real-time quantitative PCR (qPCR) using a plasmid DNA calibrator. These results indicate that both methods could be applied to determine the copy number ratio in MON810. The reported values were in agreement with estimations from a model elaborated to convert mass fractions into copy number fractions in MON810 varieties. This model was challenged on two MON810 varieties used for the production of MON810 certified reference materials (CRMs) which differ in the parental origin of the introduced GM trait. We conclude that dPCR has a high metrological quality and can be used for certifying GM CRMs in terms of DNA copy number ratio.

  3. Hepatitis C virus-polymerase chain reaction of routinely processed liver biopsies.

    PubMed

    el-Batanony, M H; Savage, K; Jacobs, R; el-Refaie, A O; Squadrito, G G; Brown, D; Saleh, S M; Raouf, A A; Amer, K M; Dusheiko, G M

    1994-08-01

    The aim of the study was to evaluate the specificity and sensitivity of detection of hepatitis C virus (HCV)-RNA in formalin-fixed paraffin-embedded (FFPE) liver biopsies by polymerase chain reaction (PCR). Routinely processed FFPE diagnostic needle liver biopsies as well as stored serum samples from 43 patients with liver disease were tested for HCV-RNA by reverse transcription-nested PCR using the same sets of primers and following strict anticontamination measures. Twenty-nine cases were positive and 14 were negative for serum HCV-RNA. Tissue HCV-RNA was detected in 17 out of the 29 serum HCV-RNA-positive cases but not in any of the 14 serum HCV-RNA-negative cases. Compared to serum-PCR, tissue-PCR was 100% specific, 58.6% sensitive, and 72% efficient. HCV-RNA was detected more frequently in biopsies stored for less than 1 year, than in those stored for more than 1 year (P = 0.046). In biopsies stored for up to 1 year detection of HCV-RNA by PCR was 81.8% sensitive and 90.9% efficient. Short (< 0.5 cm) liver biopsies were as sufficient for nucleic acid extraction and amplification as long (> 0.5 cm) ones. It is concluded that following strict anticontamination measures, HCV-RNA detection by PCR in routinely fixed, processed, and stored diagnostic liver biopsies provides a valuable adjunct to diagnosis of HCV infection. In this study, this option was free from contamination problems, even though routine batch histological processing schedules were used.

  4. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  5. Use of polymerase chain reaction in the diagnosis of Whipple's disease.

    PubMed

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi

    2015-12-01

    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight.

  6. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    PubMed

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  7. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive.

  8. Analysis of gene amplification in archival tissue by differential polymerase chain reaction.

    PubMed

    Neubauer, A; Neubauer, B; He, M; Effert, P; Iglehart, D; Frye, R A; Liu, E

    1992-05-01

    Oncogene amplification is found in many human tumors, and its detection may have important prognostic value. However, analysis of gene amplification may be hampered by inadequate tissue or poor DNA quality. We have previously described a polymerase chain reaction (PCR)-based procedure called differential PCR that can detect variations in gene dosage using miniscule amounts of tumor DNA [Frye, R.A., Benz, C.C. & Liu, E. (1989). Oncogene, 4, 1153-1157]. We now report the optimization of this technique for the analysis of oncogene amplification in paraffin-embedded archival tissues. We find that differential PCR is able to detect amplification of the HER2 (c-erbB-2) and the epidermal growth factor receptor (EGFR) genes and can be used to arrive at a semiquantitative estimate of gene dosage. Furthermore, our approach can determine gene amplification in samples in which the DNA is significantly degraded. Using differential PCR on paraffin-embedded tissues from cases previously investigated by standard DNA extraction and dot-blot procedures, good correlation between the two methods was found. Approaches are described to overcome technical problems posed by factors that affect the differential PCR, including the method of DNA extraction and extreme fragmentation of the DNA (less than 200 base pairs). Furthermore, the resulting analytical algorithm reported herein has proved effective in detecting oncogene amplification in archival breast cancer specimens from standard pathology laboratories. Thus, differential PCR will be particularly helpful in the analysis of tumor specimens that are archived, small in size or rare in occurrence.

  9. Detection of Xanthomonas campestris pv. citri by the polymerase chain reaction method.

    PubMed Central

    Hartung, J S; Daniel, J F; Pruvost, O P

    1993-01-01

    pFL1 is a pUC9 derivative that contains a 572-bp EcoRI insert cloned from plasmid DNA of Xanthomonas campestris pv. citri XC62. The nucleotide sequence of pFL1 was determined, and the sequence information was used to design primers for application of the polymerase chain reaction (PCR) to the detection of X. campestris pv. citri, the causal agent of citrus bacterial canker disease. Seven 18-bp oligonucleotide primers were designed and tested with DNA from X. campestris pv. citri strains and other strains of X. campestris associated with Citrus spp. as templates in the PCR. Four primer pairs directed the amplification of target DNA from X. campestris pv. citri strains but not from strains of X. campestris associated with a different disease, citrus bacterial spot. Primer pair 2-3 directed the specific amplification of target DNA from pathotype A but not other pathotypes of X. campestris pv. citri. A pH 9.0 buffer that contained 1% Triton X-100 and 0.1% gelatin was absolutely required for the successful amplification of the target DNA, which was 61% G+C. Limits of detection after amplification and gel electrophoresis were 25 pg of purified target DNA and about 10 cells when Southern blots were made after gel electrophoresis and probed with biotinylated pFL1. This level of detection represents an increase in sensitivity of about 100-fold over that of dot blotting with the same hybridization probe. PCR products of the expected sizes were amplified from DNA extracted from 7-month-old lesions from which viable bacteria could not be isolated. These products were confirmed to be specific for X. campestris pv. citri by Southern blotting. This PCR-based detection protocol will be a useful addition to current methods of detection of this pathogen, which is currently the target of international quarantine measures. Images PMID:8476288

  10. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    PubMed Central

    Peng, Xiao-Mou; Gu, Lin; Chen, Xue-Juan; Li, Jian-Guo; Huang, Yang-Su; Gao, Zhi-Liang

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation. METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control. To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CD-PCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to 10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe-ndent of the amount of templates and the number of PCR cycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles. PMID:15962387

  11. Detection of MYCN Amplification in Serum DNA Using Conventional Polymerase Chain Reaction.

    PubMed

    Ma, Youngeun; Lee, Ji Won; Park, Soo Jin; Yi, Eun Sang; Choi, Young Bae; Yoo, Keon Hee; Sung, Ki Woong; Koo, Hong Hoe

    2016-09-01

    Neuroblastoma (NB) is the most common extra-cranial solid tumor of childhood and is characterized by a wide range of clinical behaviors. Amplification of MYCN is a well-known poor prognostic factor in NB patients. As the MYCN amplification status is usually tested using tumor specimens, lengthy and invasive procedures are unavoidable. To evaluate the possibility of detecting MYCN amplification without invasive procedure, we performed conventional polymerase chain reaction (PCR) analysis to identify MYCN amplification using the preserved serum DNA. PCR of serum DNA was done in 105 NB patients whose MYCN status had been confirmed by fluorescence in situ hybridization. MYCN amplification was evaluated as the ratio of signal intensities between MYCN and NAGK (M/N ratio). When regarding the tissue FISH results as a reference, 10 patients had MYCN-amplified (MNA) NB, and 95 had non-MNA NB. The M/N ratio of the MNA group (median 2.56, range 1.01-3.58) was significantly higher than that of the non-MNA group (median 0.97, range 0.67-5.18) (P < 0.001). In the receiver operating characteristic curve analysis, the area under the curve was 0.957 (95% confidence interval 0.898-1.000; P < 0.001), and it showed 90.9% sensitivity and 97.9% specificity with the selected cut-off value set as 1.6. The detection of MYCN amplification using conventional PCR analysis of serum samples seems to be a simple and promising method to evaluate the MYCN status of NB patients. Further study with a larger set of patients is needed to confirm the accuracy of this result.

  12. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis.

    PubMed

    Santos, M S; Souza, E S; S Junior, R M; Talhari, S; Souza, J V B

    2010-08-01

    Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP). More specifically: a) to evaluate 3 different amplification regions, b) to investigate 3 different restriction enzymes, and c) to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2) were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel) produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas--FMTAM) were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  13. Predictive role of polymerase chain reaction in the early diagnosis of congenital Trypanosoma cruzi infection.

    PubMed

    Velázquez, Elsa B; Rivero, Rocío; De Rissio, Ana María; Malagrino, Nora; Esteva, Mónica I; Riarte, Adelina Rosa; Ruiz, Andrés Mariano

    2014-09-01

    The efficacy of specific chemotherapy in congenital Chagas disease before the first year of life ranges between 90 and 100%. Between this age and 15 years of age, the efficacy decreases to around 60%. Therefore, early infection detection is a priority in vertical transmission. The aim of this work was to assess whether polymerase chain reaction (PCR) plays a predictive role in the diagnosis of congenital Chagas disease as compared to conventional parasitological and serological methods. To this end, we studied a total of 468 children born to Trypanosoma cruzi seroreactive mothers came from Argentina, Bolivia and Paraguay, who lived in the city of Buenos Aires and suburban areas (Argentina), a non-endemic area of this country. These children were assessed by PCR from 2004 to 2009 with the specific primers Tcz1 and Tcz2, and 121 and 122. PCR allowed detecting 49 T. cruzi-positive children. Eight of these 49 children were excluded from the analysis: six because they did not complete follow-up and two because the first control was performed after 12 months of age. Parasitological methods allowed detecting 25 positive children, 7 of whom had been earlier diagnosed by PCR (1.53±2.00 vs. 6.71±1.46 months; p=0.0002). Serological methods allowed detecting 16 positive children, 12 of whom had been earlier diagnosed by PCR (1.46±1.48 vs. 11.77±4.40 months; p<0.0001). None of the children negative by PCR was positive by serological or parasitological methods. This study shows that PCR allows early diagnosis in congenital Chagas disease. At present, an early positive PCR is not indicative for treatment. However, a positive PCR would alert the health system to search only those infected infants diagnosed by early PCR and thus generate greater efficiency in the diagnosis and treatment of congenital T. cruzi infection.

  14. Hepatitis C virus-polymerase chain reaction of routinely processed liver biopsies.

    PubMed

    el-Batanony, M H; Savage, K; Jacobs, R; el-Refaie, A O; Squadrito, G G; Brown, D; Saleh, S M; Raouf, A A; Amer, K M; Dusheiko, G M

    1994-08-01

    The aim of the study was to evaluate the specificity and sensitivity of detection of hepatitis C virus (HCV)-RNA in formalin-fixed paraffin-embedded (FFPE) liver biopsies by polymerase chain reaction (PCR). Routinely processed FFPE diagnostic needle liver biopsies as well as stored serum samples from 43 patients with liver disease were tested for HCV-RNA by reverse transcription-nested PCR using the same sets of primers and following strict anticontamination measures. Twenty-nine cases were positive and 14 were negative for serum HCV-RNA. Tissue HCV-RNA was detected in 17 out of the 29 serum HCV-RNA-positive cases but not in any of the 14 serum HCV-RNA-negative cases. Compared to serum-PCR, tissue-PCR was 100% specific, 58.6% sensitive, and 72% efficient. HCV-RNA was detected more frequently in biopsies stored for less than 1 year, than in those stored for more than 1 year (P = 0.046). In biopsies stored for up to 1 year detection of HCV-RNA by PCR was 81.8% sensitive and 90.9% efficient. Short (< 0.5 cm) liver biopsies were as sufficient for nucleic acid extraction and amplification as long (> 0.5 cm) ones. It is concluded that following strict anticontamination measures, HCV-RNA detection by PCR in routinely fixed, processed, and stored diagnostic liver biopsies provides a valuable adjunct to diagnosis of HCV infection. In this study, this option was free from contamination problems, even though routine batch histological processing schedules were used. PMID:7964648

  15. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, Tonie E.; Smith, Susan R.; Miyamoto, Amy; Shadduck, Daniel J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  16. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, T.E.; Smith, S.R.; Miyamoto, A.; Shadduck, D.J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 ?? 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  17. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses

    PubMed Central

    2016-01-01

    Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate) (PMMA) Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs) for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane) interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately. PMID:27230459

  18. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].

    PubMed

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P

    2013-06-01

    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; P<0.001). Viremia was detected when the serum was sampled within 30 h after the beginning of symptoms. These results confirm previous reports of early and transient viremia in young children. This preliminary study shows the limits and added value of EV PCR in serum. It suggests that in some children and under certain conditions (age >3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients.

  19. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1.

    PubMed

    Rocke, Tonie E; Smith, Susan R; Miyamoto, Amy; Shadduck, Daniel J

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 x 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission. PMID:12061646

  20. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed Central

    Kyambadde, J. W.; Enyaru, J. C.; Matovu, E.; Odiit, M.; Carasco, J. F.

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter. PMID:10686746

  1. Integrated continuous flow polymerase chain reaction and micro-capillary electrophoresis system with bioaffinity preconcentration.

    PubMed

    Njoroge, Samuel K; Witek, Magorzata A; Battle, Katrina N; Immethun, Vicki E; Hupert, Mateusz L; Soper, Steven A

    2011-11-01

    An integrated and modular DNA analysis system is reported that consists of two modules: (i) A continuous flow polymerase chain reaction (CFPCR) module fabricated in a high T(g) (150°C) polycarbonate substrate in which selected gene fragments were amplified using biotin and fluorescently labeled primers accomplished by continuously shuttling small packets of PCR reagents and template through isothermal zones as opposed to heating and cooling large thermal masses typically performed in batch-type thermal reactors. (ii) μCE (micro-capillary electrophoresis) module fabricated in poly(methylmethacrylate) (PMMA), which utilized a bioaffinity selection and purification bed (2.9  μL) to preconcentrate and purify the PCR products generated from the CFPCR module prior to electrophoretic sorting. Biotin-labeled CFPCR products were hydrostatically pumped through the streptavidin-modified bed, where they were extracted onto the surface of micropillars. The affinity bed was also fabricated in PMMA and was populated with an array of microposts (50  μm width; 100  μm height) yielding a total surface area of ∼117  mm(2). This solid-phase extraction (SPE) process demonstrated high selectivity for biotinylated amplicons and utilized the strong streptavidin/biotin interaction (K(d) = 10(-15)  M) to generate high recoveries. The SPE selected CFPCR products were thermally denatured and single-stranded DNA released for injection into a 7-cm-long μCE channel for size-based separations and fluorescence detection. The utility of the system was demonstrated using Alu DNA typing for gender and ethnicity determinations as a model. Compared with the traditional cross-T injection procedure typically used for μCE, the affinity pre-concentration and injection procedure generated signal enhancements of 17- to 40-fold, critical for CFPCR thermal cyclers due to Taylor dispersion associated with their operation. PMID:22038569

  2. Use of pooled samples for the detection of Salmonella in feces by polymerase chain reaction.

    PubMed

    Singer, Randall S; Cooke, Cara L; Maddox, Carol W; Isaacson, Richard E; Wallace, Richard L

    2006-07-01

    Many epidemiological studies of Salmonella rely on conventional bacteriological culture methods to detect Salmonella in fecal samples. These culture-based methods are inefficient for epidemiological studies in populations with a low prevalence of Salmonella. The objective of this study was to optimize a protocol that uses pooled Salmonella enrichment broth cultures of bovine feces and polymerase chain reaction (PCR) for the detection of the invA gene of Salmonella in feces. In one field trial, 196 animals were sampled, and all samples were tested by culture, invA PCR on individual samples, invA PCR on pools of 5 samples, and BAX PCR on individual samples. All assays showed a high agreement on individual samples (kappa > or = 0.75). The invA PCR was run on each of 40 pools and detected 19 of 22 culture-positive pools. In another field trial, 152 samples were taken from 4 dairies, and the invA PCR was performed on pools of 5 samples in addition to bacteriological culture of individual samples. Salmonella was detected in 5 of the 32 pools (7 total positive samples) by both PCR and culture. One pool was PCR-positive but culture-negative. Pooling did not dramatically affect the performance of the invA PCR; most of the culture-positive samples were detected, including all of the samples when there were 4 or more Salmonella colonies on the agar plate. Based on these field trials, invA PCR on pooled samples appears to be an efficient method of Salmonella detection as long as Salmonella loads are not extremely low.

  3. Inhibitory effects of atrazine on Chlorella vulgaris as assessed by real-time polymerase chain reaction.

    PubMed

    Qian, Haifeng; Daniel Sheng, G; Liu, Weiping; Lu, Yingcong; Liu, Zhenghai; Fu, Zhengwei

    2008-01-01

    Atrazine, a highly toxic herbicide, is frequently detected in surface water because of its heavy application. Algae are among the aquatic organisms most susceptible to atrazine pollution in water. In the present study, the aquatic alga Chlorella vulgaris Beijerinck was chosen to assess the acute toxicity of atrazine (48-96 h) in terms of gene transcription and physiological changes. A real-time polymerase chain reaction (PCR) assay was used to quantify transcript levels of three photosystem genes in C. vulgaris. The diel patterns for regulation of the psaB (photosystem I reaction center protein subunit B), psbC (an integral membrane protein component of photosystem II), and rbcL (large subunit of ribulose-1,5-bisphosphate carboxylase oxygenase) gene transcripts were successfully quantified. Results showed that atrazine reduced the transcript abundances of three target genes and that the abundances decreased with increasing atrazine concentration. The determined smallest transcript levels of psaB, psbC, and rbcL, which occurred at the highest atrazine concentration tested (400 mug/L), were only 34.6, 34.6, and 8.1%, respectively, of the control sample value. Exposure to atrazine increased the level of malondialdehyde by 1.74-fold (the highest value) in C. vulgaris, suggesting potential oxidative damage to the alga. The activities of antioxidation enzymes (e.g., superoxide dismutase, peroxidase, and catalase) also increased markedly in the presence of atrazine, with maximum increases of 1.82-, 1.59-, and 2.31-fold, respectively. These elevated activities may help to alleviate the oxidative damage. Our results demonstrate that atrazine is highly toxic to this alga and that real-time PCR is an efficient technique for assessing the toxicity of xenobiotic compounds in algae.

  4. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  5. Biosynthetic enhancement of the detection of bacteria by the polymerase chain reaction.

    PubMed

    Do, Julie S; Weigel, Kris M; Meschke, John S; Cangelosi, Gerard A

    2014-01-01

    Molecular viability testing (MVT) was previously reported to specifically detect viable bacterial cells in complex samples. In MVT, brief nutritional stimulation induces viable cells, but not non-viable cells, to produce abundant amounts of species-specific ribosomal RNA precursors (pre-rRNA). Quantitative polymerase chain reaction (qPCR) is used to quantify specific pre-rRNAs in a stimulated aliquot relative to a non-stimulated control. In addition to excluding background signal from non-viable cells and from free DNA, we report here that MVT increases the analytical sensitivity of qPCR when detecting viable cells. Side-by-side limit-of-detection comparisons showed that MVT is 5-fold to >10-fold more sensitive than standard (static) DNA-targeted qPCR when detecting diverse bacterial pathogens (Aeromonas hydrophila, Acinetobacter baumannii, Listeria monocytogenes, Mycobacterium avium, and Staphylococcus aureus) in serum, milk, and tap water. Sensitivity enhancement may come from the elevated copy number of pre-rRNA relative to genomic DNA, and also from the ratiometric measurement which reduces ambiguity associated with weak or borderline signals. We also report that MVT eliminates false positive signals from bacteria that have been inactivated by moderately elevated temperatures (pasteurization), a condition that can confound widely-used cellular integrity tests that utilize membrane-impermeant compounds such as propidium iodide (PI) or propidium monoazide (PMA) to differentiate viable from inactivated bacteria. MVT enables the sensitive and specific detection of very small numbers of viable bacteria in complex matrices.

  6. Relevance of semen polymerase chain reaction positive for tuberculosis in asymptomatic men undergoing infertility evaluation

    PubMed Central

    Regmi, Subodh Kumar; Singh, Urvashi B.; Sharma, Jai Bhagwan; Kumar, Rajeev

    2015-01-01

    OBJECTIVE: Male partners of infertile women with genital tuberculosis (TB) are often screened for genital TB. We aimed to evaluate the clinical significance of a positive screening semen polymerase chain reaction (PCR) for Mycobacterium tuberculosis test (TB-PCR) in asymptomatic men undergoing infertility evaluation and determine the need for a detailed investigation and treatment for TB. MATERIALS AND METHODS: Between March 2012 and January 2013, male partners of 15 infertile women with a diagnosis of genitourinary TB (GUTB) as the cause of infertility, tested positive either on semen PCR for TB (13 cases), or Mycobacterium Growth Indicator Tube-960 test (2 cases). These asymptomatic men underwent infertility evaluation along with evaluation for GUTB. Diagnosis of GUTB was based on standard clinical criteria, which included a high index of suspicion along with clinical, laboratory, and/or radiological evidence of GUTB. Men who had no clinical evidence of GUTB were followed up with clinical evaluation, semen analysis, and repeat semen PCR for TB after 6 months. RESULTS: Fourteen subjects consented for inclusion in the study. One had a history of pulmonary TB 20 years earlier. Another patient was found to have mediastinal lymphadenopathy (tubercular). All except one had a normal semen analysis. None of the patients met the standard clinical criteria for GUTB diagnosis. 8 patients followed up at 6 months with repeat semen analysis, which was similar to the baseline values and no clinical evidence of TB. INTERPRETATION AND CONCLUSIONS: Asymptomatic men with positive screening semen PCR for TB do not have clinical evidence of TB. Male partners of women with infertility and GUTB should not be screened if they have no symptoms. PMID:26538860

  7. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis.

    PubMed

    Santos, M S; Souza, E S; S Junior, R M; Talhari, S; Souza, J V B

    2010-08-01

    Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP). More specifically: a) to evaluate 3 different amplification regions, b) to investigate 3 different restriction enzymes, and c) to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2) were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel) produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas--FMTAM) were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods. PMID:20640387

  8. One-sided polymerase chain reaction: the amplification of cDNA.

    PubMed Central

    Ohara, O; Dorit, R L; Gilbert, W

    1989-01-01

    We report a rapid technique, based on the polymerase chain reaction (PCR), for the direct targeting, enhancement, and sequencing of previously uncharacterized cDNAs. This method is not limited to previously sequenced transcripts, since it requires only two adjacent or partially overlapping specific primers from only one side of the region to be amplified. These primers can be located anywhere within the message. The specific primers are used in conjunction with nonspecific primers targeted either to the poly(A)+ region of the message or to an enzymatically synthesized d(A) tail. Pairwise combinations of specific and general primers allow for the amplification of regions both 3' and 5' to the point of entry into the message. The amplified PCR products can be cloned, sequenced directly by genomic sequencing, or labeled for sequencing by amplifying with a radioactive primer. We illustrate the power of this approach by deriving the cDNA sequences for the skeletal muscle alpha-tropomyosins of European common frog (Rana temporaria) and zebrafish (Brachydanio rerio) using only 300 ng of a total poly(A)+ preparation. In these examples, we gained initial entry into the tropomyosin messages by using heterologous primers (to conserved regions) derived from the rat skeletal muscle alpha-tropomyosin sequence. The frog and zebrafish sequences are used in an analysis of tropomyosin evolution across the vertebrate phylogenetic spectrum. The results underscore the conservative nature of the tropomyosin molecule and support the notion of a constrained heptapeptide unit as the fundamental structural motif of tropomyosin. Images PMID:2788276

  9. Incidence of enteroviruses in Mamala Bay, Hawaii using cell culture and direct polymerase chain reaction methodologies.

    PubMed

    Reynolds, K A; Roll, K; Fujioka, R S; Gerba, C P; Pepper, I L

    1998-06-01

    The consequence of point and nonpoint pollution sources, discharged into marine waters, on public recreational beaches in Mamala Bay, Hawaii was evaluated using virus cell culture and direct reverse transcriptase-polymerase chain reaction (RT-PCR). Twelve sites, nine marine, two freshwater (one stream and one canal), and one sewage, were assessed either quarterly or monthly for 1 year to detect the presence of human enteric viruses. Water samples were concentrated from initial volumes of 400 L to final volumes of 30 mL using Filterite electronegative cartridge filters and a modified beef extract elution procedure. Cell culture was applied using the Buffalo Green Monkey kidney cell line to analyze samples for enteroviruses. Positive samples were also evaluated by RT-PCR, using enterovirus-specific primers. Levels of RT-PCR inhibition varied with each concentrated sample. Resin column purification increased PCR detection sensitivity by at least one order of magnitude in a variety of sewage outfall and recreational marine water samples but not in the freshwater canal samples. Using cell culture, viable enteroviruses were found in 50 and 17% of all outfall and canal samples, respectively. Samples were positive at beaches 8% of the time. These data illustrate the potential public health hazard associated with recreational waters. Using direct PCR, viruses were detected at the outfall but were not found in any beach or canal samples, in part, owing to substances that inhibit PCR. Therefore, conventional cell culture is the most effective means of detecting low levels of infectious enteroviruses in environmental waters, whereas direct RT-PCR is rendered less effective by inhibitory compounds and low equivalent reaction volumes. PMID:9734309

  10. Human papillomavirus infection in lung vs. oral squamous cell carcinomas: a polymerase chain reaction study.

    PubMed

    Halimi, M; Morshedi Asl, S

    2011-06-01

    The role of Human Papillomavirus (HPV) has been suspected in pathogenesis of various malignancies; however, the available data are not conclusive. This study aimed to determine and compare the frequency of HPV infection in oral and lung Squamous Cell Carcinoma (SCC) by a sensitive method. Sixty specimens of oral and lung SCC (30 cases each one) were reevaluated in Tabriz Imam Reza Centre in a 24 month period. Following genomic DNA extract, the Polymerase Chain Reaction (PCR) amplification was performed in presence of specific MY11 and MY09 primers for HPV infection. Three cervical specimens and a combination of PCR solution lacking DNA plus healthy persons' DNA samples were employed as positive and negative controls, respectively. The oral group was significantly older than the lung group (68.90 vs. 56.67 y, p < 0.001) with more males in the latter (83.3 vs. 60%; p = 0.04). Percentages of HPV infection in the oral and lung groups were comparable (20 vs. 10%, respectively; p = 0.47). Majority of patients with HPV infection were older than 60 years (88.9%) or male (88.9%). In the oral group, all these cases were well differentiated and the majority was of lower lip origin (83.3%). In the lung group, 66.7% of these specimens were moderately differentiated and the origin was bronchus in all cases. In conclusion, the rate of HPV infection in lung and oral SCC samples is rather lower than the previous reports in the literature. This rate is apparently higher in the oral than the lung SCC specimens. PMID:22235505

  11. National Malaria Prevalence in Cambodia: Microscopy Versus Polymerase Chain Reaction Estimates.

    PubMed

    Lek, Dysoley; Popovici, Jean; Ariey, Frederic; Vinjamuri, Seshu Babu; Meek, Sylvia; Bruce, Jan; Taylor, Walter R J; Socheat, Duong; Menard, Didier; Rogers, William O

    2016-09-01

    Accurate information regarding malaria prevalence at national level is required to design and assess malaria control/elimination efforts. Although many comparisons of microscopy and polymerase chain reaction (PCR)-based methods have been conducted, there is little published literature covering such comparisons in southeast Asia especially at the national level. Both microscopic examination and PCR detection were performed on blood films and dried blood spots samples collected from 8,067 individuals enrolled in a nationwide, stratified, multistage, cluster sampling malaria prevalence survey conducted in Cambodia in 2007. The overall malaria prevalence and prevalence rates of Plasmodium falciparum, Plasmodium vivax, and Plasmodium malariae infections estimated by microscopy (N = 8,067) were 2.74% (95% confidence interval [CI]: 2.39-3.12%), 1.81% (95% CI: 1.53-2.13%), 1.14% (95% CI: 0.92-1.40%), and 0.01% (95% CI: 0.003-0.07%), respectively. The overall malaria prevalence based on PCR detection (N = 7,718) was almost 2.5-fold higher (6.31%, 95% CI: 5.76-6.89%, P < 0.00001). This difference was significantly more pronounced for P. falciparum (4.40%, 95% CI: 3.95-4.90%, P < 0.00001) compared with P. vivax (1.89%, 95% CI: 1.60-2.22%, P < 0.001) and P. malariae infections (0.22%, 95% CI: 0.13-0.35%, P < 0.0001). The significant proportion of microscopy-negative but PCR-positive individuals (289/7,491, 3.85%) suggest microscopic examination frequently underestimated malaria infections and that active case detection based on microscopy may miss a significant reservoir of infection, especially in low-transmission settings. PMID:27402511

  12. Incidence of enteroviruses in Mamala Bay, Hawaii using cell culture and direct polymerase chain reaction methodologies.

    PubMed

    Reynolds, K A; Roll, K; Fujioka, R S; Gerba, C P; Pepper, I L

    1998-06-01

    The consequence of point and nonpoint pollution sources, discharged into marine waters, on public recreational beaches in Mamala Bay, Hawaii was evaluated using virus cell culture and direct reverse transcriptase-polymerase chain reaction (RT-PCR). Twelve sites, nine marine, two freshwater (one stream and one canal), and one sewage, were assessed either quarterly or monthly for 1 year to detect the presence of human enteric viruses. Water samples were concentrated from initial volumes of 400 L to final volumes of 30 mL using Filterite electronegative cartridge filters and a modified beef extract elution procedure. Cell culture was applied using the Buffalo Green Monkey kidney cell line to analyze samples for enteroviruses. Positive samples were also evaluated by RT-PCR, using enterovirus-specific primers. Levels of RT-PCR inhibition varied with each concentrated sample. Resin column purification increased PCR detection sensitivity by at least one order of magnitude in a variety of sewage outfall and recreational marine water samples but not in the freshwater canal samples. Using cell culture, viable enteroviruses were found in 50 and 17% of all outfall and canal samples, respectively. Samples were positive at beaches 8% of the time. These data illustrate the potential public health hazard associated with recreational waters. Using direct PCR, viruses were detected at the outfall but were not found in any beach or canal samples, in part, owing to substances that inhibit PCR. Therefore, conventional cell culture is the most effective means of detecting low levels of infectious enteroviruses in environmental waters, whereas direct RT-PCR is rendered less effective by inhibitory compounds and low equivalent reaction volumes.

  13. High-throughput double quantitative competitive polymerase chain reaction for determination of genetically modified organisms.

    PubMed

    Mavropoulou, Anastasia K; Koraki, Theodora; Ioannou, Penelope C; Christopoulos, Theodore K

    2005-08-01

    Quantitative competitive polymerase chain reaction (PCR), especially the double competitive PCR methods (DC-PCR), have evolved as reliable approaches to quantification of genetically modified organisms (GMO) in food. However, DC-PCR is a low-throughput method because it requires titration of each sample with various amounts of a competitive internal standard, a protocol that involves several PCRs per sample followed by electrophoresis and densitometry. To address this drawback, we have developed a new method for GMO quantification, namely, a high-throughput double quantitative competitive PCR (HT-DCPCR). In HT-DCPCR, electrophoresis and densitometry are replaced by a rapid, microtiter well-based bioluminometric hybridization assay and there is no need for titration of each sample. The determination of GM soya was chosen as a model. We have constructed internal standards (DNA competitors) both for the 35S promoter sequence and for a plant-specific reference gene (lectin). The competitors have identical size and share the same primer binding sites with the target sequences but differ in a 24-bp internal segment. Each target sequence (35S and lectin) is coamplified with a constant amount (1000 copies) of the respective competitor. The four amplified fragments are hybridized with specific probes and captured on a universal solid phase to achieve simplicity and high throughput. The hybrids are determined by using streptavidin conjugated to the photoprotein aequorin. The ratio of the luminescence values obtained for the target and the competitor is linearly related to the starting amount of target DNA. The limit of quantification for the 35S promoter is 24 copies. The proposed method was evaluated by determining the GMO content of soybean powder certified reference materials. Also HT-DCPCR was compared to real-time PCR in a variety of real samples.

  14. Infrared temperature control system for a completely noncontact polymerase chain reaction in microfluidic chips.

    PubMed

    Roper, Michael G; Easley, Christopher J; Legendre, Lindsay A; Humphrey, Joseph A C; Landers, James P

    2007-02-15

    A completely noncontact temperature system is described for amplification of DNA via the polymerase chain reaction (PCR) in glass microfluidic chips. An infrared (IR)-sensitive pyrometer was calibrated against a thermocouple inserted into a 550-nL PCR chamber and used to monitor the temperature of the glass surface above the PCR chamber during heating and cooling induced by a tungsten lamp and convective air source, respectively. A time lag of less than 1 s was observed between maximum heating rates of the solution and surface, indicating that thermal equilibrium was attained rapidly. Moreover, the time lag was corroborated using a one-dimensional heat-transfer model, which provided insight into the characteristics of the device and environment that caused the time lag. This knowledge will, in turn, allow for future tailoring of the devices to specific applications. To alleviate the need for calibrating the pyrometer with a thermocouple, the on-chip calibration of pyrometer was accomplished by sensing the boiling of two solutions, water and an azeotrope, and comparing the pyrometer output voltage against the known boiling points of these solutions. The "boiling point calibration" was successful as indicated by the subsequent chip-based IR-PCR amplification of a 211-bp fragment of the B. anthracis genome in a chamber reduced beyond the dimensions of a thermocouple. To improve the heating rates, a parabolic gold mirror was positioned above the microfluidic chip, which expedited PCR amplification to 18.8 min for a 30-cycle, three-temperature protocol. PMID:17297927

  15. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  16. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) Larvae in Wetlands, Western Kenya: Confirmation by Polymerase Chain Reaction Method

    PubMed Central

    OHBA, SHIN-YA; KAWADA, HITOSHI; DIDA, GABRIEL O.; JUMA, DUNCAN; SONYE, GORGE; MINAKAWA, NOBORU; TAKAGI, MASAHIRO

    2010-01-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  17. Rapid detection of poliovirus by reverse transcription and polymerase chain amplification: application for differentiation between poliovirus and nonpoliovirus enteroviruses.

    PubMed Central

    Abraham, R; Chonmaitree, T; McCombs, J; Prabhakar, B; Lo Verde, P T; Ogra, P L

    1993-01-01

    This report describes a rapid method of detection of poliovirus from viral isolates of clinical specimens using a single set of primers selected from the conserved 5' noncoding region of the poliovirus genome. Of the 144 clinical viral isolates examined, 81 were positive for polioviruses and 50 were positive for nonpoliovirus enteroviruses by tissue culture neutralization and infectivity. All 81 (100%) of the viral isolates identified as poliovirus by tissue culture infectivity were also positive by polymerase chain reaction. Of 50 nonpoliovirus enterovirus isolates found to be negative for poliovirus by tissue culture neutralization and infectivity, 48 were also negative by polymerase chain reaction. The high sensitivity (100%) and specificity (96%) of the primer set indicate that this assay has potential clinical applicability in the diagnosis of nonpoliovirus enterovirus infection. Images PMID:7679404

  18. Synthesis of a non-radioactive hepatitis B virus DNA probe from human serum by the polymerase chain reaction.

    PubMed

    Rodríguez-Frías, F; Arranz, J A; Buti, M; Esteban, R; Jardí, R

    1994-05-01

    A method for synthesizing probes for detecting hepatitis B virus DNA in serum was developed. It uses DNA extracted from the serum of an hepatitis B virus carrier as target, and digoxigenin-11-dUTP incorporated in DNA sequences during the polymerase chain reaction as tracer. Using a spot hybridization assay, the sensitivity and specificity of the digoxigenin-labelled DNA probe were compared with two standard hepatitis B virus DNA probes, synthesized with cloned hepatitis B virus DNA and labelled either with digoxigenin or 32P by random priming. Data obtained from the three methods showed an excellent correlation. Thus, hepatitis B virus DNA extracted from human serum and labelled by polymerase chain reaction may be considered a suitable alternative to cloned DNA. It provides reliable probes and eliminates the need for facilities and personnel dedicated to the manipulation of clones. These advantages will allow a wider application of hepatitis B virus DNA testing in clinical practice.

  19. Evaluation of gold nanoparticles as the additive in real-time polymerase chain reaction with SYBR Green I dye

    NASA Astrophysics Data System (ADS)

    Yang, Wenchao; Mi, Lijuan; Cao, Xueyan; Zhang, Xiaodong; Fan, Chunhai; Hu, Jun

    2008-06-01

    Gold nanoparticles (AuNPs) have been proven to be able to improve the specificity or increase the efficiency of a polymerase chain reaction (PCR) when a suitable amount of AuNPs was used. However, there is still a lack of systematic evaluation of AuNPs in real-time PCR. In this study, DNA degradation and the fluorescence quenching effect of AuNPs were first tested in real-time PCR. Then two different kinds of Taq DNA polymerase, native and recombinant Taq polymerase, were employed to evaluate the AuNPs' effect on the threshold cycle (CT) values, standard curves and melting curves in real-time PCR. Different ratios of the amount of native Taq DNA polymerase to the amount of AuNPs were also tested. It was found that AuNPs could be applied in real-time PCR with correlation coefficient R2>0.989. The combination of 2.09 nM AuNPs with 3.75 U of native Taq DNA polymerase could make the amplification curves shift to the left and enhance the efficiency of the real-time PCR (0.628 39 without AuNPs compared with 0.717 89 with 2.09 nM AuNPs), thus enabling faster detection in comparison with those of control samples. However, no improvement ability of AuNPs was found in real-time PCR based on recombinant rTaq DNA polymerase. Besides, the results suggest that a complex interaction exists between AuNPs and native Taq DNA polymerase.

  20. Clinical application of a polymerase chain reaction assay in the diagnosis of pneumonia caused by Rhodococcus equi in a horse.

    PubMed

    Vivrette, S L; Sellon, D C; Gibbons, D S

    2000-11-01

    Diagnosis of pneumonia caused by Rhodococcus equi can be made more rapidly by use of a polymerase chain reaction (PCR) assay than by use of conventional bacteriologic culture techniques. Use of a PCR assay aids in the differentiation between virulent and avirulent strains of R equi, and the assay may be used to identify R equi in feces and soil of breeding farms. PMID:11061388

  1. Transcription analysis of class II human leukocyte antigen genes from normal and immunodeficient B lymphocytes, using polymerase chain reaction.

    PubMed Central

    Bull, M; van Hoef, A; Gorski, J

    1990-01-01

    The RNA transcript levels of all human leukocyte antigen class II loci were determined from class II congenital immunodeficient B cells by polymerase chain reaction amplification of cDNA. No mRNA was observed under conditions in which 0.01% normal levels could be visualized. Pre-mRNA could be amplified from normal B cells but not from immunodeficient B cells, indicating a transcription defect. Images PMID:2113177

  2. Histoplasma capsulatum var. duboisii infection in a patient with AIDS: rapid diagnosis using polymerase chain reaction-sequencing.

    PubMed

    Pellaton, Cyril; Cavassini, Matthias; Jaton-Ogay, Katia; Carron, Pierre-Nicolas; Christen-Zaech, Stéphanie; Calandra, Thierry; Bille, Jacques; Hauser, Philippe M

    2009-05-01

    We describe an original case of disseminated infection with Histoplasma capsulatum (Hc) var. duboisii in an African patient with AIDS who migrated to Switzerland. The diagnosis of histoplasmosis was suggested using direct examination of tissues and confirmed in 24 h with a panfungal polymerase chain reaction assay. The variety duboisii of Hc was established using DNA sequencing of the polymorphic genomic region OLE. Molecular tools allow diagnosis of histoplasmosis in 24 h, which is drastically shorter than culture procedures. PMID:19304436

  3. Allele-specific duplex polymerase chain reaction to differentiate Mycobacterium abscessus subspecies and to detect highly clarithromycin-resistant isolates.

    PubMed

    Kim, H Y; Lee, S Y; Kim, B J; Kook, Y H

    2016-01-01

    On the basis of the structural differences of erm, we used a duplex polymerase chain reaction (PCR) to differentiate Mycobacterium abscessus subsp. abscessus and subsp. massiliense isolates and to detect the point mutations of 23S rRNA gene that confer a high level of resistance to clarithromycin. Subsp. massiliense strains occupying almost half of the clinical isolates can be simply identified, and their clarithromycin susceptibility can be rapidly determined. PMID:27514964

  4. Search for mycobacteria in interstitial cystitis using mycobacteria-specific DNA probes with signal amplification by polymerase chain reaction.

    PubMed

    Hampson, S J; Christmas, T J; Moss, M T

    1993-09-01

    The aetiology of interstitial cystitis is not known. Various infective agents have been postulated and although recognised as perpetrators of chronic inflammatory conditions, mycobacteria have never been satisfactorily excluded from interstitial cystitis. If present in interstitial cystitis tissue, mycobacteria exist either in very small numbers or in forms which contemporary staining techniques fail to recognise. We used a polymerase chain reaction with mycobacteria-specific DNA probes and found no evidence of mycobacterial involvement in 8 cases of proven interstitial cystitis.

  5. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia

    PubMed Central

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Introduction Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. Objective The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Methods Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan–Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Results Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1 × 10−3 for precursor B-cell acute lymphoblastic leukemia and 1 × 10−2 for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1% ± 5.6% versus 41.7% ± 17.3%, respectively; p-value = 0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Conclusion Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. PMID:26670399

  6. Semiquantification of circulating hepatocellular carcinoma cells by reverse transcriptase polymerase chain reaction.

    PubMed Central

    Wong, I. H.; Leung, T.; Ho, S.; Lau, W. Y.; Chan, M.; Johnson, P. J.

    1997-01-01

    Hepatocellular carcinoma (HCC) is one of the most common and rapidly fatal malignancies worldwide. Treatment options are severely limited by the frequent presence of metastases. If hepatocyte-specific mRNAs are detected in the circulation, it is possible to infer the presence of circulating, presumably malignant, liver cells. If these can be quantified, it is possible to predict the likelihood of haematogenous metastasis. In this investigation, we have attempted to gain an index of the mass of circulating HCC cells (with reference to the number of hepatoblastoma cells) by measuring the amounts of PCR products for albumin (alb) mRNA and alpha-fetoprotein (afp) mRNA by reverse transcriptase polymerase chain reaction (RT-PCR) and Southern blot analysis. For calibration, total RNA from 1-10(6) HepG2 cells was mixed with total RNA from 10(6) normal peripheral mononuclear cells. A linear relationship was demonstrated between the amount of alb- or afp PCR product and the level of HepG2 total RNA spiked. The assay is sensitive down to a detection level of one HepG2 cell. Alb mRNA was detected in 50% of 18 normal subjects and afp mRNA in only two normal subjects. The alb mRNA cut-off level for the normal was exceeded by seven normal subjects and 34 out of 64 HCC patients, and that for afp mRNA was exceeded by six HCC patients but none of the normal subjects. The level of alb mRNA detected was not linearly proportional to the amount of afp mRNA detected in peripheral blood of the same patients, suggesting heterogeneous expression of alb and afp genes in different circulating tumour cells. In addition, no significant linear association between the levels of afp mRNA and serum AFP was observed. Semiquantification of both mRNA markers for HCC cell detection may prove useful in prediction of metastases. Images Figure 1 Figure 2 Figure 5 Figure 6 PMID:9303362

  7. Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications.

    PubMed

    Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai

    2013-11-19

    Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA

  8. Three-dimensional on-chip continuous-flow polymerase chain reaction employing a single heater.

    PubMed

    Wu, Wenming; Lee, Nae Yoon

    2011-06-01

    Multi-step temperature control in a polymerase chain reaction (PCR) is a limiting factor in device miniaturization and portability. In this study, we propose the fabrication of a three-dimensional (3D) microdevice employing a single heater to minimize temperature control required for an on-chip continuous-flow PCR as well as the overall footprint by stacking the device in multi-layers. Two poly(dimethylsiloxane) (PDMS) layers with differing thicknesses are vertically stacked with their microchannel-engraved sides facing down. Through-holes are made in the thicker PDMS layer, which is sandwiched between a glass substrate at the bottom and the thinner PDMS layer at the top. In this way, a fluidic conduit is realized in a 3D configuration. The assembled 3D microdevice is then placed onto a heater glass-side down. The interface of the two PDMS layers displays a relatively lower temperature than that of the PDMS and glass layers due to the low thermal conductivity of the PDMS and its physical distance from the heater. The denaturation temperature can be controlled by adjusting the temperature of the heater, while the annealing/extension temperature can be controlled automatically by molding the thicker bottom PDMS layer into the appropriate thickness calculated using a numerical derivation proposed in this study. In this way, a cumbersome temperature measurement step is eliminated. DNA amplification was successfully carried out using the proposed 3D fluidic microdevice, and the intensity of the resulting amplicon was comparable to that obtained using a thermal cycler. This novel concept of adopting a single heating source greatly simplifies the temperature control issue present in an on-chip continuous-flow PCR. It also allows the use of a commercialized hot plate as a potential heat source, paving the way for device miniaturization and portability in a highly cost-effective manner. In this study, a simple and facile technique to make arrays of through-holes for the

  9. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene.

    PubMed

    Brakstad, O G; Aasbakk, K; Maeland, J A

    1992-07-01

    Synthetic oligonucleotide primers of 21 and 24 bases, respectively, were used in the polymerase chain reaction (PCR) to amplify a sequence of the nuc gene, which encodes the thermostable nuclease of Staphylococcus aureus. A DNA fragment of approximately 270 bp was amplified from lysed S. aureus cells or isolated DNA. The PCR product was detected by agarose gel electrophoresis or Southern blot analysis by using a 33-mer internal nuc gene hybridization probe. With S. aureus cells the lower detection limit was less than 10 CFU, and with the isolated target the lower detection limit was 0.69 pg of DNA. The primers recognized 90 of 90 reference or clinical S. aureus strains. Amplification was not recorded when 80 strains representing 16 other staphylococcal species were tested or when 20 strains representing 9 different nonstaphylococcal species were tested. Some of the non-S. aureus staphylococci produced thermostable nucleases but were PCR negative. The PCR product was generated when in vitro-cultured S. aureus was used to prepare simulated clinical specimens of blood, urine, cerebrospinal fluid, or synovial fluid. No PCR product was generated when the sterile body fluids were tested. However, the sensitivity of the PCR was reduced when S. aureus in blood or urine was tested in comparison with that when bacteria in saline were tested. With the bacteria in blood, the detection limit of the PCR was 10(3) CFU. A positive PCR result was recorded when a limited number of clinical samples from wounds verified to be infected with S. aureus were tested, while the PCR product was not detected in materials from infections caused by other bacteria. Generation of PCR products was not affected by exposure of S. aureus to bactericidal agents, including cloxacillin and gentamicin, prior to testing, but was affected by exposure to UV radiation. The PCR for amplification of the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical

  10. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    PubMed

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  11. [Comparison of direct microscopy, culture and polymerase chain reaction methods for the diagnosis of cutaneous leishmaniasis].

    PubMed

    Ertabaklar, Hatice; Özlem Çalışkan, Serçin; Boduç, Erengül; Ertuğ, Sema

    2015-01-01

    Cutaneous leishmaniasis (CL) is an endemic disease especially in Southeastern Anatolia of Turkey and recently shows a trend for spread to other regions of the country including the Aegean region. The diagnosis of CL is based on combined evaluation of epidemiological data with the clinical symptoms and laboratory findings. Direct microscopic examination and culture methods are mainly used in the routine diagnosis of CL, while molecular methods are mainly used for research. The aim of this study was to detect the presence of Leishmania spp. in samples obtained from CL-suspected patients by using direct microscopy, culture and polymerase chain reaction (PCR) methods and to compare the results. A total of 55 patients who were admitted to Parasitology Laboratory of Adnan Menderes University Hospital, Aydin (located at Aegean region in Turkey), between 2012-2014 were included in the study. Smear preparations from the skin lesions of cases were fixed and stained with Giemsa, and the presence of amastigote forms were evaluated by direct microscopy. NNN medium was used for the cultivation of samples. Total genomic DNA of Leishmania from the samples were extracted with a commercial kit (NucleoSpin Tissue(®) Kit, Macherey-Nagel, Germany) and PCR was performed by using 13A and 13B primers to amplify the 116 base pair fragment of Leishmania spp. specific kinetoplast DNA. Amastigotes were observed in 29 (53%) of the 55 samples by direct microscopy, promastigotes were detected among 34 (62%) samples in culture, and parasite-specific amplicons were revealed in 30 (55%) samples by PCR. All assays were positive in 24 patients while in 18 patients all of the tests yielded negative results. Thirty-seven (67%) out of 55 cases were diagnosed as CL when reactivity in at least one of these three methods were considered as positive. Accordingly the positivity rates of the methods were 78.4% (29/37) for direct microscopy, 92% (34/37) for culture and 81.1% (30/37) for PCR in CL

  12. Quantitative Polymerase Chain Reaction Analysis of the Mouse Cyp2j Subfamily: Tissue Distribution and Regulation.

    PubMed

    Graves, Joan P; Gruzdev, Artiom; Bradbury, J Alyce; DeGraff, Laura M; Li, Huiling; House, John S; Hoopes, Samantha L; Edin, Matthew L; Zeldin, Darryl C

    2015-08-01

    Members of the cytochrome P450 CYP2J subfamily are expressed in multiple tissues in mice and humans. These enzymes are active in the metabolism of fatty acids to generate bioactive compounds. Herein we report new methods and results for quantitative polymerase chain reaction (qPCR) analysis for the seven genes (Cyp2j5, Cyp2j6, Cyp2j8, Cyp2j9, Cyp2j11, Cyp2j12, and Cyp2j13) of the mouse Cyp2j subfamily. SYBR Green primer sets were developed and compared with commercially available TaqMan primer/probe assays for specificity toward mouse Cyp2j cDNA, and analysis of tissue distribution and regulation of Cyp2j genes. Each TaqMan primer/probe set and SYBR Green primer set were shown to be specific for their intended mouse Cyp2j cDNA. Tissue distribution of the mouse Cyp2j isoforms confirmed similar patterns of expression between the two qPCR methods. Cyp2j5 and Cyp2j13 were highly expressed in male kidneys, and Cyp2j11 was highly expressed in both male and female kidneys. Cyp2j6 was expressed in multiple tissues, with the highest expression in the small intestine and duodenum. Cyp2j8 was detected in various tissues, with highest expression found in the skin. Cyp2j9 was highly expressed in the brain, liver, and lung. Cyp2j12 was predominately expressed in the brain. We also determined the Cyp2j isoform expression in Cyp2j5 knockout mice to determine whether there was compensatory regulation of other Cyp2j isoforms, and we assessed Cyp2j isoform regulation during various inflammatory models, including influenza A, bacterial lipopolysaccharide, house dust mite allergen, and corn pollen. Both qPCR methods detected similar suppression of Cyp2j6 and Cyp2j9 during inflammation in the lung.

  13. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods

    PubMed Central

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Merialdi, Giuseppe

    2016-01-01

    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  14. A fast-and-robust profiler for improving polymerase chain reaction diagnostics.

    PubMed

    Besseris, George J

    2014-01-01

    Polymerase chain reaction (PCR) is an in vitro technology in molecular genetics that progressively amplifies minimal copies of short DNA sequences in a fast and inexpensive manner. However, PCR performance is sensitive to suboptimal processing conditions. Compromised PCR conditions lead to artifacts and bias that downgrade the discriminatory power and reproducibility of the results. Promising attempts to resolve the PCR performance optimization issue have been guided by quality improvement tactics adopted in the past for industrial trials. Thus, orthogonal arrays (OAs) have been employed to program quick-and-easy structured experiments. Profiling of influences facilitates the quantification of effects that may counteract the detectability of amplified DNA fragments. Nevertheless, the attractive feature of reducing greatly the amount of work and expenditures by planning trials with saturated-unreplicated OA schemes is known to be relinquished in the subsequent analysis phase. This is because of an inherent incompatibility of ordinary multi-factorial comparison techniques to convert small yet dense datasets. Treating unreplicated-saturated data with either the analysis of variance (ANOVA) or regression models destroys the information extraction process. Both of those mentioned approaches are rendered blind to error since the examined effects absorb all available degrees of freedom. Therefore, in lack of approximating an experimental uncertainty, any outcome interpretation is rendered subjective. We propose a profiling method that permits the non-linear maximization of amplicon resolution by eliminating the necessity for direct error estimation. Our approach is distribution-free, calibration-free, simulation-free and sparsity-free with well-known power properties. It is also user-friendly by promoting rudimentary analytics. Testing our method on published amplicon count data, we found that the preponderant effect is the concentration of MgCl2 (p<0.05) followed by the

  15. One-heater flow-through polymerase chain reaction device by heat pipes cooling

    PubMed Central

    Chen, Jyh Jian; Liao, Ming Huei; Li, Kun Tze; Shen, Chia Ming

    2015-01-01

    This study describes a novel microfluidic reactor capable of flow-through polymerase chain reactions (PCR). For one-heater PCR devices in previous studies, comprehensive simulations and experiments for the chip geometry and the heater arrangement were usually needed before the fabrication of the device. In order to improve the flexibility of the one-heater PCR device, two heat pipes with one fan are used to create the requisite temperature regions in our device. With the integration of one heater onto the chip, the high temperature required for the denaturation stage can be generated at the chip center. By arranging the heat pipes on the opposite sides of the chip, the low temperature needed for the annealing stage is easy to regulate. Numerical calculations and thermal measurements have shown that the temperature distribution in the five-temperature-region PCR chip would be suitable for DNA amplification. In order to ensure temperature uniformity at specific reaction regions, the Re of the sample flow is less than 1. When the microchannel width increases and then decreases gradually between the denaturation and annealing regions, the extension region located in the enlarged part of the channel can be observed numerically and experimentally. From the simulations, the residence time at the extension region with the enlarged channel is 4.25 times longer than that without an enlarged channel at a flow rate of 2 μl/min. The treated surfaces of the flow-through microchannel are characterized using the water contact angle, while the effects of the hydrophilicity of the treated polydimethylsiloxane (PDMS) microchannels on PCR efficiency are determined using gel electrophoresis. By increasing the hydrophilicity of the channel surface after immersing the PDMS substrates into Tween 20 (20%) or BSA (1 mg/ml) solutions, efficient amplifications of DNA segments were proved to occur in our chip device. To our knowledge, our group is the first to introduce heat pipes into

  16. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    PubMed Central

    Thabit, Abrar K; Nicolau, David P

    2016-01-01

    Background Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated. Aim We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day), length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting. Methods Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest. Results The most common ribotypes were 027 (38%), 014/020 (21%), and 106/174 (21%). Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2). The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively). Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6). Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters), although the degree of nausea/vomiting did not differ between the three groups (P=0.3). A serum creatinine level ≥1.5 times the premorbid level was seen in only three patients, each infected with a different ribotype. Conclusion Although these data provide a baseline assessment of outcomes to aid in the design of future studies, the diversity of C. difficile ribotypes within the population must be considered, and additional work with other ribotypes

  17. Elimination of contaminating DNA within polymerase chain reaction reagents: implications for a general approach to detection of uncultured pathogens.

    PubMed Central

    Meier, A; Persing, D H; Finken, M; Böttger, E C

    1993-01-01

    Analysis based on comparisons of 16S rRNA sequences provides a rapid and reliable approach to identifying human pathogens. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, bacterial 16S ribosomal DNA sequences of virtually any member of the eubacterial kingdom can be amplified by polymerase chain reaction and subsequently analyzed by sequence determination. Indeed, automated systems for broad-range amplification, sequencing, and data analysis are now feasible and may form the basis of the next generation of automated microbial identification systems. However, identification of pathogens by this strategy is hampered by the frequent contamination of reagents used for the amplification reaction, in particular Taq polymerase, with exogenous bacterial DNA. Here, we describe detailed investigations on the use of 8-methoxypsoralen and long-wave UV light to eliminate contaminating DNA in polymerase chain reaction reagents. The clinical utility of the developed procedure was demonstrated in a case of paucibacillary osteomyelitis, for which no specific bacterial agent had been cultured. Images PMID:8458958

  18. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  19. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    PubMed

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  20. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    PubMed

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  1. Reduction in plasma human immunodeficiency virus ribonucleic acid after dideoxynucleoside therapy as determined by the polymerase chain reaction.

    PubMed

    Holodniy, M; Katzenstein, D A; Israelski, D M; Merigan, T C

    1991-11-01

    Cell-free HIV RNA in plasma was detected and quantitated after antiviral therapy by the polymerase chain reaction. RNA was extracted from plasma, reverse transcribed to cDNA, amplified by polymerase chain reaction, and quantitated by absorbance based on an enzyme-linked affinity assay. 72 HIV antibody-positive subjects had one plasma sample taken. 39 who were not receiving antiretroviral therapy at the time had a mean plasma HIV RNA copy number of 690 +/- 360 (mean +/- SEM) per 200 microliters of plasma, while 33 subjects who had been receiving zidovudine therapy for a minimum of 3 mo had a mean copy number of 134 +/- 219 (P less than 0.05). 27 additional HIV antibody-positive patients had two plasma samples taken before and 1 mo after initiating dideoxynucleoside therapy. Plasma HIV RNA copy number fell from 540 +/- 175 to 77 +/- 35 (P less than 0.05). Finally, nine of these subjects had two baseline samples obtained before initiating therapy and two posttreatment samples 1 and 2 mo after therapy was begun. Mean plasma RNA copy number declined from 794 +/- 274 to less than 40 (below the lower limit of sensitivity) after 1 mo of therapy, with suppression maintained after 2 mo of therapy. These results suggest that gene amplification can be used to detect and quantitate changes in plasma HIV RNA after dideoxynucleoside therapy. Plasma HIV polymerase chain reaction may be a more sensitive marker to monitor antiviral therapy, particularly in asymptomatic patients where measurement of p24 antigen or quantitative plasma cultures are negative.

  2. Escherichia coli Vertebral Osteomyelitis Diagnosed According to Broad-range 16S rRNA Gene Polymerase Chain Reaction (PCR).

    PubMed

    Shibata, Satoshi; Tanizaki, Ryutaro; Watanabe, Koji; Makabe, Kenta; Shoda, Naoki; Kutsuna, Satoshi; Nagamatsu, Maki; Oka, Shinichi; Ohmagari, Norio

    2015-01-01

    Identifying the causative agent of pyogenic osteomyelitis is often challenging, especially when antibiotics are administered before a biopsy. We herein present a case of osteomyelitis in the cervical vertebrae presenting with progressive paralytic symptoms, in which we successfully identified Escherichia coli from a biopsy specimen using broad-range 16S rRNA gene polymerase chain reaction (PCR) even though sensitive antibiotics had been used for more than 50 days before the biopsy. Broad-range 16S rRNA gene PCR is a useful diagnostic method, especially when prebiopsy antibiotics are unavoidably used for a clinically unstable state.

  3. Ribosomal RNA-based panbacterial polymerase chain reaction for rapid diagnosis of septicaemia in Intensive Care Unit patients.

    PubMed

    Gupta, Mahua Das; Kaur, Harsimran; Ray, Pallab; Gautam, Vikas; Puri, G D

    2016-01-01

    Early diagnosis and treatment of sepsis by appropriate antibiotics is of utmost importance. Therefore, we evaluated 16S rRNA panbacterial polymerase chain reaction (PCR) for rapid diagnosis of sepsis in 49 adult patients in Intensive Care Units (ICUs) and compared it with an automated blood culture. 8 ml of 10 ml blood collected was inoculated into BACTEC® aerobic bottle and the remaining 2 ml was used for DNA extraction and PCR. 109 of 115 (93%) episodes of suspected sepsis showed concordant results between automated culture and PCR. Six episodes were positive by PCR only. Panbacterial PCR reduces turnaround time with rapid differentiation between systemic inflammatory response syndrome and sepsis. PMID:27080778

  4. Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.

    PubMed

    Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W

    2014-12-01

    We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration.

  5. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    PubMed

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  6. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    PubMed

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola.

  7. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  8. The Importance of IgG Avidity and the Polymerase Chain Reaction in Treating Toxoplasmosis during Pregnancy: Current Knowledge

    PubMed Central

    Bortoletti Filho, João; Carvalho, Natália da Silva; Helfer, Talita Micheletti; Nogueira Serni, Priscila de Oliveira; Nardozza, Luciano Marcondes Machado; Moron, Antonio Fernandes

    2013-01-01

    A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR) for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary. PMID:24191157

  9. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided. PMID:27408919

  10. Specific discrimination of chicken DNA from other poultry DNA in processed foods using the polymerase chain reaction.

    PubMed

    Fujimura, Tatsuya; Matsumoto, Takashi; Tanabe, Soichi; Morimatsu, Fumiki

    2008-03-01

    In the present study, specific discrimination of chicken DNA contamination in processed foods using the polymerase chain reaction was investigated. The primer pair was designed to amplify a 102-bp fragment of the chicken mitochondrial 16S ribosomal RNA gene. While the DNA from chicken meat was amplified, the DNA from other poultry meat, mammalian meat, fish, shellfish, and cereals was not amplified. The primer amplified DNA fragments derived from model processed and nonprocessed food samples containing 0.001, 0.01, 0.1, 1, 10, and 100% chicken.

  11. Total integrated slidable and valveless solid phase extraction-polymerase chain reaction-capillary electrophoresis microdevice for mini Y chromosome short tandem repeat genotyping.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Sim, Jeong Eun; Woo, Kwang Man; Kim, Do Hyun; Im, Sung Gap; Seo, Tae Seok

    2016-04-15

    A fully integrated slidable and valveless microsystem, which performs solid phase DNA extraction (SPE), micro-polymerase chain reaction (μPCR) and micro-capillary electrophoresis (μCE) coupled with a portable genetic analyser, has been developed for forensic genotyping. The use of a slidable chip, in which a 1 μL-volume of the PCR chamber was patterned at the center, does not necessitate any microvalves and tubing systems for fluidic control. The functional micro-units of SPE, μPCR, and μCE were fabricated on a single glass wafer by conventional photolithography, and the integrated microdevice consists of three layers: from top to bottom, a slidable chip, a channel wafer in which a SPE chamber, a mixing microchannel, and a CE microchannel were fabricated, and a Ti/Pt resistance temperature detector (RTD) wafer. The channel glass wafer and the RTD glass wafer were thermally bonded, and the slidable chip was placed on the designated functional unit. The entire process from the DNA extraction using whole human blood sample to identification of target Y chromosomal short tandem repeat (STR) loci was serially carried out with simply sliding the slidable chamber from one to another functional unit. Monoplex and multiplex detection of amelogenin and mini Y STR loci were successfully analysed on the integrated slidable SPE-μPCR-μCE microdevice by using 1 μL whole human blood within 60 min. The proposed advanced genetic analysis microsystem is capable of point-of-care DNA testing with sample-in-answer-out capability, more importantly, without use of complicated microvalves and microtubing systems for liquid transfer.

  12. Tandem competitive polymerase chain reaction (TC-PCR): a method for determining ratios of RNA and DNA templates.

    PubMed

    Virdi, A S; Krishna, S; Sykes, B C

    1992-10-01

    A sensitive and accurate method for determining the ratios of RNA and DNA templates by polymerase chain reaction (PCR) is presented. A common competitor containing tandemly arranged internal standards differing from the target template by the presence of different restriction enzyme sites is coamplified with the target templates under identical conditions. Products from each template and internal standard are identified by the band pattern after digestion with the restriction enzyme. As the amount of the common competitor is kept constant for all target templates, the ratio of PCR products from the templates reflects their ratio in the reaction mix before amplification. The method was used to study the relative abundance of mRNA for the pro-alpha1 and pro-alpha2 chains of type I collagen and for estimating disturbances of normal ratio in the inherited bone disorder, osteogenesis imperfecta.

  13. Is real-time polymerase chain reaction (PCR) more useful than a conventional PCR for the clinical management of leishmaniasis?

    PubMed

    Antinori, Spinello; Calattini, Sara; Piolini, Roberta; Longhi, Erika; Bestetti, Giovanna; Cascio, Antonio; Parravicini, Carlo; Corbellino, Mario

    2009-07-01

    It is currently unknown if the use of a real-time polymerase chain reaction (PCR) adds value to the diagnosis and follow-up prognosis of patients affected by leishmaniasis. We performed a study using a real-time PCR directed against the alpha-polymerase gene and a semiquantitative PCR that target the SSU ribosomal RNA (rRNA) gene as control for the diagnosis and quantification of parasites in patients with visceral (VL) and cutaneous (CL) leishmaniasis. Our single copy real-time PCR missed one diagnosis of VL compared with the conventional PCR, whereas both PCR methods were able to detect Leishmania parasites in CL. Under anti-leishmania treatment the kinetics of parasitemia were comparable with the two methods. The real-time PCR directed against alpha-polymerase of Leishmania despite being able to make a more accurate quantification of parasites does not add to the decision-making management compared with a semiquantitative PCR, and it is comparatively expensive.

  14. Polymerase Chain Reaction (PCR) Versus Bacterial Culture in Detection of Organisms in Otitis Media with Effusion (OME) in Children.

    PubMed

    Aly, Balegh H; Hamad, Mostafa S; Mohey, Mervat; Amen, Sameh

    2012-03-01

    The aim of this study was to compare between polymerase chain reaction (PCR) and bacterial culture in detection of Streptococcus Pneumonia and M. Catarrhalis in otitis media with effusion (OME) in children. Fifty patients having OME were included in this study between 2003 and 2008. Myringotomy and tympanostomy tube insertion were done in every patient and the middle ear effusion samples were aspirated. The samples were subjected to bacteriological study in the form of culture and molecular study in the form of PCR using JM201/202-204 primer probe set for both S. pneumonia and M. catarrhalis. The results of Bacterial cultures are as follows: five cases (10%) were culture positive for S. pneumonia. Six cases (12%) were culture positive for M. catarrhalis. Only one case (2%) showed positively for both S. pneumonia and M. catarrhalis. Polymerase chain reaction test shows that 18 cases (36%) were positive for S. pneumonia, 22 cases (44%) were positive for M. catarrhalis, 6 cases (12%) were positive for both organism and 4 cases (8%) were negative. The difference between the proportion of culture positive and PCR positive specimens for both organisms individually and collectively was significant (P < 0.001). From our study we can conclude that PCR is more accurate than bacterial culture in detection of organisms in middle ear fluid in OME and that M. catarrhalis plays a significant rule in OME as it is the sole organism identified more than the other one by PCR.

  15. Interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction as a diagnostic aid for synovial sarcoma.

    PubMed Central

    Shipley, J.; Crew, J.; Birdsall, S.; Gill, S.; Clark, J.; Fisher, C.; Kelsey, A.; Nojima, T.; Sonobe, H.; Cooper, C.; Gusterson, B.

    1996-01-01

    Identification of the t(X;18)(p11.2;q11.2) that is associated with a high proportion of synovial sarcoma can be a useful diagnostic aid. The translocation results in fusion of the SYT gene on chromosome 18 to either the SSX1 or the SSX2 gene, two homologous genes within Xp11.2. Two-color interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction were assessed as approaches to identify the rearrangement in well characterized cases. The presence of the translocation, and the specific chromosome X gene disrupted, were inferred from the configuration of signals from chromosome-specific centromere probes, paints, and markers flanking each gene in preparations of interphase nuclei. Rearrangement was found in two cell lines and eight of nine tumor samples, including analysis of five touch imprints. This was consistent with cytogenetic data in four cases and reverse transcription polymerase chain reaction analysis using primers known to amplify both SYT-SSX1 and SYT-SSX2 transcripts. The transcripts were distinguished by restriction with LspI and SmaI. Contrary to previous suggestions, there was no obvious correlation between histological subtype and involvement of the SSX1 or SSX2 gene. These approaches could also be applied to the identification of tumor-free margins and metastatic disease. Images Figure 1 Figure 3 PMID:8579118

  16. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    PubMed

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis.

  17. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  18. A polymerase chain reaction assay for non-random X chromosome inactivation identifies monoclonal endometrial cancers and precancers.

    PubMed

    Mutter, G L; Chaponot, M L; Fletcher, J A

    1995-02-01

    We hypothesize that endometrial carcinoma and their precursors share a monoclonal growth pattern and tested this thesis with archival paraffin-embedded tissues using a polymerase chain reaction-based assay for non-random X chromosome inactivation. Of the 10 well-differentiated endometrial adenocarcinoma cases with heterozygous markers (HUMARA, X-linked androgen receptor gene), 9 had skewed X inactivation consistent with a monoclonal process, and one contained a structurally altered HUMARA gene. X inactivation skewing similar to that of the tumor was seen in matched control polyclonal tissues of 4 (of 9) cases, caused by the small number of endometrial stem cells at the time of embryonic X inactivation. When the polymerase chain reaction assay was applied to four potential endometrial precancers (atypical endometrial hyperplasia) and matched control tissues, two were inconclusive, and two were found to be monoclonal. We conclude that 1) it is essential to include polyclonal control tissues in X inactivation analyses to determine whether skewing is a specific indicator of monoclonality; and 2) endometrial adenocarcinomas and some putative precancers, atypical endometrial hyperplasia, are monoclonal.

  19. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB.

  20. [Detection of the genetically modified organisms in genetically modified soybean and maize by polymerase chain reaction method].

    PubMed

    Mao, Deqian; Mu, Weipeng; Yang, Xiaoguang

    2002-06-01

    A method for the detection of the (genetically modified organism GMOs) in genetically modified soybean (Round-up Ready soybean, RR soybean) and maize(Bt-176 maize) is described. The polymerase chain reaction (PCR) method is discussed with the genetically modified soybean and maize whose contents are known. The detection limit can be 0.1%, that is to say, we can detect the GMO in the food whose content is only 0.1%, the detection method is just a screening method. The procedure includes: (1) extraction of genomic DNA of maize and soybean, (2) amplification of the inserted genes, CaMV35S promoter and the NOS terminator inserted by means of the polymerase chain reaction (PCR) method, (3) amplification of the specific genes of maize and soybean in order to determine that the samples are maize and soybean, (4) characterization and confirmation of the PCR products by restriction enzyme analysis and the electrophoresis on agarose gel. The RR soybean contains CaMV35S promoter and NOS terminator, and the Bt-176 maize contains only CaMV35S promoter. Due to the high content of the starch in maize, the effect of the electrophororesis is not so good as of the soybean's.

  1. [The experience of implementation of REP-u RAPD-polymerase chain reaction in epidemiologic characteristic of nosocomial isolates Pseudomonas aeruginosa].

    PubMed

    Kuznetsova, M V; Maksimova, A V; Karpunina, T I

    2015-03-01

    The article presents comparative evaluation of diagnostic value of technique REP- u RAPD-polymerase chain reaction applied under genetic typing of clinical isolates of Pseudomonas Aeruginosa. The strains are isolated in different hospital departments of medical institutions in adult (8 medical institutions; n = 145) and children (5 medical institutions; n = 151) medical networks. The results of study demonstrated different boundary capacity of three reactions. The Simpson discrimination index made up to 0.993, 0.875 and 0.639 for RAPD-, ERIC- and BOX-polymerase chain reaction correspondingly. The RAPD-polymerase chain reaction makes it possible to detect individual characteristics of strains. Out of two alternatives the REP-polymerase chain reaction demonstrated its advantage, besides only with one primer ERIC2. The BOX-polymerase chain reaction has a least discriminating capacity under typing of isolates P. aeruginosa, detecting only species' characteristics. The clinical strains P. aeruginosa are distributed on 24 genome groups and 52 isolates had individual genotypes. The evaluation of results of genetic typing permitted to point out both similarity of tendencies in propagation of strains of P. aeruginosa among hospitalized adults and adolescents and specificity of detection in neonatal clinics. It is obvious that hospitals of different profiles, including departments of reanimation and intensive therapy represent specific ecological environment significantly different in its level of endogenous and exogenous infection.

  2. Can rapid integrated polymerase chain reaction-based diagnostics for gastrointestinal pathogens improve routine hospital infection control practice? A diagnostic study.

    PubMed Central

    Pankhurst, Louise; Macfarlane-Smith, Louissa; Buchanan, James; Anson, Luke; Davies, Kerrie; O'Connor, Lily; Ashwin, Helen; Pike, Graham; Dingle, Kate E; Peto, Timothy Ea; Wordsworth, Sarah; Walker, A Sarah; Wilcox, Mark H; Crook, Derrick W

    2014-01-01

    BACKGROUND Every year approximately 5000-9000 patients are admitted to a hospital with diarrhoea, which in up to 90% of cases has a non-infectious cause. As a result, single rooms are 'blocked' by patients with non-infectious diarrhoea, while patients with infectious diarrhoea are still in open bays because of a lack of free side rooms. A rapid test for differentiating infectious from non-infectious diarrhoea could be very beneficial for patients. OBJECTIVE To evaluate MassCode multiplex polymerase chain reaction (PCR) for the simultaneous diagnosis of multiple enteropathogens directly from stool, in terms of sensitivity/specificity to detect four common important enteropathogens: Clostridium difficile, Campylobacter spp., Salmonella spp. and norovirus. DESIGN A retrospective study of fixed numbers of samples positive for C. difficile (n = 200), Campylobacter spp. (n = 200), Salmonella spp. (n = 100) and norovirus (n = 200) plus samples negative for all these pathogens (n = 300). Samples were sourced from NHS microbiology laboratories in Oxford and Leeds where initial diagnostic testing was performed according to Public Health England methodology. Researchers carrying out MassCode assays were blind to this information. A questionnaire survey, examining current practice for infection control teams and microbiology laboratories managing infectious diarrhoea, was also carried out. SETTING MassCode assays were carried out at Oxford University Hospitals NHS Trust. Further multiplex assays, carried out using Luminex, were run on the same set of samples at Leeds Teaching Hospitals NHS Trust. The questionnaire was completed by various NHS trusts. MAIN OUTCOME MEASURES Sensitivity and specificity to detect C. difficile, Campylobacter spp., Salmonella spp., and norovirus. RESULTS Nucleic acids were extracted from 948 clinical samples using an optimised protocol (200 Campylobacter spp., 199 C. difficile, 60 S. enterica, 199 norovirus and 295 negative

  3. Triplex DNA: A new platform for polymerase chain reaction – based biosensor

    PubMed Central

    Li, Yubin; Miao, Xiangmin; Ling, Liansheng

    2015-01-01

    Non - specific PCR amplification and DNA contamination usually accompany with PCR process, to overcome these problems, here we establish a sensor for thrombin by sequence - specific recognition of the PCR product with molecular beacon through triplex formation. Probe A and probe B were designed for the sensor, upon addition of thrombin, two probes hybridized to each other and the probe B was extended in the presence of Klenow Fragment polymerase and dNTPs. The PCR amplification occurred with further addition of Taq DNA Polymerase and two primers, the PCR product was recognized by molecular beacon through triplex formation. The fluorescence intensity increased with the logarithm of the concentration of thrombin over the range from 1.0 × 10−12 M to 1.0 × 10−7 M, with a detection limit of 261 fM. Moreover, the effect of DNA contamination and non - specific amplification could be ignored completely in the proposed strategy. PMID:26268575

  4. Triplex DNA: A new platform for polymerase chain reaction-based biosensor.

    PubMed

    Li, Yubin; Miao, Xiangmin; Ling, Liansheng

    2015-01-01

    Non-specific PCR amplification and DNA contamination usually accompany with PCR process, to overcome these problems, here we establish a sensor for thrombin by sequence-specific recognition of the PCR product with molecular beacon through triplex formation. Probe A and probe B were designed for the sensor, upon addition of thrombin, two probes hybridized to each other and the probe B was extended in the presence of Klenow Fragment polymerase and dNTPs. The PCR amplification occurred with further addition of Taq DNA Polymerase and two primers, the PCR product was recognized by molecular beacon through triplex formation. The fluorescence intensity increased with the logarithm of the concentration of thrombin over the range from 1.0 × 10(-12) M to 1.0 × 10(-7) M, with a detection limit of 261 fM. Moreover, the effect of DNA contamination and non - specific amplification could be ignored completely in the proposed strategy.

  5. Universal molecular beacon-based tracer system for real-time polymerase chain reaction.

    PubMed

    Li, Xiaomin; Huang, Yong; Guan, Yuan; Zhao, Meiping; Li, Yuanzong

    2006-11-15

    DNA diagnostic has been moving from expensive, low-throughput, multistep methods to inexpensive, higher throughput, closed-tube, and automated methods. Fluorescence is the favored signaling technology for such assays. In this method, we describe a universal molecular beacon (U-MB) as the fluorescent tracer in the real-time PCR technique. A 5'-universal template primer (5'-UT primer) has been designed with a tail in complementary to the loop and 5'-side arm sequence of U-MB at the 5'-end of forward target specific primer. As PCR cycles increase, a new DNA fragment with a 5'-UT primer tail is synthesized, which is used as the template for next PCR cycle. As the reverse primer extends to the 5'-UT primer tail, the U-MB hybridized is displaced and the fluorescence from the fluorophore of the U-MB is quenched, indicating that the allele-specific PCR is in progress. This tracing system combined with an allele-specific reverse primer and vent (exo-) DNA polymerase, a polymerase that lacks 3'- to 5'-exonuclease activity, was used for the detection of point mutations of base G in codon 259 (AGA) of exon 7 of p53 gene on a panel of breast cancer individuals.

  6. Metal nanoparticle assisted polymerase chain reaction for strain typing of Salmonella Typhi.

    PubMed

    Rehman, Asma; Sarwar, Yasra; Raza, Zulfiqar Ali; Hussain, Syed Zajif; Mustafa, Tanveer; Khan, Waheed S; Ghauri, Muhammad Afzal; Haque, Abdul; Hussain, Irshad

    2015-11-01

    Salmonella enterica serotype Typhi (S. Typhi) is the causative agent of typhoid fever and remains a major health threat in most of the developing countries. The prompt diagnosis of typhoid directly from the patient's blood requires high level of sensitivity and specificity. Some of us were the first to report PCR based diagnosis of typhoid. This approach has since then been reported by many scientists using different genomic targets. Since the number of bacteria circulating in the blood of a patient can be as low as 0.3 cfu ml(-1), there is always a room for improvement in diagnostic PCR. In the present study, the role of different types of nanoparticles was investigated to improve the existing PCR based methods for diagnosis and strain typing of S. Typhi (targeting Variable Number of Tandem Repeats [VNTR]) by using optimized PCR systems. Three different types of nanoparticles were used i.e., citrate stabilized gold nanoparticles, rhamnolipid stabilized gold and silver nanoparticles, and magnetic iron oxide nanoparticles. The non-specific amplification was significantly reduced in VNTR typing when gold and silver nanoparticles were used in an appropriate concentration. More importantly, the addition of nanoparticles decreased the non-specificity to a significant level in the case of multiplex PCR thus further validating the reliability of PCR for the diagnosis of typhoid.

  7. Metal nanoparticle assisted polymerase chain reaction for strain typing of Salmonella Typhi.

    PubMed

    Rehman, Asma; Sarwar, Yasra; Raza, Zulfiqar Ali; Hussain, Syed Zajif; Mustafa, Tanveer; Khan, Waheed S; Ghauri, Muhammad Afzal; Haque, Abdul; Hussain, Irshad

    2015-11-01

    Salmonella enterica serotype Typhi (S. Typhi) is the causative agent of typhoid fever and remains a major health threat in most of the developing countries. The prompt diagnosis of typhoid directly from the patient's blood requires high level of sensitivity and specificity. Some of us were the first to report PCR based diagnosis of typhoid. This approach has since then been reported by many scientists using different genomic targets. Since the number of bacteria circulating in the blood of a patient can be as low as 0.3 cfu ml(-1), there is always a room for improvement in diagnostic PCR. In the present study, the role of different types of nanoparticles was investigated to improve the existing PCR based methods for diagnosis and strain typing of S. Typhi (targeting Variable Number of Tandem Repeats [VNTR]) by using optimized PCR systems. Three different types of nanoparticles were used i.e., citrate stabilized gold nanoparticles, rhamnolipid stabilized gold and silver nanoparticles, and magnetic iron oxide nanoparticles. The non-specific amplification was significantly reduced in VNTR typing when gold and silver nanoparticles were used in an appropriate concentration. More importantly, the addition of nanoparticles decreased the non-specificity to a significant level in the case of multiplex PCR thus further validating the reliability of PCR for the diagnosis of typhoid. PMID:26381602

  8. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  9. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus

    PubMed Central

    2010-01-01

    Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes. PMID:20534175

  10. COMPARISON OF THE TEMPORAL VARIABILITY OF ENTEROCOCCAL CLUSTERS IN IMPACTED STREAMS USING A MULTIPLEX POLYMERASE CHAIN REACTION PROCEDURE

    EPA Science Inventory

    Understanding how fecal indicator bacteria and/or fecal indicator genotypes vary over time is important to determine the sources of fecal contamination. Enterococcus is one of the two indicators recommended by the EPA to monitor freshwaters for fecal contamination. Along with E...

  11. Multiplex Polymerase Chain Reaction in the Horn Fly: Detection of Pyrethroid, Organophosphate and Cyclodiene Target Site Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The horn fly, Haematobia irritans irritans, is an important pest to the livestock industry that causes economic losses of approximately US$1 billion in the U.S. and a similar value in Latin America. Horn fly control efforts still relies mainly on direct application of insecticides although horn fly ...

  12. Initiation and elongation of polyribonucleotide chains on rat ventral-prostate chromatin transcribed by homologous ribonucleic acid polymerase B.

    PubMed Central

    Thomas, P; Davies, P; Griffiths, K

    1977-01-01

    The characteristics of initiation of RNA synthesis and the elongation of RNA chains on rat ventral-prostate chromatin by RNA polymerase B were investigated by two methods. 1. Initiation was carried out under low-salt conditions with three ribonucleoside triphosphates, and elongation was begun in the absence of reinitiation by the addition of the fourth ribonucleoside triphosphate and increasing the salt concentration. 2. Stable initiation complexes were formed by preincubation of enzyme with template at 37 degrees C, elongation was started by the addition of all four ribonucleoside triphosphates and reinitiation or spurious RNA synthesis was prevented by rifamycin AF/013. The latter method gave more reliable results. The dependence of those parameters on the androgenic status of the animal was studied. During the first 24h after castration, elongation was mainly affected, whereas after 72h a smaller number of initiation sites for RNA polymerase B on chromatin was evident. Considerable diurnal variations in the various parameters were observed. Changes in the relative concentrations of the chromatin-associated proteins were also observed after castration. In the rat ventral-prostate gland androgenic steroids may not only influence one stage of the transcriptional process, but may affect many factors involved in the control of gene expression. PMID:562164

  13. Analysis of DNA damage and repair in murine leukemia L1210 cells using a quantitative polymerase chain reaction assay.

    PubMed Central

    Kalinowski, D P; Illenye, S; Van Houten, B

    1992-01-01

    The polymerase chain reaction (PCR) represents an alternative to the current methods for investigating DNA damage and repair in specific genomic segments. In theory, any DNA lesion which blocks Taq polymerase can be measured by this assay. We used quantitative PCR (QPCR) to determine the lesion frequencies produced by cisplatin and ultraviolet light (UV) in a 2.3 kilobase (kb) segment of mitochondrial DNA and a 2.6 kb segment of the DHFR gene in mouse leukemia L1210 cells. The frequency of UV-induced lesions increased linearly with dose, and was 0.58 lesions/10 kb/10 J/m2 in the mitochondrial DNA, and 0.37 lesions/10 kb/10 J/m2 in the DHFR gene. With cisplatin, the lesion frequency also increased linearly with dose, and was 0.17 lesions/10 kb/10 microM in the DHFR gene, and 0.07 lesions/10 kb/10 microM in mitochondrial DNA. This result is contrary to that of Murata et al., 1990 (1), in which mitochondrial DNA received greater cisplatin damage than did nuclear DNA. Using PCR to measure the repair of UV-induced lesions in the DHFR gene segment, we observed that less than 10% of the lesions were removed by 4 h, but over 70% of the lesions were removed by 8 h. Repair of 43% of UV-induced lesions in mitochondrial DNA was also observed during a 24 h period. Images PMID:1630919

  14. Deletion screening at the hypoxanthine-guanine phosphoribosyltransferase locus in Chinese hamster cells using the polymerase chain reaction

    SciTech Connect

    Xu, Z.D.; Yu, Y.J.; Hsie, A.W.; Caskey, C.T.; Rossiter, B.; Gibbs, R.A. )

    1989-01-01

    We have developed a rapid screening method using the polymerase chain reaction (PCR) for detecting deletion mutations at the hypoxanthine-guanine phosphoribosyltransferase (hprt) locus in Chinese hamster cells. DNA was extracted from spontaneous and ultraviolet (UV) light- and X-ray-induced hprt-deficient mutants. Two primer sets were used to amplify 276 bp and 344 bp fragments containing the entire exon 3 and exon 9 coding sequence, respectively. The PCR was performed using Taq DNA polymerase for 40 cycles, and the PCR product was directly analyzed for the presence of the respective amplified DNA using electrophoresis on agarose gels stained with ethidium bromide. With this assay, we have analyzed 39 independently derived hprt-deficient mutants. Four of ten spontaneous mutants were found to have deletions in exon 9. UV light produced mutants with predominantly wild-type amplification patterns (10/14). X-ray induced mostly deletion patterns (11/15); six of these occurred only in exon 9, and five occurred in both exons 3 and 9. These observations are consistent with the classical notion that UV light induces predominantly missense mutations and X-ray produces a high proportion of deletion mutations. Deletion mutations occurred most frequently at the 3' end of the hprt gene, suggesting the possible existence of hot spots for deletions in this region. The PCR assay for deletion detection has the advantage that it can be completed in less than 4 hr without using radioisotopes. This assay should be useful for routine deletion screening.

  15. Electrochemical detection of point mutation based on surface hybridization assay conjugated allele-specific polymerase chain reaction.

    PubMed

    Huang, Yong; Zhu, Jing; Li, Guiyin; Chen, Zhencheng; Jiang, Jian-Hui; Shen, Guo-Li; Yu, Ru-Qin

    2013-04-15

    In this work, we developed an electrochemical detection method based on allele-specific polymerase chain reaction (AS-PCR) and surface hybridization assay technique for the point mutation detection. A high-fidelity Vent(R)™(exo⁻) DNA polymerase, which eliminated the 3'→5' proofreading exonuclease activity by genetical engineering, was used to discriminate and extend the detection probe that perfectly matched with mutant target DNA and generate a redox-active DNA replica which folded into a molecular beacon structure by intramolecular hybridization. After hybridized with capture probe modified on gold electrode by self-assembly reaction, the redox tags can be closed to electrode, resulting in a substantial current with the maximized sensitivity for point mutation analysis. However, when there is an allele mismatch in the wild target DNA, and so no the redox-active replica DNA can be obtained. In this case, no remarkable current signal can be trigged. The proposed approach has been successfully implemented for the identification of single base mutation at the -28 position in human β-globin gene with a detection limit of 0.5 fM, demonstrating that this method provides a highly specific, sensitive and cost-efficient approach for point mutation detection.

  16. Leishmania spp. identification by polymerase chain reaction-restriction fragment length polymorphism analysis and its applications in French Guiana.

    PubMed

    Simon, Stéphane; Veron, Vincent; Carme, Bernard

    2010-02-01

    Leishmania (Viannia) guyanensis was for many years the only species commonly identified in French Guiana, but precise species identifications were quite rare. We describe a new restriction fragment length polymorphism-polymerase chain reaction technique using a 615-bp fragment of the RNA polymerase II gene and 2 restriction enzymes, TspRI and HgaI. Seven reference strains (Leishmania (Leishmania) amazonensis, Leishmania (Viannia) lainsoni, Leishmania (Viannia) braziliensis, L. (V.) guyanensis, Leishmania (Viannia) naiffi, Leishmania (Leishmania) major, Leishmania (Leishmania) infantum) and 112 clinical samples from positive lesions were used for the development of the technique. The rates of positive species identification were 85.7% for punch skin biopsy specimens, 93.1% for positive Giemsa-stained smears, and 100% for positive culture supernatants. In the framework of cutaneous leishmaniasis species surveillance for the 2006 to 2008 period, parasite identification was carried out for 199 samples from different patients. The prevalence of the various Leishmania spp. was 84.4% for L. (V.) guyanensis, 8.0% for L. (V.) braziliensis, 5.0% for L. (L.) amazonensis, and 2.6% for L. (V.) lainsoni. L. (V.) braziliensis seems to be locally an emerging pathogen.

  17. Identification of goose, mule duck, chicken, turkey, and swine in foie gras by species-specific polymerase chain reaction.

    PubMed

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martín, Rosario

    2003-03-12

    A specific Polymerase Chain Reaction (PCR) has been developed for the identification of goose (Anser anser), mule duck (Anas platyrhynchos x Cairina moschata), chicken (Gallus gallus), turkey (Meleagris gallopavo), and swine (Sus scrofa domesticus) in foie gras. A forward common primer was designed on a conserved DNA sequence in the mitochondrial 12S ribosomal RNA gene (rRNA), and reverse primers were designed to hybridize on species-specific DNA sequences of each species considered. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose, mule duck, chicken, turkey, and swine in foie gras. Analysis of experimental mixtures demonstrated that the detection limit of the assay was approximately 1% for each species analyzed. This genetic marker can be very useful for the accurate identification of these species, avoiding mislabeling or fraudulent species substitution in foie gras.

  18. Development of a polymerase chain reaction assay for species identification of goose and mule duck in foie gras products.

    PubMed

    Rodrı X0301 Guez, Miguel A; Garcı X0301 A, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martı X0301 N, Rosario

    2003-12-01

    Polymerase chain reaction amplification of a conserved region of the α-actin gene has been used for the specific identification of goose (Anser anser) and mule duck (Anas platyrhynchos×Cairina moschata) foie gras. Universal primers were used for the amplification of a DNA fragment containing three introns and four exons of the α-actin gene in goose and mule duck. Sequence analysis of the amplified fragments was necessary for the design of forward species-specific primers in the goose and mule duck α-actin genes. The use of species-specific forward primers, together with a reverse universal primer, produced amplicons of different length, allowing clear identification of goose and mule duck foie gras samples. Analysis of experimental mixtures demonstrated that 1% of duck can be easily detected in goose foie gras using the PCR method developed here. This genetic marker can be very useful for the accurate identification of these two species in foie gras products.

  19. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus.

  20. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.