Science.gov

Sample records for multiplex polymerase chain

  1. Thermally multiplexed polymerase chain reaction

    PubMed Central

    Phaneuf, Christopher R.; Pak, Nikita; Saunders, D. Curtis; Holst, Gregory L.; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L.; Jerris, Robert; Forest, Craig R.

    2015-01-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously—each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel. PMID:26339317

  2. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  3. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    PubMed Central

    Berwal, Anupam; Chawla, Kiran; Vishwanath, Shashidhar; Shenoy, Vishnu Prasad

    2017-01-01

    Tuberculous meningitis (TBM) is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR) in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF) specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1%) patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM. PMID:28367034

  4. Single Multiplex Polymerase Chain Reaction To Detect Diverse Loci Associated with Diarrheagenic Escherichia coli

    PubMed Central

    López-Saucedo, Catalina; Cerna, Jorge F.; Villegas-Sepulveda, Nicolas; Thompson, Rocío; Velazquez, F. Raul; Torres, Javier; Tarr, Phillip I.

    2003-01-01

    We developed and tested a single multiplex polymerase chain reaction (PCR) that detects enterotoxigenic, enteropathogenic, enteroinvasive, and Shiga-toxin–producing Escherichia coli. This PCR is specific, sensitive, and rapid in detecting target isolates in stool and food. Because of its simplicity, economy, and efficiency, this protocol warrants further evaluation in large, prospective studies of polymicrobial substances. PMID:12533296

  5. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  6. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction.

    PubMed

    Khamlor, Trisadee; Pongpiachan, Petai; Sangsritavong, Siwat; Chokesajjawatee, Nipa

    2014-10-01

    Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR) assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP) gene and sex-determining region Y (SRY) were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99%) comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05). The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90%) as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  7. Oral candidiasis: a comparison between conventional methods and multiplex polymerase chain reaction for species identification.

    PubMed

    Liguori, G; Di Onofrio, V; Lucariello, A; Gallé, F; Signoriello, G; Colella, G; D'Amora, M; Rossano, F

    2009-02-01

    Oral candidiasis is the most common fungal infection in dental practice, and is caused by yeasts that are normally present in the endogenous flora. To evaluate a rapid diagnostic method for identification of Candida oral isolates, a multiplex polymerase chain reaction (PCR) was carried out on colonies and on oral rinse solutions from 95 subjects with suspected oral candidiasis and results were compared with those from seven commonly used phenotypic identification systems. Between four and nine species were characterized in the samples by the phenotypic methods. PCR identified the same species in 60 (74%) samples from both colony and oral rinse solutions. Statistical analysis, carried out only for the three most frequently isolated species (Candida albicans, Candida glabrata, and Candida tropicalis), showed good concordance in the comparison of multiplex PCR with API 20C AUX and with the Rapid Yeast Identification Panel; conversely, significant differences were registered in the comparison between the molecular method and other phenotypic systems, including four chromogenic media and the automated system Vitek2. Multiplex PCR was rapid and effective in the identification of Candida species and allowed the detection of more than one species in the same sample.

  8. Multiplex-microsphere-quantitative polymerase chain reaction: nucleic acid amplification and detection on microspheres.

    PubMed

    Liang, Fang; Lai, Richard; Arora, Neetika; Zhang, Kang Liang; Yeh, Che-Cheng; Barnett, Graeme R; Voigt, Paul; Corrie, Simon R; Barnard, Ross T

    2013-01-01

    We report the development of a new system to monitor the amplification of nucleic acids on microspheres. This was realized by the design of (i) a "universal" oligonucleotide "tagged" polymerase chain reaction (PCR) forward primer, (ii) a sensor sequence complementary to the universal sequence on the forward PCR primer modified with a fluorescent dye, and (iii) a universal oligonucleotide coupled to Luminex microspheres. The PCR takes place with the microspheres present in the reaction tube. With the consumption of the universal oligonucleotide tagged forward primer, the fluorescently labeled sequences can bind to the universal oligonucleotide on the microspheres. We tested the microsphere quantitative PCR system with up to three different target genes (Neisseria meningitides porA and ctrA and influenza A M gene segment) as templates in a single PCR tube. The analytical sensitivity of this quantitative PCR system was tested and compared with the TaqMan system. The multiplex-microsphere-quantitative PCR system does not require design of unique internal probes for each target and has potential for a high degree of multiplexing, greater than the limited multiplexing achievable with current real-time protocols.

  9. A simple multiplex polymerase chain reaction to determine ABO blood types of rhesus macaques (Macaca mulatta).

    PubMed

    Premasuthan, A; Kanthaswamy, S; Satkoski, J; Smith, D G

    2011-06-01

    Rhesus macaques are the most common nonhuman primate model organism used in biomedical research. Their increasingly frequent use as subjects in studies involving transplantation requires that blood and other tissue antigens of donors and recipients be compatible. We report here an easy and rapid multiplex polymerase chain reaction (PCR) to determine the ABO blood group phenotypes of rhesus macaques that can be performed with only small amounts of DNA. We phenotyped 78 individuals and found this species to exhibit the A, B and AB phenotypes in frequencies that vary by geographic region. The probability of randomly pairing rhesus macaque donors and recipients that exhibit major ABO phenotype incompatibility is approximately 0.35 and 0.45 for Indian and Chinese rhesus macaques, respectively.

  10. Multiplex polymerase chain reaction method to detect Cyclospora, Cystoisospora, and Microsporidia in stool samples.

    PubMed

    Taniuchi, Mami; Verweij, Jaco J; Sethabutr, Orntipa; Bodhidatta, Ladaporn; Garcia, Lynne; Maro, Athanasia; Kumburu, Happiness; Gratz, Jean; Kibiki, Gibson; Houpt, Eric R

    2011-12-01

    Cyclospora, Cystoisospora, and Microsporidia are eukaryotic enteropathogens that are difficult to detect in stool samples because they require special stains and microscopy. We developed a multiplex polymerase chain reaction (PCR) reaction with 4 primer sets to amplify Cyclospora cayetanensis, Cystoisospora belli, Enterocytozoon bieneusi, and Encephalitozoon intestinalis. Detection of the amplicon is through specific probes coupled to Luminex beads. Sensitivity of the assay was evaluated using Encephalitozoon intestinalis spores and revealed detection of 10(1) spores spiked into stool. No cross-reactivity was observed. We evaluated the assay on diarrheal specimens from Thailand, Tanzania, Indonesia, and the Netherlands that had been previously tested by microscopy, and the assay yielded 87-100% sensitivity and 88-100% specificity. Microscopy-negative/PCR-positive samples had lower Luminex values, suggesting they were true but with lower burden infections. In summary, this is a convenient single PCR reaction that can detect Cyclospora, Cystoisospora, and Microsporidia without the need for cumbersome microscopic analysis.

  11. Quantitative multiplexed detection of common pulmonary fungal pathogens by labeled primer polymerase chain reaction.

    PubMed

    Gu, Zhengming; Buelow, Daelynn R; Petraitiene, Ruta; Petraitis, Vidmantas; Walsh, Thomas J; Hayden, Randall T

    2014-11-01

    Invasive fungal infections are an important cause of morbidity and mortality among immunocompromised patients. To design and evaluate a multiplexed assay aimed at quantitative detection and differentiation of the 5 molds that are most commonly responsible for pulmonary infections. Using labeled primer polymerase chain reaction chemistry, an assay was designed to target the 5.8S and 28S ribosomal RNA genes of Aspergillus spp, Fusarium spp, Scedosporium spp, and members of the order Mucorales ( Rhizopus oryzae , Rhizopus microsporus, Cunninghamella bertholletiae, Mucor circinelloides, Lichtheimia corymbifera, and Rhizomucor pusillus). This assay was split into 2 multiplexed reactions and was evaluated using both samples seeded with purified nucleic acid from 42 well-characterized clinical fungal isolates and 105 archived samples (47 blood [45%], 42 bronchoalveolar lavage fluid [40%], and 16 tissue [15%]) collected from rabbit models of invasive pulmonary fungal infections. Assay detection sensitivity was less than 25 copies of the target sequence per reaction for Aspergillus spp, 5 copies for Fusarium spp and Scedosporium spp, and 10 copies for the Mucorales. The assay showed quantitative linearity from 5 × 10(1) to 5 × 10(5) copies of target sequence per reaction. Sensitivities and specificities for bronchoalveolar lavage fluid, tissue, and blood samples were 0.86 and 0.99, 0.60 and 1.00, and 0.46 and 1.00, respectively. Labeled primer polymerase chain reaction permits rapid, quantitative detection and differentiation of common agents of invasive fungal infection. The assay described herein shows promise for clinical implementation that may have a significant effect on the rapid diagnosis and treatment of patients' severe infections caused by these pulmonary fungal pathogens.

  12. A multiplex real-time polymerase chain reaction assay to diagnose Epiphyas postvittana (Lepidoptera: Tortricidae).

    PubMed

    Barr, N B; Ledezma, L A; Farris, R E; Epstein, M E; Gilligan, T M

    2011-10-01

    A molecular assay for diagnosis of light brown apple moth, Epiphyas postvittana (Walker) (Lepidoptera: Tortricidae), in North America is reported. The assay multiplexes two TaqMan real-time polymerase chain reaction (RT-PCR) probe systems that are designed to target DNA segments of the internal transcribed spacer region 2 (ITS2) and 18S rRNA gene. The RT-PCR probe designed for the 18S target recognizes a DNA sequence conserved in all of the moths included in the study and functions as a control in the assay. The second probe recognizes a segment of the ITS2 specifically found in E. postvittana and not found in the other moths included in the study, i.e., this segment is not conserved. Inclusion of the two markers in a single multiplex reaction did not affect assay performance. The assay was tested against 637 moths representing > 90 taxa in 15 tribes in all three subfamilies in the Tortricidae. The assay generated no false negatives based on analysis of 355 E. postvittana collected from California, Hawaii, England, New Zealand, and Australia. Analysis of a data set including 282 moths representing 41 genera generated no false positives. Only three inconclusive results were generated from the 637 samples. Spike experiments demonstrated that DNA contamination in the assay can affect samples differently. Contaminated samples analyzed with the ITS2 RT-PCR assay and DNA barcode methodology by using the cytochrome oxidase I gene can generate contradictory diagnoses.

  13. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

    PubMed

    Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

    2016-12-07

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray(®) Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea.

  14. Evaluation of a multiplex polymerase chain reaction for early diagnosis of ventriculostomy-related infections.

    PubMed

    Gordon, Claire L; Tokarz, Rafal; Briese, Thomas; Lipkin, W Ian; Jain, Komal; Whittier, Susan; Shah, Jayesh; Connolly, E Sander; Yin, Michael T

    2015-12-01

    Diagnosis of ventriculostomy-related infections (VRIs) is challenging due to the lack of rapid, sensitive assays for pathogen detection. The authors report the development of a multiplex polymerase chain reaction (PCR) assay for differential diagnosis of common VRI pathogens. MassTag PCR was used to develop a multiplex assay for detection of 11 VRI pathogens. The assay was established and optimized using cloned template standards and spiked samples and was then evaluated on CSF specimens from ventricular drains. Subjects were grouped into definite VRI, possible VRI, or no VRI based on conventional microbiology, CSF evaluation, and clinical parameters. CSF specimens were obtained from 45 subjects (median age 49 years, interquartile range 32-63 years; 51% were male). The assay detected 10-100 genome copies. It detected a pathogen in 100% (6 of 6) of definite VRI cases in which a pathogen targeted by the assay was present; these represented 67% of all definite VRIs (6 of 9). Among subjects with a possible VRI, the assay detected a pathogen in 29% (5 of 17). In subjects without overt infection the presence of a pathogen was detected in 32% of subjects (6 of 19), albeit with lower signal compared with the VRI group. MassTag PCR enabled parallel testing of CSF specimens for 11 pathogens of VRI. The high sensitivity of PCR combined with possible device colonization, specimen contamination, and concurrent antibiotic treatments limit the clinical value of the assay, similar to other current diagnostic approaches. With further optimization, multiplex PCR may provide timely identification of multiple possible VRI pathogens and guide management, complementing classic culture approaches.

  15. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar

    PubMed Central

    Humphrey, John M.; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E.; Farag, Elmoubasher; Abu-Raddad, Laith J.; Glesby, Marshall J.

    2016-01-01

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015–2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4–10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2–7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. PMID:27928081

  16. Thermostabilization of indigenous multiplex polymerase chain reaction reagents for detection of enterotoxigenic Staphylococcus aureus.

    PubMed

    Nagaraj, Sowmya; Ramlal, Shylaja; Kingston, Joseph; Batra, Harsh Vardhan

    2016-05-13

    Among DNA-based techniques, polymerase chain reaction (PCR) is the most widely accepted molecular tool for the detection of pathogens. However, the technique involves several reagents and multiple pipetting steps that often lead to error-prone results. Additionally, the reagents entail a cold-chain facility to maintain their stability during storage and transportation. The main aim of the present study was to simplify the utility of a pre-optimized multiplex PCR format that was developed to detect toxigenic strains of Staphylococcus aureus by providing stable, pre-mixed, and ready-to-use master mix in a lyophilized formulation. Master mix containing all reagents except the template was lyophilized in the presence of an excipient lyoprotectant to achieve long-term stability without altering the sensitivity, specificity and PCR performance. Bromophenol blue was also included in the master mix to reduce the risk of external contamination during gel loading. The stability of lyophilized master mix was analyzed at different temperatures. The PCR performance was also examined after exposure of master mix to notable temperature fluctuations during transportation. The shelf-life of lyophilized master mix was estimated to be 1.5 months at ambient temperature and 6 months at 4°C. Stability was unaffected by temperature fluctuations during transportation even in cold-chain-free conditions, thus reducing the cost required for cold storage. The sensitive, cost-effective, ready-to-use, and ambient temperature stable formulation could be implemented as a detection tool in food analysis and diagnostic laboratories and hospitals and for on-field application outside the laboratories, as well as for detection of toxigenic strains of S. aureus. Copyright © 2016. Published by Elsevier B.V.

  17. An evaluation of serotyping of Avibacterium paragallinarum by use of a multiplex polymerase chain reaction.

    PubMed

    Morales-Erasto, Vladimir; Posadas-Quintana, José de Jesús; Fernández-Díaz, Manolo; Saravia, Luis E; Martínez-Castañeda, José Simón; Blackall, Patrick J; Soriano-Vargas, Edgardo

    2014-03-01

    In the present study, the ability of a recently proposed multiplex polymerase chain reaction (mPCR) to determine the serogroups (A, B, and C) of Avibacterium paragallinarum was evaluated. A total of 12 reference strains and 69 field isolates of Av. paragallinarum from Ecuador, Mexico, Panama, and Peru were included in the study. With some exceptions (which were serotyped in the current study), all of the isolates and strains had been previously examined by 2 serotyping schemes (Page and Kume) or were the formal reference strains for the schemes. Three of 6 (50%) reference strains of serogroup A, 2 (100%) of serogroup B, and 1 of 4 (25%) reference strains of serogroup C were correctly serotyped by the mPCR. With the field isolates, the mPCR correctly recognized 16 of the 17 serogroup A isolates, 10 of the 12 serogroup B isolates, and 18 of the 37 serogroup C isolates. Overall, the specificity and sensitivity of the PCR test was as follows: 82.6% and 87.3% (serogroup A), 85.7% and 71.9% (serogroup B), and 46.3% and 100% (serogroup C). The poor performance of the mPCR in terms of recognition of serogroup C isolates (low sensitivity of 46.3%) and the relatively high level of uncertainty about the accuracy of the serogroup A and B results (specificity of 87.3% and 71.9%, respectively) means that the assay cannot be recommended as a replacement for conventional serotyping.

  18. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction.

    PubMed

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  19. A simple multiplex polymerase chain reaction assay for the identification of four environmentally relevant fungal contaminants.

    PubMed

    Dean, Timothy R; Roop, Barbara; Betancourt, Doris; Menetrez, Marc Y

    2005-04-01

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods may often be time-consuming and inaccurate, necessitating the development of identification protocols that are rapid, sensitive, and precise. The polymerase chain reaction (PCR) has shown great promise in its ability to identify and quantify individual organisms from a mixed culture environment; however, the cost effectiveness of single organism PCR reactions is quickly becoming an issue. Our laboratory has developed a simple method to identify multiple fungal species, Stachybotrys chartarum, Aspergillus versicolor, Penicillium purpurogenum, and Cladosporium spp. by performing multiplex PCR and distinguishing the different reaction products by their mobility during agarose gel electrophoresis. The amplified genes include the beta-Tubulin gene from A. versicolor, the Tri5 gene from S. chartarum, and ribosomal sequences from both P. purpurogenum and Cladosporium spp. This method was found to be both rapid and easy to perform, while maintaining high sensitivity and specificity for characterizing isolates, even from a mixed culture.

  20. IDENTIFICATION OF MAMMALIAN BLOOD MEALS IN MOSQUITOES BY A MULTIPLEXED POLYMERASE CHAIN REACTION TARGETING CYTOCHROME B

    PubMed Central

    Kent, Rebekah J.; Norris, Douglas E.

    2014-01-01

    To date, no polymerase chain reaction diagnostic technique exists to directly identify mammalian blood meals from mosquitoes by sized DNA fragments following agarose gel electrophoresis. We have developed a vertebrate-specific multiplexed primer set based on mitochondrial cytochrome b to identify the mammalian blood hosts of field-collected mosquitoes. Although designed for the study of African malaria vectors, the application of this tool is not restricted to this disease system. Validation of this diagnostic technique on dried anopheline and culicine field specimens collected in Zambia and Mali demonstrated that blood meals could be identified 2–7 months after collection. Time course experiments showed that host DNA was detectable in frozen mosquito abdomens 24–30 hours post-feeding. Additionally, multiple blood meals from different mammals could be detected in a single mosquito. This diagnostic assay will be a valuable tool for identifying the blood meals of field-collected mosquitoes where people and alternative mammal hosts are present. PMID:16103600

  1. A multiplex polymerase chain reaction for discriminating Erysipelothrix rhusiopathiae from Erysipelothrix tonsillarum.

    PubMed

    Yamazaki, Yoshinao

    2006-07-01

    Erysipelothrix rhusiopathiae is the causative agent of swine erysipelas, and it causes great economic losses in Japan and worldwide. In meat inspection, it is very important to distinguish E. rhusiopathiae from other bacteria showing similar clinical signs of disease or similar bacterial characteristics. To distinguish E. rhusiopathiae from Erysipelothrix tonsillarum, 2 polymerase chain reaction (PCR) systems were combined. The primer sets ERY-1F and ERY-2R were designed to amplify 2210 base pairs (bp) of nucleotide sequence specific for E. rhusiopathiae chromosomal DNA, and the primer sets MO101 and ERS-1R were designed to amplify 719 bp of nucleotide sequence including a highly conserved region of genus Erysipelothrix 16S rRNA. Two fragments were amplified when E. rhusiopathiae was used as the PCR template using the primer sets, whereas a single fragment was amplified when E. tonsillarum was used as the template. No fragments were amplified when nucleic acid from other bacteria that cause clinical signs similar to swine erysipelas were used as the template. Moreover, 5 specimens collected from postinspected swine carcasses were diagnosed as E. rhusiopathiae using the PCR described in this study, in agreement with results of microbiological tests for the genus Erysipelothrix, whereas negative samples were negative both in conventional bacterial tests and by PCR. The detection limit of multiplex PCR ranged from 10(2) to 10(4) colony forming units per reaction tube for positive samples. These results suggest that this method is useful for screening of swine erysipelas in meat inspection centers.

  2. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future. PMID:26078959

  3. Development of a diagnostic multiplex polymerase chain reaction microarray assay to detect and differentiate Brucella spp.

    PubMed

    Schmoock, Gernot; Ehricht, Ralf; Melzer, Falk; Elschner, Mandy; Tomaso, Herbert; Neubauer, Heinrich; Al Dahouk, Sascha

    2011-12-01

    Brucellosis is a worldwide zoonosis leading to tremendous economic losses and severe human illness. Fast and reliable laboratory tests are needed to detect disease in both humans and animals and to monitor the production of safe food products and feed. For rapid identification of the genus Brucella and differentiation of its species, a multiplex polymerase chain reaction microarray assay based on 11 signature sequences and redundant oligonucleotide probes was developed. The gene targets included genus-specific sequences in bcsp31, perA, cgs, and omp2b, as well as chromosomal regions displaying species-specific hybridization patterns. Brucella reference strains and a representative panel of 102 field isolates were unambiguously identified by their hybridization patterns. The differentiation of species, however, was limited in members of the groups B. suis bv 3/4/B. canis and B. neotomae/B. microti. In summary, the newly developed Brucella ArrayTube® assay is an easy-to-handle molecular test for high-throughput and parallel analysis. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Multiplexed Real-Time Polymerase Chain Reaction on a Digital Microfluidic Platform

    PubMed Central

    Hua, Zhishan; Rouse, Jeremy L.; Eckhardt, Allen E.; Srinivasan, Vijay; Pamula, Vamsee K.; Schell, Wiley A.; Benton, Jonathan L.; Mitchell, Thomas G.; Pollack, Michael G.

    2010-01-01

    This paper details the development of a digital microfluidic platform for multiplexed real-time polymerase chain reactions. Liquid samples in discrete droplet format are programmably manipulated upon an electrode array by the use of electrowetting. Rapid PCR thermocycling is performed in a closed-loop flow-through format where for each cycle the reaction droplets are cyclically transported between different temperature zones within an oil-filled cartridge. The cartridge is fabricated using low-cost printed-circuit-board technology and is intended to be a single-use disposable device. The PCR system exhibited remarkable amplification efficiency of 94.7%. To test its potential application in infectious diseases, this novel PCR system reliably detected diagnostic DNA levels of methicillin-resistant Staphylococcus aureus (MRSA), Mycoplasma pneumoniae, and Candida albicans. Amplification of genomic DNA samples was consistently repeatable across multiple PCR loops both within and between cartridges. In addition, simultaneous real-time PCR amplification of both multiple different samples and multiple different targets on a single cartridge was demonstrated. A novel method of PCR speed optimization using variable cycle times has also been proposed and proven feasible. The versatile system includes magnetic bead handling capability, which was applied to the analysis of simulated clinical samples that were prepared from whole blood using a magnetic bead capture protocol. Other salient features of this versatile digital microfluidic PCR system are also discussed, including the configurability and scalability of microfluidic operations, instrument portability and substrate-level integration with other pre- and post-PCR processes. PMID:20151681

  5. Effective characterization of Salmonella Enteritidis by most probable number (MPN) followed by multiplex polymerase chain reaction (PCR) methods.

    PubMed

    Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe

    2017-02-01

    Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.

  6. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  7. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  8. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.

  9. Identification of co-occurring Branchinecta fairy shrimp species from encysted embryos using multiplex polymerase chain reaction

    USGS Publications Warehouse

    Vandergast, A.G.; Wood, D.A.; Simovich, M.; Bohonak, A.J.

    2009-01-01

    Morphological identification of many fairy shrimp species is difficult because distinguishing characters are restricted to adults. We developed two multiplex polymerase chain reaction assays that differentiate among three Branchinecta fairy shrimp with distributional overlap in southern California vernal pools. Two of the species are federally listed as threatened. Molecular identification of Branchinecta from cysts allows for species surveys to be conducted during the dry season, expanding the timeframe for population assessment and providing a less intrusive method of sampling sensitive vernal pool habitats. ?? Published 2009. This article is a US Government work and is in the public domain in the USA.

  10. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    PubMed

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products.

  11. A new, multiplex, quantitative real-time polymerase chain reaction system for nucleic acid detection and quantification.

    PubMed

    Liang, Fang; Arora, Neetika; Zhang, Kang Liang; Yeh, David Che Cheng; Lai, Richard; Pearson, Darnley; Barnett, Graeme; Whiley, David; Sloots, Theo; Corrie, Simon R; Barnard, Ross T

    2013-01-01

    Quantitative real-time polymerase chain reaction (qPCR) has emerged as a powerful investigative and diagnostic tool with potential to generate accurate and reproducible results. qPCR can be designed to fulfil the four key aspects required for the detection of nucleic acids: simplicity, speed, sensitivity, and specificity. This chapter reports the development of a novel real-time multiplex quantitative PCR technology, dubbed PrimRglo™, with a potential for high-degree multiplexing. It combines the capacity to simultaneously detect many viruses, bacteria, or nucleic acids, in a single reaction tube, with the ability to quantitate viral or bacterial load. The system utilizes oligonucleotide-tagged PCR primers, along with complementary fluorophore-labelled and quencher-labelled oligonucleotides. The analytic sensitivity of PrimRglo technology was compared with the widely used Taqman(®) and SYBR green detection systems.

  12. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    PubMed

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  13. [Evaluation of the efficiency of differential diagnosis of influenza by multiplex real-time polymerase chain reaction].

    PubMed

    Lobodanov, S A; Nikonova, A A; Faĭzuloev, E B; Trushakova, S V; Zabiiaka, Iu I; Kalinkina, M A; Ivanova, V T; Shevchenko, E S; Zverev, V V; Burtseva, E I

    2012-01-01

    The paper gives the results of a comparative analysis of the detection of influenza viruses in clinical samples, by using multiplex real-time polymerase chain reaction (RT-PCR) and by virus isolation in MDCK cell cultures. The investigation employed 267 nasopharyngeal swab specimens obtained from patients with influenza symptoms during two epidemic seasons (2008-2009 and 2009-2010). Influenza viruses were found in 104 samples (48 with influenza A virus (IAV) and 56 with influenza B virus (IBV)) by multiplex RT-RCR and in 84 samples (35 with IAV and 49 with IBV) by a cultural technique. The results of detection of influenza viruses by the two methods showed 89.4% agreement. The diagnostic sensitivity of multiplex RT-PCR testing a panel of the clinical samples in question was estimated to be 94.3% for IAV and 95.9% for IBV. The diagnostic sensitivity of multiplex RT-PCR in virus detection was demonstrated to be not only highly competitive with virus isolation, but also superior to the latter.

  14. DETECTION OF Leishmania (Viannia) IN Nyssomyia neivai AND Nyssomyia whitmani BY MULTIPLEX POLYMERASE CHAIN REACTION, IN SOUTHERN BRAZIL

    PubMed Central

    Neitzke-Abreu, Herintha Coeto; Reinhold-Castro, Kárin Rosi; Venazzi, Mateus Sabaini; Scodro, Regiane Bertin de Lima; Dias, Alessandra de Cassia; Silveira, Thaís Gomes Verzignassi; Teodoro, Ueslei; Lonardoni, Maria Valdrinez Campana

    2014-01-01

    Sandflies transmit pathogens of leishmaniasis. The natural infection of sandflies by Leishmania (Viannia) was assessed in municipalities, in the state of Paraná, in Southern Brazil. Sandflies were collected with Falcão and Shannon traps. After dissection in search of flagellates in digestive tubes and identification of the species, female sandflies were submitted to the Multiplex Polymerase Chain Reaction (multiplex PCR) for detection of the fragment of the kDNA of Leishmania (Viannia) and the fragment from the IVS6 cacophony gene region of the phlebotomine insects. The analysis was performed in pools containing seven to 12 guts from females of the same species. A total of 510 female sandflies were analyzed, including nine Migonemyia migonei, 17 Pintomyia fischeri, 216 Nyssomyia neivai, and 268 Nyssomyia whitmani. Although none of the females was found naturally infected by flagellates through dissection, the fragment of DNA from Leishmania (Viannia) was shown by multiplex PCR in one sample of Ny. neivai (0.46%) and three samples of Ny. whitmani (1.12%). It was concluded that Ny. neivai and Ny. whitmani are susceptible to Leishmania infection, and that multiplex PCR can be used in epidemiological studies to detect the natural infection of the sandfly vector, because of its sensitivity, specificity and feasibility. PMID:25229218

  15. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

    PubMed

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

    2011-09-01

    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  16. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  17. Detection of Escherichia coli enteropathogens by multiplex polymerase chain reaction from children's diarrheal stools in two Caribbean-Colombian cities.

    PubMed

    Gómez-Duarte, Oscar G; Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y

    2010-02-01

    Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean-Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1-9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin-producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area.

  18. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    NASA Astrophysics Data System (ADS)

    Liang, Gaofeng; Ma, Chao; Zhu, Yanliang; Li, Shuchun; Shao, Youhua; Wang, Yong; Xiao, Zhongdang

    2011-12-01

    Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA). The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  19. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  20. Identification of Listeria Spp. Strains Isolated from Meat Products and Meat Production Plants by Multiplex Polymerase Chain Reaction.

    PubMed

    Mazza, Roberta; Piras, Francesca; Ladu, Daniela; Putzolu, Miriam; Consolati, Simonetta Gianna; Mazzette, Rina

    2015-11-02

    Listeriosis is a foodborne disease caused by Listeria monocytogenes and is considered as a serious health problem, due to the severity of symptoms and the high mortality rate. Recently, other Listeria species have been associated with disease in human and animals. The aim of this study was to develop a multiplex polymerase chain reaction (PCR) in order to simultaneously detect six Listeria species (L. grayi, L. welshimeri, L. ivanovii, L. monocytogenes, L. seeligeri, L. innocua) in a single reaction. One hundred eighteen Listeria spp. strains, isolated from meat products (sausages) and processing plants (surfaces in contact and not in contact with meat), were included in the study. All the strains were submitted to biochemical identification using the API Listeria system. A multiplex PCR was developed with the aim to identify the six species of Listeria. PCR allowed to uniquely identify strains that had expressed a doubtful profile with API Listeria The results suggest that the multiplex PCR could represent a rapid and sensitive screening test, a reliable method for the detection of all Listeria species, both in contaminated food and in clinical samples, and also a tool that could be used for epidemiological purposes in food-borne outbreaks. A further application could be the development of a PCR that can be directly applied to the pre-enrichment broth.

  1. Identification of Listeria Spp. Strains Isolated from Meat Products and Meat Production Plants by Multiplex Polymerase Chain Reaction

    PubMed Central

    Mazza, Roberta; Ladu, Daniela; Putzolu, Miriam; Consolati, Simonetta Gianna; Mazzette, Rina

    2015-01-01

    Listeriosis is a foodborne disease caused by Listeria monocytogenes and is considered as a serious health problem, due to the severity of symptoms and the high mortality rate. Recently, other Listeria species have been associated with disease in human and animals. The aim of this study was to develop a multiplex polymerase chain reaction (PCR) in order to simultaneously detect six Listeria species (L. grayi, L. welshimeri, L. ivanovii, L. monocytogenes, L. seeligeri, L. innocua) in a single reaction. One hundred eighteen Listeria spp. strains, isolated from meat products (sausages) and processing plants (surfaces in contact and not in contact with meat), were included in the study. All the strains were submitted to biochemical identification using the API Listeria system. A multiplex PCR was developed with the aim to identify the six species of Listeria. PCR allowed to uniquely identify strains that had expressed a doubtful profile with API Listeria The results suggest that the multiplex PCR could represent a rapid and sensitive screening test, a reliable method for the detection of all Listeria species, both in contaminated food and in clinical samples, and also a tool that could be used for epidemiological purposes in food-borne outbreaks. A further application could be the development of a PCR that can be directly applied to the pre-enrichment broth. PMID:27800422

  2. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and Oropouche-like viruses

    PubMed Central

    Naveca, Felipe Gomes; do Nascimento, Valdinete Alves; de Souza, Victor Costa; Nunes, Bruno Tardelli Diniz; Rodrigues, Daniela Sueli Guerreiro; Vasconcelos, Pedro Fernando da Costa

    2017-01-01

    ABSTRACT We describe a sensitive method for simultaneous detection of Oropouche and Oropouche-like viruses carrying the Oropouche S segment, as well as the Mayaro virus, using a multiplexed one-step reverse transcription real-time polymerase chain reaction (RT-qPCR). A chimeric plasmid containing both Mayaro and Oropouche targets was designed and evaluated for the in vitro production of transcribed RNA, which could be easily used as a non-infectious external control. To track false-negative results due to PCR inhibition or equipment malfunction, the MS2 bacteriophage was also included in the multiplex assay as an internal positive control. The specificity of the multiplex assay was evaluated by Primer-Blast analysis against the entire GenBank database, and further against a panel of 17 RNA arboviruses. The results indicated an accurate and highly sensitive assay with amplification efficiency greater than 98% for both targets, and a limit of detection between two and 20 copies per reaction. We believe that the assay described here will provide a tool for Mayaro and Oropouche virus detection, especially in areas where differential diagnosis of Dengue, Zika and Chikungunya viruses should be performed. PMID:28591313

  3. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and Oropouche-like viruses.

    PubMed

    Naveca, Felipe Gomes; Nascimento, Valdinete Alves do; Souza, Victor Costa de; Nunes, Bruno Tardelli Diniz; Rodrigues, Daniela Sueli Guerreiro; Vasconcelos, Pedro Fernando da Costa

    2017-07-01

    We describe a sensitive method for simultaneous detection of Oropouche and Oropouche-like viruses carrying the Oropouche S segment, as well as the Mayaro virus, using a multiplexed one-step reverse transcription real-time polymerase chain reaction (RT-qPCR). A chimeric plasmid containing both Mayaro and Oropouche targets was designed and evaluated for the in vitro production of transcribed RNA, which could be easily used as a non-infectious external control. To track false-negative results due to PCR inhibition or equipment malfunction, the MS2 bacteriophage was also included in the multiplex assay as an internal positive control. The specificity of the multiplex assay was evaluated by Primer-Blast analysis against the entire GenBank database, and further against a panel of 17 RNA arboviruses. The results indicated an accurate and highly sensitive assay with amplification efficiency greater than 98% for both targets, and a limit of detection between two and 20 copies per reaction. We believe that the assay described here will provide a tool for Mayaro and Oropouche virus detection, especially in areas where differential diagnosis of Dengue, Zika and Chikungunya viruses should be performed.

  4. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  5. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    PubMed Central

    Mishra, Raghavendra Prasad; Jain, Udit; Singh, Rakesh Kumar

    2016-01-01

    Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC) in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR). Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health. PMID:27651685

  6. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    PubMed Central

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL–1 of Dickeya sp. genomic DNA, and down to 0.1 ng µL–1 of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 101 cfu mL–1 plant extract (102 cfu g–1 plant tissue), 102 cfu mL–1 plant extract (103 cfu g–1 plant tissue), 103 cfu mL–1 plant extract (104 cfu g–1 plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland. PMID:25506085

  7. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction.

    PubMed

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-11-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL(-1) of Dickeya sp. genomic DNA, and down to 0.1 ng µL(-1) of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 10(1) cfu mL(-1) plant extract (10(2) cfu g(-1) plant tissue), 10(2) cfu mL(-1) plant extract (10(3) cfu g(-1) plant tissue), 10(3) cfu mL(-1) plant extract (10(4) cfu g(-1) plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland.

  8. [Microarray analytic system for multiplex analysis by real-time polymerase chain reaction with reagents immobilized in microreactors].

    PubMed

    Navolotskiĭ, D V; Perchik, A V; Mark'ianov, I A; Ganeev, A A; Sliadnev, M N

    2011-01-01

    A microarray analytic system that uses a silicon chip with immobilized in microreactor test-system for multiplex analysis of DNA by real-time polymerase chain reaction (RT-PCR) was developed and optimized. We suggested the method of immobilization of PCR-components of a test-system, chose the stabilizer, and conducted the optimization of the composition of reaction mixture to achieve permanent stability of a microarray. We conducted optimization of preparation of samples using magnetic sorbent and indicated that, with 2.6 x 10(4) copies/ml, 60 min are necessary to obtain positive identification including time for preparation of model probes. The abilities of the created system were demonstrated on the example of microarray analysis of samples with different content of DNA, low absolute limits of identification (20 DNA copies in microreactor), and high reproducibility of the analysis.

  9. Development of a multiplex real-time reverse transcriptase-polymerase chain reaction for equine infectious anemia virus (EIAV).

    PubMed

    Cook, R Frank; Cook, S J; Li, F Li; Montelaro, R C; Issel, C J

    2002-08-01

    A single-tube reverse transcriptase-polymerase chain reaction (RT-PCR) using a fluorogenic real-time PCR detection method is described for the quantitation of equine infectious anemia virus (EIAV) RNA in the plasma of equids. To compensate for variations inherent in sample preparation a multiplex real-time RT-PCR system was developed that permitted the simultaneous calculation of the nucleic acid recovery rate along with the copy number of viral RNA molecules. Detection of EIAV RNA was linear from 10(9) to 10(1) molecules with intra- and inter-assay variability of less than 1% at 10(8), 10(6), 10(4) and 10(2) molecules.

  10. A pipeline with multiplex reverse transcription polymerase chain reaction and microarray for screening of chromosomal translocations in leukemia.

    PubMed

    Xiong, Fei-Fei; Li, Ben-Shang; Zhang, Chun-Xiu; Xiong, Hui; Shen, Shu-Hong; Zhang, Qing-Hua

    2013-01-01

    Chromosome rearrangements and fusion genes present major portion of leukemogenesis and contribute to leukemic subtypes. It is practical and helpful to detect the fusion genes in clinic diagnosis of leukemia. Present application of reverse transcription polymerase chain reaction (RT-PCR) method to detect the fusion gene transcripts is effective, but time- and labor-consuming. To set up a simple and rapid system, we established a method that combined multiplex RT-PCR and microarray. We selected 15 clinically most frequently observed chromosomal rearrangements generating more than 50 fusion gene variants. Chimeric reverse primers and chimeric PCR primers containing both gene-specific and universal sequences were applied in the procedure of multiplex RT-PCR, and then the PCR products hybridized with a designed microarray. With this approach, among 200 clinic samples, 63 samples were detected to have gene rearrangements. All the detected fusion genes positive and negative were validated with RT-PCR and Sanger sequencing. Our data suggested that the RT-PCR-microarray pipeline could screen 15 partner gene pairs simultaneously at the same accuracy of the fusion gene detection with regular RT-PCR. The pipeline showed effectiveness in multiple fusion genes screening in clinic samples.

  11. Multiplex polymerase chain reaction assay for detection of nonserotypable Shiga toxin-producing Escherichia coli strains of serogroup O147.

    PubMed

    DebRoy, Chitrita; Roberts, Elisabeth; Davis, Michael; Bumbaugh, Alyssa

    2010-11-01

    Nonserotypable Shiga toxin-producing Escherichia coli (STEC) strains (n = 72) from the collection of the E. coli Reference Center were O typed by a polymerase chain reaction (PCR)-restriction fragment length polymorphism method, and those that exhibited similar profiles (n = 17) were chosen for the study. These isolates, derived from pigs, carried genes for Shiga toxin variant 2e (100%), heat stable enterotoxins STa and STb (70% and 76%, respectively), and F107 (F18) fimbriae (82%). DNA sequencing and analysis of the O-antigen gene cluster of one of the nonserotypable strains exhibited 100% homology with O-antigen cluster of E. coli O147 although the lipopolysaccharide profiles differed significantly between the nonserotypable strains and O147 reference control strain normally used for antibody production. Scanning electron micrographs of the nonserotypable strains showed altered morphology as compared to E. coli O147. Therefore, nonserotypable strains may share 100% homology with O-antigen gene cluster of a certain serogroup but may not express that specific O-antigen. Highly specific multiplex PCR for detecting the nonserotypable STEC of serogroup O147 was developed targeting virulence genes stx2, stb, and fedA encoding for F107 fimbriae, and wzx and wzy of the O147 O-antigen cluster genes. The multiplex PCR method will allow identifying potentially pathogenic subgroup of STEC important in porcine and human health.

  12. Differential diagnosis of Goatpox virus in Taiwan by multiplex polymerase chain reaction assay and high-resolution melt analysis.

    PubMed

    Chan, Kun-Wei; Lee, Ming-Liang; Yang, Wei-Cheng; Wong, Min-Liang; Hsu, Wei-Li; Ho, Chia-Fang; Hsieh, Yao-Ching; Wang, Chi-Young

    2014-03-01

    The A32L gene from a Goatpox virus (GTPV) strain isolated from a goat in Yunlin County (Taiwan) displays several substitutions compared with the sequence of the Kenyan GTPV vaccine strain SGP0240 and the Pellor GTPV strain. Samples from the skin lesions on 6 goats with GTPV infection or from goats with Orf virus (ORFV) infection were tested in a multiplex polymerase chain reaction (PCR) system that used primers GPF, GPR1, and GPR2 as well as previously published primers specific for ORFV. These primers were able to amplify either GTPV or ORFV without cross-reactivity. A high-resolution melt analysis (HRMA) was carried out on amplified DNA from the skin lesions of 6 goats with GTPV infection and with the GTPV SGP0240 strain. The results indicated that the melting temperature profiles amplified from samples with Yunlin GTPV infection can be differentiated from the GTPV SGP0240 strain. The findings showed that a successful differential assay for these GTPVs had been developed. Accordingly, both methods can be used to detect and differentiate GTPV isolated from animals that may have either been vaccinated or been infected with a wild strain. The multiplex PCR and HRMA could be used on skin samples of suspected cases to serve as the front-line and confirmative assays, respectively, which will be beneficial to the eradication of GTPV.

  13. Development of a multiplex polymerase chain reaction method for simultaneous detection of eight events of genetically modified maize.

    PubMed

    Onishi, Mari; Matsuoka, Takeshi; Kodama, Takashi; Kashiwaba, Koichi; Futo, Satoshi; Akiyama, Hiroshi; Maitani, Tamio; Furui, Satoshi; Oguchi, Taichi; Hino, Akihiro

    2005-12-14

    In this study, we developed a novel multiplex polymerase chain reaction (PCR) method for simultaneous detection of up to eight events of genetically modified (GM) maize within a single reaction. The eight detection primer pairs designed to be construct specific for eight respective GM events (i.e., Bt11, Event176, GA21, MON810, MON863, NK603, T25, and TC1507) and a primer pair for an endogenous reference gene, ssIIb, were included in the nonaplex(9plex) PCR system, and its amplified products could be distinguished by agarose gel and capillary electrophoreses based on their different lengths. The optimal condition enabled us to reliably amplify two fragments corresponding to a construct specific sequence and a taxon specific ssIIb in each of the eight events of GM maize and all of nine fragments in a simulated GM mixture containing as little as 0.25% (w/w) each of eight events of GM maize. These results indicate that this multiplex PCR method could be an effective qualitative detection method for screening GM maize.

  14. Comparison between Culture and a Multiplex Quantitative Real-Time Polymerase Chain Reaction Assay Detecting Ureaplasma urealyticum and U. parvum

    PubMed Central

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR. PMID:25047036

  15. Evaluation of a new multiplex polymerase chain reaction assay STDFinder for the simultaneous detection of 7 sexually transmitted disease pathogens.

    PubMed

    Muvunyi, Claude Mambo; Dhont, Nathalie; Verhelst, Rita; Crucitti, Tania; Reijans, Martin; Mulders, Brit; Simons, Guus; Temmerman, Marleen; Claeys, Geert; Padalko, Elizaveta

    2011-09-01

    We evaluated a new multiplex polymerase chain reaction (mPCR), "STDFinder assay", a novel multiplex ligation-dependent probe amplification (MLPA) assay for the simultaneous detection of 7 clinically relevant pathogens of STDs, i.e., Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma genitalium, Treponema pallidum, and herpes simplex virus type 1 and 2 (HSV-1 and HSV-2). An internal amplification control was included in the mPCR reaction. The limits of detection for the STDFinder assay varied among the 7 target organisms from 1 to 20 copies per MLPA assay. There were no cross-reactions among any of the probes. Two hundred and forty-two vaginal swabs and an additional 80 specimens with known results for N. gonorrhoeae and C. trachomatis, obtained from infertile women seen at an infertility research clinic at the Kigali Teaching Hospital in Rwanda, were tested by STDFinder assay and the results were confirmed by single real-time PCR using different species-specific targets. Compared to the reference standard, the STDFinder assay showed specificities and sensitivities of 100% and 100%, respectively, for N. gonorrhoeae, C. trachomatis, and M. genitalium; 90.2% and 100%, respectively, for Trichomonas vaginalis; and 96.1% and 100%, respectively, for HSV-2. No specimen was found to be positive for HSV-1 by either the STDFinder assay or the comparator method. Similarly, the sensitivity for Treponema pallidum could not be calculated due to the absence of any Treponema pallidum-positive samples. In conclusion, the STDFinder assays have comparable clinical sensitivity to the conventional mono and duplex real-time PCR assay and are suitable for the routine detection of a broad spectrum of these STDs at relatively low cost due to multiplexing.

  16. Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.

    PubMed

    Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum

    2012-12-01

    The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.

  17. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    PubMed Central

    Han, Jae-Ik; Chang, Dong-Woo

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 µL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  18. The genotyping of infectious bronchitis virus in Taiwan by a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction.

    PubMed

    Huang, Shr-Wei; Ho, Chia-Fang; Chan, Kun-Wei; Cheng, Min-Chung; Shien, Jui-Hung; Liu, Hung-Jen; Wang, Chi-Young

    2014-11-01

    Infectious bronchitis virus (IBV; Avian coronavirus) causes acute respiratory and reproductive and urogenital diseases in chickens. Following sequence alignment of IBV strains, a combination of selective primer sets was designed to individually amplify the IBV wild-type and vaccine strains using a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) approach. This system was shown to discriminate the IBV wild-type and vaccine strains. Moreover, an ARMS real-time RT-PCR (ARMS qRT-PCR) was combined with a high-resolution analysis (HRMA) to establish a melt curve analysis program. The specificity of the ARMS RT-PCR and the ARMS qRT-PCR was verified using unrelated avian viruses. Different melting temperatures and distinct normalized and shifted melting curve patterns for the IBV Mass, IBV H120, IBV TW-I, and IBV TW-II strains were detected. The new assays were used on samples of lung and trachea as well as virus from allantoic fluid and cell culture. In addition to being able to detect the presence of IBV vaccine and wild-type strains by ARMS RT-PCR, the IBV Mass, IBV H120, IBV TW-I, and IBV TW-II strains were distinguished using ARMS qRT-PCR by their melting temperatures and by HRMA. These approaches have acceptable sensitivities and specificities and therefore should be able to serve as options when carrying out differential diagnosis of IBV in Taiwan and China.

  19. High-Throughput Multiplex Quantitative Polymerase Chain Reaction Method for Giardia lamblia and Cryptosporidium Species Detection in Stool Samples

    PubMed Central

    Nurminen, Noora; Juuti, Rosa; Oikarinen, Sami; Fan, Yue-Mei; Lehto, Kirsi-Maarit; Mangani, Charles; Maleta, Kenneth; Ashorn, Per; Hyöty, Heikki

    2015-01-01

    Giardia lamblia and Cryptosporidium species belong to a complex group of pathogens that cause diseases hampering development and socioeconomic improvements in the developing countries. Both pathogens are recognized as significant causes of diarrhea and nutritional disorders. However, further studies are needed to clarify the role of parasitic infections, especially asymptomatic infections in malnutrition and stunting. We developed a high-throughput multiplex quantitative polymerase chain reaction (qPCR) method for G. lamblia and Cryptosporidium spp. detection in stool samples. The sensitivity and specificity of the method were ensured by analyzing confirmed positive samples acquired from diagnostics laboratories and participating in an external quality control round. Its capability to detect asymptomatic G. lamblia and Cryptosporidium spp. infections was confirmed by analyzing stool samples collected from 44 asymptomatic 6-month-old infants living in an endemic region in Malawi. Of these, five samples were found to be positive for G. lamblia and two for Cryptosporidium spp. In conclusion, the developed method is suitable for large-scale studies evaluating the occurrence of G. lamblia and Cryptosporidium spp. in endemic regions and for clinical diagnostics of these infections. PMID:25918202

  20. High-throughput multiplex quantitative polymerase chain reaction method for Giardia lamblia and Cryptosporidium species detection in stool samples.

    PubMed

    Nurminen, Noora; Juuti, Rosa; Oikarinen, Sami; Fan, Yue-Mei; Lehto, Kirsi-Maarit; Mangani, Charles; Maleta, Kenneth; Ashorn, Per; Hyöty, Heikki

    2015-06-01

    Giardia lamblia and Cryptosporidium species belong to a complex group of pathogens that cause diseases hampering development and socioeconomic improvements in the developing countries. Both pathogens are recognized as significant causes of diarrhea and nutritional disorders. However, further studies are needed to clarify the role of parasitic infections, especially asymptomatic infections in malnutrition and stunting. We developed a high-throughput multiplex quantitative polymerase chain reaction (qPCR) method for G. lamblia and Cryptosporidium spp. detection in stool samples. The sensitivity and specificity of the method were ensured by analyzing confirmed positive samples acquired from diagnostics laboratories and participating in an external quality control round. Its capability to detect asymptomatic G. lamblia and Cryptosporidium spp. infections was confirmed by analyzing stool samples collected from 44 asymptomatic 6-month-old infants living in an endemic region in Malawi. Of these, five samples were found to be positive for G. lamblia and two for Cryptosporidium spp. In conclusion, the developed method is suitable for large-scale studies evaluating the occurrence of G. lamblia and Cryptosporidium spp. in endemic regions and for clinical diagnostics of these infections.

  1. A multiplex polymerase chain reaction assay to simultaneously distinguish Cryptosporidium species of veterinary and public health concern in cattle.

    PubMed

    Santín, Mónica; Zarlenga, Dante S

    2009-12-03

    Four species of Cryptosporidium are routinely found in cattle: Cryptosporidium parvum, Cryptosporidium bovis, Cryptosporidium ryanae, and Cryptosporidium andersoni. It is important to determine the species of Cryptosporidium in infected cattle because C. parvum is the only serious pathogen for humans as well as cattle. Identification of Cryptosporidium species and genotypes currently relies on molecular methods such as polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) or gene sequencing. Incorporation of these techniques in a routine veterinary diagnostic laboratory is cost prohibitive. As such, their applications are limited primarily to research and a few public health laboratories. To overcome this problem, a multiplex PCR assay was developed for simultaneously detecting the 4 species of Cryptosporidium that commonly infect cattle. This assay specifically identifies Cryptosporidium oocysts present in cattle feces, improves the detection of mixed infections, reduces the time and cost relative to current sequencing methods, and further demonstrates the shortcomings of sequencing as the definitive method for identification when analyzing samples containing mixed infections.

  2. Rapid identification of aminoglycoside-induced deafness gene mutations using multiplex real-time polymerase chain reaction.

    PubMed

    Huang, Shasha; Xiang, Guangxin; Kang, Dongyang; Wang, Chen; Kong, Yanling; Zhang, Xun; Liang, Shujian; Mitchelson, Keith; Xing, Wanli; Dai, Pu

    2015-07-01

    Exposure to aminoglycoside antibiotics can induce ototoxicity in genetically susceptible individuals carrying certain mitochondrial DNA (mtDNA) mutations (C1494T and A1555G), resulting in hearing loss. So, a rapid diagnostic approach is needed to accurately identify subjects carrying such gene mutations. In the present study, we describe a rapid and reliable four-color, real-time quantitative polymerase chain reaction (qPCR) assay for simultaneously detecting two mtDNA 12S rRNA gene variants, A1555G and C1494T, which are prevalent in the Han Chinese population. This multiplex assay incorporates three allele-specific TaqMan probes labeled with different fluorophores in a single reaction, providing high genotyping accuracy for clinical blood samples. Tests with C1494T, A1555G and wild-type DNA exhibited high sensitivity, specificity, reproducibility and accuracy of discriminating mutations from wild-type. This study shows that this simple and inexpensive method can be used for routine molecular diagnostics and potentially for large-scale genetic screening. Copyright © 2015. Published by Elsevier Ireland Ltd.

  3. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    PubMed

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes.

  4. Development of one-tube multiplex polymerase chain reaction (PCR) for detecting Mycobacterium bovis.

    PubMed

    Quan, Zhang; Haiming, Tan; Xiaoyao, Cai; Weifeng, Yuan; Hong, Jia; Hongfei, Zhu

    2017-01-10

    A multiplex PCR (m-PCR) with primers targeting the 16S rRNA, Rv3873 and a 12.7-kb fragment in the genomes of a Mycobacterium tuberculosis complex was designed for the differential diagnosis of M. tuberculosis, M. bovis, M. bovis BCG and non-tuberculosis Mycobacterium (NTM). The specificity of this assay was 100%, and the detection limit was 15 pg of genomic DNA. Of the 206 blinded clinical samples, the detection rate of M. bovis infection by m-PCR was lower than that of the interferon gamma (IFN-γ) release assay; however, the false-positive rate by the tuberculin skin test and false-negative samples in the IFN-γ release assay were reduced. Our findings indicated that our m-PCR method is a useful tool for complementation to differentiate M. bovis from M. tuberculosis and NTM species.

  5. Multiplex polymerase chain reaction for identification of Escherichia coli, Escherichia albertii and Escherichia fergusonii.

    PubMed

    Lindsey, Rebecca L; Garcia-Toledo, L; Fasulo, D; Gladney, L M; Strockbine, N

    2017-09-01

    Escherichia coli, Escherichia albertii, and Escherichia fergusonii are closely related bacteria that can cause illness in humans, such as bacteremia, urinary tract infections and diarrhea. Current identification strategies for these three species vary in complexity and typically rely on the use of multiple phenotypic and genetic tests. To facilitate their rapid identification, we developed a multiplex PCR assay targeting conserved, species-specific genes. We used the Daydreamer™ (Pattern Genomics, USA) software platform to concurrently analyze whole genome sequence assemblies (WGS) from 150 Enterobacteriaceae genomes (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other species) and design primers for the following species-specific regions: a 212bp region of the cyclic di-GMP regulator gene (cdgR, AW869_22935 from genome K-12 MG1655, CP014225) for E. coli/Shigella; a 393bp region of the DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025) for E. albertii; and a 575bp region of the palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158) for E. fergusonii. We incorporated the species-specific primers into a conventional multiplex PCR assay and assessed its performance with a collection of 97 Enterobacteriaceae strains. The assay was 100% sensitive and specific for detecting the expected species and offers a quick and accurate strategy for identifying E. coli, E. albertii, and E. fergusonii in either a single reaction or by in silico PCR with sequence assemblies. Published by Elsevier B.V.

  6. Randomized Trial of Rapid Multiplex Polymerase Chain Reaction–Based Blood Culture Identification and Susceptibility Testing

    PubMed Central

    Banerjee, Ritu; Teng, Christine B.; Cunningham, Scott A.; Ihde, Sherry M.; Steckelberg, James M.; Moriarty, James P.; Shah, Nilay D.; Mandrekar, Jayawant N.; Patel, Robin

    2015-01-01

    Background. The value of rapid, panel-based molecular diagnostics for positive blood culture bottles (BCBs) has not been rigorously assessed. We performed a prospective randomized controlled trial evaluating outcomes associated with rapid multiplex PCR (rmPCR) detection of bacteria, fungi, and resistance genes directly from positive BCBs. Methods. A total of 617 patients with positive BCBs underwent stratified randomization into 3 arms: standard BCB processing (control, n = 207), rmPCR reported with templated comments (rmPCR, n = 198), or rmPCR reported with templated comments and real-time audit and feedback of antimicrobial orders by an antimicrobial stewardship team (rmPCR/AS, n = 212). The primary outcome was antimicrobial therapy duration. Secondary outcomes were time to antimicrobial de-escalation or escalation, length of stay (LOS), mortality, and cost. Results. Time from BCB Gram stain to microorganism identification was shorter in the intervention group (1.3 hours) vs control (22.3 hours) (P < .001). Compared to the control group, both intervention groups had decreased broad-spectrum piperacillin-tazobactam (control 56 hours, rmPCR 44 hours, rmPCR/AS 45 hours; P = .01) and increased narrow-spectrum β-lactam (control 42 hours, rmPCR 71 hours, rmPCR/AS 85 hours; P = .04) use, and less treatment of contaminants (control 25%, rmPCR 11%, rmPCR/AS 8%; P = .015). Time from Gram stain to appropriate antimicrobial de-escalation or escalation was shortest in the rmPCR/AS group (de-escalation: rmPCR/AS 21 hours, control 34 hours, rmPCR 38 hours, P < .001; escalation: rmPCR/AS 5 hours, control 24 hours, rmPCR 6 hours, P = .04). Groups did not differ in mortality, LOS, or cost. Conclusions. rmPCR reported with templated comments reduced treatment of contaminants and use of broad-spectrum antimicrobials. Addition of antimicrobial stewardship enhanced antimicrobial de-escalation. Clinical Trials Registration. NCT01898208. PMID:26197846

  7. Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

    PubMed

    Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

    2016-11-22

    Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

  8. Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

    PubMed Central

    Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

    2010-01-01

    A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

  9. Development of a multiplex real-time polymerase chain reaction for the detection of influenza virus type A including H5 and H9 subtypes.

    PubMed

    Li, Pei-Qiong; Zhang, Jun; Muller, Claude P; Chen, Jing-Xian; Yang, Zi-Feng; Zhang, Ren; Li, Juan; He, Yun-Shao

    2008-06-01

    Avian influenza viruses (AIVs) are endemic in wild birds and, if transmitted to poultry, can cause serious economic losses. The aim of this study was to develop a multiplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) for rapid detection of influenza virus type A, including H5 and H9 subtypes. The selected primers and various labeled TaqMan reporter probes corresponding to matrix, H5, and H9 genes were used in a multiplex real-time RT-PCR to simultaneously detect triple fluorescent signals. The results showed that the multiplex real-time RT-PCR assay can be applied to detect RNA of influenza virus type A including H5 and H9 subtypes with a high specificity and a sensitivity of 10 copies per reaction. As a result of its short turnaround times and a high specificity and sensitivity, the assay is very suitable for large-scale screening during AIV outbreaks.

  10. Multipurpose assessment for the quantification of Vibrio spp. and total bacteria in fish and seawater using multiplex real-time polymerase chain reaction

    PubMed Central

    Kim, Ji Yeun; Lee, Jung-Lim

    2014-01-01

    Background This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. Results The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL−1 in pure culture and seawater, and 10 CFU g−1 in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Conclusion Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:24752974

  11. Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

    PubMed Central

    Latha, C.; Anu, C. J.; Ajaykumar, V. J.; Sunil, B.

    2017-01-01

    Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR) method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349), chicken (n=325), pork (n=310), chevon (n=50), and meat products (n=100) were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7%) was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost. PMID:28919685

  12. Detection and differentiation of genotype I and III Japanese encephalitis virus in mosquitoes by multiplex reverse transcriptase-polymerase chain reaction.

    PubMed

    Chen, Y Y; Lin, J W; Fan, Y C; Chiou, S S

    2014-02-01

    Japanese encephalitis (JE) is a disease that threatens both human and animal populations in Asian countries, and the causative agent of JE, Japanese encephalitis virus (JEV), has recently changed from genotype III (GIII) to genotype I (GI). However, a test for the rapid differentiation of GI and GIII JEV is still unavailable, especially one that can be used for mosquito-based surveillance. We have designed GI- and GIII-specific primer sets for the rapid detection and differentiation of GI and GIII JEV by multiplex reverse transcriptase-polymerase chain reaction (multiplex RT-PCR). The GI-specific and GIII-specific primer sets were able to specifically amplify the target gene from GI and GIII JEV, respectively. The limitations of detection were 0.00225 and 0.225 pfu for the GI-specific and GIII-specific primers, respectively. Using a mixture of GI-specific and GIII-specific primers, the multiplex RT-PCR was able to specifically detect and differentiate GI and GIII JEV. The multiplex RT-PCR was able to successfully differentiate GI and GIII virus in JEV-infected mosquitoes. Thus, a sensitive and specific multiplex RT-PCR system for the rapid detection and differentiation of GI and GIII JEV has been developed, and this test is likely to be valuable when carrying out mosquito-based JEV surveillance. © 2012 Blackwell Verlag GmbH.

  13. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

  14. Development of a novel dengue virus serotype-specific multiplex real-time reverse transcription-polymerase chain reaction assay for blood screening.

    PubMed

    Tezuka, Kenta; Kuramitsu, Madoka; Okuma, Kazu; Nojima, Kiyoko; Araki, Kumiko; Shinohara, Naoya; Matsumoto, Chieko; Satake, Masahiro; Takasaki, Tomohiko; Saijo, Masayuki; Kurane, Ichiro; Hamaguchi, Isao

    2016-12-01

    Dengue fever is caused by four related RNA viruses of the genus Flavivirus, dengue virus (DENV)-1, -2, -3, and -4, which are transmitted to humans by mosquitoes. Although DENV is not endemic in Japan, an autochthonous dengue outbreak occurred in 2014. Several transfusion-transmitted cases have also been reported after the use of blood and plasma products in DENV-endemic countries. The aim of this study was to develop a novel multiplex reverse transcription-polymerase chain reaction (RT-PCR) assay for DENV blood screening. Large-scale oligonucleotide screening was performed to obtain DENV-specific primers and probes using a variety of DENV clinical isolates. A multiplex RT-PCR assay was then developed using the identified oligonucleotides and the ability of this assay to detect DENV RNA was evaluated. A number of oligonucleotides suitable for DENV RNA detection were identified and a novel DENV serotype-specific multiplex RT-PCR assay was successfully established. Comparative analysis revealed that the multiplex assay could detect levels of viral contamination as low as 100 viral copies/mL. This established serotype-specific multiplex RT-PCR assay provides a simple, sensitive, and quantitative detection method for DENV, which could be applied in the screening of blood samples to prevent transfusion-transmitted DENV infection. © 2016 AABB.

  15. Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples.

    PubMed

    Tramuta, Clara; Lacerenza, Daniela; Zoppi, Simona; Goria, Mariella; Dondo, Alessandro; Ferroglio, Ezio; Nebbia, Patrizia; Rosati, Sergio

    2011-07-01

    The current study describes the development of a set of 5 multiplex polymerase chain reaction (mPCR) assays for the simultaneous detection of abortive infection agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mPCR1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mPCR2); Coxiella burnetii and Chlamydophila psittaci (mPCR3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mPCR4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mPCR5). The protocol was tested on different tissue samples collected from 50 aborted bovine fetuses, and it showed that out of the 50 fetuses, 7 (14%, mPCR2) were PCR-positive for N. caninum, 4 (8%, mPCR5) were PCR-positive for BVDV, and 2 (4%, mPCR4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Moreover, all multiplex PCR assays on clinical samples were compared with reference methods, obtaining a perfect accordance in all samples and confirming the validity of the set of multiplex PCR assays. The proposed set of multiplex PCR assays is, therefore, suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion.

  16. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  17. A sensitive and a rapid multiplex polymerase chain reaction for the identification of Candida species in concentrated oral rinse specimens in patients with diabetes.

    PubMed

    Sampath, Asanga; Weerasekera, Manjula; Gunasekara, Chinthika; Dilhari, Ayomi; Bulugahapitiya, Uditha; Fernando, Neluka

    2017-03-01

    Oral candidiasis is being frequently recognized in patients with diabetes, and is associated with multiple pathogens including Candida albicans, Candida parapsilosis, Candida glabrata and Candida tropicalis. The aim of this study was to evaluate a usefulness of a Multiplex Polymerase Chain Reaction as a rapid diagnostic tool for identification of four oral Candida pathogens in patients with diabetes. A multiplex PCR was optimized to identify four Candida species in concentrated oral rinse samples. Common reverse primer, ITS4 and four species-specific forward primers targeting ITS1 and ITS2 regions of yeast genome were used. Species-specific single amplicon were detected by agarose gel electrophoresis. Performance efficacy of multiplex PCR was compared with phenotypic identification. Out of 100 oral rinse samples, 72 were culture positive and of these 43 were at risk of oral Candida infection (>600cfu/ml). Multiple Candida species including C. albicans, C. parapsilosis and C. tropicalis were identified in 22 samples which had risk of oral Candida infection. In total, 85 patients were positive for Candida by multiplex PCR and of them 49 had multiple Candida species. All 43 colonized specimens were also positive by multiplex PCR. C. albicans was the most predominant organism (75/85) followed by C. parapsilosis (47/85), C. tropicalis (17/85) and C. glabrata (6/85). In specimens with multiple species, the two most common organisms were C. albicans and C. parapsilosis. Multiplex PCR yielded a sensitivity of 10 Candida cells/ml of oral rinse sample. Multiplex PCR is found to be rapid, sensitive and specific than phenotypic identification methods in discriminating multiple Candida species in oral rinse specimens.

  18. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.

    PubMed

    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R

    2001-06-01

    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  19. Utilization of the respiratory virus multiplex reverse transcription-polymerase chain reaction test for adult patients at a Korean tertiary care center.

    PubMed

    Ahn, Mi Young; Choi, Seong-Ho; Chung, Jin-Won; Kim, Hye Ryoun

    2015-01-01

    Respiratory viruses (RVs) are considered to be important respiratory pathogens in adult patients, and the multiplex reverse transcription-polymerase chain reaction (RT-PCR) test is used frequently in adult patients with respiratory infections. However, clinical data regarding utilization of the multiplex RT-PCR test for RVs are lacking. We investigated the utilization of the multiplex RT-PCR test for RVs at Chung-Ang University Hospital in Seoul, Korea, between January 2012 and April 2013. During the study period, the multiplex RT-PCR test was performed for 291 adult patients. The test frequency was 4.9% of rapid influenza antigen detection tests and 0.8% of respiratory bacterial culture studies. A turnaround time of < 48 hours was observed in 25.9% of positive tests. Most of the tests were performed for admitted patients (97.9%) with a community-acquired infection (84.2%) during the flu season (82.5%). RVs were detected in 81 of 291 cases (27.8%). The RV positivity rates for community- and hospital-acquired infections did not differ (28.6% vs. 23.9%, p = 0.52). Of 166 patients with pneumonia, 44 (26.5%) had a viral infection. Among the patients with RV-associated pneumonia, an RV other than influenza was detected in 20 patients (45.4%). The multiplex RT-PCR test for RVs was infrequently performed at a tertiary care center, and the test results were often reported late. The test was most often performed for admitted adult patients with community-acquired infections during the flu season. The utilization of multiplex RT-PCR testing for RVs in current clinical practice should be improved.

  20. Rapid and inexpensive species differentiation using a multiplex real-time polymerase chain reaction high-resolution melt assay.

    PubMed

    Elkins, Kelly M; Perez, Anjelica C U; Sweetin, Katherine C

    2016-05-01

    We demonstrate a method for developing real-time polymerase chain reaction (PCR) high-resolution melt (HRM) assays to identify multiple species present in a mixture simultaneously using LCGreen Plus and melt temperatures. Highly specific PCR primers are designed to yield amplicons with different melt temperatures for simple routine species identification compared with differentiating melt curve kinetics traces or difference plots. This method is robust and automatable, and it leads to savings in time and reagent costs, is easily modified to probe any species of interest, eliminates the need for post-PCR gel or capillary electrophoresis in routine assays, and requires no expensive dye-labeled primers.

  1. Role of multiplex polymerase chain reaction using IS6110 and Protein b for the diagnosis of extra-pulmonary tuberculosis: North India.

    PubMed

    Sharma, Kusum; Appannanavar, Suma B; Modi, Manish; Singh, Malkit; Sharma, Aman; Varma, Subhash

    2015-01-01

    Prompt and accurate diagnosis of extra-pulmonary tuberculosis (TB) is highly challenging. Current conventional techniques lack sensitivity and are time-consuming. Here, we report our experience with multiplex polymerase chain reaction (MPCR) using two targets namely IS6110 and protein antigen b in the diagnosis of extra-pulmonary TB. A total of 150 patients of extra-pulmonary TB visiting tertiary care center in north India between September 2008 and December 2009 were included in the study. Sixty-six biopsy samples and 84 were body fluids from these patients were subjected for microscopy (Ziehl-Neelsen), culture on LJ medium and for Multiplex PCR using IS6110 and Protein b antigen. Smear positivity was noted in 11 samples (7.33%), and LJ culture yielded Mycobacterium tuberculosis in 8 biopsies and 9 body fluids with overall positivity of 11.3%. The multi-targeted PCR could detect M. tuberculosis in a total of 112 samples. Of 112 positive samples, only Protein b band was detected in 7 samples and only IS6110 was detected in 5 samples. Overall Protein b, PCR could detect 71.33% of the cases, whereas IS6110 was positive in 66.6% of the cases. Overall the sensitivities of microscopy, culture, IS6110 PCR, Protein b PCR and MPCR were 7.33%, 11.3%, 66.67%, 71.3% and 74.6%, respectively. Thus by using more than two targets the sensitivity increased from 66.67% of IS6110 to 74.6% in MPCR. Multiplex polymerase chain reaction using IS6110 and Protein b antigen is a highly sensitive and specific tool in the diagnosis of pauci-bacillary conditions like extra-pulmonary TB.

  2. Detection of Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari in skin biopsy specimens using a multiplex real-time polymerase chain reaction assay.

    PubMed

    Denison, Amy M; Amin, Bijal D; Nicholson, William L; Paddock, Christopher D

    2014-09-01

    Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari are the most common causes of spotted fever group rickettsioses indigenous to the United States. Infected patients characteristically present with a maculopapular rash, often accompanied by an inoculation eschar. Skin biopsy specimens are often obtained from these lesions for diagnostic evaluation. However, a species-specific diagnosis is achieved infrequently from pathologic specimens because immunohistochemical stains do not differentiate among the causative agents of spotted fever group rickettsiae, and existing polymerase chain reaction (PCR) assays generally target large gene segments that may be difficult or impossible to obtain from formalin-fixed tissues. This work describes the development and evaluation of a multiplex real-time PCR assay for the detection of these 3 Rickettsia species from formalin-fixed, paraffin-embedded (FFPE) skin biopsy specimens. The multiplex PCR assay was specific at discriminating each species from FFPE controls of unrelated bacterial, viral, protozoan, and fungal pathogens that cause skin lesions, as well as other closely related spotted fever group Rickettsia species. This multiplex real-time PCR demonstrates greater sensitivity than nested PCR assays in FFPE tissues and provides an effective method to specifically identify cases of Rocky Mountain spotted fever, rickettsialpox, and R. parkeri rickettsiosis by using skin biopsy specimens. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  3. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials.

  4. PrimRglo: a multiplexable quantitative real-time polymerase chain reaction system for nucleic acid detection.

    PubMed

    Lai, Richard; Liang, Fang; Pearson, Darnley; Barnett, Graeme; Whiley, David; Sloots, Theo; Barnard, Ross T; Corrie, Simon R

    2012-03-15

    We report the development of a new real-time polymerase chain reaction (PCR) detection system that uses oligonucleotide "tagged" PCR primers, a fluorophore-labeled "universal" detection oligonucleotides, and a complementary quenching oligonucleotide. The fluorescence signal decreases as PCR product accumulates due to the increase in detection/quencher hybrid formation as the tagged primer is consumed. We use plasmids containing the influenza A matrix gene and the porA and ctrA genes of Neisseria meningitidis as targets for developing the system. Cycle threshold (Ct) values were generated, and the sensitivity of the new system (dubbed "PrimRglo") compared favorably with the commonly used SYBR green and Taqman detection systems and, unlike the latter system, does not require the design of a new dual-labeled detection oligonucleotide for each new target sequence.

  5. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  6. Discrimination of Culicoides midge larvae using multiplex polymerase chain reaction assays based on DNA sequence variation at the mitochondrial cytochrome C oxidase I gene.

    PubMed

    Schwenkenbecher, Jan M; Mordue, A Jennifer; Switek, Krzysztof; Piertney, Stuart B

    2009-05-01

    The recent spread of Bluetongue disease in northwestern Europe has indicated the ability of Palaearctic Culicoides species to vector the disease. Because the different midge species vary in their ability to harbor and transmit the Bluetongue virus, quick and reliable identification is necessary to resolve the species composition of midge communities, both adult and larval, at any place at any given time point. Given that morphological identification of Culicoides species is problematic, we developed three multiplex polymerase chain reaction (PCR) assays that facilitate high-throughput analysis of midge specimens. One assay distinguishes between species of the so-called Culicoides obsoletus s.l. complex (including C. dewulfi), whereas two assays facilitate differentiation of species of the Culicoides pulicaris s.l. complex. These assays yield two PCR products: one species-specific and one generic band. We show the application of the assays in the analysis of Culicoides larvae from three different farms in northeast Scotland.

  7. Development of multiplex real-time polymerase chain reaction for detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in clinical specimens.

    PubMed

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-10-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas.

  8. Detection of somatic quantitative genetic alterations by multiplex polymerase chain reaction for the prediction of outcome in diffuse large B-cell lymphomas.

    PubMed

    Jardin, Fabrice; Ruminy, Philippe; Kerckaert, Jean-Pierre; Parmentier, Françoise; Picquenot, Jean-Michel; Quief, Sabine; Villenet, Céline; Buchonnet, Gérard; Tosi, Mario; Frebourg, Thierry; Bastard, Christian; Tilly, Hervé

    2008-04-01

    Genomic gains and losses play a crucial role in the development of diffuse large B-cell lymphomas. High resolution array comparative genomic hybridization provides a comprehensive view of these genomic imbalances but is not routinely applicable. We developed a polymerase chain reaction assay to provide information regarding gains or losses of relevant genes and prognosis in diffuse large B-cell lymphomas. Two polymerase chain reaction assays (multiplex polymerase chain reaction of short fluorescent fragments, QMPSF) were designed to detect gains or losses of c-REL, BCL6, SIM1, PTPRK, MYC, CDKN2A, MDM2, CDKN1B, TP53 and BCL2. Array comparative genomic hybridization was simultaneously performed to evaluate the sensitivity and predictive value of the QMPSF assay. The biological and clinical relevance of this assay were assessed. The predictive value of the QMPSF assay for detecting abnormal DNA copy numbers ranged between 88-97%, giving an overall concordance rate of 92% with comparative genomic hybridization results. In 77 cases of diffuse large B-cell lymphomas, gains of MYC, CDKN1B, c-REL and BCL2 were detected in 12%, 40%, 27% and 29%, respectively. TP53 and CDKN2A deletions were observed in 22% and 36% respectively. BCL2 and CDKN2A allelic status correlated with protein expression. TP53 mutations were associated with allelic deletions in 45% of cases. The prognostic value of a single QMPSF assay including TP53, MYC, CDKN2A, SIM1 and CDKN1B was predictive of the outcome independently of the germinal center B-cell like/non-germinal center B-cell like subtype or the International Prognostic Index. QMPSF is a reliable and flexible method for detecting somatic quantitative genetic alterations in diffuse large B-cell lymphomas and could be integrated in future prognostic predictive models.

  9. The polymerase chain reaction.

    PubMed

    Welch, Hazel M

    2012-01-01

    The polymerase chain reaction (PCR) has had a significant impact on all aspects of the molecular biosciences, from cancer research to forensic science. The sensitivity and specificity inherent in the technique allow minute quantities of genetic material to be detected while the unique properties of thermostable DNA polymerase ensure that abundant copies are reliably reproduced to levels that can be visualized and/or used for further applications. This chapter describes applications of PCR and PCR-RT to investigate primary cancer and metastatic disease at both the DNA and mRNA expression levels.

  10. Rapid and sensitive detection of 68 unique varicella zoster virus gene transcripts in five multiplex reverse transcription-polymerase chain reactions

    PubMed Central

    Nagel, Maria A.; Gilden, Don; Shade, Ted; Gao, Bifeng; Cohrs, Randall J.

    2010-01-01

    Varicella zoster virus (VZV) becomes latent in ganglionic neurons along the entire neuraxis. Although all predicted VZV open reading frames (ORFs) have been detected by macroarray and microarray analysis in virus-infected cells in culture where virus gene expression is abundant, array technology does not detect all VZV gene transcripts in latently-infected human ganglia, where the abundance of ganglionic RNA is low and VZV gene transcription is highly variable. Using reverse transcription-polymerase chain reaction (RT-PCR) and the GenomeLab Genetic Analysis System (GeXPS), transcripts mapping to all 68 predicted unique VZV ORFs were detected in VZV-infected MeWo cells. Oligonucleotide primers contained both VZV- and cell-specific sequences linked to universal DNA sequences such that PCR amplification products were of predetermined sizes. Amplification products were resolved by capillary gel electrophoresis and detected by fluorescence spectrophotometry. Serial dilutions of total RNA extracted from VZV-infected MeWo cells were analyzed in parallel by GeXPS multiplex RT-PCR and real-time RT-PCR. GeXPS technology detected as few as 20 copies of VZV gene-specific transcripts. Only five multiplex RT-PCR assays were needed to analyze the entire VZV transcriptome. This technology will allow rapid analysis of all VZV genes transcribed during latency in human ganglia. PMID:19109999

  11. Impact of the multiplex polymerase chain reaction in culture-positive samples on appropriate antibiotic use in patients with staphylococcal bacteremia.

    PubMed

    Na, Sun Hee; Kim, Chung-Jong; Kim, Moonsuk; Park, Jeong Su; Song, Kyoung-Ho; Choe, Pyoeng Gyun; Park, Wan Beom; Bang, Ji-Hwan; Kim, Eu Suk; Park, Sang Won; Park, Kyoung Un; Kim, Nam Joong; Oh, Myoung-Don; Kim, Hong Bin

    2016-04-01

    Rapid identification of the microorganisms in patients with bacteremia may be useful in clinical practice. We evaluated the impact of the multiplex polymerase chain reaction (PCR) on appropriate antibiotic use for patients with gram-positive cocci cluster (GPCC) bacteremia. We divided the GPCC bacteremia cases into a pre-PCR group (2010-2011) and a post-PCR group (2012-2013). A total 664 cases were included in the pre-PCR group; and 570, in the post-PCR group. In methicillin-susceptible Staphylococcus aureus (MSSA) cases, optimal antibiotics were administered earlier in the post-PCR group (77.4h versus 42.6h, P=0.035). Although the proportions of glycopeptide exposure did not differ (54.7% versus 56.7%, P=0.799), the duration of exposure decreased (69.6h versus 30.7h, P=0.004). In methicillin-resistant S. aureus cases, the time to optimal antibiotics administration did not differ (45.4h versus 43.7h, P=0.275). Multiplex PCR test significantly improved the early initiation of optimal antibiotics in MSSA bacteremia and reduced the unnecessary glycopeptide exposure. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Simultaneous detection of Chlamydia spp., Coxiella burnetii, and Neospora caninum in abortion material of ruminants by multiplex real-time polymerase chain reaction.

    PubMed

    Reisberg, Kerstin; Selim, Abdelfattah M; Gaede, Wolfgang

    2013-09-01

    Chlamydia spp., Coxiella burnetii, and Neospora caninum are responsible for reproductive diseases and are closely linked with high abortion rates in ruminants. Furthermore, C. burnetii and Chlamydia spp. have zoonotic potential. A real-time polymerase chain reaction (PCR) assay was developed for the simultaneous detection of Chlamydia spp., C. burnetii, and N. caninum. The detection of beta-actin as internal control in the same PCR reaction provides additional information about sample quality by detecting the presence of PCR inhibitors. The multiplex real-time PCR developed in the current study shows a greater sensitivity compared to previously used single-target PCR reactions with a reproducible detection limit of 0.13 plasmid copies per PCR for each target. Additional parallel amplification of all detectable pathogens did not adversely impact sensitivity. This new multiplex PCR allows the highly sensitive, cost-effective, and rapid detection of 3 important pathogens and has the potential to be a useful time-saving tool in the routine diagnosis of abortion cases in ruminants.

  13. Detection of genetically modified crops using multiplex asymmetric polymerase chain reaction and asymmetric hyperbranched rolling circle amplification coupled with reverse dot blot.

    PubMed

    Wang, Xiumin; Teng, Da; Guan, Qingfeng; Tian, Fang; Wang, Jianhua

    2015-04-15

    To meet the ever-increasing demand for detection of genetically modified crops (GMCs), low-cost, high-throughput and high-accuracy detection assays are needed. The new multiplex asymmetric polymerase chain reaction and asymmetric hyper-branched rolling circle amplification coupled with reverse dot blot (RDB) systems were developed to detect GMCs. Thirteen oligonucleotide probes were designed to identify endogenous targets (Lec1, Hmg and Sad1), event-specific targets (RRS-5C, RRS-3C, Bt176-3C and MON810-3C), screening targets (35S promoter and NOS terminator), and control targets (18S and PLX). Optimised conditions were as follows: tailed hybridization probes (1-2 pmol/l) were immobilized on a membrane by baking for 2h, and a 10:1 ratio of forward to reverse primers was used. The detection limits were 0.1 μg/l of 2% RRS and 0.5 ng/l of DNA from genetically modified (GM) soybean. These results indicate that the RDB assay could be used to detect multiplex target genes of GMCs rapidly and inexpensively.

  14. Novel single-step multiplex real-time polymerase chain reaction assay for simultaneous quantification of hepatitis virus A, B, C, and E in serum.

    PubMed

    Irshad, Mohammad; Ansari, Mohammad Ahmad; Irshad, Khushboo; Lingaiah, Raghavendra

    2013-12-01

    Viral hepatitis needs an earliest diagnosis for its proper and timely treatment. Although serodiagnosis of viral hepatitis is in regular practice, however, it has certain limitations and points to alternate procedures of diagnosis. Present study was designed to develop a single-step multiplex real-time polymerase chain reaction (PCR) assay for detection of hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV) and hepatitis E virus (HEV) related nucleic acids in sera from infected patients. The PCR was standardized to detect HAV, HBV, HCV and HEV in serum using variables including annealing temperature, extension temperature, MgCl2 , and primer concentrations. The conserved regions of all viral genomes were used as targets for amplification. This novel assay was found to be a fast, sensitive, specific, and reproducible system for detection of HAV, HBV, HCV, and HEV in serum. The detection limit for different viral genomes at 100% level was found to be 280 copies/mL for HAV, 290 copies/mL for HBV, 30 copies/mL for HCV, and 300 copies/mL for HEV in a single-tube assay system. Present multiplex real-time PCR is the first report on single-step nucleic acid detection of HAV, HBV, HCV, and HEV in sera samples. It is an alternate diagnostic assay for common use in laboratories analyzing viral hepatitis cases. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  15. A Novel Capillary Electrophoresis-Based High-Throughput Multiplex Polymerase Chain Reaction System for the Simultaneous Detection of Nine Pathogens in Swine

    PubMed Central

    2017-01-01

    Here we aimed to develop a capillary electrophoresis-based high-throughput multiplex polymerase chain reaction (PCR) system for the simultaneous detection of nine pathogens in swine. Nine pairs of specific primers and a set of universal primers were designed; the multiplex PCR was established. The specificity and cross-reactivity of this assay were examined, and the detection limit was determined using serial 10-fold dilutions of plasmids containing the target sequences. The assay was further tested using 144 clinical samples. We found that the nine specific amplification peaks were observed, and the assay had a high degree of specificity, without nonspecific amplification. The simultaneous detection limit for the nine viruses reached 10000 copies μL−1 when all of the premixed viral targets were present. Seventy-seven of the clinical samples tested positive for at least one of the viruses; the principal viral infections in the clinical samples were porcine circovirus type 2 and porcine reproductive and respiratory syndrome virus. This approach has much potential for further development of high-throughput detection tools for the diagnosis of diseases in animals. PMID:28691030

  16. Quantitation of Bt-176 maize genomic sequences by surface plasmon resonance-based biospecific interaction analysis of multiplex polymerase chain reaction (PCR).

    PubMed

    Feriotto, Giordana; Gardenghi, Sara; Bianchi, Nicoletta; Gambari, Roberto

    2003-07-30

    Surface plasmon resonance (SPR) based biosensors have been described for the identification of genetically modified organisms (GMO) by biospecific interaction analysis (BIA). This paper describes the design and testing of an SPR-based BIA protocol for quantitative determinations of GMOs. Biotinylated multiplex Polymerase Chain Reaction (PCR) products from nontransgenic maize as well as maize powders containing 0.5 and 2% genetically modified Bt-176 sequences were immobilized on different flow cells of a sensor chip. After immobilization, different oligonucleotide probes recognizing maize zein and Bt-176 sequences were injected. The results obtained were compared with Southern blot analysis and with quantitative real-time PCR assays. It was demonstrated that sequential injections of Bt-176 and zein probes to sensor chip flow cells containing multiplex PCR products allow discrimination between PCR performed using maize genomic DNA containing 0.5% Bt-176 sequences and that performed using maize genomic DNA containing 2% Bt-176 sequences. The efficiency of SPR-based BIA in discriminating material containing different amounts of Bt-176 maize is comparable to real-time quantitative PCR and much more reliable than Southern blotting, which in the past has been used for semiquantitative purposes. Furthermore, the approach allows the BIA assay to be repeated several times on the same multiplex PCR product immobilized on the sensor chip, after washing and regeneration of the flow cell. Finally, it is emphasized that the presented strategy to quantify GMOs could be proposed for all of the SPR-based, commercially available biosensors. Some of these optical SPR-based biosensors use, instead of flow-based sensor chips, stirred microcuvettes, reducing the costs of the experimentation.

  17. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    PubMed Central

    Bhat, M. Mansoor; Salahuddin, Mir; Mantoo, Imtiyaz A.; Adil, Sheikh; Jalal, Henna; Pal, M. Ashraf

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materials and Methods: Three experimental trials were conducted wherein the products were prepared from pure mutton, beef and buffalo meat, and their admixtures in the ratios of 60:20:20, 80:10:10, 90:05:05 and 98:01:01, respectively. Results: The primers used in the study amplified the cyt b gene fragments of sizes 124 bp, 472 bp and 585 bp for buffalo, cattle and sheep, respectively. It was possible to detect cattle and buffalo meat at the level of 1% in the mixed meat cooked Rista. The multiplex PCR successfully amplified cyt b gene fragments of mtDNA of the target species and thus produced characteristic band pattern for each species. The band intensities of cattle and buffalo in the mixed meat Rista progressively decreased corresponding to their decreasing level from 20% to 1%. Processing, cooking (moist heating) and non-meat formulation ingredients had no effect on detection of meat species adulteration. Conclusion: The multiplex PCR procedure standardized and developed in this study is simple, efficient, sensitive, reliable and highly specific for detecting falsification of cooked mutton product with beef and buffalo meat up to 1% level. PMID:27057103

  18. Simultaneous detection of the seven main tomato-infecting RNA viruses by two multiplex reverse transcription polymerase chain reactions.

    PubMed

    Panno, Stefano; Davino, Salvatore; Rubio, Luis; Rangel, Ezequiel; Davino, Mario; García-Hernández, Jorge; Olmos, Antonio

    2012-12-01

    Cucumber mosaic virus, Tomato spotted wilt virus, Tomato mosaic virus, Tomato chlorosis virus, Pepino mosaic virus, Torrado tomato virus and Tomato infectious chlorosis virus cause serious damage and significant economic losses in tomato crops worldwide. The early detection of these pathogens is essential for preventing the viruses from spreading and improving their control. In this study, a procedure based on two multiplex RT-PCRs was developed for the sensitive and reliable detection of these seven viruses. Serial dilutions of positive controls were analysed by this methodology, and the results were compared with those obtained by ELISA and singleplex versions of RT-PCR. The multiplex and singleplex RT-PCR assays were able to detect specific targets at the same dilution and were 100 times more sensitive than ELISA. The multiplex versions were able to detect composite samples containing different concentrations of specific targets at ratios from 1:1 to 1:1000. In addition, 45 symptomatic tomato samples collected in different tomato-growing areas of Sicily (Italy) were analysed by multiplex RT-PCR, singleplex RT-PCR and commercially available ELISA tests. Similar results were obtained using the RT-PCR techniques, with a higher sensitivity than ELISA, revealing a common occurrence of mixed infections and confirming the presence of these seven virus species in Italy.

  19. Simultaneous detection of Pyrethroid, Organophosphate and Cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex Polymerase chain reaction

    USDA-ARS?s Scientific Manuscript database

    The horn fly, Haematobia irritans irritans (Linnaeus, 1758), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex...

  20. Development of a multiplex polymerase chain reaction assay for simultaneous identification of human enterovirus 71 and coxsackievirus A16

    PubMed Central

    Thao, Nguyen Thi Thanh; Ngoc, Nguyen Thi Kim; Tú, Phan Văn; Thúy, Trần Thi; Cardosa, Mary Jane; McMinn, Peter Charles; Phuektes, Patchara

    2010-01-01

    Human enterovirus 71 (HEV71) and coxsackievirus A16 (CVA16) are two major aetiological agents of hand, foot and mouth disease (HFMD) in children. Recently there have been several large outbreaks of HFMD in Vietnam and the Asia-Pacific region. In this study, a multiplex RT-PCR assay was developed in order to detect simultaneously HEV71, CVA16 and other human enteroviruses. Enterovirus detection was performed with a mixture of three pairs of oligonucleotide primers: one pair of published primers for amplifying all known enterovirus genomes and two new primer pairs specific for detection of the VP1 genes of HEV71 and CVA16. Enterovirus isolates, CVA16 and HEV71 strains identified previously from patients with HFMD were examined to evaluate the sensitivity and specificity of the multiplex RT-PCR assay. The assay was then applied to the direct detection of these viruses in clinical specimens obtained from HFMD cases identified at Children's Hospital Number 2, Ho Chi Minh City, Vietnam. The multiplex RT-PCR assay showed 100% specificity in screening for enteroviruses and in identifying HEV71 and CVA16. Similar results were obtained when using the multiplex RT-PCR assay to screen for enteroviruses and to identify HEV71 and CVA16 in clinical specimens obtained from HFMD cases identified at the hospital. This multiplex RT-PCR assay is a rapid, sensitive and specific assay for the diagnosis of HEV71 or CVA16 infection in cases of HFMD and is also potentially useful for molecular epidemiological investigations. PMID:20863857

  1. Discrimination and simultaneous detection of two myxozoan parasites belonging to genus Thelohanellus by multiplex polymerase chain reaction.

    PubMed

    Woo, Sung Ho; Seo, Jung Soo; Lee, Eun Hye

    2014-06-16

    Thelohanellus kitauei and Thelohanellus hovorkai are myxozoan parasites pathogenic in cyprinid fish especially adult Israel carp and common carp. In the present study, the complete 18S rRNA-ITS1-5.8S rRNA-ITS2 sequences of these two Thelohanellus species were cloned with primers designed from information from Genbank and previous studies. The results revealed that ITS1 and ITS2 sequences of T. kitauei and T. hovorkai were clearly distinguished although the 18S rRNA regions of the two parasites were highly conserved. Based on these sequences, new primer sets were designed for specific identification of these two parasites by multiplex PCR. Both single and multiplex PCR methods using these primers could identify these two myxozoan parasites from mixed DNA samples successfully. Our findings provide a powerful tool for the differentiation of the highly similar pathogenic Thelohanellus species for specific detection for the early diagnosis of diseases.

  2. Clinical screening of gene rearrangements in childhood leukemia by using a multiplex polymerase chain reaction-microarray approach.

    PubMed

    Nasedkina, Tatyana V; Zharinov, Vladislav S; Isaeva, Ekaterina A; Mityaeva, Olga N; Yurasov, Roman N; Surzhikov, Sergei A; Turigin, Alexander Y; Rubina, Alla Y; Karachunskii, Alexander I; Gartenhaus, Ronald B; Mirzabekov, Andrei D

    2003-11-15

    Currently, many forms of leukemia are considered potentially curable, with prognosis and clinical outcome strongly dependent on the underlying molecular pathophysiology. A substantial number of leukemia patients harbor nonrandom karyotypic abnormalities that define subgroups with unique biological and clinical features. For detection of these types of gene rearrangements, a combination of multiplex RT-PCR with hybridization on oligonucleotide gel array was presented previously, which identified five chromosomal translocations with fusion variants. In the present study, additional clinically relevant translocations were included in our analysis using a second generation of microarrays. We also expanded significantly on the clinical correlation of our findings. An oligonucleotide microarray was designed for hybridization with products of a multiplex RT-PCR to identify the following translocations: t(9;22)p190, t(4;11), t(12;21), t(1;19), typical for acute lymphoblastic leukemia; t(9;22)p210 for chronic myeloid leukemia; and t(8;21), t(15;17), inv16, typical for acute myeloblastic leukemia. To demonstrate the potential clinical application of the method, 247 cases of childhood leukemia were screened, and the above-mentioned gene rearrangements were found in 30% of cases. The sensitivity and specificity of the assay is comparable with the RT-PCR technique, so that it can be used to follow minimal residual disease. The feasibility of an additional refinement of the method, on-chip-multiplex PCR, has been successfully demonstrated by identifying a common translocation, t(9;22), in chronic myeloid leukemia. Our data suggest that the microarray-based assay can be an effective and reliable tool in the clinical screening of leukemia patients for the presence of specific gene rearrangements with important diagnostic and prognostic implications. The method is amenable for automation and high-throughput analysis.

  3. Detection of novel Bartonella strains and Yersinia pestis in prairie dogs and their fleas (Siphonaptera: Ceratophyllidae and Pulicidae) using multiplex polymerase chain reaction.

    PubMed

    Stevenson, Heather L; Bai, Ying; Kosoy, Michael Y; Montenieri, John A; Lowell, Jennifer L; Chu, May C; Gage, Kenneth L

    2003-05-01

    We developed a multiplex polymerase chain reaction (PCR) assay that simultaneously detects three types of flea-associated microorganisms. Targets for the assay were sequences encoding portions of the gltA, a 17-kDa antigen, and pla genes of Bartonella spp. Strong et al., Rickettsia spp. da Rocha-Lima, and Yersinia pestis Yersin, respectively. A total of 260 flea samples containing bloodmeal remnants were analyzed from fleas collected from abandoned prairie dog (Cynomys ludovicianus) burrows at the site of an active plague epizootic in Jefferson County, CO. Results indicated that 34 (13.1%) fleas were positive for Bartonella spp., 0 (0%) were positive for Rickettsia spp., and 120 (46.2%) were positive for Y. pestis. Twenty-three (8.8%) of these fleas were coinfected with Bartonella spp. and Y. pestis. A second group of 295 bloodmeal-containing fleas was collected and analyzed from abandoned burrows in Logan County, CO, where a prairie dog die-off had occurred 2-4 mo before the time of sampling. Of these 295 fleas, 7 (2.4%) were positive for Bartonella spp., 0 (0%) were positive for Rickettsia spp., and 46 (15.6%) were positive for Y. pestis. Coinfections were not observed in fleas from the Logan County epizootic site. The multiplex PCR also was used to identify Y. pestis and Bartonella in prairie dog blood and tissues. This report represents the first identification of Bartonella from prairie dogs and their fleas. Prairie dog fleas were tested with PCR, and the Bartonella PCR amplicons produced were sequenced and found to be closely related to similar sequences amplified from Bartonella that had been isolated from prairie dog blood samples. Phylogenetic analyses indicate that the sequences of bartonellae from prairie dogs and prairie dog fleas cluster tightly within a clade that is distinct from those containing other known Bartonella genotypes.

  4. An integrated slidable and valveless microdevice with solid phase extraction, polymerase chain reaction, and immunochromatographic strip parts for multiplex colorimetric pathogen detection.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Kim, Do Hyun; Seo, Tae Seok

    2015-11-07

    A total integrated genetic analysis microsystem was developed, which consisted of solid phase extraction (SPE), polymerase chain reaction (PCR), and immunochromatographic strip (ICS) parts for multiplex colorimetric detection of pathogenic Staphylococcus aureus (S. aureus) and Escherichia coli O157:H7 (E. coli O157:H7) on a portable genetic analyzer. Utilizing a slidable chamber, which is a movable glass wafer, complex microvalves could be eliminated for fluidic control in the microchannel, which could simplify the chip design and chip operation. The integrated slidable microdevice was composed of 4 layers: a 4-point Pt/Ti resistance temperature detector (RTD) wafer, a micro-patterned channel wafer, a 2 μL volume slidable chamber, and an ICS. The entire process from the DNA extraction in the SPE chamber to the detection of the target gene expression by the ICS was serially performed by simply sliding the slidable chamber from one part to another functional part. The total process for multiplex pathogenic S. aureus and E. coli O157:H7 detection on the integrated slidable microdevice was accomplished within 55 min with a detection limit of 5 cells. Furthermore, spiked bacteria samples in milk were also successfully analysed on the portable genetic analysis microsystem with sample-in-answer-out capability. The proposed total integrated microsystem is adequate for point-of-care DNA testing in that no microvalves and complex tubing systems are required due to the use of the slidable chamber and the bulky and expensive fluorescence or electrochemical detectors are not necessary due to the ICS based colorimetric detection.

  5. A Novel Semiquantitative Fluorescence-Based Multiplex Polymerase Chain Reaction Assay for Rapid Simultaneous Detection of Bacterial and Parasitic Pathogens from Blood

    PubMed Central

    Selvapandiyan, Angamuthu; Stabler, Katie; Ansari, Nasim A.; Kerby, Stephen; Riemenschneider, Jenny; Salotra, Poonam; Duncan, Robert; Nakhasi, Hira L.

    2005-01-01

    A multiplex polymerase chain reaction assay was developed for the rapid simultaneous detection of category A select bacterial agents (Bacillus anthracis and Yersinia pestis) and parasitic pathogens (Leishmania species) in blood using the Cepheid Smart Cycler platform. B. anthracis (Sterne) and Yersinia. pseudotuberculosis were used in the assay for optimization for B. anthracis and Y. pestis, respectively. The specificity of the target amplicons [protective antigen gene of B. anthracis and rRNA genes of other pathogens or human (internal control)] was evaluated by staining the amplicons with SYBR Green I and determining their individual melting temperatures (Tm). As a novel approach for pathogen semiquantitation, the Tm peak height of the amplicon was correlated with a known standard curve of pathogen-spiked samples. This assay was able to detect DNA in blood spiked with less than 50 target cells/ml for all of the pathogens. The sensitivity of this assay in blood was 100% for the detection of Leishmania donovani from leishmaniasis patients and B. anthracis (Sterne) from symptomatic mice. The time necessary for performing this assay including sample preparation was less than 1.5 hours, making this a potentially useful method for rapidly diagnosing and monitoring the efficacy of drugs or vaccines in infected individuals. PMID:15858151

  6. Real-time and multiplex real-time polymerase chain reactions for the detection of Bartonella henselae within cat flea, Ctenocephalides felis, samples.

    PubMed

    Robinson, M T; Morgan, E R; Woods, D; Shaw, S E

    2010-12-01

    Bartonella henselae (Rhizobiales: Bartonellacae), the agent of cat-scratch disease, is an emerging bacterial pathogen which can be transmitted via infective faecal material of Ctenocephalides felis Bouché (Siphonaptera: Pulicidae). Worldwide, B. henselae has been identified in 1-53% of felines and 2.9-17.4% of fleas. Although culture is the routine method for detection, the procedure is time-consuming and is rarely used for isolation directly from flea vectors. The current study reports the development of a quantitative real-time polymerase chain reaction (qPCR) to detect and quantify B. henselae organisms from vector samples. The qPCR is specific and detects as few as 2.5 genome copies. To enable direct quantification of Bartonella organisms in different vector samples, we developed a qPCR to detect C. felis DNA that also acts as an extraction control. Combining both PCRs into a multiplex format validates B. henselae results when sampling flea populations, although there is a reduction in sensitivity. This reduction might be counteracted by a different combination of probe fluorophores.

  7. High-risk human papillomavirus infection involving multiple anatomic sites of the female lower genital tract: a multiplex real-time polymerase chain reaction-based study.

    PubMed

    Hui, Yiang; Manna, Pradip; Ou, Joyce J; Kerley, Spencer; Zhang, Cunxian; Sung, C James; Lawrence, W Dwayne; Quddus, M Ruhul

    2015-09-01

    High-risk human papillomavirus infection usually is seen at one anatomic site in an individual. Rarely, infection at multiple anatomic sites of the female lower genital tract in the same individual is encountered either simultaneously and/or at a later date. The current study identifies the various subtypes of high-risk human papillomavirus infection in these scenarios and analyzes the potential significance of these findings. High-risk human papillomavirus infection involving 22 anatomic sites from 7 individuals was identified after institutional review board approval. Residual paraffin-embedded tissue samples were retrieved, and all 15 high-risk human papillomavirus were identified and viral load quantified using multiplex real-time polymerase chain reaction-based method. Multiple high-risk human papillomavirus subtypes were identified in 32% of the samples and as many as 5 different subtypes of high-risk human papillomavirus infection in a single anatomic site. In general, each anatomic site has unique combination of viral subtypes, although one individual showed overlapping subtypes in the vagina, cervix, and vulvar samples. Higher viral load and rare subtypes are more frequent in younger patients and in dysplasia compared with carcinoma. Follow-up ranging from 3 to 84 months revealed persistent high-risk human papillomavirus infection in 60% of cases. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

    PubMed

    Meena, Ram Prasnna; Baranwal, V K

    2016-09-01

    Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Defining a 0.5-mb region of genomic gain on chromosome 6p22 in bladder cancer by quantitative-multiplex polymerase chain reaction.

    PubMed

    Evans, Andrew J; Gallie, Brenda L; Jewett, Michael A S; Pond, Gregory R; Vandezande, Kirk; Underwood, John; Fradet, Yves; Lim, Gloria; Marrano, Paula; Zielenska, Maria; Squire, Jeremy A

    2004-01-01

    Metaphase-based comparative genomic hybridization (CGH) has identified recurrent regions of gain on different chromosomes in bladder cancer, including 6p22. These regions may contain activated oncogenes important in disease progression. Using quantitative multiplex polymerase chain reaction (QM-PCR) to study DNA from 59 bladder tumors, we precisely mapped the focal region of genomic gain on 6p22. The marker STS-X64229 had copy number increases in 38 of 59 (64%) tumors and the flanking markers, RH122450 and A009N14, had copy number gains in 33 of 59 (56%) and 26 of 59 (45%) respectively. Contiguous gain was present for all three markers in 14 of 59 (24%) and for two (RH122450 and STS-X64229) in 25 of 59 (42%). The genomic distance between the markers flanking STS-X64229 is 0.5 megabases, defining the minimal region of gain on 6p22. Locus-specific interphase fluorescence in situ hybridization confirmed the increased copy numbers detected by QM-PCR. Current human genomic mapping data indicates that an oncogene, DEK, is centrally placed within this minimal region. Our findings demonstrate the power of QM-PCR to narrow the regions identified by CGH to facilitate identifying specific candidate oncogenes. This also represents the first study identifying DNA copy number increases for DEK in bladder cancer.

  10. A Multiplex Allele Specific Polymerase Chain Reaction (MAS-PCR) for the Detection of Factor V Leiden and Prothrombin G20210A.

    PubMed

    Bagheri, Morteza; Rad, Isa Abdi

    2011-01-01

    In order to determine the frequencies of factor V Leiden and prothrombin G20210A point mutations in the Iranian population with Azeri Turkish origin. 120 unrelated individuals from general population randomly selected and were examined for factor V Leiden and prothrombin G20210A mutations using a multiplex allele specific polymerase chain reaction (MAS-PCR) assayOutcomes: The frequency of prothrombin G20210A mutation was 2.08%, which means 5 chromosomes out of 240 chromosomes had prothrombin G20210A mutation. The distribution of prothrombin 20210 GG, GA, AA genotypes and prothrombin 20210A allele were 37(92.5%), 3(7.5%), 0(0%) and 3(3.75%) in males and 78(97.5%), 2(2.5%), 0(0%) and 2(1.25%) in females, respectively. Factor V Leiden was not found in our tested group (zero chromosomes out of 240 chromosomes). Analysis of the observed frequencies in the studied groups indicates that there is no statistically significant difference between females and males, regarding prothrombin G20210A mutation (p value>0.05). This is the first study in its own kind in this population and implies that the frequency of Factor V Leiden G1691A (R506Q, FV-Leiden) allele is extremely low but the prothrombin G20210A mutation is more frequent in the tested group.

  11. A Multiplex Allele Specific Polymerase Chain Reaction (MAS-PCR) for the Detection of Factor V Leiden and Prothrombin G20210A

    PubMed Central

    Bagheri, Morteza; Rad, Isa Abdi

    2011-01-01

    ABSTRACT Introduction: In order to determine the frequencies of factor V Leiden and prothrombin G20210A point mutations in the Iranian population with Azeri Turkish origin. Material and methods: 120 unrelated individuals from general population randomly selected and were examined for factor V Leiden and prothrombin G20210A mutations using a multiplex allele specific polymerase chain reaction (MAS-PCR) assay Outcomes: The frequency of prothrombin G20210A mutation was 2.08%, which means 5 chromosomes out of 240 chromosomes had prothrombin G20210A mutation. The distribution of prothrombin 20210 GG, GA, AA genotypes and prothrombin 20210A allele were 37(92.5%), 3(7.5%), 0(0%) and 3(3.75%) in males and 78(97.5%), 2(2.5%), 0(0%) and 2(1.25%) in females, respectively. Factor V Leiden was not found in our tested group (zero chromosomes out of 240 chromosomes). Analysis of the observed frequencies in the studied groups indicates that there is no statistically significant difference between females and males, regarding prothrombin G20210A mutation (p value>0.05). Conclusions: This is the first study in its own kind in this population and implies that the frequency of Factor V Leiden G1691A (R506Q, FV-Leiden) allele is extremely low but the prothrombin G20210A mutation is more frequent in the tested group. PMID:21977183

  12. Detection of β-globin Gene Mutations Among β-thalassaemia Carriers and Patients in Malaysia: Application of Multiplex Amplification Refractory Mutation System–Polymerase Chain Reaction

    PubMed Central

    Hassan, Syahzuwan; Ahmad, Rahimah; Zakaria, Zubaidah; Zulkafli, Zefarina; Abdullah, Wan Zaidah

    2013-01-01

    Background: β-thalassaemia is one of the most common single-gene disorders worldwide. Each ethnic population has its own common mutations, accounting for the majority of cases, with a small number of mutations for the rarer alleles. Due to the heterogeneity of β-thalassaemia and the multi-ethnicity of Malaysians, molecular diagnostics may be expensive and time consuming. Methods: A simple polymerase chain reaction (PCR) approach involving a multiplex amplification refractory mutation system (MARMS) and one amplification refractory mutation system (ARMS), consisting of 20 β-globin gene mutations, were designed and employed to investigate β-thalassaemia patients and carriers. Results: Out of 169 carriers tested with the MARMS, Cd 41/42 (–TTCT), Cd 26 (A–G) HbE, IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 78.1%. Among the Malays, Cd 26 (A–G) HbE, Cd 41/42 (–TTCT), IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 81.4%, whereas Cd 41/42 (–TTCT) and IVS 2–654 (C–T) were most common among the Chinese (79.1%). Conclusion: We propose the use of this cheap, easy to interpret, and simple system for the molecular diagnostics of β-thalassaemia among Malaysians at the Institute for Medical Research (IMR). PMID:23613656

  13. Detection of Staphylococcus aureus enterotoxigenic strains in bovine raw milk by reversed passive latex agglutination and multiplex polymerase chain reaction

    PubMed Central

    Mansour, Asmaa Samy; Wagih, Gad El-Said; Morgan, Sabry D.; Elhariri, Mahmoud; El-Shabrawy, Mona A.; Abuelnaga, Azza S. M.; Elgabry, E. A.

    2017-01-01

    Aim: This review gives an outline of the assessment of enterotoxigenic Staphylococcus aureus tainting levels in raw milk from different sources in Egypt and characterization of enterotoxigenic strains utilizing a technique in light of PCR to identify genes coding for the production of staphylococcal enterotoxin (SE). The obtained data were compared with results from the application of the reversed passive latex. Materials and Methods: Multiplex PCR and reversed passive latex agglutination (RPLA) were used. A total of 141 samples of raw milk (cow’s milk=33, buffalo’s milk=58, and bulk tank milk=50) were investigated for S. aureus contamination and tested for enterotoxin genes presence and toxin production. Results: S. aureus was detected in 23 (16.3%) samples phenotypically and genotypically by amplification of nuc gene. The S. aureus isolates were investigated for SEs genes (sea to see) by multiplex PCR and the toxin production by these isolates was screened by RPLA. SEs genes were detected in six isolates (26.1%) molecularly; see was the most observed gene where detected in all isolates, two isolates harbored seb, and two isolates harbored sec. According to RPLA, three isolates produced SEB and SEC. Conclusion: The study revealed the widespread of S. aureus strains caring genes coding for toxins. The real significance of the presence of these strains or its toxins in raw milk and their possible impact a potential hazard for staphylococcal food poisoning by raw milk consumption. Therefore, detection of enterotoxigenic S. aureus strains in raw milk is necessary for consumer safety. PMID:28919671

  14. Polymerase chain reaction

    SciTech Connect

    Arnhelm, N. ); Levenson, C.H. )

    1990-10-01

    This paper discusses the polymerase chain reaction (PCR) an in-vitro method of amplifying DNA sequences. Beginning with DNA of any origin- bacterial, viral, plant, or animal- PCR can increase the amount of a DNA sequence hundreds of millions to billions of times. The procedure can amplify a targeted sequence even when it makes up less than one part in a million of the total initial sample. PCR is an enzymatic process that is carried out in discrete cycles of amplification, each of which can double the amount of target DNA in the sample. Thus, n cycles can produce 2{sup n} times as much target as was present to begin with. This paper discusses how PCR has had an impact on molecular biology, human genetics, infectious and genetic disease diagnosis, forensic science, and evolutionary biology.

  15. Pathotypic and Phylogenetic Study of Diarrheagenic Escherichia coli and Uropathogenic E. coli Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Salmani, Hamzeh; Azarnezhad, Asaad; Fayazi, Mohammad Reza; Hosseini, Arshad

    2016-01-01

    Background: Acute diarrheal disease and urinary tract infection are leading causes of childhood morbidity and mortality in the developing world. Diarrheagenic Escherichia coli (DEC) has been identified as a major etiologic agent of diarrhea worldwide, and urinary tract infection (UTI) caused by uropathogenic Escherichia coli (UPEC) is one of the most common bacterial infections among human beings. Quick and precise detection of these bacteria help provide more effective intervention and management of infection. Objectives: In this study we present a precise and sensitive typing and phylogenetic study of UPEC and DEC using multiplex PCR in order to simplify and improve the intervention and management of diarrheal and UT infections. Materials and Methods: In total, 100 urinary tract infection samples (UTI) and 200 specimens from children with diarrhea, which had been diagnosed with E. coli as the underlying agent by differential diagnosis using MacConkey’s agar and biochemical study, were submitted for molecular detection. Pathotyping of E. coli pathotypes causing urinary tract infection and diarrhea were examined using a two set multiplex PCR, targeting six specific genes. Phylogenetic typing was done by targeting three genes, including ChuA, YjaA and TspE4C2. Results: Overall, 88% of DEC and 54% of UTI isolates were positive for one or more of the six genes encoding virulence factors. Prevalence of the genes encoding virulence factors for DEC were 62%, 25%, 24%, 13%, 7% and 5% for ST (ETEC), LT (ETEC), aggR (EAggEC), daaD (DAEC), invE (EIEC) and eae (EPEC), respectively; whereas, the prevalence rates for the UTI samples were 23%, 14%, 6%, 6% and 4% for aggR (EAggEC), LT (ETEC), daaD (DAEC), invE (EIEC) and ST (ETEC), respectively. No coding virulence factors were detected for eae (EPEC). Group B2 was the most prevalent phylogroup and ST was the most frequently detected pathotype in all phylogroups. Conclusions: ETEC and EAggEC were the most detected E. coli among

  16. Profiling viral infections in grapevine using a randomly primed reverse transcription-polymerase chain reaction/macroarray multiplex platform.

    PubMed

    Thompson, J R; Fuchs, Marc; McLane, Heather; Celebi-Toprak, Fevziye; Fischer, Kael F; Potter, Jamie L; Perry, Keith L

    2014-02-01

    Crop-specific diagnostics to simultaneously detect a large number of pathogens provides an invaluable platform for the screening of vegetative material prior to its propagation. Here we report the use of what is to-date the largest published example of a crop-specific macroarray for the detection of 38 of the most prevalent or emergent viruses to infect grapevine. The reusable array consists of 1,578 virus-specific 60 to 70mer oligonucleotide probes and 19 plant and internal control probes spotted onto an 18 × 7 cm nylon membrane. In a survey of 99 grapevines from the United States and Europe, virus infections were detected in 46 selections of Vitis vinifera, V. labrusca, and interspecific hybrids. The majority of infected vines (30) was singly infected, while 16 were mixed-infected with viruses from two or more families. Representatives of the four main virus families Betaflexiviridae, Closteroviridae, Secoviridae, and Tymoviridae present in grapevines were found alone and in combination, with a notable bias in representation by members of the family Tymoviridae. This work demonstrates the utility of the macroarray platform for the multiplex detection of viruses in a single crop, its potential for characterizing grapevine virus associations, and usefulness for rapid diagnostics of introduced material in quarantine centers or in certification programs.

  17. Environmental monitoring for biological threat agents using the autonomous pathogen detection system with multiplexed polymerase chain reaction.

    PubMed

    Regan, John F; Makarewicz, Anthony J; Hindson, Benjamin J; Metz, Thomas R; Gutierrez, Dora M; Corzett, Todd H; Hadley, Dean R; Mahnke, Ryan C; Henderer, Bruce D; Breneman, John W; Weisgraber, Todd H; Dzenitis, John M

    2008-10-01

    We have developed and field-tested a now operational civilian biodefense capability that continuously monitors the air in high-risk locations for biological threat agents. This stand-alone instrument, called the Autonomous Pathogen Detection System (APDS), collects and selectively concentrates particles from the air into liquid samples and analyzes the samples using multiplexed PCR amplification coupled with microsphere array detection. During laboratory testing, we evaluated the APDS instrument's response to Bacillus anthracis and Yersinia pestis by spiking the liquid sample stream with viable spores and cells, bead-beaten lysates, and purified DNA extracts. APDS results were also compared to a manual real-time PCR method. Field data acquired during 74 days of continuous operation at a mass-transit subway station are presented to demonstrate the specificity and reliability of the APDS. The U.S. Department of Homeland Security recently selected the APDS reported herein as the first autonomous detector component of their BioWatch antiterrorism program. This sophisticated field-deployed surveillance capability now generates actionable data in one-tenth the time of manual filter collection and analysis.

  18. Isolation of toxigenic Clostridium difficile from ready-to-eat salads by multiplex polymerase chain reaction in Isfahan, Iran

    PubMed Central

    Yamoudy, Mahire; Mirlohi, Maryam; Isfahani, Bahram Nasr; Jalali, Mohammad; Esfandiari, Zahra; Hosseini, Nafiseh Sadat

    2015-01-01

    Background: Since 2003, the incidence of community associated Clostridium difficile infection (CA-CDI) has increased; different types of food have been supposed to be the vectors of C. difficile strains. The purpose of this study is to investigate the occurrence of C. difficile strains in ready-to-eat salads distributed in food services. Materials and Methods: A total of 106 ready-made salad specimens were sampled from different restaurants and food services located in Isfahan, in the center of Iran. Positive isolates of C. difficile were identified and confirmed for the existence of three genes including tpi, tcdA and tcdB by multiplex PCR. Results: A total of six (5.66%) samples were positive for C. difficile strains. Of which, one strain (16.6%) was positive for A and B toxins. Conclusion: The existence of toxigenic C. difficile in ready-made salads could be a caution for public health. Further investigation is required to assess the relationship between the isolated strains in our study and those from diarrheic patients through molecular typing. PMID:26015913

  19. Isolation of toxigenic Clostridium difficile from ready-to-eat salads by multiplex polymerase chain reaction in Isfahan, Iran.

    PubMed

    Yamoudy, Mahire; Mirlohi, Maryam; Isfahani, Bahram Nasr; Jalali, Mohammad; Esfandiari, Zahra; Hosseini, Nafiseh Sadat

    2015-01-01

    Since 2003, the incidence of community associated Clostridium difficile infection (CA-CDI) has increased; different types of food have been supposed to be the vectors of C. difficile strains. The purpose of this study is to investigate the occurrence of C. difficile strains in ready-to-eat salads distributed in food services. A total of 106 ready-made salad specimens were sampled from different restaurants and food services located in Isfahan, in the center of Iran. Positive isolates of C. difficile were identified and confirmed for the existence of three genes including tpi, tcdA and tcdB by multiplex PCR. A total of six (5.66%) samples were positive for C. difficile strains. Of which, one strain (16.6%) was positive for A and B toxins. The existence of toxigenic C. difficile in ready-made salads could be a caution for public health. Further investigation is required to assess the relationship between the isolated strains in our study and those from diarrheic patients through molecular typing.

  20. Genetic characterization of hatchery populations of Korean spotted sea bass (Lateolabrax maculatus) using multiplex polymerase chain reaction assays.

    PubMed

    An, H S; Kim, H Y; Kim, J B; Chang, D S; Park, K D; Lee, J W; Myeong, J I; An, C M

    2014-08-28

    The spotted sea bass, Lateolabrax maculatus, is an important commercial and recreational fishery resource in Korea. Aquacultural production of this species has increased because of recent resource declines, growing consumption, and ongoing government-operated stock release programs. Therefore, the genetic characterization of hatchery populations is necessary to maintain the genetic diversity of this species and to develop more effective aquaculture practices. In this study, the genetic diversity and structure of three cultured populations in Korea were assessed using multiplex assays with 12 highly polymorphic microsatellite loci; 144 alleles were identified. The number of alleles per locus ranged from 6 to 28, with an average of 13.1. The mean observed and expected heterozygosities were 0.724 and 0.753, respectively. Low levels of inbreeding were detected according to the inbreeding coefficient (mean FIS = 0.003-0.073). All hatchery populations were significantly differentiated from each other (overall fixation index (FST) = 0.027, P < 0.01), and no population formed a separate cluster. Pairwise multilocus FST tests, estimates of genetic distance, mantel test, and principal component analyses did not show a consistent relationship between geographic and genetic distances. These results could reflect the exchange of breeds and eggs between hatcheries and/or genetic drift due to intensive breeding practices. For optimal resource management, the genetic variation of hatchery stocks should be monitored and inbreeding controlled within the spotted sea bass stocks that are being released every year. This genetic information will be useful for the management of both L. maculatus fisheries and the aquaculture industry.

  1. Simultaneous detection of single nucleotide polymorphisms and copy number variations in the CYP2D6 gene by multiplex polymerase chain reaction combined with capillary electrophoresis.

    PubMed

    Liao, Hsiao-Wei; Tsai, I-Lin; Chen, Guan-Yuan; Kuo, Chun-Ting; Wei, Ming-Feng; Hwang, Tzung-Jeng; Chen, Wei J; Shen, Li-Jiuan; Kuo, Ching-Hua

    2013-02-06

    CYP2D6 (cytochrome P450 2D6) is one of the most important enzymes involved in drug metabolism, and CYP2D6 gene variants may cause toxic effects of therapeutic drugs or treatment failure. In this research, a rapid and simple method for genotyping the most common mutant alleles in the Asian population (CYP2D6*1/*1, CYP2D6*1/*10, CYP2D6*10/*10, CYP2D6*1/*5, CYP2D6*5/*10, and CYP2D6*5/*5) was developed by allele-specific polymerase chain reaction (AS-PCR) combined with capillary electrophoresis (CE). We designed a second mismatch nucleotide next to the single nucleotide polymorphism (SNP) site in allele-specific primers to increase the difference in PCR amplification. Besides, we established simulation equations to predict the CYP2D6 genotypes by analyzing the DNA patterns in the CE chromatograms. The multiplex PCR combined with CE method was applied to test 50 patients, and all of the test results were compared with the DNA sequencing method, long-PCR method and real-time PCR method. The correlation of the analytical results between the proposed method and other methods were higher than 90%, and the proposed method is superior to other methods for being able to simultaneous detection of SNPs and copy number variations (CNV). Furthermore, we compared the plasma concentration of aripiprazole (a CYP2D6 substrate) and its major metabolites with the genotype of 25 patients. The results demonstrate the proposed genotyping method is effective for estimating the activity of the CYP2D6 enzyme and shows potential for application in personalized medicine. Similar approach can be applied to simultaneous detection of SNPs and CNVs of other genes.

  2. Multiplex polymerase chain reaction-based deletion analysis of spontaneous, gamma ray- and alpha-induced hprt mutants of CHO-K1 cells.

    PubMed

    Schwartz, J L; Rotmensch, J; Sun, J; An, J; Xu, Z; Yu, Y; Hsie, A W

    1994-11-01

    Independent Chinese hamster ovary (CHO)-K1 cell mutants at the hypoxanthine-guanine phosphoribosyltransferase (hprt) locus were isolated from untreated, 60Co gamma ray- and 212Bi alpha-exposed cells and the genetic changes underlying the mutation determined by multiplex polymerase chain reaction (PCR)-based exon deletion analysis. In the 71 spontaneous mutants analyzed, 77.5% of the clones showed no change in exon number or size, 15.5% showed a loss of a single exon, 4.2% showed a loss of 2-8 exons, and 2.8% showed loss of all nine hprt exons (total gene deletion). Exposure to 6 Gy of gamma rays, which reduced survival levels to 10%, produced a significantly different deletion spectrum that was shifted toward deletions with 45% of the 20 mutants analyzed showing a loss of a single exon and 30% showing a loss of all nine exons. Exposure to 2 Gy alpha radiation from 212Bi, a 220Rn daughter, a dose which also reduced survival levels to about 10%, resulted in a deletion spectrum similar to the gamma-ray spectrum in that more than 75% of the 49 mutants analyzed were deletions. The alpha spectrum, however, was significantly different from both the spontaneous and gamma spectra with 55.1% of the alpha mutants showing a loss of all nine exons, 10.2% showing loss of a single exon, and 14.3% showing loss of 2-8 exons. Thus, alpha-radiation appears to produce larger intragenic deletions than gamma radiation. The results suggest that intragenic deletion size should be considered when low- and high linear energy transfer (LET) mutation spectra are compared.

  3. Sensitive detection of deletions of one or more exons in the neurofibromatosis type 2 (NF2) gene by multiplexed gene dosage polymerase chain reaction.

    PubMed

    Diebold, Ruth; Bartelt-Kirbach, Britta; Evans, D Gareth; Kaufmann, Dieter; Hanemann, C Oliver

    2005-02-01

    Mutation detection in the neurofibromatosis type 2 (NF2) gene is challenging because when combining mutation detection methods such as single-strand conformational polymorphism and heteroduplex analysis, denaturing gradient gel electrophoresis, and direct sequencing of aberrant polymerase chain reaction (PCR) fragments only 30 to 60% of the constitutional mutations are detected. Because large deletions and complete chromosome rearrangements are also described methods such as microarray-comparative genomic hybridization and fluorescence in situ hybridization are also used. The one type of mutation often missed corresponds to deletions encompassing one or few exons. To detect this type we have developed a swift and reliable method. We perform a gene dosage analysis with two fluorescent multiplex PCR assays that amplify 15 of the 17 NF2 exons. The labeled PCR products are quantified and gene dose is calculated with respect to controls. We tested the reliability of this method with DNA from eight NF2 patients with known heterozygous NF2 deletions, eight controls and four unknown NF2 patients. In all of the patients with known heterozygous deletions we found in several exons a reduction of gene dosage to 50 to 69%. In one NF2 patient with previously unknown mutation and a severe phenotype we found the gene dosage of two exons reduced by 50% indicating a deletion of these two exons on one allele. This finding was validated by reverse transcriptase-PCR on fibroblast and schwannoma cell cultures of this patient and cDNA sequencing. Our gene dosage assay will detect deletions of one or more exons as well as gross deletions of the whole coding region of the gene. It can complement the existing screening methods because it is faster and easier.

  4. Evaluation of a multiplex real-time polymerase chain reaction for the quantification of Escherichia coli O157 in cattle feces.

    PubMed

    Jacob, Megan E; Shi, Xiaorong; An, Baoyan; Nagaraja, Tiruvoor G; Bai, Jianfa

    2012-01-01

    Cattle are asymptomatic reservoirs for Escherichia coli O157, a major foodborne pathogen. The organism generally colonizes the hindgut of cattle and is shed in the feces at low concentrations. The objective of this research was to evaluate a multiplex, real-time polymerase chain reaction (mqPCR) assay for quantification of E. coli O157 in cattle feces using stx1, stx2, and rfbE gene targets. Primer efficiency and analytical sensitivity of the assay were evaluated with a single or pooled (five strain) culture of E. coli O157. In pure culture, the minimum detection limit of the assay was 1.4×10(3) CFU/mL and 3.6×10(3) CFU/mL for the single and five-strain mixture of E. coli O157, respectively. Diagnostic sensitivity was analyzed using DNA extracted from cattle feces spiked with E. coli O157. In feces spiked with the pooled mixture of five E. coli O157 strains, the minimum detection limit was 3.6×10(4) CFU/g. We also evaluated the assay with feces from cattle experimentally inoculated with E. coli O157 by comparing the results to a culture-based method. For the majority of samples tested, the concentration of E. coli O157 detected by the real-time and culture methods was within one log difference. However, the assay could only be evaluated for cattle shedding high concentrations of E. coli O157. In conclusion, the mqPCR quantifying E. coli O157 in cattle feces using stx1, stx2, and rfbE gene targets may have use in detecting and quantifying super shedders, but is not applicable for quantification in animals shedding low concentrations (10(2) to 10(3) CFU/g feces).

  5. Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

    PubMed

    Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

    2014-07-01

    A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines.

  6. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus.

    PubMed

    Si, Wei; Zhou, Shun; Wang, Zhao; Cui, Shang-jin

    2010-05-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  7. Etiological diagnosis of bloodstream infections through a multiplex real-time polymerase chain reaction test in pediatric patients: a case series from a tertiary Italian hospital.

    PubMed

    Calitri, Carmelina; Denina, Marco; Scolfaro, Carlo; Garazzino, Silvia; Licciardi, Francesco; Burdino, Elisa; Allice, Tiziano; Carraro, Francesca; De Intinis, Gianfranco; Ghisetti, Valeria; Tovo, Pier-Angelo

    2015-02-01

    The outcome of bloodstream infections (BSIs) is strongly related to microbiological diagnosis. Several factors may reduce blood culture (BC) diagnostic yield in pediatric BSIs, making the application of molecular methods quite promising. Multiplex real-time polymerase chain reaction (PCR) tests (the LightCycler Septifast Test MGRADE by Roche Diagnostics--LC-SF) performed in the tertiary centre of Regina Margherita Children's Hospital (Turin, Italy) over a 3-year period were retrospectively evaluated. Results of the LC-SF test were compared with those of BC (Automated Bact/Alert 3D, Biomerieux) collected at a close time point. 545 LC-SF tests were collected from 289 patients (183 males, median age 6.8 years, interquartile range (IQR) = 2.7-13.1); 163 had congenital or acquired immunodeficiency. In 515 cases (94.5%) the LC-SF test was performed with ongoing empirical antimicrobial therapy. Etiological definition was achieved in 111 BSI cases (20.4%). Both LC-SF and BC identified the responsible pathogen in 39 episodes. The LC-SF test alone gave a positive result in 29 septic episodes; BC alone permitted the etiological diagnosis in 43 episodes, but isolates were not included in the LC-SF master list in 10 cases. A 26% increase in bacterial identification chances due to the LC-SF test was documented. Cohen's kappa test indicated a moderate strength of agreement (0.49) between LC-SF tests and BCs closely collected. BC remains the gold standard for the etiological diagnosis of BSIs, but PCR methods proved to be a valuable adjunctive diagnostic tool in pediatric BSIs, especially in children receiving empirical chemotherapy.

  8. Development and application of a multiplex reverse-transcription polymerase chain reaction assay for screening a global collection of Citrus tristeza virus isolates.

    PubMed

    Roy, Avijit; Ananthakrishnan, G; Hartung, John S; Brlansky, R H

    2010-10-01

    The emerging diversity of Citrus tristeza virus (CTV) genotypes has complicated detection and diagnostic measures and prompted the search for new differentiation methods. To simplify the identification and differentiation of CTV genotypes, a multiplex reverse-transcription polymerase chain reaction (RT-PCR) technique for the screening of CTV isolates was developed. Variable regions within the open reading frame (ORF)-1a of diverse CTV genotypes were identified to develop first a simplex (S) and then a hexaplex (H) RT-PCR. CTV isolates have been grouped previously into five genotypes (namely, T3, T30, T36, VT, and B165) based on the nucleotide sequence comparisons and phylogenetic analyses. Nucleotide sequences from GenBank were used to design species and genotype-specific primers (GSPs). The GSPs were initially used for reliable detection of all CTV genotypes using S-RT-PCR. Furthermore, detection of all five recognized CTV genotypes was established using the H-RT-PCR. Six amplicons, one generic to all CTV isolates and one for each of the five recognized genotypes, were identified on the basis of their size and were confirmed by sequence analysis. In all, 175 CTV isolates from 29 citrus-growing countries were successfully analyzed by S- and H-RT-PCR. Of these, 97 isolates contained T36 genotypes, 95 contained T3 genotypes, 76 contained T30 genotypes, 71 contained VT genotypes, and 24 contained B165 genotype isolates. In total, 126 isolates contained mixed infections of 2 to 5 of the known CTV genotypes. Two of the CTV isolates could not be assigned to a known genotype. H-RT-PCR provides a sensitive, specific, reliable, and rapid way to screen for CTV genotypes compared with other methods for CTV genotype detection. Efficient identification of CTV genotypes will facilitate a better understanding of CTV isolates, including the possible interaction of different genotypes in causing or preventing diseases. The methods described can also be used in virus-free citrus

  9. A rapid single-tube multiplex polymerase chain reaction assay for the seven most prevalent alpha-thalassemia deletions and alphaalphaalpha(anti 3.7) alpha-globin gene triplication.

    PubMed

    de Mare, Arjan; Groeneger, Antoinette Heijs-Oude; Schuurman, Sander; van den Bergh, Frank A T J M; Slomp, Jennichjen

    2010-01-01

    alpha-Globin gene triplications may exacerbate the alpha chain and beta chain imbalance in beta-thalassemia (beta-thal) and may compensate for the effect of alpha-globin gene deletion in alpha-thal. Identification of an alpha-globin gene triplication is, therefore, valuable in predicting the clinical phenotype of the thalassemias. To be able to detect alpha-globin gene triplications, we have modified an existing multiplex polymerase chain reaction (PCR) assay for the seven most prevalent alpha-globin gene deletions by incorporating two triplication-specific primers and concurrently substituting one of the original primers by a newly designed primer. This modified multiplex PCR assay was evaluated by performing the assay on archival DNA samples and on peripheral blood samples from 163 suspected thalassemia cases. It was found to function properly. Our assay thereby represents the first multiplex PCR assay that can detect both the seven most prevalent alpha-globin gene deletions and the alphaalphaalpha(anti 3.7) alpha-globin gene triplication in a single-tube reaction.

  10. Development of a Multiplexed Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Assay to Identify Common Members of the Subgenera Culex (Culex) and Culex (Phenacomyia) in Guatemala

    PubMed Central

    Kent, Rebekah J.; Deus, Stephen; Williams, Martin; Savage, Harry M.

    2010-01-01

    Morphological differentiation of mosquitoes in the subgenera Culex (Culex) and Culex (Phenacomyia) in Guatemala is difficult, with reliable identification ensured only through examination of larval skins from individually reared specimens and associated male genitalia. We developed a multiplexed polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay to identify common Cx. (Cux.) and Cx. (Phc.). Culex (Cux.) chidesteri, Cx. (Cux.) coronator, Cx. (Cux.) interrogator, Cx. (Cux.) quinquefasciatus, Cx. (Cux.) nigripalpus/Cx. (Cux.) thriambus, and Cx. (Phc.) lactator were identified directly with a multiplexed primer cocktail comprising a conserved forward primer and specific reverse primers targeting ribosomal DNA (rDNA). Culex nigripalpus and Cx. thriambus were differentiated by restriction digest of homologous amplicons. The assay was developed and optimized using well-characterized specimens from Guatemala and the United States and field tested with unknown material from Guatemala. This assay will be a valuable tool for mosquito identification in entomological and arbovirus ecology studies in Guatemala. PMID:20682869

  11. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-02

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences.

  12. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    PubMed

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  13. A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

    PubMed

    Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

    2009-11-01

    To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

  14. Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

    PubMed

    Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

    2016-11-01

    Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

  15. Development and validation of a multiplex quantitative polymerase chain reaction assay for the detection of Mollicutes impurities in human cells, cultured under good manufacturing practice conditions, and following European Pharmacopoeia requirements and the International Conference on Harmonization guidelines.

    PubMed

    Vanni, Irene; Ugolotti, Elisabetta; Raso, Alessandro; Di Marco, Eddi; Melioli, Giovanni; Biassoni, Roberto

    2012-07-01

    The clinical applications of in vitro manipulated cultured cells and their precursors are often made use of in therapeutic trials. However, tissue cultures can be easily contaminated by the ubiquitous Mollicutes micro-organisms, which can cause various and severe alterations in cellular function. Thus methods able to detect and trace Mollicutes impurities contaminating cell cultures are required before starting any attempt to grow cells under good manufacturing practice (GMP) conditions. We developed a multiplex quantitative polymerase chain reaction (qPCR) assay specific for the 16S-23S rRNA intergenic spacer regions, for the Tuf and P1 cytoadhesin genes, able to detect contaminant Mollicutes species in a single tube reaction. The system was validated by analyzing different cell lines and the positive samples were confirmed by 16S and P1 cytoadhesin gene dideoxy sequencing. Our multiplex qPCR detection system was able to reach a sensitivity, specificity and robustness comparable with the culture and the indicator cell culture method, as required by the European Pharmacopoeia guidelines. We have developed a multiplex qPCR method, validated following International Conference on Harmonization (ICH) guidelines, as a qualitative limit test for impurities, assessing the validation characteristics of limit of detection and specificity. It also follows the European Pharmacopoeia guidelines and Food and Drug Administration (FDA) requirements.

  16. Detection of circulating tumor cells in breast cancer patients using multiplex reverse transcription-polymerase chain reaction and specific primers for MGB, PTHRP and KRT19 correlation with clinicopathological features.

    PubMed

    Skondra, Maria; Gkioka, Eliona; Kostakis, Ioannis D; Pissimissis, Nikolaos; Lembessis, Panagiotis; Pectasides, Dimitrios; Koutsilieris, Michael

    2014-11-01

    The aim of this study was to correlate the clinicopathological features of breast cancer patients with the positive detection of parathyroid hormone-related protein (PTHRP), cytokeratin protein 19 (KRT19) and mammaglobin (MGB) using a multiplex reverse transcription polymerase chain reaction (RT-PCR) assay developed to detect circulating tumor cells (CTCs) in peripheral blood of patients with breast cancer. Peripheral blood samples were collected from 54 breast cancer patients and 20 healthy blood donors. Subsequently, the samples were processed for RNA extraction and analyzed for the expression of PTHRP, KRT19 and MGB using specific primers and multiplex RT-PCR. The positive detection rates in breast cancer patients for PTHRP, KRT19 and MGB were 68.5%, 63% and 22.2% and for healthy donors 10%, 0% and 10%, respectively. The statistical analysis revealed that PTHRP- and KRT19-positive detections correlated with the diagnosis of breast cancer while the combined positive detections of PTHRP-plus-KRT19 correlated with the presence of distant metastasis, especially with bone metastasis. Moreover, positive detections of KRT19 correlated with high proliferation rate of breast cancer tumors. MGB-positive detections did not add any diagnostic advantage in such analysis. Multiplex-PCR based detection of CTCs using PTHRP and KRT19 primers can provide useful information for the disease. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Fixed nuclei as alternative template of BIOMED-2 multiplex polymerase chain reaction for immunoglobulin gene clonality testing in B-cell malignancies.

    PubMed

    Tang, Yuan; Chen, Jie; Wang, Jianchao; Zheng, Ke; Liao, Dianying; Liao, Xiaomei; Liu, Weiping; Wang, Lin

    2015-01-01

    Evaluation of immunoglobulin (Ig) gene rearrangements with BIOMED-2 multiplex PCR has become a standard detection of clonality in mature B cell malignancies. Conventionally, this method is relatively labor-intensive and time-consuming, as it requires DNA isolation from bone marrow aspirates (BM) or peripheral blood (PB) in patients with BM or PB involvement. On the other hand, fluorescence in situ hybridization (FISH) is routinely used as genetic screening in B cell malignancies, but the surplus fixed nuclei initially prepared for FISH usually turn useless afterwards. We sought to use these surplus nuclei after FISH as a template to perform PCR-based Ig gene clonality testing. Templates of 12 patients with mature B cell malignancies, which consisted of both DNA isolated with commercial DNA isolation kit from fresh BM or PB (DNA group) and the fixed nuclei initially prepared for FISH (nuclei group) from the same individuals, were subjected to PCR with BIOMED-2 primer sets for immunoglobulin heavy chain and kappa light chain under recommended conditions. Our result, for the first time, showed a high consistency between the two groups in detecting B cell clonality, which indicates that nuclei for FISH can function as a reliable template comparable to fresh tissue-isolated DNA in PCR based Ig clonality testing. This offers a simple, rapid and more economical alternative to standard Ig testing based on regular DNA.

  18. Extraction and purification of microbial DNA from petroleum-contaminated soils and detection of low numbers of toluene, octane and pesticide degraders by multiplex polymerase chain reaction and Southern analysis.

    PubMed

    Knaebel, D B; Crawford, R L

    1995-10-01

    We investigated the use of multiplex polymerase chain reaction (PCR) techniques coupled with Southern analysis to detect xenobiotic-degrading organisms that had been added to three soils. Two soils highly contaminated with petroleum hydrocarbons and a less contaminated control soil were amended with tenfold dilutions of Pseudomonas putida mt-2 (pWW0), P. oleovorans (OCT), and Alcaligenes eutrophus JMP134 (pJP4), or, for controls, phosphate buffer alone. Total DNA was then isolated from the soils and purified using a sequential precipitation and dissolution purification procedure. This DNA was subjected to multiplex polymerase chain reaction (PCR) using primers that amplify regions of xylM (PCR product = 631 bp), alkB (546 bp) and tfdA (710 bp), which are found on pWW0, OCT and pJP4, respectively. The sizes of the amplified DNA fragments were designed to permit simultaneous amplification and detection of the target genes. Ethidium bromide-stained gels of the initial PCR reaction indicated detectable amplification of between 10(0) to 10(6) cells per gram soil, depending on the soil and the target gene. Southern analysis of the PCR amplified DNA improved detection limits to between 1 and 10 cells of each target species per gram of soil, and confirmed the identity of the PCR products. For some samples that were initially resistant to PCR, dilution of the environmental DNA resulted in positive PCR results. This treatment presumably overcame the inhibition of the PCR by diluting coextracted contaminants in the environmental DNA. A second PCR on an aliquot (1 microL) of the first reaction increased the ethidium bromide-based detection limits for one of the soils to six cells per gram of soil; it did not increase the detection limits for the other soils. Therefore, the DNA extraction procedure and multiplex PCR permitted the simultaneous detection of three types of biodegradative cells, at a lower detection limit of approximately 10 cells per gram of highly contaminated

  19. A novel multiplex polymerase chain reaction assay for detection of both HLA-A*31:01/HLA-B*15:02 alleles, which confer susceptibility to carbamazepine-induced severe cutaneous adverse reactions.

    PubMed

    Nguyen, D V; Vidal, C; Chi, H C; Do, N T Q; Fulton, R; Li, J; Fernando, S L

    2017-09-08

    HLA-A*31:01 and HLA-B*15:02 have been widely reported to confer genetic susceptibility to carbamazepine (CBZ)-induced severe cutaneous adverse reactions (SCARs). Accordingly, the screening for these alleles has been highly recommended to prevent SCAR prior to introducing CBZ therapy. Although a number of methods are available for screening of HLA-A*31:01 or HLA-B*15:02 alleles separately, developing an assay that can detect both these alleles would be more clinically practical, cost-effective and less time-consuming. Therefore, in this study, a multiplex polymerase chain reaction (PCR) using TaqMan Probe was designed and validated to be able to detect HLA-A*31:01 and HLA-B*15:02. In comparison with Luminex-SSO/SBT/SSB, the multiplex PCR assay for detection of HLA-A*31:01 and HLA-B*15:02 had a perfect agreement in the validation group of 125 samples. The method was able to detect the target genes at the DNA concentration of 0.037 ng/μL. The unit cost of this assay is less than $5 USD with total time of 110 minutes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    PubMed

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.

  1. Frequency of Pathogenic Paediatric Bacterial Meningitis in Mozambique: The Critical Role of Multiplex Real-Time Polymerase Chain Reaction to Estimate the Burden of Disease

    PubMed Central

    Nhantumbo, Aquino Albino; Cantarelli, Vlademir Vicente; Caireão, Juliana; Munguambe, Alcides Moniz; Comé, Charlotte Elizabeth; Pinto, Gabriela do Carmo; Zimba, Tomás Francisco; Mandomando, Inácio; Semá, Cynthia Baltazar; Dias, Cícero; Moraes, Milton Ozório; Gudo, Eduardo Samo

    2015-01-01

    Background In Sub-Saharan Africa, including Mozambique, acute bacterial meningitis (ABM) represents a main cause of childhood mortality. The burden of ABM is seriously underestimated because of the poor performance of culture sampling, the primary method of ABM surveillance in the region. Low quality cerebrospinal fluid (CSF) samples and frequent consumption of antibiotics prior to sample collection lead to a high rate of false-negative results. To our knowledge, this study is the first to determine the frequency of ABM in Mozambique using real-time polymerase chain reaction (qPCR) and to compare results to those of culture sampling. Method Between March 2013 and March 2014, CSF samples were collected at 3 regional hospitals from patients under 5 years of age, who met World Health Organization case definition criteria for ABM. Macroscopic examination, cytochemical study, culture, and qPCR were performed on all samples. Results A total of 369 CSF samples were collected from children clinically suspected of ABM. qPCR showed a significantly higher detection rate of ABM-causing pathogens when compared to culture (52.3% [193/369] versus 7.3% [27/369], p = 0.000). The frequency of Streptococcus pneumoniae, Haemophilus influenzae, group B Streptococci, and Neisseria meningitidis were 32.8% (121⁄369), 12.2%, (45⁄369), 3.0% (16⁄369) and 4.3% (11⁄369), respectively, significantly higher compared to that obtained on culture (p < 0.001 for each). Conclusion Our findings demonstrate that culture is less effective for the diagnosis of ABM than qPCR. The common use of culture rather than qPCR to identify ABM results in serious underestimation of the burden of the disease, and our findings strongly suggest that qPCR should be incorporated into surveillance activities for ABM. In addition, our data showed that S. pneumoniae represents the most common cause of ABM in children under 5 years of age. PMID:26393933

  2. Diagnostic accuracy of two multiplex real-time polymerase chain reaction assays for the diagnosis of meningitis in children in a resource-limited setting

    PubMed Central

    Khumalo, Jermaine; Nicol, Mark; Hardie, Diana; Muloiwa, Rudzani; Mteshana, Phindile

    2017-01-01

    Introduction Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR) assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children. Methods We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis. Results From 292 samples, bacterial DNA was detected in 12 (4.1%) and viral nucleic acids in 94 (32%). Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10%) of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR. Discussion In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation. PMID:28346504

  3. Detection of influenza virus types A and B and type A subtypes (H1, H3, and H5) by multiplex polymerase chain reaction.

    PubMed

    Boonsuk, Pitirat; Payungporn, Sunchai; Chieochansin, Thaweesak; Samransamruajkit, Rujipat; Amonsin, Alongkorn; Songserm, Thaweesak; Chaisingh, Arunee; Chamnanpood, Pornchai; Chutinimitkul, Salin; Theamboonlers, Apiradee; Poovorawan, Yong

    2008-07-01

    Infections with influenza virus type A and B present serious public health problems on a global scale. However, only influenza A virus has been reported to cause fatal pandemic in many species. To provide suitable clinical management and prevent further virus transmission, efficient and effective clinical diagnosis is essential. Therefore, we developed multiplex PCR assays for detecting influenza types A and B and the subtypes of influenza A virus (H1, H3 and H5). Upon performing multiplex PCR assays with type-specific primer sets, the clearly distinguishable products representing influenza A and B virus were separated by agarose gel electrophoresis. In addition, the subtypes of influenza A virus (H1, H3 and H5), which are most common in humans, can be readily distinguished by PCR with subtype-specific primer sets, yielding PCR products of different sizes depending on which subtype has been amplified. This method was tested on 46 influenza virus positive specimens of avian and mammalian (dog and human) origins collected between 2006 and 2008. The sensitivity of this method, tested against known concentrations of each type and subtype specific plasmid, was established to detect 10(3) copies/microl. The method's specificity was determined by testing against other subtypes of influenza A virus (H2, H4 and H6-H15) and respiratory pathogens commonly found in humans. None of them could be amplified, thus excluding cross reactivity. In conclusion, the multiplex PCR assays developed are advantageous as to rapidity, specificity, and cost effectiveness.

  4. Multiplex PCR (polymerase chain reaction) assay for detection of E. coli O157:H7, Salmonella sp., Vibrio cholerae and Vibrio parahaemolyticus in spiked shrimps (Penaeus monodon).

    PubMed

    Fakruddin, M D; Sultana, Mahmuda; Ahmed, Monzur Morshed; Chowdhury, Abhijit; Choudhury, Naiyyum

    2013-03-15

    The coastal aquaculture mainly shrimps constitute major export sector in Bangladesh and is increasingly shaped by international trade conditions and by national responses to those stringent quality and safety standards. PCR based validated methods for detection of major bacterial pathogens in shrimp might be very useful tool for ensuring quality and safety standards of exportable shrimps. The objective of this study was to evaluate overall performance (sensitivity and specificity) of the multiplex PCR assay for detection of Vibrio cholerae, Vibrio parahaemolyticus, Salmonella sp. and Escherichia coli O157:H7 from spiked shrimp samples. The targeted genes were ompW for V. cholerae, tdh for V. parahaemolyticus, sefA for Salmonella spp. and hlyEHEC for E. coli O157:H7. The genomic DNA was extracted by using standard method and amplified accordingly. Sensitivity of the assay was tested by inoculating the shrimp homogenate with viable cells of laboratory references strains (target pathogens). The genes were amplified individually both from culture homogenate and spiked samples. Twenty different uniplex and multiplex PCR assay were performed; the results showed that the sensitivity and specificity of multiplex PCR are comparable to that of the results of uniplex PCR for the samples. DNA extracted from shrimp samples spiked with non-target pathogen (Bacillus cereus, Shigella flexneri and Staphylococcus aureus) yielded negative results.

  5. Polymerase chain reaction in liposomes.

    PubMed

    Oberholzer, T; Albrizio, M; Luisi, P L

    1995-10-01

    Compartmentalization of biochemical reactions within a spherically closed bilayer is an important step in the molecular evolution of cells. Liposomes are the most suitable structures to model this kind of chemistry. We have used the polymerase chain reaction (PCR) to demonstrate that complex biochemical reactions such as DNA replication can be carried out inside these compartments. We describe the first example of DNA amplification by the PCR occurring inside liposomes composed of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), or of a mixture of POPC and phosphatidylserine. We show that these liposomes are stable even under the high temperature conditions used for PCR. Although only a very small fraction of liposomes contains all eight different reagents together, a significant amount of DNA is produced which can be observed by polyacrylamide gel electrophoresis. This work shows that it is possible to carry out complex biochemical reactions within liposomes, which may be germane to the question of the origin of living cells. We have established the parameters and conditions that are critical for carrying out this complex reaction within the liposome compartment.

  6. Simultaneous confirmatory analysis of different transgenic maize (zea mays) lines using multiplex polymerase chain reaction-restriction analysis and capillary gel electrophoresis with laser induced fluorescence detection.

    PubMed

    García-Cañas, Virginia; Cifuentes, Alejandro

    2008-09-24

    A novel analytical procedure based on the combination of multiplex PCR, restriction analysis, and CGE-LIF to unambiguosly and simultaneously confirm the presence of multiple lines of genetically modified corn is proposed. This methodology is based on the amplification of event-specific DNA regions by multiplex PCR using 6-FAM-labeled primers. Subsequently, PCR products are digested by a mixture containing specific restriction endonucleases. Thus, restriction endonucleases selectively recognize DNA target sequences contained in the PCR products and cleave the double-stranded DNA at a given cleavage site. Next, the restriction digest is analyzed by CGE-LIF corroborating the length of the expected restriction fragments, confirming (or not) the existence of GMOs. For accurate size determination of the DNA fragments by CGE-LIF a special standard DNA mixture was produced in this laboratory for calibration. The suitability of this mixture for size determination of labeled DNA fragments is also demonstrated. The usefulness of the proposed methodology is demonstrated through the simultaneous detection and confirmatory analysis of samples containing 0.5% of GA21 and MON863 maize plus an endogenous gene of maize as control.

  7. Enteroaggregative Escherichia coli in Venda, South Africa: distribution of virulence-related genes by multiplex polymerase chain reaction in stool samples of human immunodeficiency virus (HIV)-positive and HIV-negative individuals and primary school children.

    PubMed

    Samie, Amidou; Obi, Chikwelu Larry; Dillingham, Rebecca; Pinkerton, Relana C; Guerrant, Richard L

    2007-07-01

    We used a multiplex polymerase chain reaction (PCR) and a quantitative real-time PCR to determine the distribution of three enteroaggregative Escherichia coli (EAEC) virulence-related genes in stool samples from hospital patients and school children in the Venda region of South Africa. At least one gene was found in 52 (16.5%) samples, 50 (19.6%) from hospitals and 2 (3%) from schools. The AA probe was found in 36 (69%), the aggR gene was found in 41 (79%), and the aap gene was found in 49 (94%) of all positive samples. EAEC was significantly associated with diarrhea and intestinal inflammation and was significantly higher (chi(2) = 5.360, P = 0.021) in human immunodeficiency virus (HIV)-positive persons (29.5%) than in HIV-negative persons (13.7%). The presence of EAEC genes was significantly associated with occult blood (chi(2) = 30.543, P < 0.0001) in the stool samples. This study suggests that the clinical presentation of EAEC infection may be directly related to the bacterial load as well as to the genetic characteristics of the strains involved.

  8. Universal primer-multiplex-polymerase chain reaction (UP-M-PCR) and capillary electrophoresis-laser-induced fluorescence analysis for the simultaneous detection of six genetically modified maize lines.

    PubMed

    Zhang, Chunjiao; Xu, Wentao; Zhai, Zhifang; Luo, Yunbo; Yan, Xinghua; Zhang, Nan; Huang, Kunlun

    2011-05-25

    To meet the labeling and traceability requirement of genetically modified (GM) maize and their products for trade and regulation, it is essential to develop a specific detection method for monitoring the presence of GM content. In this work, six GM maize lines, including GA21, Bt11, NK603, Bt176, Mir604, and Mon810, were simultaneously detected by universal primer-multiplex-polymerase chain reaction (UP-M-PCR), and the amplicons for the six event-specific genes as well as the endogenous Ivr gene were successfully separated by the method of capillary electrophoresis-laser-induced fluorescence (CE-LIF). The UP-M-PCR method overcame the disadvantages in conventional M-PCR, such as complex manipulation, lower sensitivity, amplification disparity resulting from different primers, etc., and in combination with CE-LIF, it obtained a high sensitivity of 0.1 ng for both single and mixed DNA samples. The established method can be widely used for the qualitative identification of the GM maize lines.

  9. Retrospective analysis of multiplex polymerase chain reaction-based molecular diagnostics (SES) in 70 patients with suspected central nervous system infections: A single-center study

    PubMed Central

    Ramalingam, Rama Krishnan Tiruppur Chinnappan; Chakraborty, Dipanjan

    2016-01-01

    Background: Central nervous system (CNS) infections present a grave health care challenge due to high morbidity and mortality. Clinical findings and conventional laboratory assessments are not sufficiently distinct for specific etiologic diagnosis. Identification of pathogens is a key to appropriate therapy. Aim: In this retrospective observational study, we evaluated the efficacy and clinical utility of syndrome evaluation system (SES) for diagnosing clinically suspected CNS infections. Materials and Methods: This retrospective analysis included inpatients in our tertiary level neurointensive care unit (NICU) and ward from February 2010 to December 2013. Cerebrospinal fluid (CSF) samples of 70 patients, clinically suspected of having CNS infections, were subjected to routine laboratory tests, culture, imaging, and SES. We analyzed the efficacy of SES in the diagnosis of CNS infections and its utility in therapeutic decision-making. Results: SES had a clinical sensitivity of 57.4% and clinical specificity of 95.6%. Streptococcus pneumoniae and Pseudomonas aeruginosa were the top two bacterial pathogens, whereas Herpes simplex virus (HSV) was the most common viral pathogen. Polymicrobial infections were detected in 32.14% of SES-positive cases. SES elicited a change in the management in 30% of the patients from initial empiric therapy. At discharge, 51 patients recovered fully while 11 patients had partial recovery. Three-month follow-up showed only six patients to have neurological deficits. Conclusion: In a tertiary care center, etiological microbial diagnosis is central to appropriate therapy and outcomes. Sensitive and accurate multiplex molecular diagnostics play a critical role in not only identifying the causative pathogen but also in helping clinicians to institute appropriate therapy, reduce overuse of antimicrobials, and ensure superior clinical outcomes. PMID:27994358

  10. A multiplex allele-specific real-time polymerase chain reaction assay for HLA-B*13:01 genotyping in four Chinese populations.

    PubMed

    Liu, Z; Chen, G; Kang, X; Han, M; Chen, R; Chen, C; Wang, H

    2016-10-01

    Human leukocyte antigen HLA-B*13:01 is identified currently as a marker of individual susceptibility to drug-induced hypersensitivity reaction, such as dapsone-induced hypersensitivity reactions (DIHRs) and trichloroethylene-induced dermatitis. Therefore, screening for the HLA-B*13:01 allele can assist clinics in identifying patients at risk of developing DIHRs. By combining the allele-specific primers with TaqMan probes, we established a single tube, triplex real-time PCR to detect HLA-B*13:01. The reliability of this assay was validated by the comparison of genotyping results with those by sequence-based typing (SBT). With this assay, the distribution of HLA-B*13:01 in a total of 350 blood samples from four ethnic groups: Han, Tibetan, Uighur, and Buyei were determined. A 100% concordance was observed between the results with the established real-time PCR and SBT in 100 samples. The detection limit of this assay was 0.016 ng genomic DNA. The prevalence of HLA-B*13:01 carriers were 11%, 8%, 1%, and 2% in the Buyei (n = 100), Northern Han (n = 100), Tibetan (n = 100), and Uighur (n = 50) populations, respectively. The multiplex real-time PCR assay provided a fast and reliable method for accurate detection of HLA-B*13:01 allele prior to dapsone administration in clinical practice and onset of the reaction after exposure to trichloroethylene. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Viruses detected by systematic multiplex polymerase chain reaction in adults with suspected community-acquired pneumonia attending emergency departments in France.

    PubMed

    Das, D; Le Floch, H; Houhou, N; Epelboin, L; Hausfater, P; Khalil, A; Ray, P; Duval, X; Claessens, Y-E; Leport, C

    2015-06-01

    Infectious agents associated with community-acquired pneumonia (CAP) are under-studied. This study attempted to identify viruses from the upper respiratory tract in adults visiting emergency departments for clinically suspected CAP. Adults with suspected CAP enrolled in the ESCAPED study (impact of computed tomography on CAP diagnosis) had prospective nasopharyngeal (NP) samples studied by multiplex PCR (targeting 15 viruses and four intracellular bacteria). An adjudication committee composed of infectious disease specialists, pneumologists and radiologists blinded to PCR results reviewed patient records, including computed tomography and day 28 follow up, to categorize final diagnostic probability of CAP as definite, probable, possible, or excluded. Among the 254 patients enrolled, 78 (31%) had positive PCR, which detected viruses in 72/254 (28%) and intracellular bacteria in 8 (3%) patients. PCR was positive in 44/125 (35%) patients with definite CAP and 21/83 (25%) patients with excluded CAP. The most frequent organisms were influenza A/B virus in 27 (11%), rhinovirus in 20 (8%), coronavirus in seven (3%), respiratory syncytial virus in seven (3%) and Mycoplasma pneumoniae in eight (3%) of 254 patients. Proportion of rhinovirus was higher in patients with excluded CAP compared with other diagnostic categories (p = 0.01). No such difference was observed for influenza virus. Viruses seem common in adults attending emergency departments with suspected CAP. A concomitant clinical, radiological and biological analysis of the patient's chart can contribute to either confirm their role, or suggest upper respiratory tract infection or shedding. Their imputability and impact in early management of CAP deserve further studies. NCT01574066. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. Rapid Detection of Genomic Mutations in gyrA and parC Genes of Escherichia coli by Multiplex Allele Specific Polymerase Chain Reaction.

    PubMed

    Onseedaeng, Sukanlayanee; Ratthawongjirakul, Panan

    2016-11-01

    Fluoroquinolone (FR) resistant Escherichia coli infection has become a global problem. The FR resistance usually occurs mainly due to specific point of mutations within the quinolone resistance-determining regions (QRDRs) at the gyrA codon of Ser83 and Asp87 and the parC codon of Ser80 and Glu84. Here, we appraised type and frequency of the QRDR mutations in FR-resistant E. coli isolates, and developed multiplex allele specific PCR (MAS-PCR) for the detection of "hot spot" mutations. A total of 111 ciprofloxacin-resistant E. coli from Ramathibodi Hospital in Bangkok, Thailand, were performed Minimum Inhibitory Concentration (MIC) by Etest® and investigated for gyrA and parC genes' mutations by MAS-PCR. Sensitivity and specificity of MAS-PCR were compared to the sequencing method's. Ninety-nine of 111 (89.19%) E. coli isolates had mutation at least one point in the QRDRs. Six usual amino acid substitutes were reported, including Ser83-Lue, Asp87-Asn, Asp87-Tyr, Ser80-Ile, Glu84-Gly, and Glu84-Val. MAS-PCR detected codons 83 and 87 in gyrA and codons 80 and 84 in parC mutations, yielding 96.97%, 100%, 100%, and 93.33% sensitivity, respectively, and 100%, 100%, 100%, and 98.48% specificity, respectively. MAS-PCR may be used for rapid detection of FR resistance in routine laboratory as well as in epidemiology study. © 2016 Wiley Periodicals, Inc.

  13. Prevalence, distribution, and viral burden of all 15 high-risk human papillomavirus types in adenosquamous carcinoma of the uterine cervix: a multiplex real-time polymerase chain reaction-based study.

    PubMed

    Quddus, M Ruhul; Manna, Pradip; Sung, C James; Kerley, Spencer; Steinhoff, Margaret M; Lawrence, W Dwayne

    2014-02-01

    Human papillomavirus (HPV) 16 and 18 are the types most commonly found in cervical adenosquamous carcinoma. Multiple HPV types have been found in cervical adenocarcinoma but not in the adenosquamous variant. Type-specific detection of high-risk (HR) HPV allows the detection of co-infection by multiple HPV types and assessment of viral load per cell. Our aim was to identify and quantify all HR HPV types in cervical adenosquamous carcinoma and to correlate viral loads with prognosis-related histologic features. All 15 HR HPV types were tested for by multiplex real-time polymerase chain reaction, and standard curves were created for each type. Viral loads were determined retrospectively. Prognosis-related histologic features were correlated with specific HPV types and the viral loads. A total of 80% of the tumors examined expressed HPV. Types 16/18 were detected in 86% of these cases, whereas the remaining 14% of the positive cases were infected by other types. A single type of virus was detected in 67% of cases, 2 in 29%, and 3 in 4%. Poor prognostic features were seen in 84.6% of the tumors infected with HPV 16, 46% of those infected with HPV 18, and 100% of those infected with other types. As expected, HPV 16, HPV 18, or both were the most frequent viral types; HPV 73 was the next most frequent type. Multiple HPV types were detected in 33% of the tumors. Non-HPV 16/18 cases had low viral loads, but all of these had poor prognosis-related histologic features. Two of the three recurrent cases had multiple viral types. © 2014 Elsevier Inc. All rights reserved.

  14. Development and use of a multiplex real-time quantitative polymerase chain reaction assay for detection and differentiation of Porcine circovirus-2 genotypes 2a and 2b in an epidemiological survey.

    PubMed

    Gagnon, Carl A; del Castillo, Jérome R E; Music, Nedzad; Fontaine, Guy; Harel, Josée; Tremblay, Donald

    2008-09-01

    By the end of 2004, the Canadian swine population had experienced a severe increase in the incidence of Porcine circovirus-associated disease (PCVAD), a problem that was associated with the emergence of a new Porcine circovirus-2 genotype (PCV-2b), previously unrecovered in North America. Thus, it became important to develop a diagnostic tool that could differentiate between the old and new circulating genotypes (PCV-2a and PCV-2b, respectively). Consequently, a multiplex real-time quantitative polymerase chain reaction (mrtqPCR) assay that could sensitively and specifically identify and differentiate PCV-2 genotypes was developed. A retrospective epidemiologic survey that used the mrtqPCR assay was performed to determine if cofactors could affect the risk of PCVAD. From 121 PCV-2-positive cases gathered for this study, 4.13%, 92.56%, and 3.31% were positive for PCV-2a, PCV-2b, and both genotypes, respectively. In a data analysis using univariate logistic regressions, the PCVAD-compatible (PCVAD/c) score was significantly associated with the presence of Porcine reproductive and respiratory syndrome virus (PRRSV), PRRSV viral load, PCV-2 viral load, and PCV-2 immunohistochemistry (IHC) results. Polytomous logistic regression analysis revealed that PCVAD/c score was affected by PCV-2 viral load (P = 0.0161) and IHC (P = 0.0128), but not by the PRRSV variables (P > 0.9), which suggests that mrtqPCR in tissue is a reliable alternative to IHC. Logistic regression analyses revealed that PCV-2 increased the odds ratio of isolating 2 major swine pathogens of the respiratory tract, Actinobacillus pleuropneumoniae and Streptococcus suis serotypes 1/2, 1, 2, 3, 4, and 7, which are serotypes commonly associated with clinical diseases.

  15. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

    PubMed

    Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

    2015-03-01

    African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. © 2015 The Author(s).

  16. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  17. Polymerase Chain Reaction for Educational Settings.

    ERIC Educational Resources Information Center

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  18. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  19. Polymerase Chain Reaction for Educational Settings.

    ERIC Educational Resources Information Center

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  20. Red light-controlled polymerase chain reaction.

    PubMed

    Meyer, A; Schikora, Margot; Mokhir, A

    2015-09-04

    A 23-mer DNA "caged" at its 3'-terminus with a 9-anthracenyl moiety was prepared. It can be uncaged in the presence of photosensitizer (In(pyropheophorbide-a)chloride)-containing DNAs (9-12 mers) and upon irradiation with red light. This mixture of DNAs was used to design red-light controlled polymerase chain reaction.

  1. Polymerase chain reaction assay for avian polyomavirus.

    PubMed Central

    Phalen, D N; Wilson, V G; Graham, D L

    1991-01-01

    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By using the polymerase chain reaction, BFDV was detected in adult, nestling, and embryo budgerigar (Melopsitticus undulatus) tissue DNAs and in sera from adult and nestling budgerigars. These results suggest the possibility of persistent infections in adult birds and lend further support to previously described evidence of possible in ovo transmission. BFDV was also detected in chicken embryo fibroblast cell cultures and chicken eggs inoculated with the virus. A 550-bp product with identical restriction enzyme sites was amplified from a suspected polyomavirus isolated from a peach-faced lovebird (Agapornis pesonata) and from tissue DNA from a Hahn's macaw (Ara nobilis) and a sun conure (Aratinga solstitialis) with histological lesions suggestive of polyomavirus infection. These fragments also hybridized with a BFDV-derived probe, proving that they were derived from a polyomavirus very similar, if not identical, to BFDV. Images PMID:1647403

  2. Polymerase chain reaction assay for avian polyomavirus.

    PubMed

    Phalen, D N; Wilson, V G; Graham, D L

    1991-05-01

    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By using the polymerase chain reaction, BFDV was detected in adult, nestling, and embryo budgerigar (Melopsitticus undulatus) tissue DNAs and in sera from adult and nestling budgerigars. These results suggest the possibility of persistent infections in adult birds and lend further support to previously described evidence of possible in ovo transmission. BFDV was also detected in chicken embryo fibroblast cell cultures and chicken eggs inoculated with the virus. A 550-bp product with identical restriction enzyme sites was amplified from a suspected polyomavirus isolated from a peach-faced lovebird (Agapornis pesonata) and from tissue DNA from a Hahn's macaw (Ara nobilis) and a sun conure (Aratinga solstitialis) with histological lesions suggestive of polyomavirus infection. These fragments also hybridized with a BFDV-derived probe, proving that they were derived from a polyomavirus very similar, if not identical, to BFDV.

  3. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE PAGES

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  4. Polymerase chain reaction with nearby primers.

    PubMed

    Garafutdinov, Ravil R; Galimova, Aizilya A; Sakhabutdinova, Assol R

    2017-02-01

    DNA analysis of biological specimens containing degraded nucleic acids such as mortal remains, archaeological artefacts, forensic samples etc. has gained more attention in recent years. DNA extracted from these samples is often inapplicable for conventional polymerase chain reaction (PCR), so for its amplification the nearby primers are commonly used. Here we report the data that clarify the features of PCR with nearby and abutting primers. We have shown that the proximity of primers leads to significant reduction of the reaction time and ensures the successful performance of DNA amplification even in the presence of PCR inhibitors. The PCR with abutting primers is usually characterized by the absence of nonspecific amplification products that causes extreme sensitivity with limit of detection on single copy level. The feasibility of PCR with abutting primers was demonstrated on species identification of 100 years old rotten wood. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Relationship between the para-homologous sodium channel point mutation (g --> c at nucleotide 2979) and knockdown resistance in the German cockroach using multiplex polymerase chain reaction to discern genotype.

    PubMed

    Valles, Steven M; Perera, Omaththage P; Strong, Charles A

    2003-06-01

    Extensive use of pyrethroid insecticides for urban pest control has led to widespread pyrethroid resistance in the German cockroach. A mutation at nucleotide position 2979 (G to C, causing a leucine to phenylalanine change) in the S6 transmembrane segment of domain II of the para-homologous voltage-gated sodium channel has been previously identified in knockdown-resistant cockroaches and demonstrated by site-directed mutagenesis to reduce channel sensitivity to pyrethroids. In a recent survey, 83% of pyrethroid-resistant German cockroach populations were found to possess this mutation. A German cockroach strain with a low incidence of the L993F mutation was subjected to selection pressure with cypermethrin and subsequently evaluated over several generations for the knockdown resistance phenotype. Correspondingly, we determined the genotype of individual cockroaches of each population at the 2979 position of the para-homologous gene. Genotype was discerned by development of a polymerase chain reaction method that employed a mismatched primer-template set. A direct relationship was observed between mean knockdown time and the presence of the kdr mutation. Furthermore, individuals homozygous for the kdr mutation exhibited a significantly higher mean knockdown time than heterozygotes or wildtype cockroaches. This is the first report demonstrating the progressive expression of the kdr allele in response to insecticide selection pressure.

  6. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    ERIC Educational Resources Information Center

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  7. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    ERIC Educational Resources Information Center

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  8. Integrated polymerase chain reaction/electrophoresis instrument

    DOEpatents

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  9. Actinobaculum suis Detection Using Polymerase Chain Reaction

    PubMed Central

    Amigo, Cristina Román; de Gobbi, Debora Dirani Sena; Gomes, Vasco Túlio de Moura; Perina, Danilo do Prado; Nogueira de Lima Filsner, Pedro Henrique; Costa, Barbara Letícia Pereira; Spindola, Maria Garcia; Ferreira, Thais Sebastiana Porfida; Brandão, Paulo Eduardo; Moreno, Andrea Micke

    2012-01-01

    Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR) for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0 × 101 CFU/mL and 1.0 × 102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192) in sow urine samples and 82.2% (37/45) in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45) of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs. PMID:23346017

  10. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  11. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  12. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    PubMed

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  13. Multiplexed miRNA northern blots via hybridization chain reaction.

    PubMed

    Schwarzkopf, Maayan; Pierce, Niles A

    2016-09-06

    Northern blots enable detection of a target RNA of interest in a biological sample using standard benchtop equipment. miRNAs are the most challenging targets as they must be detected with a single short nucleic acid probe. With existing approaches, it is cumbersome to perform multiplexed blots in which several RNAs are detected simultaneously, impeding the study of interacting regulatory elements. Here, we address this shortcoming by demonstrating multiplexed northern blotting based on the mechanism of hybridization chain reaction (HCR). With this approach, nucleic acid probes complementary to RNA targets trigger chain reactions in which fluorophore-labeled DNA hairpins self-assemble into tethered fluorescent amplification polymers. The programmability of HCR allows multiple amplifiers to operate simultaneously and independently within a blot, enabling straightforward multiplexing. We demonstrate simultaneous detection of three endogenous miRNAs in total RNA extracted from 293T and HeLa cells. For a given target, HCR signal scales linearly with target abundance, enabling relative and absolute quantitation. Using non-radioactive HCR, sensitive and selective miRNA detection is achieved using 2'OMe-RNA probes. The HCR northern blot protocol takes ∼1.5 days independent of the number of target RNAs.

  14. Basics of quantitative polymerase chain reaction: 2. Electrophoresis and quantitation of polymerase chain reaction products.

    PubMed

    Sundfors, C; Collan, Y

    1996-01-01

    The performance of agarose and polyacrylamide (PAGE) gels in quantitating polymerase chain reaction (PCR) amplified c-erbB2 and p53 gene sequences (213 and 133 base pairs, respectively) was studied by applying image analysis on photographed ethidium bromide stained gels. The 5 mm thick agarose gels were more insensitive than the 1 mm thin PAGE gels and already started to show saturation effects within a narrow concentration range. The explanation is the greater dilution of band-associated products within the volume of the gel and the inefficient penetration of exciting UV light through the gel. Such effects produced inconsistency and dramatic variations in the band ratio estimates. In the system used by us, agarose electrophoresis and also electrophoresis using 5 mm thick PAGE gels have only a limited value in quantitation of PCR products with the band density ratios, but both can be used well in qualitative work. The far thinner (1 mm) PAGE gels, which did not markedly absorb UV light, performed better in the light of band density ratio estimates. The linear or approximately linear range of concentrations was wider. The coefficient of variation of band ratio, when estimated from the same gels, after loading them with aliquots of identical DNA from several PCR amplified tubes, was in the range of 4%. The absolute values of band densities had a more remarkable variation (than 4%) in both agarose and PAGE gels. Our recommendation is that quantitation of PCR products be done with band density ratio estimates, and in thin PAGE gels.

  15. A noncontact temperature measurement method in polymerase chain reaction reactors

    NASA Astrophysics Data System (ADS)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  16. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  17. Mathematics analysis of polymerase chain reaction kinetic curves.

    PubMed

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  18. [The contamination under polymerase chain reaction studies: problems and solutions].

    PubMed

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  19. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  20. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOEpatents

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  1. Rapid Differentiation and Identification of Potential Severe Strains of Citrus tristeza Virus by Real-Time Reverse Transcription Polymerase Chain Reaction Assays

    USDA-ARS?s Scientific Manuscript database

    A multiplex Taqman®-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to detect all strains of Citrus tristeza virus (CTV) and to identify potentially severe strains of the virus. A CTV TaqMan probe (CTV-CY5) based on the coat protein (CP) gene sequences...

  2. Quantitative Analysis of Periodontal Pathogens Using Real-Time Polymerase Chain Reaction (PCR).

    PubMed

    Marin, Mª José; Figuero, Elena; Herrera, David; Sanz, Mariano

    2017-01-01

    The quantitative polymerase chain reaction (qPCR) is a variant of PCR aimed to detect and quantify a targeted DNA molecule through the addition of probes labeled with fluorescent molecules that emit fluorescence within each amplification cycle, what results in fluorescence values proportional to the amount of accumulated PCR product. This chapter presents the detailed procedures for quantification of different periodontal pathogens (Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Campylobacter rectus, and Fusobacterium spp.) using qPCR. It also includes the description of the most frequent problems encountered and how to solve them. In addition, a detailed protocol for multiplex qPCR to detect and quantify P. gingivalis and A. actinomycetemcomitans is included.

  3. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  4. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  5. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    PubMed Central

    Kwon, Ji Yeon; Ryu, Ki Hyun; Choi, Sun Hee

    2013-01-01

    A detection system based on a multiplex reverse transcription (RT) polymerase chain reaction (PCR) was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV), lily mottle virus (LMoV), lily symptomless virus (LSV). Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV) by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility. PMID:25288961

  6. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    PubMed

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  7. Detection of Clostridium septicum hemolysin gene by polymerase chain reaction.

    PubMed

    Takeuchi, S; Hashizume, N; Kinoshita, T; Kaidoh, T; Tamura, Y

    1997-09-01

    A polymerase chain reaction (PCR) was developed for the detection of the hemolysin (alpha toxin) gene of Clostridium septicum. The PCR primers were designed from the sequence of the hemolysin gene and synthesized. A DNA fragment of 270 bp was amplified from 10 strains of C. septicum, but was not from strains of C. chauvoei, C. perfringens, C. novyi, or C. haemolyticum. When the PCR product was digested with Sau3AI, two DNA fragments of the expected 148 bp and 122 bp were recognized. The lowest detectable threshold of PCR for the hemolysin gene was 3.8 x 10(3) cells/ml. The PCR technique may be useful for rapid detection or identification of C. septicum associated with malignant edema.

  8. Diagnosis of Jamestown Canyon encephalitis by polymerase chain reaction.

    PubMed

    Huang, C; Campbell, W; Grady, L; Kirouac, I; LaForce, F M

    1999-06-01

    In recent years, polymerase chain reaction (PCR) has been under study as a potential technique to improve the accuracy of diagnosis of suspected central nervous system viral infections. We describe a case of severe encephalitis in a previously healthy 20-year-old woman from New York who presented with headache, fever, and photophobia. Her illness was characterized by progressive worsening of her neurological status, leading to confusion, delirium, and status epilepticus. The diagnosis of Jamestown Canyon encephalitis was established by positive reverse transcriptase (RT)-PCR and nucleic acid sequencing of the band from both cerebrospinal fluid and brain tissue. The nucleotide sequence and the deduced amino acid sequence of the Jamestown Canyon virus from this patient were very similar to Jamestown Canyon virus isolates from mosquito pools in New York. This report suggests that RT-PCR assays could be important tools in the diagnostic workup of cases of encephalitis.

  9. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  10. Aqueous humor polymerase chain reaction in uveitis - utility and safety.

    PubMed

    Chronopoulos, Argyrios; Roquelaure, Daniel; Souteyrand, Georges; Seebach, Jörg Dieter; Schutz, James Scott; Thumann, Gabriele

    2016-10-28

    To study the value and safety of aqueous humor polymerase chain reaction (PCR) analysis for Herpes simplex, varicella zoster, cytomegalovirus, Epstein-Barr virus and Toxoplasma gondii in patients with uveitis. Records of 45 consecutive patients with anterior and posterior uveitis who underwent AC paracentesis with PCR were reviewed. The main outcome measure was frequency of PCR positivity. Secondary outcomes were alteration of treatment, safety of paracentesis, and correlation of keratitic precipitates with PCR positivity, RESULTS: The overall PCR positivity was 48.9 % (22/45). Therapy was changed because of the PCR results in 14/45 patients (37.7 %). One patient experienced a paracentesis related complication (1/45, 2.2 %) without long-term sequelae. Aqueous PCR altered the diagnosis and treatment in over a third of our patients and was relatively safe. Aqueous PCR should be considered for uveitis of atypical clinical appearance, recurrent severe uveitis of uncertain etiology, and therapy refractory cases.

  11. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    PubMed Central

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  12. [Staphylococcus aureus in food determined by polymerase chain reaction].

    PubMed

    Tian, Jing; Ji, Rong; Yang, Jun; Li, Yepeng

    2007-03-01

    To establish a rapid polymerase chain reaction (PCR)method for detection of staphylococcus aureus in milk, ice cream and meat. Two pairs of oligonucleotide primers were designed with thermo nuclease gene nuc and surfaced-associated fibrinogen-binding protein gene ClfA to detect staphylococcus aureus. Fifty-two staphylococcus aureus and thirty-one non staphylococcus aureus were amplified by PCR to verify the specificity. Various numbers of bacteria were added into milk, ice cream and meat. After enrichment, DNA extracted in different time was amplified by PCR to verify detection limit. Each primer pair allows specific detection. The limit of detection was 10 cfu/g (ml) in three kinds of food. Whole procedure of detection could be finished in 24 hours. A rapid, sensitive and specific PCR method can be applied detecting staphylococcus aureus in milk, ice cream and meat.

  13. Universal CG cloning of polymerase chain reaction products.

    PubMed

    Stevenson, Julian; Brown, Andrew J

    2015-02-15

    Single-insert cloning of DNA fragments without restriction enzymes has traditionally been achieved using TA cloning, with annealing of a polymerase chain reaction (PCR) fragment containing a single overhanging 3' A to a plasmid vector containing a 3' T. In this article, we show that the analogous "CG cloning" is faster and far more efficient, using AhdI to generate a C-vector. For an afternoon ligation, CG cloning achieved double the cloning efficiency and more than 4-fold the number of transformants compared with TA cloning. However, blunt-end ligation was markedly more efficient than both. CG cloning could prove to be extremely useful for single-copy high-throughput cloning.

  14. Toxoplasma polymerase chain reaction on experimental blood samples.

    PubMed

    Joss, A W; Chatterton, J M; Evans, R; Ho-Yen, D O

    1993-01-01

    A two-stage polymerase chain reaction (PCR) assay employing oligonucleotide primers from the B1 gene of Toxoplasma gondii was developed and assessed for sensitivity and specificity. It was able to detect T. gondii DNA from as little as one parasite/sample in mock-infected rat or mouse leucocyte preparations. Parasitaemia was also identified in animals at five stages between 16 and 66 h after infection with the virulent RH strain, and at 12 stages between 2 and 38 days after infection with the cyst-forming Beverley strain. In the latter case, PCR was more sensitive than animal culture. No cross-reactions were observed in samples containing various opportunist pathogens which may also be found in the blood of immunocompromised patients.

  15. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  16. Rapid electrochemiluminescence assays of polymerase chain reaction products.

    PubMed

    Kenten, J H; Casadei, J; Link, J; Lupold, S; Willey, J; Powell, M; Rees, A; Massey, R

    1991-09-01

    We demonstrate the first use of an electrochemiluminescent (ECL) label, [4-(N-succimidyloxycarbonylpropyl)-4'-methyl-2,2'- bipyridine]ruthenium(II) dihexafluorophosphate (Origen label; IGEN Inc.), in DNA probe assays. This label allows rapid (less than 25 min) quantification and detection of polymerase chain reaction (PCR)-amplified products from oncogenes, viruses, and cloned genes. For the PCR, we used labeled oligonucleotide primers complementary to human papiloma virus and the Ha-ras oncogene. These samples were followed by ECL analysis or hybridization with specific, Origen-labeled oligonucleotide probes. These studies demonstrate the speed, specificity, and effectiveness of the new ECL labels, compared with 32P, for nucleic acid probe applications. We describe formats involving conventional methodologies and a new format that requires no wash step, allowing simple and rapid sample analysis. These rapid assays also reduce PCR contamination, by requiring less sample handling. Improvements in ECL detectability are currently under investigation for use in DNA probe assays without amplification.

  17. Detection of Mycoplasma pneumoniae by using the polymerase chain reaction.

    PubMed Central

    Bernet, C; Garret, M; de Barbeyrac, B; Bebear, C; Bonnet, J

    1989-01-01

    The polymerase chain reaction (PCR) technique was used to detect Mycoplasma pneumoniae. A specific DNA sequence for M. pneumoniae was selected from a genomic library, and two oligonucleotides were chosen in this sequence to give an amplified fragment of 144 base pairs. We show that DNA from different M. pneumoniae strains can be detected by PCR, with DNA from other Mycoplasma species giving negative results. Analysis of biological samples (throat swabs) obtained from hamsters that were experimentally infected with M. pneumoniae showed that PCR was more sensitive and reliable than conventional culture techniques for the detection of M. pneumoniae. Initial experiments on artificially seeded human bronchoalveolar lavages showed that PCR can be used to detect 10(2) to 10(3) organisms. Images PMID:2509513

  18. Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

    PubMed

    Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

    2005-01-01

    The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  19. The polymerase chain reaction for Mycoplasma gallisepticum detection.

    PubMed

    Kempf, I; Blanchard, A; Gesbert, F; Guittet, M; Bennejean, G

    1993-12-01

    On the basis of the aligned 16S rRNA sequences of Mollicutes, a pair of primers was chosen for the detection of Mycoplasma gallisepticum. When used in the polymerase chain reaction (PCR), the primers detected a specific amplification of all Mg strains tested, yielding an expected 330 bp product. Amplification was not detected when other Mollicutes or E. coli were used as PCR templates. SPF chickens were experimentally inoculated with two strains of M. gallisepticum or Mycoplasma iowae. Tracheal swabs were collected 8, 15, 20 and 28 days after inoculation, and cultured for mycoplasma or tested by PCR. PCR products were detected by hybridization with a digoxigenin-labeled probe and by chemiluminescence. The results showed that culture was positive for 49/73 swabs while PCR detected 70/72 positive samples. Thus, PCR can provide the basis of a sensitive, specific, rapid and non-radio-active method for detecting M. gallisepticum.

  20. Convective polymerase chain reaction around micro immersion heater

    NASA Astrophysics Data System (ADS)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  1. Inhibitory effect of silicon nanowires on the polymerase chain reaction.

    PubMed

    Wang, Hongwei; Wang, Lei; Yuan, Lin; Yang, Weikang; Brash, John L; Chen, Hong

    2012-09-14

    The effect of nanomaterials on biological reactions has received much attention. We report herein that silicon nanowires (SiNWs) inhibit the polymerase chain reaction (PCR). The inhibitory effect was found to be concentration-dependent, with a minimum inhibitory concentration of about 0.4 mg ml(-1). DNA polymerase, restriction endonucleases, lysozyme and horseradish peroxidase maintained their bioactivities after exposure to SiNWs. Also the interaction of SiNWs with primers and dNTP did not lead to decreased PCR yield. Compared to primers and dNTP, template DNA showed 4.7-10.5-fold greater adsorption on SiNWs. Template bound to SiNWs was ineffective in the PCR, whereas addition of free template to the PCR system increased the yield. The results of this work suggest that the inhibitory effect of SiNWs on the PCR was due to the selective adsorption of double-stranded DNA on SiNWs, thereby decreasing the availability of template for the reaction.

  2. Identification of duck plague virus by polymerase chain reaction.

    PubMed

    Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

  3. Multiplex PCR Assay Discriminates Rabbit, Rat and Squirrel Meat in Food Chain.

    PubMed

    Ahamad, Mohammad Nasir Uddin; Ali, Md Eaqub; Hossain, M A Motalib; Asing, Asing; Sultana, Sharmin; Jahurul, M H A

    2017-07-27

    Rabbit meat is receiving increasing attention because it contains more proteins and less fat. On the other hand, squirrel meat is served in aristocrat meals in certain countries and so it is sold at higher prices. The other side of the coin is rat meat that has family ties with rabbit and squirrel but possesses huge threats to public health because it is a potential career of several zoonotic organisms. Recently, rat meat was mislabeled and sold as lamb after chemical modification. Thus the chances of rabbit and squirrel meat substitution by rat meat cannot be ruled out. For the first time, a multiplex polymerase chain reaction assay was developed here for the discriminatory identification of rat, rabbit and squirrel in food chain. Rabbit (123 bp), rat (108 bp) and squirrel (243 bp) targets were amplified from ATP6 and cytb genes along with a eukaryotic internal control (141bp). The products were sequenced and cross-tested against 22 species. A total of 81 reference samples and 72 meatball specimens were screened to validate the assay. Analyte stability was evaluated through boiling, autoclaving and microoven cooking. The tested lower limits of detection were 0.01ng DNA for pure meat and 0.1% for meatballs.

  4. Diagnostic challenges of tuberculous lymphadenitis using polymerase chain reaction analysis: a case study.

    PubMed

    Taniguchi, Hirokazu; Nakamura, Masahiko; Shimokawa, Kazuki; Kamiseki, Fumi; Ishizawa, Shin; Abo, Hitoshi; Furuse, Hideaki; Tsuda, Takeshi; Masaki, Yasuaki; Suzuki, Kensuke

    2015-01-01

    This report presents a case of tuberculous lymphadenitis that was difficult to diagnose using polymerase chain reaction analysis. An 80-year-old Japanese female was hospitalized due to swollen cervical lymph nodes. Her lymph node tests revealed paradoxical polymerase chain reaction results. Polymerase chain reaction analysis of two biopsy tissues using the Cobas TaqMan revealed a positive result for Mycobacterium avium and a negative result for Mycobacterium tuberculosis. However, polymerase chain reaction analysis of a cultured colony of acid-fast bacteria from biopsy tissue using the Cobas TaqMan and an alternative polymerase chain reaction analysis of biopsy tissue yielded discordant results. The patient was diagnosed as having tuberculous lymphadenitis. She was treated with antitubercular drugs and subsequently had a reduction in cervical lymph node swelling. Polymerase chain reaction analysis is not 100% accurate; hence, its use as a diagnostic tool for mycobacterial infection requires increased attention.

  5. Effects of Upconversion Nanoparticles on Polymerase Chain Reaction

    PubMed Central

    Hwang, Sang-Hyun; Im, Su-Gyeong; Hah, Sang Soo; Cong, Vu Thanh; Lee, Eun Jeong; Lee, Yeon-Su; Lee, Geon Kook

    2013-01-01

    Nanoparticles (NPs) are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs), which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR) specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix) and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit). Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C–45°C), addition of the 40 nm UCNP (1 µg/µL) to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation. PMID:24039935

  6. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

    PubMed Central

    Lorenz, Todd C.

    2012-01-01

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: ● Set up reactions and thermal cycling

  7. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    PubMed

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  8. Multifunctional polyurethane sponge for polymerase chain reaction enhancement.

    PubMed

    Seok, Seunghwan; Shin, Sujeong; Lee, Tae Jae; Jeong, Jae-Min; Yang, MinHo; Kim, Do Hyun; Park, Jung Youn; Lee, Seok Jae; Choi, Bong Gill; Lee, Kyoung G

    2015-03-04

    Selective filtering of target biomaterials from impurities is an important task in DNA amplification through polymerase chain reaction (PCR) enhancement and gene identification to save endangered animals and marine species. Conventional gene extraction methods require complicated steps, skilled persons, and expensive chemicals and instruments to improve DNA amplification. Herein, we proposed an alternative method for overcoming such challenges by imparting secondary functionality using commercially available polyurethane (PU) sponges and cost-effective fabrication approaches through polydopamine and polysiloxane coatings. The porous, highly flexible, and chemically modified superhydrophilic and superhydrophobic PU sponges allow large surface areas and mechanically stable frames for effective extraction of genomic DNA through selective filtering of fish tissues and oils. Furthermore, these chemically modified PU sponges allow separation of genes and improvement of PCR for DNA amplification for the identification of fish species. The combination of a simple fabrication method and functionalized PU sponges could be a useful platform for PCR enhancement and gene-based identification of species for practical applications.

  9. Taylor dispersion in polymerase chain reaction in a microchannel

    NASA Astrophysics Data System (ADS)

    Lee, Jinkee; Kulla, Elejdis; Chauhan, Anuj; Tripathi, Anubhav

    2008-09-01

    Polymerase chain reaction (PCR) is commonly used for a wide range of DNA applications such as disease detection, genetic fingerprinting, and paternity testing. The importance of PCR has led to an increased interest in performing PCR in a microfluidic platform with a high throughput while using very small DNA quantities. In this paper we solve convection-diffusion equations for the DNA and deoxynucleoside triphosphate (dNTP) under conditions suitable for PCR operation in a microchip. These include pressure driven flow accompanied by temporal temperature changes that lead to an amplification reaction, which is modeled as a first order reaction. The convection-diffusion-reaction equations are solved by using the method of multiple time scales to yield average equations that can be solved to obtain the long time evolution of the concentration profiles. The results obtained by solving the averaged equations agree well with full numerical solutions. The averaged equations are also solved to simulate the PCR to illustrate some interesting aspects of this operation in a microfluidic device. It is shown that insufficient nucleotide concentrations can lead to complete depletion of NTP at certain axial locations, which leads to termination of DNA amplification at these locations, resulting in formation of a plateau in DNA concentration.

  10. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    SciTech Connect

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  11. Detection of Penicillium expansum by polymerase chain reaction.

    PubMed

    Marek, Patrick; Annamalai, Thirunavukkarasu; Venkitanarayanan, Kumar

    2003-12-31

    Penicillium expansum is a major causative agent of postharvest decay in a variety of fruits, including apples, peaches, nectarines, and cherries. It causes significant economic losses to the fruit industry and is also of potential public health significance, since it produces patulin, a mycotoxin known to cause harmful effects in animals. Rapid and specific detection of P. expansum is important for ensuring microbiological quality and safety of fruits and fruit juices. The traditional methods for identification of P. expansum are time-consuming and labor-intensive. In this study, we report a polymerase chain reaction utilizing primers based on the polygalacturonase gene of P. expansum. The PCR amplified a 404-bp DNA product from all the P. expansum isolates tested, but not in other common foodborne Penicillium species and Escherichia coli. Experiments to determine the sensitivity of the PCR indicated that it can detect the DNA equivalent from as low as 25 spores of P. expansum. The PCR could potentially be used as a rapid tool for screening fruits for the presence of P. expansum.

  12. Integrated polymerase chain reaction chips utilizing digital microfluidics.

    PubMed

    Chang, Yi-Hsien; Lee, Gwo-Bin; Huang, Fu-Chun; Chen, Yi-Yu; Lin, Jr-Lung

    2006-09-01

    This study reports an integrated microfluidic chip for polymerase chain reaction (PCR) applications utilizing digital microfluidic chip (DMC) technology. Several crucial procedures including sample transportation, mixing, and DNA amplification were performed on the integrated chip using electro-wetting-on-dielectric (EWOD) effect. An innovative concept of hydrophobic/hydrophilic structure has been successfully demonstrated to integrate the DMC chip with the on-chip PCR device. Sample droplets were generated, transported and mixed by the EWOD-actuation. Then the mixture droplets were transported to a PCR chamber by utilizing the hydrophilic/hydrophobic interface to generate required surface tension gradient. A micro temperature sensor and two micro heaters inside the PCR chamber along with a controller were used to form a micro temperature control module, which could perform precise PCR thermal cycling for DNA amplification. In order to demonstrate the performance of the integrated DMC/PCR chips, a detection gene for Dengue II virus was successfully amplified and detected. The new integrated DMC/PCR chips only required an operation voltage of 12V(RMS) at a frequency of 3 KHz for digital microfluidic actuation and 9V(DC) for thermal cycling. When compared to its large-scale counterparts for DNA amplification, the developed system consumed less sample and reagent and could reduce the detection time. The developed chips successfully demonstrated the feasibility of Lab-On-a-Chip (LOC) by utilizing EWOD-based digital microfluidics.

  13. Diagnosis of duck plague in waterfowl by polymerase chain reaction.

    PubMed

    Hansen, W R; Nashold, S W; Docherty, D E; Brown, S E; Knudson, D L

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  14. Development of a polymerase chain reaction test for Entamoeba invadens.

    PubMed

    Bradford, Carol M; Denver, Mary C; Cranfield, Michael R

    2008-06-01

    Entamoeba invadens is a protozoal parasite of reptiles that causes colitis, abscesses of liver and other organs, and sometimes acute death. It is generally considered a commensal of chelonians but has also been implicated as a cause of colitis, diarrhea, and death in gopher (Gopherus polyphemus) and leopard (Geochelone pardalis) tortoises. Diagnosis of E. invadens is currently by detection of trophozoites and/or cysts upon direct fecal examination. However, definitive diagnosis of E. invadens has been difficult due to the very similar morphology of nonpathogenic Entamoeba spp., including E. ranarum, E. insolita, E. barreti, and E. terrapinae. Definitive speciation of Entamoeba spp. is important to avoid misdiagnosis or overtreatment for nonpathogenic protozoa. It is also important for consideration of mixed species reptile collections to avoid exposing snakes and lizards to E. invadens. In this study, we developed polymerase chain reaction (PCR) primers for E. invadens, E. ranarum, E. terrapinae, and E. insolita and conducted PCR amplification of purified DNA from cell cultures, as well as purified DNA from reptile stool samples with E. invadens trophozoites added. As a result of this study, a naturally occurring infection of E. invadens was confirmed in a giant South American river turtle (Podocnemis expansa). This study has developed successful PCR primers for four species of Entamoeba and demonstrates that PCR is a promising diagnostic tool for the definitive identification of E. invadens.

  15. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    NASA Astrophysics Data System (ADS)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  16. Diagnosis of duck plague in waterfowl by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  17. A primer on on-demand polymerase chain reaction technology.

    PubMed

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  18. Fluorescence-based temperature control for polymerase chain reaction.

    PubMed

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  19. Applications of the polymerase chain reaction to genome analysis

    SciTech Connect

    Rose, E.A. )

    1991-01-01

    The objectives of the Human Genome Project are to create high-resolution genetic and physical maps, and ultimately to determine the complete nucleotide sequence of the human genome. The result of this initiative will be to localize the estimated 50,000-100,000 human genes, and acquire information that will enable development of a better understanding of the relationship between genome structure and function. To achieve these goals, new methodologies that provide more rapid, efficient, and cost effective means of genomic analysis will be required. From both conceptual and practical perspectives, the polymerase chain reaction (PCR) represents a fundamental technology for genome mapping and sequencing. The availability of PCR has allowed definition of a technically credible form that the final composite map of the human genome will take, as described in the sequence-tagged site proposal. Moreover, applications of PCR have provided efficient approaches for identifying, isolating, mapping, and sequencing DNA, many of which are amenable to automation. The versatility and power provided by PCR have encouraged its involvement in almost every aspect of human genome research, with new applications of PCR being developed on a continual basis.

  20. Electrochemical product detection of an asymmetric convective polymerase chain reaction.

    PubMed

    Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

    2009-10-15

    For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

  1. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    PubMed

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Nucleic acid amplification: Alternative methods of polymerase chain reaction.

    PubMed

    Fakruddin, Md; Mannan, Khanjada Shahnewaj Bin; Chowdhury, Abhijit; Mazumdar, Reaz Mohammad; Hossain, Md Nur; Islam, Sumaiya; Chowdhury, Md Alimuddin

    2013-10-01

    Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR) was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically.

  3. Sensitive detection of Helicobacter pylori by using polymerase chain reaction.

    PubMed Central

    Clayton, C L; Kleanthous, H; Coates, P J; Morgan, D D; Tabaqchali, S

    1992-01-01

    A polymerase chain reaction (PCR) for the specific detection of Helicobacter pylori was developed with a single primer pair derived from the nucleotide sequence of the urease A gene of H. pylori. We achieved specific amplification of a 411-bp DNA fragment in H. pylori. After 35 cycles of amplification, the product could be detected by agarose gel electrophoresis and contained conserved single HinfI and AluI restriction sites. This fragment was amplified in all 50 strains of H. pylori tested, but it was not detected in other bacterial species, showing the PCR assay to be 100% specific. PCR DNA amplification was able to detect as few as 10 H. pylori cells. PCR detected H. pylori in 15 of 23 clinical human gastric biopsy samples, whereas culturing and microscopy detected H. pylori in only 7 of the samples found to be positive by PCR. Additional primer pairs based on the urease genes enabled the detection of H. pylori in paraffin-embedded human gastric biopsy samples. The detection of H. pylori by PCR will enable both retrospective and prospective analyses of clinical samples, elucidating the role of this organism in gastroduodenal disease. Images PMID:1734052

  4. Nucleic acid amplification: Alternative methods of polymerase chain reaction

    PubMed Central

    Fakruddin, Md; Mannan, Khanjada Shahnewaj Bin; Chowdhury, Abhijit; Mazumdar, Reaz Mohammad; Hossain, Md. Nur; Islam, Sumaiya; Chowdhury, Md. Alimuddin

    2013-01-01

    Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR) was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically. PMID:24302831

  5. Identifying of meat species using polymerase chain reaction (PCR)

    SciTech Connect

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  6. Demonstration of cytomegalovirus by polymerase chain reaction after liver transplantation.

    PubMed

    Schmidt, C A; Oettle, H; Neuhaus, P; Wiens, M; Timm, H; Wilborn, F; Siegert, W

    1993-10-01

    The polymerase chain reaction (PCR) is a highly sensitive and specific technique for detection of cytomegalovirus DNA. With this method we prospectively analyzed buffy coat leukocytes at weekly intervals over 3 months in 60 patients after liver transplantation (LTX). The PCR results were correlated with the pretransplant donor/recipient CMV antibody status and with the occurrence of CMV-induced disease. Thirty-three of 60 (55%) patients became PCR-positive during their posttransplant course. None of the 27 patients with permanent negative PCRs developed CMV disease. Of 33 patients with positive PCRs, 13 (39%) became ill. CMV disease developed in 9 of 22 (41%) antibody-negative recipients but only in 4 of 38 (10%) seropositive graft recipients. The incidence of CMV disease was 75% (9 of 12 patients) in seronegative recipients who converted to positive PCR results and 19% (4 of 21 patients) in seropositive patients with positive PCR findings. The predictive value of a positive PCR was 75% in seronegative patients but it was low (19%) in seropositive recipients. The predictive value of a negative PCR is 100%. Thus, PCR determinations are useful in identifying patients who will not develop CMV disease and in narrowing down the number of individuals who will become sick. Further, PCR is a helpful tool in the follow-up of patients under antiviral treatment.

  7. Nested polymerase chain reaction for early diagnosis of typhoid fever.

    PubMed

    Sultana, S; Hossain, M A; Alam, M A; Paul, S K; Mahmud, C; Kabir, M R; Haque, N; Yesmin, T; Kayes, M T; Maruf, A A; Kobayashi, N

    2012-01-01

    Typhoid fever, caused by Salmonella typhi, is an important cause of morbidity and mortality in many developing countries. A rapid and sensitive method for the detection of S. typhi is essential for early diagnosis. This was a study to prospectively evaluate the sensitivity and specificity of nested polymerase chain reaction (PCR) to identify the S. typhi using flagellin gene related primers. The study was carried out in the department of Microbiology, Mymensingh Medical College, Mymensingh between July, 2010 and June, 2011, including 82 individuals of different age and sex. Of them, 62 were clinically suspected cases of typhoid fever and remaining 20 were apparently healthy controls. Cultures as well as PCR of blood specimens were performed for each of the cases. Among the 62 suspected typhoid fever cases, 8(12.9%) were blood culture positive and 55(88.7%) were PCR positive for S. typhi. All culture positive cases were positive by PCR and among 54 culture negative cases, 47(87%) were positive by PCR. Neither of the healthy controls was positive by PCR or blood culture. The sensitivity, specificity, positive predictive value and negative predictive value of PCR using blood culture as gold standard were 88.7%, 100%, 100% and 74% respectively for typhoid fever. In this study, the PCR appears highly specific, very sensitive and superior to blood culture for the early diagnosis of typhoid fever.

  8. The Future of Digital Polymerase Chain Reaction in Virology.

    PubMed

    Vynck, Matthijs; Trypsteen, Wim; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2016-10-01

    Driven by its potential benefits over currently available methods, and the recent development of commercial platforms, digital polymerase chain reaction (dPCR) has received increasing attention in virology research and diagnostics as a tool for the quantification of nucleic acids. The current technologies are more precise and accurate, but may not be much more sensitive, compared with quantitative PCR (qPCR) applications. The most promising applications with the current technology are the analysis of mutated sequences, such as emerging drug-resistant mutations. Guided by the recent literature, this review focuses on three aspects that demonstrate the potential of dPCR for virology researchers and clinicians: the applications of dPCR within both virology research and clinical virology, the benefits of the technique over the currently used real-time qPCR, and the importance and availability of specific data analysis approaches for dPCR. Comments are provided on current drawbacks and often overlooked pitfalls that need further attention to allow widespread implementation of dPCR as an accurate and precise tool within the field of virology.

  9. Polymerase chain reaction based detection of fungi in infected corneas

    PubMed Central

    Gaudio, P A; Gopinathan, U; Sangwan, V; Hughes, T E

    2002-01-01

    Aims: To evaluate a polymerase chain reaction (PCR) based assay to detect fungi in scrapings from infected corneas. Methods: A PCR assay was developed to amplify a portion of the fungal 18S ribosome gene. Corneal scrapings from 30 patients with presumed infectious keratitis were evaluated using this assay, as well as by standard microbiological techniques, and the results were compared. Conjunctival swabs from each patient's healthy, fellow eye were also evaluated by PCR. Results: PCR and fungal culture results matched (were both positive or both negative for fungi) in 22 (74%) of 30 scrapings from infected corneas. Three (10%) of 30 samples were PCR positive but fungal culture negative; two of these appeared clinically to represent fungal infections, and the third was clinically indeterminate. Four (13%) scrapings were positive by PCR but also by bacterial and not fungal culture. One specimen (3%) was PCR negative but fungal culture positive. Of the conjunctival swabs from each patient's healthy fellow eye, five (17%) of 30 were positive by PCR, and the opposite, infected eye of all five of these harboured a fungal infection. Conclusions: PCR is promising as a means to diagnose fungal keratitis and offers some advantages over culture methods, including rapid analysis and the ability to analyse specimens far from where they are collected. PMID:12084744

  10. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    PubMed

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  11. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    PubMed

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  12. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  13. Quantitative polymerase chain reaction analysis by deconvolution of internal standard.

    PubMed

    Hirakawa, Yasuko; Medh, Rheem D; Metzenberg, Stan

    2010-04-29

    Quantitative Polymerase Chain Reaction (qPCR) is a collection of methods for estimating the number of copies of a specific DNA template in a sample, but one that is not universally accepted because it can lead to highly inaccurate (albeit precise) results. The fundamental problem is that qPCR methods use mathematical models that explicitly or implicitly apply an estimate of amplification efficiency, the error of which is compounded in the analysis to unacceptable levels. We present a new method of qPCR analysis that is efficiency-independent and yields accurate and precise results in controlled experiments. The method depends on a computer-assisted deconvolution that finds the point of concordant amplification behavior between the "unknown" template and an admixed amplicon standard. We apply the method to demonstrate dexamethasone-induced changes in gene expression in lymphoblastic leukemia cell lines. This method of qPCR analysis does not use any explicit or implicit measure of efficiency, and may therefore be immune to problems inherent in other qPCR approaches. It yields an estimate of absolute initial copy number of template, and controlled tests show it generates accurate results.

  14. [Species-specific detection of Proteus vulgaris and Proteus mirabilis by the polymerase chain reaction].

    PubMed

    Limanskiĭ, A; Minukhin, V; Limanskaia, O; Pavlenko, N; Mishina, M; Tsygenenko, A

    2005-01-01

    Sets of primers for the species-specific detection of P. mirabilis and P. vulgaris by the polymerase chain reaction (PCR) were developed. As targets for these primers beta-lactamase and 16S rRNA gene fragments were chosen on the basis of the multiple leveling of the sequences of the DNA of all known P. mirabilis and P. vulgaris isolates. For differential detection oligonucleotides were selected in such a way that primers, specific for P. vulgaris, contained the non-paired nucleotide for P. mirabilis isolate at the 3'-end, and all other nucleotides were complementary to the beta-lactamase gene fragment. Primers, specific for gene 16S rRNA of P. mirabilis, contained the non-paired nucleotide for P. vulgaris isolates at the 3'-end. Standard PCR was carried out for 6 P. mirabilis and P. vulgaris strains. The use of PCR species-specific primers to P. vulgaris DNA made it possible to amplify the DNA fragment of the expected length only for P. vulgaris isolates, while the result of PCR for P. mirabilis was negative. PCR with primers specific to P. mirabilis permitted the detection of amplicon sized 101 nucleotides pairs only for P. mirabilis strains. These primers were optimized so as to use them in the specific differentiation of closely related P. mirabilis and P. vulgaris species by multiplex PCR. Genus-specific primers permitted the detection of bacterial gyrB gene of the genus Proteus were developed also.

  15. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    PubMed

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  16. Leptospirosis diagnosis by immunocapture polymerase chain reaction: a new tool for early diagnosis and epidemiologic surveillance.

    PubMed

    Balassiano, Ilana Teruszkin; Vital-Brazil, Juliana Magalhães; Pereira, Martha Maria

    2012-09-01

    The aim of this study was to develop an immunocapture polymerase chain reaction (IC-PCR) protocol for leptospirosis. For the standardization of IC-PCR, polyclonal (AS) and monoclonal (MAb) antibodies against different serogroups and serovars of Leptospira were coupled to polystyrene plates. Human sera were artificially contaminated with leptospires and incubated on plates. The bacterial DNA was obtained and used in a multiplex PCR. Sensitivity was tested using sera contaminated with crescent concentrations of leptospires, while specificity was established using sera contaminated with different bacterial genera and sera obtained from patients positive for viral infections. IC-PCR using AS was able to recognize specific serogroups, although some cross-reactions have been observed. No cross-reactions were observed when MAbs were used; however, the sensitivity in this case was lower than that of IC-PCR using AS. IC-PCR proved to be specific to Leptospira and is a promising tool for early diagnosis of leptospirosis, providing additional information about the infecting serovar or serogroup.

  17. [Use of polymerase chain reaction for the diagnosis of central nervous system infections].

    PubMed

    Zambrano, Yelitza; Chiarello, Anna; Soca, Alain; Villalobos, Iris; Marrero, Miguel; Soler, Maritza; Laferte, José; Alvarez, Maritza

    2006-12-01

    In the present work, the polymerase chain reaction (PCR) assay and his variants RT-PCR and Multiplex PCR were applied for the detection of specific sequences of Enterovirus, Human Herpes viruses (Herpes simple virus, Human Herpes virus type 6, Cytomegalovirus, Epstein Barr virus, and Varicella Zoster), Human Immunodeficiency virus, Toxoplasma gondii, Mycobacterium tuberculosis and Mycoplasma pneumoniae in patients' cohorts grouped by medical suspicion of meningoencephalitis. Of 326 samples of processed cerebrospinal fluid (CSF), 93 samples (28.5%) were positive for the different infectious agents. In the group of patients with clinical diagnosis of viral meningoencephalitis (n=212), there was obtained a whole of 73 positive samples (34.4%), of which 37 patients were positive to Enterovirus (50.7%), 19 were positive to VHS (26%) and 10 patients (13.7%) were positive to CMV. Other viral agents as VZV, EBV and HVH6 were detected in minor frequency. The 114 remaining samples were analyzed applying specific PCR to each pathogen for strict medical indication, being able to detect the presence of Human Immunodeficiency Virus (40%), Mycoplasma pneumoniae (40%), Toxoplasma gondii (14%) and Mycobacterium tuberculosis (12%) in CSF samples. The results obtained in this study demonstrate the convenience of the application of the molecular assays in the laboratory diagnosis of the meningoencefalitis of different etiology. Besides this, it is also a very valuable tool for the clinical management of the patients and for the execution of the epidemiological studies.

  18. Trends and advances in food analysis by real-time polymerase chain reaction.

    PubMed

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  19. Diagnosis of Whooping Cough in Switzerland: Differentiating Bordetella pertussis from Bordetella holmesii by Polymerase Chain Reaction

    PubMed Central

    Pittet, Laure F.; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M.

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001−, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447

  20. Detection of Aspergillus fumigatus by polymerase chain reaction.

    PubMed Central

    Spreadbury, C; Holden, D; Aufauvre-Brown, A; Bainbridge, B; Cohen, J

    1993-01-01

    Aspergillus fumigatus is an opportunistic nosocomial pathogen causing an often fatal pneumonia, invasive aspergillosis (IA), in immunosuppressed patients. Oligonucleotide primers were used to amplify a 401-bp fragment spanning the 26S/intergenic spacer region of the rDNA complex of A. fumigatus by the polymerase chain reaction (PCR). The primers were highly sensitive and specific: as little as 1 pg of A. fumigatus genomic DNA could be detected, and the primers only amplified DNA from A. fumigatus and not any other fungal, bacterial, viral, or human DNA tested. Using the PCR, we were able to detect A. fumigatus DNA in lung homogenates from immunosuppressed mice experimentally infected with A. fumigatus but not from immunosuppressed uninfected controls. There was 93% correlation between the culture results and the PCR results. In a retrospective clinical study, the sensitivity of the PCR for the detection of A. fumigatus in clinical samples was confirmed by positive amplification in three of three culture-positive respiratory samples from confirmed cases of IA. Because isolation of Aspergillus spp. may reflect contamination and colonization without infection, the feasibility of using the PCR was evaluated by analyzing culture-negative samples from both immunosuppressed patients at high risk for IA and immunocompetent patients with other lung infections. Only 2 of 10 patients were culture negative and PCR positive in the high-risk group, and 2 of 7 patients were culture negative and PCR positive in the immunocompetent group. The results indicate that PCR detection might be a valuable adjunct to current laboratory methods to diagnose IA. Images PMID:8458955

  1. A circular ferrofluid driven microchip for rapid polymerase chain reaction.

    PubMed

    Sun, Y; Kwok, Y C; Nguyen, N T

    2007-08-01

    In the past few years, much attention has been paid to the development of miniaturized polymerase chain reaction (PCR) devices. After a continuous flow (CF) PCR chip was introduced, several CFPCR systems employing various pumping mechanisms were reported. However, the use of pumps increases cost and imposes a high requirement on microchip bonding integrity due to the application of high pressure. Other significant limitations of CFPCR devices include the large footprint of the microchip and the fixed cycle number which is dictated by the channel layout. In this paper, we present a novel circular close-loop ferrofluid driven microchip for rapid PCR. A small ferrofluid plug, containing sub-domain magnetic particles in a liquid carrier, is driven by an external magnet along the circular microchannel, which in turn propels the PCR mixture through three temperature zones. Amplification of a 500 bp lambda DNA fragment has been demonstrated on the polymethyl methacrylate (PMMA) PCR microchip fabricated by CO(2) laser ablation and bonded by a low pressure, high temperature technique. Successful PCR was achieved in less than 4 min. Effects of cycle number and cycle time on PCR products were investigated. Using a magnet as the actuator eliminates the need for expensive pumps and provides advantages of low cost, small power consumption, low requirement on bonding strength and flexible number of PCR cycles. Furthermore, the microchip has a much simpler design and smaller footprint compared to the rectangular serpentine CFPCR devices. To demonstrate its application in forensics, a 16-loci short tandem repeat (STR) sample was successfully amplified using the PCR microchip.

  2. A diagnostic polymerase chain reaction assay for Zika virus.

    PubMed

    Balm, Michelle N D; Lee, Chun Kiat; Lee, Hong Kai; Chiu, Lily; Koay, Evelyn S C; Tang, Julian W

    2012-09-01

    Zika virus (ZIKV) is a mosquito-borne flavivirus. Infection results in a dengue-like illness with fever, headache, malaise, and a maculopapular rash. Nearly all cases are mild and self-limiting but in 2007, a large outbreak of ZIKV was reported from the island of Yap (in Micronesia, northwest of Indonesia). Singapore is already endemic for dengue, and its impact on public health and economic burden is significant. Other dengue-like infections (e.g., Chikungunya virus) are present. Yet only 10% of reported dengue cases have laboratory confirmation. The identification and control of other dengue-like, mosquito-transmitted infections is thus important for the health of Singapore's population, as well as its economy. Given that ZIKV shares the same Aedes mosquito vector with both dengue and Chikungunya, it is possible that this virus is present in Singapore and causing some of the mild dengue-like illness. A specific and sensitive one-step, reverse transcription polymerase chain reaction (RT-PCR) with an internal control (IC) was designed and tested on 88 archived samples of dengue-negative, Chikungunya-negative sera from patients presenting to our hospital with a dengue-like illness, to determine the presence of ZIKV in Singapore. The assay was specific for detection of ZIKV and displayed a lower limit of detection (LoD) of 140 copies viral RNA/reaction when tested on synthetic RNA standards prepared using pooled negative patient plasma. Of the 88 samples tested, none were positive for ZIKV RNA, however, the vast majority of these were from patients admitted to hospital and further study may be warranted in community-based environments.

  3. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  4. Real-Time Fluorescent Polymerase Chain Reaction Detection of Phytophthora ramorum and Phytophthora pseudosyringae Using Mitochondrial Gene Regions.

    PubMed

    Tooley, Paul W; Martin, Frank N; Carras, Marie M; Frederick, Reid D

    2006-04-01

    ABSTRACT A real-time fluorescent polymerase chain reaction (PCR) detection method for the sudden oak death pathogen Phytophthora ramorum was developed based on mitochondrial DNA sequence with an ABI Prism 7700 (TaqMan) Sequence Detection System. Primers and probes were also developed for detecting P. pseudosyringae, a newly described species that causes symptoms similar to P. ramorum on certain hosts. The species-specific primer-probe systems were combined in a multiplex assay with a plant primer-probe system to allow plant DNA present in extracted samples to serve as a positive control in each reaction. The lower limit of detection of P. ramorum DNA was 1 fg of genomic DNA, lower than for many other described PCR procedures for detecting Phytophthora species. The assay was also used in a three-way multiplex format to simultaneously detect P. ramorum, P. pseudosyringae, and plant DNA in a single tube. P. ramorum was detected down to a 10(-5) dilution of extracted tissue of artificially infected rhododendron 'Cunningham's White', and the amount of pathogen DNA present in the infected tissue was estimated using a standard curve. The multiplex assay was also used to detect P. ramorum in infected California field samples from several hosts determined to contain the pathogen by other methods. The real-time PCR assay we describe is highly sensitive and specific, and has several advantages over conventional PCR assays used for P. ramorum detection to confirm positive P. ramorum finds in nurseries and elsewhere.

  5. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  6. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  7. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  8. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  10. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  11. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    PubMed

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  12. Aneuploidy screening of embryonic stem cell clones by metaphase karyotyping and droplet digital polymerase chain reaction.

    PubMed

    Codner, Gemma F; Lindner, Loic; Caulder, Adam; Wattenhofer-Donzé, Marie; Radage, Adam; Mertz, Annelyse; Eisenmann, Benjamin; Mianné, Joffrey; Evans, Edward P; Beechey, Colin V; Fray, Martin D; Birling, Marie-Christine; Hérault, Yann; Pavlovic, Guillaume; Teboul, Lydia

    2016-08-05

    Karyotypic integrity is essential for the successful germline transmission of alleles mutated in embryonic stem (ES) cells. Classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. As part of the International Mouse Phenotyping Consortium, we gathered data from over 1,500 ES cell clones and found that the germline transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triage of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germline transmission potential. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germline transmission and reducing the number of animals used in failed microinjection attempts. This method can be applied to any other experiments that require accurate analysis of the genome for

  13. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    PubMed

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications.

  14. Evaluation of polymerase chain reaction in nerve biopsy specimens of patients with Hansen's disease.

    PubMed

    Tiwari, Vandana; Malhotra, Kiranpreet; Khan, Kainat; Maurya, Pradeep K; Singh, Ajai Kumar; Thacker, Anup Kumar; Husain, Nuzhat; Kulshreshtha, Dinkar

    2017-09-15

    Pure neuritic variety of leprosy (PNL) presents as peripheral neuropathy with absent skin lesions and negative skin smears. Diagnosing PNL is an uphill task as most of these patients have nonspecific changes on nerve biopsy. In such circumstances, additional molecular diagnostic tools like polymerase chain reaction (PCR) has proven to be useful in diagnosing leprosy. The present study was planned to evaluate the role of PCR in nerve biopsy specimens of patients with PNL. Patients attending the neuromuscular clinic from January 2013 to June 2014 with mononeuropathy multiplex underwent detailed diagnostic evaluation to ascertain the cause of neuropathy. Patients where this evaluation failed to establish an etiology underwent a nerve biopsy. Nerve biopsy was done in 52 patients, of which 35 were diagnosed as pure neuritic leprosy. Definite leprosy with positive wade fite staining for lepra bacilli was seen in 13 patients and 22 biopsies revealed a probable leprosy without lepra bacilli being identified. PCR for M. leprae was positive in 22 patients (62%). 12 of the 13 cases with definite leprosy on histopathology were PCR positive while in the AFB negative group, PCR was positive in 10 cases. PCR had a sensitivity of 92.3%, specificity of 54.5%. The positive and negative predictive value of PCR was 54.5% and 92.3% respectively. PCR helps in diagnosing PNL in doubtful cases. A positive PCR increases the sensitivity of detection of M. leprae especially in cases of probable PNL group where AFB cannot be demonstrated on histopathology. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Differential diagnosis of Taenia saginata and Taenia solium infections: from DNA probes to polymerase chain reaction.

    PubMed

    González, Luis Miguel; Montero, Estrella; Sciutto, Edda; Harrison, Leslie J S; Parkhouse, R Michael E; Garate, Teresa

    2002-04-01

    The objective of this work was the rapid and easy differential diagnosis of Taenia saginata and T. solium. First, a T. saginata size-selected genomic deoxyribonucleic acid (gDNA) library was constructed in the vector lambda gt10 using the 2-4 kb fraction from the parasite DNA digested with EcoR1, under 'star' conditions. After differential screening of the library and hybridization analysis with DNA from T. saginata, T. solium, T. taeniaeformis, T. crassiceps, and Echinococcus granulosus (bovine, porcine, and human), 2 recombinant phages were selected. They were designated HDP1 and HDP2. HDP1 reacted specifically with T. saginata DNA, and HDP2 recognized DNA from both T. saginata and T. solium. The 2 DNA probes were then sequenced and further characterized. HDP1 was a repetitive sequence with a 53 bp monomeric unit repeated 24 times in direct tandem along the 1272 bp fragment, while the 3954 bp HDP2 was not a repetitive sequence. Using the sequencing data, oligonucleotides were designed and used in a polymerase chain reaction (PCR). The 2 selected oligonucleotides from probe HDP1 (PTs4F1 and PTs4R1) specifically amplified gDNA from T. saginata, but not T. solium or other related cestodes, with a sensitivity of < 10 pg of T. saginata gDNA, about the quantity of DNA in one taeniid egg. The 3 oligonucleotides selected from the HDP2 sequence (PTs7S35F1, PTs7S35F2, and PTs7S35R1) allowed the differential amplification of gDNA from T. saginata, T. solium and E. granulosus in a multiplex PCR, again with a sensitivity of < 10 pg. These diagnostic tools have immediate application in the differential diagnosis of T. solium and T. saginata in humans and in the diagnosis of dubious cysts in the slaughterhouse. We also hope to apply them to epidemiological surveys of, for example, soil and water in endemic areas.

  16. Triplex Real-time Polymerase Chain Reaction Optimization for AZF Y-chromosome Microdeletion Analysis.

    PubMed

    Torres, Tatiana Puga; Rojas, Xavier Blum; Narváez, Medardo Blum; Montanero, Edith López; Sarasti, Alexandra Narváez

    2015-05-01

    Y chromosome microdeletions at the "Azoospermia Factor" regions (AZFa, AZFb, AZFc) are the second genetic cause of spermatogenic failure in infertile men. Despite its importance for the treatment of infertile patients, no prior investigations have been previously published in Ecuador. . The purpose of this study is to optimize a molecular technique that allows detection of microdeletions in the AZF region. Using a genomic DNA of healthy male with natural conceived offsprings, a multiplex real time polymerase chain reaction (qPCR) was standarized with eigth sequence-tagged site (STS) sY85, G34990, sY133, sY127, sY254, sY255, and using as internal control sex-determine region Y (SRY) and Ameologenin Y (AMELY). With this technique, 35 DNA samples taken from peripheral blood of patients with severe oligozoospermia were analyzed. A triplex qPCR was standardized using EvaGreen DNA-binding dye to obtain melting temperature (Tm) of the STS previously mentioned. Three of the patients evaluated were detected to have partial microdeletion in the AZFa region, with a frequency of 8.8%; being losses in the G34990 section (one patient) and sY85 section (two patients). No cases of microdeletions in other AZF regions were found. The triplex qPCR optimizated allows the identification of microdeletions in AZFa, AZFb and AZFc region in infertile men and a better clinical management of the patient's treatment decision. This first report for Ecuador reveled a higher prevalence of microdeletions in the AZFa region in comparison with those previously described in other populations.

  17. Highly Sensitive and Reliable Detection of EGFR Exon 19 Deletions by Droplet Digital Polymerase Chain Reaction.

    PubMed

    Oskina, Natalya; Oscorbin, Igor; Khrapov, Evgeniy; Boyarskikh, Ulyana; Subbotin, Dmitriy; Demidova, Irina; Imyanitov, Evgeny; Filipenko, Maxim

    2017-06-06

    Analysis of EGFR mutations is becoming a routine clinical practice but the optimal EGFR mutation testing method is still to be determined. We determined the nucleotide sequence of deletions located in exon 19 of the EGFR gene in lung tumor samples of patients residing in different regions of Russia (153 tumor DNA specimens), using Sanger sequencing. We developed a droplet digital polymerase chain reaction assay capable of detecting all common EGFR deletions in exon 19. We also compared the therascreen amplification refractory mutation system assay with a droplet digital polymerase chain reaction assay for the detection of all the deletions in our study. The droplet digital polymerase chain reaction assay demonstrated 100% sensitivity against polymerase chain reaction fragment length analysis and detected all possible types of deletions revealed in our study (22 types). At the same time, the therascreen EGFR RGQ PCR Kit was not able to detect deletions c.2252-2276>A and c.2253-2276 and showed low performance for another long deletion. Thus, we can conclude that the extraordinary length of deletions and their atypical locations (shift at the 3'-region compared to known deletions) could be problematic for the therascreen EGFR RGQ PCR Kit and should be taken into account during targeted mutation test development. However, droplet digital polymerase chain reaction is a promising and reliable assay that can be used as a diagnostic tool to genotype formalin-fixed paraffin-embedded cancer samples for EGFR or another clinically relevant somatic mutation.

  18. Random Mutagenesis by Error-Prone Polymerase Chain Reaction Using a Heavy Water Solvent.

    PubMed

    Minamoto, Toshifumi

    2017-01-01

    Heavy water is a form of water that contains a heavier isotope of hydrogen ((2)H, also known as deuterium, D) or oxygen ((17)O or (18)O). When using heavy water as a solvent, error-prone polymerase chain reaction (epPCR) can induce random mutations independent of the polymerase used or the composition of the PCR reaction mixture. This relatively new method can easily be combined with the existing epPCR methods to increase the rate of mutations.

  19. Direct extraction of bacterial plasmids from food for polymerase chain reaction amplification.

    PubMed Central

    Andersen, M R; Omiecinski, C J

    1992-01-01

    In this report we describe a simple and rapid technique using DNA affinity columns that permits direct extraction of bacterial plasmids from a variety of foods for polymerase chain reaction amplification. The procedure was used to detect virulent enteroinvasive Escherichia coli in several artificially seeded matrices, including seafoods, greens, dairy products, enrichment media, and water. Polymerase inhibitors present in both foods and enrichment media were removed efficiently. Images PMID:1476448

  20. A transcribing RNA polymerase molecule survives DNA replication without aborting its growing RNA chain.

    PubMed

    Liu, B; Wong, M L; Alberts, B

    1994-10-25

    We have demonstrated elsewhere that a precisely placed, stalled Escherichia coli RNA polymerase ternary transcription complex (polymerase-RNA-DNA) stays on the DNA template after passage of a DNA replication fork. Moreover, the bypassed complex remains competent to resume elongation of its bound RNA chain. But the simplicity of our experimental system left several important questions unresolved: in particular, might the observation be relevant only to the particular ternary complex that we studied, and can the finding be generalized to a transcribing instead of a stalled RNA polymerase? To address these issues, we have created three additional ternary transcription complexes and examined their fates after passage of a replication fork. In addition, we have examined the fate of moving RNA polymerase molecules during DNA replication. The results suggest that our previous finding applies to all transcription intermediates of the E. coli RNA polymerase.

  1. Methyl mercury stimulates chain elongation by purified HeLa RNA polymerase II.

    PubMed

    Frenkel, G D; Ducote, J

    1988-11-01

    Methyl mercury (MeHg) inhibited the overall RNA synthetic reaction of HeLa RNA polymerase II. However, when RNA chain initiation was allowed to occur in its absence, MeHg stimulated the rate of the subsequent elongation stage of the reaction. Chain elongation with both double-stranded and single-stranded DNA templates was stimulated. This stimulatory effect was specific for MeHg; both p-hydroxymercuribenzoate and HgCl2 inhibited chain elongation (to about the same degree as they inhibited the overall reaction). The stimulatory effect was also specific for the HeLa polymerase; with Escherichia coli RNA polymerase, MeHg inhibited elongation (to the same degree as it inhibited the overall reaction).

  2. Prenatal detection of trisomy 21 and 18 from amniotic fluid by quantitative fluorescent polymerase chain reaction.

    PubMed Central

    Tóth, T; Findlay, I; Papp, C; Tóth-Pál, E; Marton, T; Nagy, B; Quirke, P; Papp, Z

    1998-01-01

    Prenatal diagnosis of fetal trisomies is usually performed by cytogenetic analysis on amniotic fluid. This requires lengthy laboratory procedures and high costs, and is unsuitable for large scale screening of pregnant women. An alternative method, which is both rapid and inexpensive and suitable for diagnosing trisomies even from single fetal cells, is the fluorescent polymerase chain reaction using polymorphic small tandem repeats (STRs). In this paper we present the preliminary results of a larger study comparing parallel prenatal diagnoses of trisomies 21 and 18 using cytogenetics with quantitative fluorescent polymerase chain reaction using STR markers. The results obtained by the two techniques were concordant in all cases. This is the first study reporting significant numbers of prenatal diagnoses using the quantitative fluorescent polymerase chain reaction. We believe that further studies on greater numbers of samples will determine the absolute reliability of this technique. These results also provide a model for diagnosis of trisomy from single fetal cells isolated from maternal blood. PMID:9507392

  3. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices.

  4. Direct detection of hepatitis B virus from dried blood spots by polymerase chain reaction amplification.

    PubMed Central

    Gupta, B P; Jayasuryan, N; Jameel, S

    1992-01-01

    The presence of hepatitis B virus DNA in the sera of individuals is the most definitive marker of an active viral infection. We have used polymerase chain reaction detection of hepatitis B virus DNA directly on whole blood dried as a spot on filter paper. The method is rapid, specific, and sensitive and has the ability to detect as little as 10 virus particles by ethidium bromide staining of the polymerase chain reaction-amplified products. The method is cost-effective, and the stability of the spots makes the collection and transportation of potentially infectious blood safe. Images PMID:1500493

  5. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    PubMed Central

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  6. Detection of Murine Typhus Infection in Fleas by Using the Polymerase Chain Reaction

    DTIC Science & Technology

    1990-03-01

    spotted fever ( Rickettsia group-specific primers and probes for the diagnosis of rick- rickettsii ), epidemic typhus ( Rickettsia prowazekii), murine...Polymerase chain reaction, Xenops.yl~j.Lopsis;" Rickettsia typhi,- Enz me-linked immunosorbent assay ’ A amplificatin6 fProu)t 19. ABSTRACT (Continue on...olymerase chain reaction (PCR) amplification of CDNA was used to detect the etiologic agent of murine typhus, Rickettsia typhi, in experimentally infected

  7. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    PubMed Central

    Lin, Hwai-Jeng; Lo, Wen-Ching; Perng, Chin-Lin; Tseng, Guan-Ying; Li, Anna Fen-Yau; Ou, Yueh-Hsing

    2005-01-01

    AIM: Helicobacter pylori (H pylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma. Conventional invasive tests are less sensitive than non-invasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers. METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test, histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of H pylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2), iceA1, iceA2 and cag A. RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%) and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity, positive predictive value and diagnostic accuracy of mucosal polymerase reaction for H pylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79% and 81

  8. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction.

    PubMed

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment.

  9. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR)

    PubMed Central

    Fukui, Kenji; Bessho, Yoshitaka; Shimada, Atsuhiro; Yokoyama, Shigeyuki; Kuramitsu, Seiki

    2013-01-01

    Polymerase chain reaction (PCR)-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3′ end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science. PMID:23519109

  10. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction

    PubMed Central

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment. PMID:28265464

  11. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  12. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  13. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  14. Rapid identification of Debaryomyces hansenii/Candida famata by polymerase chain reaction.

    PubMed

    Nishikawa, A; Sugita, T; Shinoda, T

    1999-04-01

    Primers designed in this study were used in a polymerase chain reaction test to amplify a species-specific fragment of approximately 340 bp of the large subunit ribosomal DNA of Debaryomyces hansenii/Candida famata. None of the other medically relevant yeasts including C. guilliermondii, and also the related species, D. nepalensis and C. saitoana, were amplified by this primer pair.

  15. Specific Detection of Campylobacter Jejuni and Campylobacter Coli by Using Polymerase Chain Reaction

    DTIC Science & Technology

    1992-10-01

    polymerase descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. chain reaction for the detection of Mycobacterium leprae . 1. Bacteriol. 41:451-455...with Campylobacter spp. Infect. Immun. 59:2259-2264. detection of Mycobacterium tuberculosis in clinical specimens 29. Rashtchian, A. 1985. Detection

  16. Polymerase Chain Reaction Assay and Bacterial Meningitis Surveillance in Remote Areas, Niger

    PubMed Central

    Sidikou, Fati; Djibo, Saacou; Taha, Muhamed Kheir; Alonso, Jean Michel; Djibo, Ali; Kairo, Kiari Kaka; Chanteau, Suzanne

    2003-01-01

    To compensate for the lack of laboratories in remote areas, the national reference laboratory for meningitis in Niger used polymerase chain reaction (PCR) to enhance the surveillance of meningitis caused by Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. PCR effectively documented the wide geographic spread of N. meningitidis serogroup W135. PMID:14718100

  17. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  18. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  19. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  20. Haemophilus ducreyi detection by polymerase chain reaction in oesophageal lesions of HIV patients.

    PubMed

    Borges, M C; Colares, J K B; Lima, D M; Fonseca, B A L

    2009-04-01

    HIV patients frequently have opportunistic oesophageal infections. We report Haemophilus ducreyi genetic material detected by polymerase chain reaction in biopsies of oesophageal lesions in three HIV-1-infected patients. This finding may be an indication of its aetiopathological role in oesophageal lesions of HIV patients.

  1. [Application of the polymerase chain reaction for detecting respiratory syncytial virus].

    PubMed

    Sarmiento, L; Chacón, D; Valdivia, A; Savón, C; Goyenechea, A

    1997-01-01

    The polymerase chain reaction (PCR) was developed in order to identify the respiratory syncytial virus by using the reference strain. The high sensitivity and specificity obtained show the PCR utility for detecting the RSV genoma and its application on the diagnosis.

  2. Characterization by polymerase chain reaction of ruminant rotaviruses isolated in Italy.

    PubMed

    Pratelli, A; Martella, V; Tempesta, M; Buonavoglia, C

    1999-04-01

    Several group A rotaviruses isolated in Italy from cattle, buffalos and goats were characterized by polymerase chain reaction assay for G- and P-type. G6 and P5 were the types most frequently recovered. The genotypes of buffalo and goat strains were similar to those of cattle isolates.

  3. Novel use of polymerase chain reaction to amplify cellular DNA adjacent to an integrated provirus.

    PubMed Central

    Silver, J; Keerikatte, V

    1989-01-01

    We describe a modification of the polymerase chain reaction technique which allows amplification of cellular DNA adjacent to an integrated provirus given sequence information for the provirus only. The modified technique should be generally useful for studies of insertional mutagenesis and other situations in which one wishes to isolate DNA adjacent to a region of known sequence. Images PMID:2704070

  4. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  5. Use of enrichment real time-Polymerase Chain Reaction to enumerate Salmonella on chicken parts

    USDA-ARS?s Scientific Manuscript database

    Salmonella that survive cooking and that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. Consequently, the present study was undertaken to use enrichment real time-polymerase chain reaction (RT-PCR) to enu...

  6. Diversity of Enterococcus faecalis Genotypes from Multiple Oral Sites Associated with Endodontic Failure Using Repetitive Sequence-based Polymerase Chain Reaction and Arbitrarily Primed Polymerase Chain Reaction.

    PubMed

    Delboni, Maraísa G; Gomes, Brenda P F A; Francisco, Priscila A; Teixeira, Fabrício B; Drake, David

    2017-03-01

    The aim of this study was to evaluate the diversity and similarity of Enterococcus faecalis genotype isolates from multiple oral sites using repetitive sequence-based polymerase chain reaction and arbitrarily primed polymerase chain reaction (AP-PCR). Forty-two endodontically treated teeth with apical periodontitis were selected. A total of 126 microbial samples were collected from 3 different sites (saliva, pulp chamber, and root canals, all n = 42) during the nonsurgical retreatment procedures. After growth on m-Enterococcus agar, the colonies were isolated, characterized as gram-positive catalase negative cocci, and identified using an API 20 Strep kit (bioMérieux, Marcy-l'Etoile, France). Seventy-four colonies from 10 patients were confirmed as E. faecalis by polymerase chain reaction (16S ribosomal RNA). Repetitive sequence-based polymerase chain reactions using ERIC and AP-PCR using RW3A primers were performed in all 74 colonies. Fingerprints were analyzed and separated into genotypic groups based on the Dice coefficient percentage of similarity (82% or greater) as determined by ERIC reproducibility assays involving E. faecalis controls. Seven different E. faecalis genotypes (GTs) (GT1 = 27%, GT2 = 17.6%, GT3 = 1.3%, GT4 = 18.9%, GT5 = 9.5%, GT6 = 14.9%, and GT7 = 10.8%) were observed in different subjects and oral sites associated with endodontic failure. Remarkably, in 4 of 5 patients, the same GTs present in the infected root canals were also isolated from either the pulp chamber or the saliva samples. In particular, GT6 was detected in all 3 oral sites of patient 37. E. faecalis GTs isolated from saliva, the pulp chamber, and the root canal were similar using the Rep-PCR and AP-PCR methods. These findings suggest that coronal microleakage is a conceivable cause of endodontic failure. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  7. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... value) was determined to be the PCR cycle number at which the fluorescence of the reaction exceeded 30...

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  10. Detection of deoxyribonucleic acid (DNA) targets using polymerase chain reaction (PCR) and paper surface-enhanced Raman spectroscopy (SERS) chromatography.

    PubMed

    Hoppmann, Eric P; Yu, Wei W; White, Ian M

    2014-01-01

    Surface-enhanced Raman spectroscopy (SERS) enables multiplex detection of analytes using simple, portable equipment consisting of a single excitation source and detector. Thus, in theory, SERS is ideally suited to replace fluorescence in assays that screen for numerous deoxyribonucleic acid (DNA) targets, but in practice, SERS-based assays have suffered from complexity and elaborate processing steps. Here, we report an assay in which a simple inkjet-fabricated plasmonic paper device enables SERS-based detection of multiple DNA targets within a single polymerase chain reaction (PCR). In prior work, we demonstrated the principles of chromatographic separation and SERS-based detection on inkjet-fabricated plasmonic paper. The present work extends that capability for post-PCR gene sequence detection. In this design, hydrolysis DNA probes with 5' Raman labels are utilized; if the target is present, the probe is hydrolyzed during PCR, freeing the reporter. After applying the PCR sample to a paper SERS device, an on-device chromatographic separation and concentration is conducted to discriminate between hydrolyzed and intact probes. SERS is then used to detect the reporter released by the hydrolyzed probes. This simple separation and detection on paper eliminates the need for complex sample processing steps. In this work, we simultaneously detect the methicillin-resistant Staphylococcus aureus genes mecA and femB to illustrate the concept. We envision that this approach could contribute to the development of multiplex DNA diagnostic tests enabling screening for several target sequences within a single reaction, which is necessary for cases in which sample volume and resources are limited.

  11. Comprehensive polymerase chain reaction assay for detection of pathogenic DNA in lymphoproliferative disorders of the ocular adnexa

    PubMed Central

    Usui, Yoshihiko; Rao, Narsing A.; Takase, Hiroshi; Tsubota, Kinya; Umazume, Kazuhiko; Diaz-Aguilar, Daniel; Kezuka, Takeshi; Mochizuki, Manabu; Goto, Hiroshi; Sugita, Sunao

    2016-01-01

    Infectious agents have been identified as a major cause of specific types of human cancers worldwide. Several microorganisms have been identified as potential aggravators of ocular adnexal neoplasms; however, given the rarity of these neoplasms, large epidemiological studies are difficult to coordinate. This study aimed to conduct an exhaustive search for pathogenic DNA in lymphoproliferative disorders (LPD) of the ocular adnexa in a total of 70 patients who were diagnosed with LPD of the ocular adnexa between 2008 and 2013. Specimens were screened for bacterial, viral, fungal, and parasitic DNA by multiplex polymerase chain reaction (PCR) and quantitative real-time PCR. Among cases of conjunctival mucosa-associated lymphoid tissue lymphoma, human herpes virus (HHV)-6, HHV-7, chlamydia, Epstein-Barr virus (EBV) and bacterial 16S ribosomal DNA were detected. In cases of IgG4-related ocular disease, similar pathogens were detected but in a larger number of patients. Our PCR assays detected DNAs of various infectious agents in tumor specimens, especially HHV6, HHV7, and EBV, with different positive rates in various types of LPD. Chronic inflammatory stimulation or activation of oncogenes from these infectious agents might be involved in the pathogenesis of LPD of the ocular adnexa. PMID:27830722

  12. Detection of multiple strains of Pasteurella multocida in fowl cholera outbreaks by polymerase chain reaction-based typing.

    PubMed

    Shivachandra, S B; Kumar, A A; Gautam, R; Saxena, M K; Chaudhuri, P; Srivastava, S K

    2005-12-01

    Applicability of molecular methods for the detection and differentiation of Pasteurella multocida strains involved in two separate fowl cholera outbreaks in a single poultry farm was investigated. A total of 12 and 18 strains of P. multocida obtained from two separate outbreaks were subjected to phenotypic and genotypic characterization. Phenotypically, all strains were similar; however, DNA-based techniques by employing polymerase chain reaction (PCR) assays were found to be highly specific and sensitive for rapid detection and differentiation of strains. All 30 strains gave amplicons of approximately 460 bp and approximately 1,044 bp specific for P. multocida and capsular serogroup A in the Multiplex Capsular PCR typing system. Molecular typing techniques such as repetitive extragenic palindromic PCR, enterobacterial repetitive intergenic consensus PCR and single primer PCR differentiated all 30 strains into different profiles. However, similar patterns of genome fragments were observed among all strains following restriction endonuclease analysis using the enzyme HpaII. The current investigation revealed involvement of the same and multiple strains of P. multocida in two outbreaks. The results also indicated that molecular methods of detection and typing are rapid in comparison with conventional methods for epidemiological investigations of fowl cholera outbreaks.

  13. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture

    PubMed Central

    Alcantara, Monica Visnieski; Fragoso, Stenio Perdigão; Picchi/, Gisele Fernanda Assine

    2014-01-01

    Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR) assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by PCR directly from liquid culture - without prior DNA extraction. This simple approach enabled us to generate PCR amplifications from different cultures varying from 106-108 cells/mL. We also show that it is possible to combine different primer pairs in a multiplex detection reaction and even to achieve knockout confirmation with an extremely simple interpretation of a real-time PCR result. Using the “culture PCR” approach, we show for the first time that we can assess different DNA sequence combinations by PCR directly from liquid culture, saving time in several tasks for T. cruzi genotype interrogation. PMID:24936912

  14. Polymerase chain reaction-capillary electrophoresis genetic analysis microdevice with in-line affinity capture sample injection.

    PubMed

    Thaitrong, Numrin; Toriello, Nicholas M; Del Bueno, Nadia; Mathies, Richard A

    2009-02-15

    An integrated polymerase chain reaction (PCR)-capillary electrophoresis (CE) microdevice with an efficient in-line affinity-based injector has been developed for genetic analysis. Double stranded DNA PCR amplicons generated in an integrated 250 nL PCR reactor are captured, purified, and preconcentrated by an oligonucleotide probe immobilized in an in situ polymerized gel matrix followed by thermal release and injection into the CE-separation channel. This in-column injector employs a photopolymerized oligonucleotide-modified acrylamide capture gel to eliminate band broadening and increase the injection efficiency to 100%. The on-chip generated PCR amplicons processed on this microdevice exhibit a 3-5 fold increase in signal intensities and improved resolution compared to our previous T-shaped injector. Multiplex analysis of 191-bp amplicons from Escherichia coli O157 and 256-bp amplicons from E. coli K12 is achieved with a 6-fold increase in resolution. These advances are exploited to successfully detect E. coli O157 in a 500-fold higher background of E. coli K12. This microdevice with in-line affinity capture gel injection provides an improved platform for low-volume, high sensitivity, fully integrated genetic analysis.

  15. A valveless microfluidic device for integrated solid phase extraction and polymerase chain reaction for short tandem repeat (STR) analysis.

    PubMed

    Hagan, Kristin A; Reedy, Carmen R; Bienvenue, Joan M; Dewald, Alison H; Landers, James P

    2011-05-07

    A valveless microdevice has been developed for the integration of solid phase extraction (SPE) and polymerase chain reaction (PCR) on a single chip for the short tandem repeat (STR) analysis of DNA from a biological sample. The device consists of two domains--a SPE domain filled with silica beads as a solid phase and a PCR domain with an ~500 nL reaction chamber. DNA from buccal swabs was purified and amplified using the integrated device and a full STR profile (16 loci) resulted. The 16 loci Identifiler® multiplex amplification was performed using a non-contact infrared (IR)-mediated PCR system built in-house, after syringe-driven SPE, providing an ~80-fold and 2.2-fold reduction in sample and reagent volumes consumed, respectively, as well as an ~5-fold reduction in the overall analysis time in comparison to conventional analysis. Results indicate that the SPE-PCR system can be used for many applications requiring genetic analysis, and the future addition of microchip electrophoresis (ME) to the system would allow for the complete processing of biological samples for forensic STR analysis on a single microdevice.

  16. Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics.

    PubMed

    Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio

    2017-05-01

    Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.

  17. Detection of Leishmania siamensis DNA in Saliva by Polymerase Chain Reaction

    PubMed Central

    Phumee, Atchara; Kraivichian, Kanyarat; Chusri, Sarunyou; Noppakun, Nopadon; Vibhagool, Asda; Sanprasert, Vivornpun; Tampanya, Vich; Wilde, Henry; Siriyasatien, Padet

    2013-01-01

    Polymerase chain reaction was used to detect Leishmania siamensis DNA from clinical samples collected from six leishmaniasis patients during 2011–2012. The samples used in this study came from bone marrow, blood, buffy coat, saliva, urine, and tissue biopsy specimens. Saliva was a good source for L. siamensis DNA by polymerase chain reaction. L. siamensis DNA was also found in saliva of an asymptomatic case-patient. Levels of L. siamensis DNA in saliva decreased until being undetectable after treatment. These levels could be used as a marker to evaluate efficacy of the treatment. A larger study is needed to evaluate this method as a screening and survey tool to study the silent background of Leishmania infection among the at-risk population. PMID:24062485

  18. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  19. Detection of enteric viruses in oysters by using the polymerase chain reaction.

    PubMed Central

    Atmar, R L; Metcalf, T G; Neill, F H; Estes, M K

    1993-01-01

    A procedure for the detection of enteric viral nucleic acid in oysters by the polymerase chain reaction was developed. Known quantities of poliovirus type 1 were seeded into oysters. Virus was extracted and concentrated by using organic flocculation and polyethylene glycol precipitation. Inhibitors of reverse transcription-polymerase chain reaction were present in the oyster extracts, preventing amplification of target viral nucleic acid. The use of cetyltrimethylammonium bromide precipitation sufficiently removed inhibitors to allow detection of as few as 10 PFU of poliovirus. Norwalk virus also could be detected after being seeded into oysters. This methodology may be useful for the detection of these and other shellfish-borne viral pathogens. Images PMID:8382024

  20. A single side chain prevents Escherichia coli DNA polymerase I (Klenow fragment) from incorporating ribonucleotides

    PubMed Central

    Astatke, Mekbib; Ng, Kimmie; Grindley, Nigel D. F.; Joyce, Catherine M.

    1998-01-01

    Although nucleic acid polymerases from different families show striking similarities in structure, they maintain stringent specificity for the sugar structure of the incoming nucleoside triphosphate. The Klenow fragment of E. coli DNA polymerase I selects its natural substrates, deoxynucleotides, over ribonucleotides by several thousand fold. Analysis of mutant Klenow fragment derivatives indicates that discrimination is provided by the Glu-710 side chain which sterically blocks the 2′-OH of an incoming rNTP. A nearby aromatic side chain, at position 762, plays an important role in constraining the nucleotide so that the Glu-710 “steric gate” can be fully effective. Even with the E710A mutation, which is extremely permissive for addition of a single ribonucleotide to a DNA primer, Klenow fragment does not efficiently synthesize pure RNA, indicating that additional barriers prevent the incorporation of successive ribonucleotides. PMID:9520378

  1. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    SciTech Connect

    Sharma, Vinay Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-06

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  2. Rapid detection of bovine viral diarrhea virus by polymerase chain reaction.

    PubMed Central

    Lopez, O J; Osorio, F A; Donis, R O

    1991-01-01

    The polymerase chain reaction was used to detect genomic sequences of the positive-stranded RNA of bovine viral diarrhea virus (BVDV), a member of the family Togaviridae. Using a set of 20-bp primers located within the conserved 3' region of the BVDV genome, we were able to consistently amplify a 205-bp target sequence from BVDV cDNA. BVDV RNAs from cell culture-propagated BVDV reference strains, diverse unrelated cytopathic and noncytopathic field isolates, and clinical serum samples were transcribed to cDNA by using avian myeloblastosis virus reverse transcriptase and further specifically amplified by using the polymerase chain reaction assay. The amplification assay was sensitive enough to detect one molecule of cloned BVDV cDNA. Reconstitution experiments conducted by adding decreasing amounts of BVDV (NADL strain) to BVDV-free serum indicated that the threshold of sensitivity of the assay was less than or equal to 1 50% tissue culture infective dose. These results show that the polymerase chain reaction may be used for the rapid detection of diverse strains of BVDV in cell cultures, biological products, and clinical specimens from cattle. Images PMID:1709950

  3. Polymerase Chain Reaction as a Diagnostic Tool for Six Sexually Transmitted Infections - Preliminary Results.

    PubMed

    Grad, Alecsandra Iulia; Vica, Mihaela Laura; Matei, Horea Vladi; Grad, Doru Lucian; Coman, Ioan; Tataru, Dumitru Alexandru

    2015-01-01

    Sexually transmitted infections are a very frequent and under-diagnosed cause of illness worldwide. A high number of detection methods and a large range of specimens in which sexually transmitted infections can be determined are available at the moment. Polymerase chain reaction performed on first void urine offers the advantage of being non-invasive, self-collectable and has high sensitivity and specificity. We looked to determine the frequency of Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Mycoplasma hominis, Mycoplasma genitalium and Ureaplasma urealyticum in symptomatic and asymptomatic patients. Six sexually transmitted infections were determined in the first void urine of 15 symptomatic and asymptomatic patients by polymerase chain reaction. We used "Epicenter MasterPure™ Complete DNA and RNA Purification Kit" for the DNA purification and "Seeplex® STD6 ACE Detection" for the DNA amplification. The results were examined in UV light. A number of 5 patients had positive results for Chlamydia trachomatis or Neisseria gonorrhoeae. Sexually transmitted infections are more frequent in men between 27 and 40 years old. Polymerase chain reaction is a good diagnostic tool for sexually transmitted infections because it has a high sensitivity and specificity. Chlamydia trachomatis is the most frequent sexually transmitted infection, followed by Neisseria gonorrhoeae.

  4. A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain.

    PubMed

    Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Ali, Md Eaqub

    2015-01-01

    Food forgery has posed considerable risk to public health, religious rituals, personal budget and wildlife. Pig, dog, cat, rat and monkey meat are restricted in most religions, but their sporadic adulteration are rampant. Market controllers need a low-cost but reliable technique to track and trace suspected species in the food chain. Considering the need, here we documented a lab-on-a-chip-based multiplex polymerase chain reaction (PCR) assay for the authentication of five non-halal meat species in foods. Using species-specific primers, 172, 163, 141, 129 and 108-bp sites of mitochondrial ND5, ATPase 6 and cytochrome b genes were amplified to detect cat, dog, pig, monkey and rat species under complex matrices. Species-specificity was authenticated against 20 different species with the potential to be used in food. The targets were stable under extreme sterilisation (121°C at 45 psi for 2.5 h) which severely degrades DNA. The assay was optimised under the backgrounds of various commercial meat products and validated for the analysis of meatballs, burgers and frankfurters, which are popular fast food items across the globe. The assay was tested to detect 0.1% suspected meats under commercial backgrounds of marketed foods. Instead of simplex PCR which detects only one species at a time, such a multiplex platform can reduce cost by at least fivefolds by detecting five different species in a single assay platform.

  5. Principles of rapid polymerase chain reactions: mathematical modeling and experimental verification.

    PubMed

    Whitney, Scott E; Sudhir, Alugupally; Nelson, R Michael; Viljoen, Hendrik J

    2004-07-01

    Polymerase chain reaction (PCR) is an important diagnostic tool for the amplification of DNA. The PCR process can be treated as a problem in biochemical engineering. This study focuses on the development of a mathematical model of the polymerase chain reaction. The PCR process consists of three steps: denaturation of target DNA, annealing of sequence-specific oligonucleotide primers and the enzyme-catalyzed elongation of the annealed complex (primer:DNA:polymerase). The denaturation step separates the double strands of DNA; this model assumes denaturation is complete. The annealing step describes the formation of a primer-fragment complex followed by the attachment of the polymerase to form a ternary complex. This step is complicated by competitive annealing between primers and incomplete fragments including primer-primer reactions. The elongation step is modeled by a stochastic method. Species that compete during the elongation step are deoxynucleotide triphosphates dCTP, dATP, dTTP, dGTP, dUTP, and pyrophosphate. Thermal deamination of dCTP to form dUTP is included in the model. The probability for a species to arrive at the active site is based on its molar fraction. The number of random insertion events depends on the average processing speed of the polymerase and the elongation time of the simulation. The numerical stochastic experiment is repeated a sufficient number of times to construct a probability density distribution (PDF). The moment of the PDF and the annealing step products provide the product distribution at the end of the elongation step. The overall yield is compared to six experimental values of the yield. In all cases the comparisons are very good.

  6. Reprogrammable multiplexed detection of circulating oncomiRs using hybridization chain reaction.

    PubMed

    Rana, Muhit; Balcioglu, Mustafa; Kovach, Maya; Hizir, Mustafa Salih; Robertson, Neil M; Khan, Irfan; Yigit, Mehmet V

    2016-02-28

    In this study, we have coupled the DNA polymerization capability of hybridization chain reaction (HCR) with the plasmonic properties of gold nanoparticles to develop a reprogrammable and multiplexed detection of three circulating oncomiRs (miR-10b, miR-21 and miR-141) dysregulated in various disease states of breast cancer. We have demonstrated that by simply changing the initiator (label-free short single stranded DNA) content of the HCR, while keeping everything else unchanged, the same nanoparticle assembly can be reprogrammed for the detection of the target oncomiRs individually or simultaneously in all possible combinations. We have shown that as little as 20 femtomoles of each oncomiR can be detected visually without using any analytical instrument. Furthermore, we demonstrated that the target oncomiR can be detected in an RNA pool isolated from a liquid biopsy mimic of breast cancer.

  7. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  8. Comparative study of microscopy and polymerase chain reaction for the diagnosis of suspected visceral leishmaniasis patients in Nepal.

    PubMed

    Pandey, K; Mallik, A K; Pyakurel, S; Pun, S B; Pandey, B D

    2013-01-01

    Visceral leishmaniasis is potentially fatal protozoan diseases caused by Leishmania donovani. Nepal is an endemic region in which visceral leishmaniasis causes a major public health problem in the lowland areas that border the endemic areas of Bihar state in India. Accurate diagnosis to inform treatment is a first step in achieving the goal of visceral leishmaniasis elimination from South East Asian regions by 2020. The objective of the present study was to compare between the Microcopy and polymerase chain reaction for diagnosis of visceral leishmaniasis. In the present study, 236 bone marrow aspirations were collected from suspected visceral leishmaniasis patients in Janakpur Zonal Hospital, Dhanusa district, Terai region of Nepal in between 2003-2007. We evaluated bone marrow samples by microscopic examination with subsequent testing of the same sample by polymerase chain reaction and sequence analysis. Giemsa's solution stained bone marrow slides stored for over five years were used for polymerase chain reaction amplification. The result showed that 71% were polymerase chain reaction positive and 56% were microscopic positive. Out of 104 microscopic negative bone marrow samples, 15% of samples were positive by polymerase chain reaction. Polymerase chain reaction could make a very good option for diagnosis by using less or non-invasive material from visceral leishmaniasis patients in endemic areas of Nepal.

  9. Detection of biological warfare agents using the polymerase chain reaction. Final report, June-August 1991

    SciTech Connect

    Mann, B.J.

    1992-09-01

    The detection of biological warfare agents is an important mission for the U.S. Army. This report explores the feasibility of using the polymerase chain reaction as a means of rapid detection of biological warfare agents. Two levels of detection are proposed. The first level is group specific detection, using primers derived from 16S rDNA sequences, to detect various groups of pathogenic bacteria. The second level is species-specific detection using primers derived from DNA sequences, unique to each pathogenic organism targeted for detection. Specific examples of Vibrio cholerae, Francisella tularensis, Yersinia pestis, Staphylococcus aureus, and Bacillus anthracis are described.

  10. Low predictive value of polymerase chain reaction for diagnosis of cytomegalovirus disease in liver transplant recipients.

    PubMed Central

    Delgado, R; Lumbreras, C; Alba, C; Pedraza, M A; Otero, J R; Gómez, R; Moreno, E; Noriega, A R; Payá, C V

    1992-01-01

    The polymerase chain reaction (PCR) and viral culture techniques were prospectively compared for the detection of cytomegalovirus (CMV) in blood samples from 24 liver transplant recipients. Nine patients had one or more episodes of viremia, seven of which were clinically symptomatic infections. All samples in which CMV was isolated by culture were positive by the PCR. However, the PCR result was also positive for one or more samples from 11 patients who never developed CMV-related symptoms. Although the PCR is a very sensitive technique for CMV detection in blood samples from liver transplant recipients, it is not useful as a marker of symptomatic CMV disease. PMID:1321171

  11. Low predictive value of polymerase chain reaction for diagnosis of cytomegalovirus disease in liver transplant recipients.

    PubMed

    Delgado, R; Lumbreras, C; Alba, C; Pedraza, M A; Otero, J R; Gómez, R; Moreno, E; Noriega, A R; Payá, C V

    1992-07-01

    The polymerase chain reaction (PCR) and viral culture techniques were prospectively compared for the detection of cytomegalovirus (CMV) in blood samples from 24 liver transplant recipients. Nine patients had one or more episodes of viremia, seven of which were clinically symptomatic infections. All samples in which CMV was isolated by culture were positive by the PCR. However, the PCR result was also positive for one or more samples from 11 patients who never developed CMV-related symptoms. Although the PCR is a very sensitive technique for CMV detection in blood samples from liver transplant recipients, it is not useful as a marker of symptomatic CMV disease.

  12. DNA fingerprinting of thermophilic lactic acid bacteria using repetitive sequence-based polymerase chain reaction.

    PubMed

    De Urraza, P J; Gómez-Zavaglia, A; Lozano, M E; Romanowski, V; De Antoni, G L

    2000-08-01

    DNA fingerprints of lactic acid bacteria were generated by polymerase chain reaction using a primer based on the repetitive elements found in the genome of Streptococcus pneumoniae (BOX-PCR). The method made it possible to identify 37 isolates from raw milk. industrial starters and yogurt. Differentiation at species, subspecies and strain level was possible for Lactobacillus delbrueckii subsp. lactis, Lb. delbrueckii subsp bulgaricus and Str. thermophilus. BOX-PCR was also applied to studying the strain composition of a starter culture and the direct detection of strains in commercial fermented milk.

  13. Polymerase chain reaction based detection of Mycobacterium tuberculosis complex in lupus vulgaris: a case report.

    PubMed

    Baylan, O; Arca, E; Ozcan, A; Kisa, O; Albay, A; Doganci, L

    2004-09-01

    Lupus vulgaris (LV), the commonest of all forms of cutaneous tuberculosis, can affect the earlobes. Authors present a 20-year-old male patient with LV of the left earlobe initially misdiagnosed as pyoderma and treated superfluously with antibiotics at different intervals over the last 4 years in another hospital. Mycobacteria could not be seen or isolated by stained smears or conventional or radiometric culture methods from the skin biopsy specimens. Suspected clinical diagnosis of our patient was LV. This was supported by positive polymerase chain reaction assay and histological findings. The lesion was treated successfully with anti-tuberculosis chemotherapy, further confirming the diagnosis of LV.

  14. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    PubMed

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland.

  15. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.

    PubMed Central

    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W; Atlas, R M

    1992-01-01

    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can discriminate between the relevant species of the G. duodenalis type pathogenic to humans and other Giardia species that are not human pathogens. This method can detect a single Giardia cyst and is therefore sensitive enough for environmental monitoring. Images PMID:1734070

  16. Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

    PubMed

    Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

    2007-02-01

    In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

  17. DNA from oral bacteria by sodium hydroxide-paper method suitable for polymerase chain reaction.

    PubMed

    Lefimil, Claudia; Lozano, Carla; Morales-Bozo, Irene; Plaza, Anita; Maturana, Cristian; Urzúa, Blanca

    2013-02-15

    In the oral cavity, we can find a complex mixture of microorganisms, commensals, and pathogens. The studies of normal oral microbiota, as well as the studies of much oral pathology (e.g., caries, periodontitis), involve the isolation and cultivation of these microorganisms and their molecular analysis. The aim of this study was to validate a quick, easy, efficient, and inexpensive DNA extraction method for the recovery of genomic DNA from gram-positive and gram-negative oral bacteria to be used in polymerase chain reaction amplification. This method worked great with all samples analyzed, providing an approach to extract DNA for different microorganisms.

  18. Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

    PubMed

    Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

    2013-01-01

    Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

  19. The rapid molecular genetic diagnosis of cystic fibrosis by polymerase chain reaction: an experience report.

    PubMed

    Macek, M; Boehm, I; Arnold, L; Smrt, J; Macek, M; Duspivová, R; Vávrová, V; Sedlácek, Z; Sperling, K; Schmidtke, J

    1990-01-01

    The authors report their experience with about two thousand DNA amplifications by polymerase chain reaction (PCR) in prenatal diagnosis of cystic fibrosis. The method is demonstrated on examples of diagnostic informativity and prenatal diagnosis examination in a family at 1 in 4 risk of the disease using closely CF-linked diagnostic polymorphisms: J3.11/MspI, MetH/MspI, CS7/HhaI, KM19/PstI, Mp6-d9/MspI and XV2c/TaqI, PCR methodology and safety precautions are discussed.

  20. Enzymological considerations for a theoretical description of the quantitative competitive polymerase chain reaction (QC-PCR).

    PubMed

    Schnell, S; Mendoza, C

    1997-02-21

    The enzymological principles of the polymerase chain reaction (PCR) and of the quantitative competitive PCR (QC-PCR) are developed, proposing a theoretical framework that will facilitate quantification in experimental methodologies. It is demonstrated that the specificity of the QC-PCR, i.e. the ratio of the target initial velocity to that of the competitor template, remains constant not only during a particular amplification but also for increasing initial competitor concentrations. Linear fitting procedures are thus recommended that will enable a quantitative estimate of the initial target concentration. Finally, expressions for the efficiency of the PCR and QC-PCR are derived that are in agreement with previous experimental inferences.

  1. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction.

    PubMed

    Fan, J; Zhang, W H; Wu, Y Y; Jing, X Y; Claas, E C

    The aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The results of the PCR were compared with the Mikro Trak immunofluorescence assay (IFA). From 49 specimens of patients with conjunctivitis, 31 were found positive by PCR (63%) and 23 by IFA (47%). On the other hand, in 10 normal eye specimens and 10 non-Chlamydia trachoma conjunctivitis specimens no Chlamydia trachomatis was detected.

  2. JC polyomavirus nephropathy confirmed by using an in-house polymerase chain reaction method.

    PubMed

    Querido, S; Jorge, C; Sousa, H; Birne, R; Matias, P; Weigert, A; Adragão, T; Bruges, M; Ramos, S; Santos, M; Paixão, P; Curran, M D; Machado, D

    2015-10-01

    We report the case of an isolated JC virus (JCV) infection, without co-infection by polyoma BK virus (BKV), associated with nephropathy 4 years after kidney transplantation. Clinical suspicion followed the observation of a decrease in estimated glomerular filtration rate (eGFR) and a renal allograft biopsy revealing polyomavirus-associated tubulointerstitial nephritis and positivity for SV40. An in-house real-time polymerase chain reaction assay, targeting the presence of JCV and the absence of BKV in biopsy tissue, confirmed diagnosis. Thirteen months after diagnosis, and following therapeutic measures, eGFR remains stable. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Improved polymerase chain reaction technique for determining the species composition of Eimeria in poultry litter.

    PubMed

    Jenkins, M C; Miska, K; Klopp, S

    2006-12-01

    An improved polymerase chain reaction (PCR)-based method for determining the species composition of Eimeria in poultry litter was developed by incorporating species-specific internal standards in the assay. Internal standard molecules were prepared by fusing seven different Eimeria species-specific intervening transcribed sequence 1 (ITS1) rDNA primer pairs to a non-Eimeria DNA molecule and by cloning the hybrid DNA molecules into a plasmid. The internal DNA standards were then used in Eimeria-specific ITS 1 PCR, and they were found to be capable of detecting E. acervulina, E. maxima, E. praecox, and E. tenella oocysts isolated directly from poultry litter.

  4. Application of polymerase chain reaction (PCR) for diagnosis of equine herpes virus-1 (EHV-1).

    PubMed

    Gupta, A K; Singh, B K; Yadav, M P

    1996-11-01

    Fifty aborted foetus samples were diagnosed for the presence of equine herpes virus-1 (EHV-1) by polymerase chain reaction (PCR) technique. Specific primer pair for amplification of a particular segment of EHV-1 DNA in gc region having 3 Hae III restriction endonuclease sites was used. A 409 base pair segment obtained as PCR amplification product in 9 samples was digested with Hae III to confirm the presence of EHV-1 as the infectious agent in aborted tissues. It was observed that PCR technique was more sensitive, specific and rapid than the conventional virological diagnostic methods.

  5. Rapid detection of influenza virus H1 by the polymerase chain reaction.

    PubMed

    Bressoud, A; Whitcomb, J; Pourzand, C; Haller, O; Cerutti, P

    1990-03-16

    We applied a combination of reverse transcription (RT) with the polymerase chain reaction (PCR) for a rapid detection of influenza virus H1 subtype. We amplified a 441 bp segment of relatively high genetic stability of the hemagglutinin gene. Experimental conditions were established using plasmid DNA and infected cell cultures. The test was applied to 28 nasopharyngeal lavages from patients, two of which were positive for influenza virus H1. When the amplified DNA of a positive sample was sequenced we found 97% homology with the recent strain A/USSR/70.

  6. Rapid detection of waterborne viruses using the polymerase chain reaction and a gene probe.

    PubMed

    Jothikumar, N; Khanna, P; Kamatchiammal, S; Murugan, R P

    1992-01-01

    We describe a membrane-filter-based urea-arginine phosphate buffer method for concentrating waterborne viruses from large volumes of water to microlitre volumes, and their subsequent detection by the polymerase chain reaction (PCR). The detection step involves the extraction of RNA, synthesis of complementary DNA, amplification by PCR of target DNA with specific primers, and confirmation through nucleic acid hybridization with a radiolabelled oligonucleotide probe. The PCR technique detected the presence of enteroviruses in spiked as well as in contaminated water samples. The technique is sensitive and detects as few as 120 waterborne viral particles. PCR is simple, rapid, sensitive, specific and adaptable for water quality surveillance in less developed countries.

  7. Touchdown digital polymerase chain reaction for quantification of highly conserved sequences in the HIV-1 genome.

    PubMed

    De Spiegelaere, Ward; Malatinkova, Eva; Kiselinova, Maja; Bonczkowski, Pawel; Verhofstede, Chris; Vogelaers, Dirk; Vandekerckhove, Linos

    2013-08-15

    Digital polymerase chain reaction (PCR) is an emerging absolute quantification method based on the limiting dilution principle and end-point PCR. This methodology provides high flexibility in assay design without influencing quantitative accuracy. This article describes an assay to quantify HIV DNA that targets a highly conserved region of the HIV-1 genome that hampers optimal probe design. To maintain high specificity and allow probe binding and hydrolysis of a probe with low melting temperature, a two-stage touchdown PCR was designed with a first round of amplification at high temperature and a subsequent round at low temperature to allow accumulation of fluorescence.

  8. [Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

    PubMed

    Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

    2009-01-01

    A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

  9. Rapid diagnosis of invasive pulmonary aspergillosis by quantitative polymerase chain reaction using bronchial lavage fluid.

    PubMed

    Kawazu, Masahito; Kanda, Yoshinobu; Goyama, Susumu; Takeshita, Masataka; Nannya, Yasuhito; Niino, Miyuki; Komeno, Yukiko; Nakamoto, Tetsuya; Kurokawa, Mineo; Tsujino, Shiho; Ogawa, Seishi; Aoki, Katsunori; Chiba, Shigeru; Motokura, Toru; Ohishi, Nobuya; Hirai, Hisamaru

    2003-01-01

    Polymerase chain reaction (PCR) is a sensitive method for detection of Aspergillus DNA in bronchoalveolar lavage fluid, but it has not yet been able to distinguish infection from contamination. We have established a technique to quantify Aspergillus DNA using a real-time PCR method to resolve this problem, and we report herein a successful application of real-time PCR to diagnose invasive pulmonary aspergillosis by comparing the amount of Aspergillus DNA in bronchial lavage fluid from an affected area to that from an unaffected area. This novel tool will provide rapid, sensitive, and specific diagnosis of pulmonary aspergillosis.

  10. Simultaneous Detection of Three Bacterial Seed-Borne Diseases in Rice Using Multiplex Polymerase Chain Reaction.

    PubMed

    Kang, In Jeong; Kang, Mi-Hyung; Noh, Tae-Hwan; Shim, Hyeong Kwon; Shin, Dong Bum; Heu, Suggi

    2016-12-01

    Burkholderia glumae (bacterial grain rot), Xanthomonas oryzae pv. oryzae (bacterial leaf blight), and Acidovorax avenae subsp. avenae (bacterial brown stripe) are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae, and transposase A gene sequence for X. oryzae pv. oryzae, three sets of primers had been designed to produce 402 bp for B. glumae, 490 bp for X. oryzae, and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants.

  11. Simultaneous Detection of Three Bacterial Seed-Borne Diseases in Rice Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Kang, In Jeong; Kang, Mi-Hyung; Noh, Tae-Hwan; Shim, Hyeong Kwon; Shin, Dong Bum; Heu, Suggi

    2016-01-01

    Burkholderia glumae (bacterial grain rot), Xanthomonas oryzae pv. oryzae (bacterial leaf blight), and Acidovorax avenae subsp. avenae (bacterial brown stripe) are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae, and transposase A gene sequence for X. oryzae pv. oryzae, three sets of primers had been designed to produce 402 bp for B. glumae, 490 bp for X. oryzae, and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants. PMID:27904465

  12. A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

    EPA Science Inventory

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

  13. A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

    EPA Science Inventory

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

  14. Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial

    PubMed Central

    2011-01-01

    Background Viral respiratory infections are common worldwide and range from completely benign disease to life-threatening illness. Symptoms can be unspecific, and an etiologic diagnosis is rarely established because of a lack of suitable diagnostic tools. Improper use of antibiotics is common in this setting, which is detrimental in light of the development of bacterial resistance. It has been suggested that the use of diagnostic tests could reduce antibiotic prescription rates. The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR) assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs) would have an impact on antibiotic prescription rate in primary care clinical settings. Methods Adult patients with symptoms of ARTI were prospectively included. Nasopharyngeal and throat swabs were analysed by using a multiplex real-time PCR method targeting thirteen viruses and two bacteria. Patients were recruited at 12 outpatient units from October 2006 through April 2009, and samples were collected on the day of inclusion (initial visit) and after 10 days (follow-up visit). Patients were randomised in an open-label treatment protocol to receive a rapid or delayed result (on the following day or after eight to twelve days). The primary outcome measure was the antibiotic prescription rate at the initial visit, and the secondary outcome was the total antibiotic prescription rate during the study period. Results A total sample of 447 patients was randomised. Forty-one were excluded, leaving 406 patients for analysis. In the group of patients randomised for a rapid result, 4.5% (9 of 202) of patients received antibiotics at the initial visit, compared to 12.3% (25 of 204) (P = 0.005) of patients in the delayed result group. At follow-up, there was no significant difference between the groups: 13.9% (28 of 202) in the rapid result group and 17.2% (35 of 204) in the delayed result group (P = 0

  15. Two-step polymerase chain reactions and restriction endonuclease analyses detect and differentiate ompA DNA of Chlamydia spp.

    PubMed Central

    Kaltenboeck, B; Kousoulas, K G; Storz, J

    1992-01-01

    Specific and sensitive amplification of major outer membrane protein (MOMP) gene (ompA) DNA sequences of Chlamydia species with various MOMP genotypes was achieved by a two-step polymerase chain reaction (PCR). Degenerate, inosine-containing oligonucleotide primers homologous to the 5' and 3' ends of the translated regions of all chlamydial MOMP genes were used in a PCR to amplify a DNA fragment of approximately 1,120 bp. A portion of this DNA fragment was amplified in a second genus-specific reaction that yielded a DNA fragment of approximately 930 bp. A pair of degenerate oligonucleotide primers homologous to internal sequences of the primary DNA fragment was used in this PCR. This method detected three cognate chlamydial genomes in a background of 1 microgram of unrelated DNA. MOMP genes of 13 representative chlamydial MOMP genotypes of the species C. trachomatis, C. pneumoniae, and C. psittaci were amplified. In a secondary PCR, group-specific detection was achieved by the simultaneous use of one genus-specific primer and three primers derived from different fingerprint regions of three major groups of chlamydiae. This multiplex PCR differentiated the groups by the length of the amplified DNA fragments and detected the simultaneous presence of DNA sequences of the Chlamydia spp. with different MOMP genotypes. Further differentiation as ompA restriction fragment length polymorphism types among all chlamydial strains with the various MOMP genotypes analyzed here was achieved by restriction endonuclease analysis of the secondary PCR products. DNA sequences corresponding to the ompA restriction fragment length polymorphism type B577 of C. psittaci were detected in two of seven milk samples from cases of bovine mastitis. Images PMID:1349899

  16. The Use of Polymerase Chain Reaction Amplification for the Detection of Viruses and Bacteria in Severe Community-Acquired Pneumonia.

    PubMed

    Siow, Wen Ting; Koay, Evelyn Siew-Chuan; Lee, Chun Kiat; Lee, Hong Kai; Ong, Venetia; Ngerng, Wang Jee; Lim, Hui Fang; Tan, Adeline; Tang, Julian Wei-Tze; Phua, Jason

    2016-01-01

    Pathogens are often not identified in severe community-acquired pneumonia (CAP), and the few studies using polymerase chain reaction (PCR) techniques for virus detection are from temperate countries. This study assesses if PCR amplification improves virus and bacteria detection, and if viral infection contributes to mortality in severe CAP in a tropical setting, where respiratory pathogens have less well-defined seasonality. In this cohort study of patients with severe CAP in an intensive care unit, endotracheal aspirates for intubated patients and nasopharyngeal swabs for non-intubated patients were sent for PCR amplification for respiratory viruses. Blood, endotracheal aspirates for intubated patients, and sputum for non-intubated patients were analysed using a multiplex PCR system for bacteria. Out of 100 patients, using predominantly cultures, bacteria were identified in 42 patients; PCR amplification increased this number to 55 patients. PCR amplification identified viruses in 32 patients. In total, only bacteria, only viruses, and both bacteria and viruses were found in 37, 14, and 18 patients, respectively. The commonest viruses were influenza A H1N1/2009 and rhinovirus; the commonest bacterium was Streptococcus pneumoniae. Hospital mortality rates for patients with no pathogens, bacterial infection, viral infection, and bacterial-viral co-infection were 16.1, 24.3, 0, and 5.6%, respectively (p = 0.10). On multivariable analysis, virus detection was associated with lower mortality (adjusted odds ratio 0.12, 95% confidence interval 0.2-0.99; p = 0.049). Viruses and bacteria were detected in 7 of 10 patients with severe CAP with the aid of PCR amplification. Viral infection appears to be independently associated with lower mortality. © 2016 S. Karger AG, Basel.

  17. Development, optimization, and validation of a Classical swine fever virus real-time reverse transcription polymerase chain reaction assay.

    PubMed

    Eberling, August J; Bieker-Stefanelli, Jill; Reising, Monica M; Siev, David; Martin, Barbara M; McIntosh, Michael T; Beckham, Tammy R

    2011-09-01

    Classical swine fever (CSF) is an economically devastating disease of pigs. Instrumental to the control of CSF is a well-characterized assay that can deliver a rapid, accurate diagnosis prior to the onset of clinical signs. A real-time fluorogenic-probe hydrolysis (TaqMan) reverse transcription polymerase chain reaction (RT-PCR) for CSF was developed by the United States Department of Agriculture (USDA) at the Plum Island Animal Disease Center (CSF PIADC assay) and evaluated for analytical and diagnostic sensitivity and specificity. A well-characterized panel including Classical swine fever virus (CSFV), Bovine viral diarrhea virus (BVDV), and Border disease virus (BDV) isolates was utilized in initial feasibility and optimization studies. The assay was initially designed and validated for use on the ABI 7900HT using the Qiagen QuantiTect® Probe RT-PCR chemistry. However, demonstrating equivalency with multiple one-step RT-PCR chemistries and PCR platforms increased the versatility of the assay. Limit of detection experiments indicated that the Qiagen QuantiTect® Multiplex (NoROX) and the Invitrogen SuperScript® III RT-PCR kits were consistently the most sensitive one-step chemistries for use with the CSF PIADC primer/probe set. Analytical sensitivity of the CSF PIADC assay ranged from <1-2.95 log(10) TCID(50)/ml on both the ABI 7900HT and ABI 7500 platforms. The CSF PIADC assay had 100% diagnostic sensitivity and specificity when tested on a panel of 152 clinical samples from the Dominican Republic and Colombia. The ability to perform this newly developed assay in 96-well formats provides an increased level of versatility for use in CSF surveillance programs.

  18. Polymerase chain reaction (PCR) identification of Penicillium brevicompactum, a grape contaminant and mycophenolic acid producer.

    PubMed

    Patiño, B; Medina, A; Doménech, M; González-Jaén, M T; Jiménez, M; Vázquez, C

    2007-02-01

    Penicillium brevicompactum is a ubiquitous fungal species that contaminates diverse substrates and commodities and produces an array of metabolites toxic to human and animals. The present work has obtained evidence, by liquid chromatography (LC)-ion-trap mass spectrometry, of the ability of P. brevicompactum strains isolated from grapes to produce mycophenolic acid, a potent immunosuppressor. In order to facilitate early diagnosis of this species on commodities for human and animal consumption, a rapid, sensitive and specific polymerase chain reaction (PCR) assay for P. brevicompactum was developed. The specific primers were designed based on the ITS1-5.8S-ITS2ITS (Internal Transcribed Spacers of rRNA genes) multicopy region. This method provides a useful aid to detect the presence of this fungal species in grapes and other commodities in order to prevent the toxins produced entering the food chain.

  19. Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

    PubMed

    Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

    2015-08-25

    Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  1. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. © The American Society of Tropical Medicine and Hygiene.

  2. Detection of equine herpesvirus 3 in equine skin lesions by polymerase chain reaction.

    PubMed

    Kleiboeker, Steven B; Chapman, Rodney K

    2004-01-01

    During a recent breeding season, ulcerative, pustular skin lesions were observed on the external genitalia of 2 mares and 1 stallion within a small herd. Based on the location and description of the skin lesions plus the clinical history, equine coital exanthema, caused by equine herpesvirus 3 (EHV3), was the primary differential diagnosis. Scrapings of skin lesions from the perineum of 2 mares were submitted for diagnostic evaluation. Virus isolation was attempted by inoculation of several cell lines of equine origin, but no cytopathic agent was detected. The skin scrapings were processed for DNA extraction, and polymerase chain reaction (PCR) amplification was performed for herpesvirus DNA polymerase and DNA-packaging protein (terminase) genes using nested, degenerate primers targeted to conserved regions of the herpesvirus genome. Products of the expected sizes were generated for both assays, and subsequent nucleotide sequencing of the amplification products established that EHV3 had been detected in DNA extracted from the skin lesions. Detection of EHV3 was confirmed using an EHV3-specific PCR assay targeted to the gC gene. Using the novel EHV3 nucleotide sequence identified in this report, a sensitive and specific PCR assay targeted to the highly conserved DNA polymerase gene was developed.

  3. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    PubMed Central

    Alexandrakis, G.; Jalali, S.; Gloor, P.

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In one rabbit the contralateral eye served as a control. From four to 28 days after inoculation, the corneas were scraped for culture, then scraped and swabbed for PCR analysis. The PCR was performed with primers directed against a portion of the Fusarium cutinase gene, and the presence or absence of this amplified target sequence was determined by agarose gel.
RESULTS—The amplified DNA sequence was detected in 25 of 28 samples from the corneas infected with Fusarium, for a sensitivity of 89%. Only three of the 14 samples from these eyes with Fusarium keratitis were positive by culture, for a sensitivity of 21%. Seven of eight control samples were negative by the PCR based test, for a specificity of 88%.
CONCLUSION—This PCR based test holds promise of being an effective method of diagnosing Fusarium keratitis as well as Fusarium infections at other sites.

 Keywords: keratitis; Fusarium; ulcer; cornea; polymerase chain reaction PMID:9602631

  4. Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

    PubMed

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

  5. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.

    PubMed Central

    Burg, J L; Grover, C M; Pouletty, P; Boothroyd, J C

    1989-01-01

    We applied the polymerase chain reaction to detection of the pathogenic protozoan Toxoplasma gondii based on our identification of a 35-fold-repetitive gene (the B1 gene) as a target. Using this procedure, we were able to amplify and detect the DNA of a single organism directly from a crude cell lysate. This level of sensitivity also allowed us to detect the B1 gene from purified DNA samples containing as few as 10 parasites in the presence of 100,000 human leukocytes. This is representative of the maximal cellular infiltration (10(5)/ml) in 1 ml of cerebrospinal fluid obtained from patients with toxoplasmic encephalitis. The B1 gene is present and conserved in all six T. gondii strains tested to date, including two isolates from patients with acquired immunodeficiency syndrome. No signal was detected by using this assay and DNAs from a variety of other organisms, including several which might be found in the central nervous system of an immunocompromised host. This combination of sensitivity and specificity should make detection of the B1 gene based on polymerase chain reaction amplification a very useful method for diagnosis of toxoplasmosis both in immunocompromised hosts and in congenitally infected fetuses. Images PMID:2768467

  6. Panfungal Polymerase Chain Reaction for Identification of Fungal Pathogens in Formalin-Fixed Animal Tissues.

    PubMed

    Meason-Smith, Courtney; Edwards, Erin E; Older, Caitlin E; Branco, Mackenzie; Bryan, Laura K; Lawhon, Sara D; Suchodolski, Jan S; Gomez, Gabriel; Mansell, Joanne; Hoffmann, Aline Rodrigues

    2017-07-01

    Identification of fungal organisms often poses a problem for pathologists because the histomorphology of some fungal organisms is not specific, fresh tissues may not be available, and isolation and identification in culture may take a long time. The purpose of this study was to validate the use of panfungal polymerase chain reaction (PCR) to identify fungal organisms from formalin-fixed paraffin-embedded (FFPE) tissues. Formalin-fixed paraffin-embedded curls were tested from 128 blocks containing canine, feline, equine, and bovine tissues with cutaneous, nasal, pulmonary, and systemic fungal infections, identified by the presence of fungi in histologic sections. Quantitative scoring of histologic sections identified rare (11.9%), occasional (17.5%), moderate (17.5%), or abundant (53.1%) fungal organisms. DNA was isolated from FFPE tissues and PCR was performed targeting the internal transcribed spacer 2 (ITS-2) region, a segment of noncoding DNA found in all eukaryotes. Polymerase chain reaction products were sequenced and identified at ≥97% identity match using the Basic Local Alignment Search Tool and the NCBI database of ITS sequences. Of the 128 blocks, 117 (91.4%) yielded PCR products and high-quality sequences were derived from 89 (69.5%). Sequence and histologic identifications matched in 79 blocks (61.7%). This assay was capable of providing genus- and species-level identification when histopathology could not and, thus, is a beneficial complementary tool for diagnosis of fungal diseases.

  7. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers.

    PubMed

    D'Souza, Doris H; Critzer, Faith J; Golden, David A

    2009-11-01

    Recent outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to help control the spread of disease. Reverse-transcriptase polymerase chain reaction (RT-PCR) can detect the presence of mRNA (shorter half-life than DNA) with greater potential for detecting viable pathogens. The chromosomally located invA gene required for host invasion by Salmonella is widely used for detection of this pathogen by PCR. Detection of Salmonella was undertaken by real-time RT-PCR (rt-RT-PCR) using newly designed invA gene primers to develop a sensitive and specific assay. Salmonella serovars Typhimurium and Enteritidis were grown (7.68 log(10) CFU/mL) in Luria-Bertani broth overnight at 37 degrees C, and RNA was extracted, followed by rt-RT-PCR with and without SYBR green I and agarose gel electrophoresis. All experiments were replicated at least thrice. Detection for both serovars using traditional RT-PCR was lower ( approximately 10(5) CFU/mL) than rt-RT-PCR (10(3) CFU/mL) by gel electrophoresis. Melt curve analysis showed melt temperatures at 87.5 degrees C with Ct values from 12 to 15 for up to 10(3) CFU/mL and improved to 10(2) CFU/mL after further optimization. Further, addition of RNA internal amplification control constructed using in vitro transcription with a T7 RNA polymerase promoter, to the RT-PCR assay also gave detection limits of 10(2) CFU/mL. Cross-reactivity was not observed against a panel of 21 non-Salmonella bacteria. Heat-inactivated (autoclaved) Salmonella showed faint or no detection by rt-RT-PCR or gel electrophoresis. This method has potential to be applied for the detection of Salmonella serovars in fresh produce and the simultaneous detection of foodborne viral (RNA viruses) and bacterial pathogens in a multiplex format.

  8. Rapid differentiation and identification of potential severe strains of Citrus tristeza virus by real-time reverse transcription-polymerase chain reaction assays.

    PubMed

    Yokomi, R K; Saponari, M; Sieburth, P J

    2010-04-01

    A multiplex Taqman-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to identify potential severe strains of Citrus tristeza virus (CTV) and separate genotypes that react with the monoclonal antibody MCA13. Three strain-specific probes were developed using intergene sequences between the major and minor coat protein genes (CPi) in a multiplex reaction. Probe CPi-VT3 was designed for VT and T3 genotypes; probe CPi-T36 for T36 genotypes; and probe CPi-T36-NS to identify isolates in an outgroup clade of T36-like genotypes mild in California. Total nucleic acids extracted by chromatography on silica particles, sodium dodecyl sulfate-potassium acetate, and CTV virion immunocapture all yielded high quality templates for real-time PCR detection of CTV. These assays successfully differentiated CTV isolates from California, Florida, and a large panel of CTV isolates from an international collection maintained in Beltsville, MD. The utility of the assay was validated using field isolates collected in California and Florida.

  9. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  10. Bacterial pathogens related to chronic suppurative otitis media in individuals with cleft palate: bacteriological culture and polymerase chain reaction.

    PubMed

    Weckwerth, Paulo Henrique; de Mattias Franco, Adriana Terezinha; de Magalhães Lopes, Carlos Alberto; Santos, Fernando Dos; Weckwerth, Ana Carolina Villas Bôas; Vivan, Rodrigo Ricci; Duarte, Marco Antonio Húngaro

    2014-03-01

    To characterize the microbial etiology of chronic suppurative otitis media comparing the methods of classical bacteriological culture and polymerase chain reaction. Bacteriological analysis by classical culture and by molecular polymerase chain reaction of 35 effusion otitis samples from patients with cleft lip and palate attending the Hospital for Rehabilitation of Craniofacial Anomalies of the University of São Paulo, Bauru, Brazil. Collection of clinical samples of otitis by effusion through the external auditory tube. Otolaryngologic diagnosis of chronic suppurative otitis media. Positive cultures were obtained from 83% of patients. Among the 31 bacterial lineages the following were isolated. In order of decreasing frequency: Pseudomonas aeruginosa (54.9%), Staphylococcus aureus (25.9%), and Enterococcus faecalis (19.2%). No anaerobes were isolated by culture. The polymerase chain reaction was positive for one or more bacteria investigated in 97.1% of samples. Anaerobe lineages were detected by the polymerase chain reaction method, such as Fusobacterium nucleatum , Bacteroides fragilis , and Peptostreptococcus anaerobius . Patients with cleft lip and palate with chronic suppurative otitis media presented high frequency of bacterial infection in the middle ear. The classical bacteriological culture did not detect strict anaerobes, whose presence was identified by the polymerase chain reaction method.

  11. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    PubMed

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  12. Performance characteristics of nested polymerase chain reaction vs real-time polymerase chain reaction methods for detecting Mycobacterium tuberculosis complex in paraffin-embedded human tissues.

    PubMed

    Seo, An Na; Park, Hyo Jin; Lee, Hye Seung; Park, Jung Ok; Chang, Ho Eun; Nam, Kyung Han; Choe, Gheeyoung; Park, Kyoung Un

    2014-09-01

    Nucleic acid amplification tests on formalin-fixed, paraffin-embedded (FFPE) tissue specimens enable Mycobacterium tuberculosis complex (MTB) detection and rapid tuberculosis diagnosis in the absence of microbiologic culture tests. We aimed to evaluate the efficacy of different polymerase chain reaction (PCR) methods for detecting Mycobacterium species in FFPE tissues. We examined 110 FFPE specimens (56 nonmycobacterial cases, 32 MTB, and 22 nontuberculous mycobacteria [NTM] determined by acid-fast bacilli [AFB] culture) to assess five PCR methods: nested PCR (N-PCR) (Seeplex MTB Nested ACE Detection; Seegene, Seoul, South Korea), an in-house real-time PCR (RT-PCR) method, and three commercial RT-PCR methods (AccuPower MTB RT-PCR [Bioneer, Seoul, Korea], artus M tuberculosis TM PCR [Qiagen, Hilden, Germany], and AdvanSure tuberculosis/NTM RT-PCR [LG Life Sciences, Seoul, Korea]). The results of N-PCR, in-house RT-PCR, and AdvanSure RT-PCR correlated well with AFB culture results (concordance rates, 94.3%, 87.5%, and 89.5%, respectively). The sensitivity of N-PCR (87.5%) was higher than that of the RT-PCR methods, although these differences were not statistically significant between N-PCR and the in-house and AdvanSure RT-PCR methods (68.8% and 80.0%, respectively). All the PCR methods had high specificities, ranging from 98.2% to 100%. Only two NTM cases were detected by AdvanSure RT-PCR, implying a very low sensitivity. Well-designed RT-PCR and N-PCR can effectively identify MTB in FFPE specimens. Copyright© by the American Society for Clinical Pathology.

  13. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

    PubMed

    Siqueira, José F; Rôças, Isabela N

    2003-08-01

    Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and

  14. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.

    PubMed

    Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S

    2010-03-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  15. Rapid detection of pathogenic leptospires by lyophilized reagent-based polymerase chain reaction.

    PubMed

    Lee, S V; Tai, E S; Mutalib, A R; Khairani-Bejo, S; Bahaman, A R

    2011-12-01

    A simple and reliable tool for the early diagnosis of leptospirosis is urgently needed. We report the development of a lyophilized reagent-based polymerase chain reaction (PCR) assay targeting lipL32 gene, which is present only in pathogenic leptospires. To determine the effectiveness of the newly developed assay in the early diagnosis of leptospirosis, the sensitivity and specificity was evaluated. In simulated clinical samples, the assay was able to detect 10² and 10³ leptospires/ml in spiked urine and blood samples, respectively. In experimentally infected animals, leptospiral DNA could be detected in blood and lung samples as early as Day 1 post infection. This assay was also shown to be stable and remained sensitive for up to five months at ambient temperature. Hence, this lyophilized reagent-based PCR assay with high specificity, sensitivity and stability would provide a simple, rapid and reliable method in diagnosing acute leptospirosis, especially in the field of veterinary medicine.

  16. Assembling long heteroduplexes by asymmetric polymerase chain reaction and annealing the resulting single-stranded DNAs.

    PubMed

    Wang, Mugui; Wei, Chuchu; Ye, Xiufen; Liu, Jianping; Zhang, Cuicui; Chen, Hao; Zhang, Xiaobo; Tu, Jumin

    2015-04-15

    We developed an effective protocol for generating high-purity heteroduplexes via annealing single-stranded DNAs (ssDNAs) derived from plasmid DNA by asymmetric polymerase chain reaction (A-PCR). With the addition of dimethyl sulfoxide, a one-step A-PCR procedure can generate ssDNAs stably at a range of reaction temperatures. Several annealing buffers can anneal two ssDNAs into heteroduplexes effectively. We further developed a simple strategy to create d(GATC) hemimethylated heteroduplexes by annealing fully methylated homoduplexes in the presence of excessive unmethylated ssDNAs. The constructed heteroduplexes have been well tested as substrates for mismatch repair in Escherichia coli and, thus, can be used in various biotechnology applications.

  17. Rapid detection for rabbit-derived dermatophytes using microsatellite-primed polymerase chain reaction.

    PubMed

    Miao, Zengmin; Li, Song; Li, Daijun; Cai, Chunmei; Cai, Yumei

    2014-01-01

    A method exhibiting high sensitivity, specificity and rapidity to detect pathogenic dermatophytes was developed using microsatellite-primed polymerase chain reaction (PCR) in combination with a clustering method. The DNA fragments of Trichophyton mentagrophyton, Microsporum gypseum and Microsporum canis were amplified by using the primer (GACA)4 to detect the DNA polymorphism fingerprints. Twenty-one clinical strains identified as T. mentagrophyton, M. gypseum or M. canis by morphological methods were distinguished according to the differences of standard stains' bands combined with NTSYS-pc2.10 software. The results showed that there were obvious and direct differences in the bands of the three pathogenic dermatophytes, and the similarity of isolated strains and standard strains were above 90%, in line with the results of morphological identification. The method is more accurate, rapid and simple, which is meaningful for the clinical diagnosis and epidemic research of the dermatophytes.

  18. Speciation of human microsporidia by polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Fedorko, D P; Nelson, N A; Didier, E S; Bertucci, D; Delgado, R M; Hruszkewycz, A M

    2001-10-01

    We describe the application of single-strand conformation polymorphism (SSCP) analysis to the speciation of human microsporidia after polymerase chain reaction (PCR) amplification with the panmicrosporidian primers PMP1 and PMP2. We compared the DNA extracted and amplified from different genotypes or isolates of Enterocytozoon bieneusi, Encephalitozoon cuniculi, E. hellem, and E. intestinalis plus an isolate of Vittaforma corneae. The PCR-SSCP, when performed at 20 degrees C, generated 2 bands in distinctive, reproducible patterns in polyacrylamide gels for each species of microsporidia tested, regardless of genotype or isolate. We found PCR-SSCP to be an easy and reproducible method for speciation of human microsporidia when the primer pair PMP1 and PMP2 is used.

  19. [The application of the polymerase chain reaction technic for the detection of human papillomavirus sequences].

    PubMed

    Soto, Y; Muné, M; Goicolea, A; Morales, E; Santoyo, J M; Valdés, O; Ramírez, R; Pimentel, T

    1998-01-01

    The polymerase chain reaction technique was applied to detect sequences of human Papillomavirus (HPV) by controls of cellular lines of cervical cancer and of tissues obtained through biopsy with a HPV-positive clinical diagnosis. A set of consensus oligonucleotides, which are complementary to a highly conserved region within the open reading frame E1 of the viral genome of HPV affecting the cervical mucosa, was used. With these primers it was possible to amplify DNA sequences corresponding to HPV 6 and 11, considered in the low risk group, and to HPV 16, 18, 31 and 33, included in the high risk group. The study of the sensitivity of the amplification technique showed a level of detection of 3,5 viral particles per each cellular diploid genome.

  20. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  1. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    SciTech Connect

    Bell, D.A. )

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  2. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  3. Presence of Legionellaceae in warm water supplies and typing of strains by polymerase chain reaction.

    PubMed Central

    Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.

    2001-01-01

    Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675

  4. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.

    PubMed Central

    Tzianabos, T; Anderson, B E; McDade, J E

    1989-01-01

    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinical specimens tested; all six control specimens gave negative results. These findings indicate that R. rickettsii can be detected early after the onset of RMSF, possibly facilitating the decision regarding appropriate antibiotic therapy for some patients. Further refinement of PCR technology could make this procedure a mainstay in the clinical laboratory. Images PMID:2512328

  5. The quantitative real-time polymerase chain reaction for the analysis of plant gene expression.

    PubMed

    Fitzgerald, Timothy L; McQualter, Richard B

    2014-01-01

    The quantitative real-time polymerase chain reaction is used to simultaneously amplify and quantify a targeted DNA molecule. It can be used to determine exact copy number of a molecule within a sample and/or to compare the quantity of a molecule between samples. When combined with reverse transcription, it is a powerful tool for the analysis of gene expression, and it is widely used for this purpose in plant species. Here we provide an introduction to fundamental concepts relevant for the analysis of gene expression in plants using this technique and a protocol for quantification of the relative expression of a sucrose phosphate synthase gene along the maturation gradient of a sugarcane leaf.

  6. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  7. Amebic Liver Abscess Diagnosed by Polymerase Chain Reaction in 14 Returning Travelers

    PubMed Central

    Vallois, Dorothée; Epelboin, Loïc; Touafek, Feriel; Magne, Denis; Thellier, Marc; Bricaire, François; Caumes, Eric

    2012-01-01

    Amebic liver abscesses (ALA) are not commonly described in travelers. The ALA diagnosis is usually based on serology and Entamoeba histolytica polymerase chain reaction (PCR) is a new tool. We retrospectively reviewed all ALA cases diagnosed by PCR on the liver abscess pus aspirate of patients admitted in French hospitals between 2007 and 2011. Fourteen cases (10 male, median age 48 years) were included. The median lag time between return and onset of symptoms was 23 days (interquartile range [IQ] 18–24). All patients had an elevated cardiopulmonary resuscitation level, and 11 had leukocytosis. The ALA was multiple in five patients, localized in the right lobe in 12, and higher than 5 cm in 11. Serology was initially negative in one patient, whereas PCR was positive. There was bacterial co-infection in one patient. The outcome was good. Liver puncture allows a rapid diagnosis of ALA with PCR and helps identify the association with a bacterial dual infection. PMID:23033402

  8. Polymerase Chain Reaction Diagnosis of Leishmaniasis: A Species-Specific Approach.

    PubMed

    González-Marcano, Eglys; Kato, Hirotomo; Concepción, Juan Luis; Márquez, María Elizabeth; Mondolfi, Alberto Paniz

    2016-01-01

    Leishmaniasis is an infectious disease caused by protozoan parasites of the genus Leishmania which are transmitted to humans through bites of infected sand flies. The variable clinical manifestations and the evolution of the disease are determined by the infecting species. Recognition at a species level is of utmost importance since this greatly impacts therapy decision making as well as predicts outcome for the disease. This chapter describes the application of polymerase chain reaction (PCR) in the detection of Leishmania parasites across the disease spectrum, including protocols for sample collection and transportation, genomic material extraction, and target amplification methods with special emphasis on PCR amplification of the cytochrome b gene for Leishmania spp. species identification.

  9. Subtyping of Legionella pneumophila isolates by arbitrarily primed polymerase chain reaction.

    PubMed

    Ledesma, E; Camaró, M L; Carbonell, E; Sacristán, T; Martí, A; Pellicer, S; Llorca, J; Herrero, P; Dasí, M A

    1995-09-01

    Arbitrarily primed polymerase chain reaction (AP-PCR) was used to differentiate strains of Legionella pneumophila isolated from different water sources in a resort hotel in Benidorm, Alicante, Spain, where an outbreak of Legionnaires' disease occurred among a group of tourists between 65 and 80 years of age. All isolates were L. pneumophila serogroup 1, subtype Pontiac (Knoxville 1). Five different patterns (P1 to P5) were obtained by AP-PCR. The number of bands per pattern varied between 4 and 11. Patterns P1 and P2 represented 60 and 20% of L. pneumophila isolates, respectively. Since different subpopulations of L. pneumophila coexisted (up to three different AP-PCR patterns were identified in a single room), it was not possible to link an individual L. pneumophila strain to the occurrence of this outbreak.

  10. Identification of genetically modified potato (Solanum tuberosum) cultivars using event specific polymerase chain reaction.

    PubMed

    Côté, Marie-José; Meldrum, Allison J; Raymond, Philippe; Dollard, Cheryl

    2005-08-24

    Several genetically modified (GM) cultivars are registered in Canada although they are not currently in commercial production. The GM cultivars can be distinguished from the non-GM and other GM cultivars by analyzing the DNA nucleotide sequence at the insertion site of the transgene corresponding to a single transformation event in the plant genome. Techniques based on modified polymerase chain reaction (PCR) strategies were used to generate sequence information from the plant genome flanking the insertion site of transgenic DNA for specific GM potato events. The plant genome sequence adjacent to the transgenic insertion was used to design PCR primers, which could be used in combination with a primer annealing to one of the nearby inserted genetic elements to amplify an event specific DNA fragment. The event specific PCR fragments generated were sequenced to confirm the specificity of the method.

  11. Detection of human papillomavirus types 45 and 51 by type-specific polymerase chain reaction.

    PubMed

    Weyn, Christine; Boulenouar, Selma; Mathys, Vanessa; Vanhoolandt, Julie; Bernis, Aurore; Fontaine, Véronique

    2007-12-01

    Human papillomavirus (HPV) types 45 and 51 are both considered as high risk types for the development of human cervical cancer. To optimize the detection of these two types in clinical samples, HPV-45 and HPV-51 specific primers were designed to amplify respectively a 141bp and a 266bp fragment from the L1 gene by polymerase chain reaction (PCR). The sensitivity and the specificity of these two PCR reactions were determined using varying amounts of HPV DNA containing plasmids and negative and positive controls. Overall, the sensitivity for the HPV-45 plasmid DNA is 10fg, while for HPV-51 the sensitivity is 1fg. This is equivalent to approximately 100 and 10 HPV genome copies per PCR reaction, respectively.

  12. Usefulness and limitations of polymerase chain reaction in the etiologic diagnosis of neurotoxoplasmosis in immunocompromised patients.

    PubMed

    Anselmo, Lívia Maria Pala; Vilar, Fernando Crivelenti; Lima, José Eduardo; Yamamoto, Aparecida Yule; Bollela, Valdes Roberto; Takayanagui, Osvaldo Massaiti

    2014-11-15

    The objective of the present study was to assess the performance and the best indication of the polymerase chain reaction (PCR) for the detection of Toxoplasmosis gondii DNA in cerebrospinal fluid (CSF) from patients with suspected neurotoxoplasmosis. CSF samples were collected from 79 patients for amplification of the T. gondii genome (gene B1) by two PCR techniques (nested and real time). Twenty-seven of the 79 patients were classified as probable cases of neurotoxoplasmosis on the basis of clinical criteria, neuroimaging and therapeutic response. PCR showed high sensitivity (86.6%) when performed in CSF samples which were collected up to the seventh day of specific toxoplasmosis treatment. There was no positive test after 1 week of treatment. These results suggest the usefulness of PCR for the diagnosis of cerebral toxoplasmosis, and support the first week as the window for the best performance of toxoplasmosis PCR in CSF. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting.

    PubMed

    Purcell, Maureen K; Getchell, Rodman G; McClure, Carol A; Garver, Kyle A

    2011-09-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  14. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  15. Extended kinetic model of real-time polymerase chain reaction process

    NASA Astrophysics Data System (ADS)

    Fedorov, A. A.; Sochivko, D. G.; Varlamov, D. A.; Kurochkin, V. E.

    2016-11-01

    Real-time polymerase chain reaction (real-time PCR) is the main molecular genetic method used for qualitative and quantitative analysis of specific nucleic acid sequences in many areas of biomedical research. Theoretical study of pCr models allows to estimate the influence of various reaction components and parameters, and to determine the unknown parameter values by approximating the experimental real-time PCR curves. An extended kinetic model of real-time PCR is presented. The model takes into account the enzyme activity based on Michaelis-Menten kinetics, the hybridization of complementary DNA fragments, the presence of a fluorescent probe used for detection of the reaction products, and the temperature dependence of primers and probe hybridization.

  16. Polymerase Chain Reaction–Based Assays for the Diagnosis of Invasive Fungal Infections

    PubMed Central

    Kourkoumpetis, Themistoklis K.; Fuchs, Beth Burgwyn; Coleman, Jeffrey J.; Desalermos, Athanasios

    2012-01-01

    Currently accepted fungal diagnostic techniques, such as culture, biopsy, and serology, lack rapidity and efficiency. Newer diagnostic methods, such as polymerase chain reaction (PCR)–based assays, have the potential to improve fungal diagnostics in a faster, more sensitive, and specific manner. Preliminary data indicate that, when PCR-based fungal diagnostic assays guide antifungal therapy, they may lower patient mortality and decrease unnecessary antifungal treatment, improving treatment-associated costs and avoiding toxicity. Moreover, newer PCR techniques can identify antifungal resistance DNA loci, but the clinical correlation between those loci and clinical failure has to be studied further. In addition, future studies need to focus on the implementation of PCR techniques in clinical decision making and on combining them with other diagnostic tests. A consensus on the standardization of PCR techniques, along with validation from large prospective studies, is necessary to allow widespread adoption of these assays. PMID:22362884

  17. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  18. Polymerase Chain Reaction-Based Detection Method Is Suitable for Dengue Infection During Epidemics.

    PubMed

    Iqbal, Kashif; Hashmi, Abu Saeed; Idrees, Muhammad; Shahzad, Sadeem; Fatima, Zareen

    2017-09-26

    Over the years, dengue fever has become a significant infectious disease in different parts of the world. Medical and public health services have been unable to deal with infection as there is no vaccine available for the prevention of this infection. With dengue, effective treatments are not available due to which severe symptoms may develop. To deal with this challenge, a sensitive and specific technique is required for its early diagnosis along with the knowledge of dengue serotype to increase the specificity of diagnosis and treatment. This study was designed to check the usefulness of immunological and nucleic acid-based molecular determination of dengue virus. The study recommends polymerase chain reaction as a suitable method for the rapid detection of dengue virus as it was found more sensitive than other utilized techniques, including antibodies detection. Nucleic acid analysis may also help to define the common serotypes/genotypes of dengue virus circulating in any region.

  19. Identification of Rickettsia conorii infection by polymerase chain reaction in a soldier returning from Somalia.

    PubMed

    Williams, W J; Radulovic, S; Dasch, G A; Lindstrom, J; Kelly, D J; Oster, C N; Walker, D H

    1994-07-01

    A soldier developed characteristic manifestations of boutonneuse fever shortly after leaving Somalia. Rickettsial DNA was detected in a biopsy sample of the tache noire by a polymerase chain reaction (PCR) in which primers derived from the 190-kD antigen gene of Rickettsia rickettsii were used. The source of this DNA was identified as Rickettsia conorii by restriction fragment length polymorphism (RFLP) analysis of the PCR product. R. conorii was also isolated from the skin biopsy specimen. The patient did not develop a significant increase in specific antibodies, as assessed by indirect fluorescent antibody testing, until several weeks after the onset of symptoms. This case demonstrates that the PCR/RFLP technique can be used for the direct identification of rickettsiae from clinical specimens. To our knowledge, this is the first confirmed case of R. conorii infection in Somalia.

  20. Fluorosugar Chain Termination Agents as Probes of the Sequence Specificity of a Carbohydrate Polymerase

    PubMed Central

    Brown, Christopher D.; Rusek, Max S.; Kiessling, Laura L.

    2012-01-01

    Naturally occurring carbohydrate polymers are ubiquitous. They are assembled by polymerizing glycosyltransferases, which can generate polysaccharide products with repeating sequence patterns. The fidelity of enzymes of this class is unknown. We report a method for testing the fidelity of carbohydrate polymerase pattern deposition: we synthesized fluorosugar donors and used them as chain termination agents. The requisite nucleotide fluorosugars could be produced from a single intermediate using the Jacobsen catalyst in a kinetically controlled separation of diastereomers. The resulting fluorosugar donors were used by galactofuranosyltransferase GlfT2 from Myco-bacterium tuberculosis (M. tb), and the data indicate that this enzyme mediates the cell wall galactan production through a sequence-specific polymerization. PMID:22458542

  1. Gene analysis of multiple oral bacteria by the polymerase chain reaction coupled with capillary polymer electrophoresis.

    PubMed

    Liu, Chenchen; Yamaguchi, Yoshinori; Sekine, Shinichi; Ni, Yi; Li, Zhenqing; Zhu, Xifang; Dou, Xiaoming

    2016-03-01

    Capillary polymer electrophoresis is identified as a promising technology for the analysis of DNA from bacteria, virus and cell samples. In this paper, we propose an innovative capillary polymer electrophoresis protocol for the quantification of polymerase chain reaction products. The internal standard method was modified and applied to capillary polymer electrophoresis. The precision of our modified internal standard protocol was evaluated by measuring the relative standard deviation of intermediate capillary polymer electrophoresis experiments. Results showed that the relative standard deviation was reduced from 12.4-15.1 to 0.6-2.3%. Linear regression tests were also implemented to validate our protocol. The modified internal standard method showed good linearity and robust properties. Finally, the ease of our method was illustrated by analyzing a real clinical oral sample using a one-run capillary polymer electrophoresis experiment.

  2. Detection of Mycoplasma Contamination Directly from Culture Supernatant Using Polymerase Chain Reaction.

    PubMed

    Pisal, R V; Hrebíková, H; Chvátalová, J; Kunke, D; Filip, S; Mokrý, J

    2016-01-01

    Ensuring mycoplasma-free cell culture is of prime importance as they severely affect cellular characteristics leading to experimental artefacts and spurious results. Various methods persist for mycoplasma detection; out of the whole array of methods polymerase chain reaction (PCR) is the most favoured one because it is highly sensitive, specific and quick. The PCR-based detection procedure involves three steps: cell culture supernatant collection, DNA isolation, and PCR. We have modified this procedure so that cell culture supernatant can directly be used for PCR without the need for DNA extraction. This modification makes the procedure quicker and more sensitive because loss of mycoplasma DNA is prevented and this loss becomes more significant when the level of mycoplasma contamination is very low.

  3. Polymerase Chain Reaction Detection of Trypanosoma cruzi in Macaca fascicularis Using Archived Tissues

    PubMed Central

    Williams, Jeff T.; Mubiru, James N.; Schlabritz-Loutsevitch, Natalia E.; Rubicz, Rohina C.; VandeBerg, John L.; Dick, Edward J.; Hubbard, Gene B.

    2009-01-01

    This study describes conventional and real-time polymerase chain reaction (PCR) methods developed to detect and quantify Trypanosoma cruzi DNA in cynomolgus monkeys (Macaca fascicularis) using formalin-fixed paraffin-embedded blocks archived for periods of up to 6 years. The highest concentration of T. cruzi DNA was found in the myocardium, urinary bladder, stomach, lymph node, adrenal gland, and colon. The concentration of T. cruzi DNA detected in cardiac tissues was 10–100-fold greater than found elsewhere; the mean concentrations of T. cruzi DNA in non-cardiac tissues were otherwise comparable. Trypanosoma cruzi DNA was amplified from cerebrum but not cerebellum or kidney. Successful use of DNA from formalin-fixed, paraffin-embedded blocks is important because most pathology laboratories routinely archive wax blocks. This archived resource can be used for further studies on the prevalence of this disease. PMID:19635875

  4. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  5. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.

    PubMed Central

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G

    1991-01-01

    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day. Images PMID:1650795

  6. Glyco-seek: Ultrasensitive Detection of Protein-Specific Glycosylation by Proximity Ligation Polymerase Chain Reaction.

    PubMed

    Robinson, Peter V; Tsai, Cheng-Ting; de Groot, Amber E; McKechnie, Julia L; Bertozzi, Carolyn R

    2016-08-31

    We report a non-destructive biochemical technique, termed "Glyco-seek", for analysis of O-GlcNAcylated proteins. Glyco-seek combines chemoenzymatic labeling, proximity ligation, and quantitative polymerase chain reaction to detect O-GlcNAcylated proteins with ultrahigh sensitivity. Our glycan-specific assay can be paired with traditional proximity ligation assays to simultaneously determine the change in total protein levels. We show that Glyco-seek detects attomoles of glycoproteins of interest from cell lysates, with sensitivity several orders of magnitude higher than that of current techniques. We used the method to directly assay the O-GlcNAcylation status of a low-abundance transcription factor from cell lysates without need for isolation or enrichment.

  7. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  8. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    PubMed

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  9. Polymerase chain reaction detection of Clostridium perfringens in feces from captive and wild chimpanzees, Pan troglodytes.

    PubMed

    Fujita, Shiho; Kageyama, Takashi

    2007-02-01

    For veterinary management of non-human primates in captivity, and conservation of wild-living primates, management of their health risks is necessary. Incidences of pathogenic bacteria in the fecal specimens are considered as one of the useful indicators for non-invasive health monitoring. We carried out the detection of Clostridium perfringens in feces from captive and wild chimpanzees by the rapid polymerase chain reaction method. The bacterium was detected in most fecal specimens (80%) in captive chimpanzees. Contrarily, the detection rate in the wild chimpanzees was low, with 23% (n = 12) of 53 fecal samples from the Bossou group, Guinea, and 1.2% (1/81) in the Mahale group, Tanzania. These results show that the intestinal microflora differs between Pan populations under various living conditions, being influenced by their diet and environment.

  10. Prevalence of Dirofilaria immitis infection in dogs from Celestun, Mexico, using polymerase chain reaction test.

    PubMed

    Caro-Gonzalez, Johny Antonio; Bolio-Gonzalez, Manuel Emilio; Escobedo-Ortegón, Francisco Javier; Manrique-Saide, Pablo; Rodriguez-Vivas, Roger Ivan; Rodriguez-Buenfil, Jorge Carlos; Sauri-Arceo, Carlos Humberto

    2011-02-01

    The aim of this study was to determine the prevalence of Dirofilaria immitis in dogs and to analyze risk factors associated with infection at Celestun, a coastal locality in southeast Mexico. Blood samples were collected from 279 asymptomatic individuals between August 2007 and March 2008 and analyzed by polymerase chain reaction technique. The association between D. immitis infection and sex, age group, and distance of residence from a wetland of dogs was statistically analyzed. Prevalence of D. immitis infection was of 59.8%. Age of individuals (>2 years) was a risk factor for infection with D. immitis (odds ratio 2.49, confidence interval 1.47-4.23, p=0.001). In conclusion, Celestun can be considered a focus of D. immitis infection with high levels of transmission among the local dog population, as confirmed by the high prevalence reported and the association of age (dogs >2 years) as a risk associated with infection.

  11. Polymerase chain reaction of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia in primary endodontic infections.

    PubMed

    Gomes, Brenda P F A; Montagner, Francisco; Jacinto, Rogério Castilho; Zaia, Alexandre A; Ferraz, Caio Cezar Randi; Souza-Filho, Francisco J

    2007-09-01

    The aim of this study was to investigate the correlation between endodontic clinical signs and symptoms and the presence of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia or their association by nested polymerase chain reaction assay. Microbial samples were taken from 50 cases with necrotic pulp tissues in primary infections. DNA was extracted from the samples, which were analyzed for the presence of three endodontic pathogens by using species-specific primers. P gingivalis, T denticola, and T forsythia were detected in 46%, 38%, and 22% of the symptomatic cases, respectively. The bacterial complex composed by T forsythia, P gingivalis, and T denticola was found in 14% of the cases with spontaneous pain, tenderness to percussion, swelling, and pain on palpation. The high prevalence of P gingivalis, T denticola, and T forsythia in the samples examined suggests that these bacteria are related to the etiology of symptomatic periradicular diseases.

  12. Detection of Escherichia coli in sewage and sludge by polymerase chain reaction

    SciTech Connect

    Tsai, Yuli; Palmer, C.J.; Sangermano, L.R. )

    1993-02-01

    The polymerase chain reaction (PCR) is a powerful tool in exploration of microbial activities and identities in environmental microbiology. High concentrations of humic acidlike substances in raw sewage and raw sludge have prevented the use of PCR with sewage and sludge samples. However, monitoring waste water and sludge by the PCR would lead to increased public health protection. In this study a rapid DNA extraction method and rapid purification procedure are combined with the PCR to detect Escherichia coli in sewage and sludge. The PCR is successfully used to amplify from both, a fragment of the E. coli uidAgene that codes for [beta]-D-glucuronidase. Because of their sensitivity and specificity, the PCR and nonradioactive gene probe techniques can be used to detect potentially pathogenic microorganisms in raw sewage and sludge, allowing for evaluation of the efficiency of treatments to remove pathogens.

  13. Qualitative and semiquantitative polymerase chain reaction to predict Plasmodium falciparum treatment failure.

    PubMed

    Kain, K C; Kyle, D E; Wongsrichanalai, C; Brown, A E; Webster, H K; Vanijanonta, S; Looareesuwan, S

    1994-12-01

    Multidrug-resistant falciparum malaria is increasing in most malaria-endemic areas. Rapid methods for predicting treatment failure would aid management and control of drug-resistant infections. In this study, Plasmodium falciparum DNA clearance was examined by qualitative and semiquantitative polymerase chain reaction (PCR). Thai patients with acute falciparum malaria were prospectively followed by light microscopy and by PCR of P. falciparum DNA eluted from filter paper blood samples. A 206-bp P. falciparum sequence was amplified and detected radiometrically and by high-performance liquid chromatography. Clearance of P. falciparum DNA was significantly delayed in treatment failures compared with that in successfully treated patients (P = .02). Semiquantitative PCR levels did not drop to < 50% of pretreatment levels until day 3 or later in treatment failures compared with day 1 or earlier for successfully treated parasitemia-matched controls (P = .005). These results suggest that qualitative and semiquantitative PCR may be useful as a method for monitoring response to therapy.

  14. Identification of Actinobacillus actinomycetemcomitans by leukotoxin gene-specific hybridization and polymerase chain reaction assays.

    PubMed Central

    Tønjum, T; Haas, R

    1993-01-01

    Eleven strains of Actinobacillus actinomycetemcomitans isolated from cases of systemic infections, local abscesses, and periodontitis were identified by genetic assays using the leukotoxin gene as the target. We have developed a polymerase chain reaction (PCR) assay, based on the leukotoxin structural gene of this pathogen, which clearly identified all tested strains of A. actinomycetemcomitans and separated them from the closely related Haemophilus aphrophilus as well as other bacterial species. Furthermore, DNA-DNA hybridization was performed with the cloned partial leukotoxin structural gene (lktA) as a probe, which again clearly distinguished A. actinomycetemcomitans from H. aphrophilus, parts of the normal oral flora, and species harboring RTX (repeats in toxin) family-related cytotoxins. The PCR fragment amplified from the leukotoxin structural gene gave results similar to those given by the cloned leukotoxin gene when used as a probe in hybridization experiments. The hybridization and PCR assays described here are fundamental improvements for the identification of A. actinomycetemcomitans. Images PMID:8349764

  15. Mycoplasma gallisepticum infection in drug-treated chickens: comparison of diagnosis methods including polymerase chain reaction.

    PubMed

    Kempf, I; Gesbert, F; Guittet, M; Bennejean, G

    1994-11-01

    Ten chickens were inoculated with Mycoplasma gallisepticum (MG) and treated with enrofloxacine. On eight different dates post-inoculation (PI), tracheal swab samples were collected for mycoplasma culture or detection by polymerase chain reaction (PCR), and blood samples were analysed by slide-agglutination test (SA) and enzyme-linked immunosorbent assay (ELISA). Results showed that culture and PCR detected MG from 14/80 or 20/80 samples, respectively. The last culture-positive sample was collected on day 26 PI, whereas PCR still gave positive results on day 54 PI. This difference may be attributed to the high sensitivity of PCR and to its ability to detect non-viable or non-culturable pathogens. Sera were SA positive as early as 5 days PI and some of them remained positive up to day 47 PI. ELISA detected 53 suspicious or positive sera.

  16. Detection of rodent coronaviruses in tissues and cell cultures by using polymerase chain reaction.

    PubMed Central

    Homberger, F R; Smith, A L; Barthold, S W

    1991-01-01

    A polymerase chain reaction (PCR) method was developed for the detection of rodent coronaviruses in biological material by using reverse transcriptase and two primers which flanked an M gene sequence of 375 bp. PCR detected all of 11 different strains of mouse hepatitis virus (MHV) as well as rat sialodacryoadenitis virus but not bovine coronavirus or human coronavirus strains OC43 and 229E. The M gene sequences of bovine coronavirus and human coronavirus OC43 are homologous to that of MHV, but minor differences exist in the primer regions, preventing annealing of the primers. For detecting MHV-Y in tissue samples, PCR was faster than and at least as sensitive as either of the two bioassays (infant mouse bioassay and mouse antibody production test) currently used for MHV diagnostic purposes. Images PMID:1661745

  17. Polymerase chain reaction-based assays for the diagnosis of human brucellosis.

    PubMed

    Wang, Ying; Wang, Zhanli; Zhang, Yaxian; Bai, Liyun; Zhao, Yue; Liu, Chunfang; Ma, An; Yu, Hui

    2014-08-01

    Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed.

  18. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis.

    PubMed Central

    Telenti, A; Marchesi, F; Balz, M; Bally, F; Böttger, E C; Bodmer, T

    1993-01-01

    A method for the rapid identification of mycobacteria to the species level was developed on the basis of evaluation by the polymerase chain reaction (PCR) of the gene encoding for the 65-kDa protein. The method involves restriction enzyme analysis of PCR products obtained with primers common to all mycobacteria. Using two restriction enzymes, BstEII and HaeIII, medically relevant and other frequent laboratory isolates were differentiated to the species or subspecies level by PCR-restriction enzyme pattern analysis. PCR-restriction enzyme pattern analysis was performed on isolates (n = 330) from solid and fluid culture media, including BACTEC, or from frozen and lyophilized stocks. The procedure does not involve hybridization steps or the use of radioactivity and can be completed within 1 working day. Images PMID:8381805

  19. The actin multigene family and livestock speciation using the polymerase chain reaction.

    PubMed

    Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

    1998-01-01

    Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

  20. Serotype identification of Actinobacillus pleuropneumoniae by arbitrarily primed polymerase chain reaction.

    PubMed Central

    Hennessy, K J; Iandolo, J J; Fenwick, B W

    1993-01-01

    Rapid and accurate determination of the Actinobacillus pleuropneumoniae serotype involved in a disease outbreak is important both in limiting the severity of an outbreak and for tracing the source of the infecting organism. This study describes the use of arbitrarily primed polymerase chain reaction (AP-PCR) as a rapid, precise, and genetically based procedure to identify A. pleuropneumoniae. AP-PCR amplification of bacterial genomic DNA results in specific DNA profiles, which can be used to differentiate currently recognized serotypes. This technique is especially useful for identifying previously nontypeable and serologically cross-reactive A. pleuropneumoniae field isolates. Consecutive passages of isolates on different media, freezing, and subsequent infection of pigs did not alter the AP-PCR genomic profile. We propose the use of M13 and T3-T7 oligodeoxynucleotide primers for diagnostic and epidemiological identification of A. pleuropneumoniae by AP-PCR techniques. Images PMID:8501215

  1. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  2. Discrepancies between Antigen and Polymerase Chain Reaction Tests for the Detection of Rotavirus and Norovirus.

    PubMed

    Kim, Hyun Soo; Kim, Jae-Seok

    2016-05-01

    We compared the results of an antigen test (ELISA) with those of polymerase chain reaction (PCR) for the detection of rotavirus and norovirus in stool specimens. Rotavirus and norovirus antigen-positive stool specimens were collected, and rotavirus and norovirus PCRs were performed on these specimens. Of the 325 rotavirus antigen-positive specimens, 200 were positive for both assays and 125 were PCR negative. Of 286 norovirus antigen-positive specimens, 51 were PCR negative. Comparison of the lower limit of detection showed that rotavirus PCR was 16 times more sensitive and norovirus PCR was over 4,000 times more sensitive than the ELISA. Discrepant results between ELISA and PCR were common, and the possibility of false-positive and false-negative results should be considered with rotavirus and norovirus assays.

  3. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

    PubMed

    Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

    2017-04-15

    Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR.

  4. Acanthamoeba can be differentiated by the polymerase chain reaction and simple plating assays.

    PubMed

    Khan, N A; Jarroll, E L; Paget, T A

    2001-09-01

    Acanthamoeba are opportunistic pathogens with invasive and noninvasive species. For clinical purposes it is important to differentiate potentially pathogenic from nonpathogenic isolates. For the rapid and sensitive identification of Acanthamoeba at the genus level, we used a polymerase chain reaction (PCR)-based method which detected as few as five cells. Further, we tested nine isolates of Acanthamoeba for their ability to produce cytopathic effects (CPE) on corneal epithelial cells. On the basis of the results, Acanthamoeba were divided into pathogenic or nonpathogenic groups. However, because CPE assays are not available to every diagnostic laboratory, we developed a simple plating assay based on osmotolerance which correlated well with the CPE assays. Pathogenic Acanthamoeba showed growth on higher osmolarity (agar plates containing one molar mannitol), while growth of nonpathogens was inhibited on these plates. In conclusion, we have developed methods for the rapid identification and differentiation of Acanthamoeba.

  5. Polymerase chain reaction for diagnosis of genital herpes: a missed opportunity?

    PubMed

    Agius, E; Arthur, G; Mandhyan, K; Mercey, D

    2005-08-01

    This study audited the utilization of herpes simplex virus polymerase chain reaction (HSV PCR) in the investigation of recurrent anogenital ulceration at the Mortimer Market Centre. Clinic guidelines for use of HSV PCR were modified in April 2003 to expand PCR use. Ninety-six case-notes belonging to patients presenting with recurrent anogenital ulceration between 1 April and 16 October 2003 were reviewed and 59 were suitable for inclusion. Details of the investigations carried out at each visit were recorded. HSV PCR was used according to guidelines in eight of the 59 cases studied. This audit showed under-utilization of HSV PCR testing with poor adherence to clinic guidelines when cases of suspected recurrent genital herpes were investigated. This led to under-diagnosis and delay in diagnosis. This audit stresses the importance of informing all clinical staff of the improved sensitivity and relative affordability of HSV PCR compared with HSV tissue culture.

  6. Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

    PubMed

    Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

    2005-01-01

    A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

  7. A new approach to primer selection in polymerase chain reaction experiments

    SciTech Connect

    Pearson, W.R.; Robins, G.; Wrege, D.E.; Zhang, Tongtong

    1995-12-31

    We address the problem of primer selection in polymerase chain reaction (PCR) experiments. We prove that the problem of minimizing the number of primers required to amplify a set of DNA sequences is NP-complete, and show that even approximating solutions to this problem to within a constant factor times optimal is intractable. On the practical side, we give a simple branch-and-bound algorithm that solves the primers minimization problem within reasonable time for typical instances. We present an efficient approximation scheme for this problem, and prove that our heuristic always produces solutions no worse than a logarithmic factor times the optimal, this being the best approximation possible within polynomial time. Finally, we analyze a weighted variant, where both the number of primers as well as the sum of their {open_quotes}costs{close_quotes} is optimized simultaneously. We conclude by presenting the empirical performance of our methods on biological data.

  8. Detection of Fasciola gigantica infection in snails by polymerase chain reaction.

    PubMed

    Velusamy, R; Singh, B P; Raina, O K

    2004-02-26

    Polymerase chain reaction (PCR) was used to detect Fasciola gigantica infection in the snail intermediate host. Fasciola specific primers amplified a 124 bp fragment in PCR when the genomic DNA isolated from F. gigantica infected Lymnaea auricularia snails was used as template. In addition to the 124 bp amplicon, a ladder of DNA fragments representing amplification of the 124 bp repetitive sequences was observed. Genomic DNA of the parasite was used as a positive control, which also gave an amplification of the 124 bp fragment. DNA isolated from non-infected snails was used as a negative control and no amplification of this sequence was observed. This technique is highly specific and sensitive and possesses fairly good prospects of its utility as an epidemiological tool for ascertaining the infectivity status in ubiquitous snail populations.

  9. Gene synthesis by integrated polymerase chain assembly and PCR amplification using a high-speed thermocycler

    PubMed Central

    TerMaat, Joel R.; Pienaar, Elsje; Whitney, Scott E.; Mamedov, Tarlan G.; Subramanian, Anuradha

    2013-01-01

    Polymerase chain assembly (PCA) is a technique used to synthesize genes ranging from a few hundred base pairs to many kilobase pairs in length. In traditional PCA, equimolar concentrations of single stranded DNA oligonucleotides are repeatedly hybridized and extended by a polymerase enzyme into longer dsDNA constructs, with relatively few full-length sequences being assembled. Thus, traditional PCA is followed by a second primer-mediated PCR reaction to amplify the desired full-length sequence to useful, detectable quantities. Integration of assembly and primer-mediated amplification steps into a single reaction using a high-speed thermocycler is shown to produce similar results. For the integrated technique, the effects of oligo concentration, primer concentration, and number of oligonucleotides are explored. The technique is successfully demonstrated for the synthesis of two genes encoding EPCR-1 (653 bp) and pUC19 β-lactamase (929 bp) in under 20 min. However, rapid integrated PCA–PCR was found to be problematic when attempted with the TM-1 gene (1509 bp). Partial oligonucleotide sets of TM-1 could be assembled and amplified simultaneously, indicating that the technique may be limited to a maximum number of oligonucleotides due to competitive annealing and competition for primers. PMID:19799938

  10. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

    PubMed

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

    2017-05-01

    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml(-1) while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml(-1). It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml(-1) by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg(2+) ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Increased sample capacity for genotyping and expression profiling by kinetic polymerase chain reaction.

    PubMed

    Watson, Robert M; Griaznova, Olga I; Long, Christopher M; Holland, Michael J

    2004-06-01

    We fabricated and evaluated high-throughput kinetic thermal cyclers with 768-reaction capacity for kinetic polymerase chain reaction (kPCR)-based genotyping and kinetic reverse transcription (kRT)-PCR-based transcript quantitation. The system uses dye-based detection with ethidium bromide and a single DNA polymerase-based PCR or RT-PCR assay. Allele-specific detection of the two most common hereditary hemochromotosis mutant alleles, C282Y and H63D, was reliably measured by kPCR using human DNA templates as low as 10 genome equivalents per assay. Transcript profiling was performed for 16 yeast transcripts ranging in intracellular abundance over four orders of magnitude. Standard deviations of the PCR cycle threshold values determined from multiple kRT-PCR assays in three different instruments ranged from 0.11 to 0.97 PCR cycles and were reproducible, transcript specific, and instrument independent. The effects of the sin3, gal11, and snf2 knockout mutations on expression of 385 yeast genes were evaluated by kRT-PCR and compared to published values determined by high-density oligonucleotide array and/or microarray analysis for snf2 and sin3. The 768-reaction kinetic thermalcyclers, each with a capacity for more than a half million assays per year, are well suited to genomics applications such as single nucleotide polymorphism/disease association studies and genomewide transcription profiling where high sensitivity and accuracy are required.

  12. Silicon inhibition effects on the polymerase chain reaction: a real-time detection approach.

    PubMed

    Wang, Wei; Wang, Hai-Bin; Li, Zhi-Xin; Guo, Zeng-Yuan

    2006-04-01

    In the miniaturization of biochemical analysis systems, biocompatibility of the microfabricated material is a key feature to be considered. A clear insight into interactions between biological reagents and microchip materials will help to build more robust functional bio-microelectromechanical systems (BioMEMS). In the present work, a real-time polymerase chain reaction (PCR) assay was used to study the inhibition effects of silicon and native silicon oxide particles on Hepatitis B Virus (HBV) DNA PCR amplification. Silicon nanoparticles with different surface oxides were added into the PCR mixture to activate possible interactions between the silicon-related materials and the PCR reagents. Ratios of silicon nanoparticle surface area to PCR mixture volume (surface to volume ratio) varied from 4.7 to 235.5 mm2/microL. Using high speed centrifugation, the nanoparticles were pelleted to tube inner surfaces. Supernatant extracts were then used in subsequent PCR experiments. To test whether silicon materials participated in amplifications directly, in some cases, entire PCR mixture containing silicon nanoparticles were used in amplification. Fluorescence histories of PCR amplifications indicated that with the increase in surface to volume ratio, amplification efficiency decreased considerably, and within the studied ranges, the higher the particle surface oxidation, the stronger the silicon inhibition effects on PCR. Adsorption of Taq polymerase (not nucleic acid) on the silicon-related material surface was the primary cause of the inhibition phenomena and silicon did not participate in the amplification process directly. (c) 2005 Wiley Periodicals, Inc.

  13. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    PubMed Central

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  14. Presence of human immunodeficiency virus nucleic acids in wastewater and their detection by polymerase chain reaction.

    PubMed Central

    Ansari, S A; Farrah, S R; Chaudhry, G R

    1992-01-01

    The human immunodeficiency virus type 1 (HIV-1) released by infected individuals or present in human and hospital wastes can potentially cause contamination problems. The presence of HIV-1 was investigated in 16 environmental samples, including raw wastewater, sludge, final effluent, soil, and pond water, collected from different locations. A method was developed to extract total nucleic acids in intact form directly from the raw samples or from the viral concentrates of the raw samples. The isolated nucleic acids were analyzed for the presence of HIV-1 by using in vitro amplification of the target sequences by the polymerase chain reaction (PCR) method. HIV-1-specific proviral DNA and viral RNA were detected in the extracted nucleic acids obtained from three wastewater samples by this method. The specificity of the PCR-amplified products was determined by Southern blot hybridization with an HIV-1-specific oligonucleotide probe, SK19. The isolated nucleic acids from wastewater samples were also screened for the presence of poliovirus type 1, representing a commonly found enteric virus, and simian immunodeficiency virus, representing, presumably, rare viruses. While poliovirus type 1 viral RNA was found in all of the wastewater samples, none of the samples yielded a simian immunodeficiency virus-specific product. No PCR-amplified product was yielded when wastewater samples were directly used for the detection of HIV-1 and poliovirus type 1. The wastewater constituents appeared to be inhibitory to the enzymes reverse transcriptase and DNA polymerase.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1476440

  15. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  16. Polymerase chain reaction-based analysis of microorganisms associated with failed endodontic treatment.

    PubMed

    Siqueira, José F; Rôças, Isabela N

    2004-01-01

    In this study, we aimed to investigate the occurrence of several microbial species in cases of failed endodontic therapy by means of the polymerase chain reaction (PCR). Study design Root canal samples were taken from 22 root-filled teeth with persistent periradicular lesions selected for re-treatment. DNA was extracted from the samples and analyzed for the presence of 19 microbial taxa by using the polymerase chain reaction. All samples were positive for at least 1 of the target microbial species. Enterococcus faecalis was the most prevalent species-detected in 77% of the cases. The other most prevalent species were Pseudoramibacter alactolyticus (52%), Propionibacterium propionicum (52%), Dialister pneumosintes (48%), and Filifactor alocis (48%). Candida albicans was found in 9% of the samples. The mean number of species in samples filled up to 2 mm short of the radiographic apex was 3 (range, 1-5), whereas cases in which the filling was greater than 2 mm from the apex yielded a mean of 5 species (range, 2-11). This difference was statistically significant (P <.05). Microorganisms occurred in all cases of root-filled teeth associated with periradicular lesions, which lends strong support to the assertion that treatment failures are rather of infectious etiology, caused by persistent or secondary intraradicular infections. E faecalis was the most prevalent species, followed by 4 other anaerobic species: P. alactolyticus, P. propionicum, D. pneumosintes, and F. alocis. All examined samples harbored at least 1 of the following gram-positive bacterial species: E. faecalis, P. alactolyticus, or P. propionicum.

  17. Polymerase chain reaction method for leptospirosis, analysis on samples from an autochthon swine population in Sicily, Italy.

    PubMed

    Vitale, Maria; Vitale, Fabrizio; Di Marco, Vincenzo; Curró, Vittoria; Vesco, Gesualdo; Caracappa, Santo

    2005-01-01

    We set a method targeting 16 rRNA gene consisting in a single polymerase chain reaction of 40 cycles which is specific for pathogenic leptospira. Negative polymerase chain reaction results were observed with nonpathogenic Leptospira (serovar patoc) and other bacteria species. By this method a survey on a population of autochthon swine herds had been conducted in Sicily particularly on kidney samples of slaughtered animals and on urine samples from live animals. The analysis showed that a prevalence of leptospira up to 40 % can be observed on these animals. Results on other bovine and ovine herds from the same province in Sicily showed a lower prevalence.

  18. Direct polymerase chain reaction for detection of toxigenic Corynebacterium diphtheriae strains from the Republic of Georgia after prolonged storage.

    PubMed

    Kobaidze, K; Popovic, T; Nakao, H; Quick, L

    2000-02-01

    A total of 226 paired nose and throat swab specimens from 113 clinical diphtheria cases from the republic of Georgia were analyzed by direct polymerase chain reaction targeting both A and B subunits of the diphtheria toxin gene, tox. Even after prolonged transport and extensive storage (7-14 months) of the clinical specimens in silica gel packages, direct polymerase chain reaction detected the diphtheria tox gene in 54% of the specimens. Specimens obtained by throat swab were three times more likely than those obtained by nose swab to be positive for Corynebacterium diphtheriae.

  19. DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction

    PubMed Central

    Elshawadfy, Ashraf M.; Keith, Brian J.; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A.

    2014-01-01

    The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the “forked-point” (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the “forked-point” and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms. PMID:24904539

  20. A quantitative polymerase chain reaction assay for rapid detection of 9 pathogens directly from stools of travelers with diarrhea.

    PubMed

    Antikainen, Jenni; Kantele, Anu; Pakkanen, Sari H; Lääveri, Tinja; Riutta, Jukka; Vaara, Martti; Kirveskari, Juha

    2013-10-01

    Every year, 80 million tourists traveling to tropical and subtropical areas contract traveler's diarrhea (TD). Forty percent to 80% of cases are caused by bacteria, yet clinical diagnostic tests are available to identify only a few of the strains that cause TD. We aimed to develop a quantitative polymerase chain reaction (qPCR) assay to identify all major pathogens in stool samples. We developed a low-cost, high-throughput, multiplex qPCR assay for simultaneous detection of 9 bacterial pathogens in stool samples: Salmonella, Yersinia, Campylobacter, and Vibrio cholerae, as well as Shigella or enteroinvasive Escherichia coli, enterohemorrhagic E coli, enterotoxigenic E coli (ETEC), enteroaggregative E coli (EAEC), and enteropathogenic E coli (EPEC). The assay was validated using positive (n = 245) and negative (n = 243) control strains, as well as preselected positive and negative stool samples. In addition, stool samples were collected from 96 returning travelers with TD. The findings were compared with those from routine diagnostic tests. The assay detected the bacterial strains with 100% sensitivity and specificity, compared with results from the reference tests. Of all stool samples collected from travelers with TD, EPEC was found in 47%, EAEC in 46%, ETEC in 22%, enterohemorrhagic E coli in 7%, Campylobacter in 6%, Shigella or enteroinvasive E coli in 2%, and Salmonella in 2%. Multiple pathogens were found in 37% of all samples. We developed a low-cost, high-throughput qPCR assay for use in routine diagnostic analysis and research. It detects the pathogenic bacteria most commonly associated with TD in stool samples with 100% sensitivity and specificity, compared with reference methods. The assay requires 4 hours, whereas current detection methods require 1 to 7 days. At least 1 TD pathogen was identified in stool samples from 76% of returning travelers, whereas conventional methods found a pathogen in only 17%. The most commonly detected bacteria were EPEC

  1. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay.

    PubMed Central

    Young, K K; Resnick, R M; Myers, T W

    1993-01-01

    Amplification of RNA by the polymerase chain reaction (PCR) is normally a two-step process requiring separate enzymes and buffer conditions. We describe a combined reverse transcription-PCR (RT-PCR) assay for hepatitis C virus (HCV) RNA amplification in which a single enzyme and buffer condition are used. In this assay, both the RT and PCR steps are carried out with the thermoactive DNA polymerase of Thermus thermophilus. A transcription vector containing HCV sequences has also been constructed to generate quantifiable HCV RNA templates that can be used to optimize reaction conditions and to assess the efficiency of amplification. Amplification from < or = 100 copies of RNA was detected reproducibly by gel electrophoresis. The assay sensitivity was increased to 10 RNA copies by hybridization to a probe. The patterns of viremia in three individuals infected with HCV were examined by amplification of HCV RNA from plasma samples collected serially over a period of 1 year. These results were correlated with the times of seroconversion and the onset of rise in levels of alanine aminotransferase in serum. In all three subjects, HCV RNA was detected prior to seroconversion and the initial rise in levels of alanine aminotransferase in serum. Upon seroconversion, HCV RNA fell to a level below the detection limit of the assay. This pattern of transient viremia appears to be characteristic of acute, resolving HCV infections. The combined RT-PCR assay is a sensitive method which circumvents the problems associated with PCR amplification of RNA. Using this assay, we demonstrated that three donors infected by the same index case all have similar patterns of viremia. Images PMID:8385151

  2. Rapid identification of Salmonella enterica subsp. arizonae and S. enterica subsp. diarizonae by real-time polymerase chain reaction.

    PubMed

    Hopkins, Katie L; Peters, Tansy M; Lawson, Andy J; Owen, Robert J

    2009-08-01

    Reptiles are popular as pets, leading to an increased risk of human infections due to uncommon Salmonella strains including the Arizona group (subspecies arizonae and diarizonae). We present a real-time Arizona-specific polymerase chain reaction demonstrating 100% specificity and 99.6% sensitivity, offering savings in time and labor over traditional identification methods.

  3. National Department of Defense Surveillance for Invasive Streptococcus Pneumoniae: Antibiotic Resistance, Serotype Distribution, and Arbitrarily Primed Polymerase Chain Reaction Analyses

    DTIC Science & Technology

    2008-02-15

    penicillin -susceptible and peni- cillin-resistant Streptococcnspneuttmoniae serotypes in Canada. J Infect Dis Streptococcus pneumoniae Surveillance Group...Gray for the Streptococcus pneumonia Surveillance Group Report No. 00-44 Approved for public release; distribution unlimited. NAVAL HEALTH RESEARCH...Defense Surveillance for Invasive Streptococcus pneumoniae : Antibiotic Resistance, Serotype Distribution, and Arbitrarily Primed Polymerase Chain

  4. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  5. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  6. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  8. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  9. Development of a polymerase chain reaction test for specific identification of the urinary tract pathogen Aerococcus urinae.

    PubMed Central

    Aguirre, M; Collins, M D

    1993-01-01

    A polymerase chain reaction test was developed for identification of the gram-positive urinary tract pathogen Aerococcus urinae. Oligonucleotide primers were based on highly specific sequences within the small-subunit rRNA gene. A confirmatory test based on hybridization of the amplified products to a highly specific internal probe was also developed. Images PMID:7684752

  10. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis.

  11. A centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria.

    PubMed

    Choi, Goro; Jung, Jae Hwan; Park, Byung Hyun; Oh, Seung Jun; Seo, Ji Hyun; Choi, Jong Seob; Kim, Do Hyun; Seo, Tae Seok

    2016-06-21

    In this study, we developed a centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria contaminated milk samples. The microdevice was designed to contain identical triplicate functional units and each unit has four reaction chambers, thereby making it possible to perform twelve direct-RPA reactions simultaneously. The integrated microdevice consisted of two layers: RPA reagents were injected in the top layer, while spiked milk samples with food poisoning bacteria were loaded into sample reservoirs in the bottom layer. For multiplex bacterial detection, the target gene-specific primers and probes were dried in each reaction chamber. The introduced samples and reagents could be equally aliquoted and dispensed into each reaction chamber by centrifugal force, and then the multiplex direct-RPA reaction was executed. The target genes of bacteria spiked in milk could be amplified at 39 °C without a DNA extraction step by using the direct-RPA cocktails, which were a combination of a direct PCR buffer and RPA enzymes. As the target gene amplification proceeded, the increased fluorescence signals coming from the reaction chambers were recorded in real-time at an interval of 2 min. The entire process, including the sample distribution, the direct-RPA reaction, and the real-time analysis, was accomplished with a custom-made portable genetic analyzer and a miniaturized optical detector. Monoplex, duplex, and triplex food poisoning bacteria (Salmonella enterica, Escherichia coli O157:H7, and Vibrio parahaemolyticus) detection was successfully performed with a detection sensitivity of 4 cells per 3.2 μL of milk samples within 30 min. By implementing the direct-PRA on the miniaturized centrifugal microsystem, the on-site food poisoning bacteria analysis would be feasible with high speed, sensitivity, and multiplicity.

  12. Specific detection of Pacific oyster (Crassostrea gigas) larvae in plankton samples using nested polymerase chain reaction.

    PubMed

    Patil, Jawahar G; Gunasekera, Rasanthi M; Deagle, Bruce E; Bax, Nicholas J

    2005-01-01

    Management of sustainable Pacific oyster fisheries would be assisted by an early, rapid, and accurate means of detecting their planktonic larvae. Reported here is an approach, based on polymerase chain reaction (PCR), for the detection of Pacific oyster larvae in plankton samples. Species-specific primers were designed by comparing partial mitochondrial cytochrome oxidase subunit I (COI) sequences from Crassostrea gigas, with other members of the family Ostreidae including those of Crassostrea angulata. Assay specificity was empirically validated through screening DNA samples obtained from several species of oysters. The assay was specific as only C. gigas samples returned PCR-positive results. A nested PCR approach could consistently detect 5 or more D-hinge-stage larvae spiked into a background of about 146 mg of plankton. The assay does not require prior sorting of larvae. We conclude that the assay could be used to screen environmental and ballast water samples, although further specificity testing against local bivalve species is recommended in new locations.

  13. Detection of human papillomavirus in juvenile laryngeal papillomatosis using polymerase chain reaction.

    PubMed

    Gómez, M A; Drut, R; Lojo, M M; Drut, R M

    1995-01-01

    We examined the presence and subtypes of human papillomavirus (HPV) in 20 paraffin-embedded samples (from 12 patients) of juvenile laryngeal papillomatosis using the polymerase chain reaction (PCR). The biopsies had been stored for months to 12 years. Due to the great genetic variability of HPV, we selected a conservative sequence of the viral genome (L1 region) to identify the vast majority of the subtypes. Positive results were obtained by one-step PCR amplification with the MY09-11 consensus primers (L1 region) in only 10 of the cases. After a two-step amplification (nested-PCR) with GP5-6 primers the 20 samples proved to be positive demonstrating the higher sensitivity of this method. In order to amplify a highly variable region of the genome (E6), specific primers for HPV types 6 and 11 (H6/11 L1-R2) were used. 7/12 patients were positive for this subtype. Since more that one subtype has been reported in the same sample, the presence of HPV 6-11 sequences does not exclude that other subtypes might be involved. The results of this study show that: 1) HPV is present in JLP. 2) The most frequent HPV subtype involved was from the 6-11 group. 3) PCR can be successfully used in archived tissue routinely processed in a laboratory of pathology.

  14. A highly sensitive immuno-polymerase chain reaction assay for Clostridium botulinum neurotoxin type A.

    PubMed

    Chao, Hai-Yuan; Wang, Yeau-Ching; Tang, Shiao-Shek; Liu, Hwan-Wun

    2004-01-01

    Our goal was to develop a sensitive method for detecting Clostridium botulinum neurotoxin type A (BoNT/A). We were able to detect BoNT/A in the femtogram (10(-15)g) range using an indirect immuno-polymerase chain reaction (immuno-PCR) assay and an indirect sandwich immuno-PCR assay. For the indirect immuno-PCR assay, enzyme-linked immunosorbent assay (ELISA) plates were coated with BoNT/A that was recognized by anti-BoNT/A monoclonal antibody. For the indirect sandwich immuno-PCR assay, the monoclonal antibody was immobilized on ELISA plates for detecting BoNT/A that was recognized by its polyclonal antibodies. Reporter DNA was prepared by PCR amplification using biotinylated 5'-primers, and it was coupled with biotinylated antibodies through streptavidin. In order to increase sensitivity and reduce background noise, the amounts of reporter DNA (ranging from 50 fg to 50 ng) and streptavidin (ranging from 0.125 ng to 8 ng) were optimized. Using the optimized concentration of reporter DNA and streptavidin, both indirect and indirect sandwich immuno-PCR assays detected BoNT/A as low as 50 fg. These results are a 10(5)-fold improvement over conventional indirect ELISA and indirect sandwich ELISA methods. The assays we developed are currently the most sensitive methods for detecting BoNT/A.

  15. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

    PubMed

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-20

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  16. Rapid screening for sickle cell disease by polymerase chain reaction-high resolution melting analysis.

    PubMed

    Yue, Liang; Lin, Min; Chen, Jiang-Tao; Zhan, Xiao-Fen; Zhong, De-Shang; Monte-Nguba, Santiago-M; Liu, Pei-Fen; Pan, Xue-Fen; Huang, Jiang-Hua; Wang, Xi; Ehapo, Juan Carlos Salas; Eyi, Urbano Monsuy; Yang, Hui-Tian; Yang, Li-Ye

    2014-06-01

    Each year, ~300,000 individuals with sickle cell disease (SCD), a hemoglobinopathy caused by β-globin gene mutation, are born, and >75% of those are in Africa. The present study examined 511 individuals on the island of Bioko (Equatorial Guinea) and attempted to establish a method for rapid sickle cell disease screening. Following DNA extraction and polymerase chain reaction (PCR) amplification, high resolution melting (HRM) analysis was used to assess the specificity of fluorescence signals of the PCR products and to differentiate various genotypes of these products. The analytical results of HRM were validated using DNA sequencing. By HRM analysis, 80 out of 511 samples were classified as hemoglobin S (Hb S) heterozygotes, while 431 out of 511 samples were classified as wild-type. No mutant homozygote was identified. DNA sequencing indicated that within the 431 wild-type samples as indicated by HRM analysis, one case was actually a Hb S heterozygote and another case was a rare hemoglobin S-C genotype (sickle-hemoglobin C disease). One out of 80 suspected Hb S heterozygotes as indicated by HRM was confirmed as wild-type by DNA sequencing and the results of residual 508 cases were consistent for HRM analysis and sequencing. In conclusion, HRM analysis is a simple, high-efficiency approach for Hb S screening and is useful for early diagnosis of SCD and particularly suitable for application in the African area.

  17. Detection of schistosomes polymerase chain reaction amplified DNA by oligochromatographic dipstick.

    PubMed

    Akinwale, O P; Laurent, T; Mertens, P; Leclipteux, T; Rollinson, D; Kane, R; Emery, A; Ajayi, M B; Akande, D O; Fesobi, T W

    2008-08-01

    The applications of highly specific and sensitive molecular techniques based on polymerase chain reaction (PCR) have constituted a valuable tool for the diagnosis of schistosomiasis and also for the detection of schistosome infections in the snail intermediate hosts. The common method of detecting PCR amplicons is gel electrophoresis in the presence of ethidium bromide, a carcinogen, which is followed by UV transillumination. Other methods, which are available for detecting PCR products, are real-time PCR, PCR-enzyme-linked immunosorbent assay (PCR-ELIZA) and mass spectrometry but they are cumbersome while they are sometimes complex and expensive. Therefore, a simple method of PCR product detection would be a welcome idea and a most valuable tool particularly in disease endemic countries with limited research facilities and resources. In this study, we applied a simple and rapid method for the detection of Schistosoma haematobium and Schistosoma mansoni PCR amplified DNA products using oligochromatographic (OC) dipstick. The amplicons are visualized by hybridization with a gold conjugated probe, while a control for the chromatographic migration is incorporated in the assay. The lower detection limit observed was 10fg of genomic DNA from each of the two species, while the dipstick was also specific for each of the species used in this study.

  18. A specific polymerase chain reaction test for the identification of Streptococcus pneumoniae.

    PubMed

    Prère, Marie-Françoise; Fayet, Olivier A

    2011-05-01

    Using an approach based on the comparison of arbitrary primer polymerase chain reaction (PCR) genomic profiles from oral streptococci and Streptococcus pneumoniae strains, we identified a 434-bp genomic fragment apparently specific for S. pneumoniae. From the nucleotidic sequence of this common fragment, a pair of primers was designed and tested on a set of strains comprising the major Streptococcus species. One species, S. anginosus, gave an amplification product of the same length as S. pneumoniae. Sequence comparison of the S. anginosus and S. pneumoniae amplicons revealed several variations which were used to define a new set of primers giving a 181-bp S. pneumoniae-specific fragment. The amplified fragment contains the 5' terminal part of a gene encoding a putative sugar-specific permease and an intergenic sequence. The PCR test was evaluated on 257 strains of invasive S. pneumoniae corresponding to clinical isolates and on 153 non-pneumoniae oral streptococci strains; in addition, 3 S. pseudopneumoniae strains were tested. With these primers, an amplification product was only obtained with the S. pneumoniae strains. Moreover, the test was successfully evaluated on 10 atypical S. pneumoniae strains related to pneumococcal diseases. In this study, we therefore established the capacity of a simple PCR test to discriminate S. pneumoniae from other Streptococci (including S. pseudopneumoniae), thus allowing rapid and accurate diagnosis.

  19. Quantitative detection of human enteric adenoviruses in river water by microfluidic digital polymerase chain reaction.

    PubMed

    Kishida, Naohiro; Noda, Naohiro; Haramoto, Eiji; Kawaharasaki, Mamoru; Akiba, Michihiro; Sekiguchi, Yuji

    2014-01-01

    We describe an assay for simple and accurate quantification of human enteric adenoviruses (EAdVs) in water samples using a recently developed quantification method named microfluidic digital polymerase chain reaction (dPCR). The assay is based on automatic distribution of reaction mixture into a large number of nanolitre-volume reaction chambers and absolute copy number quantification from the number of chambers containing amplification products on the basis of Poisson statistics. This assay allows absolute quantification of target genes without the use of standard DNA. Concentrations of EAdVs in Japanese river water samples were successfully quantified by the developed dPCR assay. The EAdVs were detected in seven of the 10 samples (1 L each), and the concentration ranged from 420 to 2,700 copies/L. The quantified values closely resemble those by most probable number (MPN)-PCR and real-time PCR when standard DNA was validated by dPCR whereas they varied substantially when the standard was not validated. Accuracy and sensitivity of the dPCR was higher than those of real-time PCR and MPN-PCR. To our knowledge, this is the first study that has successfully quantified enteric viruses in river water using dPCR. This method will contribute to better understanding of existence of viruses in water.

  20. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant

    2004-09-01

    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  1. Cattle fetal sex determination by polymerase chain reaction using DNA isolated from maternal plasma.

    PubMed

    da Cruz, A S; Silva, D C; Costa, E O A; De M-Jr, P; da Silva, C C; Silva, D M; da Cruz, A D

    2012-03-01

    The objective of this study was to evaluate the use of polymerase chain reaction analysis (PCR) of fetal cells/DNA in the maternal plasma of pregnant cows to determine the sex of the fetus. Plasma was harvested from 35 cows of mixed genotype at different stages of pregnancy ranging from 5 to 35 weeks. A male calf and a heifer calf provided the control samples. Fetal sex was determined by amplification of Y-specific sequences. For the 35 cows, the fetal sex predicted by this technique was in accordance with the sex of the calf at birth in 88.6% of cases. The agreement between predicted and observed fetal sex was less for cows with a gestational length of 35-48 days (63.6%). Regression analysis showed that there was a strong relationship between the probability of correctly predicting fetal sex and the stage of gestation. It was estimated that the test performed at 43.8 days post fertilization would have 95% accuracy, increasing to 99% accuracy for testing at 48.4 days and 99.9% accuracy for tests at 55.0 days or later. It was concluded that PCR analysis of fetal cells in maternal plasma can be used to predict successfully the sex of the fetus in cattle.

  2. Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis

    PubMed Central

    Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

    2003-01-01

    Aim: To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. Methods: The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Results: Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. Conclusions: PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive. PMID:12488268

  3. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan

    2012-03-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  4. A Novel, Essential Control for Clonality Analysis with Human Androgen Receptor Gene Polymerase Chain Reaction

    PubMed Central

    van Dijk, Jeroen P.; Heuver, Leonie H.; van der Reijden, Bert A.; Raymakers, Reinier A.; de Witte, Theo; Jansen, Joop H.

    2002-01-01

    The most widely used technique for determining clonality based on X-chromosome inactivation is the human androgen receptor gene polymerase chain reaction (PCR). The reliability of this assay depends critically on the digestion of DNA before PCR with the methylation-sensitive restriction enzyme HpaII. We have developed a novel method for quantitatively monitoring the HpaII digestion in individual samples. Using real-time quantitative PCR we measured the efficiency of HpaII digestion by measuring the amplification of a gene that escapes X-chromosome inactivation (XE169) before and after digestion. This method was tested in blood samples from 30 individuals: 2 healthy donors and 28 patients with myelodysplastic syndrome. We found a lack of XE169 DNA reduction after digestion in the granulocytes of two myelodysplastic syndrome patients leading to a false polyclonal X-chromosome inactivation pattern. In all other samples a significant reduction of XE169 DNA was observed after HpaII digestion. The median reduction was 220-fold, ranging from a 9.0-fold to a 57,000-fold reduction. Also paraffin-embedded malignant tissue was investigated from two samples of patients with mantle cell lymphoma and two samples of patients with colon carcinoma. In three of these cases inefficient HpaII digestion led to inaccurate X-chromosome inactivation pattern ratios. We conclude that monitoring the efficiency of the HpaII digestion in a human androgen receptor gene PCR setting is both necessary and feasible. PMID:12213708

  5. Comparison of Analytic Methods for Quantitative Real-Time Polymerase Chain Reaction Data

    PubMed Central

    Chen, Ping

    2015-01-01

    Abstract Polymerase chain reaction (PCR) is a laboratory procedure to amplify and simultaneously quantify targeted DNA molecules, and then detect the product of the reaction at the end of all the amplification cycles. A more modern technique, real-time PCR, also known as quantitative PCR (qPCR), detects the product after each cycle of the progressing reaction by applying a specific fluorescence technique. The quantitative methods currently used to analyze qPCR data result in varying levels of estimation quality. This study compares the accuracy and precision of the estimation achieved by eight different models when applied to the same qPCR dataset. Also, the study evaluates a newly introduced data preprocessing approach, the taking-the-difference approach, and compares it to the currently used approach of subtracting the background fluorescence. The taking-the-difference method subtracts the fluorescence in the former cycle from that in the latter cycle to avoid estimating the background fluorescence. The results obtained from the eight models show that taking-the-difference is a better way to preprocess qPCR data compared to the original approach because of a reduction in the background estimation error. The results also show that weighted models are better than non-weighted models, and that the precision of the estimation achieved by the mixed models is slightly better than that achieved by the linear regression models. PMID:26204477

  6. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay.

    PubMed

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J

    1993-05-01

    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  7. Utility of Real-Time Quantitative Polymerase Chain Reaction in Detecting Mycobacterium tuberculosis

    PubMed Central

    Zhang, Mingxin; Zhang, Hui

    2017-01-01

    This study aimed to assess the value of real-time quantitative polymerase chain reaction (RT-qPCR) for the detection of Mycobacterium tuberculosis (MTB). Samples from 192 patients with suspected MTB were examined by RT-qPCR and an improved Löwenstein–Jensen (L-J) culture method. To evaluate the diagnostic usefulness of RT-qPCR in detecting MTB, a receiver operating characteristic (ROC) curve for RT-qPCR was generated, and the area under the curve (AUC) as well as a cutoff value was calculated. Using the L-J culture method as the gold standard, accuracy of the RT-qPCR method for detecting MTB was 92.7%, with sensitivity and specificity of 62.5% and 97.02%, respectively. In comparison with the improved L-J culture method, the AUC of RT-qPCR ROC curve was 0.957, which was statistically significant (p < 0.001). The Youden Index reached the maximum value (0.88) for gene copy number of 794.5 IU/mL, which was used as the cutoff value. RT-qPCR detection of MTB yielded results consistent with those of the improved L-J culture method, with high accuracy. RT-qPCR may be used as an auxiliary method for etiological diagnosis of tuberculosis. PMID:28168192

  8. A reverse transcriptase-polymerase chain reaction assay for detecting Highlands J virus.

    PubMed

    Whitehouse, C A; Guibeau, A; McGuire, D; Takeda, T; Mather, T N

    2001-01-01

    Highlands J (HJ) virus is an arbovirus frequently recovered at high rates in mosquitoes collected in the eastern United States. HJ virus is primarily a veterinary pathogen causing disease in domestic birds including turkeys, chickens, and partridges. It has an enzootic cycle similar to eastern equine encephalitis (EEE) virus and is often used as an indicator species in EEE surveillance programs. Current immunologic techniques to identify HJ virus are often inefficient and can involve cross-reactivity of antibodies. Therefore, we developed a molecular-based assay by a reverse transcriptase (RT)-polymerase chain reaction (PCR) technique. Primers were constructed from conserved sequences of the E1 coding region from 19 strains of HJ virus. PCR amplifications from serial dilutions of HJ virus-infected Vero cell culture supernatants indicated that this assay could detect viral RNA at concentrations of 10 plaque-forming units per reaction. Extracted RNAs from western equine encephalitis, EEE, LaCrosse, and Jamestown Canyon viruses were not detected with this assay. RNA extracted directly from the brain tissue of a dead house sparrow and from a pool of Culiseta mosquitoes yielded a PCR product of the expected size. The RT-PCR technique developed was both sensitive and specific for detecting HJ virus from infected cell culture supernatants, bird brain tissues, and mosquitoes. This new assay will permit rapid and accurate diagnosis of HJ virus, both enhancing surveillance activities for EEE transmission risk and monitoring infections in domestic poultry and wild birds.

  9. Polymerase chain reaction-restriction fragment length polymorphism authentication of raw meats from game birds.

    PubMed

    Rojas, María; González, Isabel; Fajardo, Violeta; Martín, Irene; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2008-01-01

    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis has been applied to the identification of meats from quail (Coturnix coturnix), pheasant (Phasianus colchicus), red-legged partridge (Alectoris rufa), guinea fowl (Numida meleagris), capercaillie (Tetrao urogallus), Eurasian woodcock (Scolopax rusticola), woodpigeon (Columba palumbus), and song thrush (Turdus philomelos). PCR amplification was performed using a set of primers flanking a conserved region of approximately 720 base pairs (bp) from the mitochondrial 12S rRNA gene. Restriction site analysis based on sequence data from this DNA fragment permitted the selection of AluI and BfaI endonucleases for species identification. The restriction profiles obtained when amplicons were digested with the chosen enzymes allowed the unequivocal identification of all game bird species analyzed. However, the use of the PCR-RFLP technique described is limited to raw meat authentication. It is not suitable for cooked products because thermal treatment strongly accelerates DNA degradation leading to difficulties in amplifying the 720 bp fragment.

  10. Rapid diagnosis of scrub typhus in rural Thailand using polymerase chain reaction.

    PubMed

    Sonthayanon, Piengchan; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Blacksell, Stuart D; Pimda, Kriangsak; Suputtamongkol, Yupin; Pukrittayakamee, Sasithon; White, Nicholas J; Day, Nicholas P; Peacock, Sharon J

    2006-12-01

    The aim of this study was to evaluate the use of polymerase chain reaction (PCR) amplification of the O. tsutsugamushi 16S rRNA gene for the diagnosis of scrub typhus in rural Thailand. A prospective study of acute febrile illness in Udon Thani, northeast Thailand, identified 183 patients as having scrub typhus on the basis of immunofluorescent antibody testing (IFA) of paired sera. A further 366 febrile patients admitted concurrently with a range of other diagnoses acted as negative controls. Diagnostic sensitivity and specificity of 16S rRNA PCR was 44.8% and 99.7%, respectively, compared with IFA. PCR positivity was related to duration of symptoms and presence of eschar (P < 0.001, both cases). PCR using primers to amplify a fragment of the 56-kd gene had a sensitivity and specificity of 29.0% and 99.2%, respectively. PCR has a high specificity but low sensitivity for the rapid diagnosis of scrub typhus in this endemic setting.

  11. Confirmation of presumptive Salmonella colonies contaminated with Proteus swarming using the polymerase chain reaction (PCR) method.

    PubMed

    Gutiérrez Rojo, Rosalba; Torres Chavolla, Edith

    2007-01-01

    In Mexico, zero tolerance regulation is practiced regarding Salmonella in food products. the presence of which is verified by the procedure described in NOM 114-SSA-1994. During the period between August 2002 and March 2003, 245 food samples were tested using this procedure in the Central Laboratories of the Department of Health for the State of Jalisco (CEESLAB). Of these 245 samples, 35 showed presumptive colonies contaminated with Proteus swarm cells even after selective isolation. These swarm cells make Salmonella recovery and biochemical identification difficult due to the occurance of atypical biochemical profiles which generally correspond to that of Proteus. Out of the 35 samples contaminated with Proteus, 65 presumptive colonies were isolated. These colonies were analyzed using both normative microbiological method and Polymerase Chain Reaction (PCR). The PCR method detected two positive samples while normative microbiological method was not able to identify. In order to determine the extent of interference of Proteus swarming on the Salmonella-specific PCR band amplification, Salmonella ser. Typhimurium was grown in the presence of Proteus swarming. These results show that Proteus swarming did not interfere with Salmonella PCR-amplification, although the appearance of Sanlmonella was altered such that the black precipitate was no observed in the presence of Proteus swarming. Ours result indicate that the PCR method used in this study may be successfully applied to confirm presumptive Salmnonella colonies contaminated with Proteus swarming.

  12. Polymerase chain reaction–based assays for the diagnosis of human brucellosis

    PubMed Central

    2014-01-01

    Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed. PMID:25082566

  13. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    NASA Astrophysics Data System (ADS)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  14. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA.

    PubMed

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong

    2012-04-06

    Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  15. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification

    SciTech Connect

    Zietkiewicz, E.; Labuda, D. ); Rafalski, A. )

    1994-03-15

    Simple sequence repeats (SSR), or microsatellites, are ubiquitous in eukaryotic genomes. Here the authors demonstrate the utility of microsatellite-directed DNA fingerprinting by polymerase chain reaction (PCR) amplification of the interrepeat region. No sequencing is required to design the oligonucleotide primers. They tested primers anchored at 3[prime] or 5[prime] termini of the (A)[sub n] repeats, extended into the flanking sequence by 2 to 4 nucleotide residues [3[prime]-anchored primers: (CA)[sub 8]RG, (CA)[sub 8]RY, and (CA)[sub 7]RTCY; and 5[prime]-anchored primers: BDB(CA)[sub 7]C, DBDA(CA)[sub 7], VHVG(TG)[sub 7] and HVH(TG)[sub 7]T]. Radioactively labeled amplification products were analyzed by electrophoresis, revealing information on multiple genomic loci in a single gel lane. Complex, species-specific patterns were obtained from a variety of eukaryotic taxa. Intraspecies polymorphisms were also observed and shown to segregate as Mendelian markers. Inter-SSR PCR provides a novel fingerprinting approach applicable for taxonomic and phylogenetic comparisons and as a mapping tool in a wide range of organisms. This application of (CA)[sub n] repeats may be extended to different microsatellites and other common dispersed elements. 24 refs., 6 figs.

  16. Cell-based polymerase chain reaction for canine transmissible venereal tumor (CTVT) diagnosis

    PubMed Central

    SETTHAWONGSIN, Chanokchon; TECHANGAMSUWAN, Somporn; TANGKAWATTANA, Sirikachorn; RUNGSIPIPAT, Anudep

    2016-01-01

    Canine transmissible venereal tumor (CTVT) is the only naturally contagious tumor that is transmitted during coitus or social behaviors. Based on the tumor’s location, the diagnosis of genital TVT (GTVT) is comparably easier than those in the extragenital area (ETVT) that are more easily incorrectly diagnosed. Fortunately, CTVT cells contain a specific long interspersed nuclear elements (LINE), inserted upstream of the myc gene, allowing a diagnostic polymerase chain reaction (PCR) based detection assay. The objectives of this study were aimed to improve the diagnostic accuracy by applying the diagnostic LINE1-c-myc PCR assay and fine needle aspiration (FNA) collection in direct comparison with standard cytological and histopathological analyses. Seventy-four dogs, comprised of 41 and 31 dogs with tumor masses at their external genitalia and extragenital areas (e.g. skin and nasal cavity), respectively, were included in this study. The signalment of these 65 dogs and clinical history of 20 client-owned dogs were collected. Samples were taken by biopsy for both histopathological examination and FNA for cytological examination and diagnostic PCR. The PCR products from 10 apparently CTVT samples were purified and sequenced. Sixty-one CTVT cases were diagnosed by cytological and histological analyses, but 65 were positive by the PCR assay. Overall, the PCR assay improved the accuracy of diagnostic CTVT results, especially for the more difficult ETVT tumors. Moreover, this PCR-based approach can facilitate the decision as to discontinue chemotherapy by discrimination between residual tumor cell masses and fibrotic tissue. PMID:27075116

  17. Detection of Magnaporthe grisea in infested rice seeds using polymerase chain reaction.

    PubMed

    Chadha, S; Gopalakrishna, T

    2006-05-01

    To develop a diagnostic assay based on polymerase chain reaction for the detection of Magnaporthe grisea from infested rice seeds. Primers were designed based on the nucleotide sequence of the mif 23, an infection-specific gene of M. grisea. The primers amplified target DNA from genetically and geographically diverse isolates of the pathogen. The lowest concentration of template DNA that led to amplification was 20 rhog. No PCR product was detected when DNA from other fungi was used, indicating the specificity of the primers. With this PCR based seed assay, M. grisea was detected in rice seedlots with infestation rates as low as 0.2%. The PCR detection of M. grisea is simple, rapid, specific, sensitive and suitable for the routine detection of the pathogen in infested seeds. Introduction of the blast fungus into new areas where it has not been previously recorded could be avoided by the detection of infested seedlots. A PCR-based seed assay could facilitate risk assessment of naturally infested rice seeds; help design management programs and optimize fungicide use.

  18. Polymerase chain reaction-based active surveillance of MRSA in emergency department patients

    PubMed Central

    Seki, Masafumi; Takahashi, Hiroki; Yamamoto, Norihisa; Hamaguchi, Shigeto; Ojima, Masahiro; Hirose, Tomoya; Yoshiya, Kazuhisa; Ogura, Hiroshi; Shimazu, Takeshi; Tomono, Kazunori

    2015-01-01

    Conventional culture methods to detect methicillin-resistant Staphylococcus aureus (MRSA) take a few days, and their sensitivity and usefulness also need to be improved. In this study, active screening was performed using the polymerase chain reaction (PCR) for colonization with MRSA on admission and follow-up surveillance after admission to an emergency department between June 2012 and August 2012, and the backgrounds of PCR and/or culture-method-positive patients were compared. Among 95 patients, 15 (15.8%) patients were positive for MRSA on PCR and/or culture; 6.3% (6/95) of patients were positive on admission, and 9.5% (9/95) became positive during the stay after admission. The major primary diagnoses in MRSA-positive patients were trauma and cerebrovascular diseases. Nine (60%) of 15 patients were MRSA-positive on both PCR and culture, compared with three (20%) of 15 who were PCR-positive but culture-negative. The other three (20%) of 15 patients were PCR-negative but culture-positive. Furthermore, there was a tendency for younger age and shorter stay to be associated with PCR-positive but culture-negative results. These findings suggest that active surveillance with PCR may be highly sensitive and useful for the early diagnosis of MRSA colonization to prevent nosocomial transmission from the emergency department to the regular inpatient wards of the hospital. PMID:25999747

  19. Detecting and Number Counting of Single Engineered Nanoparticles by Digital Particle Polymerase Chain Reaction.

    PubMed

    Paunescu, Daniela; Mora, Carlos A; Querci, Lorenzo; Heckel, Reinhard; Puddu, Michela; Hattendorf, Bodo; Günther, Detlef; Grass, Robert N

    2015-10-27

    The concentrations of nanoparticles present in colloidal dispersions are usually measured and given in mass concentration (e.g. mg/mL), and number concentrations can only be obtained by making assumptions about nanoparticle size and morphology. Additionally traditional nanoparticle concentration measures are not very sensitive, and only the presence/absence of millions/billions of particles occurring together can be obtained. Here, we describe a method, which not only intrinsically results in number concentrations, but is also sensitive enough to count individual nanoparticles, one by one. To make this possible, the sensitivity of the polymerase chain reaction (PCR) was combined with a binary (=0/1, yes/no) measurement arrangement, binomial statistics and DNA comprising monodisperse silica nanoparticles. With this method, individual tagged particles in the range of 60-250 nm could be detected and counted in drinking water in absolute number, utilizing a standard qPCR device within 1.5 h of measurement time. For comparison, the method was validated with single particle inductively coupled plasma mass spectrometry (sp-ICPMS).

  20. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    PubMed

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; Brito, Cristiana Ferreira Alves de; Carvalho, Luzia Helena

    2014-02-01

    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  1. Polymerase chain reaction in cerebrospinal fluid for the diagnosis of congenital toxoplasmosis.

    PubMed

    Olariu, Tudor R; Remington, Jack S; Montoya, Jose G

    2014-06-01

    Congenital toxoplasmosis can result in visual impairment, hearing loss, serious neurologic sequelae and death in the infant. We studied the potential of the polymerase chain reaction (PCR) in cerebrospinal fluid (CSF) for diagnosis of congenital toxoplasmosis. For this purpose, we studied both congenitally infected (diagnosed clinically and serologically) and noninfected infants born to untreated mothers. The infants ranged in age from 0 to 180 days. CSF PCR was positive in 27 of the 58 (46.5%) congenitally infected infants and was negative in each of the 103 infants without congenital toxoplasmosis. The frequency of positive CSF PCR varied according to whether infants had major clinical signs of the disease; PCR was positive in 70.9%, 53.3% and 50.9% of those with hydrocephalus, cerebral calcifications and/or eye disease, respectively. Of 6 infants who were negative for both IgM and IgA antibodies, 3 had a positive PCR in their CSF as the confirmatory test for diagnosis of congenital toxoplasmosis. IgM and IgA antibodies and CSF PCR, when combined, yielded a higher sensitivity for diagnosis of congenital toxoplasmosis when compared with the performance of each test alone. Our findings reveal that in infants with clinical and serologic findings suggestive of congenital toxoplasmosis and born to untreated mothers, CSF PCR has the potential to increase the frequency of cases in which the diagnosis is confirmed.

  2. Detection of Salmonella sp. in Dermanyssus gallinae using an FTA filter-based polymerase chain reaction.

    PubMed

    Moro, C Valiente; Desloire, S; Chauve, C; Zenner, L

    2007-06-01

    Salmonella spp. bacteria are responsible for some of the most important zoonoses worldwide. Because Dermanyssus gallinae (DeGeer) (Acari: Dermanyssidae) has been recently reported to be an experimental vector of Salmonella Enteritidis, it would be of benefit to evaluate the presence of this bacterium in mites. A molecular detection tool associating a simple filter-based DNA preparation with a specific 16S rDNA Salmonella sp. polymerase chain reaction (PCR) amplification was described. The limit of detection with this method was 2 x 10(4) bacteria per mite. To adapt this technique for large-scale studies, two sizes of mite pools were tested and a preliminary investigation was carried out on mites from 16 currently or previously contaminated farms. Mites sampled from one farm of each type were positive for Salmonella, suggesting that Dermanyssus could act as a reservoir between flocks. In further investigations, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

  3. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis.

    PubMed

    Venazzi, Eneide Aparecida Sabaini; Roberto, Andréa Claudia Bekner Silva; Barbosa-Tessmann, Ione Parra; Zanzarini, Paulo Donizeti; Lonardoni, Maria Valdrinez Campana; Silveira, Thaís Gomes Verzignassi

    2006-06-01

    The objective of this work was to compare the polymerase chain reaction (PCR) using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL). For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6%) presented positive parasite direct search (PD), 81 (51.9%) had positive Montenegro skin test (MST), and 90 (57.7%) presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity), in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482) and inferior to the MST (P = 0.0455), and to the PD/MST association (P = 0.0133). The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  4. Nanostructured biochip for label-free and real-time optical detection of polymerase chain reaction.

    PubMed

    Hiep, Ha Minh; Kerman, Kagan; Endo, Tatsuro; Saito, Masato; Tamiya, Eiichi

    2010-02-19

    In this report, Au-coated nanostructured biochip with functionalized thiolated primers on its surface is developed for label-free and real-time optical detection of polymerase chain reaction (PCR). A PCR chamber of 150 microm in thickness containing Au-coated nanostructured substrate in the bottom layer was bordered with SU-8 100 walls. After immobilization of 5'-thiolated primers on the surface, simultaneous DNA amplification and detection were performed without any labeled molecules via the relative reflected intensity (RRI) of Au-coated nanostructured substrate. When human genomic DNA at several concentrations of 0.2, 0.5 and 1 ng microL(-1) was included in the initial DNA samples, the increases in the RRI peak values were clearly observed with the increasing PCR cycle numbers. We found that the starting point of the optical signal, which was divergent from the background in our PCR biochip, was around 3-4 cycles, much lower than that of the fluorescent real-time PCR analysis (around 23-25 cycles). Our proposed PCR device using Au-coated nanostructured substrate holds noteworthy promise for rapid, label-free and real-time DNA detection for point-of-care testing (POCT) applications.

  5. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses.

    PubMed

    Trinh, Kieu The Loan; Zhang, Hainan; Kang, Dong-Jin; Kahng, Sung-Hyun; Tall, Ben D; Lee, Nae Yoon

    2016-05-01

    We aim to fabricate a thermoplastic poly(methylmethacrylate) (PMMA) Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs) for rapid molecular detection of foodborne pathogen bacteria. A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane) interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

  6. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    PubMed

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

  7. Detection of Leuconostoc strains at a meat processing plant using polymerase chain reaction.

    PubMed

    Goto, Seitaro; Takahashi, Hajime; Kawasaki, Susumu; Kimura, Bon; Fujii, Tateo; Nakatsuji, Miki; Watanabe, Itaru

    2004-02-01

    To simplify the labor-intensive conventional routine testing of samples to detect Leuconostoc at a meat processing plant, we developed polymerase chain reaction (PCR) primers specific for Leuconostoc from 16S rRNA gene sequences. These primers did not detect other common lactic acid bacteria such as Lactobacillus plantarum, Lact. sake, Lact. fermentum, Lact. acidophilus and Weissella viridescens. PCR with this primer detected all Leuconostoc species tested (Leu. mesenteroides subsp. mesenteroides, Leu. pseudomesenteroides, Leu. carnosum, Leu. lactic, Leu. citreum, Leu. amelibiosum, Leu. gelidum), except for Leu. fallax, and no other lactic acid bacteria on agarose gel electrophoresis. The method could identify areas contaminated with Leuconostoc in a large-scale industrial meat processing plant. Of 69 samples analyzed, 34 were positive for Leuconostoc according to the conventional culture method (isolation of LAB producing dextran) and PCR, whereas 29 were negative according to both. Six samples were culture-negative but positive by PCR. No false negative results were generated by PCR. The method is rapid and simple, is useful for routinely monitoring areas contaminated with Leuconostoc in meat processing plants, and could help to prevent the spoilage of meat products.

  8. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    PubMed

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  9. Nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) assay.

    PubMed

    Zhu, Xiao; Zhou, Xiaoming; Xing, Da

    2012-01-15

    Here we have developed a novel nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) strategy for detection of genome. The key idea of this method is integrating the two in situ processes: PCR on the surface of magnetic nanoparticles (MNPs) and magnetic beads based ECL readout platform, to avoid some laborious manual operations and achieve rapid yet sensitive detection. At first, the approach employs a pair of functional primers for amplification: one is tris-(2,2'-bipyridyl) ruthenium (TBR) labeled primer; the other one is nano-magnetic primer which is prepared by attaching the primer to the surfaces of MNPs. With the presence of DNA analyte and PCR mixture, the TBR labeled products are directly loaded and enriched on the surface of MNPs during PCR cycling. Then the MNPs-TBR complexes can be analyzed by a magnetic ECL platform without any post-modification or post-incubation. Finally, we used Listeria monocytogenes as the target to examine these desirable properties of this assay, reaching a detection limit of 500 fg/μL for genome in 1 h. The proposed study has provided the evidence as a proof-of-concept, thus having potential for development of automatic mode for detection of specific gene.

  10. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    PubMed Central

    Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi

    2012-01-01

    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). METHODS: Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. RESULTS: Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. CONCLUSION: We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC. PMID:22851866

  11. Analysis of hepcidin expression: in situ hybridization and quantitative polymerase chain reaction from paraffin sections.

    PubMed

    Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi

    2012-07-28

    To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  12. Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.

    PubMed

    Hamlet, Stephen M

    2010-01-01

    The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.

  13. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  14. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    PubMed Central

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; de Brito, Cristiana Ferreira Alves; Carvalho, Luzia Helena

    2013-01-01

    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur. PMID:24626306

  15. Accuracy of universal polymerase chain reaction (PCR) for detection of bacterial meningitis among suspected patients.

    PubMed

    Moayedi, Ali Reza; Nejatizadeh, Abdolazim; Mohammadian, Maryam; Rahmati, Mohammad Bagher; Namardizadeh, Vahideh

    2015-12-01

    Central nervous system (CNS) infections are life-threatening diseases caused by viral, bacterial, parasitic and fungal microorganisms. The aim of this study was to determine the accuracy of universal polymerase chain reaction (PCR) for the detection of bacterial meningitis among patients who were referred to Koodakan Hospital in Bandar Abbas because they were suspected of having the disease. This study was conducted in 2013 on the patients who were admitted to Bandar Abbas' Koodakan Hospital because they were suspected of having meningitis. A questionnaire, including demographic data, was completed for each patient. Universal PCR, Cerebrospinal fluid (CSF) analysis, and gram staining and cultures were done for all the patients. The data were analyzed using SPSS software. Among the 100 patients studied 59 (59%) were male and 41 (41%) were female. No patient in our study had a positive smear and culture for meningitis. Among the patients with negative smears and cultures six (6%) had positive universal PCR, and 94 (94%) had negative universal PCR. Based on these results, PCR had 95% specificity and 100% negative predictive value for the prediction of meningitis. In 30 patients (30%), the biochemical analysis of CSF were in favor of meningitis. Among the 30 patients, six patients (20%) had positive universal PCR and 24 patients (80%) had negative universal PCR. Based on our results, the universal PCR test is useful in the diagnosis of bacterial meningitis in children. We recommend using it in combination with other tests, such as CSF analysis, for diagnosis of bacterial meningitis.

  16. Intrapartum group B Streptococcus screening using real-time polymerase chain reaction in Japanese population.

    PubMed

    Tanaka, Kei; Iwashita, Mitsutoshi; Matsushima, Miho; Wachi, Yuichi; Izawa, Tomoko; Sakai, Keiji; Kobayashi, Yoichi

    2016-01-01

    The objective of this study was to analyze the diagnostic accuracy of a commercial real-time polymerase chain reaction (PCR) assay for group B streptococcus (GBS) colonization status and to compare results of the intrapartum PCR with the antepartum conventional GBS culture in Japanese pregnant women. This prospective observational study enrolled Japanese pregnant women at 35-37 weeks' gestation. Paired recto-vaginal swabs were obtained for PCR and conventional culture, both at 35-37 weeks' gestation and at admission for delivery. Performance of PCR was analyzed by comparing with the culture results. Furthermore, using the intrapartum culture results as the gold standard, the test of both the antepartum culture and the intrapartum PCR were characterized. We prospectively enrolled 79 pregnant women at 35-37 weeks' gestation, and the intrapartum results were obtained from 73 of those women. The sensitivity of PCR was 86.2%, and concordance rate with the conventional culture was 96.7% overall. Compared with the intrapartum culture, the sensitivity and the specificity of the intrapartum PCR were 83.3% and 98.4%, respectively, while the sensitivity and the specificity of the antepartum culture were 100.0% and 95.1%. The intrapartum real-time PCR assay for GBS screening has the accuracy similar to the antepartum conventional culture method.

  17. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods.

    PubMed

    Morinha, F; Cabral, J A; Bastos, E

    2012-09-01

    Accurate identification of sex in birds is important for the management and conservation of avian wildlife in several ways, namely in the development of population, behavioral and ecological studies, as well as in the improvement of ex situ captive breeding programs. In general, nestlings, juveniles and adult birds of a wide number of sexually monomorphic species cannot be sexed based on phenotypic traits. The development of molecular methodologies for avian sexing overcame these difficulties, allowing a reliable gender differentiation for these species. The polymerase chain reaction (PCR)-based methods have been widely applied in molecular sexing of birds, using a large diversity of sex-linked markers. During the last 15 yrs, there was a continuous improvement in the PCR-based protocols for bird sexing, increasing the accuracy, speed and high-throughput applicability of these techniques. The recent advances in real-time PCR platforms and whole genome analysis methods provided new resources for the detection and analysis of novel specific markers and protocols. This review presents a comparative guide of classical and recent advances in PCR-based methods for avian molecular sexing, highlighting its strengths and limitations. Future research opportunities in this field are also addressed. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    PubMed

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  19. Detecting and resolving position-dependent temperature effects in real-time quantitative polymerase chain reaction.

    PubMed

    von Kanel, Thomas; Gerber, Dominik; Wittwer, Carl T; Hermann, Mark; Gallati, Sabina

    2011-12-15

    Real-time quantitative polymerase chain reaction (qPCR) depends on precise temperature control of the sample during cycling. In the current study, we investigated how temperature variation in plate-based qPCR instruments influences qPCR results. Temperature variation was measured by amplicon melting analysis as a convenient means to assess well-to-well differences. Multiple technical replicates of several SYBR Green I-based qPCR assays allowed correlation of relative well temperature to quantification cycle. We found that inadequate template denaturation results in an inverse correlation and requires increasing the denaturation temperature, adding a DNA destabilizing agent, or pretreating with a restriction enzyme. In contrast, inadequate primer annealing results in a direct correlation and requires lowering the annealing temperature. Significant correlations were found in 18 of 25 assays. The critical nature of temperature-dependent effects was shown in a blinded study of 29 patients for the diagnosis of Prader-Willy and Angelman syndromes, where eight diagnoses were incorrect unless temperature-dependent effects were controlled. A method to detect temperature-dependent effects by pairwise comparisons of replicates in routine experiments is presented and applied. Systematic temperature errors in qPCR instruments can be recognized and their effects eliminated when high precision is required in quantitative genetic diagnostics and critical complementary DNA analyses. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Rapid detection of SAG 926delA mutation using real-time polymerase chain reaction.

    PubMed

    Yoshida, Shigeo; Yamaji, Yoko; Yoshida, Ayako; Ikeda, Yasuhiro; Yamamoto, Ken; Ishibashi, Tatsuro

    2006-12-06

    Mutation 926delA of the arrestin/S-antigen SAG gene is the main cause of Oguchi disease in the Japanese. The purpose of this study was to develop a rapid diagnostic assay to detect mutations in the SAG gene. Two sequence-specific primers and fluorophore-labeled probes for exon 11 of the SAG gene were designed, and the region spanning the mutations was amplified by polymerase chain reaction (PCR) using the LightCycler detection system (Roche Diagnostics, Mannheim, Germany). The mutations were then identified by melting curve analyses of the hybrid formed between the PCR product and a specific fluorescent probe. We clearly distinguished each SAG genotype (homozygous and heterozygous 926delA and wild type) by the distinct melting peaks at different temperatures. One thermal cycling required approximately 54 min to process, and the results were 100% in concordance with the genotypes determined by DNA sequencing. We have succeeded in developing a rapid method to detect the most frequent mutation in the SAG gene. This method will help in identifying gene mutations associated with Oguchi disease with a rapid and reliable identification or the exclusion of the frequent mutations in the SAG gene.

  1. Use of polymerase chain reaction to detect Brucella abortus biovar 1 in infected goats.

    PubMed

    Leal-Klevezas, D S; Martínez-Vázquez, I O; García-Cantú, J; López-Merino, A; Martínez-Soriano, J P

    2000-07-03

    The polymerase chain reaction (PCR) was used to diagnose goat brucellosis and compare its sensitivity against some of the most commonly used serological and bacteriological techniques. Twenty two female and one male out of 300 clinically healthy, mixed-breed goats were randomly chosen from a ranch located at Marín, Nuevo León, Mexico. Milk and blood samples were taken from each animal and used to obtain both microbiological cultures and DNA of the pathogen, and sera was tested against Rose Bengal antigen (RBT). Results showed that 86% of the blood samples were positive on the PCR test, while 60% were positive on the serological test. The pathogen was isolated from only one blood culture. Sixty four percent of the milk samples were positive on PCR tests, but failed to yield bacteria in culture. Biochemical and PCR specific assay demonstrated that Brucella abortus biovar 1 was associated with the infection. This study demonstrates the higher sensitivity of PCR over RBT and blood culture and its potential towards a rapid identification of Brucella strains.

  2. Polymerase chain reaction and real-time PCR for diagnosing of Leishmania infantum chagasi in dogs.

    PubMed

    Ramos, Rafael Antonio do Nascimento; Ramos, Carlos Alberto do Nascimento; Jusi, Márcia Mariza Gomes; de Araújo, Flábio Ribeiro; Machado, Rosangela Zacarias; Faustino, Maria Aparecida da Glória; Alves, Leucio Câmara

    2012-01-01

    The importance of dogs as a reservoir for Leishmania infantumchagasi in urban environments has stimulated numerous studies assessing diagnostic techniques. When performed properly, such procedures are an important step in preventing leishmaniasis in humans. Molecular methods have become prominent for this purpose. The aim of the present study was to determine the performance of the polymerase chain reaction (PCR) and real-time PCR (qPCR) for diagnosing of canine visceral leishmaniasis (CVL) using different biological samples. For this, 35 dogs from an area endemic for CVL were used. Bone marrow aspirate and lymph node and spleen fragments from these dogs were used for the molecular diagnosis. In the present study, qPCR was able to detect a greater number of positive animals than seen with PCR. Among the different biological samples used, there was no significant difference in L. infantumchagasi DNA detection between PCR and qPCR. However, considering that lymph nodes are easy to acquire, these can be considered to be the best samples for making molecular diagnoses of L. infantum chagasi infection.

  3. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    PubMed Central

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction patterns generated with AluI, PacI, and PsiI restriction endonucleases. Results: Variations in the number and size of digested fragments were recorded from treated individuals compared with controls showing that the restriction enzymes created a cut at different locations. In addition, sequences of COII gene from control and treated individuals were also used to confirm the RFLP patterns. From the sequence alignment data, it was found that mutations caused the destruction and generation of restriction sites in the gene sequence of treated individuals. Conclusion: This study indicates that all the three pesticides had potential to induce mutations in the normal sequence of COII gene and also advocates the use of PCR-RFLP assay as an efficient, rapid, and sensitive technique to detect mutagenicity of pesticides. PMID:24403735

  4. Introduction of a dermatophyte polymerase chain reaction assay to the diagnostic mycology service in Scotland.

    PubMed

    Alexander, C L; Shankland, G S; Carman, W; Williams, C

    2011-05-01

    Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  5. Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis.

    PubMed

    Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

    2003-01-01

    To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive.

  6. Use of Polymerase Chain Reaction for Bivalve Pathogen Surveillance in the Yellow Clam Mesodesma mactroides.

    PubMed

    Carvalho, Yuri Bovi Morais; da Silva Santos, Juan Jethro; Raibenberg, Fernando C; Poersch, Luis Henrique; Romano, Luis Alberto

    2016-06-01

    The yellow clam Mesodesma mactroides is a valuable shellfish occurring from the southeastern coast of Brazil to the northern coast of Argentina. Populations of yellow clams are disappearing from their entire range, and the cause is still unknown. The objective of this paper was to search for World Organisation for Animal Health (OIE)-listed pathogens and their relatives in the genera Marteilia, Bonamia, and Perkinsus as well as Mikrocytos mackini and the virus OsHV-1 μ var the yellow clam population in southern Brazil using molecular techniques and classic histology protocols. A total of 180 clams were manually collected in the intertidal region at six sampling points covering the entire coast of Rio Grande do Sul State (length, 622 km) in 2013. Tissue samples were tested by OIE-recommended single-step conventional polymerase chain reaction assays. The screening showed no evidence of the specific sequences of the protistan parasites and viral pathogens at any site within the six zones under study. We recommend continuous monitoring of the mollusks in the region. Received July 3, 2015; accepted February 3, 2016.

  7. Clinical utility of a polymerase chain reaction assay in culture-negative necrotizing otitis externa.

    PubMed

    Gruber, Maayan; Roitman, Ariel; Doweck, Ilana; Uri, Nechama; Shaked-Mishan, Pninit; Kolop-Feldman, Aharon; Cohen-Kerem, Raanan

    2015-04-01

    This study describes a subset of necrotizing otitis externa (NOE) patients with a refractory disease and negative cultures. In these cases, we decided to use a polymerase chain reaction (PCR) assay from surgically obtained tissue under sterile conditions to improve pathogen detection sensitivity. Retrospective case review. Academic medical center. Nineteen consecutive patients diagnosed with NOE between January 2008 and January 2014 inclusive. Three patients of this cohort presented a culture-negative disease. Diagnostic. Positive detection of pathogens using a PCR assay in cases with a complicated course of NOE and clinical resolution of the disease after targeted therapy according to PCR results. Surgical samples were obtained under sterile conditions from three patients with negative cultures and a refractory disease course of NOE. PCR assays were performed using pan-bacteria and pan-fungi protocols. In all three samples, a positive result for a fungal pathogen was recorded and followed by successful empirical targeted therapy. Patients who present with a refractory culture-negative NOE should be suspected as suffering from a fungal disease. The PCR assay may be an important laboratory adjunct in detecting pathogens responsible for NOE and can aid to promote therapy and disease resolution.

  8. Keratinizing odontogenic cyst with verrucous pattern featuring negative human papillomavirus status by polymerase chain reaction.

    PubMed

    Argyris, Prokopios P; Nelson, Andrew C; Koutlas, Ioannis G

    2015-04-01

    Verrucous odontogenic cysts (OCs) are extremely rare. Here, we report the clinicopathologic features of this unusual entity and investigate the role of human papillomavirus (HPV) by p16INK4A immunohistochemistry and HPV-DNA polymerase chain reaction (PCR). A 32-year-old male presented with a 8.3 × 4.0 cm, multilocular radiolucency of the left ascending ramus of the mandible. Microscopically, the cystic cavity was lined by hyperplastic stratified squamous epithelium demonstrating marked verrucous morphology with multiple sharp or blunt projections. Mild dysplastic features were also identified. A final diagnosis of keratinizing OC with verrucous hyperplasia and epithelial dysplasia was rendered. Immunohistochemically, the verrucous OC showed foci of moderate-to-intense and diffuse, nuclear, and cytoplasmic p16INK4A positivity as well as weak or absent p53 immunopositivity in the p16INK4A labeled areas. The Ki-67 expression was increased. Interestingly, HPV-DNA PCR failed to reveal transcriptionally active HPV genotypes. Complete surgical excision was performed, with no recurrences seen during a 66-month follow-up. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    PubMed Central

    Pérez, Lester J.; de Arce, Heidy Díaz

    2009-01-01

    Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

  10. Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction

    PubMed Central

    Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404

  11. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    PubMed

    Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  12. Tissue polymerase chain reaction in diagnosis of intestinal tuberculosis and Crohn's disease.

    PubMed

    Amarapurkar, D N; Patel, N D; Amarapurkar, A D; Agal, S; Baigal, R; Gupte, P

    2004-11-01

    1) To evaluate the utility of PCR in differentiating intestinal tuberculosis from Crohn's disease. 2) To compare histological features of tuberculosis and Crohn's disease. A total of 60 cases of diagnosed intestinal tuberculosis and 20 Crohn's disease were included in the study. Clinical data, radiological and endoscopic findings and response to treatment were taken into consideration. Endoscopic biopsies from affected areas were subjected to histopathological examination and polymerase chain reaction (PCR) assay. Acid fast staining on tissue and culture was done whenever possible. Clinical symptoms, radiological and endoscopic findings were almost similar between intestinal tuberculosis and Crohn's disease. PCR was positive in 21.6% cases of intestinal tuberculosis and 5% Crohn's disease. Nine out of 42 cases (21.4%) without granuloma were also positive by PCR. There was no statistical difference for PCR positivity between patients with intestinal tuberculosis with or without granuloma on histology and also between caseating and non-caseating granuloma. PCR assay showed high specificity (95%) for the diagnosis of intestinal tuberculosis hence may be valuable method to differentiate intestinal tuberculosis from Crohn's disease.

  13. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

    PubMed

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

    2017-06-01

    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  14. Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction.

    PubMed Central

    Szabo, E A; Pemberton, J M; Desmarchelier, P M

    1993-01-01

    The polymerase chain reaction (PCR) was used as the basis for the development of highly sensitive and specific diagnostic tests for organisms harboring botulinum neurotoxin type A through E genes. Synthetic DNA primers were selected from nucleic acid sequence data for Clostridium botulinum neurotoxins. Individual components of the PCR for each serotype (serotypes A through E) were adjusted for optimal amplification of the target fragment. Each PCR assay was tested with organisms expressing each of the botulinum neurotoxin types (types A through G), Clostridium tetani, genetically related nontoxigenic organisms, and unrelated strains. Each assay was specific for the intended target. The PCR reliably identified multiple strains having the same neurotoxin type. The sensitivity of the test was determined with different concentrations of genomic DNA from strains producing each toxin type. As little as 10 fg of DNA (approximately three clostridial cells) was detected. C. botulinum neurotoxin types A, B, and E, which are most commonly associated with human botulism, could be amplified from crude DNA extracts, from vegetative cells, and from spore preparations. This suggests that there is great potential for the PCR in the identification and detection of botulinum neurotoxin-producing strains. Images PMID:8215372

  15. Real-time polymerase chain reaction-based exponential sample amplification for microarray gene expression profiling.

    PubMed

    Nagy, Zsolt B; Kelemen, János Z; Fehér, Liliána Z; Zvara, Agnes; Juhász, Kata; Puskás, László G

    2005-02-01

    Conventional approaches to target labeling for gene expression analysis using microarray technology typically require relatively large amounts of RNA, a serious limitation when the available sample is limited. Here we describe an alternative exponential sample amplification method by using quantitative real-time polymerase chain reaction (QRT-PCR) to follow the amplification and eliminate the overamplified cDNA which could distort the quantitative ratio of the starting mRNA population. Probes generated from nonamplified, PCR-amplified, and real-time-PCR-amplified cDNA samples were generated from lipopolysaccharide-treated and nontreated mouse macrophages and hybridized to mouse cDNA microarrays. Signals obtained from the three protocols were compared. Reproducibility and reliability of the methods were determined. The Pearson correlation coefficients for replica experiments were r=0.927 and r=0.687 for QRT-PCR-amplification and PCR-overamplification protocols, respectively. Chi2 test showed that overamplification resulted in major biases in expression ratios, while these alterations could be eliminated by following the cycling status with QRT-PCR. Our exponential sample amplification protocol preserves the original expression ratios and allows unbiased gene expression analysis from minute amounts of starting material.

  16. Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

    PubMed

    Lo, Yat-Tung; Shaw, Pang-Chui

    2017-10-25

    Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (CT) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  18. Use of the polymerase chain reaction for diagnosing bovine tuberculosis in Panama.

    PubMed

    Cedeño, I; de Obaldía, R; Sanjur, O; Bayard, V; Ortega-Barría, E; Escobar, C

    2005-12-01

    In addition to causing large losses to the cattle industry, Mycobacterium bovis, the causative agent for bovine tuberculosis, is a serious public health issue because it can potentially infect humans. Diagnosis based on isolation and identification of the bacillus is tedious and may take weeks. The diagnosis of M. bovis by polymerase chain reaction (PCR), using species-specific primers, is fast, highly sensitive and of great value in epidemiological studies. In this study, deoxyribonucleic acid (DNA) was extracted from 60 nasal mucus samples collected from three different farms, all located in an area where M. bovis is endemic. Two farms tested negative for an antibody response to the M. tuberculosis purified protein derivative (PPD) antigen, whereas the other farm gave a positive result. The amplified fragment of DNA was 460 base pairs with a sequence similar to that previously reported. Only 5% of the samples from the third farm tested positive for the presence of antibodies against PPD, whereas 65% of samples (from all three farms) gave a positive result when PCR was used. Thus, the authors suggest the use of the PCR species-specific primers test to support the programme against bovine tuberculosis in Panama.

  19. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    PubMed

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  20. Towards dynamic coating of glass microchip chambers for amplifying DNA via the polymerase chain reaction.

    PubMed

    Giordano, B C; Copeland, E R; Landers, J P

    2001-01-01

    As microchip technology evolves to allow for the integration of more complex processes, particularly the polymerase chain reaction (PCR), it will become necessary to define simple approaches for minimizing the effects of surfaces on the chemistry/processes to be performed. We have explored alternatives to silanization of the glass surface with the use of additives that either dynamically coat or adsorb to the glass surface. Polyethylene glycol, polyvinylpyrrolidone (PVP), and hydroxyethylcellulose (HEC) have been explored as potential dynamic coatings and epoxy (poly)dimethylacrylamide (EPDMA) evaluated as an adsorbed coating. By carrying out analysis of the PCR products generated under different conditions via microchip electrophoresis, we demonstrate that these coating agents adequately passivate the glass surface in a manner that prevents interference with the subsequent PCR process. While several of the agents tested allowed for PCR amplification of DNA in glass, the EPDMA was clearly superior with respect to ease of preparation. However, more efficient PCR (larger mass of amplified product) could be obtained by silanizing the glass surface.