Science.gov

Sample records for multiplexed colorimetric solid-phase

  1. Multiplexed Colorimetric Solid-Phase Extraction

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Fritz, James S.; Porter, Marc D.

    2009-01-01

    Multiplexed colorimetric solid-phase extraction (MC-SPE) is an extension of colorimetric solid-phase extraction (C-SPE) an analytical platform that combines colorimetric reagents, solid phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water. In CSPE, analytes are extracted and complexed on the surface of an extraction membrane impregnated with a colorimetric reagent. The analytes are then quantified directly on the membrane surface using a handheld diffuse reflectance spectrophotometer. Importantly, the use of solid-phase extraction membranes as the matrix for impregnation of the colorimetric reagents creates a concentration factor that enables the detection of low concentrations of analytes in small sample volumes. In extending C-SPE to a multiplexed format, a filter holder that incorporates discrete analysis channels and a jig that facilitates the concurrent operation of multiple sample syringes have been designed, enabling the simultaneous determination of multiple analytes. Separate, single analyte membranes, placed in a readout cartridge create unique, analyte-specific addresses at the exit of each channel. Following sample exposure, the diffuse reflectance spectrum of each address is collected serially and the Kubelka-Munk function is used to quantify each water quality parameter via calibration curves. In a demonstration, MC-SPE was used to measure the pH of a sample and quantitate Ag(I) and Ni(II).

  2. Colorimetric Solid-Phase Extractor

    NASA Technical Reports Server (NTRS)

    2003-01-01

    The heart of a colorimetric solid phase extractor (CSPE) test kit quickly measures the concentration of the biocides silver or iodine in astronauts' drinking water to determine whether concentrations are safe. When 10 milliliters (ml) of water is drawn through the disk, the disk will turn color (yellow in this picture for iodine) indicating the presence of the biocides. The device could someday be used to test water safety at reservoirs and water treatment plants on Earth. (photo credit: Microanalytical Instrumentation Center, Iowa State University).

  3. Development of colorimetric solid phase extraction (C-SPE) for in-flight monitoring of spacecraft water supplies

    NASA Astrophysics Data System (ADS)

    Gazda, Daniel Bryan

    2004-12-01

    Colorimetric solid phase extraction (C-SPE) is a sorption-spectrophotometric technique that combines colorimetric reagents, solid phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water samples. In C-SPE, a syringe is used to meter a known volume of sample through a membrane impregnated with a selective colorimetric reagent along with any additives required to optimize the complexation of the reagent and analyte. As the sample is passed through the membrane, analytes are extracted and complexed, leading to a detectable change in the optical characteristics of the membrane. The analyte-reagent complex is then quantified directly on the membrane, using a hand-held diffuse reflectance spectrophotometer. This dissertation focuses on the development, ground testing, and microgravity flight demonstration of C-SPE methods to meet the near- and long-term water quality monitoring needs of NASA. To this end, the ability of C-SPE to function in a microgravity environment was tested through performance evaluations of methods for the determination of the biocidal agents silver(I) and iodine on the KC-135 microgravity simulator. The biocidal iodine platform was investigated further to determine which iodine species is responsible for the C-SPE signal. Through systematic comparisons of C-SPE results and UV-Visible absorbance studies it was determined that biocidally active I2 is the iodine species complexed by poly(vinylpyrrolidone). The application of C-SPE to additional target water quality parameters is demonstrated through the determination of nickel(II), a metal leachate found in archived water samples from the International Space Station, using dimethylglyoxime. This method introduced a new variation of C-SPE, the quantification of trace analytes based on the collection of an insoluble, colored precipitate. The nickel(II) method was then combined with the method for biocidal silver(I) and a new method to measure sample pH to create a

  4. A rapid, simple method for determining formaldehyde in drinking water using colorimetric-solid phase extraction.

    PubMed

    Hill, April A; Lipert, Robert J; Fritz, James S; Porter, Marc D

    2009-02-15

    Formaldehyde has been detected in drinking water supplies across the globe and on board NASA spacecraft. A rapid, simple, microgravity-compatible technique for measuring this contaminant in water supplies using colorimetric-solid phase extraction (C-SPE) is described. This method involves collecting a water sample into a syringe by passage through a cartridge that contains sodium hydroxide, to adjust pH, and Purpald, which is a well-established colorimetric reagent for aldehydes. After completing the reaction in the syringe by agitating for 2 min on a shaker at 400 rpm, the 1.0-mL alkaline sample is passed through an extraction disk that retains the purple product. The amount of concentrated product is then measured on-disk using diffuse reflectance spectroscopy, and compared to a calibration plot generated from Kubelka-Munk transformations of the reflectance data at 700 nm to determine the formaldehyde concentration. This method is capable of determining formaldehyde concentrations from 0.08 to 20 ppm with a total work-up time of less than 3 min using only 1-mL samples.

  5. Colorimetric Solid Phase Extraction (CSPE): Using Color to Monitor Spacecraft Water Quality

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Nolan, Daniel J.; Rutz, Jeffrey A.; Schultz, John R.; Siperko, Lorraine M.; Porter, Marc D.; Lipert, Robert J.; Flint, Stephanie M.; McCoy, J. Torin

    2010-01-01

    In August 2009, an experimental water quality monitoring kit based on Colorimetric Solid Phase Extraction (CSPE) technology was delivered to the International Space Station (ISS). The kit, called the Colorimetric Water Quality Monitoring Kit (CWQMK), was launched as a Station Development Test Objective (SDTO) experiment to evaluate the suitability of CSPE technology for routine use monitoring water quality on the ISS. CSPE is a sorption-spectrophotometric technique that combines colorimetric reagents, solid-phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water samples. In CSPE, a known volume of sample is metered through a membrane disk that has been impregnated with an analyte-specific colorimetric reagent and any additives required to optimize the formation of the analyte-reagent complex. As the sample flows through the membrane disk, the target analyte is selectively extracted, concentrated, and complexed. Formation of the analyte-reagent complex causes a detectable change in the color of the membrane disk that is proportional to the amount of analyte present in the sample. The analyte is then quantified by measuring the color of the membrane disk surface using a hand-held diffuse reflectance spectrophotometer (DRS). The CWQMK provides the capability to measure the ionic silver (Ag +) and molecular iodine (I2) in water samples on-orbit. These analytes were selected for the evaluation of CSPE technology because they are the biocides used in the potable water storage and distribution systems on the ISS. Biocides are added to the potable water systems on spacecraft to inhibit microbial growth. On the United States (US) segment of the ISS molecular iodine serves as the biocide, while the Russian space agency utilizes silver as a biocide in their systems. In both cases, the biocides must be maintained at a level sufficient to control bacterial growth, but low enough to avoid any negative effects on crew health. For example, the

  6. Colorimetric Solid Phase Extraction for the Measurement of Total I (Iodine, Iodide, and Triiodide) in Spacecraft Drinking Water

    NASA Technical Reports Server (NTRS)

    Lipert, Robert J.; Porter, Marc D.; Siperko, Lorraine M.; Gazda, Daniel B.; Rutz, Jeff A.; Schultz, John R.; Carrizales, Stephanie M.; McCoy, J. Torin

    2009-01-01

    An experimental drinking water monitoring kit for the measurement of iodine and silver(I) was recently delivered to the International Space Station (ISS). The kit is based on Colorimetric Solid Phase Extraction (CSPE) technology, which measures the change in diffuse reflectance of indicator disks following exposure to a water sample. To satisfy additional spacecraft water monitoring requirements, CSPE has now been extended to encompass the measurement of total I (iodine, iodide, and triiodide) through the introduction of an oxidizing agent, which converts iodide and triiodide to iodine, for measurement using the same indicator disks currently being tested on ISS. These disks detect iodine, but are insensitive to iodide and triiodide. We report here the operational considerations, design, and ground-based performance of the CSPE method for total I. The results demonstrate that CSPE technology is poised to meet NASA's total I monitoring requirements.

  7. Multiplexed MALDI-MS arrays for screening of MIP solid phase extraction materials.

    PubMed

    Jagadeesan, Kishore Kumar; Wierzbicka, Celina; Laurell, Thomas; Sellergren, Börje; Shinde, Sudhirkumar; Ekström, Simon

    2016-05-15

    Technology that facilitates rapid investigation of solid phase extraction protocols using very small amounts of sorbent can save both time and money. The microfabricated ISET (Integrated Selective Enrichment Target) interfaced with MALDI mass spectrometry is able to provide an efficient, economic and generic optimization process for SPE sample preparation. The SPE is performed in a rapid and parallel fashion, with a processing time off only 2h per ISET with 96 samples. Each of the 96 wells on the ISET can hold 600nL of SPE sorbent. The ability to work with small amounts of sorbent and samples in the ISET platform provides a big advantage when developing affinity sorbents, such as molecularly imprinted polymers (MIPs). Here it is demonstrated that an amount of 25mg phosphoserine imprinted MIP (pS-MIP) sorbent can allow for analysis of more than 500 ISET nanovials using a multitude of different conditions. In the presented case, the multiplexed experiments allowed for early discovery of unspecific interactions and subsequent minimization of these, resulting in a protocol that provided improved enrichment of phosphopeptides.

  8. Colorimetric aptasensor using unmodified gold nanoparticles for homogeneous multiplex detection.

    PubMed

    Niu, Shucao; Lv, Zhenzhen; Liu, Jinchuan; Bai, Wenhui; Yang, Shuming; Chen, Ailiang

    2014-01-01

    Colorimetric aptasensors using unmodified gold nanoparticles (AuNPs) have attracted much attention because of their low cost, simplicity, and practicality, and they have been developed for various targets in the past several years. However, previous research has focused on developing single-target assays. Here, we report the development of a homogeneous multiplex aptasensor by using more than one class of aptamers to stabilize AuNPs. Using sulfadimethoxine (SDM), kanamycin (KAN) and adenosine (ADE) as example targets, a KAN aptamer (750 nM), an SDM aptamer (250 nM) and an ADE aptamer (500 nM) were mixed at a 1∶1∶1 volume ratio and adsorbed directly onto the surface of unmodified AuNPs by electrostatic interaction. Upon the addition of any of the three targets, the conformation of the corresponding aptamer changed from a random coil structure to a rigid folded structure, which could not adsorb and stabilize AuNPs. The AuNPs aggregated in a specific reaction buffer (20 mM Tris-HCl containing 20 mM NaCl and 5 mM KCl), which led to a color change from red to purple/blue. These results demonstrate that the multiplex colorimetric aptasensor detected three targets simultaneously while maintaining the same sensitivity as a single-target aptasensor for each individual target. The multiplex aptasensor could be extended to other aptamers for various molecular detection events. Due to its simple design, easy operation, fast response, cost effectiveness and lack of need for sophisticated instrumentation, the proposed strategy provides a powerful tool to examine large numbers of samples to screen for a small number of potentially positive samples containing more than one analyte, which can be further validated using sophisticated instruments. PMID:25279730

  9. Colorimetric-Solid Phase Extraction Technology for Water Quality Monitoring: Evaluation of C-SPE and Debubbling Methods in Microgravity

    NASA Technical Reports Server (NTRS)

    Hazen-Bosveld, April; Lipert, Robert J.; Nordling, John; Shih, Chien-Ju; Siperko, Lorraine; Porter, Marc D.; Gazda, Daniel B.; Rutz, Jeff A.; Straub, John E.; Schultz, John R.; McCoy, J. Torin

    2007-01-01

    Colorimetric-solid phase extraction (C-SPE) is being developed as a method for in-flight monitoring of spacecraft water quality. C-SPE is based on measuring the change in the diffuse reflectance spectrum of indicator disks following exposure to a water sample. Previous microgravity testing has shown that air bubbles suspended in water samples can cause uncertainty in the volume of liquid passed through the disks, leading to errors in the determination of water quality parameter concentrations. We report here the results of a recent series of C-9 microgravity experiments designed to evaluate manual manipulation as a means to collect bubble-free water samples of specified volumes from water sample bags containing up to 47% air. The effectiveness of manual manipulation was verified by comparing the results from C-SPE analyses of silver(I) and iodine performed in-flight using samples collected and debubbled in microgravity to those performed on-ground using bubble-free samples. The ground and flight results showed excellent agreement, demonstrating that manual manipulation is an effective means for collecting bubble-free water samples in microgravity.

  10. Development of colorimetric solid Phase Extraction (C-SPE) for in-flight Monitoring of spacecraft Water Supplies

    SciTech Connect

    Gazda, Daniel Bryan

    2004-01-01

    Although having recently been extremely successful gathering data on the surface of Mars, robotic missions are not an effective substitute for the insight and knowledge about our solar system that can be gained though first-hand exploration. Earlier this year, President Bush presented a ''new course'' for the U.S. space program that shifts NASA's focus to the development of new manned space vehicles to the return of humans to the moon. Re-establishing the human presence on the moon will eventually lead to humans permanently living and working in space and also serve as a possible launch point for missions into deeper space. There are several obstacles to the realization of these goals, most notably the lack of life support and environmental regeneration and monitoring hardware capable of functioning on long duration spaceflight. In the case of the latter, past experience on the International Space Station (ISS), Mir, and the Space Shuttle has strongly underscored the need to develop broad spectrum in-flight chemical sensors that: (1) meet current environmental monitoring requirements on ISS as well as projected requirements for future missions, and (2) enable the in-situ acquisition and analysis of analytical data in order to further define on-orbit monitoring requirements. Additionally, systems must be designed to account for factors unique to on-orbit deployment such as crew time availability, payload restrictions, material consumption, and effective operation in microgravity. This dissertation focuses on the development, ground testing, and microgravity flight demonstration of Colorimetric Solid Phase Extraction (C-SPE) as a candidate technology to meet the near- and long-term water quality monitoring needs of NASA. The introduction will elaborate further on the operational and design requirements for on-orbit water quality monitoring systems by discussing some of the characteristics of an ''ideal'' system. A description of C-SPE and how the individual

  11. How can we reduce costs of solid-phase multiplex-bead assays used to determine anti-HLA antibodies?

    PubMed

    Kamburova, E G; Wisse, B W; Joosten, I; Allebes, W A; van der Meer, A; Hilbrands, L B; Baas, M C; Spierings, E; Hack, C E; van Reekum, F E; van Zuilen, A D; Verhaar, M; Bots, M L; Drop, A C A D; Plaisier, L; Seelen, M A J; Sanders, J S F; Hepkema, B G; Lambeck, A J; Bungener, L B; Roozendaal, C; Tilanus, M G J; Vanderlocht, J; Voorter, C E; Wieten, L; van Duijnhoven, E M; Gelens, M; Christiaans, M H L; van Ittersum, F J; Nurmohamed, A; Lardy, N M; Swelsen, W; van der Pant, K A; van der Weerd, N C; Ten Berge, I J M; Bemelman, F J; Hoitsma, A; van der Boog, P J M; de Fijter, J W; Betjes, M G H; Heidt, S; Roelen, D L; Claas, F H; Otten, H G

    2016-09-01

    Solid-phase multiplex-bead assays are widely used in transplantation to detect anti-human leukocyte antigen (HLA) antibodies. These assays enable high resolution detection of low levels of HLA antibodies. However, multiplex-bead assays are costly and yield variable measurements that limit the comparison of results between laboratories. In the context of a Dutch national Consortium study we aimed to determine the inter-assay and inter-machine variability of multiplex-bead assays, and we assessed how to reduce the assay reagents costs. Fifteen sera containing a variety of HLA antibodies were used yielding in total 7092 median fluorescence intensities (MFI) values. The inter-assay and inter-machine mean absolute relative differences (MARD) of the screening assay were 12% and 13%, respectively. The single antigen bead (SAB) inter-assay MARD was comparable, but showed a higher lot-to-lot variability. Reduction of screening assay reagents to 50% or 40% of manufacturers' recommendations resulted in MFI values comparable to 100% of the reagents, with an MARD of 12% or 14%, respectively. The MARD of the 50% and 40% SAB assay reagent reductions were 11% and 22%, respectively. From this study, we conclude that the reagents can be reliably reduced at least to 50% of manufacturers' recommendations with virtually no differences in HLA antibody assignments.

  12. How can we reduce costs of solid-phase multiplex-bead assays used to determine anti-HLA antibodies?

    PubMed

    Kamburova, E G; Wisse, B W; Joosten, I; Allebes, W A; van der Meer, A; Hilbrands, L B; Baas, M C; Spierings, E; Hack, C E; van Reekum, F E; van Zuilen, A D; Verhaar, M; Bots, M L; Drop, A C A D; Plaisier, L; Seelen, M A J; Sanders, J S F; Hepkema, B G; Lambeck, A J; Bungener, L B; Roozendaal, C; Tilanus, M G J; Vanderlocht, J; Voorter, C E; Wieten, L; van Duijnhoven, E M; Gelens, M; Christiaans, M H L; van Ittersum, F J; Nurmohamed, A; Lardy, N M; Swelsen, W; van der Pant, K A; van der Weerd, N C; Ten Berge, I J M; Bemelman, F J; Hoitsma, A; van der Boog, P J M; de Fijter, J W; Betjes, M G H; Heidt, S; Roelen, D L; Claas, F H; Otten, H G

    2016-09-01

    Solid-phase multiplex-bead assays are widely used in transplantation to detect anti-human leukocyte antigen (HLA) antibodies. These assays enable high resolution detection of low levels of HLA antibodies. However, multiplex-bead assays are costly and yield variable measurements that limit the comparison of results between laboratories. In the context of a Dutch national Consortium study we aimed to determine the inter-assay and inter-machine variability of multiplex-bead assays, and we assessed how to reduce the assay reagents costs. Fifteen sera containing a variety of HLA antibodies were used yielding in total 7092 median fluorescence intensities (MFI) values. The inter-assay and inter-machine mean absolute relative differences (MARD) of the screening assay were 12% and 13%, respectively. The single antigen bead (SAB) inter-assay MARD was comparable, but showed a higher lot-to-lot variability. Reduction of screening assay reagents to 50% or 40% of manufacturers' recommendations resulted in MFI values comparable to 100% of the reagents, with an MARD of 12% or 14%, respectively. The MARD of the 50% and 40% SAB assay reagent reductions were 11% and 22%, respectively. From this study, we conclude that the reagents can be reliably reduced at least to 50% of manufacturers' recommendations with virtually no differences in HLA antibody assignments. PMID:27534609

  13. Comprehensive Assessment and Standardization of Solid Phase Multiplex-Bead Arrays for the Detection of Antibodies to HLA

    PubMed Central

    Reed, Elaine F.; Rao, Ping; Zhang, Zilu; Gebel, Howard; Bray, Robert A.; Guleria, Indira; Lunz, John; Mohanakumar, Thalachallour; Nickerson, Peter; Tambur, Anat R.; Zeevi, Adriana; Heeger, Peter S.; Gjertson, David

    2014-01-01

    Solid phase multiplex-bead arrays for the detection and characterization of HLA antibodies provide increased sensitivity and specificity compared to conventional lymphocyte-based assays. Assay variability due to inconsistencies in commercial kits and differences in standard operating procedures hamper comparison of results between laboratories. The Clinical Trials in Organ Transplantation Antibody Core Laboratories investigated sources of assay variation and determined if reproducibility improved through utilization of standard operating procedures, common reagents and normalization algorithms. Ten commercial kits from two manufacturers were assessed in each of seven laboratories using 20 HLA reference sera. Implementation of a standardized (versus a non-standardized) operating procedure greatly reduced MFI variation from 62% to 25%. Although laboratory agreements exceeded 90% (R2), small systematic differences were observed suggesting center specific factors still contribute to variation. MFI varied according to manufacturer, kit, bead type and lot. ROC analyses showed excellent consistency in antibody assignments between manufacturers (AUC>0.9) and suggested optimal cutoffs from 1000–1500 MFI. Global normalization further reduced MFI variation to levels near 20%. Standardization and normalization of solid phase HLA antibody tests will enable comparison of data across laboratories for clinical trials and diagnostic testing. PMID:23763485

  14. Comprehensive assessment and standardization of solid phase multiplex-bead arrays for the detection of antibodies to HLA.

    PubMed

    Reed, E F; Rao, P; Zhang, Z; Gebel, H; Bray, R A; Guleria, I; Lunz, J; Mohanakumar, T; Nickerson, P; Tambur, A R; Zeevi, A; Heeger, P S; Gjertson, D

    2013-07-01

    Solid phase multiplex-bead arrays for the detection and characterization of HLA antibodies provide increased sensitivity and specificity compared to conventional lymphocyte-based assays. Assay variability due to inconsistencies in commercial kits and differences in standard operating procedures (SOP) hamper comparison of results between laboratories. The Clinical Trials in Organ Transplantation Antibody Core Laboratories investigated sources of assay variation and determined if reproducibility improved through utilization of SOP, common reagents and normalization algorithms. Ten commercial kits from two manufacturers were assessed in each of seven laboratories using 20 HLA reference sera. Implementation of a standardized (vs. a nonstandardized) operating procedure greatly reduced MFI variation from 62% to 25%. Although laboratory agreements exceeded 90% (R(2) ), small systematic differences were observed suggesting center specific factors still contribute to variation. MFI varied according to manufacturer, kit, bead type and lot. ROC analyses showed excellent consistency in antibody assignments between manufacturers (AUC > 0.9) and suggested optimal cutoffs from 1000 to 1500 MFI. Global normalization further reduced MFI variation to levels near 20%. Standardization and normalization of solid phase HLA antibody tests will enable comparison of data across laboratories for clinical trials and diagnostic testing.

  15. Application of Colorimetric Solid Phase Extraction (C-SPE) to Monitoring Nickel(II) and Lead(II) in Spacecraft Water Supplies

    NASA Technical Reports Server (NTRS)

    Diaz, Neil C.; Gazda, Daniel B.; Fritz, James S.; Porter, Marc D.; Rutz, Jeff; Mudgett, Paul; Schultz, John

    2004-01-01

    Archived water samples collected on the International Space Station (ISS) and returned to Earth for analysis have, in a few instances, contained trace levels of heavy metals. Building on our previous advances using Colorimetric Solid Phase Extraction (C-SPE) as a biocide monitoring technique, we are devising methods for the low level monitoring of nickel(II), lead(II) and other heavy metals. C-SPE is a sorption-spectrophotometric platform based on the extraction of analytes onto a membrane impregnated with a colorimetric reagent that are then quantified on the surface of the membrane using a diffuse reflectance spectrophotometer. Along these lines, we have determined nickel(II) via complexation with dimethylglyoxime (DMG) and begun to examine the analysis of lead(II) by its reaction with 2,5- dimercapto-1,3,4-thiadiazole (DMTD) and 4-(2- pyridylazo)-resorcinol (PAR). These developments are also extending a new variant of C-SPE in which immobilized reagents are being incorporated into this methodology in order to optimize sample reaction conditions and to introduce the colorimetric reagent. This paper describes the status of our development of these two new methods.

  16. Rapid detection of mitochondrial sequence polymorphisms using multiplex solid-phase fluorescent minisequencing

    SciTech Connect

    Tully, G.; Sullivan, K.M.; Nixon, P.

    1996-05-15

    This work describes a novel method, multiplex solidphase fluorescent minisequencing, for the simultaneous detection of several point mutations and/or small deletions and insertions. The method is applied to the analysis of mitochondrial DNA polymorphisms for the purposes of individual identification. A database of 152 British Caucasians and 103 British Afro-Caribbeans has been constructed, and the probability of a chance match between two unrelated individuals is calculated as 0.054 for Caucasians and 0.026 for Afro-Caribbeans. 36 refs., 4 figs., 2 tabs.

  17. Liquid Metering Centrifuge Sticks (LMCS): A Centrifugal Approach to Metering Known Sample Volumes for Colorimetric Solid Phase Extraction (C-SPE)

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Schultz, John R.; Clarke, Mark S.

    2007-01-01

    Phase separation is one of the most significant obstacles encountered during the development of analytical methods for water quality monitoring in spacecraft environments. Removing air bubbles from water samples prior to analysis is a routine task on earth; however, in the absence of gravity, this routine task becomes extremely difficult. This paper details the development and initial ground testing of liquid metering centrifuge sticks (LMCS), devices designed to collect and meter a known volume of bubble-free water in microgravity. The LMCS uses centrifugal force to eliminate entrapped air and reproducibly meter liquid sample volumes for analysis with Colorimetric Solid Phase Extraction (C-SPE). C-SPE is a sorption-spectrophotometric platform that is being developed as a potential spacecraft water quality monitoring system. C-SPE utilizes solid phase extraction membranes impregnated with analyte-specific colorimetric reagents to concentrate and complex target analytes in spacecraft water samples. The mass of analyte extracted from the water sample is determined using diffuse reflectance (DR) data collected from the membrane surface and an analyte-specific calibration curve. The analyte concentration can then be calculated from the mass of extracted analyte and the volume of the sample analyzed. Previous flight experiments conducted in microgravity conditions aboard the NASA KC-135 aircraft demonstrated that the inability to collect and meter a known volume of water using a syringe was a limiting factor in the accuracy of C-SPE measurements. Herein, results obtained from ground based C-SPE experiments using ionic silver as a test analyte and either the LMCS or syringes for sample metering are compared to evaluate the performance of the LMCS. These results indicate very good agreement between the two sample metering methods and clearly illustrate the potential of utilizing centrifugal forces to achieve phase separation and metering of water samples in microgravity.

  18. In-Flight Water Quality Monitoring on the International Space Station (ISS): Measuring Biocide Concentrations with Colorimetric Solid Phase Extraction (CSPE)

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Schultz, John R.; Siperko, Lorraine M.; Porter, Marc D.; Lipert, Robert J.; Flint, Stephanie M.; McCoy, J. Torin

    2011-01-01

    The colorimetric water quality monitoring kit (CWQMK) was delivered to the International Space Station (ISS) on STS-128/17A and was initially deployed in September 2009. The kit was flown as a station development test objective (SDTO) experiment to evaluate the acceptability of colorimetric solid phase extraction (CSPE) technology for routine water quality monitoring on the ISS. During the SDTO experiment, water samples from the U.S. water processor assembly (WPA), the U.S. potable water dispenser (PWD), and the Russian system for dispensing ground-supplied water (SVO-ZV) were collected and analyzed with the CWQMK. Samples from the U.S. segment of the ISS were analyzed for molecular iodine, which is the biocide added to water in the WPA. Samples from the SVOZV system were analyzed for ionic silver, the biocide used on the Russian segment of the ISS. In all, thirteen in-flight analysis sessions were completed as part of the SDTO experiment. This paper provides an overview of the experiment and reports the results obtained with the CWQMK. The forward plan for certifying the CWQMK as operational hardware and expanding the capabilities of the kit are also discussed.

  19. Ligand-free gold nanoparticles as colorimetric probes for the non-destructive determination of total dithiocarbamate pesticides after solid phase extraction.

    PubMed

    Giannoulis, Kyriakos M; Giokas, Dimosthenis L; Tsogas, George Z; Vlessidis, Athanasios G

    2014-02-01

    In this work, we describe a simple and sensitive non-destructive method for the determination of the total concentration of dithiocarbamate fungicides (DTCs) in real samples. The proposed method combines for the first time the benefits of an extraction method for sample clean-up and preconcentration with a sensitive colorimetric assay based on gold nanoparticle probes. In this two-step procedure, the target DTCs are isolated from the matrix and preconcentrated by solid phase extraction onto commercially available C18 sorbents. Following elution, the extract containing the target dithiocarbamates, free from most interferences and matrix components, is delivered into an aqueous dispersion of plain citrate-capped gold nanoparticles (AuNPs) which aggregate in response to DTCs coordination on AuNPs surface through multiple gold thiolate bonds. This aggregation is evidenced by changes in the spectral properties of the solution involving a decrease in the original absorbance of Au nanoparticles at 522 nm and the appearance of a new absorption band above 700 nm. An ensuing chromatic shift of the solution from wine-red to purple-blue is observed which is visual by naked eye at concentrations as low as 50 μg L(-1). Further improvement in the detection limits can be accomplished by scaling-down the method to micro-volume conditions alleviating the need to preconcentrate larger sample volumes. Overall, by combining sample clean-up and preconcentration with the strong affinity of DTC thiol group for the gold surface, the total concentration of dithiocarbamate pesticides was successfully determined in various water samples at the low and ultra-low μg L(-1) levels without resorting to destructive techniques, sophisticated instrumentation or post-synthetic modification of gold nanoparticles. Method application in real samples showed good analytical features in terms of recoveries (81.0-94.0%), precision (5.6-8.9%) and reproducibility (~9%) rendering the method as an attractive

  20. Ligand-free gold nanoparticles as colorimetric probes for the non-destructive determination of total dithiocarbamate pesticides after solid phase extraction.

    PubMed

    Giannoulis, Kyriakos M; Giokas, Dimosthenis L; Tsogas, George Z; Vlessidis, Athanasios G

    2014-02-01

    In this work, we describe a simple and sensitive non-destructive method for the determination of the total concentration of dithiocarbamate fungicides (DTCs) in real samples. The proposed method combines for the first time the benefits of an extraction method for sample clean-up and preconcentration with a sensitive colorimetric assay based on gold nanoparticle probes. In this two-step procedure, the target DTCs are isolated from the matrix and preconcentrated by solid phase extraction onto commercially available C18 sorbents. Following elution, the extract containing the target dithiocarbamates, free from most interferences and matrix components, is delivered into an aqueous dispersion of plain citrate-capped gold nanoparticles (AuNPs) which aggregate in response to DTCs coordination on AuNPs surface through multiple gold thiolate bonds. This aggregation is evidenced by changes in the spectral properties of the solution involving a decrease in the original absorbance of Au nanoparticles at 522 nm and the appearance of a new absorption band above 700 nm. An ensuing chromatic shift of the solution from wine-red to purple-blue is observed which is visual by naked eye at concentrations as low as 50 μg L(-1). Further improvement in the detection limits can be accomplished by scaling-down the method to micro-volume conditions alleviating the need to preconcentrate larger sample volumes. Overall, by combining sample clean-up and preconcentration with the strong affinity of DTC thiol group for the gold surface, the total concentration of dithiocarbamate pesticides was successfully determined in various water samples at the low and ultra-low μg L(-1) levels without resorting to destructive techniques, sophisticated instrumentation or post-synthetic modification of gold nanoparticles. Method application in real samples showed good analytical features in terms of recoveries (81.0-94.0%), precision (5.6-8.9%) and reproducibility (~9%) rendering the method as an attractive

  1. Centrifugal loop-mediated isothermal amplification microdevice for rapid, multiplex and colorimetric foodborne pathogen detection.

    PubMed

    Oh, Seung Jun; Park, Byung Hyun; Jung, Jae Hwan; Choi, Goro; Lee, Doh C; Kim, Do Hyun; Seo, Tae Seok

    2016-01-15

    We present a centrifugal microfluidic device which enables multiplex foodborne pathogen identification by loop-mediated isothermal amplification (LAMP) and colorimetric detection using Eriochrome Black T (EBT). Five identical structures were designed in the centrifugal microfluidic system to perform the genetic analysis of 25 pathogen samples in a high-throughput manner. The sequential loading and aliquoting of the LAMP cocktail, the primer mixtures, and the DNA sample solutions were accomplished by the optimized zigzag-shaped microchannels and RPM control. We targeted three kinds of pathogenic bacteria (Escherichia coli O157:H7, Salmonella typhimurium and Vibrio parahaemolyticus) and detected the amplicons of the LAMP reaction by the EBT-mediated colorimetric method. For the limit-of-detection (LOD) test, we carried out the LAMP reaction on a chip with serially diluted DNA templates of E. coli O157:H7, and could observe the color change with 380 copies. The used primer sets in the LAMP reaction were specific only to the genomic DNA of E. coli O157:H7, enabling the on-chip selective, sensitive, and high-throughput pathogen identification with the naked eyes. The entire process was completed in 60min. Since the proposed microsystem does not require any bulky and expensive instrumentation for end-point detection, our microdevice would be adequate for point-of-care (POC) testing with high simplicity and high speed, providing an advanced genetic analysis microsystem for foodborne pathogen detection.

  2. Development and Certification of Station Development Test Objective (SDTO) Experiment # 15012-U, "Near RealTime Water Quality Monitoring Demonstration for ISS Biocides Using Colorimetric Solid Phase Extraction (CSPE)"

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Nolan, Daniel J.; Rutz, Jeffrey A.; Shcultz, John R.; Siperko, Lorraine M.; Porter, Marc D,; Lipert, Robert J.; Limardo, Jose G.; McCoy, J. Torin

    2009-01-01

    Scientists and engineers from the Wyle Integrated Science and Engineering Group are working with researchers at the University of Utah and Iowa State University to develop and certify an experimental water quality monitoring kit based on Colorimetric Solid Phase Extraction (CSPE). The kit will be launched as a Station Development Test Objective (SDTO) experiment and evaluated on the International Space Station (ISS) to determine the acceptability of CSPE technology for routine inflight water quality monitoring. Iodine and silver, the biocides used in the US and Russian on-orbit water systems, will serve as test analytes for the technology evaluation. This manuscript provides an overview of the CSPE SDTO experiment and details the development and certification of the experimental water quality monitoring kit. Initial results from reagent and standard solution stability testing and environmental testing performed on the kit hardware are also reported.

  3. The Development and Optimization of Techniques for Monitoring Water Quality on-Board Spacecraft Using Colorimetric Solid-Phase Extraction (C-SPE)

    SciTech Connect

    Hill, April Ann

    2007-12-01

    The main focus of this dissertation is the design, development, and ground and microgravity validation of methods for monitoring drinking water quality on-board NASA spacecraft using clorimetric-solid phase extraction (C-SPE). The Introduction will overview the need for in-flight water quality analysis and will detail some of the challenges associated with operations in the absence of gravity. The ability of C-SPE methods to meet these challenges will then be discussed, followed by a literature review on existing applications of C-SPE and similar techniques. Finally, a brief discussion of diffuse reflectance spectroscopy theory, which provides a means for analyte identification and quantification in C-SPE analyses, is presented. Following the Introduction, four research chapters are presented as separate manuscripts. Chapter 1 reports the results from microgravity testing of existing C-SPE methods and procedures aboard NASA's C-9 microgravity simulator. Chapter 2 discusses the development of a C-SPE method for determining the total concentration of biocidal silver (i.e., in both dissolved and colloidal forms) in water samples. Chapter 3 presents the first application of the C-SPE technique to the determination of an organic analyte (i.e., formaldehyde). Chapter 4, which is a departure from the main focus of the thesis, details the results of an investigation into the effect of substrate rotation on the kinetics involved in the antigen and labeling steps in sandwich immunoassays. These research chapters are followed by general conclusions and a prospectus section.

  4. Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA-based detection of three bacterial pathogens.

    PubMed

    Kersting, Sebastian; Rausch, Valentina; Bier, Frank F; von Nickisch-Rosenegk, Markus

    2014-01-01

    We report on the development of an on-chip RPA (recombinase polymerase amplification) with simultaneous multiplex isothermal amplification and detection on a solid surface. The isothermal RPA was applied to amplify specific target sequences from the pathogens Neisseria gonorrhoeae, Salmonella enterica and methicillin-resistant Staphylococcus aureus (MRSA) using genomic DNA. Additionally, a positive plasmid control was established as an internal control. The four targets were amplified simultaneously in a quadruplex reaction. The amplicon is labeled during on-chip RPA by reverse oligonucleotide primers coupled to a fluorophore. Both amplification and spatially resolved signal generation take place on immobilized forward primers bount to expoxy-silanized glass surfaces in a pump-driven hybridization chamber. The combination of microarray technology and sensitive isothermal nucleic acid amplification at 38 °C allows for a multiparameter analysis on a rather small area. The on-chip RPA was characterized in terms of reaction time, sensitivity and inhibitory conditions. A successful enzymatic reaction is completed in <20 min and results in detection limits of 10 colony-forming units for methicillin-resistant Staphylococcus aureus and Salmonella enterica and 100 colony-forming units for Neisseria gonorrhoeae. The results show this method to be useful with respect to point-of-care testing and to enable simplified and miniaturized nucleic acid-based diagnostics. FigureThe combination of multiplex isothermal nucleic acid amplification with RPA and spatially-resolved signal generation on specific immobilized oligonucleotides.

  5. Multiplexed colorimetric detection of Kaposi's sarcoma associated herpesvirus and Bartonella DNA using gold and silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Mancuso, Matthew; Jiang, Li; Cesarman, Ethel; Erickson, David

    2013-01-01

    Kaposi's sarcoma (KS) is an infectious cancer occurring most commonly in human immunodeficiency virus (HIV) positive patients and in endemic regions, such as Sub-Saharan Africa, where KS is among the top four most prevalent cancers. The cause of KS is the Kaposi's sarcoma-associated herpesvirus (KSHV, also called HHV-8), an oncogenic herpesvirus that while routinely diagnosed in developed nations, provides challenges to developing world medical providers and point-of-care detection. A major challenge in the diagnosis of KS is the existence of a number of other diseases with similar clinical presentation and histopathological features, requiring the detection of KSHV in a biopsy sample. In this work we develop an answer to this challenge by creating a multiplexed one-pot detection system for KSHV DNA and DNA from a frequently confounding disease, bacillary angiomatosis. Gold and silver nanoparticle aggregation reactions are tuned for each target and a multi-color change system is developed capable of detecting both targets down to levels between 1 nM and 2 nM. The system developed here could later be integrated with microfluidic sample processing to create a final device capable of solving the two major challenges in point-of-care KS detection.

  6. Directed evolution and solid phase enzyme screening

    NASA Astrophysics Data System (ADS)

    Bylina, Edward J.; Grek, Christina L.; Coleman, William J.; Youvan, Douglas C.

    2000-03-01

    A new digital imaging spectrophotometer and a series of colorimetric solid phase arrays have been developed to screen bacterial libraries expressing mutagenized enzymes undergoing directed evolution. This high-throughput solid- phase array system (known as `Kcat Technology') can detect less than a 20% difference in enzyme rates within microcolonies grown at a nearly confluent density of 500 colonies per cm2 on an assay disk. Each microcolony is analyzed simultaneously at single-pixel resolution (1.5 megapixels; 75 micron/pixel), requiring less than 100 nanoliters of substrate per measurement, a 1000-fold reduction over conventional liquid phase assays. Here we report the successful identification of variants of Agrobacterium (beta) -glucosidase--a glycosidase with broad substrate specificity that favors cleavage of glucosides over galactosides--by simultaneously assaying two different substrates tagged with spectrally distinct chromogenic reporters.

  7. Solid phase extraction membrane

    DOEpatents

    Carlson, Kurt C [Nashville, TN; Langer, Roger L [Hudson, WI

    2002-11-05

    A wet-laid, porous solid phase extraction sheet material that contains both active particles and binder and that possesses excellent wet strength is described. The binder is present in a relatively small amount while the particles are present in a relatively large amount. The sheet material is sufficiently strong and flexible so as to be pleatable so that, for example, it can be used in a cartridge device.

  8. A one-tube multiplexed colorimetric strategy based on plasmonic nanoparticles combined with non-negative matrix factorization.

    PubMed

    Liu, Yizhen; Fang, Wei; Wu, Zitong; Zhou, Guohua; Yi, Wen; Zhou, Xiaodong; Shen, Aiguo; Hu, Jiming

    2014-10-01

    Herein, a one-tube colorimetric platform has been developed for the simultaneous determination of two analytes (DNA as model object) in one tube with picomolar sensitivity. SPR-active nanoparticles are used to encode reporter probes sensitive to oligonucleotides associated with hepatitis A virus Vall7 polyprotein gene (HVA) and hepatitis B virus surface-antigen gene (HVB) respectively and magnetic beads (MBs) serve as the removal tool. In this mixed nanoparticles based biosensor, the addition of target analytes could change the concentration of each nanoparticle, leading to different colors of the supernatant. The influence of spectral overlap has been eliminated by a non-negative matrix factorization (NMF). With the assistance of NMF, the limit of detection (LOD) can be determinated as pM level without amplification. On the whole, this nanosensor boasts the advantages of high sensitivity and low sample consumption. Simultaneous colorimetric detection and quantification of two molecules in one tube are demonstrated. PMID:25059165

  9. A solid phase antibody screen.

    PubMed

    Plapp, F V; Sinor, L T; Rachel, J M; Beck, M L; Coenen, W M; Bayer, W L

    1984-12-01

    An automated solid phase antibody screen (SPAS) in microplates has been developed. Red blood cell (RBC) adherence was used as the end point instead of agglutination. Consequently, positive and negative reactions were readily distinguished by a microplate spectrophotometer. The SPAS performed as well as conventional antiglobulin methods for detecting IgG antibodies in donor sera and had increased sensitivity as determined by serial dilutions of antibodies.

  10. Solid phase microextraction field kit

    DOEpatents

    Nunes, Peter J.; Andresen, Brian D.

    2005-08-16

    A field kit for the collection, isolation and concentration of trace amounts of high explosives (HE), biological weapons (BW) and chemical weapons (CW) residues in air, soil, vegetation, swipe, and liquid samples. The field kit includes a number of Solid Phase Microextraction (SPME) fiber and syringe assemblies in a hermetically sealed transportation container or tubes which includes a sampling port, a number of extra SPME fiber and syringe assemblies, the fiber and syringe assemblies including a protective cap for the fiber, and an extractor for the protective cap, along with other items including spare parts, protective glove, and an instruction manual, all located in an airtight container.

  11. Immunomagnetic separation and solid-phase detection of Bordetella pertussis.

    PubMed Central

    Stark, M; Reizenstein, E; Uhlén, M; Lundeberg, J

    1996-01-01

    In the present study, novel solid-phase methods were used for both sample preparation and PCR detection of Bordetella pertussis. The sample preparation was performed by immunomagnetic separation with paramagnetic beads coated with polyclonal antibodies directed toward the surface antigens of the bacteria. The precoated immunobeads were directly used on nasopharyngeal aspirates to capture the bacteria on the solid support and were subsequently transferred to the PCR tube with no further manipulations. The region encompassing the pertussis toxin promoter was analyzed to allow direct discrimination between the three major Bordetella species (B. pertussis, B. parapertussis, and B. bronchiseptica). The resulting amplicons were captured on a second magnetic solid phase, allowing detection and restriction analysis of the target sequence. A colorimetric detection system based on a DNA binding fusion protein enabled the use of standardized enzyme-linked immunosorbent format tests both for the detection of Bordetella spp. and for species evaluation. When the optimized system was evaluated on 55 clinical aspirate samples, 21 of 22 (95%) culture-positive samples were positive by the system that we developed. In addition, two samples were positive by the PCR-based assay, while the culture assay was negative. The implications of these results are discussed. PMID:8815083

  12. Solid-phase fermentation of sweet sorghum

    SciTech Connect

    Bryan, W.L.; Parrish, R.L.

    1982-12-01

    Solid-phase fermentations of chopped Wray sweet sorghum, (0.6 and 2.5 cm size) occurred in 7-liter fermentors at higher rates than juice fermentations and produced 80% ethanol yields, compared to 73% for juice. Heat loss from fermentors limited maximum temperatures to 38 degrees C. Low ethanol yields may have been caused by natural inhibitors or by thermal inhibition.

  13. Solid-phase fermentation of sweet sorghum

    SciTech Connect

    Bryan, W.L.; Parrish, R.L.

    1982-12-01

    Solid-phase fermentations of chopped Wray sweet sorghum, (0.6 and 2.5 cm size) occurred in 7-liter fermentors at higher rates than juice fermentations and produced 80% ethanol yields, compared to 73% for juice. Heat loss from fermentors limited maximum temperatures to 38/sup 0/C. Low ethanol yields may have been caused by natural inhibitors or by thermal inhibition.

  14. [Solid phase techniques in blood group serology].

    PubMed

    Uthemann, H; Sturmfels, L; Lenhard, V

    1993-06-01

    As alternatives to hemagglutination, solid-phase red blood cell adherence assays are of increasing importance. The adaptation of the new techniques to microplates offers several advantages over hemagglutination. Using microplates the assays may be processed semiautomatically, and the results can be read spectrophotometrically and interpreted by a personal computer. In this paper, different red blood cell adherence assays for AB0 grouping, Rh typing, Rh phenotyping, antibody screening and identification, as well as crossmatching will be described.

  15. Solid-phase synthesis of prenylcysteine analogs

    PubMed Central

    Donelson, James L.; Hodges-Loaiza, Heather B.; Henriksen, Brian S.; Hrycyna, Christine A.

    2009-01-01

    Prenylcysteine derivatives are of interest for a variety of different biological reasons, including probing the CaaX protein processing pathway. A solid-phase synthesis protocol for the preparation of prenylcysteines using 2-chlorotrityl chloride resin as a solid support has been developed. A series of novel amide-modified farnesylcysteine analogs were synthesized in both high purity and yield under mild conditions. The farnesylcysteine analogs were evaluated using human isoprenylcysteine carboxyl methyltransferase (Icmt) as a biological target, and several new inhibitors, one with significantly enhanced potency, were identified. PMID:19320430

  16. β-Galactosidase-based colorimetric paper sensor for determination of heavy metals.

    PubMed

    Hossain, S M Zakir; Brennan, John D

    2011-11-15

    We demonstrate a novel approach for rapid, selective, and sensitive detection of heavy metals using a solid-phase bioactive lab-on-paper sensor that is inkjet printed with sol-gel entrapped reagents to allow colorimetric visualization of the enzymatic activity of β-galactosidase (B-GAL). The bioactive paper assay is able to detect a range of heavy metals, either alone or as mixtures, in as little as 10 min, with detection limits as follows: Hg(II) = 0.001 ppm; Ag(I) = 0.002 ppm, Cu(II) = 0.020 ppm; Cd(II) = 0.020 ppm; Pb(II) = 0.140 ppm; Cr(VI) = 0.150 ppm; Ni(II) = 0.230 ppm. The paper-based assay was immune to interferences from nontoxic metal ions such as Na(+) or K(+), could be used to detect heavy metals that were spiked into tap water or lake water, and provided quantitative data that was in agreement with values obtained by atomic absorption. With the incorporation of standard chromogenic metal sensing reagents into a multiplexed bioactive paper sensor, it was possible to identify specific metals in mixtures, albeit with much lower detection limits than were obtained with the enzymatic assay. The paper-based sensor should be valuable for rapid, on-site screening of trace levels of heavy metals in resource limited areas and developing countries.

  17. Solid phase microextraction device using aerogel

    DOEpatents

    Miller, Fred S.; Andresen, Brian D.

    2005-06-14

    A sample collection substrate of aerogel and/or xerogel materials bound to a support structure is used as a solid phase microextraction (SPME) device. The xerogels and aerogels may be organic or inorganic and doped with metals or other compounds to target specific chemical analytes. The support structure is typically formed of a glass fiber or a metal wire (stainless steel or kovar). The devices are made by applying gel solution to the support structures and drying the solution to form aerogel or xerogel. Aerogel particles may be attached to the wet layer before drying to increase sample collection surface area. These devices are robust, stable in fields of high radiation, and highly effective at collecting gas and liquid samples while maintaining superior mechanical and thermal stability during routine use. Aerogel SPME devices are advantageous for use in GC/MS analyses due to their lack of interfering background and tolerance of GC thermal cycling.

  18. Astronomical observations of solid phase carbon

    NASA Technical Reports Server (NTRS)

    Jura, M.

    1990-01-01

    In the outer envelopes of red giants, when the gas cools sufficiently, molecules and solids form. Thermodynamically, the most stable molecule is CO, and it is usually assumed that all the available carbon and oxygen are consumed in the formation of this molecule (Salpeter 1977). If the carbon abundance is greater than the oxygen abundance, then the carbon left over after the formation of CO is available for solid grains. Because carbon is by far the most abundant species available for making solids in these environments, researchers anticipate that the grains are composed of nearly pure carbon in some form. The observations which can be used to infer the nature of this solid phase carbon are discussed. The observations of the dust around carbon-rich red giants are discussed. These results are then placed into their broader astrophysical context.

  19. Offline solid phase microextraction sampling system

    DOEpatents

    Harvey, Chris A.

    2008-12-16

    An offline solid phase microextraction (SPME) sampling apparatus for enabling SPME samples to be taken a number of times from a previously collected fluid sample (e.g. sample atmosphere) stored in a fused silica lined bottle which keeps volatile organics in the fluid sample stable for weeks at a time. The offline SPME sampling apparatus has a hollow body surrounding a sampling chamber, with multiple ports through which a portion of a previously collected fluid sample may be (a) released into the sampling chamber, (b) SPME sampled to collect analytes for subsequent GC analysis, and (c) flushed/purged using a fluidically connected vacuum source and purging fluid source to prepare the sampling chamber for additional SPME samplings of the same original fluid sample, such as may have been collected in situ from a headspace.

  20. A digital microfluidic interface between solid-phase microextraction and liquid chromatography-mass spectrometry.

    PubMed

    Choi, Kihwan; Boyacı, Ezel; Kim, Jihye; Seale, Brendon; Barrera-Arbelaez, Luis; Pawliszyn, Janusz; Wheeler, Aaron R

    2016-04-29

    We introduce a method to couple solid-phase microextraction (SPME) with HPLC-MS using digital microfluidics (DMF). In the new system, SPME fibers are used to extract analytes from complex sample solutions, after which the analytes are desorbed into solvent droplets in a DMF device. The open geometry of DMF allows straightforward insertion of SPME fibers without requiring a complicated interface, and automated droplet manipulation enables multiplexed processing of the fibers. In contrast to other multiplexed SPME elution interfaces, the low volumes inherent to DMF allow for pre-concentration of analytes prior to analysis. The new SPME-DMF-HPLC-MS method was applied to the quantification of pg/mL-level free steroid hormones in urine. We propose that this new method will be useful for a wide range of applications requiring cleanup and pre-concentration with convenient coupling to high-performance analytical techniques. PMID:27048987

  1. Solvent-assisted dispersive solid phase extraction.

    PubMed

    Jamali, Mohammad Reza; Firouzjah, Ahmad; Rahnama, Reyhaneh

    2013-11-15

    In this research, a novel extraction technique termed solvent-assisted dispersive solid phase extraction (SADSPE) was developed for the first time. The new method was based on the dispersion of the sorbent into the sample to maximize the contact surface. In this method, the dispersion of the sorbent at a very low milligram level was achieved by injecting a solution of the sorbent into the aqueous sample. Thereby, a cloudy solution formed. The cloudy state resulted from the dispersion of the fine particles of the sorbent in the bulk aqueous sample. After extraction, phase separation was performed by centrifugation and the enriched analyte in the sedimented phase could be determined by instrumental methods. The performance of SADSPE was illustrated with the determination of the trace amounts of cobalt(II) as a test analyte in food and environmental water samples by using flame atomic absorption spectrometry detection. Some key parameters for SADSPE, such as sorbent selection and amount, type and volume of dispersive solvent, pH, chelating agent concentration, and salt concentration, were investigated. Under the most favorable conditions, good limit of detection (as low as 0.2 µg L(-1)) and repeatability of extraction (RSD below 2.2%, n=10) was obtained. The accuracy of the method was tested with standard reference material (SRM-1643e and SRM-1640a) and spiked addition. The advantages of SADSPE method are simplicity of operation, rapidity, low cost, high recovery, and enrichment factor. PMID:24148429

  2. Recent developments in solid-phase microextraction.

    PubMed

    Risticevic, Sanja; Niri, Vadoud H; Vuckovic, Dajana; Pawliszyn, Janusz

    2009-02-01

    The main objective of this review is to describe the recent developments in solid-phase microextraction technology in food, environmental and bioanalytical chemistry applications. We briefly introduce the historical perspective on the very early work associated with the development of theoretical principles of SPME, but particular emphasis is placed on the more recent developments in the area of automation, high-throughput analysis, SPME method optimization approaches and construction of new SPME devices and their applications. The area of SPME automation for both GC and LC applications is particularly addressed in this review, as the most recent developments in this field have allowed the use of this technology for high-throughput applications. The development of new autosamplers with SPME compatibility and new-generation metal fibre assemblies has enhanced sample throughput for SPME-GC applications, the latter being attributed to the possibility of using the same fibre for several hundred extraction/injection cycles. For LC applications, high-throughput analysis (>1,000 samples per day) can be achieved for the first time with a multi-SPME autosampler which uses multi-well plate technology and allows SPME sample preparation of up to 96 samples in parallel. The development and evolution of new SPME devices such as needle trap, thin-film microextraction and cold-fibre headspace SPME have offered significant improvements in performance characteristics compared with the conventional fibre-SPME arrangement.

  3. Stable solid-phase Rh antigen.

    PubMed

    Yared, M A; Moise, K J; Rodkey, L S

    1997-12-01

    Numerous investigators have attempted to isolate the Rh antigens in a stable, immunologically reactive form since the discovery of the Rh system over 56 years ago. We report here a successful and reproducible approach to solubilizing and adsorbing the human Rh antigen(s) to a solid-phase matrix in an antigenically active form. Similar results were obtained with rabbit A/D/F red blood cell antigens. The antigen preparation was made by dissolution of the red blood cell membrane lipid followed by fragmentation of the residual cytoskeleton in an EDTA solution at low ionic strength. The antigenic activity of the soluble preparations was labile in standard buffers but was stable in zwitterionic buffers for extended periods of time. Further studies showed that the antigenic activity of these preparations was enhanced, as was their affinity for plastic surfaces, in the presence of acidic zwitterionic buffers. Adherence to plastic surfaces at low pH maintained antigenic reactivity and specificity for antibody was retained. The data show that this approach yields a stable form of antigenically active human Rh D antigen that could be used in a red blood cell-free assay for quantitative analysis of Rh D antibody and for Rh D antibody immunoadsorption and purification.

  4. Rapid determination of ions by combined solid-phase extraction--diffuse reflectance spectroscopy.

    PubMed

    Fritz, James S; Arena, Matteo P; Steiner, Steven A; Porter, Marc D

    2003-05-16

    We introduce colorimetric solid-phase extraction (C-SPE) for the rapid determination of selected ions. This new technique links the exhaustive concentration of an analyte by SPE onto a membrane disk surface for quantitative measurement with a hand-held diffuse reflectance spectrometer. The concentration/measurement procedure is complete in approximately 1 min and can be performed almost anywhere. This method has been used to monitor iodine and iodide in spacecraft water in the 0.1-5.0 ppm range and silver(I) in the range of 5.0-1000 microg/l. Applications to the trace analysis of copper(II), nickel(II), iron(III) and chromium(VI) are described. Studies on the mechanism of extraction showed that impregnation of the disk with a surfactant as well as a complexing reagent results in uptake of additional water, which markedly improves the extraction efficiency.

  5. Rapid determination of ions by combined solid-phase extraction--diffuse reflectance spectroscopy

    NASA Technical Reports Server (NTRS)

    Fritz, James S.; Arena, Matteo P.; Steiner, Steven A.; Porter, Marc D.

    2003-01-01

    We introduce colorimetric solid-phase extraction (C-SPE) for the rapid determination of selected ions. This new technique links the exhaustive concentration of an analyte by SPE onto a membrane disk surface for quantitative measurement with a hand-held diffuse reflectance spectrometer. The concentration/measurement procedure is complete in approximately 1 min and can be performed almost anywhere. This method has been used to monitor iodine and iodide in spacecraft water in the 0.1-5.0 ppm range and silver(I) in the range of 5.0-1000 microg/l. Applications to the trace analysis of copper(II), nickel(II), iron(III) and chromium(VI) are described. Studies on the mechanism of extraction showed that impregnation of the disk with a surfactant as well as a complexing reagent results in uptake of additional water, which markedly improves the extraction efficiency.

  6. A lab-on-a-chip device for rapid identification of avian influenza viral RNA by solid-phase PCR.

    PubMed

    Sun, Yi; Dhumpa, Raghuram; Bang, Dang Duong; Høgberg, Jonas; Handberg, Kurt; Wolff, Anders

    2011-04-21

    The endemic of Avian Influenza Virus (AIV) in Asia and epizootics in some European regions have caused serious economic losses. Multiplex reverse-transcriptase (RT) PCR has been developed to detect and subtype AIV. However, the number of targets that can be amplified in a single run is limited because of uncontrollable primer-primer interferences. In this paper, we describe a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip. A simple UV cross-linking method was used to immobilize the DNA probes on unmodified glass surface, which makes it convenient to integrate microarray with microfluidics. This solid-phase RT-PCR method combined RT amplification of extracted RNA in the liquid phase and species-specific nested PCR on the solid phase. Using the developed approach, AIV viruses and their subtypes were unambiguously identified by the distinct patterns of amplification products. The whole process was reduced to less than 1 hour and the sample volume used in the microfluidic chip was at least 10 times less than in the literature. By spatially separating the primers, highly multiplexed amplification can be performed in solid-phase PCR. Moreover, multiplex PCR and sequence detection were done in one step, which greatly simplified the assay and reduced the processing time. Furthermore, by incorporating the microarray into a microchamber-based PCR chip, the sample and the reagent consumption were greatly reduced, and the problems of bubble formation and solution evaporation were effectively prevented. This microarray-based PCR microchip can be widely employed for virus detection and effective surveillance in wild avian and in poultry productions.

  7. Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

    PubMed

    del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

    2014-04-15

    Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers.

  8. Preparation of Ion Exchange Films for Solid-Phase Spectrophotometry and Solid-Phase Fluorometry

    NASA Technical Reports Server (NTRS)

    Hill, Carol M.; Street, Kenneth W.; Tanner, Stephen P.; Philipp, Warren H.

    2000-01-01

    Atomic spectroscopy has dominated the field of trace inorganic analysis because of its high sensitivity and selectivity. The advantages gained by the atomic spectroscopies come with the disadvantage of expensive and often complicated instrumentation. Solid-phase spectroscopy, in which the analyte is preconcentrated on a solid medium followed by conventional spectrophotometry or fluorometry, requires less expensive instrumentation and has considerable sensitivity and selectivity. The sensitivity gains come from preconcentration and the use of chromophore (or fluorophore) developers and the selectivity is achieved by use of ion exchange conditions that favor the analyte in combination with speciative chromophores. Little work has been done to optimize the ion exchange medium (IEM) associated with these techniques. In this report we present a method for making ion exchange polymer films, which considerably simplify the solid-phase spectroscopic techniques. The polymer consists of formaldehyde-crosslinked polyvinyl alcohol with polyacrylic acid entrapped therein. The films are a carboxylate weak cation exchanger in the calcium form. They are mechanically sturdy and optically transparent in the ultraviolet and visible portion of the spectrum, which makes them suitable for spectrophotometry and fluorometry.

  9. Air sampling with solid phase microextraction

    NASA Astrophysics Data System (ADS)

    Martos, Perry Anthony

    There is an increasing need for simple yet accurate air sampling methods. The acceptance of new air sampling methods requires compatibility with conventional chromatographic equipment, and the new methods have to be environmentally friendly, simple to use, yet with equal, or better, detection limits, accuracy and precision than standard methods. Solid phase microextraction (SPME) satisfies the conditions for new air sampling methods. Analyte detection limits, accuracy and precision of analysis with SPME are typically better than with any conventional air sampling methods. Yet, air sampling with SPME requires no pumps, solvents, is re-usable, extremely simple to use, is completely compatible with current chromatographic equipment, and requires a small capital investment. The first SPME fiber coating used in this study was poly(dimethylsiloxane) (PDMS), a hydrophobic liquid film, to sample a large range of airborne hydrocarbons such as benzene and octane. Quantification without an external calibration procedure is possible with this coating. Well understood are the physical and chemical properties of this coating, which are quite similar to those of the siloxane stationary phase used in capillary columns. The log of analyte distribution coefficients for PDMS are linearly related to chromatographic retention indices and to the inverse of temperature. Therefore, the actual chromatogram from the analysis of the PDMS air sampler will yield the calibration parameters which are used to quantify unknown airborne analyte concentrations (ppb v to ppm v range). The second fiber coating used in this study was PDMS/divinyl benzene (PDMS/DVB) onto which o-(2,3,4,5,6- pentafluorobenzyl) hydroxylamine (PFBHA) was adsorbed for the on-fiber derivatization of gaseous formaldehyde (ppb v range), with and without external calibration. The oxime formed from the reaction can be detected with conventional gas chromatographic detectors. Typical grab sampling times were as small as 5 seconds

  10. Doped colorimetric assay liposomes

    DOEpatents

    Charych, Deborah; Stevens, Raymond C.

    2001-01-01

    The present invention provides compositions comprising colorimetric assay liposomes. The present invention also provides methods for producing colorimetric liposomes and calorimetric liposome assay systems. In preferred embodiments, these calorimetric liposome systems provide high levels of sensitivity through the use of dopant molecules. As these dopants allow the controlled destabilization of the liposome structure, upon exposure of the doped liposomes to analyte(s) of interest, the indicator color change is facilitated and more easily recognized.

  11. Solid-phase techniques in blood transfusion serology.

    PubMed

    Beck, M L; Plapp, F V; Sinor, L T; Rachel, J M

    1986-01-01

    For nearly a century, erythrocyte agglutination has persisted as the most widely used method for the demonstration of antigen-antibody reaction in immunohematology. So far, no other system has been developed which can match its simplicity, versatility, and general reliability. The major disadvantage of agglutination reactions is the lack of an objective endpoint, which has severely hindered attempts to automate routine pretransfusion tests. To overcome this problem, we have designed a series of solid-phase assays for ABO and Rh grouping, antibody screening, compatibility, and hepatitis tests. Each of these solid-phase assays shares a common endpoint of red cell adherence, which is easily interpreted visually or spectrophotometrically. Computer interface permits the automatic interpretation and recording of results. We believe this solid-phase system should finally bring the blood bank laboratory into the age of automation.

  12. Recent Approaches Toward Solid Phase Synthesis of β-Lactams

    NASA Astrophysics Data System (ADS)

    Mandal, Bablee; Ghosh, Pranab; Basu, Basudeb

    Since the discovery of penicillin in 1929, β-lactam antibiotics have been recognized as potentially chemotherapeutic drugs of incomparable effectiveness, conjugating a broad spectrum of activity with very low toxicity. The primary motif azetidin-2-one ring (β-lactam) has been considered as specific pharmacophores and scaffolds. With the advent of combinatorial chemistry and automated parallel synthesis coupled with ample interests from the pharmaceutical industries, recent trends have been driven mostly by adopting solid phase techniques and polymer-supported synthesis of β-lactams. The present survey will present an overview of the developments on the polymer-supported and solid phase techniques for the preparation of β-lactam ring or β-lactam containing antibiotics published over the last decade. Both unsubstituted and substitutions with different functional groups at various positions of β-lactams have been synthesized using solid phase technology. However, Wang resin and application of Staudinger [2+2] cycloaddition reaction have remained hitherto the major choice. It may be expected that other solid phase approaches involving different resins would be developed in the coming years.

  13. Pyrrole-Imidazole Polyamides: Automated Solid-Phase Synthesis.

    PubMed

    Fang, Lijing; Pan, Zhengyin; Cullis, Paul M; Burley, Glenn A; Su, Wu

    2015-01-01

    In this unit, the fully automated solid-phase synthetic strategy of hairpin Py-Im polyamides is described using triphosgene (BTC) as a coupling agent. This automated methodology is compatible with all the typical building blocks, enabling the facile synthesis of polyamide libraries in 9% to 20% yield in 3 days. PMID:26623976

  14. Kinetics of Microbial Reduction of Solid Phase U(VI)

    SciTech Connect

    Liu, Chongxuan; Jeon, Byong Hun; Zachara, John M.; Wang, Zheming; Dohnalkova, Alice; Fredrickson, Jim K.

    2006-10-01

    Sodium boltwoodite (NaUO2SiO3OH ?1.5H2O) was used to assess the kinetics of microbial reduction of solid phase U(VI) by a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1. The bioreduction kinetics was studied with Na-boltwoodite in suspension or within alginate beads. Concentrations of U(VI)tot and cell number were varied to evaluate the coupling of U(VI) dissolution, diffusion, and microbial activity. Batch experiments were performed in a non-growth medium with lactate as electron donor at pH 6.8 buffered with PIPES. Microscopic and spectroscopic analyses with transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and laser-induced fluorescence spectroscopy (LIFS) collectively indicated that solid phase U(VI) was first dissolved and diffused out of grain interiors before it was reduced on bacterial surfaces and/or within the periplasm. The kinetics of solid phase U(VI) bioreduction was well described by a coupled model of bicarbonate-promoted dissolution of Na-boltwoodite, intraparticle uranyl diffusion, and Monod type bioreduction kinetics with respect to dissolved U(VI) concentration. The results demonstrated the intimate coupling of biological, chemical, and physical processes in microbial reduction of solid phase U(VI).

  15. Solid Phase Characterization of Solids Recovered from Failed Sluicer Arm

    SciTech Connect

    Cooke, Gary A.

    2015-03-09

    The Enclosure to this memo discusses the solid phase characterization of a solid sample that was retrieved from the single-shell Tank 241-C-111 extended reach sluicer #2. This sluicer, removed from riser #3 on September 25, 2014, was found to have approximately 0.4 gallons of solid tank waste adhering to the nozzle area.

  16. Solid-phase single molecule biosensing using dual-color colocalization of fluorescent quantum dot nanoprobes

    NASA Astrophysics Data System (ADS)

    Liu, Jianbo; Yang, Xiaohai; Wang, Kemin; Wang, Qing; Liu, Wei; Wang, Dong

    2013-10-01

    The development of solid-phase surface-based single molecule imaging technology has attracted significant interest during the past decades. Here we demonstrate a sandwich hybridization method for highly sensitive detection of a single thrombin protein at a solid-phase surface based on the use of dual-color colocalization of fluorescent quantum dot (QD) nanoprobes. Green QD560-modified thrombin binding aptamer I (QD560-TBA I) were deposited on a positive poly(l-lysine) assembled layer, followed by bovine serum albumin blocking. It allowed the thrombin protein to mediate the binding of the easily detectable red QD650-modified thrombin binding aptamer II (QD650-TBA II) to the QD560-TBA I substrate. Thus, the presence of the target thrombin can be determined based on fluorescent colocalization measurements of the nanoassemblies, without target amplification or probe separation. The detection limit of this assay reached 0.8 pM. This fluorescent colocalization assay has enabled single molecule recognition in a separation-free detection format, and can serve as a sensitive biosensing platform that greatly suppresses the nonspecific adsorption false-positive signal. This method can be extended to other areas such as multiplexed immunoassay, single cell analysis, and real time biomolecule interaction studies.The development of solid-phase surface-based single molecule imaging technology has attracted significant interest during the past decades. Here we demonstrate a sandwich hybridization method for highly sensitive detection of a single thrombin protein at a solid-phase surface based on the use of dual-color colocalization of fluorescent quantum dot (QD) nanoprobes. Green QD560-modified thrombin binding aptamer I (QD560-TBA I) were deposited on a positive poly(l-lysine) assembled layer, followed by bovine serum albumin blocking. It allowed the thrombin protein to mediate the binding of the easily detectable red QD650-modified thrombin binding aptamer II (QD650-TBA II) to

  17. Studies in Solid Phase Peptide Synthesis: A Personal Perspective

    SciTech Connect

    Mitchell, A R

    2007-06-01

    By the early 1970s it had became apparent that the solid phase synthesis of ribonuclease A could not be generalized. Consequently, virtually every aspect of solid phase peptide synthesis (SPPS) was reexamined and improved during the decade of the 1970s. The sensitive detection and elimination of possible side reactions (amino acid insertion, N{sup {alpha}}-trifluoroacetylation, N{sup {alpha}{var_epsilon}}-alkylation) was examined. The quantitation of coupling efficiency in SPPS as a function of chain length was studied. A new and improved support for SPPS, the 'PAM-resin', was prepared and evaluated. These and many other studies from the Merrifield laboratory and elsewhere increased the general acceptance of SPPS leading to the 1984 Nobel Prize in Chemistry for Bruce Merrifield.

  18. Allantoin as a solid phase adsorbent for removing endotoxins.

    PubMed

    Vagenende, Vincent; Ching, Tim-Jang; Chua, Rui-Jing; Gagnon, Pete

    2013-10-01

    In this study we present a simple and robust method for removing endotoxins from protein solutions by using crystals of the small-molecule compound 2,5-dioxo-4-imidazolidinyl urea (allantoin) as a solid phase adsorbent. Allantoin crystalline powder is added to a protein solution at supersaturated concentrations, endotoxins bind and undissolved allantoin crystals with bound endotoxins are removed by filtration or centrifugation. This method removes an average of 99.98% endotoxin for 20 test proteins. The average protein recovery is ∼80%. Endotoxin binding is largely independent of pH, conductivity, reducing agent and various organic solvents. This is consistent with a hydrogen-bond based binding mechanism. Allantoin does not affect protein activity and stability, and the use of allantoin as a solid phase adsorbent provides better endotoxin removal than anion exchange, polymixin affinity and biological affinity methods for endotoxin clearance.

  19. Solid-Phase Biological Assays for Drug Discovery

    NASA Astrophysics Data System (ADS)

    Forsberg, Erica M.; Sicard, Clémence; Brennan, John D.

    2014-06-01

    In the past 30 years, there has been a significant growth in the use of solid-phase assays in the area of drug discovery, with a range of new assays being used for both soluble and membrane-bound targets. In this review, we provide some basic background to typical drug targets and immobilization protocols used in solid-phase biological assays (SPBAs) for drug discovery, with emphasis on particularly labile biomolecular targets such as kinases and membrane-bound receptors, and highlight some of the more recent approaches for producing protein microarrays, bioaffinity columns, and other devices that are central to small molecule screening by SPBA. We then discuss key applications of such assays to identify drug leads, with an emphasis on the screening of mixtures. We conclude by highlighting specific advantages and potential disadvantages of SPBAs, particularly as they relate to particular assay formats.

  20. Clinically relevant interpretation of solid phase assays for HLA antibody

    PubMed Central

    Bettinotti, Maria P.; Zachary, Andrea A.; Leffell, Mary S.

    2016-01-01

    Purpose of review Accurate and timely detection and characterization of human leukocyte antigen (HLA) antibodies are critical for pre-transplant and post-transplant immunological risk assessment. Solid phase immunoassays have provided increased sensitivity and specificity, but test interpretation is not always straightforward. This review will discuss the result interpretation considering technical limitations; assessment of relative antibody strength; and the integration of data for risk stratification from complementary testing and the patient's immunological history. Recent findings Laboratory and clinical studies have provided insight into causes of test failures – false positive reactions because of antibodies to denatured HLA antigens and false negative reactions resulting from test interference and/or loss of native epitopes. Test modifications permit detection of complement-binding antibodies and determination of the IgG subclasses. The high degree of specificity of single antigen solid phase immunoassays has revealed the complexity and clinical relevance of antibodies to HLA-C, HLA-DQ, and HLA-DP antigens. Determination of antibody specificity for HLA epitopes enables identification of incompatible antigens not included in test kits. Summary Detection and characterization of HLA antibodies with solid phase immunoassays has led to increased understanding of the role of those antibodies in graft rejection, improved treatment of antibody-mediated rejection, and increased opportunities for transplantation. However, realization of these benefits requires careful and accurate interpretation of test results. PMID:27200498

  1. Solid-phase synthesis of molecularly imprinted nanoparticles.

    PubMed

    Canfarotta, Francesco; Poma, Alessandro; Guerreiro, Antonio; Piletsky, Sergey

    2016-03-01

    Molecularly imprinted polymers (MIPs) are synthetic materials, generally based on acrylic or methacrylic monomers, that are polymerized in the presence of a specific target molecule called the 'template' and capable of rebinding selectively to this target molecule. They have the potential to be low-cost and robust alternatives to biomolecules such as antibodies and receptors. When prepared by traditional synthetic methods (i.e., with free template in solution), their usefulness has been limited by high binding site heterogeneity, the presence of residual template and the fact that the production methods are complex and difficult to standardize. To overcome some of these limitations, we developed a method for the synthesis of MIP nanoparticles (nanoMIPs) using an innovative solid-phase approach, which relies on the covalent immobilization of the template molecules onto the surface of a solid support (glass beads). The obtained nanoMIPs are virtually free of template and demonstrate high affinity for the target molecule (e.g., melamine and trypsin in our published work). Because of an affinity separation step performed on the solid phase after polymerization, poor binders and unproductive polymer are removed, so the final product has more uniform binding characteristics. The overall protocol, starting from the immobilization of the template onto the solid phase and including the purification and characterization of the nanoparticles, takes up to 1 week.

  2. Solid-phase synthesis of molecularly imprinted nanoparticles.

    PubMed

    Canfarotta, Francesco; Poma, Alessandro; Guerreiro, Antonio; Piletsky, Sergey

    2016-03-01

    Molecularly imprinted polymers (MIPs) are synthetic materials, generally based on acrylic or methacrylic monomers, that are polymerized in the presence of a specific target molecule called the 'template' and capable of rebinding selectively to this target molecule. They have the potential to be low-cost and robust alternatives to biomolecules such as antibodies and receptors. When prepared by traditional synthetic methods (i.e., with free template in solution), their usefulness has been limited by high binding site heterogeneity, the presence of residual template and the fact that the production methods are complex and difficult to standardize. To overcome some of these limitations, we developed a method for the synthesis of MIP nanoparticles (nanoMIPs) using an innovative solid-phase approach, which relies on the covalent immobilization of the template molecules onto the surface of a solid support (glass beads). The obtained nanoMIPs are virtually free of template and demonstrate high affinity for the target molecule (e.g., melamine and trypsin in our published work). Because of an affinity separation step performed on the solid phase after polymerization, poor binders and unproductive polymer are removed, so the final product has more uniform binding characteristics. The overall protocol, starting from the immobilization of the template onto the solid phase and including the purification and characterization of the nanoparticles, takes up to 1 week. PMID:26866789

  3. 40 CFR 227.32 - Liquid, suspended particulate, and solid phases of a material.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... solid phases of a material. 227.32 Section 227.32 Protection of Environment ENVIRONMENTAL PROTECTION... MATERIALS Definitions § 227.32 Liquid, suspended particulate, and solid phases of a material. (a) For the... obtained above prior to centrifugation and filtration. The solid phase includes all material settling...

  4. A comparison of observables for solid-solid phase transitions

    SciTech Connect

    Smilowitz, Laura B; Henson, Bryan F; Romero, Jerry J

    2009-01-01

    The study of solid-solid phase transformations is hindered by the difficulty of finding a volumetric probe to use as a progress variable. Solids are typically optically opaque and heterogeneous. Over the past several years, second harmonic generation (SHG) has been used as a kinetic probe for a solid-solid phase transition in which the initial and final phases have different symmetries. Bulk generation of SHG is allowed by symmetry only in noncentrosymmetric crystallographic space groups. For the organic energetic nitramine octahydro-1,3 ,5,7 -tetranitro-1,3 ,5,7 -tatrazocine (HMX), the beta phase is centro symmetric (space group P2{sub 1}/c) and the delta phase iS noncentrosymmetric (space group P6{sub 1}22) making SHG an extremely sensitive, essentially zero background probe of the phase change progress. We have used SHG as a tool to follow the progress of the transformation from beta to delta phase during the solid-solid transformation. However, kinetic models of the transformation derived using different observables from several other groups have differed, showing later onset for the phase change and faster progression to completion. In this work, we have intercompared several techniques to understand these differences. The three techniques discussed are second harmonic generation, Raman spectroscopy, and differential scanning calorimetry (DSC). The progress of the beta to delta phase transition in HMX observed with each of these different probes will be discussed and advantages and disadvantages of each technique described. This paper compares several different observables for use in measuring the kinetics of solid-solid phase transitions. Relative advantages and disadvantages for each technique are described and a direct comparison of results is made for the beta to delta polymorphic phase transition of the energetic nitramine, octahydro-1,3,5,7-tetranitro-1,3,5,7-tatrazocine.

  5. Recent developments in matrix solid-phase dispersion extraction.

    PubMed

    Capriotti, Anna Laura; Cavaliere, Chiara; Giansanti, Piero; Gubbiotti, Riccardo; Samperi, Roberto; Laganà, Aldo

    2010-04-16

    Matrix solid-phase dispersion is a sample preparation strategy widely applied to solid, semisolid or viscous samples, including animal tissues and foods with a high lipidic content. The process consists in blending the matrix onto a solid support, allowing the matrix cell disruption and the subsequent extraction of target analytes by means of a suitable elution solvent. First introduced in 1989, MSPD employment and developments are still growing because of the feasibility and versatility of the process, as evidenced by the several reviews that have been published since nineties. Therefore, the aim of the present review is to provide a general overview and an update of the last developments of MSPD.

  6. Solid phase microextraction fills the gap in tissue sampling protocols.

    PubMed

    Bojko, Barbara; Gorynski, Krzysztof; Gomez-Rios, German Augusto; Knaak, Jan Matthias; Machuca, Tiago; Spetzler, Vinzent Nikolaus; Cudjoe, Erasmus; Hsin, Michael; Cypel, Marcelo; Selzner, Markus; Liu, Mingyao; Keshavjee, Shaf; Pawliszyn, Janusz

    2013-11-25

    Metabolomics and biomarkers discovery are an integral part of bioanalysis. However, untargeted tissue analysis remains as the bottleneck of such studies due to the invasiveness of sample collection, as well as the laborious and time-consuming sample preparation protocols. In the current study, technology integrating in vivo sampling, sample preparation and global extraction of metabolites--solid phase microextraction was presented and evaluated during liver and lung transplantation in pig model. Sampling approaches, including selection of the probe, transportation, storage conditions and analyte coverage were discussed. The applicability of the method for metabolomics studies was demonstrated during lung transplantation experiments. PMID:24216199

  7. The solid phase of ginkgolide K: Structure and physicochemical properties

    NASA Astrophysics Data System (ADS)

    Zhang, Yiwen; Zhang, Guoshun; Wang, Zhenzhong; Lv, Yang; Xiao, Wei

    2016-05-01

    Four solvates of ginkgolide K with dimethyl sulfoxide(I), water molecule(II), acetone-isopropyl alcohol(III), methanol-ethanol(IV) and one solvate-free (V) have been described in this work. And the solid-state techniques such as X-ray diffraction, thermal analysis and Fourier transform infrared spectroscopy were used for characterization of the solid phases. The single crystal structures of ginkgolide K solvates (I-IV) have been determined. Ginkgolide K shows strong inflexibility and solvents being incorporated in the crystal structure results in it forming polymorphs via the diverse hydrogen bond interactions.

  8. Solid-Phase Synthesis of Tetrahydropyridazinedione-Constrained Peptides

    PubMed Central

    2015-01-01

    The design and solid-phase synthesis of tetrahydropyridazine-3,6-dione (Tpd) peptidomimetics derived from backbone-aminated peptides is reported. The described protocol features the synthesis of chiral α-hydrazino acids suitable for chemoselective incorporation into growing peptide chains. Acid-catalyzed cyclization to form the Tpd ring during cleavage affords the target peptidomimetics in good yield and purity. The scope of Tpd incorporation is demonstrated through the synthesis of constrained peptides featuring nucleophilic/electrophilic side chains and sterically encumbered α-substituted hydrazino acid residues. PMID:25295511

  9. Nitrogen containing privileged structures and their solid phase combinatorial synthesis.

    PubMed

    Verma, Amit; Yadav, Mange Ram; Giridhar, Rajani; Prajapati, Navnit; Tripathi, Avinash C; Saraf, Shailendra K

    2013-06-01

    The existence of preferred molecular scaffolds that possess inherent biological activity, called privileged structures, is now well recognized. Such privileged structures not only provide enhanced drug-like properties but also give new hits for developing leads. The synthesis of combinatorial libraries, especially with the insertion of privileged substructures into heterocyclic moieties containing nitrogen, provides for a greater probability of the discovery of novel lead compounds using chemical transformation. The review focuses on the progress in the solid-phase synthetic strategies of nitrogen containing privileged structures over the years.

  10. Distribution of Dechlorinating Bacteria between the Aqueous and Solid Phases

    NASA Astrophysics Data System (ADS)

    Cápiro, N. L.; Hatt, J. K.; Wang, Y.; Loeffler, F. E.; Pennell, K. D.

    2010-12-01

    Microbial monitoring of aquifers relies on nucleic acid biomarker analysis, which is typically performed with biomass recovered from groundwater samples; however, it is unclear what fraction of the target population(s) is associated with groundwater (i.e., planktonic cells) or is attached to solid phases (i.e., biofilms). Understanding how the titer of target organism(s) in groundwater correlates with the true cell titers of the target organism in the aquifer (i.e., planktonic plus attached cells) is critical for a meaningful interpretation of the data, the prediction of bioremediation performance, and the implementation of site management strategies. To evaluate the distribution of active cells between resident solid phase and the aqueous phase, one-dimensional columns were packed under water-saturated conditions with Bio-Dechlor INOCULUM, a PCE-to ethene-dechlorinating bacterial consortium containing both multiple Dehalococcoides (Dhc) strains and Geobacter lovleyi strain SZ (GeoSZ). The columns were packed with two distinct solid matrices: a low organic content sandy Federal Fine Ottawa soil or Appling soil with higher organic matter content. Influent reduced mineral salts medium supplied at a groundwater pore-water velocity of 0.3 m/day contained both 10 mM lactate as electron donor and 0.33 mM PCE as electron acceptor. Routine collection of biomass from column side ports and effluent samples measured the titers of target cells in the aqueous phase and determined when steady state conditions had been reached. A second set of column experiments evaluated delivery and filtration effects by the solid matrix (i.e., Federal Fine Ottawa sand versus Appling soil) under the same conditions except that electron donor or acceptor were omitted (no growth conditions). Quantitative real-time PCR (qPCR) analysis using Dhc and GeoSZ 16S rRNA gene-targeted primer and probe sets determined the planktonic cell counts, and destructive sampling of the columns allowed measurement

  11. Advances in solid-phase extraction disks for environmental chemistry

    USGS Publications Warehouse

    Thurman, E.M.; Snavely, K.

    2000-01-01

    The development of solid-phase extraction (SPE) for environmental chemistry has progressed significantly over the last decade to include a number of new sorbents and new approaches to SPE. One SPE approach in particular, the SPE disk, has greatly reduced or eliminated the use of chlorinated solvents for the analysis of trace organic compounds. This article discusses the use and applicability of various SPE disks, including micro-sized disks, prior to gas chromatography-mass spectrometry for the analysis of trace organic compounds in water. Copyright (C) 2000 Elsevier Science B.V.

  12. Solid Phase Synthesis of Helically Folded Aromatic Oligoamides.

    PubMed

    Dawson, S J; Hu, X; Claerhout, S; Huc, I

    2016-01-01

    Aromatic amide foldamers constitute a growing class of oligomers that adopt remarkably stable folded conformations. The folded structures possess largely predictable shapes and open the way toward the design of synthetic mimics of proteins. Important examples of aromatic amide foldamers include oligomers of 7- or 8-amino-2-quinoline carboxylic acid that have been shown to exist predominantly as well-defined helices, including when they are combined with α-amino acids to which they may impose their folding behavior. To rapidly iterate their synthesis, solid phase synthesis (SPS) protocols have been developed and optimized for overcoming synthetic difficulties inherent to these backbones such as low nucleophilicity of amine groups on electron poor aromatic rings and a strong propensity of even short sequences to fold on the solid phase during synthesis. For example, acid chloride activation and the use of microwaves are required to bring coupling at aromatic amines to completion. Here, we report detailed SPS protocols for the rapid production of: (1) oligomers of 8-amino-2-quinolinecarboxylic acid; (2) oligomers containing 7-amino-8-fluoro-2-quinolinecarboxylic acid; and (3) heteromeric oligomers of 8-amino-2-quinolinecarboxylic acid and α-amino acids. SPS brings the advantage to quickly produce sequences having varied main chain or side chain components without having to purify multiple intermediates as in solution phase synthesis. With these protocols, an octamer could easily be synthesized and purified within one to two weeks from Fmoc protected amino acid monomer precursors. PMID:27586338

  13. Solid phase extraction of food contaminants using molecular imprinted polymers.

    PubMed

    Baggiani, Claudio; Anfossi, Laura; Giovannoli, Cristina

    2007-05-15

    Food contamination from natural or anthropogenic sources poses severe risks to human health. It is now largely accepted that continuous exposure to low doses of toxic chemicals can be related to several chronic diseases, including some type of cancer and serious hormonal dysfunctions. Contemporary analytical methods have the sensitivity required for contamination detection and quantification, but direct application of these methods on food samples can be rarely performed. In fact, the matrix introduces severe disturbances, and analysis can be performed only after some clean-up and preconcentration steps. Current sample pre-treatment methods, mostly based on the solid phase extraction technique, are very fast and inexpensive but show a lack of selectivity, while methods based on immunoaffinity extraction are very selective but expensive and not suitable for harsh environments. Thus, inexpensive, rapid and selective clean-up methods, relaying on "intelligent" materials are needed. Recent years have seen a significant increase of the "molecularly imprinted solid phase extraction" (MISPE) technique in the food contaminant analysis. In fact, this technique seems to be particularly suitable for extractive applications where analyte selectivity in the presence of very complex and structured matrices represents the main problem. In this review, several applications of MISPE in food contamination analysis will be discussed, with particular emphasis on the extraction of pesticides, drugs residua, mycotoxins and environmental contaminants.

  14. Solid-phase chemistry driven by energetic processing

    NASA Astrophysics Data System (ADS)

    Palumbo, M. E.

    2015-01-01

    Molecules in the solid phase have been detected in the line of sight of quiescent molecular clouds and star forming regions as icy mantles on dust grains. Although about 10 molecular species have been firmly identified in icy grain mantles, it is believed that many, also complex, species are present in the solid phase which are not detected due to the detection limits of infrared spectroscopy. It is generally accepted that some of the observed species (such as CO) freeze out from the gas phase while others (such as water and methanol) are formed on grains after surface reactions. Other species (such as CO2 and OCS), are not expected to freeze out in significant amount from the gas phase and grain surface models do not account for their observed abundance. It has been suggested that these molecules, along with other more complex species, are formed after energetic processing (i.e. cosmic ion and UV irradiation) of icy grain mantles. All these species are released to the gas-phase after desorption of icy mantles. Here we will present some recent laboratory experiments which show the formation of (complex) molecular species after energetic processing of simple ices. Icy targets have been processed by ion bombardment and UV photolysis both in separate experiments and recently, for the first time, simultaneously. When C-rich species are present in the initial ice, an organic refractory material is also formed.

  15. Effects of sample homogenization on solid phase sediment toxicity

    SciTech Connect

    Anderson, B.S.; Hunt, J.W.; Newman, J.W.; Tjeerdema, R.S.; Fairey, W.R.; Stephenson, M.D.; Puckett, H.M.; Taberski, K.M.

    1995-12-31

    Sediment toxicity is typically assessed using homogenized surficial sediment samples. It has been recognized that homogenization alters sediment integrity and may result in changes in chemical bioavailability through oxidation-reduction or other chemical processes. In this study, intact (unhomogenized) sediment cores were taken from a Van Veen grab sampler and tested concurrently with sediment homogenate from the same sample in order to investigate the effect of homogenization on toxicity. Two different solid-phase toxicity test protocols were used for these comparisons. Results of amphipod exposures to samples from San Francisco Bay indicated minimal difference between intact and homogenized samples. Mean amphipod survival in intact cores relative to homogenates was similar at two contaminated sites. Mean survival was 34 and 33% in intact and homogenized samples, respectively, at Castro Cove. Mean survival was 41% and 57%, respectively, in intact and homogenized samples from Islais Creek. Studies using the sea urchin development protocol, modified for testing at the sediment/water interface, indicated considerably more toxicity in intact samples relative to homogenized samples from San Diego Bay. Measures of metal flux into the overlying water demonstrated greater flux of metals from the intact samples. Zinc flux was five times greater, and copper flux was twice as great in some intact samples relative to homogenates. Future experiments will compare flux of metals and organic compounds in intact and homogenized sediments to further evaluate the efficacy of using intact cores for solid phase toxicity assessment.

  16. Electrochemically controlled in-tube solid phase microextraction.

    PubMed

    Ahmadi, Seyyed Hamid; Manbohi, Ahmad; Heydar, Kourosh Tabar

    2015-01-01

    We report a new in-tube solid phase microextraction approach named electrochemically controlled in-tube solid phase microextraction (EC in-tube SPME). This approach, which combined electrochemistry and in-tube SPME, led to decrease in total analysis time and increase in sensitivity. At first, pyrrole was elctropolymerized on the inner surface of a stainless steel tube. Then, the polypyrrole (PPy)-coated in-tube SPME was coupled on-line to liquid chromatography (HPLC) to achieve automated in-tube SPME-HPLC analysis. After the completion of EC-in-tube SPME-HPLC setup, the PPy-coated tube was used as working electrode for uptake of diclofenac as target analyte. Extraction ability of the tube in presence and in absence of applied electrical field was investigated. It was found that, under the same extraction conditions, the extraction efficiency could be greatly enhanced by using the constant potential. Important factors are also optimized. The detection limit (S/N=3) and precision were 0.1 μg L(-1) and 4.4%, respectively.

  17. Method for preparing a solid phase microextraction device using aerogel

    DOEpatents

    Miller, Fred S.; Andresen, Brian D.

    2006-10-24

    A sample collection substrate of aerogel and/or xerogel materials bound to a support structure is used as a solid phase microextraction (SPME) device. The xerogels and aerogels may be organic or inorganic and doped with metals or other compounds to target specific chemical analytes. The support structure is typically formed of a glass fiber or a metal wire (stainless steel or kovar). The devices are made by applying gel solution to the support structures and drying the solution to form aerogel or xerogel. Aerogel particles may be attached to the wet layer before drying to increase sample collection surface area. These devices are robust, stable in fields of high radiation, and highly effective at collecting gas and liquid samples while maintaining superior mechanical and thermal stability during routine use. Aerogel SPME devices are advantageous for use in GC/MS analyses due to their lack of interfering background and tolerance of GC thermal cycling.

  18. Gold nanoshells as solid-phase dot assay labels

    NASA Astrophysics Data System (ADS)

    Khlebtsov, Boris N.; Dykman, Lev A.; Bogatyrev, Vadimir A.; Khlebtsov, Nikolai G.

    2007-05-01

    We report on the first application of silica-gold nanoshells to a solid-phase dot immunoassay. The assay principle is based on staining of a drop (1μL ) analyte on a nitrocellulose membrane strip by using silica/gold nanoshells conjugated with biospecific probing molecules. Experimental example is human IgG (hIgG, target molecules) and protein A (probing molecules). For usual 15-nm colloidal gold conjugates, the minimal detectable amount of hIgG is about 4ng. By contrast, for nanoshell conjugates (silica core diameter of 70 nm and gold outer diameter of 100 nm) we have found significant increase in detection sensitivity and the minimal detectable amount of hIgG is about 0.5 ng.

  19. Solid phase indirect radioimmunoassay: standardization and applications in viral serology.

    PubMed

    Yung, L L; Loh, W; ter Meulen, V

    1977-07-18

    In solid phase indirect radioimmunoassay (IRIA) antiviral immunoglobulins (Ig) bind specifically to the viral antigen fixed onto wells of microtiter plates. Radioactively labeled (125I) anti-Ig can be used to detect these antiviral antibodies. The sensitivity of the IRIA depends on the amount of antigen in the microtiter wells and the concentration of the 125I-labeled anti-Ig used. To standardize the assay, a method of antigen titration in the IRIA was devised, using parainfluenza type 1 viruses as antigens. The IRIA provides a means to titrate viral antigens with different biologic activities and antibodies against them. A binding inhibition test (BIT) based on IRIA allows the antigenic analysis of different virus strains, as is demonstrated for two closely related parainfluenza type 1 virus strains.

  20. Kinetics of Solid Phase Reactions at High Pressure and Temperature

    SciTech Connect

    Zaug, J M; Farber, D L; Saw, C K; Weeks, B L

    2002-02-11

    We report on the subject of temperature and/or pressure induced solid-solid phase transitions of energetic molecular crystals. Over the last three years we have applied experimental techniques that when used simultaneously provide insight into some of the complexities that govern reaction rate processes. After more than 55 years of study a global kinetics model describing the P-T phase space transition kinetics of such materials as HMX (octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine) is not only missing, but from a formal perspective is perhaps as many years away from completion. The essence of this report describes what material parameters affect first-order reaction rates of the CHNO moiety of molecular crystals and introduces the application of new experimental tools thus permitting quantifiable studies of important rate limiting mechanisms.

  1. Synthesis of phytochelatins by the continuous flow solid phase procedure.

    PubMed

    Chen, Z; Hemmasi, B

    1993-11-01

    A nona- and an undecapeptide corresponding to phytochelatins with the general structure H-[gamma-Glu-Cys]n-Gly-OH were each synthesized by the continuous flow solid phase method using two different methodologies. Fmoc-amino acid derivatives were used as precursors, and two different H2N-POE-PS supports were employed. Different procedures were used to remove Acm protecting groups from Cys residues. In a second synthesis, Acm groups were removed before cleavage of the peptides from the polymer supports. The partially protected peptides of the first synthesis were purified by preparative HPLC. The purity and identity of all the synthesized peptides were verified by analytical HPLC and IS-MS and in some cases by amino acid analysis. PMID:8292265

  2. Solid–solid phase transitions via melting in metals

    PubMed Central

    Pogatscher, S.; Leutenegger, D.; Schawe, J. E. K.; Uggowitzer, P. J.; Löffler, J. F.

    2016-01-01

    Observing solid–solid phase transitions in-situ with sufficient temporal and spatial resolution is a great challenge, and is often only possible via computer simulations or in model systems. Recently, a study of polymeric colloidal particles, where the particles mimic atoms, revealed an intermediate liquid state in the transition from one solid to another. While not yet observed there, this finding suggests that such phenomena may also occur in metals and alloys. Here we present experimental evidence for a solid–solid transition via the formation of a metastable liquid in a ‘real' atomic system. We observe this transition in a bulk glass-forming metallic system in-situ using fast differential scanning calorimetry. We investigate the corresponding transformation kinetics and discuss the underlying thermodynamics. The mechanism is likely to be a feature of many metallic glasses and metals in general, and may provide further insight into phase transition theory. PMID:27103085

  3. Hydrogen cleavage by solid-phase frustrated Lewis pairs.

    PubMed

    Xing, Jun-Yi; Buffet, Jean-Charles; Rees, Nicholas H; Nørby, Peter; O'Hare, Dermot

    2016-08-18

    We report the direct synthesis of a solid-phase frustrated Lewis pair (s-FLP) by combining a silica-supported Lewis acid ([triple bond, length as m-dash]SiOB(C6F5)2, s-BCF) with a Lewis base (tri-tert-butylphosphine, (t)Bu3P) to give [[triple bond, length as m-dash]SiOB(C6F5)2][(t)Bu3P]. Reaction of this s-FLP with H2 under mild conditions led to heterolytic H-H bond cleavage and the formation of [[triple bond, length as m-dash]SiOB(H)(C6F5)2][(t)Bu3PH].

  4. Solid-solid phase transitions via melting in metals.

    PubMed

    Pogatscher, S; Leutenegger, D; Schawe, J E K; Uggowitzer, P J; Löffler, J F

    2016-04-22

    Observing solid-solid phase transitions in-situ with sufficient temporal and spatial resolution is a great challenge, and is often only possible via computer simulations or in model systems. Recently, a study of polymeric colloidal particles, where the particles mimic atoms, revealed an intermediate liquid state in the transition from one solid to another. While not yet observed there, this finding suggests that such phenomena may also occur in metals and alloys. Here we present experimental evidence for a solid-solid transition via the formation of a metastable liquid in a 'real' atomic system. We observe this transition in a bulk glass-forming metallic system in-situ using fast differential scanning calorimetry. We investigate the corresponding transformation kinetics and discuss the underlying thermodynamics. The mechanism is likely to be a feature of many metallic glasses and metals in general, and may provide further insight into phase transition theory.

  5. Solid-solid phase transitions via melting in metals

    NASA Astrophysics Data System (ADS)

    Pogatscher, S.; Leutenegger, D.; Schawe, J. E. K.; Uggowitzer, P. J.; Löffler, J. F.

    2016-04-01

    Observing solid-solid phase transitions in-situ with sufficient temporal and spatial resolution is a great challenge, and is often only possible via computer simulations or in model systems. Recently, a study of polymeric colloidal particles, where the particles mimic atoms, revealed an intermediate liquid state in the transition from one solid to another. While not yet observed there, this finding suggests that such phenomena may also occur in metals and alloys. Here we present experimental evidence for a solid-solid transition via the formation of a metastable liquid in a `real' atomic system. We observe this transition in a bulk glass-forming metallic system in-situ using fast differential scanning calorimetry. We investigate the corresponding transformation kinetics and discuss the underlying thermodynamics. The mechanism is likely to be a feature of many metallic glasses and metals in general, and may provide further insight into phase transition theory.

  6. Porous protective solid phase micro-extractor sheath

    DOEpatents

    Andresen, Brian D.; Randich, Erik

    2005-03-29

    A porous protective sheath for active extraction media used in solid phase microextraction (SPME). The sheath permits exposure of the media to the environment without the necessity of extending a fragile coated fiber from a protective tube or needle. Subsequently, the sheath can pierce and seal with GC-MS septums, allowing direct injection of samples into inlet ports of analytical equipment. Use of the porous protective sheath, within which the active extraction media is contained, mitigates the problems of: 1) fiber breakage while the fiber is extended during sampling, 2) active media coating loss caused by physical contact of the bare fiber with the sampling environment; and 3) coating slough-off during fiber extension and retraction operations caused by rubbing action between the fiber and protective needle or tube.

  7. Bench-scale solid phase biotreatment: Benfield Industries Superfund site

    SciTech Connect

    Marlowe, M.W.; Harper, T.R.; Semenak, R.K.

    1995-12-31

    The Benfield Industries, Inc. Superfund site located in Hazelwood, North Carolina has been found to have approximately 15,000 cubic yards of polycyclic aromatic hydrocarbon (PAH) contaminated soil. Risk based clean up goals were specified at the site for eight target PAH compounds including benzo(a)anthracene, benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene, chrysene, indeno(1,2,3-cd)pyrene, naphthalene, and pentachlorophenol. Treatability studies were performed to evaluate solid phase bioremediation, which includes ex-situ and in-situ land treatment processes, for treatment of the site soil. All treatments were conducted using only indigenous microorganisms maintained under aerobic conditions. Two soil samples with different levels of PAH contamination were collected from the site for use in the treatability evaluations. The two soil samples were contaminated with total PAHs at concentrations of approximately 30 milligrams per kilogram (mg/kg) and 6,000 mg/kg, respectively. Three solid phase bioremediation studies were conducted over a one and one half year period using starting concentrations of total PAHs of approximately 30; 600; and 6,000 mg/kg. The objectives of the studies included determining (1) if clean up goals could be achieved, (2) the approximate biodegradation rate of PAHs in the site soils, and (3) the optimum environmental conditions for biodegradation of the PAHs. Some of the environmental parameters which were varied during the testing included moisture levels, soil conditioners, nutrients and pH. The results of the testing indicated that total and target PAHs can be reduced by up to 90 percent in less than 50 days, depending on environmental conditions maintained in the reactors. Clean up goals for all of the target compounds were achieved at some point during the study.

  8. Individual Colorimetric Observer Model

    PubMed Central

    Asano, Yuta; Fairchild, Mark D.; Blondé, Laurent

    2016-01-01

    This study proposes a vision model for individual colorimetric observers. The proposed model can be beneficial in many color-critical applications such as color grading and soft proofing to assess ranges of color matches instead of a single average match. We extended the CIE 2006 physiological observer by adding eight additional physiological parameters to model individual color-normal observers. These eight parameters control lens pigment density, macular pigment density, optical densities of L-, M-, and S-cone photopigments, and λmax shifts of L-, M-, and S-cone photopigments. By identifying the variability of each physiological parameter, the model can simulate color matching functions among color-normal populations using Monte Carlo simulation. The variabilities of the eight parameters were identified through two steps. In the first step, extensive reviews of past studies were performed for each of the eight physiological parameters. In the second step, the obtained variabilities were scaled to fit a color matching dataset. The model was validated using three different datasets: traditional color matching, applied color matching, and Rayleigh matches. PMID:26862905

  9. Design, Certification, and Deployment of the Colorimetric Water Quality Monitoring Kit (CWQMK)

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Nolan, Daniel J.; Rutz, Jeff A.; Schultz, John R.; Siperko, Lorraine M.; Porter, Marc D.; Lipert, Robert J.; Flint, Stephanie M.; McCoy, J. Torin

    2010-01-01

    In August 2009, an experimental water quality monitoring kit based on Colorimetric Solid Phase Extraction (CSPE) technology was delivered to the International Space Station (ISS) aboard STS-128/17A. The kit, called the Colorimetric Water Quality Monitoring Kit (CWQMK), was flown and deployed as a Station Development Test Objective (SDTO) experiment on the ISS. The goal of the SDTO experiment is to evaluate the acceptability of CSPE technology for routine water quality monitoring on the ISS. This paper provides an overview of the SDTO experiment, as well as a detailed description of the CWQMK hardware and a summary of the testing and analysis conducted to certify the CWQMK for use on the ISS. The initial results obtained from the SDTO experiment are also reported and discussed in detail

  10. DNA purification using dynamic solid-phase extraction on a rotationally-driven polyethylene-terephthalate microdevice.

    PubMed

    Jackson, K R; Borba, J C; Meija, M; Mills, D L; Haverstick, D M; Olson, K E; Aranda, R; Garner, G T; Carrilho, E; Landers, J P

    2016-09-21

    We report the development of a disposable polyester toner centrifugal device for semi-automated, dynamic solid phase DNA extraction (dSPE) from whole blood samples. The integration of a novel adhesive and hydrophobic valving with a simple and low cost microfabrication method allowed for sequential addition of reagents without the need for external equipment for fluid flow control. The spin-dSPE method yielded an average extraction efficiency of ∼45% from 0.6 μL of whole blood. The device performed single sample extractions or accommodate up to four samples for simultaneous DNA extraction, with PCR-readiness DNA confirmed by effective amplification of a β-globin gene. The purity of the DNA was challenged by a multiplex amplification with 16 targeted amplification sites. Successful multiplexed amplification could routinely be obtained using the purified DNA collected post an on-chip extraction, with the results comparable to those obtained with commercial DNA extraction methods. This proof-of-principle work represents a significant step towards a fully-automated low cost DNA extraction device. PMID:27590539

  11. Solid-Phase Synthesis of Oligodeoxynucleotide Analogs Containing Phosphorodithioate Linkages.

    PubMed

    Yang, Xianbin

    2016-01-01

    The oligodeoxynucleotide phosphorodithioate modification (PS2-ODN) uses two sulfur atoms to replace two non-bridging oxygen atoms at an internucleotide phosphordiester backbone linkage. Like a natural phosphodiester ODN backbone linkage, a PS2-modified backbone linkage is achiral at phosphorus. PS2-ODNs are highly stable to nucleases and numerous in vitro assays have demonstrated their biological activity. For example, PS2-ODNs activated RNase H in vitro, strongly inhibited human immunodeficiency virus (HIV) reverse transcriptase, induced B-cell proliferation and differentiation, and bound to protein targets in the form of PS2-aptamers (thioaptamers). Thus, the interest in and promise of PS2-ODNs has spawned a variety of strategies for synthesizing, isolating, and characterizing this compounds. ODN-thiophosphoramidite monomers are commercially available from either AM Biotechnologies or Glen Research and this unit describes an effective methodology for solid-phase synthesis, deprotection, and purification of ODNs having PS2 internucleotide linkages. © 2016 by John Wiley & Sons, Inc. PMID:27584703

  12. Solid-phase synthesis of oxaliplatin-TAT peptide bioconjugates.

    PubMed

    Abramkin, Sergey; Valiahdi, Seied M; Jakupec, Michael A; Galanski, Markus; Metzler-Nolte, Nils; Keppler, Bernhard K

    2012-03-14

    Platinum-based drugs play a crucial role in the fight against cancer. Oxaliplatin, which is used in the treatment of colorectal carcinoma, was the last platinum-based agent to be approved worldwide. However, the efficiency of the therapy is limited for example by a low accumulation of the drug in cancer cells. Cell-penetrating peptides (CPPs) are known to ease the cellular membrane transport and are used as vectors for low-molecular-weight drugs and drug carriers; of them, TAT peptides are the best-studied group. In this work, a TAT-peptide fragment (YGRKKRRQRRR) was for the first time conjugated to a platinum(IV) analog of oxaliplatin as a vehicle for membrane penetration. Solid-phase peptide synthesis and subsequent coupling with the platinum complex afforded mono- and difunctionalized conjugates, which were separated by preparative HPLC and characterized by analytical HPLC, ESI-MS, and (1)H NMR spectroscopy. Both conjugates are active in the low micromolar range in CH1 and SW480 human cancer cells, requiring much lower concentrations than the untargeted analogs for equal effects.

  13. Ferrofluid-based dispersive solid phase extraction of palladium.

    PubMed

    Farahani, Malihe Davudabadi; Shemirani, Farzaneh; Gharehbaghi, Maysam

    2013-05-15

    A new mode of dispersive solid phase extraction based on ferrofluid has been developed. In this method, an appropriate amount of ferrofluid is injected rapidly into the aqueous sample by a syringe. Since the sorbent is highly dispersed in the aqueous phase, extraction can be achieved within a few seconds. The ferrofluid can be attracted by a magnet and no centrifugation step is needed for phase separation. Palladium was used as a model compound in the development and evaluation of the extraction procedure in combination with flame atomic absorption spectrometry. The experimental parameters (pH, DDTC concentration, type and concentration of eluent, the amount of adsorbent, extraction time, and the effect of interfering ions) were investigated in detail. Under the optimized conditions, the calibration graph was linear over the range of 1-100 μg L(-1) and relative standard deviation of 3.3% at 0.1 μg mL(-1) was obtained (n=7). The limit of detection and enrichment factor (EF) was obtained to be 0.35 μg L(-1) and 267, respectively. The maximum adsorption capacity of the adsorbent at optimum conditions was found to be 24.6 mg g(-1) for Pd(II). The method was validated using certified reference material, and has been applied for the determination of trace Pd(II) in actual samples with satisfactory results. PMID:23618148

  14. Solid phase microextraction of pesticide residues from strawberries.

    PubMed

    Hu, R; Hennion, B; Urruty, L; Montury, M

    1999-03-01

    A new solid phase microextraction method for the determination of pesticide residues in strawberries for 16 commonly used compounds was described. The strawberries were crushed and centrifuged. An aliquot of the well agitated aqueous supernatant (4 ml) was extracted with a fibre coated with polydimethylsiloxane (PDMS, 100 microns) for 45 min at room temperature. Identification and quantification were achieved using a gas chromatography-mass spectrometry (GC-MS) system and selective ion monitoring (SIM). The method was tested for the following pesticides: carbofuran, diethofencarb, penconazole, hexaconazole, metalaxyl, folpet, bromopropylate, dichlofluanid, alpha-endosulfan, beta-endosulfan, parathion ethyl, procymidone, iprodione, vinclozolin, myclobutanil and chlorothalonil. Limits of detection, repeatability and linearity for standard calibration in strawberries were obtained. Positive and negative effects of the matrix between the extracting solution of strawberries and water were observed. Stabilities of these compounds in the extracting solution of strawberries were determined. The solvent-free SPME procedure was found to be quicker and more cost effective than the solvent extraction methods commonly used.

  15. Solid-phase microextraction and the human fecal VOC metabolome.

    PubMed

    Dixon, Emma; Clubb, Cynthia; Pittman, Sara; Ammann, Larry; Rasheed, Zeehasham; Kazmi, Nazia; Keshavarzian, Ali; Gillevet, Pat; Rangwala, Huzefa; Couch, Robin D

    2011-01-01

    The diagnostic potential and health implications of volatile organic compounds (VOCs) present in human feces has begun to receive considerable attention. Headspace solid-phase microextraction (SPME) has greatly facilitated the isolation and analysis of VOCs from human feces. Pioneering human fecal VOC metabolomic investigations have utilized a single SPME fiber type for analyte extraction and analysis. However, we hypothesized that the multifarious nature of metabolites present in human feces dictates the use of several diverse SPME fiber coatings for more comprehensive metabolomic coverage. We report here an evaluation of eight different commercially available SPME fibers, in combination with both GC-MS and GC-FID, and identify the 50/30 µm CAR-DVB-PDMS, 85 µm CAR-PDMS, 65 µm DVB-PDMS, 7 µm PDMS, and 60 µm PEG SPME fibers as a minimal set of fibers appropriate for human fecal VOC metabolomics, collectively isolating approximately 90% of the total metabolites obtained when using all eight fibers. We also evaluate the effect of extraction duration on metabolite isolation and illustrate that ex vivo enteric microbial fermentation has no effect on metabolite composition during prolonged extractions if the SPME is performed as described herein. PMID:21494609

  16. Solid-Phase Microextraction and the Human Fecal VOC Metabolome

    PubMed Central

    Dixon, Emma; Clubb, Cynthia; Pittman, Sara; Ammann, Larry; Rasheed, Zeehasham; Kazmi, Nazia; Keshavarzian, Ali; Gillevet, Pat; Rangwala, Huzefa; Couch, Robin D.

    2011-01-01

    The diagnostic potential and health implications of volatile organic compounds (VOCs) present in human feces has begun to receive considerable attention. Headspace solid-phase microextraction (SPME) has greatly facilitated the isolation and analysis of VOCs from human feces. Pioneering human fecal VOC metabolomic investigations have utilized a single SPME fiber type for analyte extraction and analysis. However, we hypothesized that the multifarious nature of metabolites present in human feces dictates the use of several diverse SPME fiber coatings for more comprehensive metabolomic coverage. We report here an evaluation of eight different commercially available SPME fibers, in combination with both GC-MS and GC-FID, and identify the 50/30 µm CAR-DVB-PDMS, 85 µm CAR-PDMS, 65 µm DVB-PDMS, 7 µm PDMS, and 60 µm PEG SPME fibers as a minimal set of fibers appropriate for human fecal VOC metabolomics, collectively isolating approximately 90% of the total metabolites obtained when using all eight fibers. We also evaluate the effect of extraction duration on metabolite isolation and illustrate that ex vivo enteric microbial fermentation has no effect on metabolite composition during prolonged extractions if the SPME is performed as described herein. PMID:21494609

  17. Automated solid-phase peptide synthesis to obtain therapeutic peptides

    PubMed Central

    Mäde, Veronika; Els-Heindl, Sylvia

    2014-01-01

    Summary The great versatility and the inherent high affinities of peptides for their respective targets have led to tremendous progress for therapeutic applications in the last years. In order to increase the drugability of these frequently unstable and rapidly cleared molecules, chemical modifications are of great interest. Automated solid-phase peptide synthesis (SPPS) offers a suitable technology to produce chemically engineered peptides. This review concentrates on the application of SPPS by Fmoc/t-Bu protecting-group strategy, which is most commonly used. Critical issues and suggestions for the synthesis are covered. The development of automated methods from conventional to essentially improved microwave-assisted instruments is discussed. In order to improve pharmacokinetic properties of peptides, lipidation and PEGylation are described as covalent conjugation methods, which can be applied by a combination of automated and manual synthesis approaches. The synthesis and application of SPPS is described for neuropeptide Y receptor analogs as an example for bioactive hormones. The applied strategies represent innovative and potent methods for the development of novel peptide drug candidates that can be manufactured with optimized automated synthesis technologies. PMID:24991269

  18. Solid Phase Microextraction for the Analysis of Nuclear Weapons

    SciTech Connect

    Chambers, D M

    2001-06-01

    This document is a compendium of answers to commonly asked questions about solid phase microextraction as it relates to the analysis of nuclear weapons. We have also included a glossary of terms associated with this analytical method as well as pertinent weapons engineering terminology. Microextraction is a new collection technique being developed to nonintrusively sample chemicals from weapon headspace gases for subsequent analysis. The chemicals that are being targeted outgas from the high explosives and other organic materials used in the weapon assembly. This technique is therefore a valuable tool to: (1) remotely detect and assess the aging of Lawrence Livermore National Laboratory (LLNL) and, in some cases, Sandia National Laboratory (SNL) organic materials; and (2) identify potential compatibility issues (i.e., materials interactions) that should be more carefully monitored during surveillance tear-downs. Microextraction is particularly attractive because of the practical constraints inherent to the weapon surveillance procedure. To remain transparent to other core surveillance activities and fall within nuclear safety guidelines, headspace analysis of the weapons requires a procedure that: (1) maintains ambient temperature conditions; (2) allows practical collection times of less than 20 min; (3) maintains the integrity of the weapon gas volume; (4) provides reproducible and quantitative results; and (5) can identify all possible targets.

  19. Molecularly imprinted solid phase extraction of fluconazole from pharmaceutical formulations.

    PubMed

    Manzoor, S; Buffon, R; Rossi, A V

    2015-03-01

    This work encompasses a direct and coherent strategy to synthesise a molecularly imprinted polymer (MIP) capable of extracting fluconazole from its sample. The MIP was successfully prepared from methacrylic acid (functional monomer), ethyleneglycoldimethacrylate (crosslinker) and acetonitrile (porogenic solvent) in the presence of fluconazole as the template molecule through a non-covalent approach. The non-imprinted polymer (NIP) was prepared following the same synthetic scheme, but in the absence of the template. The data obtained from scanning electronic microscopy, infrared spectroscopy, thermogravimetric and nitrogen Brunauer-Emmett-Teller plot helped to elucidate the structural as well as the morphological characteristics of the MIP and NIP. The application of MIP as a sorbent was demonstrated by packing it in solid phase extraction cartridges to extract fluconazole from commercial capsule samples through an offline analytical procedure. The quantification of fluconazole was accomplished through UPLC-MS, which resulted in LOD≤1.63×10(-10) mM. Furthermore, a high percentage recovery of 91±10% (n=9) was obtained. The ability of the MIP for selective recognition of fluconazole was evaluated by comparison with the structural analogues, miconazole, tioconazole and secnidazole, resulting in percentage recoveries of 51, 35 and 32%, respectively.

  20. Solid-Solid Phase Transition Kinetics of FOX-7

    SciTech Connect

    Burnham, A K; Weese, R K; Wang, R; Kwok, Q M; Jones, D G

    2005-07-12

    Since it was developed in the late 1990s, 1,1-diamino-2,2-dinitroethene (FOX-7), with lower sensitivity and comparable performance to RDX, has received increasing interest. This paper will present our results for the phase changes of FOX-7 using DSC and HFC (Heat Flow Calorimetry). DSC thermal curves recorded at linear heating rates of 0.10, 0.35 and 1.0 C min{sup -1} show two endothermic peaks and two exothermic peaks. The two endothermic peaks represent solid-solid phase transitions, which have been observed in the literature at 114 C ({beta}-{gamma}) and 159 C ({gamma}-{delta}) by both DSC and XPD (X-ray powder diffraction) measurements. The first transition shifts from 114.5 to 115.8 C as the heating rate increases from 0.10 to 1.0 C min{sup -1}, while the second transition shifts from 158.5 to 160.4 C. Cyclical heating experiments show the endotherms and exotherms for a first heating through the {gamma} phase to the {delta} phase, a cooling and reversion to the {alpha} or {beta} phase, and a second heating to the {gamma} and {delta} phases. The data are interpreted using kinetic models with thermodynamic constraints.

  1. Molecularly imprinted solid phase extraction of fluconazole from pharmaceutical formulations.

    PubMed

    Manzoor, S; Buffon, R; Rossi, A V

    2015-03-01

    This work encompasses a direct and coherent strategy to synthesise a molecularly imprinted polymer (MIP) capable of extracting fluconazole from its sample. The MIP was successfully prepared from methacrylic acid (functional monomer), ethyleneglycoldimethacrylate (crosslinker) and acetonitrile (porogenic solvent) in the presence of fluconazole as the template molecule through a non-covalent approach. The non-imprinted polymer (NIP) was prepared following the same synthetic scheme, but in the absence of the template. The data obtained from scanning electronic microscopy, infrared spectroscopy, thermogravimetric and nitrogen Brunauer-Emmett-Teller plot helped to elucidate the structural as well as the morphological characteristics of the MIP and NIP. The application of MIP as a sorbent was demonstrated by packing it in solid phase extraction cartridges to extract fluconazole from commercial capsule samples through an offline analytical procedure. The quantification of fluconazole was accomplished through UPLC-MS, which resulted in LOD≤1.63×10(-10) mM. Furthermore, a high percentage recovery of 91±10% (n=9) was obtained. The ability of the MIP for selective recognition of fluconazole was evaluated by comparison with the structural analogues, miconazole, tioconazole and secnidazole, resulting in percentage recoveries of 51, 35 and 32%, respectively. PMID:25618633

  2. Solid-phase glycan isolation for glycomics analysis

    PubMed Central

    Yang, Shuang; Zhang, Hui

    2013-01-01

    Glycosylation is one of the most significant protein PTMs. The biological activities of proteins are dramatically changed by the glycans associated with them. Thus, structural analysis of the glycans of glycoproteins in complex biological or clinical samples is critical in correlation with the functions of glycans with diseases. Profiling of glycans by HPLC-MS is a commonly used technique in analyzing glycan structures and quantifying their relative abundance in different biological systems. Methods relied on MS require isolation of glycans from negligible salts and other contaminant ions since salts and ions may interfere with the glycans, resulting in poor glycan ionization. To accomplish those objectives, glycan isolation and clean-up methods including SPE, liquid-phase extraction, chromatography, and electrophoresis have been developed. Traditionally, glycans are isolated from proteins or peptides using a combination of hydrophobic and hydrophilic columns: proteins and peptides remain on hydrophobic absorbent while glycans, salts, and other hydrophilic reagents are collected as flowthrough. The glycans in the flowthrough are then purified through graphite-activated carbon column by hydrophilic interaction LC. Yet, the drawback in these affinity-based approaches is nonspecific binding. As a result, chemical methods by hydrazide or oxime have been developed for solid-phase isolation of glycans with high specificity and yield. Combined with high-resolution MS, specific glycan isolation techniques provide tremendous potentials as useful tools for glycomics analysis. PMID:23090885

  3. Manual Solid-Phase Peptide Synthesis of Metallocene-Peptide Bioconjugates

    ERIC Educational Resources Information Center

    Kirin, Srecko I.; Noor, Fozia; Metzler-Nolte, Nils; Mier, Walter

    2007-01-01

    A simple and relatively inexpensive procedure for preparing a biologically active peptide using solid phase peptide synthesis (SPPS) is described. Fourth-year undergraduate students have gained firsthand experience from the solid-phase synthesis techniques and they have become familiar with modern analytical techniques based on the particular…

  4. New methods and materials for solid phase extraction and high performance liquid chromatography

    SciTech Connect

    Dumont, P.J.

    1996-04-23

    This paper describes methods for solid phase extraction and high performance liquid chromatography (HPLC). The following are described: Effects of Resin Sulfonation on the Retention of Polar Organic Compounds in Solid Phase Extraction; Ion-Chromatographic Separation of Alkali Metals In Non-Aqueous Solvents; Cation-Exchange Chromatography in Non-Aqueous Solvents; and Silicalite As a Stationary Phase For HPLC.

  5. Novel materials and methods for solid-phase extraction and liquid chromatography

    SciTech Connect

    Ambrose, D.

    1997-06-24

    This report contains a general introduction which discusses solid-phase extraction and solid-phase micro-extraction as sample preparation techniques for high-performance liquid chromatography, which is also evaluated in the study. This report also contains the Conclusions section. Four sections have been removed and processed separately: silicalite as a sorbent for solid-phase extraction; a new, high-capacity carboxylic acid functionalized resin for solid-phase extraction; semi-micro solid-phase extraction of organic compounds from aqueous and biological samples; and the high-performance liquid chromatographic determination of drugs and metabolites in human serum and urine using direct injection and a unique molecular sieve.

  6. Development of novel solid-phase protein formulations

    NASA Astrophysics Data System (ADS)

    Montalvo Ortiz, Brenda Liz

    Proteins are the next-generation drugs for the treatment of several diseases. However, the number of protein drugs is still limited due to the physical or chemical instability of proteins during processing, formulation, storage, and delivery. The formulation of proteins at the solid state has advantages over liquid state, such as improved stability during long-term storage and delivery and decreases transportation costs. In this dissertation, we developed new solid-phase protein formulations in which the integrity of the protein was not compromised. The long term goal of this research was to use these protein formulations to improve protein stability in drug delivery devices, such as poly(lactic-co-glycolic) acid (PLGA). The first solid-phase protein formulation developed in this investigation was named "glassification". We proposed glassification as an alternative protein dehydration technique to the common used one, lyophilization, because this last method involves a series of steps which are detrimental to protein structure and stability. The glassification method consisted on protein dehydration by the use of organic solvents. As a result of the glassification process a small (micrometer size range) protein solid bead was obtained. The proteins used to study the glassification process were lysozyme (LYS), alpha-chymotrypsin (CHYMO) and horseradish peroxidase (HRP). These studies revealed that the glassification process itself did not alter protein structure and the activity was preserved. Ethyl acetate was the most effective organic solvent for protein glassification because it led to the highest protein residual activity, no insoluble aggregate formation and is a relatively non-toxic solvent, which allow the incorporation of these protein microparticles in PLGA microspheres. The incorporation of spherical HRP microparticles into PLGA microspheres resulted in superior properties when compared with encapsulated lyophilized HRP powder, such as improved release

  7. Versatile Solid Phase Syntheses of Structured Nanoparticle Hybrids

    NASA Astrophysics Data System (ADS)

    Koberstein, Jeffrey

    2011-03-01

    While it is widely recognized that nanoparticles can exhibit a wide variety of exciting size-dependent properties and responses, it is equally important to recognize that devices and systems cannot be created from bare nanoparticles alone. The potential of nanoparticles can only be achieved by proper consideration of matrices that not only provide mechanical support and integrity to the nanoparticles, but can also control various aspects of their spatial assembly such as geometry and interparticle spacing. Polymers represent a logical and robust matrix for the creation of nanocomposite assemblies, however, phenomena such as aggregation are often problematic when blending nanoparticles and homopolymers. These problems can be avoided by preparation of nanoparticle hybrids wherein all required polymers are covalently tethered to the nanoparticles prior to assembly so that a polymer matrix is not necessary. We report on a new method for covalent decoration of nanoparticles with polymers of tailored molecular design that is based upon a solid phase synthesis strategy. The modular process, much like molecular Tinker Toys, is capable of decorating nanoparticles with essentially any type of branched or copolymeric structure using only a few elementary heterobifunctional building blocks. Because end group functionality is always retained in the process, functional nanoparticles can be readily crosslinked by simple orthogonal reactions such as azide-alkyne click chemistry. The method can be used to create sophisticated hybrid nanoparticle structures important to drug delivery applications, to form highly functional crosslinkers that gel at conversions as low as a few percent, or to fabricate crosslinked matrix-free nanocomposites. Supported by grants DMR-0704054 from the NSF and W911NF-10-1-0184 from the US Army Research Office.

  8. Solid-phase synthesis of peptide-4-nitroanilides.

    PubMed

    Kaspari, A; Schierhorn, A; Schutkowski, M

    1996-11-01

    A wide variety of Glu/Asp and Gln containing peptide-4-nitroanilides and other chromogenic peptidyl-arylamides could be quickly synthesized by a Fmoc-based solid-phase synthesis strategy employing the side-chain carboxyl groups for transient anchoring to the resin. Suitable synthons for this method, Fmoc-Glu-NH-Np and Fmoc-Asp-NH-Np, were prepared using a diphenylphosphinic chloride-mediated coupling reaction. Peptides of the common structure Suc-Ala-Phe-Pro-Xaa-NH-Np (Xaa = Glu/Asp, Gln) were synthesized and were shown to be substrates for the protease subtilisin Carlsberg (E.C.3.4.21.14a) and for peptidyl-prolyl cis/trans-isomerases (PPIases E.C. 5.2.1.8.). The method was extended to amino acids possessing a side chain missing an anchor for binding to the matrix. We synthesized Suc-Ala-Phe-Pro-Gln-Phe-NH-Np anchoring the dipeptide derivative Fmoc-Glu-Phe-NH-Np with the carboxyl group to Rink amide resin using standard SPPS procedures. Additionally this procedure allowed us the preparation of peptidyl-arylamides, utilizing the commercial available Fmoc-Glu-OAll as building block. A mixture of pentapeptide-4-nitroanilides with the general sequence Ala-Ala-Xaa-Pro-Gln-NH-Np was synthesized. Electrospray ionization mass spectrometry (ESI-MS) was used to evaluate the hydrolysis of the peptide mixture by the protease subtilisin Carlsberg. It could be shown that peptides with the hydrophobic amino acids Phe, Tyr, Leu and Val in the varied P3-position were most rapidly cleaved under the chosen conditions. Hydrolysis of the Gln-NH-Np bond in Ala-Ala-Pro-Pro-Gln-NH-Np has not been observed.

  9. Application of solid phase microextraction on dental composite resin analysis.

    PubMed

    Wang, Ven-Shing; Chang, Ta-Yuan; Lai, Chien-Chen; Chen, San-Yue; Huang, Long-Chen; Chao, Keh-Ping

    2012-08-15

    A direct immersion solid phase microextraction (DI-SPME) method was developed for the analysis of dentin monomers in saliva. Dentine monomers, such as triethylene glycol dimethacrylate (TEGDMA), urethane dimethacrylate (UDMA) and 2,2-bis-[4-(2-hydroxy-3-methacryloyloxypropoxy) phenyl]-propane (Bis-GMA), have a high molecular weight and a low vapor pressure. The polydimethylsiloxane/divinylbenzene (PDMS/DVB) fiber with a medium polarity was employed for DI-SPME, and 215 nm of detection wavelength was found to be optimum in the chromatogram of HPLC measurement. The calibration range for DI-SPME was 0.30-300 μg/mL with correlation coefficients (r) greater than 0.998 for each analyte. The DI-SPME method achieved good accuracy (recovery 96.1-101.2%) and precision (2.30-8.15% CV) for both intra- and inter-day assays of quality control samples for three target compounds. Method validation was performed on standards dissolved in blank saliva, and there was no significant difference (p>0.2) between the DI-SPME method and the liquid injection method. However, the detection limit of DI-SPME was as low as 0.03, 0.27 and 0.06 μg/mL for TEGDMA, UDMA and Bis-GMA, respectively. Real sample analyses were performed on commercial dentin products after curing for the leaching measurement. In summary, DI-SPME is a more sensitive method that requires less sample pretreatment procedures to measure the resin materials leached in saliva.

  10. Porous, High Capacity Coatings for Solid Phase Microextraction by Sputtering.

    PubMed

    Diwan, Anubhav; Singh, Bhupinder; Roychowdhury, Tuhin; Yan, DanDan; Tedone, Laura; Nesterenko, Pavel N; Paull, Brett; Sevy, Eric T; Shellie, Robert A; Kaykhaii, Massoud; Linford, Matthew R

    2016-02-01

    We describe a new process for preparing porous solid phase microextraction (SPME) coatings by the sputtering of silicon onto silica fibers. The microstructure of these coatings is a function of the substrate geometry and mean free path of the silicon atoms, and the coating thickness is controlled by the sputtering time. Sputtered silicon structures on silica fibers were treated with piranha solution (a mixture of concd H2SO4 and 30% H2O2) to increase the concentration of silanol groups on their surfaces, and the nanostructures were silanized with octadecyldimethylmethoxysilane in the gas phase. The attachment of this hydrophobic ligand was confirmed by X-ray photoelectron spectroscopy and contact angle goniometry on model, planar silicon substrates. Sputtered silicon coatings adhered strongly to their surfaces, as they were able to pass the Scotch tape adhesion test. The extraction time and temperature for headspace extraction of mixtures of alkanes and alcohols on the sputtered fibers were optimized (5 min and 40 °C), and the extraction performances of SPME fibers with 1.0 or 2.0 μm of sputtered silicon were compared to those from a commercial 7 μm poly(dimethylsiloxane) (PDMS) fiber. For mixtures of alcohols, aldehydes, amines, and esters, the 2.0 μm sputtered silicon fiber yielded signals that were 3-9, 3-5, 2.5-4.5, and 1.5-2 times higher, respectively, than those of the commercial fiber. For the heavier alkanes (undecane-hexadecane), the 2.0 μm sputtered fiber yielded signals that were approximately 1.0-1.5 times higher than the commercial fiber. The sputtered fibers extracted low molecular weight analytes that were not detectable with the commercial fiber. The selectivity of the sputtered fibers appears to favor analytes that have both a hydrophobic component and hydrogen-bonding capabilities. No detectable carryover between runs was noted for the sputtered fibers. The repeatability (RSD%) for a fiber (n = 3) was less than 10% for all analytes tested

  11. Determining the solid phases hosting arsenic in Mekong Delta sediments

    NASA Astrophysics Data System (ADS)

    Wucher, M.; Stuckey, J. W.; McCurdy, S.; Fendorf, S.

    2011-12-01

    The major river systems originating from the Himalaya deposit arsenic bearing sediment into the deltas of South and Southeast Asia. High rates of sediment and organic carbon deposition combined with frequent flooding leads to anaerobic processes that release arsenic into the pore-water. Arsenic concentrations in the groundwater of these sedimentary basins are often above the World Health Organization drinking water standard of 10 μg As L-1. As a result, 150 million people are at risk of chronic arsenic poisoning through water and rice consumption. The composition of the iron bearing phases hosting the arsenic in these deltaic sediments is poorly understood. Here we implemented a suite of selective chemical extractions to help constrain the types of arsenic bearing solid phases, which were complimented with synchrotron-based X-ray absorption spectroscopy and X-ray diffraction analyses to define the arsenic and iron mineralogy of the system. Sediment cores were collected in triplicate from a seasonally-inundated wetland in Cambodia at depths of 10, 50, 100, and 150 centimeters. We hypothesize that (i) arsenic will be predominantly associated with iron oxides, and (ii) the ratio of crystalline to amorphous iron oxides will increase with sediment depth (and age). We performed four selective extractions in parallel to quantify the various pools of arsenic. First, 1 M MgCl2 was used to extract electrostatically-bound arsenic (labile forms) from the sediment. Second, 1 M NaH2PO4 targeted strongly adsorbed arsenic. Third, 1 M HCl was used to liberated arsenic coprecipitated with amorphous Fe/Mn oxides, carbonates, and acid-volatile sulfides. Finally, a dithionite extraction was used to account for arsenic associated with reducible Fe/Mn oxides. Through this work, we identified the composition of the phases hosting arsenic at various depths through the soil profile, improving our understanding of how arsenic persists in the aquifer. In addition, defining the arsenic and

  12. Use of continuous solid-phase synthesis to obtain phosphors based on strontium aluminate

    NASA Astrophysics Data System (ADS)

    Kerbel, B.; Katsnelson, L.; Falkovich, Yu; Prokopyev, D.

    2016-02-01

    The effect of conditions of continuous solid-phase synthesis on particle size distribution of nanostructured powders of strontium aluminate was studied. It was shown that continuous solid-phase synthesis allows for: synthesis of strontium aluminate in the form of nanostructured powders with controlled particle size distribution directly during its synthesis; in the presence of a liquid phase strontium aluminate is synthesized with a high level of monophasity. It was shown that in order to optimize the illuminating parameters of phosphors based on strontium aluminate, it is advisable to use continuous solid-phase synthesis.

  13. DETERMINATION OF CHLOROETHENES IN ENVIRONMENTAL BIOLOGICAL SAMPLES USING GAS CHROMATOGRAPHY COUPLED WITH SOLID PHASE MICRO EXTRACTION

    EPA Science Inventory

    An analytical method has been developed to determine the chloroethene series, tetrachloroethene (PCE), trichloroethene (TCE),cisdichloroethene (cis-DCE) andtransdichloroethene (trans-DCE) in environmental biotreatment studies using gas chromatography coupled with a solid phase mi...

  14. EVALUATION OF SOLID PHASE MICROEXTRACTION FOR THE ANALYSIS OF HYDROPHILIC COMPOUNDS

    EPA Science Inventory

    Two commercially available solid phase microextractions (SPME) fibers, polyacrylate and carboxem/polydimethylsiloxane (PDMS), were evaluated for their ability to extract hydrophilic compounds from drinking water. Conditions, such as desorption time, desorption temperature, sample...

  15. Colorimetric monitoring of formaldehyde in indoor environment using built-in camera on mobile phone.

    PubMed

    Sekine, Yoshika; Katori, Risa; Tsuda, Yuko; Kitahara, Takio

    2016-01-01

    A simple monitoring system of indoor air pollution is proposed by integrating a novel colorimetric detector of formaldehyde (HCHO) and a function of a built-in camera on mobile phone. The colorimetric detector employs a solid phase colorimetric reagent made from 4-amino-3-hydrazino-5-mercapto-1,2,4-triazole, ZnO, KIO4 and agar, and changes colour from white to purple by exposure to HCHO gas. The degree of colour changes expressed in Red, Green and Blue model model responded to the HCHO concentration levels both in air and from building materials. Limit of quantitation of the detector with 24 h-exposure resulted in 0.011 mg/m(3) of air concentration which meets a requirement of methodology to detect indoor air quality guideline level of HCHO set by World Health Organization. The detector is also applicable to classify HCHO-emitting materials at least into Type 1, whose emission flux is greater than 120 μg/m(2)/h, and others. Then, variation of the acquired photo images was investigated by using various mobile phones and changing conditions of photography. As a result, the calibration of the measured colour intensity with a colour standard reduced the variation of the results and gave a significant output when the auto-focused images were taken under the condition of common indoor environment. PMID:26616679

  16. Simple colorimetric method determines uranium in tissue

    NASA Technical Reports Server (NTRS)

    Doran, D.; Frigerio, N. A.

    1967-01-01

    Simple colorimetric micromethod determines concentrations of uranium in tissue. The method involves dry ashing organic extraction, and colorimetric determination of uranyl ferrocyanide. This uranium determination technique could be used in agricultural research, tracer studies, testing of food products, or medical research.

  17. Colorimetric evaluation of display performance

    NASA Astrophysics Data System (ADS)

    Kosmowski, Bogdan B.

    2001-08-01

    The development of information techniques, using new technologies, physical phenomena and coding schemes, enables new application areas to be benefited form the introduction of displays. The full utilization of the visual perception of a human operator, requires the color coding process to be implemented. The evolution of displays, from achromatic (B&W) and monochromatic, to multicolor and full-color, enhances the possibilities of information coding, creating however a need for the quantitative methods of display parameter assessment. Quantitative assessment of color displays, restricted to photometric measurements of their parameters, is an estimate leading to considerable errors. Therefore, the measurements of a display's color properties have to be based on spectral measurements of the display and its elements. The quantitative assessment of the display system parameters should be made using colorimetric systems like CIE1931, CIE1976 LAB or LUV. In the paper, the constraints on the measurement method selection for the color display evaluation are discussed and the relations between their qualitative assessment and the ergonomic conditions of their application are also presented. The paper presents the examples of using LUV colorimetric system and color difference (Delta) E in the optimization of color liquid crystal displays.

  18. Enhanced denitrification of Pseudomonas stutzeri by a bioelectrochemical system assisted with solid-phase humin.

    PubMed

    Xiao, Zhixing; Awata, Takanori; Zhang, Dongdong; Zhang, Chunfang; Li, Zhiling; Katayama, Arata

    2016-07-01

    The denitrification reactions performed by Pseudomonas stutzeri JCM20778 were enhanced electrochemically with the use of solid-phase humin, although P. stutzeri itself was incapable of receiving electrons directly from the graphite electrode. Electrochemically reduced humin enhanced the microbial, but not abiotic, denitrification reactions. Electric current and cyclic voltammetry analyses suggested that the solid-phase humin functioned as an electron donor for the denitrification reactions of P. stutzeri. Nitrogen balance study and the estimation of the first-order rate constants of the consecutive denitrification reactions suggested that the solid-phase humin enhanced all reducing reactions from nitrate to nitrogen gas. Considering the wide distribution of humin in the environment, the findings that solid-phase humin can assist in electron transfer, from the electrode to a denitrifying bacterium that has little ability to directly utilize external electrons, has important implications for the widespread application of bioelectrochemical systems assisted by solid-phase humin for enhancing microbial denitrification.

  19. Determination of melamine in aquaculture feed samples based on molecularly imprinted solid-phase extraction.

    PubMed

    Lian, Ziru; Liang, Zhenlin; Wang, Jiangtao

    2015-10-01

    This research highlights the application of highly efficient molecularly imprinted solid-phase extraction for the preconcentration and analysis of melamine in aquaculture feed samples. Melamine-imprinted polymers were synthesized employing methacrylic acid and ethylene glycol dimethacrylate as functional monomer and cross-linker, respectively. The characteristics of obtained polymers were evaluated by scanning electron microscopy, Fourier transform infrared spectroscopy and binding experiments. The imprinted polymers showed an excellent adsorption ability for melamine and were applied as special solid-phase extraction sorbents for the selective cleanup of melamine. An off-line molecularly imprinted solid-phase extraction procedure was developed for the separation and enrichment of melamine from aquaculture feed samples prior to high-performance liquid chromatography analysis. Optimum molecularly imprinted solid-phase extraction conditions led to recoveries of the target in spiked feed samples in the range 84.6-96.6% and the relative standard deviation less than 3.38% (n = 3). The aquaculture feed sample was determined, and there was no melamine found. The results showed that the molecularly imprinted solid-phase extraction protocols permitted the sensitive, uncomplicated and inexpensive separation and pre-treatment of melamine in aquaculture feed samples.

  20. Structural and optical properties of solid-phase singlet oxygen photosensitizers based on fullerene aqueous suspensions

    NASA Astrophysics Data System (ADS)

    Belousova, I. M.; Belousov, V. P.; Kiselev, V. M.; Murav'eva, T. D.; Kislyakov, I. M.; Sirotkin, A. K.; Starodubtsev, A. M.; Kris'ko, T. K.; Bagrov, I. V.; Ermakov, A. V.

    2008-11-01

    The relationship between the structural and photosensitizing properties of solid-phase particles of fullerene C60 in aqueous suspensions is studied using the methods of absorption spectroscopy, electron spin resonance spectroscopy (ESR), X-ray diffraction, and spectrophotometry of solutions of singlet oxygen chemical traps—histidine in combination with p-nitrosodimethylaniline. Two new variants are proposed for obtaining aqueous suspensions of particles of solid-phase fullerene whose structures are disordered and whose degrees of amorphization are 67 and 40%, respectively. It is shown that an increase in the disorder of the structure of particles in suspensions and a decrease in their average size facilitate an increase in the formation efficiency of singlet oxygen by solid-phase fullerene presumably due to an in increase in the concentration of surface localized excitons.

  1. The Use of Functional Nucleic Acids in Solid-Phase Fluorimetric Assays

    NASA Astrophysics Data System (ADS)

    Rupcich, Nicholas; Nutiu, Razvan; Shen, Yutu; Li, Yingfu; Brennan, John D.

    The past 15 years have seen a revolution in the area of functional nucleic acid (FNA) research since the demonstration that single-stranded RNA and DNA species can be used for both ligand binding and catalysis. An emerging area of application for such species is in the development of solid-phase fluorimetric assays for biosensing, proteomics, and drug screening purposes. In this chapter, the methods for immobilization of functional nucleic acids are briefly reviewed, with emphasis on emerging technologies such as sol-gel encapsulation. Methods for generating fluorescence signals from aptamers and nucleic acid enzymes are then described, and the use of such species in solid-phase fluorimetric assays is then discussed. Unique features of sol-gel based materials for the development of solid-phase assays are highlighted, and some emerging applications of immobilized FNA species are discussed.

  2. Solid-Phase Synthesis of Amine/Carboxyl Substituted Prolines and Proline Homologues: Scope and Limitations.

    PubMed

    Zhou, Ziniu; Scott, William L; O'Donnell, Martin J

    2016-03-15

    A solid-phase procedure is used to synthesize racemic peptidomimetics based on the fundamental peptide unit. The peptidomimetics are constructed around proline or proline homologues variably substituted at the amine and carbonyl sites. The procedure expands the diversity of substituted peptidomimetic molecules available to the Distributed Drug Discovery (D3) project. Using a BAL-based solid-phase synthetic sequence the proline or proline homologue subunit is both constructed and incorporated into the peptidomimetic by an α-alkylation, hydrolysis and intramolecular cyclization sequence. Further transformations on solid-phase provide access to a variety of piperazine derivatives representing a class of molecules known to exhibit central nervous system activity. The procedure works well with proline cores, but with larger six- and seven-membered ring homologues the nature of the carboxylic acid acylating the cyclic amine can lead to side reactions and result in poor overall yields.

  3. Proposed method for controlling turbid particles in solid-phase bioluminescent toxicity measurement.

    PubMed

    Yeo, Seul-Ki; Park, Jun-Boum; Ahn, Joo-Sung; Han, Young-Soo

    2015-06-01

    In the recent half century, numerous methods have been developed to assess ecological toxicity. However, the presence of solid-particle turbidity sometimes causes such tests to end with questionable results. Many researchers focused on controlling this arbitrary turbidity effect when using the Microtox® solid-phase toxicity system, but there is not yet a standard method. In this study, we examined four solid-phase sample test methods recommended in the Microtox® manual, or proposed from the literature, and compared the existing methods with our proposed method (centrifuged basic solid-phase test, c-BSPT). Four existing methods use the following strategies to control turbid particles: complete separation of liquid and solid using 0.45-μm filtration before contacting solid samples and bacteria, natural settlement, moderate separation of large particles using coarser pore size filtration, and exclusion of light loss in the toxicity calculation caused by turbidity after full disturbance of samples. Our proposed method uses moderate centrifugation to separate out the heavier soil particles from the lighter bacteria after direct contact between them. Among the solid-phase methods tested, in which the bacteria and solid particles were in direct contact (i.e., the three existing methods and the newly proposed one, c-BSPT), no single method could be recommended as optimal for samples over a range of turbidity. Instead, a simple screening strategy for selecting a sample-dependent solid-phase test method was suggested, depending on the turbidity of the solid suspension. The results of this study highlight the importance of considering solid particles, and the necessity for optimal selection of test method to reduce errors in the measurement of solid-phase toxicity.

  4. Analysis of the structure of synthetic and natural melanins by solid-phase

    SciTech Connect

    Duff, G.A.; Roberts, J.E.; Foster, N.

    1988-09-06

    The structures of one synthetic and two natural melanins are examined by solid-state NMR using cross polarization, magic angle sample spinning, and high-power proton decoupling. The structural features of synthetic dopa malanin are compared to those of melanin from malignant melanoma cells grown in culture and sepia melanin from squid ink. Natural abundance /sup 13/C and /sup 15/N spectra show resonances consistent with known pyrrolic and indolic structures within the heterogeneous biopolymer; /sup 13/C spectra indicate the presence of aliphatic residues in all three materials. These solid-phase experiments illustrate the promise of solid-phase NMR for elucidating structural from insoluble biomaterials.

  5. Solid-phase synthetic route to multiple derivatives of a fundamental peptide unit.

    PubMed

    Scott, William L; Zhou, Ziniu; Zajdel, Paweł; Pawłowski, Maciej; O'Donnell, Martin J

    2010-07-20

    Amino acids are Nature's combinatorial building blocks. When substituted on both the amino and carboxyl sides they become the basic scaffold present in all peptides and proteins. We report a solid-phase synthetic route to large combinatorial variations of this fundamental scaffold, extending the variety of substituted biomimetic molecules available to successfully implement the Distributed Drug Discovery (D3) project. In a single solid-phase sequence, compatible with basic amine substituents, three-point variation is performed at the amino acid a-carbon and the amino and carboxyl functionalities.

  6. CuAAC: An Efficient Click Chemistry Reaction on Solid Phase.

    PubMed

    Castro, Vida; Rodríguez, Hortensia; Albericio, Fernando

    2016-01-11

    Click chemistry is an approach that uses efficient and reliable reactions, such as Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC), to bind two molecular building blocks. CuAAC has broad applications in medicinal chemistry and other fields of chemistry. This review describes the general features and applications of CuAAC in solid-phase synthesis (CuAAC-SP), highlighting the suitability of this kind of reaction for peptides, nucleotides, small molecules, supramolecular structures, and polymers, among others. This versatile reaction is expected to become pivotal for meeting future challenges in solid-phase chemistry.

  7. Solid-Phase Spectrophotometric Analysis of 1-Naphthol Using Silica Functionalized with m-Diazophenylarsonic Acid

    NASA Astrophysics Data System (ADS)

    Zaitseva, Nataliya; Alekseev, Sergei; Zaitsev, Vladimir; Raks, Viktoria

    2016-03-01

    The m-aminophenylarsonic acid (m-APAA) was immobilized onto the silica gel surface with covalently grafted quaternary ammonium groups via ion exchange. The diazotization of ion-bonded m-APAA resulted in a new solid-phase spectrophotometric reagent for detection of 1-naphtol in environmental water samples. The procedure of solid-phase spectrophotometric analysis is characterized by 20 μg L-1 limit of detection (LOD) of 1-naphtol, up to 2000 concentration factor, and insensitivity to the presence of natural water components as well as to 30-fold excess of phenol, resorcinol, and catechol.

  8. Automated extraction of acetylgestagens from kidney fat by matrix solid phase dispersion.

    PubMed

    Rosén, J; Hellenäs, K E; Törnqvist, P; Shearan, P

    1994-12-01

    A new extraction method for the acetylgestagens medroxyprogesterone acetate (MPA), chloromadinone acetate and megestrol acetate, from kidney fat, has been developed. The method is a combination of matrix solid phase dispersion and solid phase extraction and is simpler and safer than previous methods, especially as it can be automated. The recovery was estimated as 59 +/- 5% (mean +/- standard deviation) for MPA. For screening purposes detection can be achieved using a commercially available enzyme immunoassay kit giving detection limits in the range of 1.0-2.0 ng g-1.

  9. Solid-phase trapping of solutes for further chromatographic or electrophoretic analysis.

    PubMed

    Frit, J S; Macka, M

    2000-12-01

    Because of its simplicity, speed and effectiveness, solid-phase extraction (SPE) has become the preferred technique for concentration of selected analytes prior to chromatographic or electrophoretic analysis. In this review the historical development of SPE is briefly traced. Then the principles of SPE are reviewed in some detail. Numerous references are given on the format, sorbents, elution conditions, online techniques and automation with special emphasis on relatively recent developments. The principles and recent advances in solid-phase microextraction (SPME) are also reviewed. The final section on selected recent applications includes an extensive list of references to work published within the last three years. Future trends and developments are discussed briefly.

  10. Use of the 2-chlorotrityl chloride resin for microwave-assisted solid phase peptide synthesis.

    PubMed

    Ieronymaki, Matthaia; Androutsou, Maria Eleni; Pantelia, Anna; Friligou, Irene; Crisp, Molly; High, Kirsty; Penkman, Kirsty; Gatos, Dimitrios; Tselios, Theodore

    2015-09-01

    A fast and efficient microwave (MW)-assisted solid-phase peptide synthesis protocol using the 2-chlorotrityl chloride resin and the Fmoc/tBu methodology, has been developed. The established protocol combines the advantages of MW irradiation and the acid labile 2-chlorotrityl chloride resin. The effect of temperature during the MW irradiation, the degree of resin substitution during the coupling of the first amino acids and the rate of racemization for each amino acid were evaluated. The suggested solid phase methodology is applicable for orthogonal peptide synthesis and for the synthesis of cyclic peptides. PMID:26270247

  11. Selective enrichment of phenols from coal liquefaction oil by solid phase extraction method

    SciTech Connect

    Tian, M.; Feng, J.

    2009-07-01

    This study focuses on the solid phase extraction method for the enrichment and separation of phenol from coal liquefaction oil. The phenols' separation efficiency was compared on different solid phase extraction (SPE) cartridges, and the effect of solvents with different polarity and solubility parameter on amino-bonded silica was compared for selection of optimal elution solution. The result showed that amino-bonded silica has the highest selectivity and best extraction capability due to two factors, weak anion exchange adsorption and polar attraction adsorption.

  12. Detection of ibuprofen and ciprofloxacin by solid-phase extraction and UV/Vis spectroscopy

    NASA Astrophysics Data System (ADS)

    Zhou, Zhengwei; Jiang, Jia Qian

    2012-07-01

    A simple and economic solid-phase extraction coupled with UV/Vis spectrophotometric method is described for the analysis of ibuprofen and ciprofloxacin. Following solid-phase extraction from model wastewater samples containing standard ibuprofen or ciprofloxacin, elutes were analyzed by a UV/Vis spectrophotometer at 225 nm for ibuprofen and 280 nm for ciprofloxacin. The assay was linear for both compounds with good coefficients of correlation. This method shows good recoveries for both compounds with 101.0 ± 9.8% for ibuprofen and 99.4 ± 11.8% ciprofloxacin.

  13. Use of a solid phase red blood cell adherence method for pretransfusion platelet compatibility testing.

    PubMed

    Rachel, J M; Summers, T C; Sinor, L T; Plapp, F V

    1988-07-01

    A solid phase red blood cell adherence method has been used for platelet antibody detection and crossmatching for refractory platelet recipients. Patient sera were first screened for HLA or platelet-specific antibodies, then crossmatched with potential apheresis platelet donors. The overall correlation of platelet crossmatch results with transfusion outcome was 97% in patients with no evidence of nonimmune platelet destruction. The solid phase red blood cell adherence method provided a feasible and effective alternative to HLA matching as a means of donor selection for refractory platelet recipients. The speed and simplicity of this method may allow most hospital laboratories to perform platelet antibody screening before routine platelet transfusions.

  14. Reusable and specific proton transfer signalling by inorganic cyanide in solution and solid phase.

    PubMed

    Kaloo, Masood Ayoub; Sankar, Jeyaraman

    2015-10-01

    A highly specific cyanide mediated proton transfer signalling (PTS) is exhibited by a simple diaminomalenonitrile (DAMN) derivative 1. By virtue of the functional groups on it, the chromophore offered a rigid anchoring on a silica surface via a simple dip method, while retaining the recognition behaviour. The PTS triggered a prompt dual-modal display i.e., chromogenic and fluorogenic. The signal readout can be visualized even in micromolar concentrations. It is noteworthy that PTS can be reversed in both solution and solid phases. The remarkable sensitivity of 1 to detect CN(-) from the solution and solid phase envisages a pivotal step towards field-usable sensing.

  15. Optimetric system facilitates colorimetric and fluorometric measurements

    NASA Technical Reports Server (NTRS)

    Haley, F. C.

    1968-01-01

    Compact, unitary optimetric systems uses a single device for colorimetric, fluorometric and spectral absorption measurements. The basic element of the unitary systems is a test cell containing filter elements with uniquely fabricated lenses.

  16. Recent developments and future trends in solid phase microextraction techniques towards green analytical chemistry.

    PubMed

    Spietelun, Agata; Marcinkowski, Łukasz; de la Guardia, Miguel; Namieśnik, Jacek

    2013-12-20

    Solid phase microextraction find increasing applications in the sample preparation step before chromatographic determination of analytes in samples with a complex composition. These techniques allow for integrating several operations, such as sample collection, extraction, analyte enrichment above the detection limit of a given measuring instrument and the isolation of analytes from sample matrix. In this work the information about novel methodological and instrumental solutions in relation to different variants of solid phase extraction techniques, solid-phase microextraction (SPME), stir bar sorptive extraction (SBSE) and magnetic solid phase extraction (MSPE) is presented, including practical applications of these techniques and a critical discussion about their advantages and disadvantages. The proposed solutions fulfill the requirements resulting from the concept of sustainable development, and specifically from the implementation of green chemistry principles in analytical laboratories. Therefore, particular attention was paid to the description of possible uses of novel, selective stationary phases in extraction techniques, inter alia, polymeric ionic liquids, carbon nanotubes, and silica- and carbon-based sorbents. The methodological solutions, together with properly matched sampling devices for collecting analytes from samples with varying matrix composition, enable us to reduce the number of errors during the sample preparation prior to chromatographic analysis as well as to limit the negative impact of this analytical step on the natural environment and the health of laboratory employees. PMID:24238710

  17. Development of a Solid Phase Extraction Method for Agricultural Pesticides in Large-Volume Water Samples

    EPA Science Inventory

    An analytical method using solid phase extraction (SPE) and analysis by gas chromatography/mass spectrometry (GC/MS) was developed for the trace determination of a variety of agricultural pesticides and selected transformation products in large-volume high-elevation lake water sa...

  18. Solid-phase microextraction of hydrocarbons from water in a centrifuge

    NASA Astrophysics Data System (ADS)

    Ryabov, A. Yu.; Chuikin, A. V.; Velikov, A. A.

    2016-06-01

    The results of our study of solid-phase microextraction of substances using a centrifuge for determining the microquantities of hydrocarbon impurities in water are presented. The cartridge diameter, sorbent mass, and solvent volume were shown to affect the percent extraction of substances and the analytical signal intensity. The relationship between the cartridge geometry, the sorbent mass, and the solvent volume was considered.

  19. A Discovery-Oriented Approach to Solid-Phase Peptide Synthesis

    ERIC Educational Resources Information Center

    Bockman, Matthew R.; Miedema, Christopher J.; Brennan, Brian B.

    2012-01-01

    In this discovery-oriented laboratory experiment, students use solid-phase synthesis techniques to construct a dipeptide containing an unknown amino acid. Following synthesis and cleavage from the polymeric support, electrospray ionization-mass spectrometry is employed to identify the unknown amino acid that was used in the peptide coupling. This…

  20. Determination of Plant Volatiles Using Solid Phase Microextraction GC-MS

    ERIC Educational Resources Information Center

    Van Bramer, Scott; Goodrich, Katherine R.

    2015-01-01

    This experiment combines analytical techniques of solid phase microextraction and gas chromatography-mass spectrometry with easily relatable and accessible plant volatile chemistry (floral and vegetative scents of local/available plants). The biosynthesis and structure of these chemicals are of interest in the areas of organic chemistry,…

  1. Effects of inoculum size on solid-phase fermentation of fodder beets for fuel ethanol production

    SciTech Connect

    Gibbons, W.R.; Westby, C.A.

    1986-10-01

    This fuel ethanol study examined the effects of Saccharomyces cerevisiae inoculum size on solid-phase fermentation of fodder beet pulp. A 5% inoculum (wt/wt) resulted in rapid yeast and ethanol (9.1% (vol/vol)) production. Higher inocula showed no advantages. Lower inocula resulted in lowered final yeast populations and increased fermentation times.

  2. COMPARISON OF TWO DIFFERENT SOLID PHASE EXTRACTION/LARGE VOLUME INJECTION PROCEDURES FOR METHOD 8270

    EPA Science Inventory

    Two solid phase (SPE) and one traditional continuous liquid-liquid extraction method are compared for analysis of Method 8270 SVOCs. Productivity parameters include data quality, sample volume, analysis time and solvent waste.

    One SPE system, unique in the U.S., uses aut...

  3. Use of Solid Phase Extraction in the Biochemistry Laboratory to Separate Different Lipids

    ERIC Educational Resources Information Center

    Flurkey, William H.

    2005-01-01

    Solid-phase extraction (SPE) was used to demonstrate how various lipids and lipid classes could be separated in a biochemistry laboratory setting. Three different SPE methods were chosen on their ability to separate a lipid mixture, consisting of a combination of a either a fatty acid, a triacylglycerol, a mono- or diacylglycerol, phospholipid,…

  4. THE DISTRIBUTION AND SOLID-PHASE SPECIATION OF AS IN IRON-BASED TREATMENT MEDIA

    EPA Science Inventory

    Arsenic concentrations (Total Recoverable As by EPA Method 3051) and solid-phase speciation (by X-ray Absorption Near-Edge Spectroscopy-XANES) were assessed as a function of depth through Fe-media beds for two commercially available products from pilot-scale field tests. These r...

  5. Final Report for Nucleation and growth of semiconductor nanocrystals by solid-phase reaction

    SciTech Connect

    P. D. Persans; T. M. Hayes

    2005-12-12

    This final report describes the technical output of a scientific program aimed at understanding the formation and structure of II-VI nanocrystals formed by solid phase precipitation within a glass environment. The principle probes were optical absorption spectroscopy to determine crystallite sizes, Raman scattering to determine composition, and x-ray absorption spectroscopy to study the evolution of local reactant environments.

  6. Solid phase stability of molybdenum under compression: Sound velocity measurements and first-principles calculations

    SciTech Connect

    Zhang, Xiulu; Liu, Zhongli; Jin, Ke; Xi, Feng; Yu, Yuying; Tan, Ye; Dai, Chengda; Cai, Lingcang

    2015-02-07

    The high-pressure solid phase stability of molybdenum (Mo) has been the center of a long-standing controversy on its high-pressure melting. In this work, experimental and theoretical researches have been conducted to check its solid phase stability under compression. First, we performed sound velocity measurements from 38 to 160 GPa using the two-stage light gas gun and explosive loading in backward- and forward-impact geometries, along with the high-precision velocity interferometry. From the sound velocities, we found no solid-solid phase transition in Mo before shock melting, which does not support the previous solid-solid phase transition conclusion inferred from the sharp drops of the longitudinal sound velocity [Hixson et al., Phys. Rev. Lett. 62, 637 (1989)]. Then, we searched its structures globally using the multi-algorithm collaborative crystal structure prediction technique combined with the density functional theory. By comparing the enthalpies of body centered cubic structure with those of the metastable structures, we found that bcc is the most stable structure in the range of 0–300 GPa. The present theoretical results together with previous ones greatly support our experimental conclusions.

  7. Recent developments and future trends in solid phase microextraction techniques towards green analytical chemistry.

    PubMed

    Spietelun, Agata; Marcinkowski, Łukasz; de la Guardia, Miguel; Namieśnik, Jacek

    2013-12-20

    Solid phase microextraction find increasing applications in the sample preparation step before chromatographic determination of analytes in samples with a complex composition. These techniques allow for integrating several operations, such as sample collection, extraction, analyte enrichment above the detection limit of a given measuring instrument and the isolation of analytes from sample matrix. In this work the information about novel methodological and instrumental solutions in relation to different variants of solid phase extraction techniques, solid-phase microextraction (SPME), stir bar sorptive extraction (SBSE) and magnetic solid phase extraction (MSPE) is presented, including practical applications of these techniques and a critical discussion about their advantages and disadvantages. The proposed solutions fulfill the requirements resulting from the concept of sustainable development, and specifically from the implementation of green chemistry principles in analytical laboratories. Therefore, particular attention was paid to the description of possible uses of novel, selective stationary phases in extraction techniques, inter alia, polymeric ionic liquids, carbon nanotubes, and silica- and carbon-based sorbents. The methodological solutions, together with properly matched sampling devices for collecting analytes from samples with varying matrix composition, enable us to reduce the number of errors during the sample preparation prior to chromatographic analysis as well as to limit the negative impact of this analytical step on the natural environment and the health of laboratory employees.

  8. Micro versus macro solid phase extraction for monitoring water contaminants: a preliminary study using trihalomethanes.

    PubMed

    Alexandrou, Lydon D; Spencer, Michelle J S; Morrison, Paul D; Meehan, Barry J; Jones, Oliver A H

    2015-04-15

    Solid phase extraction is one of the most commonly used pre-concentration and cleanup steps in environmental science. However, traditional methods need electrically powered pumps, can use large volumes of solvent (if multiple samples are run), and require several hours to filter a sample. Additionally, if the cartridge is open to the air volatile compounds may be lost and sample integrity compromised. In contrast, micro cartridge based solid phase extraction can be completed in less than 2 min by hand, uses only microlitres of solvent and provides comparable concentration factors to established methods. It is also an enclosed system so volatile components are not lost. The sample can also be eluted directly into a detector (e.g. a mass spectrometer) if required. However, the technology is new and has not been much used for environmental analysis. In this study we compare traditional (macro) and the new micro solid phase extraction for the analysis of four common volatile trihalomethanes (trichloromethane, bromodichloromethane, dibromochloromethane and tribromomethane). The results demonstrate that micro solid phase extraction is faster and cheaper than traditional methods with similar recovery rates for the target compounds. This method shows potential for further development in a range of applications.

  9. SOLID PHASE MICROEXTRACTION FOR TRACE LEVEL ANALYSIS OF DISINFECTION BY-PRODUCTS

    EPA Science Inventory

    This presentation focuses on the development of a solid-phase microextraction (SPME)-gas chromatography (GC)/ion trap mass spectrometry (MS) method for the analysis of semivolatile disinfection by-products (DBPs) in drinking water in the low ug/L range. These DBPs were selected ...

  10. Efficient solid phase strategy for preparation of modified xanthene dyes for biolabelling.

    PubMed

    Cardenas-Maestre, Juan M; Sanchez-Martin, Rosario M

    2011-03-21

    An efficient solid phase strategy for the versatile functionalisation of xanthene dyes for conjugation and labelling of biomolecules is presented. The low cost, high purity and excellent spectral properties of the obtained materials provide an attractive alternative for the labelling of a wide range of molecules.

  11. Deglycobleomycin: solid-phase synthesis and DNA cleavage by the resin-bound ligand.

    PubMed

    Smith, Kenneth L; Tao, Zhi-Fu; Hashimoto, Shigeki; Leitheiser, Christopher J; Wu, Xihan; Hecht, Sidney M

    2002-04-01

    [structure: see text] A greatly improved solid-phase synthesis of deglycobleomycin using a Dde-based linker is reported. The resin-bound deglycobleomycin could be completely deblocked and assayed for DNA plasmid relaxation, sequence-selective DNA cleavage, and light production from a molecular beacon.

  12. Influence of Calcium on Microbial Reduction of Solid Phase Uranium (VI)

    SciTech Connect

    Liu, Chongxuan; Jeon, Byong-Hun; Zachara, John M.; Wang, Zheming

    2007-06-27

    The effect of calcium on microbial reduction of a solid phase U(VI), sodium boltwoodite (NaUO2SiO3OH ∙1.5H2O), was evaluated in a culture of a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1. Batch experiments were performed in a non-growth bicarbonate medium with lactate as electron donor at pH 7 buffered with PIPES. Calcium increased both the rate and extent of Na-boltwoodite dissolution by increasing its solubility through the formation of a ternary aqueous calcium-uranyl-carbonate species. The ternary species, however, decreased the rates of microbial reduction of aqueous U(VI). Laser-induced fluorescence spectroscopy (LIFS) and transmission electron microscopy (TEM) revealed that microbial reduction of solid phase U(VI) is a sequentially coupled process of Na-boltwoodite dissolution, U(VI) aqueous speciation, and microbial reduction of dissolved U(VI) to U(IV) that accumulated on bacterial surfaces/periplasm. The overall rates of microbial reduction of solid phase U(VI) can be described by the coupled rates of dissolution and microbial reduction that were both influenced by calcium. The results demonstrated that dissolved U(VI) concentration during microbial reduction was a complex function of solid phase U(VI) dissolution kinetics, aqueous U(VI) speciation, and microbial activity.

  13. AUTOMATED SOLID PHASE EXTRACTION GC/MS FOR ANALYSIS OF SEMIVOLATILES IN WATER AND SEDIMENTS

    EPA Science Inventory

    Data is presented on the development of a new automated system combining solid phase extraction (SPE) with GC/MS spectrometry for the single-run analysis of water samples containing a broad range of organic compounds. The system uses commercially available automated in-line sampl...

  14. Biological nitrate removal from water and wastewater by solid-phase denitrification process.

    PubMed

    Wang, Jianlong; Chu, Libing

    2016-11-01

    Nitrate pollution in receiving waters has become a serious issue worldwide. Solid-phase denitrification process is an emerging technology, which has received increasing attention in recent years. It uses biodegradable polymers as both the carbon source and biofilm carrier for denitrifying microorganisms. A vast array of natural and synthetic biopolymers, including woodchips, sawdust, straw, cotton, maize cobs, seaweed, bark, polyhydroxyalkanoate (PHA), polycaprolactone (PCL), polybutylene succinate (PBS) and polylactic acid (PLA), have been widely used for denitrification due to their good performance, low cost and large available quantities. This paper presents an overview on the application of solid-phase denitrification in nitrate removal from drinking water, groundwater, aquaculture wastewater, the secondary effluent and wastewater with low C/N ratio. The types of solid carbon source, the influencing factors, the microbial community of biofilm attached on the biodegradable carriers, the potential adverse effect, and the cost of denitrification process are introduced and evaluated. Woodchips and polycaprolactone are the popular and competitive natural plant-like and synthetic biodegradable polymers used for denitrification, respectively. Most of the denitrifiers reported in solid-phase denitrification affiliated to the family Comamonadaceae in the class Betaproteobacteria. The members of genera Diaphorobacter, Acidovorax and Simplicispira were mostly reported. In future study, more attention should be paid to the simultaneous removal of nitrate and toxic organic contaminants such as pesticide and PPCPs by solid-phase denitrification, to the elucidation of the metabolic and regulatory relationship between decomposition of solid carbon source and denitrification, and to the post-treatment of the municipal secondary effluent. Solid-phase denitrification process is a promising technology for the removal of nitrate from water and wastewater.

  15. Biological nitrate removal from water and wastewater by solid-phase denitrification process.

    PubMed

    Wang, Jianlong; Chu, Libing

    2016-11-01

    Nitrate pollution in receiving waters has become a serious issue worldwide. Solid-phase denitrification process is an emerging technology, which has received increasing attention in recent years. It uses biodegradable polymers as both the carbon source and biofilm carrier for denitrifying microorganisms. A vast array of natural and synthetic biopolymers, including woodchips, sawdust, straw, cotton, maize cobs, seaweed, bark, polyhydroxyalkanoate (PHA), polycaprolactone (PCL), polybutylene succinate (PBS) and polylactic acid (PLA), have been widely used for denitrification due to their good performance, low cost and large available quantities. This paper presents an overview on the application of solid-phase denitrification in nitrate removal from drinking water, groundwater, aquaculture wastewater, the secondary effluent and wastewater with low C/N ratio. The types of solid carbon source, the influencing factors, the microbial community of biofilm attached on the biodegradable carriers, the potential adverse effect, and the cost of denitrification process are introduced and evaluated. Woodchips and polycaprolactone are the popular and competitive natural plant-like and synthetic biodegradable polymers used for denitrification, respectively. Most of the denitrifiers reported in solid-phase denitrification affiliated to the family Comamonadaceae in the class Betaproteobacteria. The members of genera Diaphorobacter, Acidovorax and Simplicispira were mostly reported. In future study, more attention should be paid to the simultaneous removal of nitrate and toxic organic contaminants such as pesticide and PPCPs by solid-phase denitrification, to the elucidation of the metabolic and regulatory relationship between decomposition of solid carbon source and denitrification, and to the post-treatment of the municipal secondary effluent. Solid-phase denitrification process is a promising technology for the removal of nitrate from water and wastewater. PMID:27396522

  16. Identification of unwanted photoproducts of cosmetic preservatives in personal care products under ultraviolet-light using solid-phase microextraction and micro-matrix solid-phase dispersion.

    PubMed

    Alvarez-Rivera, Gerardo; Llompart, Maria; Garcia-Jares, Carmen; Lores, Marta

    2015-04-17

    The photochemical transformation of widely used cosmetic preservatives including benzoates, parabens, BHA, BHT and triclosan has been investigated in this work applying an innovative double-approach strategy: identification of transformation products in aqueous photodegradation experiments (UV-light, 254nm), followed by targeted screening analysis of such photoproducts in UV-irradiated cosmetic samples. Solid-phase microextraction (SPME) was applied, using different fiber coatings, in order to widen the range of detectable photoproducts in water, whereas UV-irradiated personal care products (PCPs) containing the target preservatives were extracted by micro-matrix solid-phase dispersion (micro-MSPD). Both SPME and micro-MSPD-based methodologies were successfully optimized and validated. Degradation kinetics of parent species, and photoformation of their transformation by-products were monitored by gas chromatography coupled to mass spectrometry (GC-MS). Thirty nine photoproducts were detected in aqueous photodegradation experiments, being tentatively identified based on their mass spectra. Transformation pathways between structurally related by-products, consistent with their kinetic behavior were postulated. The photoformation of unexpected photoproducts such as 2- and 4-hydroxybenzophenones, and 2,8-dichlorodibenzo-p-dioxin in PCPs are reported in this work for the first time.

  17. Design, Certification, and Deployment of the Colorimetric Water Quality Monitoring Kit (CWQMK)

    NASA Technical Reports Server (NTRS)

    Gazda, Daniel B.; Nolan, Daniel J.; Rutz, Jeff A.; Schultz, John R.; Siperko, Lorraine M.; Porter, Marc D.; Lipert, Robert J.; Carrizales, Stephanie M.; McCoy, J. Torin

    2009-01-01

    In August 2009, an experimental water quality monitoring kit based on Colorimetric Solid Phase Extraction (CSPE) technology was delivered to the International Space Station (ISS) aboard STS-128/17A. The kit, called the Colorimetric Water Quality Monitoring Kit (CWQMK), was developed by a team of scientists and engineers from NASA s Habitability and Environmental Factors Division in the Space Life Sciences Directorate at Johnson Space Center, the Wyle Integrated Science and Engineering Group in Houston, Texas, the University of Utah, and Iowa State University. The CWQMK was flown and deployed as a Station Development Test Objective (SDTO) experiment on ISS. The goal of the SDTO experiment was to evaluate the acceptability of CSPE technology for routine water quality monitoring on ISS. This paper provides an overview of the SDTO experiment, as well as a detailed description of the CWQMK hardware and a summary of the testing and analysis conducted to certify the CWQMK for use on ISS. The results obtained from the SDTO experiment are also reported and discussed in detail.

  18. Microsticks as solid-phase carriers for enzyme-linked immunosorbent assays.

    PubMed Central

    Shekarchi, I C; Sever, J L; Ward, L A; Madden, D L

    1982-01-01

    Microsticks are machine-tooled or molded pegs of plastic or stainless steel which were developed as solid-phase carriers for the enzyme-linked immunosorbent assay (ELISA). They consist of a stem, which can be coated with plastic to be used as the reactive surface, and a shaft designed for easy handling and labeling and for positioning the sticks in microtiter wells and transfer plates. Microsticks permit a wide selection of coating materials and afford the user greater control over quality and standardization of the solid-phase surface. Polycarbonate and nitrocellulose coatings were tested in ELISAs for antibodies to measles virus, toxoplasma, and human gamma globulin. The Microsticks were found to give reproducible, sensitive, and specific ELISA results and minimized problems due to lot-to-lot and batch-to-batch variations found with other plastic carriers. PMID:6761355

  19. Solid phase graft copolymerization of acrylic monomers onto thermoplastics and their use as blend compatibilizers

    NASA Astrophysics Data System (ADS)

    Subramanian, Srinivas

    This research work is an extension of some of the earlier work done on the development of solid phase grafting technique to graft various monomers onto polymers as well as postulation of the usefulness of the graft copolymers thus synthesized. Polystyrene grafted with acrylic acid, previously developed in bench scale, was synthesized in pilot-plant scale batches. Process parameter studies on the grafting of acrylic acid onto polypropylene and developmental studies on the grafting of maleic anhydride onto polystyrene were also done. Polymers grafted with polar molecules such as maleic anhydride and acrylic acid have been used to compatibilize immiscible blends of polar and non-polar polymers. On the same note, the applicability of the solid phase graft copolymers as blend compatibilizers were investigated and their performance was compared to commercially available compatibilizers. Solid phase graft copolymerization process is a technique to synthesize graft copolymers. Some of its salient features are use of minimal solvent to conduct the reaction and easy equipment modification. It is a low pressure and low temperature process. This technique provides a viable alternative to the environmentally hazardous, and time consuming conventional process currently in use. Hence, development of this technique could be beneficial not only to the plastics industry, but also to mankind. Also, this technique provides a low-cost and extremely easy method to develop graft copolymers such as acrylic acid functionalized polymers that are rapidly gaining popularity as blend compatibilizers and polymer reinforcing agents. A study that proves the potential of these solid phase graft copolymers as good blend compatibilizers for industrially important immiscible polymers will develop interest in the industries about this grafting process. The free radical solid phase graft copolymerization process was carried in a modified Brabender-type mixer fitted with specially designed blades to

  20. Microwave spectroscopic observation of distinct electron solid phases in wide quantum wells.

    PubMed

    Hatke, A T; Liu, Yang; Magill, B A; Moon, B H; Engel, L W; Shayegan, M; Pfeiffer, L N; West, K W; Baldwin, K W

    2014-06-20

    In high magnetic fields, two-dimensional electron systems can form a number of phases in which interelectron repulsion plays the central role, since the kinetic energy is frozen out by Landau quantization. These phases include the well-known liquids of the fractional quantum Hall effect, as well as solid phases with broken spatial symmetry and crystalline order. Solids can occur at the low Landau-filling termination of the fractional quantum Hall effect series but also within integer quantum Hall effects. Here we present microwave spectroscopy studies of wide quantum wells that clearly reveal two distinct solid phases, hidden within what in d.c. transport would be the zero diagonal conductivity of an integer quantum-Hall-effect state. Explanation of these solids is not possible with the simple picture of a Wigner solid of ordinary (quasi) electrons or holes.

  1. Polydopamine supported preparation method for solid-phase microextraction coatings on stainless steel wire.

    PubMed

    Feng, Juanjuan; Sun, Min; Li, Jubai; Xu, Lili; Liu, Xia; Jiang, Shengxiang

    2011-06-10

    In this paper, we introduced a novel and versatile route to prepare solid-phase microextraction coatings on the chemically inert stainless steel wire. Polydopamine films can be created on metallic substrates by an oxidant-induced polymerization and subsequently support various secondary reactions to prepare functional surfaces. In the present work, polydopamine-bioactivated stainless steel wire was successfully modified by nanostructured hydroxyapatite. Extraction performance of the fiber was assessed on several polycyclic aromatic hydrocarbons in water solutions. Extraction mechanism was suggested based on the correlation of partition coefficients and LogPs. Both aqueous and solid real life samples were used to test the reliability of the solid-phase microextraction-gas chromatography method; some analytes were detected and quantified.

  2. The solid phase stress tensor in porous media mechanics and the Hill-Mandel condition

    NASA Astrophysics Data System (ADS)

    Gray, William G.; Schrefler, Bernhard A.; Pesavento, Francesco

    2009-03-01

    An assessment of the stress tensors used currently for the modeling of partially saturated porous media is made which includes concepts like total stress, solid phase stress, and solid pressure. Thermodynamically constrained averaging theory is used to derive the solid phase stress tensor. It is shown that in the upscaling procedure the Hill conditions are satisfied, which is not trivial. The stress tensor is then compared to traditional stress measures. The physical meaning of two forms of solid pressure and of the Biot coefficient is clarified. Finally, a Bishop-Skempton like form of the stress tensor is obtained and a form of the total stress tensor that does not make use of the effective stress concept.

  3. Microwave spectroscopic observation of distinct electron solid phases in wide quantum wells

    PubMed Central

    Hatke, A. T.; Liu, Yang; Magill, B. A.; Moon, B. H.; Engel, L. W.; Shayegan, M.; Pfeiffer, L. N.; West, K. W.; Baldwin, K. W.

    2014-01-01

    In high magnetic fields, two-dimensional electron systems can form a number of phases in which interelectron repulsion plays the central role, since the kinetic energy is frozen out by Landau quantization. These phases include the well-known liquids of the fractional quantum Hall effect, as well as solid phases with broken spatial symmetry and crystalline order. Solids can occur at the low Landau-filling termination of the fractional quantum Hall effect series but also within integer quantum Hall effects. Here we present microwave spectroscopy studies of wide quantum wells that clearly reveal two distinct solid phases, hidden within what in d.c. transport would be the zero diagonal conductivity of an integer quantum-Hall-effect state. Explanation of these solids is not possible with the simple picture of a Wigner solid of ordinary (quasi) electrons or holes. PMID:24948190

  4. Quantitation of Binding, Recovery and Desalting Efficiency in Solid Phase Extraction Micropipette Tips

    SciTech Connect

    Palmblad, M N; Vogel, J S

    2004-08-02

    Micropipette-tip solid phase extraction systems are common in proteomic analyses for desalting and concentrating samples for mass spectrometry, removing interferences, and increasing sensitivity. These systems are inexpensive, disposable, and highly efficient. Here we show micropipette-tip solid phase extraction is a direct sample preparation method for {sup 14}C-accelerator mass spectrometry (AMS), removing salts or reagent from labeled macromolecules. We compared loading, recovery and desalting efficiency in commercially available SPE micro-tips using {sup 14}C-labeled peptides and proteins, AMS, and alpha spectrometry ion energy loss quantitation. The polypropylene in the tips was nearly {sup 14}C-free and simultaneously provided low-background carrier for AMS. The silica material did not interfere with the analysis. Alpha spectrometry provided an absolute measurement of desalting efficiency.

  5. The use of coal in a solid phase reduction of iron oxide

    NASA Astrophysics Data System (ADS)

    Nokhrina, O. I.; Rozhihina, I. D.; Hodosov, I. E.

    2015-09-01

    The results of the research process of producing metalized products by solid-phase reduction of iron using solid carbonaceous reducing agents. Thermodynamic modeling was carried out on the model of the unit the Fe-C-O and system with iron ore and coal. As a result of modeling the thermodynamic boundary reducing, oxidizing, and transition areas and the value of the ratio of carbon and oxygen in the system. Simulation of real systems carried out with the gas phase obtained in the pyrolys of coal. The simulation results allow to determine the optimal cost of coal required for complete reduction of iron ore from a given composition. The kinetics of the processes of solid-phase reduction of iron using coal of various technological brands.

  6. Synthesis and evaluation of silver nanoparticles material for solid phase extraction of cobalt from water samples

    NASA Astrophysics Data System (ADS)

    Khajeh, Mostafa; Sanchooli, Esmael

    2011-12-01

    In this study, a new solid phase extractor, nano-scale silver particles were synthesized. The silver nanoparticle-based solid phase extraction was used for separation and preconcentration of the trace amount of cobalt ion from various water samples prior to its determination by flame atomic absorption spectrometry. The effects of various parameters, including pH, amount of complexing agent [1-(2-pyridylazo)-2-naphthol] (PAN), flow rates of solution and eluent, type and least amount of the eluent for elution of the cobalt from silver nanoparticles were studied and optimized. Under the optimum conditions, the detection limit of this procedure was 0.78 μg L-1, and the relative standard deviation (RSD%) was 3.1% ( n = 10, c = 20 μg L-1). This method was applied to the determination of cobalt in water samples.

  7. Solid-phase assay of lectin activity using HRP-conjugated glycoproteins.

    PubMed

    Kojima-Aikawa, Kyoko

    2014-01-01

    Various enzyme-conjugated probes have been widely used for detection of specific interactions between biomolecules. In the case of glycan-protein interaction, horseradish peroxidase (HRP)-conjugated glycoproteins (HRP-GPs) are useful for the detection of carbohydrate-binding activity of plant and animal lectins. In this chapter, a typical solid-phase assay of the carbohydrate-binding activity of Sophora japonica agglutinin I, a Gal/GalNAc-specific lectin, using HRP-conjugated asialofetuin is described. HRP-GPs are versatile tools for probing lectin activities in crude extracts, screening many samples at one time, and applicable not only for solid-phase binding assays but also samples which are dot- or Western-blotted onto the membrane. PMID:25117228

  8. Solid-phase epitaxy of silicon amorphized by implantation of the alkali elements rubidium and cesium

    SciTech Connect

    Maier, R.; Haeublein, V.; Ryssel, H.; Voellm, H.; Feili, D.; Seidel, H.; Frey, L.

    2012-11-06

    The redistribution of implanted Rb and Cs profiles in amorphous silicon during solid-phase epitaxial recrystallization has been investigated by Rutherford backscattering spectroscopy and secondary ion mass spectroscopy. For the implantation dose used in these experiments, the alkali atoms segregate at the a-Si/c-Si interface during annealing resulting in concentration peaks near the interface. In this way, the alkali atoms are moved towards the surface. Rutherford backscattering spectroscopy in ion channeling configuration was performed to measure average recrystallization rates of the amorphous silicon layers. Preliminary studies on the influence of the alkali atoms on the solid-phase epitaxial regrowth rate reveal a strong retardation compared to the intrinsic recrystallization rate.

  9. Advances in automatic, manual and microwave-assisted solid-phase peptide synthesis.

    PubMed

    Sabatino, Giuseppina; Papini, Anna M

    2008-11-01

    Solid-phase strategies speed up the production of both short- and long-sequence peptides compared with solution methodologies. Therefore, solid-phase peptide synthesis (SPPS), proposed by Merrifield in the early 1960s, contributed to the 'Peptide Revolution' in the fields of diagnostics, and drug and vaccine development. Since then, peptide chemistry research has aimed to optimize these synthetic procedures, focusing on areas such as amide bond formation (the coupling step), solid supports and automation. Particular attention was devoted to the environmental impact of SPPS: the requirement for large amounts of organic solvents meant high costs for industrial peptide manufacturing that needed to be reduced. SPPS, alone or in hybrid technologies, has become strategic for the production of peptides as active pharmaceutical ingredients on a commercial scale.

  10. Solid-phase organic synthesis of polyisoprenoid alcohols with traceless sulfone linker.

    PubMed

    Chang, Yi-Fan; Liu, Chen-Yu; Guo, Chih-Wei; Wang, Yen-Chih; Fang, Jim-Min; Cheng, Wei-Chieh

    2008-09-19

    Solid-phase organic synthesis of polyprenols with a traceless sulfone linker is described. The polymer-bound benezenesulfinate is first linked with the "tail" building blocks of isoprenyl chlorides via S-alkylation. With use of dimsyl anion as an appropriate base, the polymer-bound alpha-sulfonyl carbanion is generated and coupled with other "body" building blocks in an efficient manner. After repeated processes and a global palladium-catalyzed desulfonation with LiEt 3BH as the reducing agent, the desired polyprenols with various chain lengths and geometrical configurations are obtained in 32-59% overall yields. The solid-phase synthesis offers the advantage in facile isolation of polyprenols without tedious operation or time-consuming purification.

  11. The Use of Aryl Hydrazide Linkers for the Solid Phase Synthesis of Chemically Modified Peptides

    SciTech Connect

    Woo, Y; Mitchell, A R; Camarero, J A

    2006-11-03

    Since Merrifield introduced the concept of solid phase synthesis in 1963 for the rapid preparation of peptides, a large variety of different supports and resin-linkers have been developed that improve the efficiency of peptide assembly and expand the myriad of synthetically feasible peptides. The aryl hydrazide is one of the most useful resin-linkers for the synthesis of chemically modified peptides. This linker is completely stable during Boc- and Fmoc-based solid phase synthesis and yet it can be cleaved under very mild oxidative conditions. The present article reviews the use of this valuable linker for the rapid and efficient synthesis of C-terminal modified peptides, head-to-tail cyclic peptides and lipidated peptides.

  12. Ionic liquid acceleration of solid-phase suzuki-miyaura cross-coupling reactions.

    PubMed

    Revell, Jefferson D; Ganesan, A

    2002-09-01

    [reaction: see text] Room-temperature ionic liquids promote various transition metal-catalyzed reactions in the solution phase. Here, for the first time, we show that these effects are translatable to solid-phase reactions. The Suzuki-Miyaura cross-coupling of 4-iodophenol immobilized on polystyrene-Wang resin with various arylboronic acids was significantly accelerated by the ionic liquid 1-butyl-3-methylimidazolium tetrafluoroborate ([bmim][BF(4)(-)]).

  13. Solid-phase reduction of Cr2O3 under chemical catalytic conditions

    NASA Astrophysics Data System (ADS)

    Simonov, V. K.; Grishin, A. M.

    2016-06-01

    The kinetics of the solid-phase reduction of Cr2O3 with carbon under chemical catalytic action on the reacting system is studied. A significant intensification of the process in the presence of small amounts of potassium and sodium salts is established. The concepts of the catalyst action mechanism are considered and experimentally substantiated. Manufacture of iron-chromium master alloys with a restricted content of carbon can be organized at low temperatures, and they can be used in steelmaking.

  14. The sulfamate functional group as a new anchor for solid-phase organic synthesis

    PubMed

    Ciobanu; Maltais; Poirier

    2000-02-24

    [reaction: see text] Sulfamate derivatives were loaded on trityl chloride resin, and two variants of cleavage were developed for this sulfamate anchor: an acid treatment to easily restore the free sulfamate and a nucleophilic treatment to generate the corresponding phenol. In addition to loading/cleavage assays and stability experiments, a model sequence of reactions was performed with the new sulfamate anchor to show its applicability in further combinatorial solid-phase synthesis of libraries of biologically relevant sulfamate derivatives.

  15. Electron Shuttling Capacity of Solid-Phase Organic Matter in Forest Soils

    NASA Astrophysics Data System (ADS)

    Patel, A.; Zhao, Q.; Yang, Y.

    2015-12-01

    Soil organic matter, as an electron shuttle, plays an important role in regulating the biogeochemical cycles of metals, especially the redox reactions for iron. Microorganisms can reduce soil organic matter under anaerobic conditions, and biotically-reduced soil organic matter can abiotically donate electrons to ferric oxides. Such soil organic matter-mediated electron transport can facilitate the interactions between microorganisms and insoluble terminal electron acceptors, i.e. iron minerals. Most previous studies have been focused on the electron shuttling processes through dissolved soil organic matter, and scant information is available for solid-phase soil organic matter. In this study, we aim to quantify the electron accepting capacity for solid-phase organic matter in soils collected from four different forests in the United States, including Truckee (CA), Little Valley (NV), Howland (ME) and Hart (MI). We used Shewanella oneidensisMR-1 to biotically reduce soil slurries, and then quantified the electrons transferred to solid-phase and solution-phase organic matter by reacting them with Fe(III)-nitrilotriacetic acid (Fe(III)-NTA). The generation of Fe(II) was measured by a ferrozine assay to calculate the electron accepting capacity of soil organic matter. Our preliminary results showed that the Truckee soil organic matter can accept 0.51±0.07 mM e-/mol carbon. We will measure the electron accepting capacity for four different soils and correlate them to the physicochemical properties of soils. Potential results will provide information about the electron accepting capacity of solid-phase soil organic matter and its governing factors, with broad implication on the coupled biogeochemical cycles of carbon and iron.

  16. Solid-phase microextraction for the enantiomeric analysis of flavors in beverages.

    PubMed

    Ebeler, S E; Sun, G M; Datta, M; Stremple, P; Vickers, A K

    2001-01-01

    Solid-phase microextraction combined with gas chromatographic/mass spectrometric analysis and separation on a chiral cyclodextrin stationary phase was a rapid, reliable technique for profiling chiral aroma compounds in flavored alcoholic beverages. Several enantiomeric terpenes, esters, alcohols, norisoprenoids, and lactones were identified in berry-, peach-, strawberry-, and citrus-flavored wine and malt beverages (wine coolers). Using this technique, we were able to confirm the addition of synthetic flavoring to several beverages, consistent with label designations. PMID:11324614

  17. Heterogeneous Phase Transfer Catalysis in Solid Phase Syntheses of Anth-Cyclic Tetrapeptides.

    PubMed

    Xin, Dongyue; Yuan, Jian; Wong, Kwok-Yin; Burgess, Kevin

    2016-09-01

    This study features solid phase syntheses of cyclic tetrapeptides containing anthranilic acid (Anth) on relatively inexpensive resins derived from polystyrene. It proved to be difficult to hydrolyze a supported Anth-methyl ester unless a phase transfer catalyst was added to facilitate transport of hydroxide into the swollen hydrophobic gel state of the resin. We suggest this may be an under-appreciated strategy for improving syntheses on polystyrene supports. PMID:27552148

  18. R. Bruce Merrifield and Solid-Phase Peptide Synthesis: A Historical Assessment

    SciTech Connect

    Mitchell, A R

    2007-12-04

    Bruce Merrifield, trained as a biochemist, had to address three major challenges related to the development and acceptance of solid-phase peptide synthesis (SPPS). The challenges were (1) to reduce the concept of peptide synthesis on a insoluble support to practice, (2) overcome the resistance of synthetic chemists to this novel approach, and (3) establish that a biochemist had the scientific credentials to effect the proposed revolutionary change in chemical synthesis. How these challenges were met is discussed in this article.

  19. Molecularly imprinted hollow spheres for the solid phase extraction of estrogens.

    PubMed

    Chen, Wei; Xue, Min; Xue, Fei; Mu, Xiangrong; Xu, Zhibin; Meng, Zihui; Zhu, Guangxian; Shea, Kenneth J

    2015-08-01

    Solid phase extraction (SPE) is widely used in many different areas, such as environmental, biological, and food analysis, where cleaning and pre-concentration of samples are key steps in the analytical protocol. New materials have significant impact on the development of solid phase extraction. In this paper, mono-dispersed molecularly imprinted hollow spheres (MIHSs) of β-estradiol (E2) were synthesized using silica nanospheres particles as the sacrificial matrix. Compared to the corresponding non-imprinted hollow spheres (NIHSs), the MIHSs with uniform size of 290 nm have outstanding affinity in aqueous solution. Static saturation adsorption required only 15min to achieve equilibrium, with a binding capacity (Qmax) of 44.5 μmol g(-1). The extraction of E2, ethinyl estradiol (EE), diethylstilbestrol (DES), ethisterone (ES) and estrone (E1) from water samples by MIHSs was also investigated. In the spiked samples of tap water, Qinghe river water and Zhanjiang river water, more than 90.42% of E2, but less than 79% of EE, DES, ES and E1 were recovered. The limits of detection (LOD) ranged from 0.1 to 0.26 µmol L(-1) after solid phase extraction by MIHSs and HPLC-UV analysis. The adsorption capacity of the MIHSs showed no significant deterioration after six rounds of regeneration. PMID:26048825

  20. Direct molecular dynamics simulation of liquid-solid phase equilibria for a three-component plasma.

    PubMed

    Hughto, J; Horowitz, C J; Schneider, A S; Medin, Zach; Cumming, Andrew; Berry, D K

    2012-12-01

    The neutron-rich isotope ²²Ne may be a significant impurity in carbon and oxygen white dwarfs and could impact how the stars freeze. We perform molecular dynamics simulations to determine the influence of ²²Ne in carbon-oxygen-neon systems on liquid-solid phase equilibria. Both liquid and solid phases are present simultaneously in our simulation volumes. We identify liquid, solid, and interface regions in our simulations using a bond angle metric. In general we find good agreement for the composition of liquid and solid phases between our MD simulations and the semianalytic model of Medin and Cumming. The trace presence of a third component, neon, does not appear to strongly impact the chemical separation found previously for two-component carbon and oxygen systems. This suggests that small amounts of ²²Ne may not qualitatively change how the material in white dwarf stars freezes. However, we do find systematically lower melting temperatures (higher Γ) in our MD simulations compared to the semianalytic model. This difference seems to grow with impurity parameter Q_{imp} and suggests a problem with simple corrections to the linear mixing rule for the free energy of multicomponent solid mixtures that is used in the semianalytic model. PMID:23368065

  1. Lights and shadows of anti-HLA antibodies detected by solid-phase assay.

    PubMed

    Picascia, Antonietta; Sabia, Chiara; Grimaldi, Vincenzo; Montesano, Maria Lourdes; Sommese, Linda; Schiano, Concetta; Napoli, Claudio

    2014-11-01

    Recently, management of patients awaiting solid organ transplantation has taken advantages after the development of more sensitive and accurate solid phase assays which have supported the historic complement dependent cytotoxicity. This approach has allowed the detection of antibodies in patients previously considered negative. The use of the single antigen beads resulted in a more accurate anti-human leukocyte antigen (HLA) antibody characterization. The detection of anti-HLA antibodies specific for C, DQ and DP loci that were not so well characterized has been possible through the implementation of the single antigen assay. The assessment of HLA compatibility has been expanded through the introduction of "epitope matching" concept and the definition of the unacceptable antigens for a more adequate evaluation of donor-recipient compatibility. However, the clinical impact of pre-formed and de novo anti-HLA antibodies detected by solid phase assays is still controversial due to the drawback related to result interpretation. Until today, the unresolved issues concern if all antibodies affect the medium and long term clinical outcome. An open debate on the clinical relevance of anti-HLA antibodies detected by single-antigen beads highlights needing to further investigations. Here, we describe the novel applications and the improvements of the solid-phase assay use. PMID:25171913

  2. Direct molecular dynamics simulation of liquid-solid phase equilibria for a three-component plasma.

    PubMed

    Hughto, J; Horowitz, C J; Schneider, A S; Medin, Zach; Cumming, Andrew; Berry, D K

    2012-12-01

    The neutron-rich isotope ²²Ne may be a significant impurity in carbon and oxygen white dwarfs and could impact how the stars freeze. We perform molecular dynamics simulations to determine the influence of ²²Ne in carbon-oxygen-neon systems on liquid-solid phase equilibria. Both liquid and solid phases are present simultaneously in our simulation volumes. We identify liquid, solid, and interface regions in our simulations using a bond angle metric. In general we find good agreement for the composition of liquid and solid phases between our MD simulations and the semianalytic model of Medin and Cumming. The trace presence of a third component, neon, does not appear to strongly impact the chemical separation found previously for two-component carbon and oxygen systems. This suggests that small amounts of ²²Ne may not qualitatively change how the material in white dwarf stars freezes. However, we do find systematically lower melting temperatures (higher Γ) in our MD simulations compared to the semianalytic model. This difference seems to grow with impurity parameter Q_{imp} and suggests a problem with simple corrections to the linear mixing rule for the free energy of multicomponent solid mixtures that is used in the semianalytic model.

  3. Weighted multiplex networks.

    PubMed

    Menichetti, Giulia; Remondini, Daniel; Panzarasa, Pietro; Mondragón, Raúl J; Bianconi, Ginestra

    2014-01-01

    One of the most important challenges in network science is to quantify the information encoded in complex network structures. Disentangling randomness from organizational principles is even more demanding when networks have a multiplex nature. Multiplex networks are multilayer systems of [Formula: see text] nodes that can be linked in multiple interacting and co-evolving layers. In these networks, relevant information might not be captured if the single layers were analyzed separately. Here we demonstrate that such partial analysis of layers fails to capture significant correlations between weights and topology of complex multiplex networks. To this end, we study two weighted multiplex co-authorship and citation networks involving the authors included in the American Physical Society. We show that in these networks weights are strongly correlated with multiplex structure, and provide empirical evidence in favor of the advantage of studying weighted measures of multiplex networks, such as multistrength and the inverse multiparticipation ratio. Finally, we introduce a theoretical framework based on the entropy of multiplex ensembles to quantify the information stored in multiplex networks that would remain undetected if the single layers were analyzed in isolation.

  4. Immobilization and functional reconstitution of antibody Fab fragment by solid-phase refolding.

    PubMed

    Kumada, Yoichi; Hamasaki, Kyoto; Nakagawa, Aya; Sasaki, Eiju; Shirai, Tatsunori; Okumura, Masahiro; Inoue, Manami; Kishimoto, Michimasa

    2013-12-31

    In this study, we demonstrated the successful preparation of a Fab antibody-immobilized hydrophilic polystyrene (phi-PS) plate via one- and two-step solid-phase refolding methods. Both polystyrene-binding peptide (PS-tag)-fused Fd fragment of heavy chain (Fab H-PS) and full-length of light-chain (Fab L-PS) were individually produced in insoluble fractions of Escherichia coli cells, and they were highly purified in the presence of 8M of urea. Antigen-binding activities of Fab antibody immobilized were correctly recovered by the one-step solid-phase refolding method that a mixture of Fab H-PS and Fab L-PS was immobilized in the presence of 0.5-2M urea, followed by surface washing of the phi-PS plate with PBST. These results indicate that by genetic fusion of a PS-tag, a complex between Fab H and Fab L was efficiently immobilized on the surface of a phi-PS plate even in the presence of a low concentration of urea, and was then correctly refolded to retain its high antigen-binding activity via removal of the urea. A two-step solid-phase refolding method whereby Fab H-PS and Fab L-PS were successively refolded on the surface of a phi-PS plate also resulted in Fab antibody formation on the plate. Furthermore, both the binding affinity and the specificity of the Fab antibody produced by the two-step method were highly maintained, according to the results of sandwich ELISA and competitive ELISA using Fab antibody-immobilized plate via two-step solid-phase refolding. Thus, the solid-phase refolding method demonstrated in this study should be quite useful for the preparation of a Fab antibody-immobilized PS surface with high efficiency from individually produced Fab H-PS and Fab L-PS. This method will be applicable to the preparation of a large Fab antibody library on the surface of a PS plate for use in antibody screening.

  5. Sensitiveness of the colorimetric estimation of titanium

    USGS Publications Warehouse

    Wells, R.C.

    1911-01-01

    The accuracy of the colorimetric estimation of titanium is practically constant over concentrations ranging from the strongest down to those containing about 1.5 mg. TiO2 in 100 cc. The change in concentration required to produce a perceptible difference in intensity between two solutions, at favorable concentrations, was found to be about 6.5 per cent, which does not differ much from the results of others with chromium and copper solutions. With suitable precautions, such as comparing by substitution and taking the mean of several settings or of the two perceptibly different extremes, the accuracy of the colorimetric comparisons appears to be about 2 per cent.

  6. Colorimetric Titration Experiment for the Undergraduate Laboratory.

    ERIC Educational Resources Information Center

    Lopez, Edwin; Vassos, Basil H.

    1984-01-01

    Describes a colorimetric titration instrument usable in the undergraduate laboratory that fulfills the objectives of ruggedness, freedom from ambient light interference, and low cost. Although accessories can be added (raising the price), the basic instrument is low priced and can be used manually with a simple voltmeter. (JN)

  7. Visualizing Capsaicinoids: Colorimetric Analysis of Chili Peppers

    ERIC Educational Resources Information Center

    Thompson, Robert Q.; Chu, Christopher; Gent, Robin; Gould, Alexandra P.; Rios, Laura; Vertigan, Theresa M.

    2012-01-01

    A colorimetric method for total capsaicinoids in chili pepper ("Capsicum") fruit is described. The placental material of the pepper, containing 90% of the capsaicinoids, was physically separated from the colored materials in the pericarp and extracted twice with methanol, capturing 85% of the remaining capsaicinoids. The extract, evaporated and…

  8. Nucleic acid-coupled colorimetric analyte detectors

    DOEpatents

    Charych, Deborah H.; Jonas, Ulrich

    2001-01-01

    The present invention relates to methods and compositions for the direct detection of analytes and membrane conformational changes through the detection of color changes in biopolymeric materials. In particular, the present invention provide for the direct colorimetric detection of analytes using nucleic acid ligands at surfaces of polydiacetylene liposomes and related molecular layer systems.

  9. A protein multiplex microarray substrate with high sensitivity and specificity

    PubMed Central

    Fici, Dolores A.; McCormick, William; Brown, David W.; Herrmann, John E.; Kumar, Vikram; Awdeh, Zuheir L.

    2010-01-01

    The problems that have been associated with protein multiplex microarray immunoassay substrates and existing technology platforms include: binding, sensitivity, a low signal to noise ratio, target immobilization and the optimal simultaneous detection of diverse protein targets. Current commercial substrates for planar multiplex microarrays rely on protein attachment chemistries that range from covalent attachment to affinity ligand capture, to simple adsorption. In this pilot study, experimental performance parameters for direct monoclonal mouse IgG detection were compared for available two and three dimensional slide surface coatings with a new colloidal nitrocellulose substrate. New technology multiplex microarrays were also developed and evaluated for the detection of pathogen specific antibodies in human serum and the direct detection of enteric viral antigens. Data supports the nitrocellulose colloid as an effective reagent with the capacity to immobilize sufficient diverse protein target quantities for increased specificory signal without compromising authentic protein structure. The nitrocellulose colloid reagent is compatible with the array spotters and scanners routinely used for microarray preparation and processing. More importantly, as an alternate to fluorescence, colorimetric chemistries may be used for specific and sensitive protein target detection. The advantages of the nitrocellulose colloid platform indicate that this technology may be a valuable tool for the further development and expansion of multiplex microarray immunoassays in both the clinical and research laborat environment. PMID:20974147

  10. Analysis of ecologically relevant pharmaceuticals in wastewater and surface water using selective solid phase extraction and UPLC/MS/MS

    EPA Science Inventory

    A rapid and sensitive method has been developed for the analysis of 48 human prescription active pharmaceutical ingredients (APIs) and 6 metabolites of interest, utilizing selective solid-phase extraction (SPE) and ultra performance liquid chromatography in combination with tripl...

  11. Effects of solid-phase extraction of plasma in measuring gut metabolic hormones in fasted and fed blood of lean and diet-induced obese rats.

    PubMed

    Reidelberger, Roger; Haver, Alvin; Anders, Krista; Apenteng, Bettye; Lanio, Craig

    2016-05-01

    Glucagon-like peptide-1 (GLP-1), peptide YY (3-36) [PYY(3-36)], amylin, ghrelin, insulin, and leptin are thought to act as hormonal signals from periphery to brain to control food intake. Here, we determined the effects of solid-phase extraction of plasma in measuring these hormones in blood of lean and diet-induced obese rats. Individual enzyme-linked immunoassays and a multiplex assay were used to measure active GLP-1, total PYY, active amylin, active ghrelin, insulin, leptin, and total GIP in response to (1) addition of known amounts of the peptides to lean and obese plasma, (2) a large meal in lean and obese rats, and (3) intravenous infusions of anorexigenic doses of GLP-1, PYY(3-36), amylin, and leptin in lean rats. Extraction of lean and obese plasma prior to assays produced consistent recoveries across assays for GLP-1, PYY, amylin, ghrelin, and insulin, reflecting losses inherent to the extraction procedure. Plasma extraction prior to assays generally revealed larger meal-induced changes in plasma GLP-1, PYY, amylin, ghrelin, and insulin in lean and obese rats. Plasma extraction and the multiplex assay were used to compare plasma levels of GLP-1, PYY, and amylin after a large meal with plasma levels produced by IV infusions of anorexigenic doses of GLP-1, PYY(3-36), and amylin. Infusions produced dose-dependent increases in plasma peptide levels, which were well above their postprandial levels. These results do not support the hypothesis that postprandial plasma levels of GLP-1, PYY(3-36), and amylin are sufficient to decrease food intake by an endocrine mechanism.

  12. Solid Phase Red Cell Adherence Assay: a tubeless method for pretransfusion testing and other applications in transfusion science.

    PubMed

    Ching, Eric

    2012-06-01

    Solid Phase Red Cell Adherence Assay (SPRCA) is one of the two tubeless methods developed to improve sensitivity and specificity in blood group serology. The SPRCA (solid phase) and the column agglutination (gel) technology have gained wide acceptance following successful adaptation to fully automated platforms, The purpose of this paper is to discuss the development, principle, procedures as well as laboratory and clinical applications of the SPRCA in transfusion medicine.

  13. Matrix solid-phase dispersion and solid-phase microextraction applied to study the distribution of fenbutatin oxide in grapes and white wine.

    PubMed

    Montes, R; Canosa, P; Lamas, J Pablo; Piñeiro, A; Orriols, I; Cela, R; Rodríguez, I

    2009-12-01

    The fate of the acaricide fenbutatin oxide (FBTO) during the elaboration of white wine is evaluated. Matrix solid-phase dispersion (MSPD) and solid-phase microextraction (SPME) were used as sample preparation techniques applied to the semi-solid and the liquid matrices involved in this research, respectively. Selective determination of FBTO was achieved by gas chromatography with atomic emission detection (GC-AED). GC coupled to mass spectrometry was also used to establish the identity of FBTO by-products detected in must and wine samples. MSPD extractions were accomplished using C18 as dispersant and co-sorbent. Sugars and other polar interferences were first removed with water and water/acetone mixtures, then FBTO was recovered with 8 mL of acetone. When used in combination with GC-AED, the MSPD method provided limits of quantification (LOQs) in the low nanogram per gram range, recoveries around 90% and relative standard deviations below 13% for extractions performed in different days. Performance of SPME for must and wine was mainly controlled by the extraction temperature, time and fibre coating. Under final conditions, FBTO was extracted in the headspace mode for 45 min at 100 degrees C, using a 100 microm poly(dimethylsiloxane)-coated fibre. The achieved LOQs remained around or below 0.1 ng mL(-1), depending on the type of sample, and the inter-day precision ranged from 10% to 13%. FBTO residues in grapes stayed mostly on the skin of the fruit. Although FBTO was not removed during must and white wine elaboration, it remained associated with suspended particles existing in must and lees, settled after must fermentation, with a negligible risk of being transferred to commercialised wine. On the other hand, two by-products of FBTO (bis and mono (2-methyl-2-phenylpropyl) tin) were identified, for first time, in must and final white wines obtained from FBTO treated grapes. Found values for the first species ranged from 0.03 to 0.9 ng mL(-1). PMID:19806346

  14. Solid-phase synthesis and hybridization properties of DNA containing sulfide-linked dinucleosides.

    PubMed Central

    Kawai, S H; Wang, D; Giannaris, P A; Damha, M J; Just, G

    1993-01-01

    Oligodeoxyribonucleotides incorporating non-hydrolyzable dialkyl sulfide linked thymidine dimers (TsT) were synthesized chemically by the solid-phase approach. The sulfide dimer TsT was stable to degradation by snake-venom phosphodiesterase, calf spleen phosphodiesterase, Nuclease P1 and Nuclease S1. Thermal denaturation analysis indicated that the incorporation of TsT dimers into DNA weakened, but did not prevent, binding to complementary DNA and RNA over a wide range of salt concentrations (10 mM to 2 M NaCl). Images PMID:8464740

  15. Solid-phase fullerene-like nanostructures as singlet oxygen photosensitizers in liquid media

    NASA Astrophysics Data System (ADS)

    Belousova, I. M.; Danilov, O. B.; Kiselev, V. M.; Kislyakov, I. M.; Kris'ko, T. K.; Murav'eva, T. D.; Videnichev, D. A.

    2007-04-01

    Singlet oxygen generation by fullerene and astralen containing surfaces and powders under visible irradiation was studied in water and organic liquids by means of 1Δ g state luminescence and chemical scavenger transmittance measurements. The chemical method, pioneered for solid photosensitizers of 10 II, allowed to measure the singlet oxygen concentration in the aqueous medium down to 10 8 cm -3. The singlet oxygen sensitizing by the solid-phase fullerene-containing systems was found to be 100 times less effective then by fullerene in solution. The results obtained confirm the applicability of these structures in biology and medicine.

  16. The role of energetic processing on solid-phase chemistry in star forming regions

    NASA Astrophysics Data System (ADS)

    Palumbo, M. E.; Urso, R. G.; Kaňuchová, Z.; Scirè, C.; Accolla, M.; Baratta, G. A.; Strazzulla, G.

    2016-05-01

    It is generally accepted that complex molecules observed in star forming regions are formed in the solid phase on icy grain mantles and are released to the gas-phase after desorption of icy mantles. Most of our knowledge on the physical and chemical properties of ices in star forming regions is based on the comparison between observations and laboratory experiments performed at low temperature (10-100 K). Here we present some recent laboratory experiments which show the formation of (complex) molecular species after ion bombardment of simple ices.

  17. Ultrasonic detection of solid phase mass flow ratio of pneumatic conveying fly ash

    NASA Astrophysics Data System (ADS)

    Duan, Guang Bin; Pan, Hong Li; Wang, Yong; Liu, Zong Ming

    2014-04-01

    In this paper, ultrasonic attenuation detection and weight balance are adopted to evaluate the solid mass ratio in this paper. Fly ash is transported on the up extraction fluidization pneumatic conveying workbench. In the ultrasonic test. McClements model and Bouguer-Lambert-Beer law model were applied to formulate the ultrasonic attenuation properties of gas-solid flow, which can give the solid mass ratio. While in the method of weigh balance, the averaged mass addition per second can reveal the solids mass flow ratio. By contrast these two solid phase mass ratio detection methods, we can know, the relative error is less.

  18. Thermal Decomposition of the Solid Phase of Nitromethane: Ab Initio Molecular Dynamics Simulations

    NASA Astrophysics Data System (ADS)

    Chang, Jing; Lian, Peng; Wei, Dong-Qing; Chen, Xiang-Rong; Zhang, Qing-Ming; Gong, Zi-Zheng

    2010-10-01

    The Car-Parrinello molecular dynamics simulations were employed to investigate thermal decomposition of the solid nitromethane. It is found that it undergoes chemical decomposition at about 2200 K under ambient pressure. The initiation of reactions involves both proton transfer and commonly known C-N bond cleavage. About 75 species and 100 elementary reactions were observed with the final products being H2O, CO2, N2, and CNCNC. It represents the first complete simulation of solid-phase explosive reactions reported to date, which is of far-reaching implication for design and development of new energetic materials.

  19. Thermal decomposition of the solid phase of nitromethane: ab initio molecular dynamics simulations.

    PubMed

    Chang, Jing; Lian, Peng; Wei, Dong-Qing; Chen, Xiang-Rong; Zhang, Qing-Ming; Gong, Zi-Zheng

    2010-10-29

    The Car-Parrinello molecular dynamics simulations were employed to investigate thermal decomposition of the solid nitromethane. It is found that it undergoes chemical decomposition at about 2200 K under ambient pressure. The initiation of reactions involves both proton transfer and commonly known C-N bond cleavage. About 75 species and 100 elementary reactions were observed with the final products being H2O, CO2, N2, and CNCNC. It represents the first complete simulation of solid-phase explosive reactions reported to date, which is of far-reaching implication for design and development of new energetic materials. PMID:21231142

  20. A novel Fmoc-based anchorage for the synthesis of protected peptides on solid phase.

    PubMed

    Liu, Y Z; Ding, S H; Chu, J Y; Felix, A M

    1990-02-01

    A novel bifunctional compound, 9-(hydroxymethyl)-2-fluoreneacetic acid, was synthesized, coupled to benzhydrylamine-resin, and evaluated for its application to the solid phase synthesis of protected peptide fragments. Anchor-bond cleavage was achieved with 15% piperidine/DMF. A protected heptapeptide, Boc-Val-Val-Ser(Bzl)-His(Tos)-Phe-Asn-Lys-(Z)-OH, corresponding to the sequence (1-7) of rat-transforming growth factor-alpha, was synthesized using this new support with an overall yield of 46%.

  1. Formation routes of interstellar glycine involving carboxylic acids: possible favoritism between gas and solid phase.

    PubMed

    Pilling, Sergio; Baptista, Leonardo; Boechat-Roberty, Heloisa M; Andrade, Diana P P

    2011-11-01

    Despite the extensive search for glycine (NH₂CH₂COOH) and other amino acids in molecular clouds associated with star-forming regions, only upper limits have been derived from radio observations. Nevertheless, two of glycine's precursors, formic acid and acetic acid, have been abundantly detected. Although both precursors may lead to glycine formation, the efficiency of reaction depends on their abundance and survival in the presence of a radiation field. These facts could promote some favoritism in the reaction pathways in the gas phase and solid phase (ice). Glycine and these two simplest carboxylic acids are found in many meteorites. Recently, glycine was also observed in cometary samples returned by the Stardust space probe. The goal of this work was to perform theoretical calculations for several interstellar reactions involving the simplest carboxylic acids as well as the carboxyl radical (COOH) in both gas and solid (ice) phase to understand which reactions could be the most favorable to produce glycine in interstellar regions fully illuminated by soft X-rays and UV, such as star-forming regions. The calculations were performed at four different levels for the gas phase (B3LYP/6-31G*, B3LYP/6-31++G**, MP2/6-31G*, and MP2/6-31++G**) and at MP2/6-31++G** level for the solid phase (ice). The current two-body reactions (thermochemical calculation) were combined with previous experimental data on the photodissociation of carboxylic acids to promote possible favoritism for glycine formation in the scenario involving formic and acetic acid in both gas and solid phase. Given that formic acid is destroyed more in the gas phase by soft X-rays than acetic acid is, we suggest that in the gas phase the most favorable reactions are acetic acid with NH or NH₂OH. Another possible reaction involves NH₂CH₂ and COOH, one of the most-produced radicals from the photodissociation of acetic acid. In the solid phase, we suggest that the reactions of formic acid with NH

  2. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer.

  3. Sequential, solid-phase assay for biotin in physiologic fluids that correlates with expected biotin status

    SciTech Connect

    Mock, D.M.; DuBois, D.B.

    1986-03-01

    Interest in accurate measurement of biotin concentrations in plasma and urine has been stimulated by recent advances in the understanding of biotin-responsive inborn errors of metabolism and by several reports describing acquired biotin deficiency during parenteral alimentation. This paper presents a biotin assay utilizing radiolabeled avidin in a sequential, solid-phase method; the assay has increased sensitivity compared to previous methods (greater than or equal to 10 fmol/tube), correlates with expected trends in biotin concentrations in blood and urine in a rat model of biotin deficiency, and can utilize commercially available radiolabeled avidin.

  4. Structurally Diverse Polyamines: Solid-Phase Synthesis and Interaction with DNA.

    PubMed

    Umezawa, Naoki; Horai, Yuhei; Imamura, Yuki; Kawakubo, Makoto; Nakahira, Mariko; Kato, Nobuki; Muramatsu, Akira; Yoshikawa, Yuko; Yoshikawa, Kenichi; Higuchi, Tsunehiko

    2015-08-17

    A versatile solid-phase approach based on peptide chemistry was used to construct four classes of structurally diverse polyamines with modified backbones: linear, partially constrained, branched, and cyclic. Their effects on DNA duplex stability and structure were examined. The polyamines showed distinct activities, thus highlighting the importance of polyamine backbone structure. Interestingly, the rank order of polyamine ability for DNA compaction was different to that for their effects on circular dichroism and melting temperature, thus indicating that these polyamines have distinct effects on secondary and higher-order structures of DNA.

  5. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  6. Volatiles from Michelia champaca flower: comparative analysis by simultaneous distillation-extraction and solid phase microextraction.

    PubMed

    Báez, Disnelys; Morales, Diego; Pino, Jorge A

    2012-05-01

    The chemical composition of the volatile compounds isolated by simultaneous distillation-extraction (SDE) and headspace-solid phase microextraction (SPME) from flowers of Michelia champaca growing in Cuba was investigated by GC/FID and GC/MS. Sixty-seven and thirty-four components were identified by SDE and SPME, respectively, with 1,8-cineole (22.8%) as the main constituent in the volatile oil isolated by SDE, and methyl benzoate (30.3%), indole (16.6%) and beta-elemene (10.4%) the major components detected by SPME.

  7. Synthesis of graphene nanoribbons from amyloid templates by gallium vapor-assisted solid-phase graphitization

    SciTech Connect

    Murakami, Katsuhisa Dong, Tianchen; Kajiwara, Yuya; Takahashi, Teppei; Fujita, Jun-ichi; Hiyama, Takaki; Takai, Eisuke; Ohashi, Gai; Shiraki, Kentaro

    2014-06-16

    Single- and double-layer graphene nanoribbons (GNRs) with widths of around 10 nm were synthesized directly onto an insulating substrate by solid-phase graphitization using a gallium vapor catalyst and carbon templates made of amyloid fibrils. Subsequent investigation revealed that the crystallinity, conductivity, and carrier mobility were all improved by increasing the temperature of synthesis. The carrier mobility of the GNR synthesized at 1050 °C was 0.83 cm{sup 2}/V s, which is lower than that of mechanically exfoliated graphene. This is considered to be most likely due to electron scattering by the defects and edges of the GNRs.

  8. A solid-phase radioimmunoassay for the determination of fibronectin levels in plasma

    SciTech Connect

    Pearlstein, E.; Baez, L.

    1981-09-15

    Fibronectin, iodinated in the absence of urea using lactoperoxidase coupled to Sepharose 4B, retained antigenic and biological activity. Utilizing the labeled protein, a solid-phase radioimmunoassay for the determination of the fibronectin concentraction in plasma was developed. The radioimmunoassay is rapid, uses small amounts of antibody, and obviates the need for a second antibody. It also facilitates the handling of large sample numbers.The mean plasma fibronectin level in normal individuals was 557 +/- 102 ..mu..g/ml, approximately 70% higher than values obtained by other procedures.

  9. Solid Phase Characterization of Tank 241-AY-102 Annulus Space Particulate

    SciTech Connect

    Cooke, G. A.

    2013-01-30

    The Special Analytical Studies Group at the 222-S Laboratory (222-S) examined the particulate recovered from a series of samples from the annular space of tank 241-AY-102 (AY-102) using solid phase characterization (SPC) methods. These include scanning electron microscopy (SEM) using the ASPEX®1 scanning electron microscope, X-ray diffraction (XRD) using the Rigaku®2 MiniFlex X-ray diffractometer, and polarized light microscopy (PLM) using the Nikon®3 Eclipse Pol optical microscope. The SEM is equipped with an energy dispersive X-ray spectrometer (EDS) to provide chemical information.

  10. Surface characterization of commercial fibers for solid-phase microextraction and related problems in their application.

    PubMed

    Haberhauer-Troyer, C; Crnoja, M; Rosenberg, E; Grasserbauer, M

    2000-02-01

    The surfaces of commercially available polydimethylsiloxane (PDMS) and Carboxen-PDMS fibers for solid-phase microextraction (SPME) were investigated by optical and electron microscopy. Damage to the coating as well as contamination of new fibers and a highly variable number of pores in Carboxen-PDMS coatings were observed. Together with the contamination of the fibers during their use with metallic particles originating from the SPME fiber holder they are possible explanations for the problems encountered in the analysis of organolead, organotin and organosulfur compounds, such as artifact formation and low repeatability. PMID:11220312

  11. Automated solid-phase extraction of herbicides from water for gas chromatographic-mass spectrometric analysis

    USGS Publications Warehouse

    Meyer, M.T.; Mills, M.S.; Thurman, E.M.

    1993-01-01

    An automated solid-phase extraction (SPE) method was developed for the pre-concentration of chloroacetanilide and triazine herbicides, and two triazine metabolites from 100-ml water samples. Breakthrough experiments for the C18 SPE cartridge show that the two triazine metabolites are not fully retained and that increasing flow-rate decreases their retention. Standard curve r2 values of 0.998-1.000 for each compound were consistently obtained and a quantitation level of 0.05 ??g/l was achieved for each compound tested. More than 10,000 surface and ground water samples have been analyzed by this method.

  12. Application of solid phase extraction procedures for rare earth elements determination in environmental samples.

    PubMed

    Pyrzynska, Krystyna; Kubiak, Anna; Wysocka, Irena

    2016-07-01

    Determination of rare earth elements in environmental samples requires often pre-concentration and separation step due to a low metal content and high concentration of the interfering matrix components. A solid phase extraction technique with different kind of solid sorbents offers a high enrichment factor, rapid phase separation and the possibility of its combination with various detection techniques used either in on-line or off-line mode. The recent developments in this area published over the last five years are presented and discussed in this paper.

  13. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer. PMID:26850226

  14. Neutron Scattering Studies of Pre-Transitional Effects in Solid-Solid Phase Transformations

    SciTech Connect

    Shapiro, S. M.

    1999-06-30

    Neutron scattering studies have played a fundamental role in understanding solid-solid phase transformations, particularly in studying the lattice dynamical behavior associated with precursor effects. A review of the studies performed on solids exhibiting Martensitic transformations is given below. The mode softening and associated elastic diffuse scattering, previously observed in NiAl alloys, will be discussed as well as more recent work on Ni{sub 2}MnGa, a system exhibiting magnetic order as well as a Martensitic transformation. Also, new results on the precursor effects in ordered and disordered FePt alloys will be presented.

  15. Challenges of infrared reflective spectroscopy of solid-phase explosives and chemicals on surfaces

    SciTech Connect

    Phillips, Mark C.; Suter, Jonathan D.; Bernacki, Bruce E.; Johnson, Timothy J.

    2012-09-01

    Reliable active and passive hyperspectral imaging and detection of explosives and solid-phase chemical residue on surfaces remains a challenge and an active area of research and development. Both methods rely on reference libraries for material identification, but in many cases the reference spectra do not sufficiently resemble those instrumental signals scattered from real-world objects. We describe a physics-based model using the dispersive complex dielectric constant to explain what is often thought of as anomalous behavior of scattered or non-specular signatures encountered in active and passive sensing of explosives or chemicals on surfaces and show modeling and experimental results for RDX.

  16. Solid-state dimer method for calculating solid-solid phase transitions

    SciTech Connect

    Xiao, Penghao; Henkelman, Graeme; Sheppard, Daniel; Rogal, Jutta

    2014-05-07

    The dimer method is a minimum mode following algorithm for finding saddle points on a potential energy surface of atomic systems. Here, the dimer method is extended to include the cell degrees of freedom for periodic solid-state systems. Using this method, reaction pathways of solid-solid phase transitions can be determined without having to specify the final state structure or reaction mechanism. Example calculations include concerted phase transitions between CdSe polymorphs and a nucleation and growth mechanism for the A15 to BCC transition in Mo.

  17. A method for solid phase synthesis of phosphors under increased pressure; creation of remote phosphors

    NASA Astrophysics Data System (ADS)

    Galashov, E. N.; Yusuf, A. A.; Mandrik, E. M.

    2016-08-01

    A method for phosphors solid-phase synthesis under high pressure is proposed. Using the method, phosphors based on rare earth garnets were synthesized at a temperature considerably lower (1300 °C) than the temperature of the synthesis by conventional method (above 1650 °C). Using organic, inorganic ligaments and synthesized phosphors, remote phosphors were created. The chromaticity coordinates of created LEDs on the base of blue LEDs and remote phosphors fall into the bin of white and green colours. Luminous efficiency reaches 140 lm/W.

  18. Solid phase synthesis of functionalised SAM-forming alkanethiol-oligoethyleneglycols.

    PubMed

    Murray, James; Nowak, Dominika; Pukenas, Laurynas; Azhar, Rizuan; Guillorit, Mathieu; Wälti, Christoph; Critchley, Kevin; Johnson, Steven; Bon, Robin S

    2014-06-28

    We present an efficient solid phase synthesis methodology that provides easy access to a range of functionalised long-chain alkanethiol-oligoethyleneglycols that form well-defined self-assembled monolayers on gold and are compatible with pre- or post-assembly conjugation of (bio)molecules. We demonstrate the versatility of our synthetic route by synthesising LCAT-OEGs with a range of functional moieties, including peptides, electro-active redox groups, chemical handles for post-assembly conjugation of (bio)molecules, and demonstrate the application of our LCAT-OEG monolayers in immunosensing, where they show good biocompatibility with minimal biofouling. PMID:25400934

  19. Synthesis of graphene nanoribbons from amyloid templates by gallium vapor-assisted solid-phase graphitization

    NASA Astrophysics Data System (ADS)

    Murakami, Katsuhisa; Dong, Tianchen; Kajiwara, Yuya; Hiyama, Takaki; Takahashi, Teppei; Takai, Eisuke; Ohashi, Gai; Shiraki, Kentaro; Fujita, Jun-ichi

    2014-06-01

    Single- and double-layer graphene nanoribbons (GNRs) with widths of around 10 nm were synthesized directly onto an insulating substrate by solid-phase graphitization using a gallium vapor catalyst and carbon templates made of amyloid fibrils. Subsequent investigation revealed that the crystallinity, conductivity, and carrier mobility were all improved by increasing the temperature of synthesis. The carrier mobility of the GNR synthesized at 1050 °C was 0.83 cm2/V s, which is lower than that of mechanically exfoliated graphene. This is considered to be most likely due to electron scattering by the defects and edges of the GNRs.

  20. Preparation and characteristics of new coating for solid-phase microextraction.

    PubMed

    Yang, Min; Wang, Yi-long; Zeng, Zhao-rui; Zhou, Ying

    2002-05-01

    Poly (methylphenylvinylsiloxane) (PMPVS) coating for solid-phase microextraction (SPME) was first prepared by using sol-gel approach and cross-linking of free radical initiation. The extraction properties of the novel coating for aromatic compounds were investigated using a self-made SPME device coupled with a gas chromatograph-flame ionization detector (GC-FID). The coating provided high surface areas and allowed high extraction efficiency. Compared with some commercial SPME stationary phases, the new phase showed better selectivity and sensitivity toward aromatic compounds. Furthermore, PMPVS coating showed good thermal stability and longer lifetime. PMID:12541936

  1. Novel nanoporous sorbent for solid-phase extraction in petroleum fingerprinting

    NASA Astrophysics Data System (ADS)

    Alayande, S. Oluwagbemiga; Hlengilizwe, Nyoni; Dare, E. Olugbenga; Msagati, Titus A. M.; Akinlabi, A. Kehinde; Aiyedun, P. O.

    2016-04-01

    Sample preparation is crucial in the analysis of petroleum and its derivatives. In this study, developing affordable sorbent for petroleum fingerprinting analysis using polymer waste such expanded polystyrene was explored. The potential of electrospun expanded polystyrene (EPS) as a sorbent for the solid-phase extraction (SPE) technique was investigated, and its efficiency was compared with commercial cartridges such as alumina, silica and alumina/silica hybrid commercial for petroleum fingerprinting analysis. The chromatograms showed that the packed electrospun EPS fibre demonstrated excellent properties for SPE applications relative to the hybrid cartridges.

  2. Polycrystalline silicon thin-film solar cell prepared by the solid phase crystallization (SPC) method

    SciTech Connect

    Baba, T.; Matsuyama, T.; Sawada, T.; Takahama, T.; Wakisaka, K.; Tsuda, S.; Nakano, S.

    1994-12-31

    A solid phase crystallization (SPC) method was applied to the fabrication of thin-film polycrystalline silicon (poly-Si) for solar cells for the first time. Among crystalline silicon solar cells crystallized at a low temperature of less than 600 C, the world`s highest conversion efficiency of 8.5% was achieved in a solar cell using thin-film poly-Si with only 10 {micro}m thickness prepared by the SPC method. This solar cell showed high photosensitivity in the long-wavelength region of more than 800 nm and also exhibited no light-induced degradation after light exposure.

  3. Chromatographic Separations Using Solid-Phase Extraction Cartridges: Separation of Wine Phenolics

    NASA Astrophysics Data System (ADS)

    Brenneman, Charles A.; Ebeler, Susan E.

    1999-12-01

    We describe a simple laboratory experiment that demonstrates the principles of chromatographic separation using solid-phase extraction columns and red wine. By adjusting pH and mobile phase composition, the wine is separated into three fractions of differing polarity. The content of each fraction can be monitored by UV-vis spectroscopy. When the experiment is combined with experiments involving HPLC or GC separations, students gain a greater appreciation for and understanding of the highly automated instrumental systems currently available. In addition, they learn about the chemistry of polyphenolic compounds, which are present in many foods and beverages and which are receiving much attention for their potentially beneficial health effects.

  4. Multiplexed Engineering in Biology.

    PubMed

    Rogers, Jameson K; Church, George M

    2016-03-01

    Biotechnology is the manufacturing technology of the future. However, engineering biology is complex, and many possible genetic designs must be evaluated to find cells that produce high levels of a desired drug or chemical. Recent advances have enabled the design and construction of billions of genetic variants per day, but evaluation capacity remains limited to thousands of variants per day. Here we evaluate biological engineering through the lens of the design–build–test cycle framework and highlight the role that multiplexing has had in transforming the design and build steps. We describe a multiplexed solution to the ‘test’ step that is enabled by new research. Achieving a multiplexed test step will permit a fully multiplexed engineering cycle and boost the throughput of biobased product development by up to a millionfold.

  5. Multiplex gas chromatography

    NASA Technical Reports Server (NTRS)

    Valentin, Jose R.

    1990-01-01

    The principles of the multiplex gas chromatography (GC) technique, which is a possible candidate for chemical analysis of planetary atmospheres, are discussed. Particular attention is given to the chemical modulators developed by present investigators for multiplex GC, namely, the thermal-desorption, thermal-decomposition, and catalytic modulators, as well as to mechanical modulators. The basic technique of multiplex GC using chemical modulators and a mechanical modulator is demonstrated. It is shown that, with the chemical modulators, only one gas stream consisting of the carrier in combination with the components is being analyzed, resulting in a simplified instrument that requires relatively few consumables. The mechanical modulator demonstrated a direct application of multiplex GC for the analysis of gases in atmosphere of Titan at very low pressures.

  6. Multiplex television transmission system

    NASA Technical Reports Server (NTRS)

    Reed, W. R.

    1967-01-01

    Time-multiplexing system enables several cameras to share a single commercial television transmission channel. This system is useful in industries for visually monitoring several operating areas or instrument panels from a remote location.

  7. Downlink data multiplexer

    NASA Technical Reports Server (NTRS)

    Holland, S. Douglas (Inventor); Steele, Glen F. (Inventor); Romero, Denise M. (Inventor); Koudelka, Robert David (Inventor)

    2008-01-01

    A data multiplexer that accommodates both industry standard CCSDS data packets and bits streams and standard IEEE 1394 data is described. The multiplexer provides a statistical allotment of bandwidth to the channels in turn, preferably four, but expandable in increments of four up to sixteen. A microcontroller determines bandwidth requested by the plurality of channels, as well as the bandwidth available, and meters out the available bandwidth on a statistical basis employing flow control to the input channels.

  8. Compact spatial multiplexers for mode division multiplexing.

    PubMed

    Chen, Haoshuo; van Uden, Roy; Okonkwo, Chigo; Koonen, Ton

    2014-12-29

    Spatial multiplexer (SMUX) for mode division multiplexing (MDM) has evolved from mode-selective excitation, multiple-spot and photonic-lantern based solutions in order to minimize both mode-dependent loss (MDL) and coupler insertion loss (CIL). This paper discusses the implementation of all the three solutions by compact components in a small footprint. Moreover, the compact SMUX can be manufactured in mass production and packaged to assure high reliability. First, push-pull scheme and center launch based SMUXes are demonstrated on two mostly-popular photonic integration platforms: Silicon-on-insulator (SOI) and Indium Phosphide (InP) for selectively exciting LP01 and LP11 modes. 2-dimensional (2D) top-coupling by using vertical emitters is explored to provide a coupling interface between a few-mode fiber (FMF) and the photonic integrated SMUX. SOI-based grating couplers and InP-based 45° vertical mirrors are proposed and researched as vertical emitters in each platform. Second, a 3-spot SMUX is realized on an InP-based circuit through employing 45° vertical mirrors. Third, as a newly-emerging photonic integration platform, laser-inscribed 3D waveguide (3DW) technology is applied for a fully-packaged dual-channel 6-mode SMUX including two 6-core photonic lantern structures as mode multiplexer and demultiplexer, respectively.

  9. Molecularly imprinted solid-phase extraction for selective trace analysis of trifluoperazine.

    PubMed

    Attaran, Abdol Mohammad; Mohammadi, Narges; Javanbakht, Mehran; Akbari-Adergani, Behrouz

    2014-08-01

    In this study, a novel sample clean-up technique based on the molecularly imprinted solid-phase extraction procedure is described for the determination of trifluoperazine (TFP) in biological fluids. The water-compatible molecularly imprinted polymers (MIPs) were prepared by using methacrylic acid as functional monomer, ethylene glycol dimethacrylate as cross-linker, chloroform as porogen and TFP as the template molecule. The novel imprinted polymer was used as a solid-phase extraction sorbent for the extraction of TFP from human serum and urine samples. Various parameters affecting the extraction efficiency of the polymer were evaluated. The selectivity of MIPs was evaluated by checking several substances with molecular structures similar to the template. The limits of detection and quantification for TFP in urine samples were 0.06 and 0.2 µg/L, respectively. These limits for TFP in serum samples were 0.15 and 0.4 µg/L, respectively. The recovery values for serum and urine samples were higher than 92 and 93%, respectively.

  10. Improvement of multilayer graphene crystallinity by solid-phase precipitation with current stress application during annealing

    NASA Astrophysics Data System (ADS)

    Sahab Uddin, Md.; Ichikawa, Hiroyasu; Sano, Shota; Ueno, Kazuyoshi

    2016-06-01

    To improve the crystallinity of multilayer graphene (MLG) films by solid-phase precipitation, a new method by which current stress is introduced during annealing of a carbon-doped cobalt (Co-C) layer using cobalt (Co) as the catalyst has been investigated. The effects of current stress on the formation and crystallinity of MLG films were investigated by comparing the characteristics of the films annealed at the same temperature with and without current by taking into account the temperature rise due to Joule heating. The characteristics obtained by Raman spectroscopy, scanning electron microscopy (SEM), transmission electron microscopy (TEM), and X-ray diffraction (XRD) measurements revealed that the MLG films produced were crystalline in nature and their crystallinity increased with applied current stress at the same temperature. From SEM observations, beside Joule heating, enhancement of Co grain size by agglomeration induced by current stress may be the potential reason for the improvement of the crystallinity of MLG films. We have also improved the uniformity of MLG films by depositing an additional copper (Cu) capping layer over the Co-C layer. Current stress application can lead to low-temperature fabrication of MLG with higher crystallinity by solid-phase precipitation.

  11. Rapid solid-phase extraction and analysis of resveratrol and other polyphenols in red wine.

    PubMed

    Hashim, Shima N N S; Schwarz, Lachlan J; Boysen, Reinhard I; Yang, Yuanzhong; Danylec, Basil; Hearn, Milton T W

    2013-10-25

    Red wine has long been credited as a good source of health-beneficial antioxidants, including the bioactive polyphenols catechin, quercetin, and (E)-resveratrol. In this paper, we report the application of reusable molecularly imprinted polymers (MIPs) for the selective and robust solid-phase extraction (SPE) and rapid analysis of (E)-resveratrol (LOD=8.87×10(-3) mg/L, LOQ=2.94×10(-2) mg/L), along with a range of other polyphenols from an Australian Pinot noir red wine. Optimization of the molecularly imprinted solid-phase extraction (MISPE) protocol resulted in the significant enrichment of (E)-resveratrol and several structurally related polyphenols. These secondary metabolites were subsequently identified by RP-HPLC and μLC-ESI ion trap MS/MS methods. The developed MISPE protocol employed low volumes of environmentally benign solvents selected according to the Green Chemistry principles, and resulted in the recovery of 99% of the total (E)-resveratrol present. These results further demonstrate the potential of generic protocols for the analysis of target compound with health beneficial properties within the food and nutraceutical industries using tailor-made MIPs.

  12. Sample cleanup using solid-phase dispersive extraction for determination of vancomycin in serum.

    PubMed

    Sakamoto, Yasuhiro; Jinno, Yuki; Shinodzuka, Ikumi; Iwasaki, Yusuke; Ito, Rie; Saito, Koichi

    2014-01-01

    A cleanup method employing quick and simple solid-phase dispersive extraction (SPDE) was investigated for its potential use in the determination of vancomycin (VCM) in serum by liquid chromatography/mass-spectrometry (LC/MS). SPDE was observed to be more rapid than conventional cartridge-type solid-phase extraction (SPE). In addition, in the analysis of viscous samples such as serum containing many proteins, SPDE could satisfactorily remove proteins even if deproteinization was not performed beforehand. The limit of detection (S/N = 3) and the limit of quantification (S/N > 10) of VCM by LC/MS were 0.05 and 0.2 ng/mL, respectively. The average recoveries of VCM from pooled serum spiked at 2, 10, and 100 ng/mL were 90.0, 90.8, and 98.6%, respectively. The repeatabilities were 7.5, 6.8, and 2.8%, and the intermediate precision values were 8.5, 6.8, and 7.0%, respectively. This suggests that the developed analytical method combing SPDE is useful for the determination of VCM in serum.

  13. Fragment-based solid-phase assembly of oligonucleotide conjugates with peptide and polyethylene glycol ligands.

    PubMed

    Dirin, Mehrdad; Urban, Ernst; Noe, Christian R; Winkler, Johannes

    2016-10-01

    Ligand conjugation to oligonucleotides is an attractive strategy for enhancing the therapeutic potential of antisense and siRNA agents by inferring properties such as improved cellular uptake or better pharmacokinetic properties. Disulfide linkages enable dissociation of ligands and oligonucleotides in reducing environments found in endosomal compartments after cellular uptake. Solution-phase fragment coupling procedures for producing oligonucleotide conjugates are often tedious, produce moderate yields and reaction byproducts are frequently difficult to remove. We have developed an improved method for solid-phase coupling of ligands to oligonucleotides via disulfides directly after solid-phase synthesis. A 2'-thiol introduced using a modified nucleotide building block was orthogonally deprotected on the controlled pore glass solid support with N-butylphosphine. Oligolysine peptides and a short monodisperse ethylene glycol chain were successfully coupled to the deprotected thiol. Cleavage from the resin and full removal of oligonucleotide protection groups were achieved using methanolic ammonia. After standard desalting, and without further purification, homogenous conjugates were obtained as demonstrated by HPLC, gel electrophoresis, and mass spectrometry. The attachment of both amphiphilic and cationic ligands proves the versatility of the conjugation procedure. An antisense oligonucleotide conjugate with hexalysine showed pronounced gene silencing in a cell culture tumor model in the absence of a transfection reagent and the corresponding ethylene glycol conjugate resulted in down regulation of the target gene to nearly 50% after naked application. PMID:27236069

  14. Palladium-coated stainless-steel wire as a solid-phase microextraction fiber.

    PubMed

    Sun, Min; Feng, Juanjuan; Bu, Yanan; Wang, Xiaojiao; Duan, Huimi; Luo, Chuannan

    2015-05-01

    A novel palladium solid-phase microextraction coating was fabricated on a stainless-steel wire by a simple in situ oxidation-reduction process. The palladium coating exhibited a rough microscaled surface and its thickness was about 2 μm. Preparation conditions (reaction time and concentration of palladium chloride and hydrochloric acid) were optimized in detail to achieve sufficient extraction efficiency. Extraction properties of the fiber were investigated by direct immersion solid-phase microextraction of several polycyclic aromatic hydrocarbons and phthalate esters in aqueous samples. The extracted analytes were transferred into a gas chromatography system by thermal desorption. The effect of extraction and desorption conditions on extraction efficiency were investigated. Under the optimum conditions, good linearity was obtained and correlation coefficients between 0.9908 and 0.9990 were obtained. Limits of detection were 0.05-0.10 μg/L for polycyclic aromatic hydrocarbons and 0.3 μg/L for phthalate esters. Their recoveries for real aqueous samples were in the range from 97.1 to 121% and from 89.1 to 108%, respectively. The intra- and interday tests were also investigated with three different addition levels, and satisfactory results were also obtained.

  15. Solid-phase heavy-metal separation under unfavorable background conditions by composite membranes

    SciTech Connect

    Sengupta, S.; Sengupta, A.K.

    1995-12-31

    Disposal of sludges or treatment of soil contaminated with minor fraction (often less than 5%) of heavy metals in the solid phase in an otherwise innocuous background is a widespread problem. Selective and targeted removal of the heavy metals from the background solid phase would constitute an efficient treatment process as it would be able to reduce the volume of hazardous sludge considerably and also may make it possible for the heavy metals to be concentrated and recycled/reused. A new class of sorptive/desorptive ion-exchange composite membranes available commercially is extremely suitable for heavy metal decontamination from sludges/slurries. In this material, fine spherical beads (<100 {micro} in dia) of heavy-metal selective chelating ion-exchangers are physically enmeshed or trapped in thin sheets ({approx}0.5 mm thick) of highly porous polytetrafluoroethylene (PTFE). These composite membranes, because of their thin-sheet like physical configuration, can be easily introduced into and withdrawn from any reactor containing sludge/slurry and the target solutes can be adsorbed onto the microbeads. These membranes are not fouled by high concentration of suspended solids but retain the retain the original properties of the chelating exchangers even after use for a number of cycles. This paper explores the efficacy of the composite membrane for heavy metal decontamination under unfavorable conditions.

  16. Isolation and analysis of sugar nucleotides using solid phase extraction and fluorophore assisted carbohydrate electrophoresis

    PubMed Central

    Barnes, Jarrod; Tian, Liping; Loftis, Jacqueline; Hiznay, James; Comhair, Suzy; Lauer, Mark; Dweik, Raed

    2016-01-01

    The building blocks of simple and complex oligosaccharides, termed sugar nucleotides, are often overlooked for their role in metabolic diseases and may hold the key to the underlying disease pathogenesis. Multiple reasons may account for the lack of analysis and quantitation of these sugar nucleotides, including the difficulty in isolation and purification as well as the required expensive instrumentation such as a high performance liquid chromatography (HPLC), mass spectrometer, or capillary electrophoresis. We have established a simple yet effective way to purify and quantitate sugar nucleotides using solid phase extraction (SPE) chromatography combined with fluorophore assisted carbohydrate electrophoresis (FACE). The simplicity of use, combined with the ability to run multiple samples at one time, give this technique a distinct advantage over the established methods for isolation and analysis of sugar nucleotides from cell culture models. • Sugar nucleotides can be easily purified with solid phase extraction chromatography. • FACE can be used to analyze multiple nucleotide sugar extracts with a single run. • The proposed method is simple, affordable, and uses common everyday research labware. PMID:27222820

  17. Selective removal of phosphorus from wastewater combined with its recovery as a solid-phase fertilizer.

    PubMed

    Sengupta, Sukalyan; Pandit, Arka

    2011-05-01

    Influx of Phosphorus (P) into freshwater ecosystems is the primary cause of eutrophication which has many undesirable effects. Therefore, P discharge limits for effluents from WWTPs is becoming increasingly common, and may be as low as 10 μg/L as P. While precipitation, filtration, membrane processes, Enhanced Biological Phosphorus Removal (EBPR) and Physico-chemical (adsorption based) methods have been successfully used to effect P removal, only adsorption has the potential to recover the P as a usable fertilizer. This benefit will gain importance with time since P is a non-renewable resource and is mined from P-rich rocks. This article provides details of a process where a polymeric anion exchanger is impregnated with iron oxide nanoparticles to effectuate selective P removal from wastewater and its recovery as a solid-phase fertilizer. Three such hybrid materials were studied: HAIX, DOW-HFO, & DOW-HFO-Cu. Each of these materials combines the durability, robustness, and ease-of-use of a polymeric ion-exchanger resin with the high sorption affinity of Hydrated Ferric Oxide (HFO) toward phosphate. Laboratory experiments demonstrate that each of the three materials studies can selectively remove phosphate from the background of competing anions and phosphorus can be recovered as a solid-phase fertilizer upon efficient regeneration of the exchanger and addition of a calcium or magnesium salt in equimolar (Ca/P or Mg/P) ratio. Also, there is no leaching of Fe or Cu from any of these hybrid exchangers.

  18. Determination of amphetamines in hair by integrating sample disruption, clean-up and solid phase derivatization.

    PubMed

    Argente-García, A; Moliner-Martínez, Y; Campíns-Falcó, P; Verdú-Andrés, J; Herráez-Hernández, R

    2016-05-20

    The utility of matrix solid phase dispersion (MSPD) for the direct analysis of amphetamines in hair samples has been evaluated, using liquid chromatography (LC) with fluorescence detection and precolumn derivatization. The proposed approach is based on the employment of MSPD for matrix disruption and clean-up, followed by the derivatization of the analytes onto the dispersant-sample blend. The fluorogenic reagent 9-fluorenylmethyl chloroformate (FMOC) has been used for derivatization. Different conditions for MSPD, analyte purification and solid phase derivatization have been tested, using amphetamine (AMP), methamphetamine (MET), ephedrine (EPE) and 3,4-methylenedioxymethamphetamine (MDMA) as model compounds. The results have been compared with those achieved by using ultrasound-assisted alkaline digestion and by MSPD combined with conventional solution derivatization. On the basis of the results obtained, a methodology is proposed for the analysis of amphetamines in hair which integrates sample disruption, clean-up and derivatization using a C18 phase. Improved sensitivity is achieved with respect to that obtained by the alkaline digestion or by the MSPD followed by solution derivatization methods. The method can be used for the quantification of the tested amphetamines within the 2.0-20.0ng/mg concentration interval, with limits of detection (LODs) of 0.25-0.75ng/mg. The methodology is very simple and rapid (the preparation of the sample takes less than 15min). PMID:27108048

  19. Solid-Phase Formation Of Isovaline, A Non-Biological, Meteoritic Amino Acid

    NASA Astrophysics Data System (ADS)

    Hudson, Reggie L.; Lewis, A. S.; Moore, M. H.; Dworkin, J. P.; Glavin, D. P.

    2007-10-01

    Among the Murchison (CM) meteoritic amino acids, isovaline stands out as being non-biological (nonprotein) and having a high abundance. Approximately equal amounts of D- and L-isovaline have been reported in CM meteorites, but the molecule's structure appears to prohibit racemization in aqueous solutions. While it is possible that isovaline could be made by the oft-studied Strecker reaction, laboratory experiments have seldom been able to produce this molecule from realistic molecular precursors. Recently we have investigated the low-temperature solid-phase chemistry of isovaline with an eye toward the molecule's formation, its stability, and the interconversion of its D- and L-enantiomers. Ion-irradiated isovaline-containing ices were examined by IR spectroscopy and highly-sensitive LC/ToF-MS methods to assess both amino acid destruction and racemization. Samples were studied both in the presence and absence of water-ice, and the destruction of isovaline was measured as a function of radiation dose. In addition, we have continued our earlier work on solid-phase amino acid formation, extending it to cover isovaline. In this presentation we will report the results of these newer investigations. This work was supported by a grant to the Goddard Center for Astrobiology through the NASA Astrobiology Institute. AL was supported by an award from the Summer Undergraduate Internship in Astrobiology program.

  20. Headspace solid-phase microextraction for direct determination of volatile phenols in cider.

    PubMed

    Pizarro, Consuelo; Pérez-del-Notario, Nuria; González-Sáiz, José María

    2009-11-01

    A headspace solid-phase microextraction coupled to gas chromatography-tandem mass spectrometry (GC-MS/MS) method was optimised and validated for the determination of 4-ethylguaiacol, 4-ethylphenol, 4-vinylguaiacol and 4-vinylphenol, involved in the presence of Brett character, in ciders. The influence of different parameters on extraction efficiency (fibre coating, salt addition, exposure time, extraction temperature and sample volume/total volume ratio) was evaluated. Divinylbenzene/carboxen/PDMS was selected as extraction fibre and the other optimised parameters were as follows: 10 mL of cider, temperature 70 degrees C, extraction time 60 min and addition of 0.4 g/mL of NaCl. The proposed method showed satisfactory linearity. The detection limits obtained were 0.01 microg/L for 4-ethylguaiacol, 0.02 microg/L for 4-ethylphenol, 0.08 microg/L for 4-vinylguaiacol and 0.03 microg/L for 4-vinylphenol. These detection limits were lower than those obtained in previous studies on the determination of volatile phenols in other alcoholic beverages. Good recoveries of over 95% were observed for all compounds, and the repeatability obtained was considered acceptable, ranging between 4 and 10%. To demonstrate the feasibility of the procedure, the method was applied to the analysis of commercial ciders. To our knowledge, this is the first time that the headspace solid-phase microextraction procedure has been optimised to determine specifically the Brett character responsible compounds in cider. PMID:20029909

  1. Evaluation of clean solid phases for extraction of nitroaromatics and nitramines from water. Special report

    SciTech Connect

    Jenkins, T.F.; Thorne, P.G.; Myers, K.F.; McCormick, E.F.; Parker, D.E.

    1995-09-01

    Salting-out solvent extraction (SOE) was compared with cartridge and membrane solid-phase extraction (SPE) for preconcentration of nitroaromatics, nitramines, and aminonitroaromatics prior to determination by reversed-phase high-performance liquid chromatography. The solid phases used were manufacturer-cleaned materials, Porapak RDX for the cartridge method and Empore SDB-RPS for the membrane method. Thirty-three groundwater samples from the Naval Surface Warfare Center, Crane, Indiana, were analyzed using the direct analysis protocol specified in SW846 Method 8330, and the results were compared with analyses conducted after preconcentration using SOE with acetonitrile, cartridge-based SPE, and membrane-based SPE. For high-concentration samples, analytical results from the three preconcentration techniques were compared with results from the direct analysis protocol; good recovery of all target analytes was achieved by all three pre-concentration methods. For low-concentration samples, results from the two SPE methods were correlated with results from the SOE method; very similar data was obtained by the SOE and SPE methods, even at concentrations well below 1 microgram/L.

  2. Integrated microfluidic device for solid-phase extraction coupled to micellar electrokinetic chromatography separation.

    PubMed

    Ramsey, Jeremy D; Collins, Greg E

    2005-10-15

    An integrated microdevice was utilized for the autonomous coupling of solid-phase extraction (SPE) to micellar electrokinetic chromatography (MEKC). Porous plugs of polymethacrylate polymer approximately 200 microm in length) were fabricated by ultraviolet irradiation in microchannels. Microcolumns of hydrophobic beads packed against the polymethacrylate plugs were utilized for the quantitative extraction of rhodamine B, yielding preconcentration factors over 200 for a 90-s extraction. The calculated detection limit for this dye was 60 fM. A sample of coumarin dyes were concentrated by SPE, eluted in a nonaqueous solvent from a separate on-chip reservoir, and injected by a gated valve onto a separate column for MEKC analysis. Using the integrated device, a completely automated sequence of extraction, elution, injection, separation, and detection were performed in less than 5 min. Observed separation efficiencies were high, with plate heights below 2 microm. The analysis was at least 3 times faster than semiautomated, conventional, solid-phase extraction, while requiring no user intervention. The design, fabrication, and autonomous operation of the device is discussed.

  3. Determination of cyproheptadine in feeds using molecularly imprinted solid-phase extraction coupled with HPLC.

    PubMed

    Yang, Jianwen; Wang, Zongnan; Zhou, Tong; Song, Xuqin; Liu, Qingyong; Zhang, Yuman; He, Limin

    2015-05-15

    A novel method was developed for the determination of cyproheptadine in feeds using molecularly imprinted solid-phase extraction coupled with high-performance liquid chromatography. The polymers were prepared using cyproheptadine as a template molecule, methacrylic acid as a functional monomer, ethylene glycol dimethacrylate as a cross-linking agent, and dichloromethane as a solvent by bulk polymerization. Under the optimum solid-phase extraction conditions, the molecular imprinting cartridge can selectively extract and enrich cyproheptadine from a variety of feeds. Mean recoveries of cyproheptadine from four kinds of feeds spiked at 0.1, 1.0 and 10mgkg(-1) ranged from 85.5% to 96.2%, with intra-day and inter-day relative standard deviation less than 10%. The calibration curve of cyproheptadine was good linear relationship (r>0.9993) within the range of 0.1-50μgmL(-1). The limit of detection (LOD) and the limit of quantification (LOQ) were 0.04 and 0.1mgkg(-1), respectively.

  4. Isolation of genomic DNA using magnetic nanoparticles as a solid-phase support

    NASA Astrophysics Data System (ADS)

    Saiyed, Z. M.; Ramchand, C. N.; Telang, S. D.

    2008-05-01

    In recent years, techniques employing magnetizable solid-phase supports (MSPS) have found application in numerous biological fields. This magnetic separation procedure offers several advantages in terms of subjecting the analyte to very little mechanical stress compared to other methods. Secondly, these methods are non-laborious, cheap, and often highly scalable. The current paper details a genomic DNA isolation method optimized in our laboratory using magnetic nanoparticles as a solid-phase support. The quality and yields of the isolated DNA from all the samples using magnetic nanoparticles were higher or equivalent to the traditional DNA extraction procedures. Additionally, the magnetic method takes less than 15 min to extract polymerase chain reaction (PCR) ready genomic DNA as against several hours taken by traditional phenol-chloroform extraction protocols. Moreover, the isolated DNA was found to be compatible in PCR amplification and restriction endonuclease digestion. The developed procedure is quick, inexpensive, robust, and it does not require the use of organic solvents or sophisticated instruments, which makes it more amenable to automation and miniaturization.

  5. Comparison of Fluorescence Microscopy and Solid-Phase Cytometry Methods for Counting Bacteria in Water

    PubMed Central

    Lisle, John T.; Hamilton, Martin A.; Willse, Alan R.; McFeters, Gordon A.

    2004-01-01

    Total direct counts of bacterial abundance are central in assessing the biomass and bacteriological quality of water in ecological and industrial applications. Several factors have been identified that contribute to the variability in bacterial abundance counts when using fluorescent microscopy, the most significant of which is retaining an adequate number of cells per filter to ensure an acceptable level of statistical confidence in the resulting data. Previous studies that have assessed the components of total-direct-count methods that contribute to this variance have attempted to maintain a bacterial cell abundance value per filter of approximately 106 cells filter−1. In this study we have established the lower limit for the number of bacterial cells per filter at which the statistical reliability of the abundance estimate is no longer acceptable. Our results indicate that when the numbers of bacterial cells per filter were progressively reduced below 105, the microscopic methods increasingly overestimated the true bacterial abundance (range, 15.0 to 99.3%). The solid-phase cytometer only slightly overestimated the true bacterial abundances and was more consistent over the same range of bacterial abundances per filter (range, 8.9 to 12.5%). The solid-phase cytometer method for conducting total direct counts of bacteria was less biased and performed significantly better than any of the microscope methods. It was also found that microscopic count data from counting 5 fields on three separate filters were statistically equivalent to data from counting 20 fields on a single filter. PMID:15345419

  6. The effect of surfactant and solid phase concentration on drug aggregates in model aerosol propellent suspensions.

    PubMed

    Bower, C; Washington, C; Purewal, T S

    1996-04-01

    The effect of increasing solid phase concentration on the morphology and flocculation rate of model aerosol suspensions has been investigated. Suspensions of micronized salbutamol sulphate and lactose in trichlorotrifluoroethane (P113) were studied under conditions of increasing shear stress. By use of image analysis techniques, measurement of aggregate size, fractal dimension and rate of aggregation was performed. The effect of the surfactant sorbitan monooleate on morphology and flocculation rate was also studied. Increased solid phase concentration caused an increase in the rate of aggregation and average aggregate size at a given value of shear stress. Surfactant addition retarded the aggregation rate, and caused a shift from a diffusion-limited cluster aggregation to a reaction-limited cluster aggregation mechanism. The aggregate profiles showed a corresponding change from rugged and crenellated without surfactant, to increasingly smooth and Euclidian with increasing surfactant concentration. The morphological changes were characterized by a decrease in the average boundary fractal dimension which also correlated well with the corresponding reduction in aggregation rate.

  7. Determination of amphetamines in hair by integrating sample disruption, clean-up and solid phase derivatization.

    PubMed

    Argente-García, A; Moliner-Martínez, Y; Campíns-Falcó, P; Verdú-Andrés, J; Herráez-Hernández, R

    2016-05-20

    The utility of matrix solid phase dispersion (MSPD) for the direct analysis of amphetamines in hair samples has been evaluated, using liquid chromatography (LC) with fluorescence detection and precolumn derivatization. The proposed approach is based on the employment of MSPD for matrix disruption and clean-up, followed by the derivatization of the analytes onto the dispersant-sample blend. The fluorogenic reagent 9-fluorenylmethyl chloroformate (FMOC) has been used for derivatization. Different conditions for MSPD, analyte purification and solid phase derivatization have been tested, using amphetamine (AMP), methamphetamine (MET), ephedrine (EPE) and 3,4-methylenedioxymethamphetamine (MDMA) as model compounds. The results have been compared with those achieved by using ultrasound-assisted alkaline digestion and by MSPD combined with conventional solution derivatization. On the basis of the results obtained, a methodology is proposed for the analysis of amphetamines in hair which integrates sample disruption, clean-up and derivatization using a C18 phase. Improved sensitivity is achieved with respect to that obtained by the alkaline digestion or by the MSPD followed by solution derivatization methods. The method can be used for the quantification of the tested amphetamines within the 2.0-20.0ng/mg concentration interval, with limits of detection (LODs) of 0.25-0.75ng/mg. The methodology is very simple and rapid (the preparation of the sample takes less than 15min).

  8. Introducing Freshmen Students to the Practice of Solid-Phase Synthesis

    NASA Astrophysics Data System (ADS)

    Taralp, Alpay; Hulusi Türkseven, Can; Özgür Çakmak, Atilla; Çengel, Ömer

    2002-01-01

    A one-semester laboratory project on solid-phase peptide chemistry was designed pedagogically to cater to freshman science students. The approach not only permitted multistep syntheses that would be considered impractical in solution, but also gave students insight into fundamental aspects of research at an early stage of development. Young scientists prepared Bz-Asn-Asn-Phe and Bz-Asn-Gln-Phe--peptides envisaged as potential competitive inhibitors of chymotrypsin. The synthesis, defined by an attachment-deprotection cycle, two elongation-deprotection cycles, and a benzoyl-capping protocol, was completed manually on Wang resin using Fmoc chemistry. Students quantified the yield of each condensation and deprotection reaction by measuring levels of dibenzylfulvene chromophore, a stoichiometrically afforded by-product. Benzoylation of the N-terminus was confirmed by employing a cadmium-ninhydrin reagent. The group also ascertained, through use of a chromogenic substrate, that chymotrypsin-catalyzed hydrolysis was impeded slightly when carried out in the presence of target peptides. Supplementary analyses supporting peptide purity and composition were given to students. Grading was based on laboratory participation, project proposals, reports, and a concluding slide-show presentation made to peers and colleagues. While the project was time-consuming overall, students acquired an impression of research work and an appreciation of the utility of solid-phase methods.

  9. Process for forming a homogeneous oxide solid phase of catalytically active material

    DOEpatents

    Perry, Dale L.; Russo, Richard E.; Mao, Xianglei

    1995-01-01

    A process is disclosed for forming a homogeneous oxide solid phase reaction product of catalytically active material comprising one or more alkali metals, one or more alkaline earth metals, and one or more Group VIII transition metals. The process comprises reacting together one or more alkali metal oxides and/or salts, one or more alkaline earth metal oxides and/or salts, one or more Group VIII transition metal oxides and/or salts, capable of forming a catalytically active reaction product, in the optional presence of an additional source of oxygen, using a laser beam to ablate from a target such metal compound reactants in the form of a vapor in a deposition chamber, resulting in the deposition, on a heated substrate in the chamber, of the desired oxide phase reaction product. The resulting product may be formed in variable, but reproducible, stoichiometric ratios. The homogeneous oxide solid phase product is useful as a catalyst, and can be produced in many physical forms, including thin films, particulate forms, coatings on catalyst support structures, and coatings on structures used in reaction apparatus in which the reaction product of the invention will serve as a catalyst.

  10. [Solid phase microextraction (SPME) of sample preparation during of a complex biological matrix in biotransformation studies].

    PubMed

    Kroll, C; Borchert, H H

    1998-03-01

    Within the scope of the investigation of drug metabolism in keratinocytes solid phase microextraction (SPME) was investigated as a suitable method for sample preparation. The application of SPME is based on the fact, that a amount of analyte is absorbed by the polymer fiber at equilibrium, and the fiber is localized on a tip of a GC-syringe. The stable nitroxyl radical TEMPO (2,2,6,6-tetramthylpiperidine-1-oxyl) and its apolar metabolite 2,2,6,6-tetramethylpiperidine were analyzed by SPME and subsequent GC using thymol as internal standard. By means of the headspace-technique and an apolar fiber the recovery rate of TEMPO and the metabolite was nearly 100% and the precision was high. However, the results of the direct SPME were unsatisfactory. In comparison with conventional liquid/liquid extraction and solid phase extraction SPE the SPME proved the best results with regard to recovery rate and precision. Furthermore, the main advantages of SPME are the renunciation of organic solvents, the saving of time, the possibility to reuse the fiber about 100-150 times and the option for a complete automatisation of the extraction procedure. PMID:9547519

  11. Determination of aflatoxins in rice samples by ultrasound-assisted matrix solid-phase dispersion.

    PubMed

    Manoochehri, Mahboobeh; Asgharinezhad, Ali Akbar; Safaei, Mahdi

    2015-01-01

    This work describes the application of ultrasound-assisted matrix solid-phase dispersion as an extraction and sample preparation approach for aflatoxins (B1, B2, G1 and G2) and subsequent determination of them by high-performance liquid chromatography-fluorescence detection. A Box-Behnken design in combination with response surface methodology was used to determine the affecting parameters on the extraction procedure. The influence of different variables including type of dispersing phase, sample-to-dispersing phase ratio, type and quantity of clean-up phase, ultrasonication time, ultrasonication temperature, nature and volume of the elution solvent was investigated in the optimization study. C18, primary-secondary amine (PSA) and acetonitrile were selected as dispersing phase, clean-up phase and elution solvent, respectively. The obtained optimized values were sample-to-dispersing phase ratio of 1 : 1, 60 mg of PSA, 11 min ultrasonication time, 30°C ultrasonication temperature and 4 mL acetonitrile. Under the optimal conditions, the limits of detection were ranged from 0.09 to 0.14 ng g(-1) and the precisions [relative standard deviation (RSD%)] were <8.6%. The recoveries of the matrix solid-phase dispersion process ranged from 78 to 83% with RSD <10% in all cases. Finally, this method was successfully applied to the extraction of trace amounts of aflatoxins in rice samples.

  12. Solid phase extraction and metabolic profiling of exudates from living copepods

    PubMed Central

    Heuschele, Jan; Nylund, Göran M.; Pohnert, Georg; Pavia, Henrik; Bjærke, Oda; Pender-Healy, Larisa A.; Tiselius, Peter; Kiørboe, Thomas

    2016-01-01

    Copepods are ubiquitous in aquatic habitats. They exude bioactive compounds that mediate mate finding or induce defensive traits in prey organisms. However, little is known about the chemical nature of the copepod exometabolome that contributes to the chemical landscape in pelagic habitats. Here we describe the development of a closed loop solid phase extraction setup that allows for extraction of exuded metabolites from live copepods. We captured exudates from male and female Temora longicornis and analyzed the content with high resolution LC-MS. Chemometric methods revealed 87 compounds that constitute a specific chemical pattern either qualitatively or quantitatively indicating copepod presence. The majority of the compounds were present in both female and male exudates, but nine compounds were mainly or exclusively present in female exudates and hence potential pheromone candidates. Copepodamide G, known to induce defensive responses in phytoplankton, was among the ten compounds of highest relative abundance in both male and female extracts. The presence of copepodamide G shows that the method can be used to capture and analyze chemical signals from living source organisms. We conclude that solid phase extraction in combination with metabolic profiling of exudates is a useful tool to develop our understanding of the chemical interplay between pelagic organisms. PMID:26788422

  13. Matrix compatible solid phase microextraction coating, a greener approach to sample preparation in vegetable matrices.

    PubMed

    Naccarato, Attilio; Pawliszyn, Janusz

    2016-09-01

    This work proposes the novel PDMS/DVB/PDMS fiber as a greener strategy for analysis by direct immersion solid phase microextraction (SPME) in vegetables. SPME is an established sample preparation approach that has not yet been adequately explored for food analysis in direct immersion mode due to the limitations of the available commercial coatings. The robustness and endurance of this new coating were investigated by direct immersion extractions in raw blended vegetables without any further sample preparation steps. The PDMS/DVB/PDMS coating exhibited superior features related to the capability of the external PDMS layer to protect the commercial coating, and showed improvements in terms of extraction capability and in the cleanability of the coating surface. In addition to having contributed to the recognition of the superior features of this new fiber concept before commercialization, the outcomes of this work serve to confirm advancements in the matrix compatibility of the PDMS-modified fiber, and open new prospects for the development of greener high-throughput analytical methods in food analysis using solid phase microextraction in the near future.

  14. An Economical Online Solid-Phase Extraction LC-MS/MS Method for Quantifying Methylprednisolone.

    PubMed

    Hu, Xingjiang; Zheng, Yunliang; Wu, Guolan; Liu, Jian; Chen, Junchun; Huang, Mingzhu; Zhou, Huili; Wu, Lihua; Shen-Tu, Jianzhong

    2015-07-01

    An economical, reproducible and automated online solid-phase extraction coupled with liquid chromatography-tandem mass spectrometry method was developed to quantify methylprednisolone in human plasma. The method was validated in terms of selectivity, precision/accuracy, process efficiency, stability, cartridge reproducibility and carryover studies. Sample pretreatment was performed by protein precipitation and elimination using methanol followed by water dilution. Then, the mixture was passed onto the HySphere C8 EC-SE online solid-phase extraction cartridge followed by the separation of the analytes on an Agilent Eclipse XDB column. Electrospray ionization in positive ion mode and multiple reaction monitoring were used to monitor the ion transitions at m/z 375.4/160.8 for methylprednisolone, and m/z 361.2/147.0 for prednisolone. The calibration curve ranged from 5.25 to 525 ng/mL. Meanwhile both the intra-day and inter-day precision values (relative standard deviation) were within 4.45%. The method which turns out to be less laborious, faster and lower consumable cost per sample has already been successfully applied to a pharmacokinetic study in which the oral administration of 16 mg methylprednisolone was conducted in Chinese volunteers.

  15. A comparison of methods to predict solid phase heats of formation of molecular energetic salts.

    PubMed

    Byrd, Edward F C; Rice, Betsy M

    2009-01-01

    In this study a variety of methods were used to compute the energies for lattice enthalpies and gas phase heats of formation of the ionic constituents used in Born-Fajans-Haber cycles to produce solid phase heats of formation of molecular ionic energetic crystals. Several quantum mechanically based or empirical approaches to calculate either the heat of formation of the ionic constituents in the gas phase (deltaH(o)f(g)) or the lattice enthalpy (deltaH(o)Lattice) were evaluated. Solid phase heats of formation calculated from combinations of deltaH(o)f(g) and deltaH(o)Lattice determined through various approaches are compared with experimental values for a series of molecular energetic salts with 1:1, 2:1 and 2:2 charge ratios. Recommendations for combinations of deltaH(o)f(g) and deltaH(o)Lattice to produce best agreement with experiment are given, along with suggestions for improvements of the methods.

  16. Development of andrographolide molecularly imprinted polymer for solid-phase extraction

    NASA Astrophysics Data System (ADS)

    Yin, Xiaoying; Liu, Qingshan; Jiang, Yifan; Luo, Yongming

    2011-06-01

    A method employing molecularly imprinted polymer (MIP) as selective sorbent for solid-phase extraction (SPE) to pretreat samples was developed. The polymers were prepared by precipitation polymerization with andrographolide as template molecule. The structure of MIP was characterized and its static adsorption capacity was measured by the Scatchard equation. In comparison with C 18-SPE and non-imprinted polymer (NIP) SPE column, MIP-SPE column displays high selectivity and good affinity for andrographolide and dehydroandrographolide for extract of herb Andrographis paniculata ( Burm.f.) Nees (APN). MIP-SPE column capacity was 11.9 ± 0.6 μmol/g and 12.1 ± 0.5 μmol/g for andrographolide and dehydroandrographolide, respectively and was 2-3 times higher than that of other two columns. The precision and accuracy of the method developed were satisfactory with recoveries between 96.4% and 103.8% (RSD 3.1-4.3%, n = 5) and 96.0% and 104.2% (RSD 2.9-3.7%, n = 5) for andrographolide and dehydroandrographolide, respectively. Various real samples were employed to confirm the feasibility of method. This developed method demonstrates the potential of molecularly imprinted solid phase extraction for rapid, selective, and effective sample pretreatment.

  17. Isolation and analysis of sugar nucleotides using solid phase extraction and fluorophore assisted carbohydrate electrophoresis.

    PubMed

    Barnes, Jarrod; Tian, Liping; Loftis, Jacqueline; Hiznay, James; Comhair, Suzy; Lauer, Mark; Dweik, Raed

    2016-01-01

    The building blocks of simple and complex oligosaccharides, termed sugar nucleotides, are often overlooked for their role in metabolic diseases and may hold the key to the underlying disease pathogenesis. Multiple reasons may account for the lack of analysis and quantitation of these sugar nucleotides, including the difficulty in isolation and purification as well as the required expensive instrumentation such as a high performance liquid chromatography (HPLC), mass spectrometer, or capillary electrophoresis. We have established a simple yet effective way to purify and quantitate sugar nucleotides using solid phase extraction (SPE) chromatography combined with fluorophore assisted carbohydrate electrophoresis (FACE). The simplicity of use, combined with the ability to run multiple samples at one time, give this technique a distinct advantage over the established methods for isolation and analysis of sugar nucleotides from cell culture models. •Sugar nucleotides can be easily purified with solid phase extraction chromatography.•FACE can be used to analyze multiple nucleotide sugar extracts with a single run.•The proposed method is simple, affordable, and uses common everyday research labware. PMID:27222820

  18. Comparison of fluorescence microscopy and solid-phase cytometry methods for counting bacteria in water

    USGS Publications Warehouse

    Lisle, John T.; Hamilton, Martin A.; Willse, Alan R.; McFeters, Gordon A.

    2004-01-01

    Total direct counts of bacterial abundance are central in assessing the biomass and bacteriological quality of water in ecological and industrial applications. Several factors have been identified that contribute to the variability in bacterial abundance counts when using fluorescent microscopy, the most significant of which is retaining an adequate number of cells per filter to ensure an acceptable level of statistical confidence in the resulting data. Previous studies that have assessed the components of total-direct-count methods that contribute to this variance have attempted to maintain a bacterial cell abundance value per filter of approximately 106 cells filter-1. In this study we have established the lower limit for the number of bacterial cells per filter at which the statistical reliability of the abundance estimate is no longer acceptable. Our results indicate that when the numbers of bacterial cells per filter were progressively reduced below 105, the microscopic methods increasingly overestimated the true bacterial abundance (range, 15.0 to 99.3%). The solid-phase cytometer only slightly overestimated the true bacterial abundances and was more consistent over the same range of bacterial abundances per filter (range, 8.9 to 12.5%). The solid-phase cytometer method for conducting total direct counts of bacteria was less biased and performed significantly better than any of the microscope methods. It was also found that microscopic count data from counting 5 fields on three separate filters were statistically equivalent to data from counting 20 fields on a single filter.

  19. The evolution of pretransfusion testing: from agglutination to solid-phase red cell adherence tests.

    PubMed

    Plapp, F V; Sinor, L T; Rachel, J M

    1989-01-01

    Hospital transfusion services and blood centers still use manual hemagglutination tests for most of their serological procedures. Automation of hemagglutination reactions has proven to be difficult, primarily because hemagglutination lacks an objective endpoint which can be easily interpreted by inexpensive instruments. Alternatively, solid-phase red cell adherence assays for ABO cell and serum grouping, Rh typing, red cell and platelet antibody screening, red cell and platelet crossmatching, IgA deficiency screening, hepatitis B surface antigen, and HIV antibody screening have been developed. The performance of these assays compares favorably with current hemagglutination and enzyme immunoassay methods. All of these tests share a common objective endpoint of adherence or nonadherence of indicator red cells. This uniformity allows easy interpretation of results visually, spectrophotometrically, or by image analysis. The latter technique has the potential to revolutionize the reading and interpretation of all agglutination tests. Solid-phase red cell adherence tests in microplates are ideal for batch processing large numbers of specimens. However, adherence tests are not restricted to this format. Therefore, blood grouping dipsticks have been produced, which permit testing of individual blood samples even outside of the laboratory.

  20. Spectrophotometric determination of iron in environmental and food samples using solid phase extraction.

    PubMed

    Kassem, Mohammed A; Amin, Alaa S

    2013-12-01

    A simple, selective and highly sensitive extraction method has been developed for the determination of iron(II) spectrophotometrically after solid phase extraction. The absorbance is measured at λmax 644 nm. Beer's law was obeyed up to 450 ng mL(-1) of iron. The molar absorptivity, Sandell's sensitivity, detection and quantification limits were calculated and found to be 1.09×10(5) L mol(-1) cm(-1), 0.51 ng cm(-2), 1.98 and 6.0 ng mL(-1), respectively and compared with parameters obtained without using solid phase extraction method. After reduction of Fe(III) by addition of 2.0 mL of 10% hydroxylamine HCl, the system was applied to the total iron. The interference of various ions has been studied in detail and the statistical evaluation of the experimental results is reported. The proposed methods have been successfully applied for the determination of trace amount of iron in environment water, soil and botanical reference materials with recovery range (98.71-101.51%).

  1. Gas chromatographic analysis of organic marker compounds in fine particulate matter using solid-phase microextraction.

    PubMed

    Lin, Lin; Lee, Milton L; Eatough, Delbert J

    2007-01-01

    A gas chromatographic method that uses solid-phase microextraction for analysis of organic marker compounds in fine particulate matter (PM2.5) is reported. The target marker compounds were selected for specificity toward emission from wood smoke, diesel or gasoline combustion, or meat cooking. Temperature-programmed volatilization analysis was used to characterize the thermal stabilities and volatile properties of the compounds of interest. The compounds were thermally evaporated from a quartz filter, sorbed to a solid phase microextraction (SPME) fiber, and thermally desorbed at 280 degrees C in a gas chromatograph injection port connected via a DB 1701 capillary separating column. Various experimental parameters (fiber type, time, and temperature of sorption) were optimized. It was found that high extraction yield could be achieved using a polyacrylate fiber for polar substances, such as levoglucosan, and a 7-microm polydimethylsiloxane (PDMS)-coated fiber for nonpolar compounds, such as hopanes and polyaromatic hydrocarbon. A compromise was made by selecting a carboxen/PDMS fiber, which can simultaneously extract all of the analytes of interest with moderate-to-high efficiency at 180 degrees C within a 30-min accumulation period. The optimized method was applied to the determination of levoglucosan in pine wood combustion emissions. The simplicity, rapidity, and selectivity of sample collection with a polymer-coated SPME coupled to capillary gas chromatography (GC) made this method potentially useful for atmospheric chemistry studies.

  2. Comparative studies of magnetic particle-based solid phase fluorogenic and electrochemiluminescent immunoassay.

    PubMed

    Yu, H

    1998-09-01

    Two solid phase immunoassays, an electrochemiluminescent immunoassay (ECLIA) and a magnetic particle fluorogenic immunoassay (MPFIA) were evaluated and compared for bacterial detection. Briefly, the ECLIA is based on a redox reaction between ruthenium (II)-trisbipyridyl Ru[(bpy)3]2+ labeled antibody and the excess of tripropylamine, which generates photons. The entire reaction is carried on the near surface area between the spherical magnetic beads and an anode electrode. The detectable bacterial spores are at a linear range from 5 x 10(3) to 5 x 10(5) colony forming units (cfu) of Bacillus subtilis var. niger spores, 10(2) to 10(4) cfu of Bacillus anthrax spores and 10(2) to 10(6) cells of Escherichia coli O157:H7 in ECLIA. The unique MPFIA technique employs antibody-coated magnetic beads as solid phase in suspension for bacterial capture and concentration in a 96-well microplate format. Primary capturing antibodies, bacteria form a sandwich with alkaline phosphatase (AP)-labeled antibodies as reporter followed by a reaction with the AP substrate, AttoPhos to generate fluorescence for detection. Immunomagnetic separation permits direct isolating and concentrating bacterial cells from the crude samples, such as blood and environmental water. The results of MPFIA for detecting bacteria showed less sensitivity compared with that of ECLIA, however it provides a means for direct, high throughput screening bacteria from crude biological samples. Both ECLIA and MPFIA are rapid (less than one hour) and easy to use.

  3. Multiplexed Biosensors for Mycotoxins.

    PubMed

    Maragos, Chris M

    2016-07-01

    Significant progress has been made in the development of biosensors that can be used to detect low-MW toxins produced by fungi (mycotoxins). The number of formats that have been investigated is impressive and is an indication of the importance attached to finding easy-to-use, accurate, and rapid methods for detecting these toxins in commodities and foods. This review explores the details of multiplexed biosensors based on many formats, including multiplexed immunoassays, suspension arrays, membrane-based devices (flow-through and immunochromatographic), and planar microarrays. Each assay format has its own strengths and areas that need improvement. Certain formats, such as multiplexed immunochromatographic devices, are well developed and relatively easy to use, and in some cases, commercial products are being sold. Others, such as the suspension arrays and microarrays, are laboratory-based assays that, although more complicated, are also more amenable to a larger scale of multiplexing. The diversity of such efforts and the multitude of formats under investigation suggest that multiple solutions will be found to satisfy the need for multiplexed toxin detection. PMID:27455928

  4. Iron solid-phase differentiation along a redox gradient in basaltic soils

    NASA Astrophysics Data System (ADS)

    Thompson, Aaron; Rancourt, Denis G.; Chadwick, Oliver A.; Chorover, Jon

    2011-01-01

    Iron compounds in soil are multifunctional, providing physical structure, ion sorption sites, catalytic reaction-centers, and a sink for respiratory electrons. Basaltic soils contain large quantities of iron that reside in different mineral and organic phases depending on their age and redox status. We investigated changes in soil iron concentration and its solid-phase speciation across a single-aged (400 ky) lava flow subjected to a gradient in precipitation (2200-4200 mm yr -1) and hence redox history. With increasing rainfall and decreasing Eh, total Fe decreased from about 25% to <1% of the soil mass. Quantitative speciation of soil solid-phase iron was constrained by combining 57Fe Mössbauer spectroscopy (MBS) at 295 and 4.2 K with powder X-ray diffraction, selective chemical extractions, and magnetic susceptibility measurements. This approach allowed us to partition iron into (1) nanoparticulate and microcrystalline Fe III-(oxy)hydroxides, (2) microcrystalline and bulk Fe III-oxides, (3) organic/silicate bound Fe III, and (4) ferrous iron. The Fe III-(oxy)hydroxide fraction dominated solid-phase Fe, exhibiting a crystallinity continuum based on magnetic ordering temperature. The continuum extended from well-ordered microcrystalline goethite through nanocrystalline Fe III-(oxy)hydroxides to a nano Fe III-(oxy)hydroxide phase of extremely low crystallinity. Magnetic susceptibility was correlated ( R2 = 0.77) with Fe III-oxide concentration, consistent with a contribution of maghemite to the otherwise hematite dominated Fe-oxide fraction. The Fe III-(oxy)hydroxide fraction of total Fe decreased with increasing rainfall and was replaced by corresponding increase in the organic/silicate Fe III fraction. The crystallinity of the Fe III-(oxy)hydroxides also decreased with increasing rainfall and leaching, with the most disordered members of the crystallinity continuum, the nano Fe III-(oxy)hydroxides, gaining proportional abundance in the wetter sites. This finding

  5. Enumerating Pathogenic Microorganism Surrogates for Groundwater Experiments Using Solid-Phase Cytometry

    NASA Astrophysics Data System (ADS)

    Stevenson, M. E.; Blaschke, A. P.; Kirschner, A.

    2010-12-01

    Regulators need a dependable method that would enable them to calculate with confidence the setback distance of a drinking water well from a potential point of contamination. Since it is not permissible to perform field tests using pathogenic microorganisms, it is necessary to predict the transport of dangerous microbes in a different way, using surrogates. One such surrogate method involves using bacteriophages, which are viruses that are pathogenic to bacteria, but are not dangerous to humans. Another possible surrogate to model the potential travel time of microbial contamination is the use of synthetic microspheres; we will test microspheres ranging in size from 0.025 to 1 µm. The constraining factor for comparing the transport of microspheres and bacteriophages is the detection limit of the measuring apparatus. Appropriate measuring techniques are mandatory for a comparison. Traditionally, bacteriophages are measured using plaque forming analysis, the detection limit being one plaque forming unit per petri dish. In our study, the use of solid-phase cytometry for enumerating microspheres for wellhead protection projects is being investigated, as the detection limit using this technology is one cell per filter. To the best of our knowledge, there is no other technique available that enables a comparable detection limit. The solid-phase cytometer used for this study is a ChemScan RDI (Chemunex, France). For comparison, epifluorescence microscopy will also be used. The ChemScan RDI device automatically drives an epifluorescent microscope to the site of each cell detected, in order to confirm the validity of the reading. In this way, it is possible to observe whether clumping together of microspheres is a problem or if non-target cells were labelled. Keywords: Microspheres, Solid-phase cytometry, ChemScan, Drinking water protection Acknowledgements: We would like to thank the Austrian Science Fund (FWF) for financial support as part of the Doctoral Program on

  6. Solid phase electron donors control denitrification in groundwater at agricultural sites

    NASA Astrophysics Data System (ADS)

    Green, C. T.; Liao, L.; Bekins, B. A.; Bohlke, J. K.

    2011-12-01

    Increased concentrations of nitrate in groundwater caused by agricultural use of chemical and organic fertilizers are a concern because of possible risks to environmental and human health. At many sites, these problems are mitigated by natural attenuation of nitrate as a result of microbially mediated denitrification of nitrate to nitrogen gas. Recent studies have clarified the factors affecting the rates and extents of denitrification in groundwater in agricultural areas. Intensive studies were conducted by the US Geological Survey to study agricultural chemicals in California, Nebraska, Washington, and Maryland using laboratory analyses, field measurements, and flow and transport modeling for monitoring well transects (0.5 to 2.5 km in length) and vertical profiles (0 to 50 m in depth). Groundwater analyses included major ion chemistry, dissolved gases, nitrogen and oxygen stable isotopes, and atmospheric age-tracers. Sediments were analyzed for concentrations of potential electron donors for denitrification, including reduced iron and sulfur, and organic carbon. Geochemical data and mass balance calculations indicated that solid-phase electron donors were an important factor controlling denitrification at these sites. To examine the generality of this result, a mathematical model of vertical flux of water, oxygen, and nitrate was developed and applied at these study sites along with 2 new study sites in Iowa and Mississippi and 8 additional sites from previous studies in Nebraska, Texas, Minnesota, Wisconsin, North Carolina, Maryland (2 sites), and New York. Model results confirmed the importance of solid phase electron donors. The normalized reaction rates on an electron flux basis tended to increase with depth from the shallow oxygen reduction zone to the underlying nitrate reduction zone. The pattern of higher rates at depth is consistent with a reaction rate controlled by solid phase donors that are depleted under oxidizing conditions near the surface and in

  7. Inhibiting sorbent stripping by designing a sorbent-packed porous probe for headspace solid-phase microextraction.

    PubMed

    Qin, Shuai; Tao, Gu; Yunjie, Huang; Shuangshuang, Xu; Luyan, Li; Hongyan, Xiao

    2015-10-01

    To prevent the stripping of coating sorbents in headspace solid-phase microextraction, a porous extraction probe with packed sorbent was introduced by using a porous stainless steel needle tube and homemade sol-gel sorbents. The traditional stainless-steel needle tube was punched by a laser to obtain two rows of holes, which supply a passageway for analyte vapor during extraction and desorption. The sorbent was prepared by a traditional sol-gel method with both poly(ethylene glycol) and hydroxy-terminated silicone oil as coating ingredients. Eight polycyclic aromatic hydrocarbons and six benzene series compounds were used as illustrative semi-volatile and volatile organic compounds in sequence to verify the extraction performance of this porous headspace solid-phase microextraction probe. It was found that the analysis method combining a headspace solid-phase microextraction probe and gas chromatography with mass spectrometry yielded determination coefficients of no less than 0.985 and relative standard deviations of 4.3-12.4%. The porous headspace solid-phase microextraction probe showed no decrease of extraction ability after 200 uses. These results demonstrate that the packed extraction probe with porous structure can be used for headspace solid-phase microextraction. This novel design may overcome both the stripping and breakage problems of the conventional coating fiber.

  8. Variable-cell double-ended surface walking method for fast transition state location of solid phase transitions.

    PubMed

    Zhang, Xiao-Jie; Liu, Zhi-Pan

    2015-10-13

    To identify the low energy pathway for solid-to-solid phase transition has been a great challenge in physics and material science. This work develops a new theoretical method, namely, variable-cell double-ended surface walking (VC-DESW) to locate the transition state (TS) and deduce the pathway in solid phase transition. Inherited from the DESW method ( J. Chem. Theory Comput. 2013 , 9 , 5745 ) for molecular systems, the VC-DESW method implements an efficient mechanism to couple the lattice and atom degrees of freedom. The method features with fast pseudopathway building and accurate TS location for solid phase transition systems without requiring expensive Hessian computation and iterative pathway optimization. A generalized coordinate, consisting of the lattice vectors and the scaled atomic coordinates, is designed for describing the crystal potential energy surface (PES), which is able to capture the anisotropic behavior in phase transition. By comparing with the existing method for solid phase transition in different systems, we show that the VC-DESW method can be much more efficient for finding the TS in crystal phase transition. With the combination of the recently developed unbiased stochastic surface walking pathway sampling method, the VC-DESW is further utilized to resolve the lowest energy pathway of SiO2 α-quartz to quartz-II phase transition from many likely reaction pathways. These new methods provide a powerful platform for understanding and predicting the solid phase transition mechanism and kinetics.

  9. Identification of FAK substrate peptides via colorimetric screening of a one-bead one-peptide combinatorial library.

    PubMed

    Witucki, Laurie A; Borowicz, Lauren Sanford; Pedley, Anthony M; Curtis-Fisk, Jaime; Kuszpit, Elizabeth Girnys

    2015-04-01

    Focal adhesion kinase (FAK) is a protein tyrosine kinase that is associated with regulating cellular functions such as cell adhesion and migration and has emerged as an important target for cancer research. Short peptide substrates that are selectively and efficiently phosphorylated by FAK have not been previously identified and tested. Here we report the synthesis and screening of a one-bead one-peptide combinatorial library to identify novel substrates for FAK. Using a solid-phase colorimetric antibody tagging detection platform, the peptide beads phosphorylated by FAK were sequenced via Edman degradation and then validated through radioisotope kinetic studies with [γ-(32)P] ATP to derive Michaelis-Menton constants. The combination of results gathered from both colorimetric and radioisotope kinase assays led to the rational design of a second generation of FAK peptide substrates. Out of all the potential peptide substrates evaluated, the most active was GDYVEFKKK with a K(M)  = 92 μM and a Vmax  = 1920 nmol/min/mg. Peptide substrates discovered within this study may be useful diagnostic tools for future kinase investigations and may lead to novel therapeutic agents.

  10. [Determination of volatile organic compounds in blood by headspace solid-phase microextraction-gas chromatography].

    PubMed

    Hao, S; Kang, J; Zhou, S; Cui, J

    2000-01-30

    The headspace solid-phase microextraction (HS-SPME) is a novel extraction technique and has been developed rapidly. It is a fast, simple, solventless and sensitive method for sampling, separating, extracting, injecting and analyzing volatile organic compounds. This paper presents the research work in detecting volatile organic compounds(including ten compounds) in blood. The extraction fiber is made by fused-silica fiber with 100 microns polydimethylsiloxane (PDMS). The extraction time of the method was 10 min. The thermal desorption time was 1 min. It was found that the optimized location of the extraction fiber in the injector of GC was to put the whole needle in the injector. The precision of the method was determined to be less 5% relative standard deviation (RSD). The linear range of the detection was rather wide. The lowest detectin limits (LODs) were all < or = 5 ng/ml.

  11. Sequential molecularly imprinted solid-phase extraction methods for the analysis of resveratrol and other polyphenols.

    PubMed

    Schwarz, Lachlan J; Danylec, Basil; Harris, Simon J; Boysen, Reinhard I; Hearn, Milton T W

    2016-03-18

    Molecularly imprinted polymers (MIPs) templated with either the phytoalexin, (E)-resveratrol, or its structural analog, 3,5-dihydroxy-N-(4-hydroxyphenyl)benzamide, have been used in tandem for the sequential extraction of (E)-resveratrol from aqueous peanut meal extracts in high purity and in near quantitative yields. Re-processing of the (E)-resveratrol-depleted peanut meal extract with the 3,5-dihydroxy-N-(4-hydroxyphenyl)benzamide imprinted MIP yielded additional polyphenolic components, identified as A-type procyanidins. Tandem liquid chromatography-electrospray ionization mass spectrometry confirmed the identity and purity of the isolated products. This study documents the advantages of tandem approaches with MIPs for the solid phase extraction and analysis of multiple bioactive compounds present in complex biomass waste streams.

  12. A solid-phase dot assay using silica/gold nanoshells

    NASA Astrophysics Data System (ADS)

    Khlebtsov, Boris; Dykman, Lev; Bogatyrev, Vladimir; Zharov, Vladimir; Khlebtsov, Nikolai

    2007-01-01

    We report on the first application of silica-gold nanoshells to a solid-phase dot immunoassay. The assay principle is based on staining of a drop (1 µl) analyte on a nitrocellulose membrane strip by using silica/gold nanoshells conjugated with biospecific probing molecules. Experimental example is human IgG (hIgG, target molecules) and protein A (probing molecules). For usual 15-nm colloidal gold conjugates, the minimal detectable amount of hIgG is about 4 ng. By contrast, for nanoshell conjugates (silica core diameter of 70 nm and gold outer diameter of 100 nm) we have found significant increase in detection sensitivity and the minimal detectable amount of hIgG is about 0.5 ng. This finding is explained by the difference in the monolayer particle extinction.

  13. Molecularly imprinted calixarene fiber for solid-phase microextraction of four organophosphorous pesticides in fruits.

    PubMed

    Li, Jing-Wen; Wang, Yu-Long; Yan, Shan; Li, Xiu-Juan; Pan, Si-Yi

    2016-02-01

    Calixarene was used as a functional monomer to fabricate a molecularly imprinted polymer (MIP) by sol-gel technique for solid-phase microextraction (SPME) of parathion-methyl and its structural analogs. The MIP-coated fiber possessed excellent thermal and chemical stability as well as high extraction capacity. Its selectivity and possible recognition mechanism were investigated. The similarities in molecular shape and functional group play a key role in the selective recognition of the imprinted material. Any changes to the structure of the template would decrease the imprinting factor. A comparison of MIP-SPME was made with liquid-liquid extraction coupled with gas chromatography for the determination of organophosphorus pesticides (OPPs) in fruits. Much lower limits of detection and better recoveries were achieved by SPME in spiked apple and pineapple samples. The experiment demonstrates that the proposed method using the calixarene MIP fiber was more suitable for selective determination of trace OPPs in those fruit samples.

  14. Solid Phase Luminescence of Several Rare Earth Ions on Ion-Exchange Films

    NASA Technical Reports Server (NTRS)

    Tanner, Stephen P.; Street, Kenneth W., Jr.

    1999-01-01

    The development and characterization of a novel ion-exchange film for solid-phase fluorometry and phosphorimetry is reported. This new cation-exchange material is suitable for spectroscopic applications in the ultraviolet and visible regions. It is advantageous because it, as a single entity, is easily recovered from solution and mounted in the spectrofluorometers. After preconcentration on the film, the luminescence intensity of lanthanide ions is several orders of magnitude greater than that of the corresponding solution, depending on the volume of solution and the amount of film. This procedure allows emission spectral measurements and determination of lanthanide ions at solution concentrations of < 5 (micro)g/L. The film may be stored for subsequent reuse or as a permanent record of the analysis. The major drawback to the use of the film is slow uptake of analyte due to diffusion limitations.

  15. Solid-phase synthesis of phenylalanine containing peptides using a traceless triazene linker.

    PubMed

    Torres-García, Carolina; Pulido, Daniel; Carceller, Magdalena; Ramos, Iván; Royo, Miriam; Nicolás, Ernesto

    2012-11-01

    The use of a triazene function to anchor phenylalanine to a polymeric support through its side chain is reported. To prove the usefulness of this strategy in solid-phase peptide synthesis, several bioactive peptides have been prepared including cyclic, C-modified, and protected peptides. The triazene linkage is formed by coupling the diazonium salt of Fmoc-Phe(pNH(2))-OAllyl to a MBHA-polystyrene resin previously functionalized with isonipecotic acid (90%). Further assembly of the peptide chain, cleavage from the resin using 2-5% TFA in DCM, and reduction of the resulting diazonium salt of the peptide with FeSO(4)·7H(2)O in DMF afforded the desired products in high purities (73-94%).

  16. Problems of Solid-Phase Synthesis in Cylindrical Ampoules under Explosive Loading

    NASA Astrophysics Data System (ADS)

    Zelepugin, S. A.; Ivanova, O. V.; Yunoshev, A. S.; Zelepugin, A. S.

    2016-04-01

    The peculiarities of solid-phase synthesis are studied experimentally and numerically in the aluminum-fluoroplastic and aluminum-sulfur mixtures in cylindrical ampoules under explosive loading. The experimental results show that the use of a mixture capable of ultrafast exothermic reactions leads to the destruction of a cylindrical ampoule under explosive loading. When the transient shock wave is reflected from the bottom lid of the ampoule as a compression wave, there is a sharp increase in pressure in the lower part of the ampoule, which is accompanied by the increase in rate of the chemical reaction. The high rate of heat release during the chemical reaction in the lower part of the ampoule causes the formation of a gas phase, which leads to a further increase in pressure and destruction of the ampoule.

  17. Molecularly imprinted calixarene fiber for solid-phase microextraction of four organophosphorous pesticides in fruits.

    PubMed

    Li, Jing-Wen; Wang, Yu-Long; Yan, Shan; Li, Xiu-Juan; Pan, Si-Yi

    2016-02-01

    Calixarene was used as a functional monomer to fabricate a molecularly imprinted polymer (MIP) by sol-gel technique for solid-phase microextraction (SPME) of parathion-methyl and its structural analogs. The MIP-coated fiber possessed excellent thermal and chemical stability as well as high extraction capacity. Its selectivity and possible recognition mechanism were investigated. The similarities in molecular shape and functional group play a key role in the selective recognition of the imprinted material. Any changes to the structure of the template would decrease the imprinting factor. A comparison of MIP-SPME was made with liquid-liquid extraction coupled with gas chromatography for the determination of organophosphorus pesticides (OPPs) in fruits. Much lower limits of detection and better recoveries were achieved by SPME in spiked apple and pineapple samples. The experiment demonstrates that the proposed method using the calixarene MIP fiber was more suitable for selective determination of trace OPPs in those fruit samples. PMID:26304345

  18. Solid phase synthesis of somatostatin-28 II. A new biologically active octacosapeptide from anglerfish pancreatic islets.

    PubMed

    Nicolas, P; Delfour, A; Boussetta, H; Morel, A; Rholam, M; Cohen, P

    1986-10-30

    Somatostatin-28 II, an octacosapeptide recently isolated from anglerfish pancreatic islets, was synthetized by the solid phase method along with its somatostatin-14 II and somatostatin-28 II-(1-12) corresponding domains. Homogeneity of the synthetic peptides was demonstrated by analytical RP-HPLC, thin layer chromatography and electrophoresis. The peptides were further characterized by amino acids analysis, fast atomic bombarding mass spectrometry and/or 252Cf plasma desorption mass spectrometry. Synthetic somatostatin-28 II and somatostatin-14 II displace equally well the potent agonist (Tyr0,D-Trp8)-somatostatin-14 from its specific binding sites on anterior pituitary cells membranes. Both peptides activate adenylate cyclase from dispersed rat anterior pituitary cells. PMID:2877662

  19. Synthesis of chitosan molecularly imprinted polymers for solid-phase extraction of methandrostenolone.

    PubMed

    Wang, Yun; Wang, Enlan; Wu, Ziming; Li, Huan; Zhu, Zhi; Zhu, Xinsheng; Dong, Ying

    2014-01-30

    Chitosan molecularly imprinted polymers (CHI-MIPs) for selective extraction of methandrostenolone (MA) was synthesized by cross-linking of chitosan with epichlorohydrin in the presence of MA as the template molecule. Systematic investigations of the influences of template, functional polymer, cross-linker as well as porogen concentrations on the rebinding capacity of CHI-MIPs were carried out. Adsorption and kinetic binding experiments indicated that the synthesized CHI-MIPs had high adsorption and excellent affinity to MA. Solid-phase extraction (SPE) using the prepared CHI-MIPs as adsorbent was then investigated, and the optimum loading and eluting conditions for SPE of the MA were established. The optimized SPE procedure was used to extract the MA from several spiked samples and a good sample clean-up was obtained with the average recoveries ranged from 95.97 to 101.79%. PMID:24299807

  20. [Preparation of a novel polymer monolith using atom transfer radical polymerization method for solid phase extraction].

    PubMed

    Shen, Ying; Qi, Li; Qiao, Juan; Mao, Lanqun; Chen, Yi

    2013-04-01

    In this study, a novel polymer monolith based solid phase extraction (SPE) material has been prepared by two-step atom transfer radical polymerization (ATRP) method. Firstly, employing ethylene glycol dimethacrylate (EDMA) as a cross-linker, a polymer monolith filled in a filter head has been in-situ prepared quickly under mild conditions. Then, the activators generated by electron transfer ATRP (ARGET ATRP) was used for the modification of poly(2-(dimethylamino)ethyl-methacrylate) (PDMAEMA) on the monolithic surface. Finally, this synthesized monolith for SPE was successfully applied in the extraction and enrichment of steroids. The results revealed that ATRP can be developed as a facile and effective method with mild reaction conditions for monolith construction and has the potential for preparing monolith in diverse devices.

  1. Determination of bevantolol in human plasma by high performance liquid chromatography using solid phase extraction technique.

    PubMed

    Trung, Tran Quoc; Long, Pham Hai; Al-Abd, Ahmed M; Ku, Hyo Jeong; Lee, Ho Yoon; Hwang, Sung Joo; Kim, Kyeong Ho

    2007-07-01

    A method was developed and fully validated for the determination of bevantolol, an adrenergic-receptor blocker, in human plasma. Bevantolol and betaxolol as internal standard (I.S) were extracted from 1 mL of human plasma by solid phase extraction technique using Sep-pak silica cartridge. Chromatographic separation was accomplished under isocratic conditions using a reverse-phase C8 analytical column and mixture of dibasic ammonium phosphate (pH 5.7; 50 mM)-acetonitrile (75:25, v/v) as mobile phase, with a detection wavelength at 220 nm. The method was proved to be specific by testing six different human plasma sources. Linearity was established for the concentration ranges of 40-1600 ng/mL with correlation coefficent of 0.9995. The lower limit of quantification 40 ng/mL with precision of 10.9% as C.V%.

  2. Anomalous bond length behavior and a new solid phase of bromine under pressure.

    PubMed

    Wu, Min; Tse, John S; Pan, Yuanming

    2016-01-01

    The behavior of diatomic molecular solids under pressure have attracted great interest and been extensively studied. Under ambient pressure, the structure of bromine is known to be a molecular phase (phase I). With increasing pressure, it transforms into an incommensurate phase (phase V) before eventually to a monoatomic phase (phase II). However, between phases I and V, the interatomic distance was found to first increase with pressure and then decreased abruptly. This anomalous bond length behavior is accompanied by the splitting of the Raman bands. These phenomena have not been resolved. Here we suggest a new solid phase that explains the Raman spectra. Furthermore, the anomalous bond length behavior is found to be the result of subtle second neighbor intermolecular interactions and is an intrinsic property of bromine in molecular phases. PMID:27156710

  3. High-throughput biopolymer desalting by solid-phase extraction prior to mass spectrometric analysis.

    PubMed

    Gilar, M; Belenky, A; Wang, B H

    2001-06-29

    In the last 10 years mass spectrometry (MS) has become an important method for analysis of peptides, proteins and DNA. It was recently utilized for accurate high-throughput protein identification, sequencing and DNA genotyping. The presence of non-volatile buffers compromises sensitivity and accuracy of MS biopolymer analysis; it is essential to remove sample contaminants prior to analysis. We have developed a fast and efficient method for desalting of DNA oligonucleotides and peptides using 96-well solid-phase extraction plates packed with 5 mg of Waters Oasis HLB sorbent (Waters, Milford, MA, USA). This reversed-phase sorbent retains the biopolymer analytes, while non-retained inorganic ions are washed out with pure deionized water. DNA oligonucleotides or peptides are eluted using a small amount (20-100 microl) of acetonitrile-water (70:30, v/v) solution. The SPE desalting performance meets the requirements for MS applications such as protein digest analysis and DNA genotyping. PMID:11461010

  4. [Comparison of FTIR microspectroscopy and diffuse reflectance spectroscopy for monitor of solid phase reaction].

    PubMed

    Wu, Q; Yang, S; Luo, J; Huang, W

    2000-10-01

    17 FTIR micro transmission spectra of single resin beads of each sample, from polystyrene sulfonyl chloride resin changing to polystyrene sulfonyl amide resin in solid-phase reaction in water at 0 degree C, 20 degrees C, 40 degrees C, 60 degrees C, were recorded. The reaction was monitored by the means of FTIR microspectroscopy and diffuse reflectance spectroscopy upon the products. It was showed that the pressed single bead as a piece of biscuit was able to give higher quality spectrum. In comparison, 8 diffuse reflectance spectra of each sample were also collected. It seems that the diffuse reflectance spectroscopy is a more easy dealing with and effective method to control the whole reaction. However, the microspectroscopy is the first choice to check the difference between resin beads.

  5. Influence of sediment composition on apparent toxicity in a solid-phase test using bioluminescent bacteria

    SciTech Connect

    Benton, M.J.; Malott, M.L. |; Knight, S.S.; Cooper, C.M.; Benson, W.H.

    1995-03-01

    Clean and spiked sediment formulations of various silt:sand and clay:sand ratios were tested for toxicity using a bioassay that utilizes bioluminescent bacteria. Measured toxicities of clean and copper sulfate-spiked sediments were negatively but nonlinearly related with percent silt and percent clay, but no significant relationship existed between measured toxicity and sediment composition for methyl parathion-spiked formulations. Results suggest that solid-phase sediment bioassays using bioluminescence bacteria may be useful for testing the toxicities of single contaminants in formulated artificial sediments of known particle-size composition, and for repeated samples collected from the same site. However, extreme caution must be taken when testing sediments of varying composition or which may be differentially contaminated or contain a suite of contaminants.

  6. Solid phase microextraction applied to the analysis of organophosphorus insecticides in fruits.

    PubMed

    Fytianos, K; Raikos, N; Theodoridis, G; Velinova, Z; Tsoukali, H

    2006-12-01

    Trace amounts of organophosphorus pesticides (OPs) were determined in various fruits by headspace solid phase microextraction (HS-SPME) and gas chromatography-nitrogen phosphorous detection (GC-NPD). Sampling from the headspace enhanced method selectivity, whereas at the same time improved fiber life time and method sensitivity. Diazinon, parathion, methyl parathion, malathion and fenithrothion were determined in various fruits: more than 150 samples of 21 types of fruits were studied. SPME-GC-NPD provided a useful and very efficient analytical tool: method linearity ranged from 1.2 to 700 ng/ml. Limits of detection (LODs) and quantitation (LOQs) ranged from 0.03 to 3 ng/ml and 0.12 to 10 ng/ml respectively, values well below the residue limits set by the EU. Less than 2% of the samples were found positive containing amounts higher than the EU limits. The effect of fruit peeling and washing was also investigated.

  7. Single crystalline SiGe layers on Si by solid phase epitaxy

    NASA Astrophysics Data System (ADS)

    Lieten, R. R.; McCallum, J. C.; Johnson, B. C.

    2015-04-01

    We demonstrate a straightforward way to obtain single crystalline SiGe layers on silicon substrates. Amorphous SiGe layers, deposited by plasma enhanced chemical vapour deposition on Si, are transformed into single crystalline and smooth layers by solid phase epitaxy during annealing in a N2 atmosphere. The SiGe layers relax during the crystallization anneal and become slightly tensile strained during cooldown due to the thermal mismatch. The SiGe layers show excellent structural quality for compositions ranging from Ge- to Si-rich. The Ge content can be accurately estimated from the SiH4 to GeH4 flow ratio. Furthermore, the crystallization temperature decreases linearly with increasing Ge content from 725 °C for a-Si to 475 °C for a-Ge.

  8. High-Quality Single Crystalline Ge(111) Growth on Si(111) Substrates by Solid Phase Epitaxy

    NASA Astrophysics Data System (ADS)

    Sun, Bing; Chang, Hu-Dong; Lu, Li; Liu, Hong-Gang; Wu, De-Xin

    2012-03-01

    Heterogeneous integration of crystalline Ge layers on cleaned and H-terminated Si(111) substrates are demonstrated by employing a combination of e-beam evaporation and solid phase epitaxy techniques. High-quality single crystalline Ge(111) layers on Si(111) substrates with a smooth Ge surface and an abrupt interface between Ge and Si are obtained. An XRD rocking curve scan of the Ge(111) diffraction peak shows a FWHM of only 260 arcsec for a 50-nm-thick Ge layer annealed at 600°C with a ramp-up rate of 20°C/s and a holding time of 1 min. The AFM images exhibit that the rms surface roughness of all the crystalline Ge layers are less than 2.1 nm.

  9. Solid-Phase Synthesis, Characterization, and Cellular Activities of Collagen-Model Nanodiamond-Peptide Conjugates

    PubMed Central

    Knapinska, Anna M.; Tokmina-Roszyk, Dorota; Amar, Sabrina; Tokmina-Roszyk, Michal; Mochalin, Vadym N.; Gogotsi, Yury; Cosme, Patrick; Terentis, Andrew C.; Fields, Gregg B.

    2015-01-01

    Nanodiamonds (NDs) have received considerable attention as potential drug delivery vehicles. NDs are small (~5 nm diameter), can be surface modified in a controllable fashion with a variety of functional groups, and have little observed toxicity in vitro and in vivo. However, most biomedical applications of NDs utilize surface adsorption of biomolecules, as opposed to covalent attachment. Covalent modification provides reliable and reproducible ND–biomolecule ratios, and alleviates concerns over biomolecule desorption prior to delivery. The present study has outlined methods for the efficient solid-phase conjugation of ND to peptides and characterization of ND–peptide conjugates. Utilizing collagen-derived peptides, the ND was found to support or even enhance the cell adhesion and viability activities of the conjugated sequence. Thus, NDs can be incorporated into peptides and proteins in a selective manner, where the presence of the ND could potentially enhance the in vivo activities of the biomolecule it is attached to. PMID:25753561

  10. Solid Phase Characterization of Tank 241-C-108 Residual Waste Solids Samples

    SciTech Connect

    Cooke, Gary A.; Pestovich, John A.; Huber, Heinz J.

    2013-05-29

    This report presents the results for solid phase characterization (SPC) of solid samples removed from tank 241-C-108 (C-108) on August 12-13,2012, using the off-riser sampler. Samples were received at the 222-S Laboratory on August 13 and were described and photographed. The SPC analyses that were performed include scanning electron microscopy (SEM) using the ASPEX(R)l scanning electron microscope, X-ray diffraction (XRD) using the Rigaku(R) 2 MiniFlex X-ray diffractometer, and polarized light microscopy (PLM) using the Nikon(R) 3 Eclipse Pol optical microscope. The SEM is equipped with an energy dispersive X-ray spectrometer (EDS) to provide chemical information. Gary A. Cooke conducted the SEM analysis, John A. Pestovich performed the XRD analysis, and Dr. Heinz J. Huber performed the PLM examination. The results of these analyses are presented here.

  11. Reproducible vapor-time profiles using solid-phase microextraction with an externally sampled internal standard.

    PubMed

    MacCrehan, William; Moore, Stephanie; Schantz, Michele

    2012-06-29

    Determination of the dynamic nature of vapor/odor release has application in a wide variety of systems. This study applies automated solid-phase microextraction (SPME) utilizing an externally sampled internal standard (ESIS) to determine the vapor-time profile of odor delivery devices for three classes of explosive compounds. The profiles of delivery systems for target odorants 2,4-dinitrotoluene (2,4-DNT), 2-ethyl-1-hexanol (2-EH), and triacetone triperoxide (TATP) as canine training aids were compared over a period of 70 h. Strategies for evaluating the vapor-time profile of components with widely differing volatility are considered. An approach to quantifying the vapor concentration is described. The differences in the vapor-time profiles are examined and suggestions for selecting the best representative odor delivery technique are outlined. PMID:22633864

  12. Solid-phase peptide synthesis: from standard procedures to the synthesis of difficult sequences.

    PubMed

    Coin, Irene; Beyermann, Michael; Bienert, Michael

    2007-01-01

    This protocol for solid-phase peptide synthesis (SPPS) is based on the widely used Fmoc/tBu strategy, activation of the carboxyl groups by aminium-derived coupling reagents and use of PEG-modified polystyrene resins. A standard protocol is described, which was successfully applied in our lab for the synthesis of the corticotropin-releasing factor (CRF), >400 CRF analogs and a countless number of other peptides. The 41-mer peptide CRF is obtained within approximately 80 working hours. To achieve the so-called difficult sequences, special techniques have to be applied in order to reduce aggregation of the growing peptide chain, which is the main cause of failure for peptide chemosynthesis. Exemplary application of depsipeptide and pseudoproline units is shown for synthesizing an extremely difficult sequence, the Asn(15) analog of the WW domain FBP28, which is impossible to obtain using the standard protocol.

  13. Matrix solid-phase dispersion (MSPD) in chromatographic analysis of essential oils in herbs.

    PubMed

    Dawidowicz, Andrzej L; Rado, Ewelina

    2010-05-01

    Matrix solid-phase dispersion (MSPD) is a simple and cheap sample preparation procedure allowing for the reduction of organic solvent consumption, exclusion of sample component degradation, improvement of extraction efficiency and selectivity, elimination of additional sample clean-up and pre-concentration step before chromatographic analysis. The paper shows the possibility of MSPD application for qualitative and quantitative analysis of essential oil components in the following herbs: thyme (Thymus vulgaris L.), mint (Mentha piperita), sage (Salvia officinalis L.), chamomile (Chamomilla recutita L.), marjoram (Origanum majorana L.), savory (Satureja hortensis L.), and oregano (Origanum vulgare). The results obtained using MSPD are compared to two other sample preparation methods: steam distillation (SD) and pressurized liquid extraction (PLE). The results presented in the paper prove that the total amount and the composition of the essential oil component obtained by MSPD are equivalent to those gained by one of the most effective extraction technique, PLE. PMID:20071125

  14. HLA antibody detection with solid phase assays: great expectations or expectations too great?

    PubMed

    Gebel, H M; Bray, R A

    2014-09-01

    Alloantibodies directed against HLA antigens, are a barrier to long-term solid organ allograft survival. The clinical impact of preformed, donor-directed HLA alloantibodies range from acceptable risk to unequivocal contraindication for organ transplantation. HLA antibodies are key factors that limit patient access to donor organs. Serological methods were once the only approach to identify HLA antigens and antibodies. Limitations in these technologies led to the development of solid phase approaches. In the early 1990s, the development of the polymerase chain reaction enabled DNA-based HLA antigen testing to be performed. By the mid-1990s, microparticle-based technology that utilized flow cytometry for analysis was developed to detect both classes I and II HLA antibodies. These methodologies revolutionized clinical histocompatibility testing. The strengths and weaknesses of these assays are described in detail in this review.

  15. Anomalous bond length behavior and a new solid phase of bromine under pressure

    PubMed Central

    Wu, Min; Tse, John S.; Pan, Yuanming

    2016-01-01

    The behavior of diatomic molecular solids under pressure have attracted great interest and been extensively studied. Under ambient pressure, the structure of bromine is known to be a molecular phase (phase I). With increasing pressure, it transforms into an incommensurate phase (phase V) before eventually to a monoatomic phase (phase II). However, between phases I and V, the interatomic distance was found to first increase with pressure and then decreased abruptly. This anomalous bond length behavior is accompanied by the splitting of the Raman bands. These phenomena have not been resolved. Here we suggest a new solid phase that explains the Raman spectra. Furthermore, the anomalous bond length behavior is found to be the result of subtle second neighbor intermolecular interactions and is an intrinsic property of bromine in molecular phases. PMID:27156710

  16. Atomic transport during solid-phase epitaxial recrystallization of amorphous germanium

    SciTech Connect

    Radek, M.; Bracht, H.; Johnson, B. C.; McCallum, J. C.; Posselt, M.; Liedke, B.

    2015-08-24

    The atomic mixing of matrix atoms during solid-phase epitaxy (SPE) is studied by means of isotopically enriched germanium (Ge) multilayer structures that were amorphized by Ge ion implantation up to a depth of 1.5 μm. Recrystallization of the amorphous structure is performed at temperatures between 350 °C and 450 °C. Secondary-ion-mass-spectrometry is used to determine the concentration-depth profiles of the Ge isotope before and after SPE. An upper limit of 0.5 nm is deduced for the displacement length of the Ge matrix atoms by the SPE process. This small displacement length is consistent with theoretical models and atomistic simulations of SPE, indicating that the SPE mechanism consists of bond-switching with nearest-neighbours across the amorphous-crystalline (a/c) interface.

  17. Chemical characterization and screening of hydrocarbon pollution in industrial soils by headspace solid-phase microextraction.

    PubMed

    Havenga, W J; Rohwer, E R

    1999-07-01

    A headspace solid-phase microextraction method, followed by a gas chromatographic-mass spectrometric analysis, has been developed for the screening of soil samples polluted by coal tar or refined petroleum products. Vapor pressures of target analytes were determined using a capillary GC method to identify environmentally important components with a sufficiently high vapor pressure to be analyzed in the headspace mode. The method was optimized under non-equilibrium conditions with simplicity and automation in mind and does not require any extraction procedure or sample preparation, other than grinding, drying and homogenizing. The analytical performance and the significance of the results for the purpose of chemical characterization, source discrimination, determination of individual isomer distributions and to calculate source or weathering ratios, is discussed.

  18. Anomalous bond length behavior and a new solid phase of bromine under pressure.

    PubMed

    Wu, Min; Tse, John S; Pan, Yuanming

    2016-05-09

    The behavior of diatomic molecular solids under pressure have attracted great interest and been extensively studied. Under ambient pressure, the structure of bromine is known to be a molecular phase (phase I). With increasing pressure, it transforms into an incommensurate phase (phase V) before eventually to a monoatomic phase (phase II). However, between phases I and V, the interatomic distance was found to first increase with pressure and then decreased abruptly. This anomalous bond length behavior is accompanied by the splitting of the Raman bands. These phenomena have not been resolved. Here we suggest a new solid phase that explains the Raman spectra. Furthermore, the anomalous bond length behavior is found to be the result of subtle second neighbor intermolecular interactions and is an intrinsic property of bromine in molecular phases.

  19. Linker phosphoramidite reagents for the attachment of the first nucleoside to underivatized solid-phase supports

    PubMed Central

    Pon, Richard T.; Yu, Shuyuan

    2004-01-01

    New linker phosphoramidite reagents containing a cleavable 3′-ester linkage are used for attaching the first nucleoside to the surface of a solid- phase support. Inexpensive, underivatized amino supports, such as long chain alkylamine controlled-pore glass, can serve as universal supports. No modifications to phosphoramidite coupling conditions are required and, after synthesis, treatment with NH4OH releases the products with 3′-OH ends. No 3′-dephosphorylation is required. Phosphoramidite reagents containing a succinate and sulfonyl diethanol linkage between the nucleoside and phosphoramidite group are particularly advantageous and can be used to create both 3′-OH and 5′-phosphate ends on oligonucleotides. Reproducibility and quality of oligonucleotide synthesis is demonstrated for either column and 96-well plate formats on low-, medium- or high-loading CPG supports. PMID:14752050

  20. Determination of metrafenone in vegetables by matrix solid-phase dispersion and HPLC-UV method.

    PubMed

    Li, Jianjun; Li, Yangyang; Xu, Dongliang; Zhang, Jingyu; Wang, Yuxi; Luo, Chao

    2017-01-01

    A simple method for determination of metrafenone in vegetables by matrix solid-phase dispersion (MSPD) and HPLC was developed. All vegetable samples were extracted with dichloromethane, and then the extracts were directly separated on a reversed-phase column with isocratic elution without a cleanup step. The linearity of metrafenone was good with the concentration between 0.005 and 5mg/kg, and the limit of detection (LOD) of the metrafenone was 0.002mg/kg. The recoveries ranged from 86.5% to 104.8% with the relative standard deviations (RSDs) in the range of 2.1-7.9% (n=6). The results indicated that the method was simple, rapid, highly sensitive and suitable for the determination of metrafenone in vegetables. PMID:27507450

  1. A carbon nanotube confinement strategy to implement homogeneous asymmetric catalysis in the solid phase.

    PubMed

    Hashimoto, Kazuki; Kumagai, Naoya; Shibasaki, Masakatsu

    2015-03-01

    A readily recyclable asymmetric catalyst has been developed based on the self-assembly of a homogeneous catalyst in a fibrous network of multiwalled carbon nanotubes (MWNTs). Dimerization of an amide-based chiral ligand with a suitable spacer allows for the efficient formation of a heterogeneous catalyst by self-assembly on addition of Er(OiPr)3. The self-assembly proceeds in the MWNT fibrous network and small clusters of assembled catalyst are confined in the MWNTs, producing an easily handled solid-phase catalyst. The resulting MWNT-confined catalyst exhibits a good catalytic performance in a catalytic asymmetric Mannich-type reaction, which can be conducted in a repeated batch system and in a continuous-flow platform.

  2. Soxhlet-assisted matrix solid phase dispersion to extract flavonoids from rape (Brassica campestris) bee pollen.

    PubMed

    Ma, Shuangqin; Tu, Xijuan; Dong, Jiangtao; Long, Peng; Yang, Wenchao; Miao, Xiaoqing; Chen, Wenbin; Wu, Zhenhong

    2015-11-15

    Soxhlet-assisted matrix solid phase dispersion (SA-MSPD) method was developed to extract flavonoids from rape (Brassica campestris) bee pollen. Extraction parameters including the extraction solvent, the extraction time, and the solid support conditions were investigated and optimized. The best extraction yields were obtained using ethanol as the extraction solvent, silica gel as the solid support with 1:2 samples to solid support ratio, and the extraction time of one hour. Comparing with the conventional solvent extraction and Soxhlet method, our results show that SA-MSPD method is a more effective technique with clean-up ability. In the test of six different samples of rape bee pollen, the extracted content of flavonoids was close to 10mg/g. The present work provided a simple and effective method for extracting flavonoids from rape bee pollen, and it could be applied in the studies of other kinds of bee pollen.

  3. Tensile strained GeSn on Si by solid phase epitaxy

    NASA Astrophysics Data System (ADS)

    Lieten, R. R.; Seo, J. W.; Decoster, S.; Vantomme, A.; Peters, S.; Bustillo, K. C.; Haller, E. E.; Menghini, M.; Locquet, J.-P.

    2013-02-01

    We demonstrate single crystalline GeSn with tensile strain on silicon substrates. Amorphous GeSn layers are obtained by limiting the adatom surface mobility during deposition. Subsequent annealing transforms the amorphous layer into single crystalline GeSn by solid phase epitaxy. Excellent structural quality is demonstrated for layers with up to 6.1% of Sn. The GeSn layers show tensile strain (up to +0.34%), which lowers the difference between direct and indirect band transition and makes this method promising for obtaining direct band gap group IV layers. GeSn with 4.5% Sn shows increased optical absorption compared to Ge and an optical band gap of 0.52 eV.

  4. Determination of chloroacetic acids in drinking water using suppressed ion chromatography with solid-phase extraction.

    PubMed

    Yoshikawa, Kenji; Soda, Yuko; Sakuragawa, Akio

    2009-12-01

    Suppressed ion chromatography with a conductivity detector was developed for the determination of trace amounts of underivatized chloroacetic acids (CAAs). When sodium carbonate and methanol were used as a mobile phase, the simultaneous determination of each CAA took approximately 25 min. The linearity, reproducibility and detection limits were determined for the proposed method. For the solid-phase extraction step, the effects of the pH of the sample solution, sample volume and the eluting agent were tested. Under the optimized extracting conditions, the average recoveries for CAAs spiked in tap water were 83-107%, with an optimal preconcentration factor of 20. The reproducibility of recovery rate for CAAs was 1.2-3.8%, based upon 6 repetitions of the recovery experiments.

  5. Explosive ordnance detection in land and water environments with solid phase extraction/ion mobility spectrometry

    NASA Astrophysics Data System (ADS)

    Chambers, William B.; Phelan, James M.; Rodacy, Philip J.; Reber, Steven; Woodfin, Ronald L.

    1999-08-01

    The qualitative and quantitative determination of nitroaromatic compounds such as trinitrotoluene (TNT) and dinitrotoluene (DNT) in water and soil has applications to environmental remediation and the detection of buried military ordnance. Recent results of laboratory and field test have shown that trace level concentrations of these compounds can be detected in water, soil, and solid gas samples taken from the vicinity of submerged or buried ordnance using specialized sampling and signal enhancement techniques. Solid phase micro-extraction methods have been combined with Ion Mobility Spectroscopy to provide rapid, sub-parts-per-billion analysis of these compounds. In this paper, we will describe the gas. These sampling systems, when combined with field-portable IMS, are being developed as a means of classifying buried or submerged objects as explosive ordnance.

  6. A Facile Solid-Phase Route to Renewable Aromatic Chemicals from Biobased Furanics.

    PubMed

    Thiyagarajan, Shanmugam; Genuino, Homer C; van der Waal, Jan C; de Jong, Ed; Weckhuysen, Bert M; van Haveren, Jacco; Bruijnincx, Pieter C A; van Es, Daan S

    2016-01-22

    Renewable aromatics can be conveniently synthesized from furanics by introducing an intermediate hydrogenation step in the Diels-Alder (DA) aromatization route, to effectively block retro-DA activity. Aromatization of the hydrogenated DA adducts requires tandem catalysis, using a metal-based dehydrogenation catalyst and solid acid dehydration catalyst in toluene. Herein it is demonstrated that the hydrogenated DA adducts can instead be conveniently converted into renewable aromatics with up to 80% selectivity in a solid-phase reaction with shorter reaction times using only an acidic zeolite, that is, without solvent or dehydrogenation catalyst. Hydrogenated adducts from diene/dienophile combinations of (methylated) furans with maleic anhydride are efficiently converted into renewable aromatics with this new route. The zeolite H-Y was found to perform the best and can be easily reused after calcination. PMID:26684008

  7. Ballpoint pen inks: the quantitative analysis of ink solvents on paper by solid-phase microextraction.

    PubMed

    Brazeau, Luc; Gaudreau, Marc

    2007-01-01

    We wish to describe further developments to a method previously reported on the detection of 2-phenoxyethanol in ink. The solid-phase microextraction (SPME) sampling technique, together with gas chromatography-mass spectrometry (GC-MS), has been used to quantify solvents in writing ink. In conventional approaches, the analysis of ink on documents requires some degree of destructive sampling. The methods commonly used remove ink samples from paper using a scalpel or a paper punch. To avoid document destruction, a sampling cell was constructed that allows solvents to be adsorbed directly onto the SPME fiber from the headspace above the document surface. Analytes (ink volatiles) are then desorbed from the SPME fiber on a gas chromatograph equipped with a mass selective detector (GC-MSD). With this method, it was possible to detect the presence of ink solvents on documents for a period lasting up to c. 2 years.

  8. Chemically and geographically distinct solid-phase iron pools in the Southern Ocean.

    PubMed

    von der Heyden, B P; Roychoudhury, A N; Mtshali, T N; Tyliszczak, T; Myneni, S C B

    2012-11-30

    Iron is a limiting nutrient in many parts of the oceans, including the unproductive regions of the Southern Ocean. Although the dominant fraction of the marine iron pool occurs in the form of solid-phase particles, its chemical speciation and mineralogy are challenging to characterize on a regional scale. We describe a diverse array of iron particles, ranging from 20 to 700 nanometers in diameter, in the waters of the Southern Ocean euphotic zone. Distinct variations in the oxidation state and composition of these iron particles exist between the coasts of South Africa and Antarctica, with different iron pools occurring in different frontal zones. These speciation variations can result in solubility differences that may affect the production of bioavailable dissolved iron.

  9. Simplified solid-phase immunobead assay for detection of ciguatoxin and related polyethers.

    PubMed

    Hokama, Y

    1990-01-01

    This study examined the development of a highly simplified solid-phase colored latex immunobead assay for the detection of ciguatoxin and related polyethers. This procedure was compared with the stick enzyme immunoassay previously reported. Chi-square analysis of two separate experiments on 153 and 283 fish of various species gave chi 2 values of p less than 0.001 and p less than 0.005, respectively. Agreement between the two procedures with 26 fish implicated in ciguatera poisoning was 100%. A preliminary assessment in the field showed encouraging results. The procedure appears to be simple and applicable to field use. Furthermore, this procedure should be applicable to other antibody-antigen detections, especially low dalton determinations.

  10. A simple and safe method for single HLA-antigen-typing by a solid phase assay.

    PubMed

    Häcker-Shahin, B; Giannitsis, D J

    1991-01-01

    A rapid solid phase assay for detection of single HLA-antigens on platelets was developed. The platelets were attached to the surface of polystyrene microtitre plate wells by means of a sodium carbonate buffer and centrifugation. Uncovered areas were blocked by a gelatin blocking buffer. After incubation with commercially available anti-HLA-sera the bound anti-HLA-specific antibodies directed against HLA-antigens present on the platelets were made visible by anti-IgG-coated indicator red cells and a brief centrifugation. A positive result, meaning the presence of an HLA-antigen, was indicated by a slight red cell adherence over the reaction surface. In the absence of the HLA-antigen no binding occurred and the indicator red cells formed a small red disc-like pellet.

  11. "Reagentless" flow injection determination of ammonia and urea using membrane separation and solid phase basification

    NASA Technical Reports Server (NTRS)

    Akse, J. R.; Thompson, J. O.; Sauer, R. L.; Atwater, J. E.

    1998-01-01

    Flow injection analysis instrumentation and methodology for the determination of ammonia and ammonium ions in an aqueous solution are described. Using in-line solid phase basification beds containing crystalline media. the speciation of ammoniacal nitrogen is shifted toward the un-ionized form. which diffuses in the gas phase across a hydrophobic microporous hollow fiber membrane into a pure-water-containing analytical stream. The two streams flow in a countercurrent configuration on opposite sides of the membrane. The neutral pH of the analytical stream promotes the formation of ammonium cations, which are detected using specific conductance. The methodology provides a lower limit of detection of 10 microgram/L and a dynamic concentration range spanning three orders of magnitude using a 315-microliters sample injection volume. Using immobilized urease to enzymatically promote the hydrolysis of urea to produce ammonia and carbon dioxide, the technique has been extended to the determination of urea.

  12. Improvements in the vapor-time profile analysis of explosive odorants using solid-phase microextraction.

    PubMed

    Young, Mimy; Schantz, Michele; MacCrehan, William

    2016-07-15

    A modified approach for characterization of the vapor-time profile of the headspace odors of explosives was developed using solid-phase microextraction (SPME) incorporating introduction of an externally-sampled internal standard (ESIS) followed by gas chromatography/mass spectrometry (GC/MS) analysis. With this new method, reproducibility of the measurements of 2-ethyl-1-hexanol and cyclohexanone were improved compared to previous work (Hoffman et al., 2009; Arthur and Pawliszyn, 1990) through the use of stable-isotope-labeled internal standards. Exposing the SPME fiber to the ESIS after sampling the target analyte proved to be advantageous, while still correcting for fiber variability and detector drift. For the analysis of high volatility compounds, incorporation of the ESIS using the SPME fiber in the retracted position minimized the subsequent competitive loss of the target analyte, allowing for much longer sampling times.

  13. Analysis of volatiles of malt whisky by solid-phase microextraction and stir bar sorptive extraction.

    PubMed

    Demyttenaere, Jan C R; Martínez, Jorge I Sánchez; Verhé, Roland; Sandra, Pat; De Kimpe, Norbert

    2003-01-24

    Blended Scotch whisky was analysed by solid-phase microextraction (SPME) and stir bar sorptive extraction (SBSE) to study the composition of the volatiles. For SPME analysis, three different fibres were compared, poly(dimethylsiloxane) (PDMS) (100 microm). poly(acrylate) (PA) (85 microm) and divinylbenzene-Carboxen on poly(dimethylsiloxane) (DVB-CAR-(PDMS) (50/30 microm). It was found that the PDMS and DVB-CAR-PDMS fibres showed a higher enrichment capacity than PA as well as a better reproducibility. The influence of sampling time, temperature and salt addition on the enrichment of volatiles as well as the difference between liquid and headspace SPME were studied. An optimum SPME method was developed. Finally a more recent sample preparation technique, namely SBSE was evaluated to extract whisky volatiles.

  14. New monoclonal-antibody two-site solid-phase immunoradiometric assay for human thyrotropin evaluated

    SciTech Connect

    Pekary, A.E.; Hershman, J.M.

    1984-07-01

    The authors compared results with a commercial solid-phase two-site immunoradiometric assay kit for human thyrotropin in which monoclonal antibodies are used with those by our radioimmunoassay, which is optimized for measurement of low concentrations of thyrotropin. In the immunoradiometric assay a specific antibody to the beta subunit of human thyrotropin is immobilized on a polystyrene bead, and a radiolabeled monoclonal antibody directed against the alpha subunit provides a measure of bead-immobilized hormone. The mean thyrotropin concentrations in 70 euthyroid serum samples were similar in the two assays. Values for hypothyroid patients were clearly higher in both assays than values for euthyroid individuals. In commercial assays the major source of error in measurement of thyrotropin response to thyroliberin in terms of the increment over the basal concentration of thyrotropin has been systematic errors in the measurement of those basal concentrations. With the present assay, however, basal values are obtained with good precision and accuracy.

  15. Synthesis and application of cephalexin imprinted polymer for solid phase extraction in milk.

    PubMed

    Lata, Kiran; Sharma, Rajan; Naik, Laxmana; Rajput, Y S; Mann, Bimlesh

    2015-10-01

    Molecular imprinted polymer (MIP) against cephalexin was synthesized by co-polymerization of functional monomer, cross-linker, radical initiator, along with target molecule (cephalexin) in a porogenic material. Binding of cephalexin towards prepared MIP was studied in different solvents (water, methanol, 1M NaCl, acetone and acetonitrile) and best binding was observed in methanol. Partition coefficient and selectivity of prepared imprint and non-imprint was also studied. Cross reactivity in terms of binding efficiency was also assessed with other antibiotics. Chromatographic study of MIP was carried out by packing prepared imprint into glass column. MIP was used as matrix in solid phase extraction (SPE) for recovery of cephalexin from spiked milk samples for further estimation by high performance liquid chromatography. No interference was observed from milk components after elution of cephalexin from MIP, indicating selectivity and affinity of MIP. On the other hand, interference was observed in eluate obtained from C18 SPE column. PMID:25872441

  16. Method and apparatus for acoustic plate mode liquid-solid phase transition detection

    DOEpatents

    Blair, Dianna S.; Freye, Gregory C.; Hughes, Robert C.; Martin, Stephen J.; Ricco, Antonio J.

    1993-01-01

    A method and apparatus for sensing a liquid-solid phase transition event is provided which comprises an acoustic plate mode detecting element placed in contact with a liquid or solid material which generates a high-frequency acoustic wave that is attenuated to an extent based on the physical state of the material is contact with the detecting element. The attenuation caused by the material in contact with the acoustic plate mode detecting element is used to determine the physical state of the material being detected. The method and device are particularly suited for detecting conditions such as the icing and deicing of wings of an aircraft. In another aspect of the present invention, a method is provided wherein the adhesion of a solid material to the detecting element can be measured using the apparatus of the invention.

  17. A solid phase assay for topoisomerase I interfacial poisons and catalytic inhibitors.

    PubMed

    Cyril, Vidusha; Muller, Mark T

    2012-02-15

    We report a mechanism-based screening technique to rapidly identify eukaryotic topoisomerase I targeting agents. The method is based on genetic tagging of topoisomerase I to immobilize the enzyme on a solid surface in a microtiter well format. DNA is added to the wells, and retained DNA is detected by Pico Green fluorescence. Compounds that result in an increase in Pico Green staining represent potential topoisomerase interfacial poisons, whereas those that reduce fluorescence report catalytic inhibitors; therefore, the solid phase assay represents a "bimodal" readout that reveals mechanisms of action. The method has been demonstrated to work with known interfacial poisons and catalytic inhibitors. This method is rapid, robust, economical, and scalable for large library screens. PMID:22214881

  18. Epitaxial growth of germanium thin films on crystal silicon substrates by solid phase crystallization

    NASA Astrophysics Data System (ADS)

    Isomura, Masao; Kanai, Mikuri

    2015-04-01

    We have investigated the solid phase crystallization (SPC) of amorphous germanium (a-Ge) precursors on single crystalline silicon (c-Si) substrates as seed layers and successfully obtained the epitaxial growth of Ge. The n-type (100) Si substrate is most suitable for preferential growth following the substrate orientation, because the velocity of preferential growth is higher than those on the other substrates and preferential growth is completed before random nucleation. The impurity contamination in the a-Ge precursors probably enhances random nucleation. The epitaxial growth is disturbed by the impurity contamination at a relatively high SPC temperature in the intrinsic and p-type Si substrates with the (100) orientation and the n-type and intrinsic Si substrates with the (111) orientation, because the lower velocity of preferential growth allows random crystallization. Almost no epitaxial growth is observed on the p-type (111) Si substrates even when low-impurity a-Ge precursors are used.

  19. Temperature-responsive Solid-phase Extraction Column for Biological Sample Pretreatment.

    PubMed

    Akimaru, Michiko; Okubo, Kohei; Hiruta, Yuki; Kanazawa, Hideko

    2015-01-01

    We have developed a novel solid-phase extraction (SPE) system utilizing a temperature-responsive polymer hydrogel-modified stationary phase. Aminopropyl silica beads (average diameter, 40 - 64 μm) were coated with poly(N-isopropylacrylamide) (PNIPAAm)-based thermo-responsive hydrogels. Butyl methacrylate (BMA) and N,N-dimethylaminopropyl acrylamide (DMAPAAm) were used as the hydrophobic and cationic monomers, respectively, and copolymerized with NIPAAm. To evaluate the use of this SPE cartridge for the analysis of drugs and proteins in biological fluids, we studied the separation of phenytoin and theophylline from human serum albumin (HSA) as a model system. The retention of the analytes in an exclusively aqueous eluent could be modulated by changing the temperature and salt content. These results indicated that this temperature-responsive SPE system can be applied to the pretreatment of biological samples for the measurement of serum drug levels.

  20. Direct potentiometric quantification of histamine using solid-phase imprinted nanoparticles as recognition elements.

    PubMed

    Basozabal, Itsaso; Guerreiro, Antonio; Gomez-Caballero, Alberto; Aranzazu Goicolea, M; Barrio, Ramón J

    2014-08-15

    A new potentiometric sensor based on molecularly imprinted nanoparticles produced via the solid-phase imprinting method was developed. For histamine quantification, the nanoparticles were incorporated within a membrane, which was then used to fabricate an ion-selective electrode. The use of nanoparticles with high affinity and specificity allowed for label-free detection/quantification of histamine in real samples with short response times. The sensor could selectively quantify histamine in presence of other biogenic amines in real wine and fish matrices. The limit of detection achieved was 1.12×10(-6)molL(-1), with a linear range between 10(-6) and 10(-2)molL(-1) and a response time below 20s, making the sensor as developed a promising tool for direct quantification of histamine in the food industry.

  1. A multiplexed quantum memory.

    PubMed

    Lan, S-Y; Radnaev, A G; Collins, O A; Matsukevich, D N; Kennedy, T A; Kuzmich, A

    2009-08-01

    A quantum repeater is a system for long-distance quantum communication that employs quantum memory elements to mitigate optical fiber transmission losses. The multiplexed quantum memory (O. A. Collins, S. D. Jenkins, A. Kuzmich, and T. A. B. Kennedy, Phys. Rev. Lett. 98, 060502 (2007)) has been shown theoretically to reduce quantum memory time requirements. We present an initial implementation of a multiplexed quantum memory element in a cold rubidium gas. We show that it is possible to create atomic excitations in arbitrary memory element pairs and demonstrate the violation of Bell's inequality for light fields generated during the write and read processes.

  2. Nano-structured lead dioxide as a novel stationary phase for solid-phase microextraction.

    PubMed

    Mehdinia, Ali; Mousavi, Mir Fazllolah; Shamsipur, Mojtaba

    2006-11-17

    The first study on the high efficiency of nano-structured lead dioxide as a new fiber for solid-phase microextraction (SPME) purposes has been reported. The size of the PbO2 particles was in the range of 34-136 nm. Lead dioxide-based fibers were prepared via electrochemical deposition on a platinum wire. The extraction properties of the fiber to benzene, toluene, ethylbenzene, and xylenes (BTEX) were examined using headspace solid-phase microextraction (HS-SPME) mode coupled to gas chromatography-flame ionization detection (GC-FID). The results obtained proved the suitability of proposed fibers for the sampling of organic compounds from water. The extraction procedure was optimized by selecting the appropriate extraction parameters, including preparation conditions of coating, salt concentration, time and temperature of adsorption and desorption and stirring rate. The calibration graphs were linear in a concentration range of 0.1-100 microg l(-1) (R2 > 0.994) with detection limits below 0.012 microg l(-1) level. Single fiber repeatability and fiber-to-fiber reproducibility were less than 10.0 and 12.5%, respectively. The PbO2 coating was proved to be very stable at relatively high temperatures (up to 300 degrees C) with a high extraction capacity and long lifespan (more than 50 times). Higher chemical resistance and lower cost are among the advantages of PbO2 fibers over commercially available SPME fibers. Good recoveries (81-108%) were obtained when environmental samples were analyzed.

  3. A highly thermal stable solid phase microextraction fiber prepared by an inorganic binder.

    PubMed

    Liu, Hongmei; Ran, Fanpeng; Tao, Caihong; Zhao, Mengmeng; Jia, Yulong; Guo, Yong

    2016-04-28

    An easy method to prepare solid phase microextraction fibers by introducing an inorganic binder was demonstrated in this study, where MoS2 was selected as the extraction phase material because of its graphite-like layered structure with large specific adsorption area and good stability, and was then adhered to a stainless steel wire by acid aluminum phosphate binder with the spraying method. The as-prepared solid phase microextraction fiber coupled with gas chromatography was then used to extract some polycyclic aromatic hydrocarbons target analytes including the low-volatile benzo(a)pyrene etc. from a standard sample. Comparing with the MoS2-epoxy resin and commercial polyacrylate fibers, the MoS2-acid aluminum phosphate fiber has a higher thermal stability because of highly thermal stable acid aluminum phosphate, which is durable for a long service life at a high temperature (320 °C), and has the advantage in the extraction of low-volatility analytes. After the optimization of adsorption and desorption factors (ionic strength, adsorption time and temperature, and desorption temperature), method detection limits of <0.1 μg L(-1) were achieved, and the calibration curves were all linear (R(2) ≥ 0.9981) within the range of 0.1-100 μg L(-1). The satisfying repeatability was also achieved, the RSD values of single-fiber were 3.49-5.81%, and the ones of fiber-to-fiber were 5.32-7.22%. As a result, the present fiber with good thermal stability can work at high temperature for a long service life, which is useful for the detection of low-volatility target analytes in practical applications. PMID:27046208

  4. Magnetic solid-phase extraction using carbon nanotubes as sorbents: a review.

    PubMed

    Herrero-Latorre, C; Barciela-García, J; García-Martín, S; Peña-Crecente, R M; Otárola-Jiménez, J

    2015-09-10

    Magnetic solid-phase extraction (M-SPE) is a procedure based on the use of magnetic sorbents for the separation and preconcentration of different organic and inorganic analytes from large sample volumes. The magnetic sorbent is added to the sample solution and the target analyte is adsorbed onto the surface of the magnetic sorbent particles (M-SPs). Analyte-M-SPs are separated from the sample solution by applying an external magnetic field and, after elution with the appropriate solvent, the recovered analyte is analyzed. This approach has several advantages over traditional solid phase extraction as it avoids time-consuming and tedious on-column SPE procedures and it provides a rapid and simple analyte separation that avoids the need for centrifugation or filtration steps. As a consequence, in the past few years a great deal of research has been focused on M-SPE, including the development of new sorbents and novel automation strategies. In recent years, the use of magnetic carbon nanotubes (M-CNTs) as a sorption substrate in M-SPE has become an active area of research. These materials have exceptional mechanical, electrical, optical and magnetic properties and they also have an extremely large surface area and varied possibilities for functionalization. This review covers the synthesis of M-CNTs and the different approaches for the use of these compounds in M-SPE. The performance, general characteristics and applications of M-SPE based on magnetic carbon nanotubes for organic and inorganic analysis have been evaluated on the basis of more than 110 references. Finally, some important challenges with respect the use of magnetic carbon nanotubes in M-SPE are discussed.

  5. Molecularly imprinted solid-phase extraction for the screening of antihyperglycemic biguanides.

    PubMed

    Feng, Sherry Y; Lai, Edward P C; Dabek-Zlotorzynska, Ewa; Sadeghi, Susan

    2004-02-20

    A new molecularly imprinted polymer (MIP) was specifically synthesized as a smart material for the recognition of metformin hydrochloride in solid-phase extraction. Particles of this MIP were packed into a stainless-steel tubing (50 mm x 0.8 mm i.d.) equipped with an exit frit. This micro-column was employed in the development of a molecularly imprinted solid-phase extraction (MISPE) method for metformin determination. The MISPE instrumentation consisted of a micrometer pump, an injector valve equipped with a 20-microl sample loop, a UV detector, and an integrator. With CH3CN as the mobile phase flowing at 0.5 ml/min, 95 +/- 2% binding could be achieved for 1200 ng of metformin from one injection of a phosphate-buffered sample solution (pH 2.5). Methanol + 3% trifluoroacetic acid was good for quantitative pulsed elution (PE) of the bound metformin. The MISPE-PE method, with UV detection at 240 nm, afforded a detection limit of 16 ng (or 0.8 microg/ml) for metformin. However, the micro-column interacted indiscriminately with phenformin with a 49 +/- 2% binding. A systematic investigation of binding selectivity was conducted with respect to sample composition (including the solvent, matrix, pH, buffer and surfactant effects). An intermediate step of differential pulsed elution used acetonitrile with 5% picric acid to remove phenformin and other structural analogues. A final pulsed elution of metformin for direct UV detection was achieved using 3% trifluoroacetic acid in methanol.

  6. Solid-phase extraction and spectrophotometric determination of mercury with 6-mercaptopurine in environmental samples.

    PubMed

    Saber-Tehrani, Mohammad; Hashemi-Moghaddam, Hamid; Husain, S Waqif; Zare, Karim

    2007-08-01

    A highly selective, sensitive and rapid method for the determination of trace amounts of inorganic mercury based on the reaction of Hg (II) with 6-mercaptopurine and the solid phase extraction of the complex on C18 membrane disks was developed. The 6-mercaptopurine selectively reacts with Hg (II) to form a complex in the pH range of 5-8. This complex was preconcentrated by solid phase extraction with C18 disks. An enrichment factor of 100 was achieved. The molar absorptivity of the complex is 0.26 x 10(-6) L. mol(-1) cm(-1) measured at 315 nm. The Beer's law is obeyed in the concentration range of 0.002-0.048 microg mL(-1). The relative standard deviation for eleven-replicated measurement of 0.04 microg mL(-1) is 1.5 %. The detection limit is 0.001 microg mL(-1) in the water samples. The advantage of the method is that the determination of Hg (II) is free from interference of almost all the cations and anions found in environment and wastewater samples. The determination of Hg (II) in water samples of different origins and marine sediment were carried out by the present method and cold vapor atomic absorption spectrometry (CVAAS). Also the method's accuracy was investigated by using SRM 2709. The obtained results by the present procedure were in good agreement with those of the CVAAS and certified value, so that the applicability of the proposed method was confirmed for the real samples.

  7. A highly thermal stable solid phase microextraction fiber prepared by an inorganic binder.

    PubMed

    Liu, Hongmei; Ran, Fanpeng; Tao, Caihong; Zhao, Mengmeng; Jia, Yulong; Guo, Yong

    2016-04-28

    An easy method to prepare solid phase microextraction fibers by introducing an inorganic binder was demonstrated in this study, where MoS2 was selected as the extraction phase material because of its graphite-like layered structure with large specific adsorption area and good stability, and was then adhered to a stainless steel wire by acid aluminum phosphate binder with the spraying method. The as-prepared solid phase microextraction fiber coupled with gas chromatography was then used to extract some polycyclic aromatic hydrocarbons target analytes including the low-volatile benzo(a)pyrene etc. from a standard sample. Comparing with the MoS2-epoxy resin and commercial polyacrylate fibers, the MoS2-acid aluminum phosphate fiber has a higher thermal stability because of highly thermal stable acid aluminum phosphate, which is durable for a long service life at a high temperature (320 °C), and has the advantage in the extraction of low-volatility analytes. After the optimization of adsorption and desorption factors (ionic strength, adsorption time and temperature, and desorption temperature), method detection limits of <0.1 μg L(-1) were achieved, and the calibration curves were all linear (R(2) ≥ 0.9981) within the range of 0.1-100 μg L(-1). The satisfying repeatability was also achieved, the RSD values of single-fiber were 3.49-5.81%, and the ones of fiber-to-fiber were 5.32-7.22%. As a result, the present fiber with good thermal stability can work at high temperature for a long service life, which is useful for the detection of low-volatility target analytes in practical applications.

  8. Solid-phase synthesis of protected peptides using new cobalt(III) ammine linkers.

    PubMed

    Arbo, B E; Isied, S S

    1993-08-01

    Cobalt(III) ammine complexes of the type cis-[CoL4(4-AMB)O-AA-Boc](CF3SO3)2, where L4 = bisethylenediamine (en)2 or tetraammine (NH3)4, and 4-AMB = 4-(aminomethyl)benzoic acid, have been synthesized and used as linkers to polystyrene resins for solid-phase synthesis of protected peptides. Boc/t-Bu-protected [Leu5]enkephalin was assembled on the two different Co(III) resins, and then cleaved from the resins by reduction of the Co(III) center in 93-96% yield. HPLC-purified protected [Leu5]enkephalin was obtained in 67-69% overall yield and characterized by amino acid analysis and 1H NMR. Stepwise synthesis on the Co(en)2-resin was also used in the assembly of Boc-Asp(OcHex)-Arg(Mts)-Gly-Asp(OcHex)-Ala-Pro-Lys(2Cl-Z)-Gl y-OH, a sequence from collagen alpha 1 Type 1. The protected peptide was cleaved from the Co(III) resin in 74% yield, and the HPLC-purified nonapeptide was characterized by amino acid analysis, 1H NMR and liquid secondary-ion mass spectrometry (LSIMS). New routes are described for the synthesis of isomerically pure Co(III) anchor complexes. The Co(III) resins were found to be compatible with both the tert-butyloxycarbonyl (Boc) and the 9-fluorenylmethoxycarbonyl (Fmoc) N alpha-protecting group strategies used in solid-phase peptide synthesis.

  9. Sorbent trapping solid-phase microextraction of fragrance allergens in indoor air.

    PubMed

    Lamas, J Pablo; Sanchez-Prado, Lucia; Lores, Marta; Garcia-Jares, Carmen; Llompart, Maria

    2010-08-13

    Exposure to fragrance substances is exponentially increasing in our daily life due to the enhanced use of scented products. Some fragrances are known to be important sensitizers, inhalation being an important exposure pathway in indoor environments. A simple and sensitive method based on solid-phase enrichment and solid-phase microextraction (SPME) followed by gas chromatography-mass spectrometry (GC-MS) has been developed for the analysis of 24 volatile fragrance allergens in indoor air. Suspected allergens present in the air (0.2 m(3)) were adsorbed onto a very small quantity of florisil (25 mg) and then transferred to a SPME fiber in the headspace mode (HS). To the best of our knowledge, this paper describes the first application of SPME for the determination of these compounds in air samples. The experimental parameters affecting the microextraction process have been optimized using a multifactor experimental design strategy. Accuracy, linearity, precision and detection limits (LODs) were evaluated to assess the performance of the proposed method. External calibration, using spiked sorbent standards, and not requiring the complete sampling process (only the SPME step), demonstrated to be suitable for the quantification of all suspected allergens. Recovery studies were performed at three concentration levels (0.04, 1.00 and 50 microg m(-3)), obtaining quantitative recoveries (> or = 85%) in most cases. LOD values at the low ng m(-3) level were achieved for all the target compounds. The application of the method to daily home air samples demonstrated the ubiquity of this kind of fragrance ingredients in quotidian indoor environments, finding 18 of the 24 considered compounds in concentrations ranging from 0.01 to 56 microg m(-3). Benzyl alcohol, linalool, citronellol, ionone and lilial were found in most analyzed samples.

  10. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis

    PubMed Central

    2015-01-01

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the “structure elucidation problem”: the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS’s utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 104 molecules/bead and sequencing allowed for elucidation of each compound’s synthetic history. We applied DESPS to the combinatorial synthesis of a 75 645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and

  11. An interior needle electropolymerized pyrrole-based coating for headspace solid-phase dynamic extraction.

    PubMed

    Bagheri, Habib; Babanezhad, Esmaeil; Khalilian, Faezeh

    2009-02-23

    A headspace solid-phase dynamic extraction (HS-SPDE) technique was developed by the use of polypyrrole (PPy) sorbent, electropolymerized inside the surface of a needle, as a possible alternative to solid-phase microextraction (SPME). Thermal desorption was subsequently, employed to transfer the extracted analytes into the injection port of a gas chromatography-mass spectrometry (GC-MS). The PPy sorbent including polypyrrole-dodecyl sulfate (PPy-DS) was deposited on the interior surface of a stainless steel needle from the corresponding aqueous electrolyte by applying a constant deposition potential. The homogeneity and the porous surface structure of the coating were examined using the scanning electron microscopy (SEM). The developed method was applied to the trace level extraction of some polycyclic aromatic hydrocarbons (PAHs) from aqueous sample. In order to enhance the extraction efficiency and increase the partition coefficient of analytes, the stainless steel needle was cooled at 5 degrees C, while the sample solution was kept at 80 degrees C. Optimization of influential experimental conditions including the voltage of power supply, the time of PPy electrodeposition, the extraction temperature, the ionic strength and the extraction time were also investigated. The detection limits of the method under optimized conditions were in the range of 0.002-0.01 ng mL(-1). The relative standard deviations (R.S.D.) at a concentration level of 0.1 ng mL(-1) were obtained between 7.54 and 11.4% (n=6). The calibration curves of PAHs showed linearity in the range of 0.01-10 ng mL(-1). The proposed method was successfully applied to the extraction of some selected PAHs from real-life water samples and the relative recoveries were higher than 90% for all the analytes.

  12. Characterization and semiquantitative analysis of volatiles in seedless watermelon varieties using solid-phase microextraction.

    PubMed

    Beaulieu, John C; Lea, Jeanne M

    2006-10-01

    Seedless triploid watermelons have increased in popularity since the early 1990s, and the demand for seedless fruit is on the rise. Sweetness and sugars are crucial breeding focuses for fruit quality. Volatiles also play an important role; yet, we found no literature for seedless varieties and no reports using solid-phase microextraction (SPME) in watermelon. The objective of this experiment was to identify volatile and semivolatile compounds in five seedless watermelon varieties using carboxen divinylbenzene polydimethylsiloxane solid-phase microextraction (SPME) with gas chromatography-mass spectrometry (GC-MS). Fully ripe watermelon was squeezed through miracloth to produce rapid juice extracts for immediate headspace SPME GC-MS. Aldehydes, alcohols, ketones, and one furan (2-pentyl furan, a lipid oxidation product) were recovered. On the basis of total ion count peak area, the most abundant compounds in five varieties were 3-nonen-1-ol/(E,Z)-2,6-nonadienal (16.5-28.2%), (E)-2-nonenal (10.6-22.5%), and (Z)-6-nonenal (2.0-11.3%). Hexanal was most abundant (37.7%) in one variety (Petite Perfection) [corrected] The most abundant ketone was 6-methyl-5-hepten-2-one (2.7-7.7%). Some sensory attributes reported for these compounds are melon, citrus, cucumber, orange, rose, floral, guava, violet, vegetable, green, grassy, herbaceous, pungent, fatty, sweet, and waxy. Identifying and relating these compounds to sensory attributes will allow for future monitoring of the critical flavor compounds in seedless watermelon after processing and throughout fresh-cut storage. PMID:17002453

  13. Automated headspace solid-phase dynamic extraction for the determination of cannabinoids in hair samples.

    PubMed

    Musshoff, Frank; Lachenmeier, Dirk W; Kroener, Lars; Madea, Burkhard

    2003-04-23

    This article describes a fully automated procedure for detecting cannabinoids in human hair samples. The procedure uses alkaline hydrolysis and headspace solid-phase dynamic extraction (HS-SPDE), followed by on-coating derivatization and gas chromatography-mass spectrometry (GC-MS). SPDE is a further development of solid-phase microextraction (SPME), based on an inside needle capillary absorption trap. It uses a hollow needle with an internal coating of polydimethylsiloxane as extraction and pre-concentration medium. Ten mg of hair were washed with deionised water, petroleum ether and dichloromethane. After adding deuterated internal standards, the sample was hydrolyzed with sodium hydroxide and directly submitted to HS-SPDE. After absorption of analytes for an on-coating derivatization procedure, the SPDE-needle was directly placed into the headspace of a second vial containing N-methyl-N-trimethylsilyl-trifluoroacetamide before GC-MS analysis. The limit of detection was 0.14 ng/mg for Delta(9)-tetrahydrocannabinol, 0.09 ng/mg for cannabidiol, and 0.12ng/mg for cannabinol. Absolute recoveries were in the range of 0.6 to 8.4%. Linearity was verified over a range from 0.2 to 20 ng/mg, with coefficients of correlation between 0.998 and 0.999. Intra- and inter-day precision were determined at two different concentrations and resulted in ranges between 2.3 and 6.0% (intra-day) and 3.3 and 7.6% (inter-day). Compared with conventional methods of hair analysis, this automated HS-SPDE-GC-MS procedure is substantially faster. It is easy to perform without using solvents and with minimal sample quantities, and it yields the same sensitivity and reproducibility. Compared to SPME, we found a higher extraction rate, coupled with a faster automated operation and greater stability of the device.

  14. Utility of solid phase extraction for spectrophotometric determination of gold in water, jewel and ore samples

    NASA Astrophysics Data System (ADS)

    Amin, Alaa S.

    2010-12-01

    A highly sensitive, selective and rapid method for the determination μg L -1 level of Au(III) based on the rapid reaction of Au(III) with 2,3-dichloro-6-(3-carboxy-2-hydroxy-1-naphthylazo)quinoxaline (DCHNAQ) and the solid phase extraction of the colored complex with a reversed phase polymer-based C18 cartridge have been developed. The DCHNAQ reacted with Au(III) to form a violet complex of a molar ratio 3:1 [DCHNAQ to Au(III)] in the presence of 5.0 M of phosphoric acid solution and Triton X-100 medium. This complex was enriched by the solid phase extraction with a polymer-based C18 cartridge. The enrichment factor of 100 was achieved. The molar absorptivity of the complex is 2.73 × 10 5 l mol -1 cm -1 at 633 nm in the measured solution. The system obeys Beer's law in the range of 0.02-1.30 μg ml -1, whereas the optimum concentration ranges obtained from Ringbom plot was 0.08-1.24 μg ml -1. The relative standard deviation for ten replicates sample of 0.6 μg ml -1 level is 1.28%. The detection and quantification limits, are 6.1 and 19.5 ng ml -1 in the original sample. This method was applied to the determination of gold in water, jewel and ore samples with good results comparing to the GFAAS method.

  15. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis.

    PubMed

    MacConnell, Andrew B; McEnaney, Patrick J; Cavett, Valerie J; Paegel, Brian M

    2015-09-14

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the "structure elucidation problem": the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS's utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 10(4) molecules/bead and sequencing allowed for elucidation of each compound's synthetic history. We applied DESPS to the combinatorial synthesis of a 75,645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and PCR

  16. Improved resins and novel materials and methods for solid phase extraction and high performance liquid chromatography

    SciTech Connect

    Freeze, R.

    1997-10-08

    Solid-phase extraction (SPE) has grown to be one of the most widely used methods for isolation and preconcentration of a vast range of compounds from aqueous solutions. By modifying polymeric SPE resins with chelating functional groups, the selective uptake of metals was accomplished. The resin, along with adsorbed metals, was vaporized in the ICP and detection of the metals was then possible using either mass or emission spectroscopy. Drug analyses in biological fluids have received heightened attention as drug testing is on the increase both in sports and in the work environment. By using a direct-injection technique, biological fluids can be injected directly into the liquid chromatographic system with no pretreatment. A new surfactant, a sulfonated form of Brij-30 (Brij-S) is shown to prevent the uptake of serum proteins on commercial HPLC columns by forming a thin coating on the silica C18 surface. Excellent separations of eight or more drugs with a wide range of retention times were obtained. The separations had sharper peaks and lower retention times than similar separations performed with the surfactant sodium dodecylsulfate (SDS). Quantitative recovery of a number of drugs with limits of detection near 1 ppm with a 5 {micro}l injection volume were obtained. Finally, a method for solid-phase extraction in a syringe is introduced. The system greatly reduced the volume of solvent required to elute adsorbed analytes from the SPE bed while providing a semi-automated setup. SPE in a syringe consists of a very small bed of resin-loaded membrane packed into a GC or HPLC syringe. After extraction, elution was performed with just a few {micro}l of solvent. This small elution volume allowed injection of the eluent directly from the syringe into the chromatographic system, eliminating the handling problems associated with such small volumes.

  17. Development of a Paper Spray Mass Spectrometry Cartridge with Integrated Solid Phase Extraction for Bioanalysis.

    PubMed

    Zhang, Chengsen; Manicke, Nicholas E

    2015-06-16

    A novel paper spray cartridge with an integrated solid phase extraction (SPE) column is described. The cartridge performs extraction and pre-concentration, as well as sample ionization by paper spray, from complex samples such as plasma. The cartridge allows for selective enrichment of target molecules from larger sample volumes and removal of the matrix, which significantly improved the signal intensity of target compounds in plasma samples by paper spray ionization. Detection limits, quantitative performance, recovery, ionization suppression, and the effects of sample volume were evaluated for five drugs: carbamazepine, atenolol, sulfamethazine, diazepam, and alprazolam. Compared with direct paper spray analysis of dried plasma spots, paper spray analysis using the integrated solid phase extraction improved the detection limits significantly by a factor of 14-70, depending on the drug. The improvement in detection limits was, in large part, due to the capability of analyzing larger sample volumes. In addition, ionization suppression was found to be lower and recovery was higher for paper spray with integrated SPE, as compared to direct paper spray analysis. By spiking an isotopically labeled internal standard into the plasma sample, a linear calibration curve for the drugs was obtained from the limit of detection (LOD) to 1 μg/mL, indicating that this method can be used for quantitative analysis. The paper spray cartridge with integrated SPE could prove valuable for analytes that ionize poorly, in applications where lower detection limits are required, or on portable mass spectrometers. The improved performance comes at the cost of requiring a more complex paper spray cartridge and requiring larger sample volumes than those used in typical direct paper spray ionization.

  18. Molecularly imprinted solid-phase extraction for the determination of fenitrothion in tomatoes.

    PubMed

    Pereira, Leandro Alves; Rath, Susanne

    2009-02-01

    Organophosphorus insecticides are widely employed in agriculture, and residues of them can remain after harvesting or storage. Pesticide residue control is an important task for ensuring food safety. Common chromatographic methods used in the determination of pesticide residues in food require clean-up and concentration steps prior to quantitation. While solid-phase extraction has been widely employed for this purpose, there is a need to improve selectivity. Due to their inherent biomimetic recognition systems, molecularly imprinted polymers (MIP) allow selectivity to be enhanced while keeping the costs of analysis low. In this work, a MIP that was designed to enable the selective extraction of fenitrothion (FNT) from tomatoes was synthesized using a noncovalent imprinting approach. The polymer was prepared using methacrylic acid as functional monomer and ethyleneglycol dimethacrylate as crosslinking monomer in dichloromethane (a porogenic solvent). The polymer was characterized by Fourier transform infrared spectroscopy, solid-state nuclear magnetic resonance (NMR), scanning electron microscopy (SEM), and nitrogen sorption porosimetry. The pore structure and the surface area were evaluated using the BET adsorption method. To characterize the batch rebinding behavior of the MIP, the adsorption isotherm was measured, allowing the total number of binding sites, the average binding affinity and the heterogeneity index to be established. A voltammetric method of quantifying FNT during the molecularly imprinted solid-phase extraction (MISPE) studies was developed. The polymer was placed in extraction cartridges which were then used to clean up and concentrate FNT in tomato samples prior to high-performance liquid chromatographic quantitation. The material presented a medium extraction efficiency of 59% (for analyses performed with three different cartridges on three days and a fortification level of 5.0 microg g(-1)) and selectivity when used in the preparation of

  19. Cold fiber solid-phase microextraction device based on thermoelectric cooling of metal fiber.

    PubMed

    Haddadi, Shokouh Hosseinzadeh; Pawliszyn, Janusz

    2009-04-01

    A new cold fiber solid-phase microextraction device was designed and constructed based on thermoelectric cooling. A three-stage thermoelectric cooler (TEC) was used for cooling a copper rod coated with a poly(dimethylsiloxane) (PDMS) hollow fiber, which served as the solid-phase microextraction (SPME) fiber. The copper rod was mounted on a commercial SPME plunger and exposed to the cold surface of the TEC, which was enclosed in a small aluminum box. A heat sink and a fan were used to dissipate the generated heat at the hot side of the TEC. By applying an appropriate dc voltage to the TEC, the upper part of the copper rod, which was in contact to the cold side of the TEC, was cooled and the hollow fiber reached a lower temperature through heat transfer. A thermocouple was embedded in the cold side of the TEC for indirect measurement of the fiber temperature. The device was applied in quantitative analysis of off-flavors in a rice sample. Hexanal, nonanal, and undecanal were chosen as three off-flavors in rice. They were identified according to their retention times and analyzed by GC-flame ionization detection instrument. Headspace extraction conditions (i.e., temperature and time) were optimized. Standard addition calibration graphs were obtained at the optimized conditions and the concentrations of the three analytes were calculated. The concentration of hexanal was also measured using a conventional solvent extraction method (697+/-143ng/g) which was comparable to that obtained from the cold fiber SPME method (644+/-8). Moreover, the cold fiber SPME resulted in better reproducibility and shorter analysis time. Cold fiber SPME with TEC device can also be used as a portable device for field sampling.

  20. Utility of solid phase extraction for spectrophotometric determination of gold in water, jewel and ore samples.

    PubMed

    Amin, Alaa S

    2010-12-01

    A highly sensitive, selective and rapid method for the determination μg L(-1) level of Au(III) based on the rapid reaction of Au(III) with 2,3-dichloro-6-(3-carboxy-2-hydroxy-1-naphthylazo)quinoxaline (DCHNAQ) and the solid phase extraction of the colored complex with a reversed phase polymer-based C18 cartridge have been developed. The DCHNAQ reacted with Au(III) to form a violet complex of a molar ratio 3:1 [DCHNAQ to Au(III)] in the presence of 5.0 M of phosphoric acid solution and Triton X-100 medium. This complex was enriched by the solid phase extraction with a polymer-based C18 cartridge. The enrichment factor of 100 was achieved. The molar absorptivity of the complex is 2.73×10(5) l mol(-1) cm(-1) at 633 nm in the measured solution. The system obeys Beer's law in the range of 0.02-1.30 μg ml(-1), whereas the optimum concentration ranges obtained from Ringbom plot was 0.08-1.24 μg ml(-1). The relative standard deviation for ten replicates sample of 0.6 μg ml(-1) level is 1.28%. The detection and quantification limits, are 6.1 and 19.5 ng ml(-1) in the original sample. This method was applied to the determination of gold in water, jewel and ore samples with good results comparing to the GFAAS method.

  1. Environmentally Friendly Method: Development and Application to Carbon Aerogel as Sorbent for Solid-Phase Extraction.

    PubMed

    Dong, Sheying; Huang, Guiqi; Su, Meiling; Huang, Tinglin

    2015-10-14

    We developed two simple, fast, and environmentally friendly methods using carbon aerogel (CA) and magnetic CA (mCA) materials as sorbents for micro-solid-phase extraction (μ-SPE) and magnetic solid-phase extraction (MSPE) techniques. The material performances such as adsorption isotherm, adsorption kinetics, and specific surface area were discussed by N2 adsorption-desorption isotherm measurements, ultraviolet and visible (UV-vis) spectrophotometry, scanning electron microscopy (SEM), and high resolution transmission electron microscopy (HR-TEM). The experimental results proved that the heterogeneities of CA and mCA were well modeled with the Freundlich isotherm model, and the sorption process well followed the pseudo-second-order rate equation. Moreover, plant growth regulators (PGRs) such as kinetin (6-KT), 6-benzylaminopurine (6-BA), 2,4-dichlorophenoxyacetic acid (2,4-D), and uniconazole (UN) in a reservoir raw water sample were selected as the evaluation of applicability for the proposed μ-SPE and MSPE techniques using high performance liquid chromatography (HPLC). The experimental conditions of two methods such as the amount of sorbent, extraction time, pH, salt concentration, and desorption conditions were studied. Under the optimized conditions, two extraction methods provided high recoveries (89-103%), low the limits of detection (LODs) (0.01-0.2 μg L(-1)), and satisfactory analytical features in terms of precision (relative standard deviation, RSD, 1.7-5.1%, n=3). This work demonstrates the feasibility and the potential of CA and mCA materials as sorbents for μ-SPE and MSPE techniques. Besides, it also could serve as a basis for future development of other functional CAs in pretreatment technology and make them valuable for analysis of pollutants in environmental applications.

  2. Determination of theophylline in serum by molecularly imprinted solid-phase extraction with pulsed elution.

    PubMed

    Mullett, W M; Lai, E P

    1998-09-01

    The technique of molecular imprinting is used to produce an extensively cross-linked poly(methacrylic acid-co-ethylene dimethacrylate) material that contains theophylline as a print molecule. After Soxhlet extraction of the theophylline, binding sites are formed in the polymer with complementary size, shape, and positioning of chemical functionalities. The molecularly imprinted polymer's (MIP) high theophylline selectivity, chemical stability, and physically robust nature make it an ideal stationary-phase material in columns for HPLC separation of theophylline from other structurally related drug compounds. Mobile-phase tests confirm that a retention mechanism typical of normal-phase chromatography governs the separation, and selectivity of the MIP column can be controlled by a combination of the mobile phase and the sample solvent. Under optimal conditions, the MIP column functions like a solid-phase sorbent for theophylline extraction. Rapid elution of the bound theophylline can be accomplished in a pulsed format through injection of 20 μL of a solvent that has the proper polarity and protic nature to disrupt the electrostatic interactions and hydrogen bonding between theophylline and binding sites. A concentration detection limit of 120 ng/mL is obtained using direct UV absorption detection at 270 nm, which corresponds to a mass detection limit of 2.4 ng. This new technique, molecularly imprinted solid-phase extraction with pulsed elution (MISPE-PE), permits on-line preconcentration of theophylline from a large volume of dilute sample solution. Using a sample volume of 300 μL, a 40 ng/mL standard solution produces a detectable peak signal. Application of MISPE-PE in serum analysis further demonstrates the high capability of the MIP column to selectively isolate theophylline from other matrix components for fast, accurate determination.

  3. A metal organic framework-polyaniline nanocomposite as a fiber coating for solid phase microextraction.

    PubMed

    Bagheri, Habib; Javanmardi, Hasan; Abbasi, Alireza; Banihashemi, Solmaz

    2016-01-29

    A metal organic framework-polyaniline (MOF/PANI) nanocomposite was electrodeposited on a stainless steel wire and used as a solid phase microextraction (SPME) fiber coating. The electropolymerization process was carried out under a constant deposition potential and applied to the corresponding aqueous electrolyte containing aniline and MOF particles. The employment of MOFs with their large and small cages and 3-D structures in synthesizing a nanocomposite was assumed to be efficient constitutes to induce more non-smooth and porous structures, approved by scanning electron microscopy (SEM) images. Three different MOFs were incorporated to synthesize the desired nanocomposites and the preliminary experiments showed that all of them, particularly the one containing MOF2, have higher extraction performances in compared with PANI. The applicability of the new fiber coating was examined by headspace-solid phase microextraction (HS-SPME) of some chlorobenzenes (CBs) from aqueous samples. Influencing parameters on the synthesize and extraction processes including the electrodeposition voltage and its duration time, the weight ratio of PANI and MOF, the ionic strength, desorption temperature and time, and extraction time and temperature were optimized. The developed method was validated by analyzing the spiked distilled water and gas chromatography-mass spectrometry (GC-MS). Under optimum condition, the relative standard deviation (RSD%) values for a double distilled water spiked with the selected CBs at 20ngL(-1) were 5-8% (n=3) and the detection limits were below 0.2ngL(-1). The linear dynamic range (LDR) of the method was in the concentration range of 0.5-1000ngL(-1) (R(2)>0.9994). The fiber-to-fiber reproducibility was found to be in the range of 4-7%. Eventually, various real-water samples were analyzed by the MOF/PANI-based HS-SPME and GC-MS and the relative recovery values were found to be in the range of 92-98%.

  4. Colorimetric Quantification of Glucose and Cholesterol in Human Blood Using a Nanocomposite Entrapping Magnetic Nanoparticles and Oxidases.

    PubMed

    Kim, Moon Il; Cho, Daeyeon; Park, Hyun Gyu

    2015-10-01

    In this study, a microscale well-plate colorimetric assay for the multiplexed detection of glucose and cholesterol in clinical human blood samples has been developed. This system utilized one-pot nanocomposite entrapping Fe3O4 magnetic nanoparticles (MNPs) as peroxidase mimetics and glucose oxidase (GOx)/cholesterol oxidase (ChOx) in mesoporous silica to detect glucose and cholesterol in blood samples. The sensing mechanism involves the generation of H2O2 by the catalytic action of an immobilized oxidase on the target molecules in the sample. This subsequently activates the MNPs in the mesopores, thereby leading to the conversion of the substrate into a colored end product. This strategy is used to detect the target glucose or cholesterol molecules in the concentration range of 15-250 mg/dL. The response is highly linear and the lower detection limit is 7.5 mg/dL. The aforementioned colorimetric assay is extremely convenient, and it exhibits a high degree of linearity, precision, and reproducibility when employing real human blood samples. Therefore, this assay can be used in clinical practice for the multiplexed and reliable quantification of glucose and cholesterol. PMID:26726446

  5. Solid-Phase and Microwave-Assisted Syntheses of 2,5-Diketopiperazines: Small Molecules with Great Potential

    PubMed Central

    O'Neill, J.C.; Blackwell, H. E.

    2008-01-01

    Diketopiperazines (DKPs) are a well-known class of heterocycles that have recently emerged as a promising biologically active scaffold. Solid-phase organic synthesis has become an important tool in the combinatorial exploration of these privileged structures, expediting the synthesis and, therefore, the discovery of active compounds. To date, certain DKPs have shown potent activities against a range of diseases and biological phenomena, including bacterial infections, various cancers, asthma, infertility, premature labor, and HIV. Recent applications of solid-phase DKP synthesis, with a particular focus on cyclative cleavage and microwave-assisted reactions, are highlighted herein. PMID:18288948

  6. Simultaneous Solid Phase Extraction and Derivatization of Aliphatic Primary Amines Prior to Separation and UV-Absorbance Detection

    PubMed Central

    Felhofer, Jessica L.; Scida, Karen; Penick, Mark; Willis, Peter A.; Garcia, Carlos D.

    2013-01-01

    To overcome the problem of poor sensitivity of capillary electrophoresis-UV absorbance for the detection of aliphatic amines, a solid phase extraction and derivatization scheme was developed. This work demonstrates successful coupling of amines to a chromophore immobilized on a solid phase and subsequent cleavage and analysis. Although the analysis of many types of amines is relevant for myriad applications, this paper focuses on the derivatization and separation of amines with environmental relevance. This work aims to provide the foundations for future developments of an integrated sample preparation microreactor capable of performing simultaneous derivatization, preconcentration, and sample cleanup for sensitive analysis of primary amines. PMID:24054648

  7. Dynamic optically multiplexed imaging

    NASA Astrophysics Data System (ADS)

    Rachlin, Yaron; Shah, Vinay; Shepard, R. Hamilton; Shih, Tina

    2015-09-01

    Optically multiplexed imagers overcome the tradeoff between field of view and resolution by superimposing images from multiple fields of view onto a single focal plane. In this paper, we consider the implications of independently shifting each field of view at a rate exceeding the frame rate of the focal plane array and with a precision that can exceed the pixel pitch. A sequence of shifts enables the reconstruction of the underlying scene, with the number of frames required growing inversely with the number of multiplexed images. As a result, measurements from a sufficiently fast sampling sensor can be processed to yield a low distortion image with more pixels than the original focal plane array, a wider field of view than the original optical design, and an aspect ratio different than the original lens. This technique can also enable the collection of low-distortion, wide field of view videos. A sequence of sub-pixel spatial shifts extends this capability to allow the recovery of a wide field of view scene at sub-pixel resolution. To realize this sensor concept, a novel and compact divided aperture multiplexed sensor, capable of rapidly and precisely shifting its fields of view, was prototyped. Using this sensor, we recover twenty-four megapixel images from a four-megapixel focal plane and show the feasibility of simultaneous de-multiplexing and super-resolution.

  8. Solid phase immobilization of optically responsive liposomes insol-gel materials for chemical and biological sensing

    SciTech Connect

    Yamanaka, Stacey A.; Charych, Deborah H.; Loy, Douglas A.; Sasaki, Darryl Y.

    1997-04-01

    Liposomes enhanced with surface recognition groups have previously been found to have high affinity for heavy metal ions and virus particles with unique fluorescent and colorimetric responses, respectively. These lipid aggregate systems have now been successfully immobilized in a silica matrix via the sol-gel method, affording sensor materials that are robust, are easily handled, and offer optical clarity. The mild processing conditions allow quantitative entrapment of preformed liposomes without modification of the aggregate structure. Lipid extraction studies of immobilized nonpolymerized liposomes showed no lipid leakage in aqueous solution over a period of 3 months. Heavy metal fluorescent sensor materials prepared with 5 percent N-[8-[1-octadecyl-2-(9-(1-pyrenyl)nonyl)-rac-glyceroyl]-3,6-dioxaoctyl]imino acid/distearylphosphatidylcholineliposomes exhibited a 4-50-fold enhancement in sensitivity to various metal ions compared to that of the liposomes in free solution. Through ionic attraction the anionic silicate surface, at the experimental pH of 7.4, may act as a preconcentrator of divalent metal ions, boosting the gel's internal metal concentration. Entrapped sialic acid-coated polydiacetylene liposomes responded with colorimetric signaling to influenza virus X31, although slower than the free liposomes in solution. The successful transport of the virus (50-100 nm diameter) reveals a large pore diameter of the gel connecting the liposome to the bulk solution. The porous and durable silica matrix additionally provides a protective barrier to biological attack (bacterial, fungal) and allows facile recycling of the liposome heavy metal sensor.

  9. Extracting information from multiplex networks.

    PubMed

    Iacovacci, Jacopo; Bianconi, Ginestra

    2016-06-01

    Multiplex networks are generalized network structures that are able to describe networks in which the same set of nodes are connected by links that have different connotations. Multiplex networks are ubiquitous since they describe social, financial, engineering, and biological networks as well. Extending our ability to analyze complex networks to multiplex network structures increases greatly the level of information that is possible to extract from big data. For these reasons, characterizing the centrality of nodes in multiplex networks and finding new ways to solve challenging inference problems defined on multiplex networks are fundamental questions of network science. In this paper, we discuss the relevance of the Multiplex PageRank algorithm for measuring the centrality of nodes in multilayer networks and we characterize the utility of the recently introduced indicator function Θ̃(S) for describing their mesoscale organization and community structure. As working examples for studying these measures, we consider three multiplex network datasets coming for social science. PMID:27368796

  10. Extracting information from multiplex networks.

    PubMed

    Iacovacci, Jacopo; Bianconi, Ginestra

    2016-06-01

    Multiplex networks are generalized network structures that are able to describe networks in which the same set of nodes are connected by links that have different connotations. Multiplex networks are ubiquitous since they describe social, financial, engineering, and biological networks as well. Extending our ability to analyze complex networks to multiplex network structures increases greatly the level of information that is possible to extract from big data. For these reasons, characterizing the centrality of nodes in multiplex networks and finding new ways to solve challenging inference problems defined on multiplex networks are fundamental questions of network science. In this paper, we discuss the relevance of the Multiplex PageRank algorithm for measuring the centrality of nodes in multilayer networks and we characterize the utility of the recently introduced indicator function Θ̃(S) for describing their mesoscale organization and community structure. As working examples for studying these measures, we consider three multiplex network datasets coming for social science.

  11. Extracting information from multiplex networks

    NASA Astrophysics Data System (ADS)

    Iacovacci, Jacopo; Bianconi, Ginestra

    2016-06-01

    Multiplex networks are generalized network structures that are able to describe networks in which the same set of nodes are connected by links that have different connotations. Multiplex networks are ubiquitous since they describe social, financial, engineering, and biological networks as well. Extending our ability to analyze complex networks to multiplex network structures increases greatly the level of information that is possible to extract from big data. For these reasons, characterizing the centrality of nodes in multiplex networks and finding new ways to solve challenging inference problems defined on multiplex networks are fundamental questions of network science. In this paper, we discuss the relevance of the Multiplex PageRank algorithm for measuring the centrality of nodes in multilayer networks and we characterize the utility of the recently introduced indicator function Θ ˜ S for describing their mesoscale organization and community structure. As working examples for studying these measures, we consider three multiplex network datasets coming for social science.

  12. Colorimetric assays for biodegradation of polycyclic aromatic hydrocarbons by fungal laccases.

    PubMed

    Alcalde, Miguel; Bulter, Thomas; Arnold, Frances H

    2002-12-01

    Polycyclic aromatic hydrocarbons (PAHs) are highly toxic organic pollutants widely distributed in terrestrial and aquatic environments. In the present work, 2 colorimetric assays for laccase-catalyzed degradation of PAHs were developed based on studies of the oxidation of 12 aromatic hydrocarbons by fungal laccases from Trametes versicolor and Myceliophthora thermophila. Using a sodium borohydride water-soluble solution, the authors could reduce the single product of laccase-catalyzed anthracene biooxidation into the orange-colored 9,10-anthrahydroquinone, which is quantifiable spectrophotometrically. An assay using polymeric dye (Poly R-478) as a surrogate substrate for lignin degradation by laccase in the presence of mediator is also presented. The decolorization of Poly R-478 was correlated to the oxidation of PAHs mediated by laccases. This demonstrates that a ligninolytic indicator such as Poly R-478 can be used to screen for PAH-degrading laccases; it will also be useful in screening mutant libraries in directed evolution experiments. Poly R-478 is stable and readily soluble. It has a high extinction coefficient and low toxicity toward white rot fungi, yeast, and bacteria, which allow its application in a solid-phase assay format.

  13. Colorimetric method for rapid determination of bacteriuria.

    PubMed

    Wallis, C; Melnick, J L; Longoria, C J

    1981-09-01

    An inexpensive, rapid, and simple colorimetric test for detection of bacteriuria is described. This test does not require bacterial growth and has the marked advantage of being able to quantify bacteria, even when the organisms are present in the urine of bacteriuric patients who are being treated with antibiotics. The test is carried out with 1 ml of urine, which is processed through a 10-mm-diameter filter than entraps the bacteria on its surface. Safranine dye is passed through the filter to stain the bacteria and the filter fibers. A decolorizer, which removes the dye from the filter fibers but not from the bacteria, is then passed through the filter. If there are greater than or equal to 10(5) colony-forming units of bacteria per ml in the sample, the 10-mm filter disk manifests a pink to red color. If there are less than 10(5)colony-forming units of bacteria per ml, the filter disk remains white or becomes slightly yellow. The entire procedure has been adapted to a semiautomated instrument and the time required per test is less than 1 min. The results obtained on the test card are a permanent record to be filled with the patient's chart. The bacteria can be quickly classified as gram positive or gram negative by selective staining of a second milliliter of urine on the filter. Of 441 urine specimens tested, 430 (98%) were correctly classified as containing more or less than 10(5) colony-forming units per ml. A total of 62 urine specimens were positive by bacterial plating (greater than or equal to 10(5) colony-forming units per ml), and 59 were positive by the colorimetric test. Eight false-positives (colorimetric test positive, plate counts less than 10(5)) were encountered in patients (bacteriuric) being prescribed antibiotics. Removal of the antibiotics from these urine specimens, with subsequent replating of the samples, indicated the presence of greater than or equal to 10(5) colony-forming units of bacteria per ml in three representative cases tested

  14. Determination of Scopolamine in Human Saliva Using Solid Phase Extraction and LC/MS/MS

    NASA Technical Reports Server (NTRS)

    Wang, Zuwei; Vaksman, Zalman; Boyd, Jason; Putcha, Lakshmi

    2007-01-01

    Purpose: Scopolamine is the preferred treatment for motion sickness during space flight because of its quick onset of action, short half-life and favorable side-effect profile. The dose administered depends on the mode of administration and usually ranges between 0.1 and 0.8 mg. Such small doses make it difficult to detect concentrations of scopolamine in biological fluids by using conventional HPLC methods. To measure scopolamine in saliva and thereby to evaluate the pharmacokinetics of scopolamine, we developed an LC/MS/MS method using off-line solid phase extraction. Method: Samples (0.5mL) were loaded onto Waters Oasis HLB co-polymer cartridges (10 mg, 1 mL) and eluted with 0.5 mL methanol without evaporation and reconstitution. HPLC separation of the eluted sample was performed using an Agilent Zorbax SB-CN column (50 x 2.1 mm) at a flow rate of 0.2 mL/min for 4 minutes. The mobile phase for separation was 90:10 (v/v) methanol: ammonium acetate (2 mM) in water, pH 5.0 +/- 0.1. Concentrations of scopolamine were determined using a Micromass Quattro Micro(TM) mass spectrometer with electrospray ionization (ESI). ESI mass spectra were acquired in positive ion mode with multiple reaction monitoring for the determination of scopolamine m/z = 304.2 yields 138.1 and internal standard (IS) hyoscyamine m/z = 290.2 yields 124.1. Results: The method is rapid, reproducible, specific and has the following parameters: scopolamine and the IS are eluted at 1.7 and 3.2 min respectively. The linear range is 50-5000 pg/mL for scopolamine in saliva with correlation coefficients > 0.99 with a CV < 0.5 %. The intra-day and inter-day CVs are < 15 % for quality control samples with concentrations of 75, 300, 750 and 3000 pg/mL of scopolamine in human saliva. Conclusion: Solid phase extraction allows more rapid sample preparation and greater precision than liquid extraction. Furthermore, we increased the sensitivity and specificity by adjusting the LC mobile phase and using an MS

  15. Cheese is a reliable alternative meal for solid-phase gastric emptying study.

    PubMed

    Drubach, Laura A; Kourmouzi, Vasiliki; Fahey, Frederic H

    2010-05-01

    We evaluated the labeling stability of several alternative meals that could be used to perform solid-phase gastric emptying study. Cooked egg whites labeled with technetium-99m sulfur colloid served as a control. Packaged instant oatmeal and instant mashed potatoes were prepared by adding hot water. Cheddar cheese was melted. Peanut butter was added to bread. The different meals were mixed with technetium-99m sulfur colloid (2.2-3.7 MBq), chopped into small pieces and placed in a glass tube containing gastric juice. Four samples of each meal were analyzed after 1 and 4 h of agitation with a 3-D rotator (two samples per time point). The meal samples were washed with 2 ml of saline and filtered using a blood transfusion filter. The activity in each sample before and after filtering was assayed in a dose calibrator. The percentage of initial radioactivity remaining with the meal of admixture with gastric juice was measured and the average of the two samples was taken. The percentage of activity bound to the solid phase was 98.2+/-1.9, 95.6+/-1.1, 62.1+/-1.7, 41.8+/-0.6, and 74.5+/-3.8% at 1 h and 98.5+/-1.0, 95.8+/-2.6, 77.2+/-6.8, 55.5+/-3.4 and 40.2+/-22.1 at 4 h for egg whites, cheese, oatmeal, mashed potatoes and peanut butter respectively. For egg whites and cheese, there was no significant difference between the values at 1 and 4 h (P>0.8). Cheddar cheese provides an alternative meal for assessing solid gastric emptying in children comparable to egg whites. Oatmeal and mashed potatoes had low and variable labeling stability and are not recommended. In view of the significant proportion of pediatric patients who refuse to eat scrambled eggs or have allergy to eggs, the availability of other meal choices is essential. The versatility of cheddar cheese, which can be added to macaroni or as a topping on pizza, makes it a useful alternative to labeled eggs.

  16. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP

    NASA Astrophysics Data System (ADS)

    Czulak, J.; Guerreiro, A.; Metran, K.; Canfarotta, F.; Goddard, A.; Cowan, R. H.; Trochimczuk, A. W.; Piletsky, S.

    2016-05-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates.Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike

  17. Experimental Method Development for Estimating Solid-phase Diffusion Coefficients and Material/Air Partition Coefficients of SVOCs

    EPA Science Inventory

    The solid-phase diffusion coefficient (Dm) and material-air partition coefficient (Kma) are key parameters for characterizing the sources and transport of semivolatile organic compounds (SVOCs) in the indoor environment. In this work, a new experimental method was developed to es...

  18. Combinatorial Solid-Phase Synthesis of Aromatic Oligoamides: A Research-Based Laboratory Module for Undergraduate Organic Chemistry

    ERIC Educational Resources Information Center

    Fuller, Amelia A.

    2016-01-01

    A five-week, research-based experiment suitable for second-semester introductory organic laboratory students is described. Each student designs, prepares, and analyzes a combinatorial array of six aromatic oligoamides. Molecules are prepared on solid phase via a six-step synthetic sequence, and purities and identities are determined by analysis of…

  19. Solid-phase synthesis and anti-infective activity of a combinatorial library based on the natural product anisomycin.

    PubMed

    Shi, Shuhao; Zhu, Shirong; Gerritz, Samuel W; Esposito, Kim; Padmanabha, Ramesh; Li, Wenying; Herbst, John J; Wong, Henry; Shu, Yue Zhong; Lam, Kin S; Sofia, Michael J

    2005-09-15

    The solid-phase synthesis of a library based on the natural product anisomycin is described. The resulting library was tested against a panel of bacterial and fungal targets, and active compounds were identified in a Staphylococcus aureus whole-cell assay and an efflux-deficient fungal whole-cell assay.

  20. QUANTIFICATION OF 2,4-D ON SOLID-PHASE EXPOSURE SAMPLING MEDIA BY LC/MS/MS

    EPA Science Inventory

    Three types of solid phase chemical exposure sampling media: cellulose, polyurethane foam (PUF) and XAD-2, were analyzed for 2,4-D and the amine salts of 2,4-D. Individual samples were extracted into acidified methanol and the extracts were analyzed via LC/MS/MS using electrospra...

  1. Rapid staining and enumeration of small numbers of total bacteria in water by solid-phase laser cytometry

    NASA Technical Reports Server (NTRS)

    Broadaway, Susan C.; Barton, Stephanie A.; Pyle, Barry H.

    2003-01-01

    The nucleic acid stain SYBR Green I was evaluated for use with solid-phase laser cytometry to obtain total bacterial cell counts from several water sources with small bacterial numbers. Results were obtained within 30 min and exceeded or equaled counts on R2A agar plates incubated for 14 days at room temperature.

  2. Detection of Giardia lamblia Antigens in Human Fecal Specimens by a Solid-Phase Qualitative Immunochromatographic Assay▿

    PubMed Central

    Garcia, Lynne S.; Garcia, John Paul

    2006-01-01

    The SIMPLE-READ Giardia rapid assay (Medical Chemical Corporation) is a solid-phase qualitative immunochromatographic assay that detects Giardia lamblia in aqueous extracts of human fecal specimens. Testing 106 Giardia-positive and 104 Giardia-negative stool specimens yielded a sensitivity of 97.2% and a specificity of 100% for the SIMPLE-READ Giardia rapid assay. PMID:17065273

  3. THE DISTRIBUTION, SOLID-PHASE SPECIATION, AND DESORPTION/DISSOLUTION OF AS IN IRON-BASED TREATMENT MEDIA

    EPA Science Inventory

    Arsenic concentrations (Total Recoverable As by EPA Method 3051) and solid-phase speciation (by X-ray Absorption Near-Edge Spectroscopy-XANES) were assessed as a function of depth through Fe-media beds for two commercially available products from pilot-scale field tests. These re...

  4. Rapid apolipoprotein E radioimmunoassay using solid-phase staphylococcus protein. Use of pooled plasma as a secondary standard

    SciTech Connect

    Au, Y.P.T.; Bren, N.D.; Kottke, B.A.

    1986-07-16

    A rapid apolipoprotein E (apo E) radioimmunoassay, which requires a total of 24 hour incubation as compared to the usual 3-5 days, has been developed in their laboratory. Solid phase staphylococcus protein A was used to separate bound and unbound labeled antigen. Use of a pooled plasma (quality control sample) as a secondary standard to reduce interassay variation was also described.

  5. Novel restricted access materials combined to molecularly imprinted polymers for selective solid-phase extraction of organophosphorus pesticides from honey.

    PubMed

    He, Juan; Song, Lixin; Chen, Si; Li, Yuanyuan; Wei, Hongliang; Zhao, Dongxin; Gu, Keren; Zhang, Shusheng

    2015-11-15

    A novel restricted access materials (RAM) combined to molecularly imprinted polymers (MIPs), using malathion as template molecule and glycidilmethacrylate (GMA) as pro-hydrophilic co-monomer, were prepared for the first time. RAM-MIPs with hydrophilic external layer were characterized by scanning electron microscopy and recognition and selectivity properties were compared with the restricted access materials-non-molecularly imprinted polymers (RAM-NIPs) and unmodified MIPs. RAM-MIPs were used as the adsorbent enclosed in solid phase extraction column and several important extraction parameters were comprehensively optimized to evaluate the extraction performance. Under the optimum extraction conditions, RAM-MIPs exhibited comparable or even higher selectivity with greater extraction capacity toward six kinds of organophosphorus pesticides (including malathion, ethoprophos, phorate, terbufos, dimethoate, and fenamiphos) compared with the MIPs and commercial solid phase extraction columns. The RAM-MIPs solid phase extraction coupled with gas chromatography was successfully applied to simultaneously determine six kinds of organophosphorus pesticides from honey sample. The new established method showed good linearity in the range of 0.01-1.0 μg mL(-1), low limits of detection (0.0005-0.0019 μg mL(-1)), acceptable reproducibility (RSD, 2.26-4.81%, n = 6), and satisfactory relative recoveries (90.9-97.6%). It was demonstrated that RAM-MIPs solid phase extraction with excellent selectivity and restricted access function was a simple, rapid, selective, and effective sample pretreatment method. PMID:25977034

  6. Novel restricted access materials combined to molecularly imprinted polymers for selective solid-phase extraction of organophosphorus pesticides from honey.

    PubMed

    He, Juan; Song, Lixin; Chen, Si; Li, Yuanyuan; Wei, Hongliang; Zhao, Dongxin; Gu, Keren; Zhang, Shusheng

    2015-11-15

    A novel restricted access materials (RAM) combined to molecularly imprinted polymers (MIPs), using malathion as template molecule and glycidilmethacrylate (GMA) as pro-hydrophilic co-monomer, were prepared for the first time. RAM-MIPs with hydrophilic external layer were characterized by scanning electron microscopy and recognition and selectivity properties were compared with the restricted access materials-non-molecularly imprinted polymers (RAM-NIPs) and unmodified MIPs. RAM-MIPs were used as the adsorbent enclosed in solid phase extraction column and several important extraction parameters were comprehensively optimized to evaluate the extraction performance. Under the optimum extraction conditions, RAM-MIPs exhibited comparable or even higher selectivity with greater extraction capacity toward six kinds of organophosphorus pesticides (including malathion, ethoprophos, phorate, terbufos, dimethoate, and fenamiphos) compared with the MIPs and commercial solid phase extraction columns. The RAM-MIPs solid phase extraction coupled with gas chromatography was successfully applied to simultaneously determine six kinds of organophosphorus pesticides from honey sample. The new established method showed good linearity in the range of 0.01-1.0 μg mL(-1), low limits of detection (0.0005-0.0019 μg mL(-1)), acceptable reproducibility (RSD, 2.26-4.81%, n = 6), and satisfactory relative recoveries (90.9-97.6%). It was demonstrated that RAM-MIPs solid phase extraction with excellent selectivity and restricted access function was a simple, rapid, selective, and effective sample pretreatment method.

  7. Solid-phase cyclopalladation in S,C,S'-pincer systems: rising alternative for synthesis in solution.

    PubMed

    Aleksanyan, Diana V; Klemenkova, Zinaida S; Vasil'ev, Andrei A; Gorenberg, Arkadii Ya; Nelyubina, Yulia V; Kozlov, Vladimir A

    2015-02-21

    In pursuit of a new and simple approach to complex organometallic systems, the possibility of formation of a palladium-carbon bond in the solid state via direct cyclopalladation has been studied toward several S,C,S'-pincer ligands with thione sulfur donors of different nature. It is found that mixtures of the ligand and PdCl2(NCPh)2 obtained by the manual grinding of reactants in a mortar efficiently undergo solid-phase cyclometalation upon heating in open test tubes without the addition of a solvent to afford the desired pincer-type products in high yields. In the case of the most active bis(thiocarbamoyl) ligand, solid-phase cyclopalladation proceeds even at room temperature. For the challenging bis(thiophosphoryl) derivative, the preformed non-metallated complexes can be successfully used as a starting material to essentially enhance the yield of the desired pincer complex compared to the conventional synthesis in solution. The solid-phase transformation is followed by IR spectroscopy and SEM analysis. The results obtained show that the suggested solid-phase methodology can serve as a powerful alternative to conventional synthesis of pincer complexes in solution.

  8. SCREENING METHOD FOR NITROAROMATIC COMPOUNDS IN WATER BASED ON SOLID-PHASE MICROEXTRACTION AND INFRARED SPECTROSCOPY. (R825343)

    EPA Science Inventory

    A new method is described for determining nitroaromatic compounds in water
    that combines solid-phase microextraction (SPME) and infrared (IR) spectroscopy. In this method, the compounds are extracted from a 250-mL volume of water into a small square (3.2 cm ? 3.2 cm ? 61.2...

  9. PARTITION INFRARED METHOD FOR TOTAL GASOLINE RANGE ORGANICS IN WATER BASED ON SOLID PHASE MICROEXTRACTION. (R825343)

    EPA Science Inventory

    A new method is described for determining total gasoline-range organics
    (TGRO) in water that combines solid-phase microextraction (SPME) and infrared
    (IR) spectroscopy. In this method, the organic compounds are extracted from
    250-mL of water into a small square (3....

  10. Separation, recovery and recycling of a fluorous-tagged nickel catalyst using fluorous solid-phase extraction.

    PubMed

    Croxtall, Ben; Hope, Eric G; Stuart, Alison M

    2003-10-01

    Highly efficient separation, recovery and recycling of the fluorous-tagged catalyst, [Ni[F13C6C(O)CHC(O)C6F13]2], can be achieved with fluorous solid-phase extraction, after the Lewis acid catalysed synthesis of enaminodiones in conventional organic solvents. PMID:14587716

  11. Total integrated slidable and valveless solid phase extraction-polymerase chain reaction-capillary electrophoresis microdevice for mini Y chromosome short tandem repeat genotyping.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Sim, Jeong Eun; Woo, Kwang Man; Kim, Do Hyun; Im, Sung Gap; Seo, Tae Seok

    2016-04-15

    A fully integrated slidable and valveless microsystem, which performs solid phase DNA extraction (SPE), micro-polymerase chain reaction (μPCR) and micro-capillary electrophoresis (μCE) coupled with a portable genetic analyser, has been developed for forensic genotyping. The use of a slidable chip, in which a 1 μL-volume of the PCR chamber was patterned at the center, does not necessitate any microvalves and tubing systems for fluidic control. The functional micro-units of SPE, μPCR, and μCE were fabricated on a single glass wafer by conventional photolithography, and the integrated microdevice consists of three layers: from top to bottom, a slidable chip, a channel wafer in which a SPE chamber, a mixing microchannel, and a CE microchannel were fabricated, and a Ti/Pt resistance temperature detector (RTD) wafer. The channel glass wafer and the RTD glass wafer were thermally bonded, and the slidable chip was placed on the designated functional unit. The entire process from the DNA extraction using whole human blood sample to identification of target Y chromosomal short tandem repeat (STR) loci was serially carried out with simply sliding the slidable chamber from one to another functional unit. Monoplex and multiplex detection of amelogenin and mini Y STR loci were successfully analysed on the integrated slidable SPE-μPCR-μCE microdevice by using 1 μL whole human blood within 60 min. The proposed advanced genetic analysis microsystem is capable of point-of-care DNA testing with sample-in-answer-out capability, more importantly, without use of complicated microvalves and microtubing systems for liquid transfer.

  12. Colorimetric Assay for the Detection of Typical Biomarkers for Periodontitis Using a Magnetic Nanoparticle Biosensor.

    PubMed

    Wignarajah, Shayalini; Suaifan, Ghadeer A R Y; Bizzarro, Sergio; Bikker, Floris J; Kaman, Wendy E; Zourob, Mohammed

    2015-12-15

    Periodontitis is a chronic disease which affects at least 10% of the population. If untreated, periodontitis can lead to teeth loss. Unfortunately, current diagnostic tests are limited in their sensitivity and specificity. In this study, a novel multiplex hand-held colorimetric diagnostic biosensor, using two typical inflammatory salivary biomarkers, Human Neutrophil Elastase (HNE) and Cathepsin-G, was constructed as proof of concept to potentially detect periodontitis. The biosensing method was based on the measurement of proteolytic activity using specific proteases probes. These probes consist of specific proteases substrates covalently bound to a magnetic bead from one end and to the gold sensor surface by the other end. When intact, this renders the golden sensor black. Upon proteolysis, the cleaved magnetic beads will be attracted by an external magnet revealing the golden color of the sensor surface observable by the naked eye. The biosensor was capable of specific and quantitative detection of HNE and Cathepsin-G in solution and in spiked saliva samples with a lower detection limit of 1 pg/mL and 100 fg/mL for HNE and Cathepsin-G, respectively. Examination of periodontitis patients' sample and a healthy control showed the potential of the multiplex biosensor to detect the presence of HNE and Cathepsin-G activity in situ. This approach is anticipated to be a useful biochip array amenable to low-cost point-of-care devices.

  13. Gold-silver-alloy nanoprobes for one-pot multiplex DNA detection.

    PubMed

    Doria, G; Larguinho, M; Dias, J T; Pereira, E; Franco, R; Baptista, P V

    2010-06-25

    A specific colorimetric DNA detection method based on oligonucleotide functionalized gold-silver-alloy nanoparticles (AuAg-alloy-nanoprobes) is presented. The AuAg-alloy-nanoprobes were then used for the specific detection of a DNA sequence from TP53-a gene involved in cancer development. The AuAg-alloy-nanoprobes were then used in combination with Au-nanoprobes for a one-pot dual-colour detection strategy that allowed for the simultaneous differential detection of two distinct target sequences. This system poses an unprecedented opportunity to explore the combined use of metal nanoparticles with different composition towards the development of a multiplex one-pot colorimetric assay for DNA detection.

  14. Multiplex detection of mutations.

    PubMed

    Perlin, David S; Balashov, Sergey; Park, Steven

    2008-01-01

    Rapid and reliable detection of mutations at the genetic level is an integral part of modern molecular diagnostics. These mutations can range from dominant single nucleotide polymorphisms within specific loci to codominant heterozygotic insertions and they present considerable challenges to investigators in developing rapid nucleic acid-based amplification assays that can distinguish wild-type from mutant alleles. The recent improvements of real-time polymerase chain reaction (PCR) using self-reporting fluorescence probes have given researchers a powerful tool in developing assays for mutation detection that can be multiplexed for high-throughput screening of multiple mutations and cost effectiveness. Here we describe an application of a multiplexed real-time PCR assay using Molecular Beacon probes for the detection of mutations in codon 54 of the CYP51A gene in Aspergillus fumigatus conferring triazole resistance.

  15. Crosslinked polymeric ionic liquids as solid-phase microextraction sorbent coatings for high performance liquid chromatography.

    PubMed

    Yu, Honglian; Merib, Josias; Anderson, Jared L

    2016-03-18

    Neat crosslinked polymeric ionic liquid (PIL) sorbent coatings for solid-phase microextraction (SPME) compatible with high-performance liquid chromatography (HPLC) are reported for the first time. Six structurally different PILs were crosslinked to nitinol supports and applied for the determination of select pharmaceutical drugs, phenolics, and insecticides. Sampling conditions including sample solution pH, extraction time, desorption solvent, desorption time, and desorption solvent volume were optimized using design of experiment (DOE). The developed PIL sorbent coatings were stable when performing extractions under acidic pH and remained intact in various organic desorption solvents (i.e., methanol, acetonitrile, acetone). The PIL-based sorbent coating polymerized from the IL monomer 1-vinyl-3-(10-hydroxydecyl) imidazolium chloride [VC10OHIM][Cl] and IL crosslinker 1,12-di(3-vinylbenzylimidazolium) dodecane dichloride [(VBIM)2C12] 2[Cl] exhibited superior extraction performance compared to the other studied PILs. The extraction efficiency of pharmaceutical drugs and phenolics increased when the film thickness of the PIL-based sorbent coating was increased while many insecticides were largely unaffected. Satisfactory analytical performance was obtained with limits of detection (LODs) ranging from 0.2 to 2 μg L(-1) for the target analytes. The accuracy of the analytical method was examined by studying the relative recovery of analytes in real water samples, including tap water and lake water, with recoveries varying from 50.2% to 115.9% and from 48.8% to 116.6%, respectively. PMID:26896916

  16. On-site calibration method based on stepwise solid-phase microextraction.

    PubMed

    Xiong, Guohua; Chen, Yong; Pawliszyn, Janusz

    2003-05-30

    A stepwise solid-phase microextraction (SPME) method was developed for on-site calibration of SPME for volatile organic compounds analysis. In this approach, a 75-microm Carboxen-polydimethylsiloxane coated fibre was loaded with a prior to exposure to samples of interest Extraction time for the target analytes can be controlled independently from that of the standard, and the response factors for the target analytes can be adjusted accordingly. A good reproducibility of the response factors for BTEXs (benzene, toluene, ethylbenzene and xylenes) was obtained with stepwise SPME. Satisfactory results were obtained by using this method for quantitative analysis of BTEXs in the air of a gas station when tetrachloroethylene was used as a standard. The introduction of standard via the stepwise SPME procedure makes SPME more useful in field applications. It can be used to detect leaks, contaminations and losses from loading of a standard onto a fibre to introduction of the fibre to an analytical instrument. However, this method cannot be used for compensation of sample matrix effects.

  17. Solid-Phase Extraction of Sulfur Mustard Metabolites Using an Activated Carbon Fiber Sorbent.

    PubMed

    Lee, Jin Young; Lee, Yong Han

    2016-01-01

    A novel solid-phase extraction method using activated carbon fiber (ACF) was developed and validated. ACF has a vast network of pores of varying sizes and microporous structures that result in rapid adsorption and selective extraction of sulfur mustard metabolites according to the pH of eluting solvents. ACF could not only selectively extract thiodiglycol and 1-methylsulfinyl-2-[2-(methylthio)-ethylsulfonyl]ethane eluting a 9:1 ratio of dichloromethane to acetone, and 1,1'-sulfonylbis[2-(methylsulfinyl)ethane] and 1,1'-sulfonylbis- [2-S-(N-acetylcysteinyl)ethane] eluting 3% hydrogen chloride in methanol, but could also eliminate most interference without loss of analytes during the loading and washing steps. A sample preparation method has been optimized for the extraction of sulfur mustard metabolites from human urine using an ACF sorbent. The newly developed extraction method was applied to the trace analysis of metabolites of sulfur mustard in human urine matrices in a confidence-building exercise for the analysis of biomedical samples provided by the Organisation for the Prohibition of Chemical Weapons. PMID:26364317

  18. Mechanisms of Neutral and Anionic Surfactant Sorption to Solid-Phase Microextraction Fibers.

    PubMed

    Haftka, Joris J-H; Hammer, Jort; Hermens, Joop L M

    2015-09-15

    Octanol-water partitioning (Kow) is considered a key parameter for hydrophobicity and is often applied in the prediction of the environmental fate and exposure of neutral organic compounds. However, surfactants can create difficulties in the determination of Kow because of emulsification of both water and octanol phases. Moreover, not only is sorption behavior of ionic surfactants related to hydrophobicity, but also other interactions are relevant in sorption processes. A different approach to develop parameters that can be applied in predictive modeling of the fate of surfactants in the environment is therefore required. Distribution between solid-phase microextraction (SPME) fibers and water was used in this study to measure the affinity of surfactants to a hydrophobic phase. Fiber-water sorption coefficients of alcohol ethoxylates, alkyl carboxylates, alkyl sulfates, and alkyl sulfonates were determined at pH 7 by equilibration of the test analytes between fiber and water. Distribution between fiber and water of anionic compounds with pKa ∼ 5 (i.e., alkyl carboxylates) was dominated by the neutral fraction. Anionic surfactants with pKa ≤ 2 (i.e., alkyl sulfates and alkyl sulfonates) showed strong nonlinear distribution to the fiber. The fiber-water sorption coefficients for alcohol ethoxylates and alkyl sulfates showed a linear trend with bioconcentration factors from the literature. Fiber-water sorption coefficients are promising as a parameter to study the effects of hydrophobicity and other potential interactions on sorption behavior of neutral and anionic surfactants.

  19. Hierarchical Graphene coating for highly sensitive solid phase microextraction of organochlorine pesticides.

    PubMed

    Wang, Fuxin; Liu, Shuqin; Yang, Hao; Zheng, Juan; Qiu, Junlang; Xu, Jianqiao; Tong, Yexiang; Zhu, Fang; Ouyang, Gangfeng

    2016-11-01

    Graphene, a novel class of carbon nanostructures, has received great attention as sorbents due to its fascinating structures, ultrahigh specific surface area, and good extraction ability. In this paper, a new type of hierarchical graphene was synthesized through employing a mild and environment-friendly method. Such 3D interconnected graphene own a high specific surface area up to 524m(2)g(-1), which is about 2.5 fold larger than the graphene, since the synthetic material has interlayer pores between nanosheets and in-plane pores. Then a superior solid-phase microextraction fiber was fabricated by sequentially coating the stainless steel fiber with silicone sealant film and hierarchical graphene powder. Since the novel hierarchical graphene possessed large surface area and good adsorption property, the as-prepared fiber exhibited good extraction properties of the organochlorine pesticides (OCPs). As for the analytical performance, the as-prepared fiber achieved low detection limits (0.08-0.80ngL(-1)) and wide linearity (10-30,000ngL(-1)) under the optimal conditions. The repeatability (n=5) for single fiber were between 5.1% and 11%, while the reproducibility (n=3) of fiber-to-fiber were range from 6.2% to14%. Moreover, the fiber was successfully applied to the analysis of OCPs in the Pearl River water. PMID:27591607

  20. Magnetic three-dimensional graphene solid-phase extraction of chlorophenols from honey samples.

    PubMed

    Liu, Xingli; Zhou, Xin; Wang, Chun; Wu, Qiuhua; Wang, Zhi

    2015-01-01

    A novel magnetic three-dimensional graphene nano-composite (3D-G@Fe3O4) with a high surface area was synthesised by a vacuum freeze-dried method. Due to its high surface area, specific 3D nanoporous structure and excellent magnetic properties, it can be used as a magnetic solid-phase extraction adsorbent. Some chlorophenols in a honey samples were enriched by this nanocomposite prior to their determination by HPLC with ultraviolet detection. Factors that affect the extraction efficiency, such as the amount of 3D-G@Fe3O4, extraction time, sample pH, ionic strength and desorption conditions, were investigated and optimised. Under the optimum conditions, good linearity existed in the range of 10.0-1000.0 ng g(-1). The enrichment factors of the method for the analytes were in the range from 101 to 248. The limits of detection of the method (S/N = 3) were 1.0-1.5 ng g(-1). The recoveries of the method for the analytes at spiking levels of 100.0 and 400.0 ng g(-1) were in the range of 93.2-98.9%. The results showed that the proposed method is simple, reliable and sensitive. It will be a useful tool for the routine monitoring of chlorophenols in honey products. PMID:25397363

  1. Determination of rhodamine B in soft drink, waste water and lipstick samples after solid phase extraction.

    PubMed

    Soylak, Mustafa; Unsal, Yunus Emre; Yilmaz, Erkan; Tuzen, Mustafa

    2011-08-01

    A new solid phase extraction method is described for sensitive and selective determination of trace levels of rhodamine B in soft drink, food and industrial waste water samples. The method is based on the adsorption of rhodamine B on the Sepabeads SP 70 resin and its elution with 5 mL of acetonitrile in a mini chromatographic column. Rhodamine B was determined by using UV visible spectrophotometry at 556 nm. The effects of different parameters such as pH, amount of rhodamine B, flow rates of sample and eluent solutions, resin amount, and sample volume were investigated. The influences of some alkali, alkali earth and transition metals on the recoveries of rhodamine B were investigated. The preconcentration factor was found 40. The detection limit based on three times the standard deviation of the reagent blank for rhodamine B was 3.14 μg L⁻¹. The relative standard deviations of the procedure were found as 5% in 1×10⁻⁵ mol L⁻¹ rhodamine B. The presented procedure was successfully applied to real samples including soft drink, food and industrial waste water and lipstick samples.

  2. Solid-Phase Synthesis and Characterization of N-Terminally Elongated Aβ-3-x -Peptides.

    PubMed

    Beyer, Isaak; Rezaei-Ghaleh, Nasrollah; Klafki, Hans-Wolfgang; Jahn, Olaf; Haußmann, Ute; Wiltfang, Jens; Zweckstetter, Markus; Knölker, Hans-Joachim

    2016-06-13

    In addition to the prototypic amyloid-β (Aβ) peptides Aβ1-40 and Aβ1-42 , several Aβ variants differing in their amino and carboxy termini have been described. Synthetic availability of an Aβ variant is often the key to study its role under physiological or pathological conditions. Herein, we report a protocol for the efficient solid-phase peptide synthesis of the N-terminally elongated Aβ-peptides Aβ-3-38 , Aβ-3-40 , and Aβ-3-42 . Biophysical characterization by NMR spectroscopy, CD spectroscopy, an aggregation assay, and electron microscopy revealed that all three peptides were prone to aggregation into amyloid fibrils. Immunoprecipitation, followed by mass spectrometry, indicated that Aβ-3-38 and Aβ-3-40 are generated by transfected cells even in the presence of a tripartite β-site amyloid precursor protein cleaving enzyme 1 (BACE1) inhibitor. The elongated Aβ peptides starting at Val(-3) can be separated from N-terminally-truncated Aβ forms by high-resolution isoelectric-focusing techniques, despite virtually identical isoelectric points. The synthetic Aβ variants and the methods presented here are providing tools to advance our understanding of the potential roles of N-terminally elongated Aβ variants in Alzheimer's disease.

  3. Determination of terpenes in tequila by solid phase microextraction-gas chromatography-mass spectrometry.

    PubMed

    Peña-Alvarez, Araceli; Capella, Santiago; Juárez, Rocío; Labastida, Carmen

    2006-11-17

    Solid phase microextraction and capillary gas chromatography-mass spectrometry were used for the determination of seven terpenes in tequila. The method was selected based on the following parameters: coating selection (PA, PDMS, CW/DVB, and PDMS/DVB), extraction temperature, addition of salt, and extraction time profile. The extraction conditions were: PDMS/DVB fiber, Headspace, 100% NaCl, 25 degrees C extraction temperature, 30 min extraction time and stirring at 1200 rpm. The calibration curves (50-1000 ng/ml) for the terpenes followed linear relationships with correlation coefficients (r) greater than 0.99, except for trans,trans-farnesol (r = 0.98). RSD values were smaller than 10% confirmed that the technique was precise. Samples from 18 different trade brands of "Aged" tequila analyzed with the developed method showed the same terpenes in different concentrations. The analytical procedure used is selective, robust (more than 100 analyses with the same fiber), fast and of low-cost.

  4. Germanium ion implantation to Improve Crystallinity during Solid Phase Epitaxy and the effect of AMU Contamination

    NASA Astrophysics Data System (ADS)

    Lee, K. S.; Yoo, D. H.; Son, G. H.; Lee, C. H.; Noh, J. H.; Han, J. J.; Yu, Y. S.; Hyung, Y. W.; Yang, J. K.; Song, D. G.; Lim, T. J.; Kim, Y. K.; Lee, S. C.; Lee, H. D.; Moon, J. T.

    2006-11-01

    Germanium ion implantation was investigated for crystallinity enhancement during solid phase epitaxial regrowth (SPE) using high current implantation equipment. Electron back-scatter diffraction(EBSD) measurement showed numerical increase of 19 percent of <100> signal, which might be due to pre-amorphization effect on silicon layer deposited by LPCVD process with germanium ion implantation. On the other hand, electrical property such as off-leakage current of NMOS transistor degraded in specific regions of wafers, which implied non-uniform distribution of donor-type impurities into channel area. It was confirmed that arsenic atoms were incorporated into silicon layer during germanium ion implantation. Since the equipment for germanium pre-amorphization implantation(PAI) was using several source gases such as BF3 and AsH3, atomic mass unit(AMU) contamination during PAI of germanium with AMU 74 caused the incorporation of arsenic with AMU 75 which resided in arc-chamber and other parts of the equipment. It was effective to use germanium isotope of AMU 72 to suppress AMU contamination, however it led serious reduction of productivity because of decrease in beam current by 30 percent as known to be difference in isotope abundance. It was effective to use enriched germanium source gas with AMU 72 in order to improve productivity. Spatial distribution of arsenic impurities in wafers was closely related to hardware configuration of ion implantation equipment.

  5. Magnetism-Enhanced Monolith-Based In-Tube Solid Phase Microextraction.

    PubMed

    Mei, Meng; Huang, Xiaojia; Luo, Qing; Yuan, Dongxin

    2016-02-01

    Monolith-based in-tube solid phase microextraction (MB/IT-SPME) has received wide attention because of miniaturization, automation, expected loading capacity, and environmental friendliness. However, the unsatisfactory extraction efficiency becomes the main disadvantage of MB/IT-SPME. To overcome this circumstance, magnetism-enhanced MB/IT-SPME (ME-MB/IT-SPME) was developed in the present work, taking advantage of magnetic microfluidic principles. First, modified Fe3O4 nanoparticles were mixed with polymerization solution and in situ polymerized in the capillary to obtain a magnetic monolith extraction phase. After that, the monolithic capillary column was placed inside a magnetic coil that allowed the exertion of a variable magnetic field. The effects of intensity of magnetic field, adsorption and desorption flow rate, volume of sample, and desorption solvent on the performance of ME-MB/IT-SPME were investigated in detail. The analysis of six steroid hormones in water samples by the combination of ME-MB/IT-SPME with high-performance liquid chromatography with diode array detection was selected as a paradigm for the practical evaluation of ME-MB/IT-SPME. The application of a controlled magnetic field resulted in an obvious increase of extraction efficiencies of the target analytes between 70% and 100%. The present work demonstrated that application of different magnetic forces in adsorption and desorption steps can effectively enhance extraction efficiency of MB/IT-SPME systems. PMID:26742590

  6. Photostability of a C60 fullerene coating as a solid-phase photosensitizer of singlet oxygen

    NASA Astrophysics Data System (ADS)

    Bagrov, I. V.; Belousova, I. M.; Ermakov, A. V.; Kiselev, V. M.; Kislyakov, I. M.; Kris'ko, T. K.; Murav'eva, T. D.

    2008-11-01

    The stability of the optical properties and the generation efficiency of singlet oxygen of a solidphase photosensitizer based on fullerene in an aqueous suspension subjected to prolonged intense irradiation with visible light are studied in comparison with a photosensitizer based on methylene blue in an aqueous solution. Changes in the absorption spectra show that, as a result of 20-min irradiation, the content of fullerene decreases by 2% from its initial value, while that of methylene blue decreases by 19%. In both cases, the dynamics of the decrease in the photosensitizing ability of the photosensitizers in the course of their irradiation correlates with the changes in their spectra, but the magnitude of this decrease in the case of the solid-phase photosensitizer is greater than the magnitude of its spectral changes because of the surface nature of the photosensitization process. The study of the absorption spectra of fullerene coatings shows that their irradiation in water or in air causes the same photodegradation of fullerene. At the same time, studies with the help of the electron spin resonance (ESR) technique reveal differences in the nature of processes undergone by fullerene in water and in air.

  7. Critical micelle concentration values for different surfactants measured with solid-phase microextraction fibers.

    PubMed

    Haftka, Joris J-H; Scherpenisse, Peter; Oetter, Günter; Hodges, Geoff; Eadsforth, Charles V; Kotthoff, Matthias; Hermens, Joop L M

    2016-09-01

    The amphiphilic nature of surfactants drives the formation of micelles at the critical micelle concentration (CMC). Solid-phase microextraction (SPME) fibers were used in the present study to measure CMC values of 12 nonionic, anionic, cationic, and zwitterionic surfactants. The SPME-derived CMC values were compared to values determined using a traditional surface tension method. At the CMC of a surfactant, a break in the relationship between the concentration in SPME fibers and the concentration in water is observed. The CMC values determined with SPME fibers deviated by less than a factor of 3 from values determined with a surface tension method for 7 out of 12 compounds. In addition, the fiber-water sorption isotherms gave information about the sorption mechanism to polyacrylate-coated SPME fibers. A limitation of the SPME method is that CMCs for very hydrophobic cationic surfactants cannot be determined when the cation exchange capacity of the SPME fibers is lower than the CMC value. The advantage of the SPME method over other methods is that CMC values of individual compounds in a mixture can be determined with this method. However, CMC values may be affected by the presence of compounds with other chain lengths in the mixture because of possible mixed micelle formation. Environ Toxicol Chem 2016;35:2173-2181. © 2016 SETAC. PMID:26873883

  8. Solid-phase dispersive extraction method for analysis of benzodiazepine drugs in serum and urine samples.

    PubMed

    Saito, Koichi; Kikuchi, Yuu; Saito, Rieko

    2014-11-01

    A simple yet highly efficient pretreatment method called solid-phase dispersive extraction (SPDE) was developed and used in combination with liquid chromatography/time-of-flight mass spectrometry (LC/TOF-MS) for the analysis of benzodiazepines (BZPs) in serum and urine samples. By using a custom-made centrifugal filter, SPDE could be performed in a closed system, thereby minimizing exposure to infectious microbes or hazardous chemicals. The limit of detection and the limit of quantification of nine BZPs were 1-10 and 5-50ng/mL, respectively. The average recoveries of BZPs from pooled serum samples spiked at 50 and 500ng/mL were 89.6-105.0% (RSD: 2.1-6.8%) and 93.6-110.4% (RSD: 2.1-4.2%), respectively, and those from urine samples were 88.7-105.5% (RSD: 2.9-6.4%) and 91.5-101.1% (RSD: 3.6-5.5%), respectively. SPDE-LC/TOF-MS has potential application in forensic science and emergency medicine. PMID:25126966

  9. Molecularly imprinted polymers-curcuminoids and its application for solid phase extraction

    NASA Astrophysics Data System (ADS)

    Wulandari, Meyliana; Amran, M. B.; Lopez, A. B. Descalzo; Urraca, J. L.; Moreno-Bondi, M. C.

    2014-03-01

    Molecularly Imprinted Polymers (MIPs) for the selective recognition properties of curcumin (CUR), a cancer chemopreventive agent were obtained by a non-covalent imprinting approach with bisdemetoxycurcumin (BDMC) as the template molecule. The double bond of BDMC has been reduced in order not to be involved in polymerization and make the template molecules easy to be eluted. Several functional monomers have been evaluated to maximize the interactions with the template molecule during polymerization. MIPs prepared by bulk of N-(2-aminoethyl) metacrylamid hydrochlorideas functional monomer, ethylene glycol dimethacrylate as crosslinker, 2,2'-azobis (2'4-dimethyl valeronitril) as initiator and acetonitrile as porogen. Non-imprinted polymer (NIP) have been also synthesized for reference purposes. UV-vis spectroscopy has been used to predict the template to functional monomer ratio which indicates the formation of 2:1 complexes between monomer and curcumin and the association constants (K11 = 2529 μM and K12 = 1960.75 μM in acetonitrile). The capacity and imprinting factor have been evaluated as stationary phases in high-pressure liquid chromatography to CUR and BDMC. The binding properties and the homogeneity of the binding sites of the different polymers have been studied by Freundlich isotherm modeling and weight average affinity and number of binding sites. One of the foremost applications of molecular imprinting has been in molecularly imprinted solid phase extraction and it has the ability to separate and preconcentrate between closely related compounds in curcuminoids.

  10. Determination of diphenylether herbicides in water samples by solid-phase microextraction coupled to liquid chromatography.

    PubMed

    Sheu, Hong-Li; Sung, Yu-Hsiang; Melwanki, Mahaveer B; Huang, Shang-Da

    2006-11-01

    Solid-phase microextraction (SPME) coupled to LC for the analysis of five diphenylether herbicides (aclonifen, bifenox, fluoroglycofen-ethyl, oxyfluorfen, and lactofen) is described. Various parameters of extraction of analytes onto the fiber (such as type of fiber, extraction time and temperature, pH, impact of salt and organic solute) and desorption from the fiber in the desorption chamber prior to separation (such as type and composition of desorption solvent, desorption mode, soaking time, and flush-out time) were studied and optimized. Four commercially available SPME fibers were studied. PDMS/divinylbenzene (PDMS/DVB, 60 microm) and carbowax/ templated resin (CW/TPR, 50 microm) fibers were selected due to better extraction efficiencies. Repeatability (RSD, < 7%), correlation coefficient (> 0.994), and detection limit (0.33-1.74 and 0.22-1.94 ng/mL, respectively, for PDMS/DVB and CW/TPR) were investigated. Relative recovery (81-104% for PDMS/DVB and 83-100% for CW/TPR fiber) values have also been calculated. The developed method was successfully applied to the analysis of river water and water collected from a vegetable garden.

  11. Development of a sensitive solid-phase radioimmunoassay for melanin-concentrating hormone

    SciTech Connect

    Eberle, A.N.; Baumann, J.B.; Girard, J. ); Baker, B.I.; Kishida, M. )

    1989-01-01

    A two-step solid-phase radioimmunoassay for melanin-concentrating hormone (MCH) was developed for direct determination of the hormone in plasma samples. To this end, synthetic MCH was coupled to bovine thyreoglobulin and the complex was injected into rabbits. Specific antisera of high titer were obtained which did not crossreact with other hormones. The IgGs were chemically linked to immunobeads, an acrylamide/acrylic acid polymer matrix. In the first step, plasma MCH was immunoextracted by incubation of diluted plasma samples with anti-MCH immunobeads. In the second step, the washed polymer was incubated with radioiodinated MCH tracer for titration of non-occupied sites. This procedure made it possible to determine as little as 4 pg MCH per ml of plasma. Application of the radioimmunoassay to plasma levels of black or white background-adapted trout showed a marked difference in circulating MCH: while trout on a black background contained a mean value of 29 {plus minus} 5.6 pg/ml, animals on a white background had 106 {plus minus} 19 pg/ml.

  12. Volatile composition of peppermint (Mentha piperita L.) commercial teas through solid phase extraction.

    PubMed

    Riachi, L G; Abi-Zaid, I E; Moreira, R F A; De Maria, C A B

    2012-12-01

    Volatiles from aqueous extract of peppermint commercial sachets were investigated through gas chromatography/flame ionization detection (GC/FID) and GC/mass spectrometry (MS). Samples were prepared under similar conditions as in homemade tea. Volatiles were isolated using solid phase extraction method (SPE) with Porapak Q trap followed by desorption with acetone. Estimated mean values for short and medium chain carboxylic acids (C2-C12) and ketones lay in the range of 50-64 microg kg(-1) whilst aliphatic alcohols and acyclic hydrocarbons had values lower than 6 microg kg(-1). The major volatiles were terpenes (275-382 microg kg(-1)) that reached 89 % of the total composition. A total of 16 compounds, among them dodecane, acetoin, acetol, citral, geraniol and octanoic acid have been described by the first time in peppermint tea. These findings could be attributed to the different analytical approach employed, mainly to the use of different extraction/pre-concentration techniques. Given the apparently lower proportion of terpenes in the aqueous extract it may be that the chemical properties of the peppermint essential oil are not entirely reproduced with homemade tea.

  13. Ionic liquid coated copper wires and tubes for fiber-in-tube solid-phase microextraction.

    PubMed

    Sun, Min; Feng, Juanjuan; Bu, Yanan; Luo, Chuannan

    2016-08-01

    A fiber-in-tube solid-phase microextraction (SPME) device was developed by filling eleven copper wires into a copper tube, and all of those were functionalized with ionic liquids. Its morphology and surface properties were characterized by scanning electron microscopy. It was connected into high performance liquid chromatography (HPLC) equipment by replacing the sample loop of six-port injection valve, building the online SPME-HPLC system. In the optimization of extraction conditions, sampling rate, sample volume, pH of sample and desorption time were investigated with five estrogens as model analytes. Under the optimum conditions, an online SPME-HPLC analysis method was achieved, showing enrichment efficiency from 611 to 1661 and a good linearity of 0.06-60μgL(-1) with low detection limits of 0.02-0.05μgL(-1). It was applied to detect estrogens analytes in two water samples, with recoveries in the range of 85-114%. Relative standard deviation (n=3) of extraction repeatability is in the range of 1.9-3.0%. Relative standard deviation of extraction tubes (n=3) is in the range of 12-19%. The extraction mechanism is probably related to hydrophobic, π-π and dipole-dipole interactions between ionic liquids coating and estrogens analytes.

  14. A convenient solid-phase method for synthesis of 3'-conjugates of oligonucleotides.

    PubMed

    Stetsenko, D A; Gait, M J

    2001-01-01

    We present a new procedure for the preparation of 3'-conjugates of oligonucleotides through solid-phase synthesis. A suitable universal solid support was readily prepared using a series of peptide-like coupling reactions to incorporate first a spacer and then an L-homoserine branching unit. The N-alpha-position of the homoserine carries an Fmoc protecting group that is removed by treatment with piperidine to liberate an amino group suitable for attachment of the conjugate (e.g., small organic molecule, fluorescent group, cholesterol, biotin, amino acid, etc.) or for assembly of a short peptide. The side-chain hydroxyl group of the homoserine carries a trityl protecting group. After TFA deprotection, the hydroxyl group acts as the site for oligonucleotide assembly. An additional spacer, such as aminohexanoyl, may be incorporated easily between the conjugate molecule and the oligonucleotide. A number of examples of synthesis of 3'-conjugates of oligonucleotides and their analogues are described that involve standard automated oligonucleotide assembly and use of commercially available materials. The linkage between oligonucleotide and 3'-conjugate is chirally pure and is stable to conventional ammonia treatment used for oligonucleotide deprotection and release from the solid support. The homoserine-functionalized solid support system represents a simple and universal route to 3'-conjugates of oligonucleotides and their derivatives.

  15. CMOS-compatible method for doping of buried vertical polysilicon structures by solid phase diffusion

    NASA Astrophysics Data System (ADS)

    Turkulets, Yury; Silber, Amir; Ripp, Alexander; Sokolovsky, Mark; Shalish, Ilan

    2016-03-01

    Polysilicon receives attention nowadays as a means to incorporate 3D-structured photonic devices into silicon processes. However, doping of buried layers of a typical 3D structure has been a challenge. We present a method for doping of buried polysilicon layers by solid phase diffusion. Using an underlying silicon oxide layer as a dopant source facilitates diffusion of dopants into the bottom side of the polysilicon layer. The polysilicon is grown on top of the oxide layer, after the latter has been doped by ion implantation. Post-growth heat treatment drives in the dopant from the oxide into the polysilicon. To model the process, we studied the diffusion of the two most common silicon dopants, boron (B) and phosphorus (P), using secondary ion mass spectroscopy profiles. Our results show that shallow concentration profiles can be achieved in a buried polysilicon layer using the proposed technique. We present a quantitative 3D model for the diffusion of B and P in polysilicon, which turns the proposed method into an engineerable technique.

  16. Thermally stable coexistence of liquid and solid phases in gallium nanoparticles

    NASA Astrophysics Data System (ADS)

    Losurdo, Maria; Suvorova, Alexandra; Rubanov, Sergey; Hingerl, Kurt; Brown, April S.

    2016-09-01

    Gallium (Ga), a group III metal, is of fundamental interest due to its polymorphism and unusual phase transition behaviours. New solid phases have been observed when Ga is confined at the nanoscale. Herein, we demonstrate the stable coexistence, from 180 K to 800 K, of the unexpected solid γ-phase core and a liquid shell in substrate-supported Ga nanoparticles. We show that the support plays a fundamental role in determining Ga nanoparticle phases, with the driving forces for the nucleation of the γ-phase being the Laplace pressure in the nanoparticles and the epitaxial relationship of this phase to the substrate. We exploit the change in the amplitude of the evolving surface plasmon resonance of Ga nanoparticle ensembles during synthesis to reveal in real time the solid core formation in the liquid Ga nanoparticle. Finally, we provide a general framework for understanding how nanoscale confinement, interfacial and surface energies, and crystalline relationships to the substrate enable and stabilize the coexistence of unexpected phases.

  17. Preparation and characterization of porous carbon material-coated solid-phase microextraction metal fibers.

    PubMed

    Zhu, Fang; Guo, Jiaming; Zeng, Feng; Fu, Ruowen; Wu, Dingcai; Luan, Tiangang; Tong, Yexiang; Lu, Tongbu; Ouyang, Gangfeng

    2010-12-10

    Two kinds of porous carbon materials, including carbon aerogels (CAs), wormhole-like mesoporous carbons (WMCs), were synthesized and used as the coatings of solid-phase microextraction (SPME) fibers. By using stainless steel wire as the supporting core, six types of fibers were prepared with sol-gel method, direct coating method and direct coating plus sol-gel method. Headspace SPME experiments indicated that the extraction efficiencies of the CA fibers are better than those of the WMC fibers, although the surface area of WMCs is much higher than that of CAs. The sol-gel-CA fiber (CA-A) exhibited excellent extraction properties for non-polar compounds (BTEX, benzene, toluene, ethylbenzene, o-xylene), while direct-coated CA fiber (CA-B) presented the best performance in extracting polar compounds (phenols). The two CA fibers showed wide linear ranges, low detection limits (0.008-0.047μgL(-1) for BTEX, 0.15-5.7μgL(-1) for phenols) and good repeatabilities (RSDs less than 4.6% for BTEX, and less than 9.5% for phenols) and satisfying reproducibilities between fibers (RSDs less than 5.2% for BTEX, and less than 9.9% for phenols). These fibers were successfully used for the analysis of water samples from the Pearl River, which demonstrated the applicability of the home-made CA fibers. PMID:21074162

  18. Sampling gaseous compounds from essential oils evaporation by solid phase microextraction devices

    NASA Astrophysics Data System (ADS)

    Cheng, Wen-Hsi; Lai, Chin-Hsing

    2014-12-01

    Needle trap samplers (NTS) are packed with 80-100 mesh divinylbenzene (DVB) particles to extract indoor volatile organic compounds (VOCs). This study compared extraction efficiency between an NTS and a commercially available 100 μm polydimethylsiloxane-solid phase microextration (PDMS-SPME) fiber sampler used to sample gaseous products in heated tea tree essential oil in different evaporation modes, which were evaporated respectively by free convection inside a glass evaporation dish at 27 °C, by evaporation diffuser at 60 °C, and by thermal ceramic wicks at 100 °C. The experimental results indicated that the NTS performed better than the SPME fiber samplers and that the NTS primarily adsorbed 5.7 ng ethylbenzene, 5.8 ng m/p-xylenes, 11.1 ng 1,2,3-trimethylbenzene, 12.4 ng 1,2,4-trimethylbenzene and 9.99 ng 1,4-diethylbenzene when thermal ceramic wicks were used to evaporate the tea tree essential oil during a 1-hr evaporation period. The experiment also indicated that the temperature used to heat the essential oils should be as low as possible to minimize irritant VOC by-products. If the evaporation temperature does not exceed 100 °C, the concentrations of main by-products trimethylbenzene and diethylbenzene are much lower than the threshold limit values recommended by the National Institute for Occupational Safety and Health (NIOSH).

  19. Enumerating Microorganism Surrogates for Groundwater Transport Studies Using Solid-Phase Cytometry.

    PubMed

    Stevenson, Margaret E; Blaschke, A Paul; Schauer, Sonja; Zessner, Matthias; Sommer, Regina; Farnleitner, Andreas H; Kirschner, Alexander K T

    2014-01-01

    Investigations on the pollution of groundwater with pathogenic microorganisms, e.g. tracer studies for groundwater transport, are constrained by their potential health risk. Thus, microspheres are often used in groundwater transport studies as non-hazardous surrogates for pathogenic microorganisms. Even though pathogenic microorganisms occur at low concentrations in groundwater, current detection methods of microspheres (spectrofluorimetry, flow cytometry and epifluorescence microscopy) have rather high detection limits and are unable to detect rare events. Solid-phase cytometry (SPC) offers the unique capability of reliably quantifying extremely low concentrations of fluorescently labelled microorganisms or microspheres in natural waters, including groundwater. Until now, microspheres have been used in combination with SPC only for instrument calibration purposes and not for environmental applications. In this study, we explored the limits of the SPC methodology for its applicability to groundwater transport studies. The SPC approach proved to be a highly sensitive and reliable enumeration system for microorganism surrogates down to a minimum size of 0.5 μm, in up to 500 ml of groundwater, and 0.75 μm, in up to 1 ml of turbid surface water. Hence, SPC is proposed to be a useful method for enumerating microspheres for groundwater transport studies in the laboratory, as well as in the field when non-toxic, natural products are used. PMID:24578583

  20. Understanding the solid phase chemical fractionation of uranium in soil and effect of ageing.

    PubMed

    Rout, Sabyasachi; Kumar, Ajay; Ravi, P M; Tripathi, R M

    2016-11-01

    The aim of the present work is to understand the solid phase chemical fractionation of Uranium (U) in soil and the mechanism involved. This study integrated batch experiments of U(VI) adsorption to soil, study of U in different soil fractions, ageing impact on fractionation of U and spectroscopic investigation of adsorbed U(VI) using X-ray Photoelectron Spectroscopy (XPS). For the study three soils, pedogenically different (S1: Igneous, S2: Sedimentary and S3: Metamorphic) were amended with U(VI) and chemical fractionation of U was studied by sequential extraction after an interval of one month and 12 months. It was found that there occurs a significant rearrangement of U in different fractions with ageing and no correlation was observed between the U content in different fractions and the adsorbents of respective fractions such as soil organic matter (SOM), Fe/Mn oxides (hydroxides) carbonates, soil cation exchange capacity (CEC). XPS study revealed that surface enrichment of U mainly governed by the carbonate minerals and SOM, whereas bulk concentration was controlled by the oxides (hydroxides) of Si and Al. Occlusion of U-Fe-oxides (hydroxides) on silica was identified as an important mechanism for bulk enrichment (Increase in residual fraction) and depletion of U concentration in reducible fraction.

  1. Direct solid-phase synthesis of octreotide conjugates: precursors for use as tumor-targeted radiopharmaceuticals.

    PubMed

    Hsieh, H P; Wu, Y T; Chen, S T; Wang, K T

    1999-09-01

    Somatostatin analogues, such as octreotide, are useful for the visualization and treatment of tumors. Unfortunately, these compounds were produced synthetically using complex and inefficient procedures. Here, we describe a novel approach for the synthesis of octreotide and its analogues using p-carboxybenzaldehyde to anchor Fmoc-threoninol to solid phase resins. The reaction of the two hydroxyl groups of Fmoc-threoninol with p-carboxybenzaldehyde was catalyzed with p-toluenesulphonic acid in chloroform using a Dean-Stark apparatus to form Fmoc-threoninol p-carboxybenzacetal in 91% yield. The Fmoc-threoninol p-carboxybenzacetal acted as an Fmoc-amino acid derivative and the carboxyl group of Fmoc-threoninol p-carboxybenzacetal was coupled to an amine-resin via a DCC coupling reaction. The synthesis of protected octreotide and its conjugates were carried out in their entirety using a conventional Fmoc protocol and an autosynthesizer. The acetal was stable during the stepwise elongation of each Fmoc-amino acid as shown by the averaged coupling yield (> 95%). Octreotide (74 to 78% yield) and five conjugated derivatives were synthesized with high yields using this procedure, including three radiotherapy octreotides (62 to 75% yield) and two cellular markers (72 to 76% yield). This novel approach provides a strategy for the rapid and efficient large-scale synthesis of octreotide and its analogues for radiopharmaceutical and tagged conjugates.

  2. Solid-phase synthesis of porcine cholecystokinin-33 in a new resin via FMOC-strategy.

    PubMed

    Penke, B; Nyerges, L

    1991-01-01

    Porcine cholecystokinin-33 has been synthesized on solid phase and characterized both chemically and biologically. In order to develop a successful synthetic strategy, a new anchor molecule (4-succinylamido-2,2',4'-trimethoxybenzhydrylamine) was designed and coupled to aminomethyl-polystyrene. The resulting 4-succinylamido-2,2',4'-trimethoxybenzhydrylamine resin was successfully used for the synthesis of cholecystokinin-33 using N-fluorenylmethoxycarbonyl amino acid symmetric anhydrides. Tyrosine-O-sulfate has been synthesized by direct sulfation of tyrosine with chlorosulfonic acid and incorporated into the peptide sequence by coupling as N-fluorenylmethoxy-O-sulfatotyrosine-pentafluorophenyl ester. Side chains of the trifunctional amino acids were protected mostly by t-butyl-type protecting groups. The guanidino function of arginine was protected by the 2,2,5,7,8-pentamethylchromane-6-sulfonyl group. After completion of the synthesis, the peptide was cleaved off the support with 50% trifluoroacetic acid (15 min); this treatment cleaved the side-chain protecting groups simultaneously. Preparative high-performance liquid chromatography resulted in pure cholecystokinin-33 of full biological activity. The structure of the peptide was proved by amino acid analysis, IR and UR spectroscopy, fast atomic bombardment mass spectroscopy and comparative high-performance liquid chromatography of the synthetic and native cholecystokinin-33.

  3. Rotating Rod Renewable Microcolumns for Automated, Solid-Phase DNA Hybridization

    SciTech Connect

    Bruckner-Lea, Cynthia J. ); Stottlemyre, Mark R.; Holman, David A.; Grate, Jay W. ); Brockman, Fred J. ); Chandler, Darrell P.

    1999-12-01

    The development of a new temperature-controlled renewable microcolumn flow cell for solid-phase nucleic acid analysis in a sequential injection system is described. The flow cell includes a stepper motor-driven rotating rod with the working end cut to a 45 degree angle. In one position, the end of the rod prevents passage of microbeads while allowing fluid flow; rotation of the rod by 180 degrees release the beads. This system was used to rapidly test many hybridization and elution protocols to examine the temperature and solution conditions required for sequence specific nucleic acid hybridization. Target nucleic acids labeled with a near-infrared fluorescent dye were detected immediately post-column using a flow-through fluorescence detector, with a detection limit of 40 pM dye concentration at a flow rate of 5 mu l/s. Temperature control of the column and the presence of Triton X-100 surfactant were critical for specific hybridization. Perfusion of the column with complementary oligonucleotide (200 mu l, 10nM) resulted in hybridization with 8% of the DNA binding sites on the microbeads with a solution residence time of less than a second and a total sample perfusion time of 40 seconds. The use of the renewable column system for detection of an unlabeled PCR product in a sandwich assay was also demonstrated.

  4. Epitaxially grown polycrystalline silicon thin-film solar cells on solid-phase crystallised seed layers

    NASA Astrophysics Data System (ADS)

    Li, Wei; Varlamov, Sergey; Xue, Chaowei

    2014-09-01

    This paper presents the fabrication of poly-Si thin film solar cells on glass substrates using seed layer approach. The solid-phase crystallised P-doped seed layer is not only used as the crystalline template for the epitaxial growth but also as the emitter for the solar cell structure. This paper investigates two important factors, surface cleaning and intragrain defects elimination for the seed layer, which can greatly influence the epitaxial grown solar cell performance. Shorter incubation and crystallisation time is observed using a simplified RCA cleaning than the other two wet chemical cleaning methods, indicating a cleaner seed layer surface is achieved. Cross sectional transmission microscope images confirm a crystallographic transferal of information from the simplified RCA cleaned seed layer into the epi-layer. RTA for the SPC seed layer can effectively eliminate the intragrain defects in the seed layer and improve structural quality of both of the seed layer and the epi-layer. Consequently, epitaxial grown poly-Si solar cell on the RTA treated seed layer shows better solar cell efficiency, Voc and Jsc than the one on the seed layer without RTA treatment.

  5. Conductive polymeric ionic liquids for electroanalysis and solid-phase microextraction.

    PubMed

    Young, Joshua A; Zhang, Cheng; Devasurendra, Amila M; Tillekeratne, L M Viranga; Anderson, Jared L; Kirchhoff, Jon R

    2016-03-01

    Three novel electropolymerizable thiophene-based ionic liquids (ILs) were synthesized and characterized as potential candidates for developing selective extraction media for chemical analysis. Electropolymerization of the bis[(trifluoromethyl)sulfonyl]imide ([NTf2](-)) analogs successfully produced uniform polymeric thin-films on macro- and microelectrode substrates from both vinyl and methylimidazolium IL monomer derivatives. The resultant conducting polymer IL (CPIL) films were characterized by electrochemical methods and found to exhibit attractive behavior towards anionic species while simultaneously providing an exclusion barrier toward cationic species. Thermogravimetric analysis of the thiophene-based IL monomers established a high thermal stability, particularly for the methylimidazolium IL, which was stable until temperatures above 350 °C. Subsequently, the methylimidazolium IL was polymerized on 125 μm platinum wires and utilized for the first time as a sorbent coating for headspace solid-phase microextraction (HS-SPME). The sorbent coating was easily prepared in a reproducible manner, provided high thermal stability, and allowed for the gas chromatographic analysis of polar analytes. The normalized response of the poly[thioph-C6MIm][NTf2]-based sorbent coating exhibited higher extraction efficiency compared to an 85 μm polyacrylate fiber and excellent fiber-to-fiber reproducibility. Therefore, the electropolymerizable thiophene-based ILs were found to be viable new materials for the preparation of sorbent coatings for HS-SPME.

  6. Robust aptamer sol-gel solid phase microextraction of very polar adenosine from human plasma.

    PubMed

    Mu, Li; Hu, Xiangang; Wen, Jianping; Zhou, Qixing

    2013-03-01

    Conventional solid phase microextraction (SPME) has a limited capacity to extract very polar analytes, such as adenosine. To solve this problem, aptamer conjugating sol-gel methodology was coupled with an SPME fiber. According to the authors' knowledge, this is the first reported use of aptamer SPME. The fiber of aptamer sol-gel SPME with a mesoporous structure has high porosity, large surface area, and small water contact angle. Rather than employing direct entrapment, covalent immobilization was the dominant method of aptamer loading in sol-gel. Aptamer sol-gel fiber captured a specified analyte from among the analog molecules, thereby, exhibiting an excellent selective property. Compared with commercial SPME fibers, this aptamer fiber was suitable for extracting adenosine, presenting an extraction efficiency higher than 20-fold. The values of repeatability and reproducibility expressed by relative standard deviation were low (9.4%). Interestingly, the sol-gel network enhanced the resistance of aptamer SPME to both nuclease and nonspecific proteins. Furthermore, the aptamer sol-gel fiber was applied in human plasma with LOQ 1.5 μg/L, which is an acceptable level. This fiber also demonstrates durability and regeneration over 20-cycles without significant loss of efficiency. Given the various targets (from metal ions to biomacromolecules and cells) of aptamers, this methodology will extend the multi-domain applications of SPME.

  7. Solid-phase synthesis of libraries of ethynylated aminosteroid derivatives as potential antileukemic agents.

    PubMed

    Talbot, Amélie; Maltais, René; Kenmogne, Lucie Carolle; Roy, Jenny; Poirier, Donald

    2016-03-01

    Steroids possessing an ethynyl group at position 17α (tertiary alcohols) are well known to be more stable than their non-ethynyl analogs (secondary alcohols). To facilitate the development of new drugs with better metabolic stability, we developed a new diethylsilyl acetylenic linker allowing us to rapidly synthesize libraries of ethynylated steroid derivatives using a solid-phase strategy. To illustrate its usefulness, this linker was used to expand the molecular diversity of a lead compound having a hydroxy acetylenic pattern and to potentially find new compounds with interesting cytotoxic activity against leukemia cell lines. Herein, we report the chemical synthesis and the characterization of three libraries of ethynylated aminosteroid derivatives using the diethylacetylenic linker. We discuss their antiproliferative activities obtained in 2 leukemia cell lines (HL-60 and Jurkat), which results provided new structure-activity relationships. We also identified a new promising aminosteroid derivative with an azetidine moiety (compound B1) inhibiting 60% and 75% of HL-60 and Jurkat cell proliferation, respectively, at 1 μM. More generally, these results validate the use of a diethylsilyl acetylenic linker for researchers interested in generating libraries of alcohol derivatives with better stability and drug profile. PMID:26742630

  8. Spectrofluorimetric determination of glutathione in human plasma by solid-phase extraction using graphene as adsorbent

    NASA Astrophysics Data System (ADS)

    Huang, Ke-Jing; Jing, Qiang-Shan; Wei, Cai-Yun; Wu, Ying-Ying

    2011-09-01

    An efficient solid phase extraction-spectrofluorimetric method using graphene as adsorbent was developed to sensitively determine glutathione (GSH) in biological samples. Fluorescent probe N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-yl)methyl)iodoacetamide (BODIPY Fl-C 1-IA) was applied for the derivatization of GSH. The procedure was based on BODIPY Fl-C 1-IA selective reaction with GSH to form highly fluorescent product BODIPY Fl-C 1-IA-GSH, its extraction to the graphene-packed SPE cartridge and spectrofluorimetric determination. Some factors affecting the extraction efficiency, such as the type of the eluent and its volume, sample pH, extraction time, and sample volume were optimized. Comparative studies were also performed between graphene and other adsorbents including C 18 silica, graphitic carbon, and multi-walled carbon nanotubes for the extraction of analyte. The calibration graph using the pretreatment system for GSH was linear over the range of 0.5-200 nM. The limit of detection was 0.01 nM (signal-to-noise ratio = 3). Relative standard deviation for six replicate determinations of GSH at 80 nM concentration level was lower than 5.0%. The developed method was applied to the determination of GSH in human plasma with recoveries of 92-108%. This work revealed the great potentials of graphene as an excellent sorbent material in the analysis of biological samples.

  9. Spectrofluorimetric determination of glutathione in human plasma by solid-phase extraction using graphene as adsorbent.

    PubMed

    Huang, Ke-Jing; Jing, Qiang-Shan; Wei, Cai-Yun; Wu, Ying-Ying

    2011-09-01

    An efficient solid phase extraction-spectrofluorimetric method using graphene as adsorbent was developed to sensitively determine glutathione (GSH) in biological samples. Fluorescent probe N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-yl)methyl)iodoacetamide (BODIPY Fl-C1-IA) was applied for the derivatization of GSH. The procedure was based on BODIPY Fl-C1-IA selective reaction with GSH to form highly fluorescent product BODIPY Fl-C1-IA-GSH, its extraction to the graphene-packed SPE cartridge and spectrofluorimetric determination. Some factors affecting the extraction efficiency, such as the type of the eluent and its volume, sample pH, extraction time, and sample volume were optimized. Comparative studies were also performed between graphene and other adsorbents including C18 silica, graphitic carbon, and multi-walled carbon nanotubes for the extraction of analyte. The calibration graph using the pretreatment system for GSH was linear over the range of 0.5-200 nM. The limit of detection was 0.01 nM (signal-to-noise ratio=3). Relative standard deviation for six replicate determinations of GSH at 80 nM concentration level was lower than 5.0%. The developed method was applied to the determination of GSH in human plasma with recoveries of 92-108%. This work revealed the great potentials of graphene as an excellent sorbent material in the analysis of biological samples.

  10. Antimony speciation by inductively coupled plasma mass spectrometry using solid phase extraction cartridges.

    PubMed

    Yu, Chunhai; Cai, Qiantao; Guo, Zhong-Xian; Yang, Zhaoguang; Khoo, Soo Beng

    2002-10-01

    A novel and simple method for inorganic antimony speciation is described based on selective solid phase extraction (SPE) separation of antimony(III) and highly sensitive inductively coupled plasma mass spectrometric (ICP-MS) detection of total antimony and antimony(V) in the aqueous phase of the sample. Non-polar SPE cartridges, such as the Isolute silica-based octyl (C8) sorbent-containing cartridge, selectively retained the Sb(III) complex with ammonium pyrrolidine dithiocarbamate (APDC), while the uncomplexed Sb(V) remained as a free species in the solution and passed through the cartridge. The Sb(III) concentration was calculated as the difference between total antimony and Sb(V) concentrations. The detection limit was 1 ng L(-1) antimony. Factors affecting the separation and detection of antimony species were investigated. Acidification of samples led to partial or complete retention of Sb(V) on C8 cartridge. Foreign ions tending to complex with Sb(III) or APDC did not interfere with the retention behavior of the Sb(III)-APDC complex. This method has been successfully applied to antimony speciation of various types of water samples.

  11. Hierarchical Graphene coating for highly sensitive solid phase microextraction of organochlorine pesticides.

    PubMed

    Wang, Fuxin; Liu, Shuqin; Yang, Hao; Zheng, Juan; Qiu, Junlang; Xu, Jianqiao; Tong, Yexiang; Zhu, Fang; Ouyang, Gangfeng

    2016-11-01

    Graphene, a novel class of carbon nanostructures, has received great attention as sorbents due to its fascinating structures, ultrahigh specific surface area, and good extraction ability. In this paper, a new type of hierarchical graphene was synthesized through employing a mild and environment-friendly method. Such 3D interconnected graphene own a high specific surface area up to 524m(2)g(-1), which is about 2.5 fold larger than the graphene, since the synthetic material has interlayer pores between nanosheets and in-plane pores. Then a superior solid-phase microextraction fiber was fabricated by sequentially coating the stainless steel fiber with silicone sealant film and hierarchical graphene powder. Since the novel hierarchical graphene possessed large surface area and good adsorption property, the as-prepared fiber exhibited good extraction properties of the organochlorine pesticides (OCPs). As for the analytical performance, the as-prepared fiber achieved low detection limits (0.08-0.80ngL(-1)) and wide linearity (10-30,000ngL(-1)) under the optimal conditions. The repeatability (n=5) for single fiber were between 5.1% and 11%, while the reproducibility (n=3) of fiber-to-fiber were range from 6.2% to14%. Moreover, the fiber was successfully applied to the analysis of OCPs in the Pearl River water.

  12. Preparation and characterization of porous carbon material-coated solid-phase microextraction metal fibers.

    PubMed

    Zhu, Fang; Guo, Jiaming; Zeng, Feng; Fu, Ruowen; Wu, Dingcai; Luan, Tiangang; Tong, Yexiang; Lu, Tongbu; Ouyang, Gangfeng

    2010-12-10

    Two kinds of porous carbon materials, including carbon aerogels (CAs), wormhole-like mesoporous carbons (WMCs), were synthesized and used as the coatings of solid-phase microextraction (SPME) fibers. By using stainless steel wire as the supporting core, six types of fibers were prepared with sol-gel method, direct coating method and direct coating plus sol-gel method. Headspace SPME experiments indicated that the extraction efficiencies of the CA fibers are better than those of the WMC fibers, although the surface area of WMCs is much higher than that of CAs. The sol-gel-CA fiber (CA-A) exhibited excellent extraction properties for non-polar compounds (BTEX, benzene, toluene, ethylbenzene, o-xylene), while direct-coated CA fiber (CA-B) presented the best performance in extracting polar compounds (phenols). The two CA fibers showed wide linear ranges, low detection limits (0.008-0.047μgL(-1) for BTEX, 0.15-5.7μgL(-1) for phenols) and good repeatabilities (RSDs less than 4.6% for BTEX, and less than 9.5% for phenols) and satisfying reproducibilities between fibers (RSDs less than 5.2% for BTEX, and less than 9.9% for phenols). These fibers were successfully used for the analysis of water samples from the Pearl River, which demonstrated the applicability of the home-made CA fibers.

  13. Magnetism-Enhanced Monolith-Based In-Tube Solid Phase Microextraction.

    PubMed

    Mei, Meng; Huang, Xiaojia; Luo, Qing; Yuan, Dongxin

    2016-02-01

    Monolith-based in-tube solid phase microextraction (MB/IT-SPME) has received wide attention because of miniaturization, automation, expected loading capacity, and environmental friendliness. However, the unsatisfactory extraction efficiency becomes the main disadvantage of MB/IT-SPME. To overcome this circumstance, magnetism-enhanced MB/IT-SPME (ME-MB/IT-SPME) was developed in the present work, taking advantage of magnetic microfluidic principles. First, modified Fe3O4 nanoparticles were mixed with polymerization solution and in situ polymerized in the capillary to obtain a magnetic monolith extraction phase. After that, the monolithic capillary column was placed inside a magnetic coil that allowed the exertion of a variable magnetic field. The effects of intensity of magnetic field, adsorption and desorption flow rate, volume of sample, and desorption solvent on the performance of ME-MB/IT-SPME were investigated in detail. The analysis of six steroid hormones in water samples by the combination of ME-MB/IT-SPME with high-performance liquid chromatography with diode array detection was selected as a paradigm for the practical evaluation of ME-MB/IT-SPME. The application of a controlled magnetic field resulted in an obvious increase of extraction efficiencies of the target analytes between 70% and 100%. The present work demonstrated that application of different magnetic forces in adsorption and desorption steps can effectively enhance extraction efficiency of MB/IT-SPME systems.

  14. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP.

    PubMed

    Czulak, J; Guerreiro, A; Metran, K; Canfarotta, F; Goddard, A; Cowan, R H; Trochimczuk, A W; Piletsky, S

    2016-06-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates. PMID:27174700

  15. Analysis of trace dicyandiamide in stream water using solid phase extraction and liquid chromatography UV spectrometry.

    PubMed

    Qiu, Huidong; Sun, Dongdi; Gunatilake, Sameera R; She, Jinyan; Mlsna, Todd E

    2015-09-01

    An improved method for trace level quantification of dicyandiamide in stream water has been developed. This method includes sample pretreatment using solid phase extraction. The extraction procedure (including loading, washing, and eluting) used a flow rate of 1.0mL/min, and dicyandiamide was eluted with 20mL of a methanol/acetonitrile mixture (V/V=2:3), followed by pre-concentration using nitrogen evaporation and analysis with high performance liquid chromatography-ultraviolet spectroscopy (HPLC-UV). Sample extraction was carried out using a Waters Sep-Pak AC-2 Cartridge (with activated carbon). Separation was achieved on a ZIC(®)-Hydrophilic Interaction Liquid Chromatography (ZIC-HILIC) (50mm×2.1mm, 3.5μm) chromatography column and quantification was accomplished based on UV absorbance. A reliable linear relationship was obtained for the calibration curve using standard solutions (R(2)>0.999). Recoveries for dicyandiamide ranged from 84.6% to 96.8%, and the relative standard deviations (RSDs, n=3) were below 6.1% with a detection limit of 5.0ng/mL for stream water samples. PMID:26354690

  16. Application of solid-phase extraction to agar-supported fermentation.

    PubMed

    Le Goff, Géraldine; Adelin, Emilie; Cortial, Sylvie; Servy, Claudine; Ouazzani, Jamal

    2013-09-01

    Agar-supported fermentation (Ag-SF), a variant of solid-state fermentation, has recently been improved by the development of a dedicated 2 m(2) scale pilot facility, Platotex. We investigated the application of solid-phase extraction (SPE) to Ag-SF in order to increase yields and minimize the contamination of the extracts with agar constituents. The selection of the appropriate resin was conducted on liquid-state fermentation and Diaion HP-20 exhibited the highest recovery yield and selectivity for the metabolites of the model fungal strains Phomopsis sp. and Fusarium sp. SPE applied to Ag-SF resulted in a particular compartmentalization of the culture. The mycelium that requires oxygen to grow migrates to the top layer and formed a thick biofilm. The resin beads intercalate between the agar surface and the mycelium layer, and trap directly the compounds secreted by the mycelium through a "solid-solid extraction" (SSE) process. The resin/mycelium layer is easily recovered by scraping the surface and the target metabolites extracted by methanol. Ag-SF associated to SSE represents an ideal compromise for the production of bioactive secondary metabolites with limited economic and environmental impact.

  17. Flexibility of solid-phase microextraction for passive sampling of atmospheric pesticides.

    PubMed

    Wang, Junxia; Tuduri, Ludovic; Millet, Maurice; Briand, Olivier; Montury, Michel

    2009-04-10

    For low volatile pesticides, the applications of solid-phase microextraction (SPME) as an air sampler were reported with sampling time chosen in the linear stage of the sorption kinetics because of long equilibrium time. In these pre-equilibrium conditions, sampling rates (SRs) expressed as the volume of air sampled by the SPME sampler per unit of time, were used to estimate analytes concentrations in air. In the present study, to achieve good extraction performance and accurate calibration, the sorption kinetics of several pesticides with SPME were investigated in detail, with a focus on parameters influencing SRs. Linear air velocity was found to be the main parameter affecting SRs. For exposed fibers, with air velocities below 20-25 cms(-1), SRs increased with increasing air velocity. When linear air velocity was equal to or greater than 25-30 cms(-1), it had little effect on SRs. To improve the flexibility of SPME, different configurations of SPME were compared, i.e. different lengths of fibers exposed, retracted fibers, exposed fibers with grids. SRs were linearly proportional to exposed lengths of fibers. Using grids, lower SRs and wider calibration time range were achieved. SRs for retracted fibers were the lowest among the different experimented configurations. The accuracy of calibration was improved and more flexibility of SPME was provided.

  18. Solid-phase microextraction gas chromatography-mass spectrometry determination of fragrance allergens in baby bathwater.

    PubMed

    Lamas, J Pablo; Sanchez-Prado, Lucia; Garcia-Jares, Carmen; Llompart, Maria

    2009-07-01

    A method based on solid-phase microextraction (SPME) and gas chromatography-mass spectrometry (GC-MS) has been optimized for the determination of fragrance allergens in water samples. This is the first study devoted to this family of cosmetic ingredients performed by SPME. The influence of parameters such as fibre coating, extraction and desorption temperatures, salting-out effect and sampling mode on the extraction efficiency has been studied by means of a mixed-level factorial design, which allowed the study of the main effects as well as two-factor interactions. Excluding desorption temperature, the other parameters were, in general, very important for the achievement of high response. The final procedure was based on headspace sampling at 100 degrees C, using polydimethylsiloxane/divinylbenzene fibres. The method showed good linearity and precision for all compounds, with detection limits ranging from 0.001 to 0.3 ng mL(-1). Reliability was demonstrated through the evaluation of the recoveries in different real water samples, including baby bathwater and swimming pool water. The absence of matrix effects allowed the use of external standard calibration to quantify the target compounds in the samples. The proposed procedure was applied to the determination of allergens in several real samples. All the target compounds were found in the samples, and, in some cases, at quite high concentrations. The presence and the levels of these chemicals in baby bathwater should be a matter of concern.

  19. Determination of rhodamine B in soft drink, waste water and lipstick samples after solid phase extraction.

    PubMed

    Soylak, Mustafa; Unsal, Yunus Emre; Yilmaz, Erkan; Tuzen, Mustafa

    2011-08-01

    A new solid phase extraction method is described for sensitive and selective determination of trace levels of rhodamine B in soft drink, food and industrial waste water samples. The method is based on the adsorption of rhodamine B on the Sepabeads SP 70 resin and its elution with 5 mL of acetonitrile in a mini chromatographic column. Rhodamine B was determined by using UV visible spectrophotometry at 556 nm. The effects of different parameters such as pH, amount of rhodamine B, flow rates of sample and eluent solutions, resin amount, and sample volume were investigated. The influences of some alkali, alkali earth and transition metals on the recoveries of rhodamine B were investigated. The preconcentration factor was found 40. The detection limit based on three times the standard deviation of the reagent blank for rhodamine B was 3.14 μg L⁻¹. The relative standard deviations of the procedure were found as 5% in 1×10⁻⁵ mol L⁻¹ rhodamine B. The presented procedure was successfully applied to real samples including soft drink, food and industrial waste water and lipstick samples. PMID:21570440

  20. Thermally stable coexistence of liquid and solid phases in gallium nanoparticles.

    PubMed

    Losurdo, Maria; Suvorova, Alexandra; Rubanov, Sergey; Hingerl, Kurt; Brown, April S

    2016-09-01

    Gallium (Ga), a group III metal, is of fundamental interest due to its polymorphism and unusual phase transition behaviours. New solid phases have been observed when Ga is confined at the nanoscale. Herein, we demonstrate the stable coexistence, from 180 K to 800 K, of the unexpected solid γ-phase core and a liquid shell in substrate-supported Ga nanoparticles. We show that the support plays a fundamental role in determining Ga nanoparticle phases, with the driving forces for the nucleation of the γ-phase being the Laplace pressure in the nanoparticles and the epitaxial relationship of this phase to the substrate. We exploit the change in the amplitude of the evolving surface plasmon resonance of Ga nanoparticle ensembles during synthesis to reveal in real time the solid core formation in the liquid Ga nanoparticle. Finally, we provide a general framework for understanding how nanoscale confinement, interfacial and surface energies, and crystalline relationships to the substrate enable and stabilize the coexistence of unexpected phases. PMID:27454047

  1. Solid phase studies and geochemical modelling of low-cost permeable reactive barriers.

    PubMed

    Bartzas, Georgios; Komnitsas, Kostas

    2010-11-15

    A continuous column experiment was carried out under dynamic flow conditions in order to study the efficiency of low-cost permeable reactive barriers (PRBs) to remove several inorganic contaminants from acidic solutions. A 50:50 w/w waste iron/sand mixture was used as candidate reactive media in order to activate precipitation and promote sorption and reduction-oxidation mechanisms. Solid phase studies of the exhausted reactive products after column shutdown, using scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD), confirmed that the principal Fe corrosion products identified in the reactive zone are amorphous iron (hydr)oxides (maghemite/magnetite and goethite), intermediate products (sulfate green rust), and amorphous metal sulfides such as amFeS and/or mackinawite. Geochemical modelling of the metal removal processes, including interactions between reactive media, heavy metal ions and sulfates, and interpretation of the ionic profiles was also carried out by using the speciation/mass transfer computer code PHREEQC-2 and the WATEQ4F database. Mineralogical characterization studies as well as geochemical modelling calculations also indicate that the effect of sulfate and silica sand on the efficiency of the reactive zone should be considered carefully during design and operation of low-cost field PRBs. PMID:20678863

  2. Magnetic solid-phase extraction of protein by ionic liquid-coated Fe@graphene oxide.

    PubMed

    Wen, Qian; Wang, Yuzhi; Xu, Kaijia; Li, Na; Zhang, Hongmei; Yang, Qin; Zhou, Yigang

    2016-11-01

    Amino functional dicationic ionic liquid (AFDCIL) was prepared and then coated on the surface of magnetic graphene oxide (GO) as a new magnetic adsorbent (Fe@GO@AFDCIL) for the magnetic solid-phase extraction (MSPE) of protein. The Fe@GO@AFDCIL composite was characterized by vibrating sample magnetometer (VSM), X-ray diffraction (XRD), Fourier transform infrared spectrometry (FT-IR), thermal gravimetric analysis (TGA), field emission scanning electron microscopy (FESEM) and zeta-potential nanoparticles. The bovine hemoglobin (BHb) was used as the analyte, and the extraction performance of Fe@GO@AFDCIL was investigated in the MSPE procedure. The concentration of BHb in samples was determined by a UV-vis spectrophotometer. A comparative investigation of Fe@GO@AFDCIL composite and traditional IL-coated Fe@GO composites (Fe@GO@IL) exhibited the benefits of Fe@GO@AFDCIL. The adsorbed BHb could be eluted from the Fe@GO@AFDCIL by 4% sodium dodecyl sulfate (SDS) solution. The Fe@GO@AFDCIL exhibited favorable stability which could be reused at least 15 times. Under the optimized condition, the real samples were investigated, which demonstrated that the Fe@GO@AFDCIL was able to be applied in extracting bovine hemoglobin (BHb) from real biological samples.

  3. Estimation of the main dill seeds odorant carvone by solid-phase microextraction and gas chromatography.

    PubMed

    Zawirska-Wojtasiak, Renata; Wasowicz, Erwin

    2002-10-01

    Solid-phase microextraction (SPME) was examined for its suitability for isolation of volatiles from seeds of dill in comparison with the traditional steam distillation procedure. Two main dill seeds volatiles, carvone and limonene, were taken into consideration. Two Supelco SPME fibers were used for the extraction: polyacrylic (PAc) and polydimethylsiloxane (PDMS). The time required to saturate the fibers was 3 min, while distillation took 3 h. Gas chromatography (GC) separation was reduced to 5 min by use of microcapillary column HP-5 cross-linked 5% Ph Me Siloxane. The standards of limonene and carvone were used to prepare calibration curves. PAc fiber responses were described by quadratic curves while PDMS responded linearly. Six varieties of dill were examined by distillation and SPME with both fibers. The good results were achieved for carvone by SPME-PDMS with significant regression between distillation and SPME. This compound can be measured in dill seeds samples within 10 min. The SPME-PDMS were also tested for its application to chiral resolution of carvone and limonene enantiomers in dill seeds oil. The enantiomeric separation was done with two chiral columns. The enantiomeric ratios measured by SPME were just the same as with distillation.

  4. Solid phase studies and geochemical modelling of low-cost permeable reactive barriers.

    PubMed

    Bartzas, Georgios; Komnitsas, Kostas

    2010-11-15

    A continuous column experiment was carried out under dynamic flow conditions in order to study the efficiency of low-cost permeable reactive barriers (PRBs) to remove several inorganic contaminants from acidic solutions. A 50:50 w/w waste iron/sand mixture was used as candidate reactive media in order to activate precipitation and promote sorption and reduction-oxidation mechanisms. Solid phase studies of the exhausted reactive products after column shutdown, using scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD), confirmed that the principal Fe corrosion products identified in the reactive zone are amorphous iron (hydr)oxides (maghemite/magnetite and goethite), intermediate products (sulfate green rust), and amorphous metal sulfides such as amFeS and/or mackinawite. Geochemical modelling of the metal removal processes, including interactions between reactive media, heavy metal ions and sulfates, and interpretation of the ionic profiles was also carried out by using the speciation/mass transfer computer code PHREEQC-2 and the WATEQ4F database. Mineralogical characterization studies as well as geochemical modelling calculations also indicate that the effect of sulfate and silica sand on the efficiency of the reactive zone should be considered carefully during design and operation of low-cost field PRBs.

  5. Lattice model theory of the equation of state covering the gas, liquid, and solid phases

    NASA Technical Reports Server (NTRS)

    Bonavito, N. L.; Tanaka, T.; Chan, E. M.; Horiguchi, T.; Foreman, J. C.

    1975-01-01

    The three stable states of matter and the corresponding phase transitions were obtained with a single model. Patterned after Lennard-Jones and Devonshires's theory, a simple cubic lattice model containing two fcc sublattices (alpha and beta) is adopted. The interatomic potential is taken to be the Lennard-Jones (6-12) potential. Employing the cluster variation method, the Weiss and the pair approximations on the lattice gas failed to give the correct phase diagrams. Hybrid approximations were devised to describe the lattice term in the free energy. A lattice vibration term corresponding to a free volume correction is included semi-phenomenologically. The combinations of the lattice part and the free volume part yield the three states and the proper phase diagrams. To determine the coexistence regions, the equalities of the pressure and Gibbs free energy per molecule of the coexisting phases were utilized. The ordered branch of the free energy gives rise to the solid phase while the disordered branch yields the gas and liquid phases. It is observed that the triple point and the critical point quantities, the phase diagrams and the coexistence regions plotted are in good agreement with the experimental values and graphs for argon.

  6. Mixed micelle cloud point-magnetic dispersive μ-solid phase extraction of doxazosin and alfuzosin

    NASA Astrophysics Data System (ADS)

    Gao, Nannan; Wu, Hao; Chang, Yafen; Guo, Xiaozhen; Zhang, Lizhen; Du, Liming; Fu, Yunlong

    2015-01-01

    Mixed micelle cloud point extraction (MM-CPE) combined with magnetic dispersive μ-solid phase extraction (MD-μ-SPE) has been developed as a new approach for the extraction of doxazosin (DOX) and alfuzosin (ALF) prior to fluorescence analysis. The mixed micelle anionic surfactant sodium dodecyl sulfate and non-ionic polyoxyethylene(7.5)nonylphenylether was used as the extraction solvent in MM-CPE, and diatomite bonding Fe3O4 magnetic nanoparticles were used as the adsorbent in MD-μ-SPE. The method was based on MM-CPE of DOX and ALF in the surfactant-rich phase. Magnetic materials were used to retrieve the surfactant-rich phase, which easily separated from the aqueous phase under magnetic field. At optimum conditions, a linear relationship between DOX and ALF was obtained in the range of 5-300 ng mL-1, and the limits of detection were 0.21 and 0.16 ng mL-1, respectively. The proposed method was successfully applied for the determination of the drugs in pharmaceutical preparations, urine samples, and plasma samples.

  7. Mixed micelle cloud point-magnetic dispersive μ-solid phase extraction of doxazosin and alfuzosin.

    PubMed

    Gao, Nannan; Wu, Hao; Chang, Yafen; Guo, Xiaozhen; Zhang, Lizhen; Du, Liming; Fu, Yunlong

    2015-01-01

    Mixed micelle cloud point extraction (MM-CPE) combined with magnetic dispersive μ-solid phase extraction (MD-μ-SPE) has been developed as a new approach for the extraction of doxazosin (DOX) and alfuzosin (ALF) prior to fluorescence analysis. The mixed micelle anionic surfactant sodium dodecyl sulfate and non-ionic polyoxyethylene(7.5)nonylphenylether was used as the extraction solvent in MM-CPE, and diatomite bonding Fe₃O₄ magnetic nanoparticles were used as the adsorbent in MD-μ-SPE. The method was based on MM-CPE of DOX and ALF in the surfactant-rich phase. Magnetic materials were used to retrieve the surfactant-rich phase, which easily separated from the aqueous phase under magnetic field. At optimum conditions, a linear relationship between DOX and ALF was obtained in the range of 5-300 ng mL(-1), and the limits of detection were 0.21 and 0.16 ng mL(-1), respectively. The proposed method was successfully applied for the determination of the drugs in pharmaceutical preparations, urine samples, and plasma samples.

  8. Synthesis and characterization of large-grain solid-phase crystallized polycrystalline silicon thin films

    SciTech Connect

    Kumar, Avishek E-mail: dalapatig@imre.a-star.edu.sg; Law, Felix; Widenborg, Per I.; Dalapati, Goutam K. E-mail: dalapatig@imre.a-star.edu.sg; Subramanian, Gomathy S.; Tan, Hui R.; Aberle, Armin G.

    2014-11-01

    n-type polycrystalline silicon (poly-Si) films with very large grains, exceeding 30 μm in width, and with high Hall mobility of about 71.5 cm{sup 2}/V s are successfully prepared by the solid-phase crystallization technique on glass through the control of the PH{sub 3} (2% in H{sub 2})/SiH{sub 4} gas flow ratio. The effect of this gas flow ratio on the electronic and structural quality of the n-type poly-Si thin film is systematically investigated using Hall effect measurements, Raman microscopy, and electron backscatter diffraction (EBSD), respectively. The poly-Si grains are found to be randomly oriented, whereby the average area weighted grain size is found to increase from 4.3 to 18 μm with increase of the PH{sub 3} (2% in H{sub 2})/SiH{sub 4} gas flow ratio. The stress in the poly-Si thin films is found to increase above 900 MPa when the PH{sub 3} (2% in H{sub 2})/SiH{sub 4} gas flow ratio is increased from 0.025 to 0.45. Finally, high-resolution transmission electron microscopy, high angle annular dark field-scanning tunneling microscopy, and EBSD are used to identify the defects and dislocations caused by the stress in the fabricated poly-Si films.

  9. Molecularly imprinted solid-phase extraction of matrine from radix Sophorae tonkinensis.

    PubMed

    Guo, Zhifeng; Zhang, Lixia; Song, Caiyu; Zhang, Xiaoxuan

    2011-07-21

    In the study, molecularly imprinted polymers (MIPs) with special molecular recognition properties of matrine (MAT) were prepared in our lab, using melamine-urea-formaldehyde (MUF) as the functional monomer and matrine as the template. An equilibrium binding experiment was performed to investigate the binding ability of the MIPs, and indicated that the MIPs had a high adsorption and good elution ability to the target molecule MAT, when the template/functional monomer ratio (T/M) was 5 mg g(-1). Scatchard analysis and isothermal equilibrium adsorption indicated that only one kind of binding site had existed in the MAT-imprinted polymers with its dissociation constants estimated to be 3.31 × 10(-4) mol L(-1) (200-400 mesh (inch(-1))) and 6.83 × 10(-4) mol L(-1) (over 400 mesh (inch(-1))) depending on the mesh of the MIPs. MAT purification and elution experiments were carried out using MIPs as the solid-phase extraction (MISPE) sorbent, and acetone, water, and chloroform as the elution solvents. The results demonstrated that MIPs achieved their highest adsorption capability after treatment with alkaline solution, while acetone was the most efficient elution solvent. Then, a crude extraction of matrine in radix Sophorae tonkinensis was performed using these MIPs as the separation medium. The results showed that MIPs had a high MAT selectivity, and the amount of matrine content obtained by MISPE was 1.4-fold to that obtained by liquid-liquid extraction.

  10. [Application of solid-phase microextraction technique to the detection of amphetamines in urine by GC].

    PubMed

    Liu, W; Shen, M

    1999-05-01

    A simple and rapid detection of nine amphetamines co-existing in urine was described. In the test, the method of solid-phase micro-extraction (SPME) by GC technique was used. Urine (1.0 ml), NaCl (0.3 g) and 4-phenylbutylamine (internal standard) were added into a vial (1.5 ml), then the sample was adjusted to pH 12 with 10% NaOH and sealed with a teflon-coated septum. After immersion of the SPME fiber (100 PDME) in the sample for 15 min, the SPME needle was inserted into the injection port of the GC and extruded for 3 min. The result showed that each peak from nine amphetamines compounds and internal standard was clearly separated. The calibration curves were linear from 0.2 to 15 micrograms/ml for most of five amphetamines with r between 0.9928-0.9995. The CV were less 10%. It is concluded that the method is simple, quick, accurate and useful for the practical detection of urine concentration of amphetamines.

  11. Determination of Rivaroxaban in Human Plasma by Solid-Phase Extraction-High Performance Liquid Chromatography.

    PubMed

    Çelebier, Mustafa; Reçber, Tuba; Koçak, Engin; Altınöz, Sacide; Kır, Sedef

    2016-02-01

    In this study, a solid-phase extraction (SPE)-high performance liquid chromatography (HPLC)-ultra violet (UV) method was developed for the determination of rivaroxaban (RIV), an oral anticoagulant drug, in human plasma samples. The concentration of RIV in plasma samples was increased 7.5 times and the interference coming from matrix components was avoided by using SPE. The extracted samples of RIV were analyzed by using an HPLC-UV method. RIV was approved in 2008 and many studies have been published in recent years in order to investigate its pharmacokinetic profile in various groups. In light of this information, it is clear that the RIV pharmacokinetic profile should be investigated in further studies; the HPLC-UV method presented in this study might be an easy method to apply, as it is a cheap and rapid alternative to HPLC-MS-MS for this purpose. A Phenomenex Luna 5-µm C18 100 Å LC column (250 × 4.6 mm) was used for the separation of RIV and prednisolone (internal standard). The total analysis time was <6 min. The method was validated according to the FDA guidelines and can be proposed for pharmacokinetic studies of RIV. PMID:26351327

  12. [Corrected Title: Solid-Phase Extraction of Polar Compounds from Water] Automated Electrostatics Environmental Chamber

    NASA Technical Reports Server (NTRS)

    Sauer, Richard; Rutz, Jeffrey; Schultz, John

    2005-01-01

    A solid-phase extraction (SPE) process has been developed for removing alcohols, carboxylic acids, aldehydes, ketones, amines, and other polar organic compounds from water. This process can be either a subprocess of a water-reclamation process or a means of extracting organic compounds from water samples for gas-chromatographic analysis. This SPE process is an attractive alternative to an Environmental Protection Administration liquid-liquid extraction process that generates some pollution and does not work in a microgravitational environment. In this SPE process, one forces a water sample through a resin bed by use of positive pressure on the upstream side and/or suction on the downstream side, thereby causing organic compounds from the water to be adsorbed onto the resin. If gas-chromatographic analysis is to be done, the resin is dried by use of a suitable gas, then the adsorbed compounds are extracted from the resin by use of a solvent. Unlike the liquid-liquid process, the SPE process works in both microgravity and Earth gravity. In comparison with the liquid-liquid process, the SPE process is more efficient, extracts a wider range of organic compounds, generates less pollution, and costs less.

  13. Bioremediation of diethylhexyl phthalate contaminated soil: a feasibility study in slurry- and solid-phase reactors.

    PubMed

    Di Gennaro, P; Collina, E; Franzetti, A; Lasagni, M; Luridiana, A; Pitea, D; Bestetti, G

    2005-01-01

    The aim of the research was to verify the possibility of applying bioremediation as a treatment strategy on a poly(vinyl chloride) (PVC) manufacturing site in the north of Italy contaminated by diethylhexyl phthalate (DEHP) at a concentration of 5.51 mg/g of dry soil. Biodegradation kinetic experiments with DEHP contaminated soil samples were performed in both slurry- and solid-phase systems. The slurry-phase results showed that the cultural conditions, such as N and P concentrations and the addition of a selected DEHP degrading strain, increased the natural DEHP degradation rate. On the basis of these data, experiments to simulate bioventing on contaminated soil columns were performed. The DEHP concentration reached 0.63 mg/g of dry soil in 76 days (89% of degradation). A kinetic equation was developed to fit the experimental data and to predict the concentration of contaminant after treatment. The data obtained are encouraging for a future in situ application of the bioventing technology.

  14. Analysis of lignocellulose derived phenolic monomers by headspace solid-phase microextraction and gas chromatography.

    PubMed

    Kolb, Michaela; Schieder, Doris; Faulstich, Martin; Sieber, Volker

    2013-09-13

    A headspace solid-phase microextraction method with subsequent GC-MS (HS-SPME/GC-MS) was established for the quantitative analysis of volatile lignin derived phenolic monomers in complex aqueous solutions. Extraction was done using a polyacrylate fiber. The optimization of HS-SPME - parameters was performed using a multi component model solution of six representative phenolic monomers identified in liquid hot water (LHW) supernatants of hydrothermally treated lignocellulosic biomass: p-coumaric acid, guaiacol, vanillin, acetosyringone, 4-hydroxy-3-methoxyphenylacetone, and acetophenone. Plackett-Burman design was applied for pre-evaluation and 2(3) central composite designs with star points for parameter optimization. LOQ (S/N>10) and LOD (S/N>3) were determined for 12 phenols yielding LOQ of <0.005-618nM and LOD of <0.005-412nM. Within-day and between-day tests (n=6) showed different results for the tested phenols. RSD ranged from 2% to 30% and recovery rates from 99% to 160% in LHW matrix. Tests on storage of LHW supernatants for several weeks indicated a considerable influence of temperature on the stability of the solutions which may even have to be taken into account for auto sampler handling. All in all the method allows a fast and solvent free analysis requiring low sample volumes making it a powerful tool for screening or high-throughput analysis of aqueous solutions of lignin derived aromatics.

  15. Solid Phase Microextraction and Related Techniques for Drugs in Biological Samples

    PubMed Central

    Moein, Mohammad Mahdi; Said, Rana; Bassyouni, Fatma

    2014-01-01

    In drug discovery and development, the quantification of drugs in biological samples is an important task for the determination of the physiological performance of the investigated drugs. After sampling, the next step in the analytical process is sample preparation. Because of the low concentration levels of drug in plasma and the variety of the metabolites, the selected extraction technique should be virtually exhaustive. Recent developments of sample handling techniques are directed, from one side, toward automatization and online coupling of sample preparation units. The primary objective of this review is to present the recent developments in microextraction sample preparation methods for analysis of drugs in biological fluids. Microextraction techniques allow for less consumption of solvent, reagents, and packing materials, and small sample volumes can be used. In this review the use of solid phase microextraction (SPME), microextraction in packed sorbent (MEPS), and stir-bar sorbtive extraction (SBSE) in drug analysis will be discussed. In addition, the use of new sorbents such as monoliths and molecularly imprinted polymers will be presented. PMID:24688797

  16. Solid phase catalysts and reagents. Final technical report, July 1, 1977-December 31, 1983

    SciTech Connect

    Regen, S.L.

    1983-12-01

    Research supported under this grant for the period 1/1/80-12/31/83 has involved six major areas: (1) defining polymer structure-activity relationships in triphase catalytic systems, (2) developing polyether- and polyamide-based catalysts for practical organic synthesis, (3) establishing new synthetic entries into macrolides based on triphase and phase-transfer catalytic principles, (4) introducing new polymeric and monomeric mercury reagents for use in organic synthesis, (5) clarifying and quantifying kinetic isolation within cross-linked polystyrene, and (6) elucidating the kinetic and mechanistic features of the hydrolysis of organic halides in aqueous - liquid organic two phase systems. Detailed reports are presented for the six areas. For the period 7/1/77-12/31/79 brief summaries are presented for the following areas: (1) insolubilized hexamethylphosphoramide as a solid solvent; (2) triphase catalysis, consideration of catalyst and experimental conditions for simple nucleophilic displacement; (3) selectivity features of polystrene-based triphase catalysts; (4) evidence for an S/sub N//sup 1/ reaction occurring at a toluene-water interface; (5) solid phase cosolvents - triphase catalytic hydrolysis of 1-bromoadamantane; (6) consideration of the role of stirring and catalyst efficiency of polystyrene-based triphase catalysts. 24 references.

  17. Selective solid-phase extraction of uranium by salicylideneimine-functionalized hydrothermal carbon.

    PubMed

    Wang, Hang; Ma, Lijian; Cao, Kecheng; Geng, Junxia; Liu, Jun; Song, Qiang; Yang, Xiaodan; Li, Shoujian

    2012-08-30

    A new salicylideneimine-functionalized hydrothermal-carbon-based solid-phase extractant was developed for the purpose of separating uranium selectively for sustainability of uranium resources. The resulting adsorption material was obtained via hydrothermal carbonization, calcination at mild temperature (573.15K), amination, and grafting with salicylaldehyde in sequence. Both Fourier transform infrared spectra and elemental analysis proved the successful grafting of salicylideneimine onto hydrothermal carbon matrix. Adsorption behaviors of the extractant on uranium(VI) were investigated by varying pH values of solution, adsorbent amounts, contact times, initial metal concentrations, temperatures, and ionic strengths. An optimum adsorption capacity of 1.10 mmol g(-1) (261 mg g(-1)) for uranium(VI) was obtained at pH 4.3. The present adsorption process obeyed pseudo-second-order model and Langmuir isotherm. Thermodynamic parameters (ΔH=+8.81 kJ mol(-1), ΔS=+110 J K(-1)mol(-1), ΔG=-23.0 kJ mol(-1)) indicated the adsorption process was endothermic and spontaneous. Results from batch adsorption test in simulated nuclear industrial effluent, containing Cs(+), Sr(2+), Ba(2+), Mn(2+), Co(2+), Ni(2+), Zn(2+), La(3+), Ce(3+), Nd(3+), Sm(3+), and Gd(3+), showed the adsorbent could separate uranium(VI) from those competitive ions with high selectivity. The adsorbent might be promising for use in certain key steps in any future sustainable nuclear fuel cycle.

  18. Isolation of tetracyclines in milk using a solid-phase extracting column and water eluent.

    PubMed

    Furusawa, Naoto

    2003-01-01

    An isolating method using a solid-phase extraction (SPE) ISOLUTE(R) C8 endcapped syringe-column for routine monitoring of residual tetracyclines (TCs) (oxytetracycline (OTC), tetracycline (TC), chlortetracycline (CTC), and doxycycline (DC)) in cow's milk is presented. In the simplest and most environmentally harmless method, milk samples could be applied directly to the SPE column, following which all TCs were eluted with water. No organic solvents were used at all. The purified sample was injected into a high-performance liquid chromatography (HPLC) with a photo-diode array detector (PDAD). For the HPLC determination/identification, a LiChrospher(R) 100 RP-8 endcapped column and a mobile phase of acetonitrile -7% (v v(-1)) acetic acid solution (in water) (35:65, v v(-1)) with a PDAD was used. The total time required for the analysis of one sample was <40 min. Average recoveries (spiked 0.1-1.0 mug ml(-1) each drug) and their standard deviations were >80 and <5%, respectively.

  19. Determination of Rivaroxaban in Human Plasma by Solid-Phase Extraction-High Performance Liquid Chromatography.

    PubMed

    Çelebier, Mustafa; Reçber, Tuba; Koçak, Engin; Altınöz, Sacide; Kır, Sedef

    2016-02-01

    In this study, a solid-phase extraction (SPE)-high performance liquid chromatography (HPLC)-ultra violet (UV) method was developed for the determination of rivaroxaban (RIV), an oral anticoagulant drug, in human plasma samples. The concentration of RIV in plasma samples was increased 7.5 times and the interference coming from matrix components was avoided by using SPE. The extracted samples of RIV were analyzed by using an HPLC-UV method. RIV was approved in 2008 and many studies have been published in recent years in order to investigate its pharmacokinetic profile in various groups. In light of this information, it is clear that the RIV pharmacokinetic profile should be investigated in further studies; the HPLC-UV method presented in this study might be an easy method to apply, as it is a cheap and rapid alternative to HPLC-MS-MS for this purpose. A Phenomenex Luna 5-µm C18 100 Å LC column (250 × 4.6 mm) was used for the separation of RIV and prednisolone (internal standard). The total analysis time was <6 min. The method was validated according to the FDA guidelines and can be proposed for pharmacokinetic studies of RIV.

  20. Applications of monolithic solid-phase extraction in chromatography-based clinical chemistry assays.

    PubMed

    Bunch, Dustin R; Wang, Sihe

    2013-04-01

    Complex matrices, for example urine, serum, plasma, and whole blood, which are common in clinical chemistry testing, contain many non-analyte compounds that can interfere with either detection or in-source ionization in chromatography-based assays. To overcome this problem, analytes are extracted by protein precipitation, solid-phase extraction (SPE), and liquid-liquid extraction. With correct chemistry and well controlled material SPE may furnish clean specimens with consistent performance. Traditionally, SPE has been performed with particle-based adsorbents, but monolithic SPE is attracting increasing interest of clinical laboratories. Monoliths, solid pieces of stationary phase, have bimodal structures consisting of macropores, which enable passage of solvent, and mesopores, in which analytes are separated. This structure results in low back-pressure with separation capabilities similar to those of particle-based adsorbents. Monoliths also enable increased sample throughput, reduced solvent use, varied support formats, and/or automation. However, many of these monoliths are not commercially available. In this review, application of monoliths to purification of samples from humans before chromatography-based assays will be critically reviewed.

  1. Dynamics of Vibrio cholerae abundance in Austrian saline lakes, assessed with quantitative solid-phase cytometry.

    PubMed

    Schauer, Sonja; Jakwerth, Stefan; Bliem, Rupert; Baudart, Julia; Lebaron, Philippe; Huhulescu, Steliana; Kundi, Michael; Herzig, Alois; Farnleitner, Andreas H; Sommer, Regina; Kirschner, Alexander

    2015-11-01

    In order to elucidate the main predictors of Vibrio cholerae dynamics and to estimate the risk of Vibrio cholera-related diseases, a recently developed direct detection approach based on fluorescence in situ hybridization and solid-phase cytometry (CARD-FISH/SPC) was applied in comparison to cultivation for water samples from the lake Neusiedler See, Austria and three shallow alkaline lakes over a period of 20 months. Vibrio cholerae attached to crustacean zooplankton was quantified via FISH and epifluorescence microscopy. Concentrations obtained by CARD-FISH/SPC were significantly higher than those obtained by culture in 2011, but were mostly of similar magnitude in 2012. Maximum cell numbers were 1.26 × 10(6) V. cholerae per L in Neusiedler See and 7.59 × 10(7) V. cholerae per L in the shallow alkaline lakes. Only on a few occasions during summer was the crustacean zooplankton the preferred habitat for V. cholerae. In winter, V. cholerae was not culturable but could be quantified at all sites with CARD-FISH/SPC. Beside temperature, suspended solids, zooplankton and ammonium were the main predictors of V. cholerae abundance in Neusiedler See, while in the shallow alkaline lakes it was organic carbon, conductivity and phosphorus. Based on the obtained concentrations a first estimation of the health risk for visitors of the lake could be performed.

  2. A rapid, sensitive, and easy-to-perform solid phase insulin radioimmunoassay

    SciTech Connect

    Vaeaenaenen, J.E.; Buchan, A.M.J.; Pederson, R.A. )

    1992-01-01

    Accurate measurement of basal insulin release in perifusion and low-density {beta}-cell preparation has been difficult with present assays. A simple, competitive, equilibrium, 15-hour insulin assay using {sup 125}I-insulin with microtiter plate immobilized antibody, has been developed. This method, a Solid-phase-RadioImmunoAssay (SPRIA), is very sensitive and has a broad useful range. Nonspecific binding was not significantly different from empty borosilicate culture tubes. This SPRIA can be used with existing {gamma}-counters, while reducing the radioactive and glass waste presently produced by RIA. The radioactivity of unused test-tubes was compared against test-tubes used for greater than 10 assays, values were 3.5 {plus minus} 0.5 and 4.4 {plus minus} 0.6 counts/minute, respectively. Results of an oral glucose tolerance test (oGTT) performed on four make Wistar Furth rats showed a close correlation between SPRIA and RIA insulin values. This SPRIA measured plasma insulin levels from a human oGTT with a variation of {le} 3.7% (SEM) between sample triplicates. Standard curves from three commonly measured insulin isoforms (human, rat and porcine) showed a high correlation. In order to determine SPRIA's ability to measure acid extracts, insulin recovery from 2N acetic acid was compared against insulin recovery from Dulbecco's Modified Eagles medium (DME).

  3. Polarization effects on the electric properties of urea and thiourea molecules in solid phase

    NASA Astrophysics Data System (ADS)

    Santos, O. L.; Fonseca, T. L.; Sabino, J. R.; Georg, H. C.; Castro, M. A.

    2015-12-01

    We present theoretical results for the dipole moment, linear polarizability, and first hyperpolarizability of the urea and thiourea molecules in solid phase. The in-crystal electric properties were determined by applying a supermolecule approach in combination with an iterative electrostatic scheme, in which the surrounding molecules are represented by point charges. It is found for both urea and thiourea molecules that the influence of the polarization effects is mild for the linear polarizability, but it is marked for the dipole moment and first hyperpolarizability. The replacement of oxygen atoms by sulfur atoms increases, in general, the electric responses. Our second-order Møller-Plesset perturbation theory based iterative scheme predicts for the in-crystal dipole moment of urea and thiourea the values of 7.54 and 9.19 D which are, respectively, increased by 61% and 58%, in comparison with the corresponding isolated values. The result for urea is in agreement with the available experimental result of 6.56 D. In addition, we present an estimate of macroscopic quantities considering explicit unit cells of urea and thiourea crystals including environment polarization effects. These supermolecule calculations take into account partially the exchange and dispersion effects. The results illustrate the role played by the electrostatic interactions on the static second-order nonlinear susceptibility of the urea crystal.

  4. Solid-phase microextraction for the investigation of sex pheromone of Eucosma notanthes Meyrick.

    PubMed

    Chu, Tzu-Yun; Hung, Chau-Chin; Hsu, Chung-Yuan

    2005-02-15

    A simple and efficient technique that does not require solvent and uses less operating time for the investigation of sex pheromones of the carambola fruit borer (Eucosma notanthes Meyrick) by utilizing headspace solid-phase microextraction (SPME) followed by GC-MS analysis has been developed. Variables such as types of SPME fiber, number of pests, temperature and extraction time have been studied. Whole sex glands of Eucosma notanthes Meyrick were dissected from 5 virgin insects, placed in a 2mL vial, equilibrated at 170 degrees C for 10min, and then extracted by headspace SPME at room temperature for 5min. The results of the GC-MS analyses of headspace SPME of these sex glandular solid samples were much better than those obtained with hexane extraction of sex glandular from 117 insects followed by either headspace SPME or direct injection due to higher absorption efficiency. The simplicity of this technique renders it a very suitable method for research on the biological control of pests.

  5. Determination of amphetamines in biological samples using electro enhanced solid-phase microextraction-gas chromatography.

    PubMed

    Zeng, Jingbin; Chen, Jingjing; Li, Min; Subhan, Fazle; Chong, Fayun; Wen, Chongying; Yu, Jianfeng; Cui, Bingwen; Chen, Xi

    2015-09-01

    In this work, an ordered mesoporous carbon (OMC)/Nafion coated fiber for solid-phase microextraction (SPME) was prepared and used as the working electrode for electro-enhanced SPME (EE-SPME) of amphetamines. The EE-SPME strategy is primarily based on the electro-migration and complementary charge interaction between fiber coating and ionic compounds. Compared with traditional SPME, EE-SPME exhibited excellent extraction efficiency for amphetamine (AP) and methamphetamine (MA) with an enhancement factor of 7.8 and 12.1, respectively. The present strategy exhibited good linearity for the determination of AP and MA in urine samples in the range of 10-1000ngmL(-1) and 20-1000ngmL(-1), respectively. The detection limits were found to be 1.2ngmL(-1) for AP and 4.8ngmL(-1) for MA. The relative standard deviations were calculated to be 6.2% and 8.5% for AP and MA, respectively. Moreover, the practical application of the proposed method was demonstrated by analyzing the amphetamines in urine and serum samples with satisfactory results.

  6. Physico-chemical approach to study organotin sorption-desorption during solid-phase microextraction.

    PubMed

    Aguerre, Sandrine; Lespes, Gaëtane; Potin-Gautier, Martine

    2003-05-30

    Solid-phase microextraction (SPME) has become a real alternative to liquid-liquid extraction in the field of speciation of organometallic compounds. Despite the high performance of this preconcentration technique, matrix effects in natural samples can affect the analytical precision. In order to understand the origin of these disturbances and control the extraction step as best as possible, the sorption-desorption behaviour of organotins was studied. In the first part, this paper discusses the analytical problems encountered in the daily use of SPME due to the particular problems observed for phenyltins. The sorption profile of these compounds was modelled using experimental design methodology to confirm the first-order kinetics. Desorption of the compounds was also observed after a given time and could not be attributed to competition between organotin compounds. In the same way, butyl- and phenyltins were studied in the presence of humic substances, which acted as representatives of organic matter found in natural samples. These substances drastically decrease the extraction yields, but do not affect the sorption profile of butyl- and phenyltins. PMID:12885052

  7. Rapid determination of organotin compounds by headspace solid-phase microextraction.

    PubMed

    Le Gac, Marjorie; Lespes, Gaëtane; Potin-Gautier, Martine

    2003-05-30

    Headspace solid-phase microextraction (SPME) followed by gas chromatography (GC) coupled to pulsed flame photometric detection have been investigated for the simultaneous speciation analysis of 14 organotin compounds, including methyl-, butyl-, phenyl-, and octyltins compounds. The analytical process (sorption on SPME fibre and thermal desorption in GC injection port) has been optimised using experimental designs. Six operating factors were considered in order to evaluate their influence on the performances of a SPME-based procedure. The evaluation of accuracy, precision and limits of detection (LODs) according to ISO standards and IUPAC recommendations has allowed the method to be validated. The LODs obtained for the 14 studied organotins compounds are widely sub-ng(Sn) l(-1). The precision evaluated using relative standard deviation ranges between 9 and 25% from five determinations of the analytes at 0.25-125 ng(Sn) l(-1) concentrations. The accuracy was studied throughout the analysis of spiked environmental samples. These first results show that headspace SPME appears really as attractive for organotins determination in the environment and the monitoring of their biogeochemical cycle. PMID:12885057

  8. Rotating rod renewable microcolumns for automated, solid-phase DNA hybridization studies.

    PubMed

    Bruckner-Lea, C J; Stottlemyre, M S; Holman, D A; Grate, J W; Brockman, F J; Chandler, D P

    2000-09-01

    The development of a new temperature-controlled renewable microcolumn flow cell for solid-phase nucleic acid hybridization in an automated sequential injection system is described. The flow cell included a stepper motor-driven rotating rod with the working end cut to a 45 degrees angle. In one position, the end of the rod prevented passage of microbeads while allowing fluid flow; rotation of the rod by 180 degrees releases the beads. This system was used to rapidly test many hybridization and elution protocols to examine the temperature and solution conditions required for sequence-specific nucleic acid hybridization. Target nucleic acids labeled with a near-infrared fluorescent dye were detected immediately postcolumn during all column perfusion and elution steps using a flow-through fluorescence detector. Temperature control of the column and the presence of Triton X-100 surfactant were critical for specific hybridization. Perfusion of the column with complementary oligonucleotide (200 microL, 10 nM) resulted in hybridization with 8% of the DNA binding sites on the microbeads with a solution residence time of less than 1 s and a total sample perfusion time of 40 s. The use of the renewable column system for detection of an unlabeled PCR product in a sandwich assay was also demonstrated. PMID:10994975

  9. Direct molecular dynamics simulation of liquid-solid phase equilibria for two-component plasmas.

    PubMed

    Schneider, A S; Hughto, J; Horowitz, C J; Berry, D K

    2012-06-01

    We determine the liquid-solid phase diagram for carbon-oxygen and oxygen-selenium plasma mixtures using two-phase molecular dynamics simulations. We identify liquid, solid, and interface regions using a bond angle metric. To study finite-size effects, we perform 27,648- and 55,296-ion simulations. To help monitor nonequilibrium effects, we calculate diffusion constants D(i). For the carbon-oxygen system we find that D(O) for oxygen ions in the solid is much smaller than D(C) for carbon ions and that both diffusion constants are 80 or more times smaller than diffusion constants in the liquid phase. There is excellent agreement between our carbon-oxygen phase diagram and that predicted by Medin and Cumming. This suggests that errors from finite-size and nonequilibrium effects are small and that the carbon-oxygen phase diagram is now accurately known. The oxygen-selenium system is a simple two-component model for more complex rapid proton capture nucleosynthesis ash compositions for an accreting neutron star. Diffusion of oxygen, in a predominantly selenium crystal, is remarkably fast, comparable to diffusion in the liquid phase. We find a somewhat lower melting temperature for the oxygen-selenium system than that predicted by Medin and Cumming. This is probably because of electron screening effects. PMID:23005226

  10. Soil solid phases effects on the proteomic analysis of Cupriavidus metallidurans CH34

    SciTech Connect

    Giagnoni L.; Taghavi S.; Magherini, F.; Landi, L.; van der Lelie, D.; Puglia, M.; Bianchi, L.; Bini, L.; Nannipieri, P.; Renella, G.; Modesti, A.

    2012-05-01

    Cupriavidus metallidurans CH34 is a completely sequenced soil-borne beta-proteobacterium with known genome and proteome. Comparative 2-D electrophoresis and protein mass spectrometry were used to compare the proteome of C. metallidurans CH34 from liquid culture and after incubation for 1, 3, and 12 days in microcosms containing quartz sand, kaolinite, montmorillonite, or an artificial soil. Results showed that proteome from liquid culture was similar to CH34 proteins extracted from sand and kaolinite, whereas the proteins extracted from artificial soil differed significantly and no proteins were detected from C. metallidurans CH34 incubated in the montmorillonite microcosms. Protein recovery decreased on prolonging incubation time in all microcosms. Mass spectrometry identification showed that the trend of lower recovery upon incubation time was independent on the putative function of protein. These results suggest that the soil solid phase influences the protein recovery and soil proteomic analysis and that distinction between protein recovery and protein expression in soil will be a challenging for soil proteomic researchers.

  11. Polarization effects on the electric properties of urea and thiourea molecules in solid phase

    SciTech Connect

    Santos, O. L.; Fonseca, T. L. Sabino, J. R.; Georg, H. C.; Castro, M. A.

    2015-12-21

    We present theoretical results for the dipole moment, linear polarizability, and first hyperpolarizability of the urea and thiourea molecules in solid phase. The in-crystal electric properties were determined by applying a supermolecule approach in combination with an iterative electrostatic scheme, in which the surrounding molecules are represented by point charges. It is found for both urea and thiourea molecules that the influence of the polarization effects is mild for the linear polarizability, but it is marked for the dipole moment and first hyperpolarizability. The replacement of oxygen atoms by sulfur atoms increases, in general, the electric responses. Our second-order Møller–Plesset perturbation theory based iterative scheme predicts for the in-crystal dipole moment of urea and thiourea the values of 7.54 and 9.19 D which are, respectively, increased by 61% and 58%, in comparison with the corresponding isolated values. The result for urea is in agreement with the available experimental result of 6.56 D. In addition, we present an estimate of macroscopic quantities considering explicit unit cells of urea and thiourea crystals including environment polarization effects. These supermolecule calculations take into account partially the exchange and dispersion effects. The results illustrate the role played by the electrostatic interactions on the static second-order nonlinear susceptibility of the urea crystal.

  12. Gas chromatographic determination of N-nitrosamines in beverages following automatic solid-phase extraction.

    PubMed

    Jurado-Sánchez, Beatriz; Ballesteros, Evaristo; Gallego, Mercedes

    2007-11-28

    A semiautomatic method for the determination of seven N-nitrosamines in beverages by gas chromatography with nitrogen-phosphorus detection is proposed. Beverage samples are aspirated into a solid-phase extraction module for preconcentration and cleanup. The influence of the experimental conditions was examined by using various sorbents among which LiChrolut EN was found to provide quantitative elution and the highest preconcentration factors of all. The proposed method is sensitive, with limits of detection between 7 and 33 ng/kg, and precise, with relative standard deviations from 4.3% to 6.0%. The recoveries of N-nitrosamines from beverage samples spiked with 0.5 or 1 microg/kg concentrations of these compounds ranged from 95% to 102%. The method was successfully applied to the determination of residues of the studied N-nitrosamines in beverages including beer, wine, liquor, whisky, cognac, rum, vodka, grape juice, cider, tonic water, and soft drinks. The analytes were only detected in beer samples, positives being confirmed by gas chromatography coupled with impact ionization mass spectrometry.

  13. Bioremediation of diethylhexyl phthalate contaminated soil: a feasibility study in slurry- and solid-phase reactors.

    PubMed

    Di Gennaro, P; Collina, E; Franzetti, A; Lasagni, M; Luridiana, A; Pitea, D; Bestetti, G

    2005-01-01

    The aim of the research was to verify the possibility of applying bioremediation as a treatment strategy on a poly(vinyl chloride) (PVC) manufacturing site in the north of Italy contaminated by diethylhexyl phthalate (DEHP) at a concentration of 5.51 mg/g of dry soil. Biodegradation kinetic experiments with DEHP contaminated soil samples were performed in both slurry- and solid-phase systems. The slurry-phase results showed that the cultural conditions, such as N and P concentrations and the addition of a selected DEHP degrading strain, increased the natural DEHP degradation rate. On the basis of these data, experiments to simulate bioventing on contaminated soil columns were performed. The DEHP concentration reached 0.63 mg/g of dry soil in 76 days (89% of degradation). A kinetic equation was developed to fit the experimental data and to predict the concentration of contaminant after treatment. The data obtained are encouraging for a future in situ application of the bioventing technology. PMID:15667113

  14. Disks solid phase extraction based polypyrrole functionalized core-shell nanofibers mat.

    PubMed

    Qi, FeiFei; Li, XiaoQing; Yang, BiYi; Rong, Fei; Xu, Qian

    2015-11-01

    A novel disks solid phase extraction (SPE) based on polypyrrole (PPy) functionalized core-shell electrospun nanofibers mat was proposed. The performance of the established disks SPE technique was evaluated in the extraction of trace polar analytes from environmental water samples. Disulphonated (acid yellow 9) and monosulphonated azo dyes (acid orange 7 and metanil yellow) were selected as typical model analytes. Under the optimum conditions, detection limits were 0.15-0.3 μg/L for all target analytes and the enrichment coefficients were 106-121. The recoveries of sulfonated azo dyes added to typical environmental water samples were 87.6-112.3%, suggesting that the interferences of the sample matrix did not affect the enrichment. Compared with existing methods, the device in this study showed higher recovery, lower detection limit and better precision. Moreover, the miniaturized disks SPE technique for sample preparation is simple and fast, with significantly reduced sorbent bed mass (2.5 mg) and eluent volume (500 μL). These results indicate that PPy nanofibers mat-based disks SPE may be a promising device that can effectively extract the polar species in water samples. PMID:26452802

  15. SOLID PHASE MICROEXTRACTION SAMPLING OF FIRE DEBRIS RESIDUES IN THE PRESENCE OF RADIONUCLIDE SURROGATE METALS

    SciTech Connect

    Duff, M; Keisha Martin, K; S Crump, S

    2007-03-23

    The Federal Bureau of Investigation (FBI) Laboratory currently does not have on site facilities for handling radioactive evidentiary materials and there are no established FBI methods or procedures for decontaminating highly radioactive fire debris (FD) evidence while maintaining evidentiary value. One experimental method for the isolation of FD residue from radionuclide metals involves using solid phase microextraction (SPME) fibers to remove the residues of interest. Due to their high affinity for organics, SPME fibers should have little affinity for most (radioactive) metals. The focus of this research was to develop an examination protocol that was applicable to safe work in facilities where high radiation doses are shielded from the workers (as in radioactive shielded cells or ''hot cells''). We also examined the affinity of stable radionuclide surrogate metals (Co, Ir, Re, Ni, Ba, Cs, Nb, Zr and Nd) for sorption by the SPME fibers. This was done under exposure conditions that favor the uptake of FD residues under conditions that will provide little contact between the SPME and the FD material (such as charred carpet or wood that contains commonly-used accelerants). Our results from mass spectrometric analyses indicate that SPME fibers show promise for use in the room temperature head space uptake of organic FD residue (namely, diesel fuel oil, kerosene, gasoline and paint thinner) with subsequent analysis by gas chromatography (GC) with mass spectrometric (MS) detection. No inorganic forms of ignitable fluids were included in this study.

  16. Determination of MTBE in a recreational harbor using solid-phase microextraction.

    PubMed

    Zuccarello, Joseph L; Ganske, Jane A; Green, David B

    2003-06-01

    Discovery of the fuel additive methyl tert-butyl ether (MTBE) in groundwater, surface water, and stormwater has prompted studies of its sources, transport and fate. More limited data, however, is available on the extent of contamination of coastal waters, as well as the persistence of MTBE in the marine environment. We apply here the combination of solid phase microextraction and gas chromatography-mass spectrometry to the detection of sub-to-low microgram/l concentrations of MTBE in seawater samples. Analysis of samples collected at the Marina del Rey harbor, a shallow recreational harbor near Los Angeles, CA, show MTBE contamination in the low microgram/l level. MTBE measurements were made at different depths, from the surface to the bottom, at five sites within the harbor during months showing no measurable precipitation. The highest concentration of MTBE (18 microgram/l) was found at the boat launching ramp, and the lowest (0.2 microgram/l) near the harbor entrance, approximately 2.3 km from the ramp. The levels of MTBE measured, as well as their variation over the study period, are fully consistent with recreational boating as the primary source of contamination. No evidence for MTBE contamination from the adjacent stormwater control channel was noted.

  17. Collecting peptide release from the brain using porous polymer monolith-based solid phase extraction capillaries.

    PubMed

    Iannacone, Jamie M; Ren, Shifang; Hatcher, Nathan G; Sweedler, Jonathan V

    2009-07-01

    Porous polymer monolithic (PPM) columns are employed to collect and concentrate neuronal release from invertebrate and vertebrate model systems, prior to their characterization with mass spectrometry. The monoliths are fabricated in fused-silica capillaries from lauryl methacrylate (LMA) and ethylene glycol dimethacrylate (EDMA). The binding capacities for fluorescein and for fluorescently labeled peptides are on the order of nanomoles per millimeter of length of monolith material for a capillary with an inner diameter of 200 microm. To evaluate this strategy for collecting peptides from physiological solutions, angiotensin I and insulin in artificial seawater are loaded onto, and then released from, the monoliths after a desalination rinse, resulting in femtomole limits of detection via matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Positioned in the extracellular media near Aplysia californica bag cell neurons, upon electrical stimulation, these LMA-EDMA monoliths are also used to collect and concentrate peptide release, with egg-laying hormones and acidic peptide detected. In addition, the collection of several known peptides secreted from chemically stimulated mouse brain slices demonstrates their ability to collect releasates from a variety of neuronal tissues. When compared to collection approaches using individual beads placed on brain slices, the PPM capillaries offer greater binding capacity. Moreover, they maintain higher spatial resolution, compared to the larger-volume, solid-phase extraction collection strategies.

  18. Rotating rod renewable microcolumns for automated, solid-phase DNA hybridization studies.

    PubMed

    Bruckner-Lea, C J; Stottlemyre, M S; Holman, D A; Grate, J W; Brockman, F J; Chandler, D P

    2000-09-01

    The development of a new temperature-controlled renewable microcolumn flow cell for solid-phase nucleic acid hybridization in an automated sequential injection system is described. The flow cell included a stepper motor-driven rotating rod with the working end cut to a 45 degrees angle. In one position, the end of the rod prevented passage of microbeads while allowing fluid flow; rotation of the rod by 180 degrees releases the beads. This system was used to rapidly test many hybridization and elution protocols to examine the temperature and solution conditions required for sequence-specific nucleic acid hybridization. Target nucleic acids labeled with a near-infrared fluorescent dye were detected immediately postcolumn during all column perfusion and elution steps using a flow-through fluorescence detector. Temperature control of the column and the presence of Triton X-100 surfactant were critical for specific hybridization. Perfusion of the column with complementary oligonucleotide (200 microL, 10 nM) resulted in hybridization with 8% of the DNA binding sites on the microbeads with a solution residence time of less than 1 s and a total sample perfusion time of 40 s. The use of the renewable column system for detection of an unlabeled PCR product in a sandwich assay was also demonstrated.

  19. [Determination of aflatoxins in hot chilli products by matrix solid-phase dispersion and liquid chromatography].

    PubMed

    Zheng, Ping; Sheng, Xuan; Yu, Xiaofeng; Hu, Yanyun

    2006-01-01

    A new method based on matrix solid-phase dispersion (MSPD) extraction with neutral alumina and co-column purification with graphitized carbon black has been developed to determine aflatoxins B1, B2, G1, G2 in hot chilli products. The method includes liquid chromatography and fluorescence detection with on-line post-column derivatization with bromine. Optimization of different parameters, such as the type of solid supports for matrix dispersion and co-column clean-up was carried out. The recoveries of aflatoxins B1, B2, G1 and G2 were 95.4%, 87.3%, 91.5% and 92.6%, respectively, with relative standard deviations ranging from 3.3% to 6.1%. The limits of detection were in the range of 0.10 ng/g (B2, G2) to 0.25 ng/g (B1, G1). In addition, the comparison of the extraction and purification effect of MSPD with immunity affinity column showed that, MSPD is a valid method to analyze aflatoxins in hot chilli products.

  20. Biogas production with horse dung in solid-phase digestion systems.

    PubMed

    Kusch, Sigrid; Oechsner, Hans; Jungbluth, Thomas

    2008-03-01

    Experiments on methanogenesis from horse dung were conducted in laboratory-scale batch reactors in order to determine the substrate performance in a solid-phase digestion process, more specifically in terms of potential energy recovery and suitable process technology. Dung from a horse stable with straw bedding was used. The temperature was kept in the mesophilic range. In the percolation process (with process water sprinkled over the stacked biomass) a proportion of 10-20% of solid inoculum (pre-digested horse dung) was found to be suitable. Comparative experiments with both percolation and flooding revealed a higher biogas production per volume for the flooded process, as no addition of solid inoculum was necessary. Methane yield from fresh material was similar in both processes: around 170 L(N) CH(4) per kg VS added was obtained in six-week cycles with untreated material under optimized conditions. Methane production was increased after chopping the substrate. Pre-aeration resulted in decreased methane production.

  1. Thermally stable coexistence of liquid and solid phases in gallium nanoparticles.

    PubMed

    Losurdo, Maria; Suvorova, Alexandra; Rubanov, Sergey; Hingerl, Kurt; Brown, April S

    2016-09-01

    Gallium (Ga), a group III metal, is of fundamental interest due to its polymorphism and unusual phase transition behaviours. New solid phases have been observed when Ga is confined at the nanoscale. Herein, we demonstrate the stable coexistence, from 180 K to 800 K, of the unexpected solid γ-phase core and a liquid shell in substrate-supported Ga nanoparticles. We show that the support plays a fundamental role in determining Ga nanoparticle phases, with the driving forces for the nucleation of the γ-phase being the Laplace pressure in the nanoparticles and the epitaxial relationship of this phase to the substrate. We exploit the change in the amplitude of the evolving surface plasmon resonance of Ga nanoparticle ensembles during synthesis to reveal in real time the solid core formation in the liquid Ga nanoparticle. Finally, we provide a general framework for understanding how nanoscale confinement, interfacial and surface energies, and crystalline relationships to the substrate enable and stabilize the coexistence of unexpected phases.

  2. Solid-Phase Combinatorial Synthesis and Biological Evaluation of Destruxin E Analogues.

    PubMed

    Yoshida, Masahito; Ishida, Yoshitaka; Adachi, Kenta; Murase, Hayato; Nakagawa, Hiroshi; Doi, Takayuki

    2015-12-01

    The solid-phase combinatorial synthesis of cyclodepsipeptide destruxin E has been demonstrated. The combinatorial synthesis of cyclization precursors 8 was achieved by using a split and pool method on SynPhase Lanterns. The products were successfully macrolactonized in parallel in the solution phase by using 2-methyl-6-nitrobenzoic anhydride and 4-(dimethylamino)pyridine N-oxide to afford macrolactones 9, and the subsequent formation of an epoxide in the side chain gave 18 member destruxin E analogues 6. Biological evaluation of analogues 6 indicated that the N-MeAla residue was crucial to the induction of morphological changes in osteoclast-like multinuclear cells (OCLs). Based on structure-activity relationships, azido-containing analogues 15 were then designed for use as a molecular probe. The synthesis and biological evaluation of analogues 15 revealed that 15 b, in which the Ile residue was replaced with a Lys(N3 ) residue, induced morphological changes in OCLs at a sufficient concentration, and modification around the Ile residue would be tolerated for attachment of a chemical tag toward the target identification of destruxin E (1).

  3. Graphene coating bonded onto stainless steel wire as a solid-phase microextraction fiber.

    PubMed

    Sun, Min; Feng, Juanjuan; Bu, Yanan; Wang, Xiaojiao; Duan, Huimin; Luo, Chuannan

    2015-03-01

    A graphene coating bonded onto stainless steel wire was fabricated and investigated as a solid-phase microextraction fiber. The coating was characterized by scanning electron microscopy and energy-dispersive X-ray spectrometer. The coating with rough and crinkled structure was about 1 μm. These characteristics were helpful for promoting extraction. Using five n-alkanes (n-undecane, n-dodecane, n-tridecane, n-tetradecane and n-hexadecane) as analytes, the fiber was evaluated in direct-immersion mode by coupling with gas chromatography (GC). Through optimizing extraction and desorption conditions, a sensitive SPME-GC analytical method was established. SPME-GC method provided wide linearity range (0.2-150 μg L(-1)) and low limits of determination (0.05-0.5 μg L(-1)). It was applied to analyze rain water and a soil sample, and analytes were quantified in the range of 0.85-1.96 μg L(-1) and 0.09-3.34 μg g(-1), respectively. The recoveries of samples spiked at 10 μg L(-1) were in the range of 90.1-120% and 80.6-94.2%, respectively. The fiber also exhibited high thermal and chemical stability, due to the covalent bonds between graphene coating and wire, and the natural resistance of graphene for thermal, acid and basic conditions. PMID:25618658

  4. Molecularly imprinted polymer solid-phase extraction for detection of zearalenone in cereal sample extracts.

    PubMed

    Lucci, Paolo; Derrien, Delphine; Alix, Florent; Pérollier, Céline; Bayoudh, Sami

    2010-07-01

    The aim of this work was to develop a method for the clean-up and preconcentration of zearalenone from corn and wheat samples employing molecularly imprinted polymer (MIP) as selective sorbent for solid-phase extraction (SPE). Cereal samples were extracted with acetonitrile/water (75:25, v/v) and the extract was diluted with water and applied to an AFFINIMIP ZON MIP-SPE column. The column was then washed to eliminate the interferences and zearalenone was eluted with methanol and quantified using HPLC with fluorescence detection (lambda(exc)=275/lambda(em)=450 nm). The precision and accuracy of the method were satisfactory for both cereals at the different fortification levels tested and it gave recoveries between 82 and 87% (RSDr 2.5-6.2%, n=3) and 86 and 90% (RSDr 0.9-6.8%, n=3) for wheat and maize, respectively. MIP-SPE column capacity was determined to be not less than 6.6 microg of zearalenone and to be at least four times higher than that of immunoaffinity column (IAC). The application of AFFINIMIP ZON molecularly imprinted polymer as a selective sorbent material for detection of zearalenone fulfilled the method performance criteria required by the Commission Regulation (EC) No. 401/2006, demonstrating the suitability of the technique for the control of zearalenone in cereal samples.

  5. Toxicity and composition profiles of solid phase extracts of oil sands process-affected water.

    PubMed

    Yue, Siqing; Ramsay, Bruce A; Wang, Jiaxi; Ramsay, Juliana

    2015-12-15

    After fractionation using sequential solid phase extraction, the presence of toxic components in oil sands process-affected water (OSPW) was detected by the Microtox® acute toxicity assay using effect-directed analysis. The composition of each fraction was determined by high-resolution electrospray ionization-Orbitrap mass spectrometry. Partial least-squares discriminant analysis (PLS-DA) was used to determine which chemical constituents in all seven fractions co-varied most strongly with toxicity. Although O2 compounds with double bond equivalence (DBE) between 3 and 9 positively correlated with toxicity, C15-C18 O2-NAs with DBE=4 (tricyclic structure), as well as C14-C17 O2-NAs with DBE=3 (bicyclic structure), were found to be most likely associated with OSPW toxicity, consistent with published toxicity studies of surrogate NAs. O4, many O3 (i.e. possibly hydroxylated O2 c-NAs) and a few O2 compounds were found to negatively correlate with toxicity. The results demonstrate the utility of the fractionation and the PLS-DA approach for evaluating composition-response relationships in a complex mixture and also contribute to a better understanding of the toxic compounds in OSPW. These findings will help to focus study on the most environmentally significant components in OSPW. PMID:26318810

  6. [Determination of residual sulfonamides in meat by high performance liquid chromatography with solid-phase extraction].

    PubMed

    Zhang, Yan; Wu, Yinliang

    2005-11-01

    A method was developed for determining residual sulfonamides (SAs) such as sulfamethazine (SM2), sulfamonomethoxine (SMM), sulfamethiazole (SMZ), sulfadimethoxine (SDM) and sulfaquinoxaline (SQ) in pork and chicken using solid-phase extraction (SPE) and high performance liquid chromatography (HPLC) with a photodiode array detector. The samples were extracted with ethyl acetate. An NH2 column was used for clean up. For the HPLC determination, an Intersil ODS-2 column was used with a mixture of methanol-acetonitrile-water-acetic acid (2: 2: 9: 0.2, v/v) as the mobile phase. The detection limits (S/N = 3) were 3 microg/kg for SM2, SMM and SMZ, and 7 microg/kg for SDM and SQ. The quantitation limits (S/N = 10) were 10 microg/kg for SM2, SMM and SMZ, and 25 microg/kg for SDM and SQ. The linear ranges were 30 - 5 000 microg/L for SM2, SMM and SMZ, and 60 - 5 000 microg/L for SDM and SQ. The recoveries were between 73.2% and 97.3% with the relative standard deviations between 2.5% and 11.6% originated from the spiked level of 50 microg/kg. PMID:16498995

  7. Arsenic redistribution after solid phase epitaxial regrowth of shallow pre-amorphized silicon layers

    SciTech Connect

    Demenev, E.; Giubertoni, D.; Gennaro, S.; Bersani, M.; Hourdakis, E.; Nassiopoulou, A. G.; Reading, M. A.; Berg, J. A. van den

    2012-11-06

    The behavior of ultra shallow ion implants of arsenic in Si following solid phase epitaxial re-growth process is reported. A 16 nm amorphous layer was created by ion implantation of Si{sup +} at energy 5 keV and a dose 1 Multiplication-Sign 10{sup 15} at/cm{sup 2}. As ion were implanted at 2 keV using 3 different doses: 1 Multiplication-Sign 10{sup 14}, 5 Multiplication-Sign 10{sup 14} and 1 Multiplication-Sign 10{sup 15} at/cm{sup 2}. The resulting As distributions, confined in the amorphous layer, were thermally treated at 550 Degree-Sign C for 5-300 s in order to electrically activate dopant atoms. Crystal re-growth and As redistribution was investigated by secondary ion mass spectrometry and medium energy ion scattering. A growth rate depending on the As concentration was observed, the rate being slower for higher As content. Arsenic re-distribution to the surface and at the end-of-range defects was observed and a segregation model was developed. Finally, the substitutional fraction of As atoms was related to sheet resistance measurements revealing a higher fraction of electrically active dopant atoms in pre-amorphized samples compared to not pre-amorphized.

  8. Direct dye binding--a quantitative assay for solid-phase immobilized protein.

    PubMed

    Bonde, M; Pontoppidan, H; Pepper, D S

    1992-01-01

    A direct dye-binding procedure was established for the quantification of protein after its immobilization on a solid phase, using IgG and BSA as model proteins. The assay, which in the range 0-5 mg protein/ml gel correlates well with indirect protein determination by A280 as well as determination of protein hydrolyzed from the gel, is based on a modified Bradford dye-binding assay. As the protein coupled to the gel binds the dye, a decrease in A465 of the supernatant is measured. Three solid supports commonly used for protein immobilization (Sepharose, Sephadex, Sephacryl) were found to be compatible with the dye-binding assay while nonspecific dye binding was found to HEMA gels. Protein was coupled to Sephacryl S-1000 using three different activation methods (aldehyde, hydrazine, and adipic acid dihydrazide). Artifactual dye-binding was not observed using any of the three different "linkers." The assay is easily carried out and represents a useful tool, e.g., when optimizing procedures for protein immobilization. PMID:1595895

  9. Solid-phase low temperature steam-assisted synthesis of thermal stable alumina nanowires.

    PubMed

    Shen, S C; Ng, W K; Chen, Q; Zeng, X T; Chew, M Z; Tan, Reginald B H

    2007-08-01

    A simple steam-assisted solid phase synthesis method was developed for synthesis of boehmite nanowires in the presence of TEAOH surfactant. The boehmite nanowires had uniform diameters (12-16 nm) and length up to 1-2 microm. The morphology of the nanostructured wires was well preserved after being converted to pure gamma-Al2O3 by thermal treatment at 600 degrees C for 5 h. The nanowires of Al2O3 exhibited excellent thermal stability by retarding the phase transformation and maintaining the wires-like nanostructure after being aged up to 1300 degrees C by preventing sintering between particles at high temperatures. The surface areas of Al2O3 nanowires could be maintained as high as 68 m2/g at 1300 degrees C while the surface areas of Al2O3 micropowder shrank to 0.89 m2/g after same thermal treatment. Both in-situ XRD and 27Al NMR results indicated that the crystal structure of gamma-Al2O3 nanowires was not transformed to alpha-Al2O3 at 1300 degrees C whereas micropowder Al2O3 was fully converted to alpha-Al2O3 at 1100 degrees C. PMID:17685289

  10. Trace element determination by combining solid-phase microextraction hyphenated to elemental and molecular detection techniques.

    PubMed

    Díez, Sergi; Bayona, Josep M

    2006-08-01

    The state of the art of analytical procedures based on solid-phase microextraction (SPME) and its applications to tin, mercury, arsenic, antimony, chromium, selenium, and lead determination in abiotic and biotic matrixes are critically reviewed from 1994 to present. First, sample pretreatment prior to SPME is evaluated, including a description of the most usual leaching procedures for sediment, soil, and biological samples. Because most organometallic species lack volatility, a derivatization step is mandatory prior to gas chromatographic (GC) determination, except for the volatile organometallics that can be directly extracted from the sample headspace or liquid phase by SPME. The most common derivatization procedures used in alkylation and hydridization reactions used for mercury, lead, and tin, as well as other procedures for the determination of total chromium and arsenic [i.e., trifluoroacetylacetonates for chromium (III) and thioglycol methylate for organic arsenic species] are reviewed. Critical variables usually evaluated along with the method development to improve the sensitivity of the extraction methods based on SPME, such as sampling size, stirring procedures, sampling temperature and pressure, polymer coating, and thermal desorption are reviewed. In addition, figures of merit of the different detection systems used in SPME combined with GC are evaluated. The validation of the reported analytical procedures with reference materials are also discussed in terms of precision and accuracy. Finally, future developments in the application of SPME to speciation are highlighted. Moreover, the capability of SPME automation for the derivatization-extraction procedures are also presented. PMID:16925944

  11. Liquid-solid phase transition alloy as reversible and rapid molding bone cement.

    PubMed

    Yi, Liting; Jin, Chao; Wang, Lei; Liu, Jing

    2014-12-01

    Acrylic bone cement has been an essential non-metallic implant used as fixing agent in the cemented total joint arthroplasty (THA). However, the currently available materials based mainly on polymethylmethacrylate (PMMA) still encounter certain limitations, such as time-consuming polymerization, thermal and chemical necrosis and troublesome revision procedure. Here from an alternative way, we proposed for the first time to adopt the injectable alloy cement to address such tough issues through introducing its unique liquid-solid phase transition mechanism. A typical cement along this way is thus made of an alloy Bi/In/Sn/Zn with a specifically designed low melting point 57.5 °C, which enables its rapid molding into various desired shapes with high plasticity and ultimate metallic behaviors. The fundamental characteristics including the mechanical strength, biocompatibility and phase transition-induced thermal effects have been clarified to demonstrate the importance of such alloy as unconventional cement with favorable merits. In addition, we also disclosed its advantage as an excellent contrast agent for radiation imaging on the bone interior structure which is highly beneficial for guiding the surgery and monitoring the therapeutic effects. Particularly, the proposed alloy cement with reversible phase transition feature significantly simplifies the revision of the cement and prosthesis. This study opens the way for employing the injectable alloy materials as reversible bone cement to fulfill diverse clinical needs in the coming time. PMID:25239039

  12. Graphene-coated fiber for solid-phase microextraction of triazine herbicides in water samples.

    PubMed

    Wu, Qiuhua; Feng, Cheng; Zhao, Guangying; Wang, Chun; Wang, Zhi

    2012-01-01

    Graphene is a novel and interesting carbon material that could be used for the separation and purification of some chemical compounds. In this investigation, graphene was used as a novel fiber-coating material for the solid-phase microextraction (SPME) of four triazine herbicides (atrazine, prometon, ametryn and prometryn) in water samples. The main parameters that affect the extraction and desorption efficiencies, such as the extraction time, stirring rate, salt addition, desorption solvent and desorption time, were investigated and optimized. The optimized SPME by graphene-coated fiber coupled with high-performance liquid chromatography-diode array detection (HPLC-DAD) was successfully applied for the determination of the four triazine herbicides in water samples. The linearity of the method was in the range from 0.5 to 200 ng/mL, with the correlation coefficients (r) ranging from 0.9989 to 0.9998. The limits of detection of the method were 0.05-0.2 ng/mL. The relative standard deviations varied from 3.5 to 4.9% (n=5). The recoveries of the triazine herbicides from water samples at spiking levels of 20.0 and 50.0  ng/mL were in the range between 86.0 and 94.6%. Compared with two commercial fibers (CW/TPR, 50 μm; PDMS/DVB, 60 μm), the graphene-coated fiber showed higher extraction efficiency.

  13. Study on the Diffusion-Dominated Solid-Phase Microextraction Kinetics in Semisolid Sample Matrix.

    PubMed

    Xu, Jianqiao; Huang, Shuyao; Wei, Songbo; Yang, Muzi; Cao, Chenyang; Jiang, Ruifen; Zhu, Fang; Ouyang, Gangfeng

    2016-09-20

    Solid-phase microextraction (SPME) kinetics in semisolid samples should be different from that in aqueous and gaseous samples, as convection is negligible in semisolid samples but dominates mass transfer in bulk phases of aqueous and gaseous samples. This study developed a mathematical model for describing SPME kinetics in semisolid samples by considering the diffusion of analytes in two compartments, i.e., the fiber coating and the ever-increasing diffusion domain in the sample matrix. The mathematical model predicted that SPME and the desorption of preloaded analytes from the fiber would be isotropic in semisolid samples, while SPME in semisolid samples would not follow the first order kinetics as in aqueous and gaseous samples. The predictions were proven true in the experiment of four pharmaceuticals in agarose gel. In return, it was observed in the experiment that SPME kinetics would deviate more significantly from the first order kinetics for the analytes with higher partition coefficients between the fiber and the sample matrix, which was well explained by the mathematical model developed in this study. In addition, SPME kinetics predicted by the model coincided well with the experimental results when the diffusion coefficients were at reasonable levels, which demonstrated that the model could be satisfactory for describing SPME kinetics in semisolid samples. The illustration of the nonfirst order SPME kinetics in semisolid samples can be valuable for evaluating the applicability of the existing pre-equilibrium calibration methods in semisolid samples. PMID:27563716

  14. Solid Phase Extraction for Monitoring of Occupational Exposure to Cr (III)

    PubMed Central

    Shahtaheri, S.J.; Khadem, M.; Golbabaei, F.; Rahimi-Froushani, A.

    2007-01-01

    Chromium is an important constituent widely used in different industrial processes for production of various synthetic materials. For evaluation of workers’ exposure to trace toxic metal of Cr (III), environmental and biological monitoring are essential processes, in which, preparation of samples is one of the most time-consuming and error-prone aspects prior to analysis. The use of solid-phase extraction (SPE) has grown and is a fertile technique of sample preparation as it provides better results than those produced by liquid-liquid extraction (LLE). SPE using mini columns filled with XAD-4 resin was optimized regarding to sample pH, ligand concentration, loading flow rate, elution solvent, sample volume, elution volume, amount of resins, and sample matrix interferences. Chromium was retained on solid sorbent and was eluted with 2 M HNO3 followed by simple determination of analytes by using flame atomic absorption spectrometery. Obtained recoveries of metal ion were more than 92%. The optimized procedure was also validated with three different pools of spiked urine samples and showed a good reproducibility over six consecutive days as well as six within-day experiments. Through this study, suitable results were obtained for relative standard deviation, therefore, it is concluded that, this optimized method can be considered to be successful in simplifying sample preparation for trace residue analysis of Cr in different matrices for evaluation of occupational and environmental exposures. To evaluate occupational exposure to chromium, 16 urine samples were taken, prepared, and analyzed based on optimized procedure. PMID:19662187

  15. Solid-phase microextraction to determine micropollutant-macromolecule partition coefficients.

    PubMed

    Bridle, Helen L; Heringa, Minne B; Schäfer, Andrea I

    2016-08-01

    Aqueous micropollutants such as estradiol can have a large environmental impact-even at low concentrations. Part of understanding this impact involves determining the extent to which the micropollutants interact with macromolecules in water. In environmental samples, relevant macromolecules to which micropollutants bind are referred to as dissolved organic matter, and the most common examples of these in freshwater and coastal seawater are fulvic and humic acids. In living organisms, the most common macromolecules that affect bioavailability of a drug (or toxin) are proteins such as albumin. Using [2, 4, 6, 7 - (3)H]estradiol as an example compound, this protocol uses solid-phase microextraction and scintillation detection as analytical tools to quantify the amount of radiolabeled micropollutant available in solution. The measured free concentration after exposure to various concentrations of macromolecule (dissolved organic matter or protein) or micropollutant is used to determine the partition coefficient in the case of micropollutant-macromolecule interactions. The calibration and preparatory studies take at least 8 d, and the steps to determine the partition coefficient can be completed within 3 d. The protocol could be modified such that nonlabeled compounds are studied; instead of detection of activity by a liquid scintillation counter (LSC), the compounds can be quantified using gas chromatography-mass spectrometry (GC-MS) or liquid chromatography (LC)-MS(/MS). PMID:27362336

  16. Enumerating Microorganism Surrogates for Groundwater Transport Studies Using Solid-Phase Cytometry.

    PubMed

    Stevenson, Margaret E; Blaschke, A Paul; Schauer, Sonja; Zessner, Matthias; Sommer, Regina; Farnleitner, Andreas H; Kirschner, Alexander K T

    2014-01-01

    Investigations on the pollution of groundwater with pathogenic microorganisms, e.g. tracer studies for groundwater transport, are constrained by their potential health risk. Thus, microspheres are often used in groundwater transport studies as non-hazardous surrogates for pathogenic microorganisms. Even though pathogenic microorganisms occur at low concentrations in groundwater, current detection methods of microspheres (spectrofluorimetry, flow cytometry and epifluorescence microscopy) have rather high detection limits and are unable to detect rare events. Solid-phase cytometry (SPC) offers the unique capability of reliably quantifying extremely low concentrations of fluorescently labelled microorganisms or microspheres in natural waters, including groundwater. Until now, microspheres have been used in combination with SPC only for instrument calibration purposes and not for environmental applications. In this study, we explored the limits of the SPC methodology for its applicability to groundwater transport studies. The SPC approach proved to be a highly sensitive and reliable enumeration system for microorganism surrogates down to a minimum size of 0.5 μm, in up to 500 ml of groundwater, and 0.75 μm, in up to 1 ml of turbid surface water. Hence, SPC is proposed to be a useful method for enumerating microspheres for groundwater transport studies in the laboratory, as well as in the field when non-toxic, natural products are used.

  17. Rapid fabrication of graphene on dielectric substrates via solid-phase processes

    NASA Astrophysics Data System (ADS)

    Xiong, W.; Zhou, Y. S.; Hou, W. J.; Lu, Y. F.

    2015-03-01

    To unleash the full potential of graphene in functional devices, high-quality graphene sheets and patterns are frequently required to be deposited on dielectric substrates. However, it generally calls for post-growth catalyst etching and graphene transfer steps in currently existing approaches, which are very time consuming and costly for fabricating functional graphene devices. We developed a rapid and cost-effective growth method to achieve the graphene formation directly on various kinds of dielectric substrates via a novel solid-phase transformation mechanism based on Ni/C thin films. High-quality graphene was obtained uniformly on whole surface of wafers with a controlled number of graphene layers. The monolayer graphene, as obtained, exhibits a low sheet resistance of about 50 Ω/sq and a high optical transmittance of 95.8% at 550 nm. Graphene patterns were successfully fabricated simply by either conventional photolithography or laser direct writing techniques. Various graphene patterns, including texts, spirals, line arrays, and even large-scale integrated circuit patterns, with a feature line width of 800 nm and a low sheet resistance of 205 ohm/sq, were achieved. The developed method provides a facile and cost-effective way to fabricate complex and high-quality graphene patterns directly on target substrates, which opens a door for fabricating various advanced optoelectronic devices.

  18. Volatile composition of pomegranates from 9 Spanish cultivars using headspace solid phase microextraction.

    PubMed

    Melgarejo, Pablo; Calín-Sánchez, Ángel; Vázquez-Araújo, Laura; Hernández, Francisca; Martínez, Juan José; Legua, Pilar; Carbonell-Barrachina, Ángel A

    2011-01-01

    Fruits of 9 Spanish pomegranate cultivars were analyzed for quality parameters, volatile composition, and sensory profile. Volatile compounds were extracted using headspace solid phase micro-extraction (HS-SPME) and analyzed by gas chromatography-mass spectrometry (GC-MS) and flame ionization detector (GC-FID). Twenty-one compounds were found in the headspace of fresh pomegranate juices, including aldehydes, monoterpenes, and alcohols. The most abundant compounds were hexanal, limonene, trans-2-hexenal, and cis-3-hexenol. Fruits from the cultivars Mollar Elche(ME) ME14, ME1, and ME2 presented the highest values of overall liking by the consumer panel; however, their total volatiles concentration were low compared to the other pomegranate cultivars and their color intensity was intermediate. Overall consumer liking of pomegranate juices was mainly associated with the presence of monoterpenes (α-terpineol); however, high aldehydes (trans-2-hexenal) concentrations were correlated with poor overall consumer liking. Fruits from sour-sweet cultivars (PTO7 and ADO4) could improve the quality of ME pomegranate juices due to their intense color, high monoterpenes concentrations, and their moderate sourness. Practical Application: The information provided in this study proves that sour-sweet pomegranate fruits can be used in the manufacturing of pomegranate juices and will improve the sensory quality and the volatile composition of this product.

  19. Methylation and Release of Mercury From the Solid Phase. What Comes First?

    NASA Astrophysics Data System (ADS)

    Regnell, O.

    2004-05-01

    It is a well-known fact that methylation leads to a dramatic increase in the bioavailability of mercury (Hg). All recent observations support the notion that Hg methylation is almost exclusively an anaerobic process. According to the reigning paradigm, methylation of Hg takes place in the cytoplasm of anaerobic bacteria, notably sulfate-reducing bacteria. It is believed that certain forms of inorganic divalent Hg (Hg(II)), can readily diffuse across the cell membrane. In addition, a recent study suggested that active uptake may occur when Hg is bound to low weight organic molecules. In the cytoplasm, cobalamin-dependent biochemical pathways, designed to methylate substrates other than Hg(II), are held responsible for the methylation of Hg(II). However, recent results from studies in a Swedish wetland (within the project "Svartsjoprojektet", aiming at understanding Hg dynamics in a Hg-polluted river-lake system) have led us to question whether Hg methylation does occur exclusively within cells. A provocative interpretation of our results is that methylation preceded the release of Hg from the solid phase, e.g. that Hg(II) sorbed to solid surfaces was methylated and subsequently released as methyl Hg to the sulfidic water. I will discuss this possibility in light of existing evidence that Hg methylation is an intra cellular process.

  20. [Determination of trace haloacetic acids in drinking water using ion chromatography coupled with solid phase extraction].

    PubMed

    Sun, Yingxue; Huang, Jianjun; Gu, Ping

    2006-05-01

    The combined solid phase extraction (SPE)-ion chromatography (IC) method was developed for the analysis of trace haloacetic acids (HAAs) in drinking water. The tested HAAs included monochloroacetic acid (MCAA), dichloroacetic acid (DCAA), trichloroacetic acid (TCAA), monobromoacetic acid (MBAA) and dibromoacetic acid (DBAA). For trace determination of HAAs in real drinking water samples, conditions of LiChrolut EN SPE cartridge were investigated for HAAs preconcentration and matrix elimination. Elution was carried out by 2 mL of sodium hydroxide (10 mmol/L) with the flow rate of 2 mL/min. The Dionex IonPac AS16 column (250 mm x 4 mm i. d.), a high capacity and hydroxide-selective anion-exchange column designed for the determination of polarizable anions, was chosen for chromatographic separation. HAAs were analyzed with a concentration gradient of NaOH with the flow rate of 0.8 mL/min and detected by suppressed conductivity. A 500 microL sample loop was used. The detection limits of this SPE-IC method for MCAA, DCAA, DBAA and TCAA were 0.38-1.69 microg/L and MBAA was 12.5 microg/L under 25-fold preconcentration. The results demonstrate that the method is suitable for the analysis of trace haloacetic acids in drinking water.

  1. Characterisation of whiskeys using solid-phase microextraction with gas chromatography-mass spectrometry.

    PubMed

    Fitzgerald, G; James, K J; MacNamara, K; Stack, M A

    2000-10-27

    The application of solid-phase microextraction and gas chromatography-mass spectrometry to the detection of flavour volatiles present in Irish and Scottish whiskeys was investigated. A method was developed to characterise these volatiles which included the extraction, identification and quantification of 17 congeners which included fusel alcohols, acetates and esters. The method validation produced the optimum fibre [85 microm poly(acrylate)], extraction time (35 min), sample volume size (3 ml) and desorption time (5 min). The impact of salt on the absorption process was also studied. Characteristic profiles were determined for each whiskey and the flavour congeners were quantified using 4-methyl-2-pentanol as the internal standard. Calibration ranges were determined for each of the congeners with coefficients of linearity ranging from 0.993 (butan-1-ol) to 0.999 (ethyl laurate) and relative standard deviations ranging from 2.5% (2-methylbutan-1-ol) to 21% (furfural) at a concentration of 18.2 mg/l. Detection limits ranged from 0.1 mg/l (ethyl caprate) to 21 mg/l (butan-2-ol). PMID:11093670

  2. Knitting aromatic polymers for efficient solid-phase microextraction of trace organic pollutants.

    PubMed

    Liu, Shuqin; Hu, Qingkun; Zheng, Juan; Xie, Lijun; Wei, Songbo; Jiang, Ruifen; Zhu, Fang; Liu, Yuan; Ouyang, Gangfeng

    2016-06-10

    A series of knitting aromatic polymers (KAPs) were successfully synthesized using a simple one-step Friedel-Crafts alkylation of aromatic monomers and were characterized by transmission electron microscopy (TEM), Fourier transform infrared (FTIR) spectroscopy, and X-ray photoelectron spectroscopy (XPS). Then, as-synthesized KAPs with large surface areas, unique pore structures and high thermal stability were prepared as solid-phase microextraction (SPME) coatings that exhibited good extraction abilities for a series of benzene compounds (i.e., benzene, toluene, ethylbenzene and m-xylene, which are referred to as BTEX) and polycyclic aromatic hydrocarbons (PAHs). Under the optimized conditions, the methodologies established for the determination of BTEX and PAHs using the KAPs-triPB and KAPs-B coatings, respectively, possessed wide linear ranges, low limits of detection (LODs, 0.10-1.13ngL(-1) for BTEX and 0.05-0.49ngL(-1) for PAHs) and good reproducibility. Finally, the proposed methods were successfully applied to the determination of BTEX and PAHs in environmental water samples, and satisfactory recoveries (93.6-124.2% for BTEX and 77.2-113.3% for PAHs) were achieved. This study provides a benchmark for exploiting novel microporous organic polymers (MOPs) for SPME applications. PMID:27155913

  3. Facile preparation and applications of graphitic carbon nitride coating in solid-phase microextraction.

    PubMed

    Xu, Na; Wang, Yiru; Rong, Mingcong; Ye, Zhifeng; Deng, Zhuo; Chen, Xi

    2014-10-17

    In this study, graphitic carbon nitride (g-C3N4) was used as a coating material for solid-phase microextraction (SPME) applications. Coupled to gas chromatography (GC), the extraction ability of the SPME fiber was investigated and compared with the commercial fibers of 100 μm PDMS and 85 μm CAR/PDMS using six target analytes including deltamethrin, nerolidol, amphetamine, dodecane, ametryn and acrylamide. The g-C3N4 coating revealed excellent extraction ability and durability comparing with those of the commercial fibers due to its loose structure and unique physicochemical properties. The repeatability for each single fiber was found to be 3.46% and reproducibility for fiber to fiber was 8.53%. The g-C3N4 SPME fiber was applied to the determination of acrylamide in potato chips, the linearity and detection limit was 0.5-250 μg g(-1) and 0.018 μg g(-1), respectively. PMID:25218628

  4. Solvent vapour monitoring in work space by solid phase micro extraction.

    PubMed

    Li, K; Santilli, A; Goldthorp, M; Whiticar, S; Lambert, P; Fingas, M

    2001-05-01

    Solid phase micro extraction (SPME) is a fast, solvent-less alternative to conventional charcoal tube sampling/carbon disulfide extraction for volatile organic compounds (VOC). In this work, SPME was compared to the active sampling technique in a typical lab atmosphere. Two different types of fibre coatings were evaluated for solvent vapour at ambient concentration. A general purpose 100 microm film polydimethylsiloxane (PDMS) fibre was found to be unsuitable for VOC work, despite the thick coating. The mixed-phase carboxen/PDMS fibre was found to be suitable. Sensitivity of the SPME was far greater than charcoal sorbent tube method. Calibration studies using typical solvent such as dichloromethane (DCM), benzene (B) and toluene (T) showed an optimal exposure time of 5 min, with a repeatability of less than 20% for a broad spectrum of organic vapour. Minimum detectable amount for DCM is in the range of 0.01 microg/l (0.003 ppmv). Variation among different fibres was generally within 30% at a vapour concentration of 1 microg DCM/l, which was more than adequate for field monitoring purpose. Adsorption characteristics and calibration procedures were studied. An actual application of SPME was carried out to measure background level of solvent vapour at a bench where DCM was used extensively. Agreement between the SPME and the charcoal sampling method was generally within a factor of two. No DCM concentration was found to be above the regulatory limit of 50 ppmv. PMID:11267747

  5. Knitting aromatic polymers for efficient solid-phase microextraction of trace organic pollutants.

    PubMed

    Liu, Shuqin; Hu, Qingkun; Zheng, Juan; Xie, Lijun; Wei, Songbo; Jiang, Ruifen; Zhu, Fang; Liu, Yuan; Ouyang, Gangfeng

    2016-06-10

    A series of knitting aromatic polymers (KAPs) were successfully synthesized using a simple one-step Friedel-Crafts alkylation of aromatic monomers and were characterized by transmission electron microscopy (TEM), Fourier transform infrared (FTIR) spectroscopy, and X-ray photoelectron spectroscopy (XPS). Then, as-synthesized KAPs with large surface areas, unique pore structures and high thermal stability were prepared as solid-phase microextraction (SPME) coatings that exhibited good extraction abilities for a series of benzene compounds (i.e., benzene, toluene, ethylbenzene and m-xylene, which are referred to as BTEX) and polycyclic aromatic hydrocarbons (PAHs). Under the optimized conditions, the methodologies established for the determination of BTEX and PAHs using the KAPs-triPB and KAPs-B coatings, respectively, possessed wide linear ranges, low limits of detection (LODs, 0.10-1.13ngL(-1) for BTEX and 0.05-0.49ngL(-1) for PAHs) and good reproducibility. Finally, the proposed methods were successfully applied to the determination of BTEX and PAHs in environmental water samples, and satisfactory recoveries (93.6-124.2% for BTEX and 77.2-113.3% for PAHs) were achieved. This study provides a benchmark for exploiting novel microporous organic polymers (MOPs) for SPME applications.

  6. Dynamic microwave assisted extraction coupled with dispersive micro-solid-phase extraction of herbicides in soybeans.

    PubMed

    Li, Na; Wu, Lijie; Nian, Li; Song, Ying; Lei, Lei; Yang, Xiao; Wang, Kun; Wang, Zhibing; Zhang, Liyuan; Zhang, Hanqi; Yu, Aimin; Zhang, Ziwei

    2015-09-01

    Non-polar solvent dynamic microwave assisted extraction was firstly applied to the treatment of high-fat soybean samples. In the dispersive micro-solid-phase extraction (D-µ-SPE), the herbicides in the high-fat extract were directly adsorbed on metal-organic frameworks MIL-101(Cr). The effects of several experimental parameters, including extraction solvent, microwave absorption medium, microwave power, volume and flow rate of extraction solvent, amount of MIL-101(Cr), and D-µ-SPE time, were investigated. At the optimal conditions, the limits of detection for the herbicides ranged from 1.56 to 2.00 μg kg(-1). The relative recoveries of the herbicides were in the range of 91.1-106.7%, and relative standard deviations were equal to or lower than 6.7%. The present method was simple, rapid and effective. A large amount of fat was also removed. This method was demonstrated to be suitable for treatment of high-fat samples.

  7. Altering the interfacial activation mechanism of a lipase by solid-phase selective chemical modification.

    PubMed

    López-Gallego, Fernando; Abian, Olga; Guisán, Jose Manuel

    2012-09-01

    This study presents a combined protein immobilization, directed mutagenesis, and site-selective chemical modification approach, which was used to create a hyperactivated semisynthetic variant of BTL2. Various alkane chains were tethered at three different positions in order to mimic the lipase interfacial activation exogenously triggered by detergents. Optimum results were obtained when a dodecane chain was introduced at position 320 by solid-phase site-selective chemical modification. The resulting semisynthetic variant showed a 2.5-fold higher activity than the wild-type nonmodified variant in aqueous conditions. Remarkably, this is the maximum hyperactivation ever observed for BTL2 in the presence of detergents such as Triton X-100. We present evidence to suggest that the endogenous dodecane chain hyperactivates the enzyme in a similar fashion as an exogenous detergent molecule. In this way, we also observe a faster irreversible enzyme inhibition and an altered detergent sensitivity profile promoted by the site-selective chemical modification. These findings are also supported by fluorescence studies, which reveal that the structural conformation changes of the semisynthetic variant are different to those of the wild type, an effect that is more pronounced in the presence of detergent. Finally, the optimal immobilized semisynthetic variant was successfully applied to the selective synthesis of oxiran-2-yl butyrate. Significantly, this biocatalyst is 12-fold more efficient than the immobilized wild-type enzyme, producing the S-enantiomer with higher enantiospecificity (ee = 92%). PMID:22876885

  8. Isothermal solid-phase amplification system for detection of Yersinia pestis.

    PubMed

    Mayboroda, Olena; Gonzalez Benito, Angel; Sabaté del Rio, Jonathan; Svobodova, Marketa; Julich, Sandra; Tomaso, Herbert; O'Sullivan, Ciara K; Katakis, Ioanis

    2016-01-01

    DNA amplification is required for most molecular diagnostic applications, but conventional polymerase chain reaction (PCR) has disadvantages for field testing. Isothermal amplification techniques are being developed to respond to this problem. One of them is the recombinase polymerase amplification (RPA) that operates at isothermal conditions without sacrificing specificity and sensitivity in easy-to-use formats. In this work, RPA was used for the optical detection of solid-phase amplification of the potential biowarfare agent Yersinia pestis. Thiolated forward primers were immobilized on the surface of maleimide-activated microtitre plates for the quantitative detection of synthetic and genomic DNA, with elongation occurring only in the presence of the specific template DNA and solution phase reverse primers. Quantitative detection was achieved via the use of biotinylated reverse primers and post-amplification addition of streptavidin-HRP conjugate. The overall time of amplification and detection was less than 1 h at a constant temperature of 37 °C. Single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) sequences were detected, achieving detection limits of 4.04*10(-13) and 3.14*10(-16) M, respectively. The system demonstrated high specificity with negligible responses to non-specific targets.

  9. Isothermal solid-phase amplification system for detection of Yersinia pestis.

    PubMed

    Mayboroda, Olena; Gonzalez Benito, Angel; Sabaté del Rio, Jonathan; Svobodova, Marketa; Julich, Sandra; Tomaso, Herbert; O'Sullivan, Ciara K; Katakis, Ioanis

    2016-01-01

    DNA amplification is required for most molecular diagnostic applications, but conventional polymerase chain reaction (PCR) has disadvantages for field testing. Isothermal amplification techniques are being developed to respond to this problem. One of them is the recombinase polymerase amplification (RPA) that operates at isothermal conditions without sacrificing specificity and sensitivity in easy-to-use formats. In this work, RPA was used for the optical detection of solid-phase amplification of the potential biowarfare agent Yersinia pestis. Thiolated forward primers were immobilized on the surface of maleimide-activated microtitre plates for the quantitative detection of synthetic and genomic DNA, with elongation occurring only in the presence of the specific template DNA and solution phase reverse primers. Quantitative detection was achieved via the use of biotinylated reverse primers and post-amplification addition of streptavidin-HRP conjugate. The overall time of amplification and detection was less than 1 h at a constant temperature of 37 °C. Single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) sequences were detected, achieving detection limits of 4.04*10(-13) and 3.14*10(-16) M, respectively. The system demonstrated high specificity with negligible responses to non-specific targets. PMID:26563112

  10. Plasma mitomycin C concentrations determined by HPLC coupled to solid-phase extraction.

    PubMed

    Paroni, R; Arcelloni, C; De Vecchi, E; Fermo, I; Mauri, D; Colombo, R

    1997-04-01

    The aim of this study was to set up a method for quantification of plasma mitomycin C (MMC) concentrations during intravesical chemotherapy delivered in the presence of local bladder hyperthermia (HT). In comparison with existing methods, this assay, characterized by relative simplicity and efficiency, resulted in the facilitation of performance with nondedicated instrumentation or nonspecialized staff. Purification from plasma matrix was carried out by solid-phase extraction under vaccuum. The purified drug was then collected directly into the vials of the HPLC autosampler. Chromatographic analysis was performed on a reversed-phase C18 column with water:acetonitrile (85:15 by vol) as the mobile phase and the UV detector set at 365 nm. The use of porfiromycin as internal standard provided a method with good within-day precision (CV 6.0% at 5 micrograms/L, n = 6), linearity (0.5-50 micrograms/L), and specificity. The lower limit of detection (< or = 0.5 microgram/L) proved to be suitable for plasma pharmacokinetics monitoring in two tested patients treated with MMC + HT for superficial bladder cancer. PMID:9105262

  11. Determination of particulate-bound formaldehyde from burning incense by solid phase microextraction.

    PubMed

    Liou, S W; Chen, C Y; Yang, T T; Lin, J M

    2008-04-01

    This work studied the feasibility of using a solid phase microextraction (SPME) fiber for sampling and analysis of gaseous formaldehyde as well as particulate-bound formaldehyde from burning Chinese incense. The SPME fiber with PDMS/DVB coating were partially coated with o-(2,3,4,5,6-pentafluorobenzyl)-hydroxylamine hydrochloride (PFBHA), and used for sampling formaldehyde. The sampling rate for formaldehyde and its dependence on temperature, relative humidity and sampling time were observed. The same PFBHA treated fibers were, in parallel, exposed to incense burning smoke with pre-filtration and without pre- filtration for 0.5-1 min. The NIOSH method 2541 using an XAD-2 tube at a flow rate of 0.1 Lpm was also applied for sampling simultaneously. The results demonstrate that commercially available PDMS/DVB fibers partially coated with PFBHA are capable of sampling the gas phase of formaldehyde as well as particulate-bound formaldehyde. The determined level of formaldehyde was close to the result obtained by the NIOSH method 2541. However, a reduction of the fiber's formaldehyde loading capacity in the aerosol sampling in comparison with gas sampling was noticed. This indicates that the particulate characteristics, and their bound chemicals other than formaldehyde may influence the maximum loading capacity of formaldehyde, and some characteristic particulates in high concentrations may even deteriorate the fiber coating.

  12. Case report: solid-phase platelet crossmatching to support the alloimmunized patient.

    PubMed

    O'Connell, B A

    1995-01-01

    Platelet crossmatching by a solid-phase red cell adherence assay was used to provide compatible platelets for two alloimmunized patients with leukemia. In this study, a successful platelet transfusion was defined as giving a corrected count increment (CCI) of >7,500 in a posttransfusion sample. For patient A, a total of 205 random platelet concentrates (PCs) were crossmatched. Eleven were considered compatible. These 11 PCs were transfused during five transfusion episodes. Four of the five transfusions produced CCIs of >7,500 and were considered successful. Individually, eight of the eleven units were considered in vivo compatible, and five of the eight donors of these units agreed to become apheresis donors. Platelets from three of these five apheresis donors gave CCIs of >7,500. For patient B, 1,074 random PCs were crossmatched, and 332 were considered compatible. These units were administered during 78 different transfusions. Seventy-one of these transfusion episodes resulted in CCIs of >7,500. In addition, 19 apheresis donors were identified by platelet crossmatching, and they provided platelets for 38 of 39 successful transfusions for Patient B. Platelet crossmatching should therefore be considered when a blood bank is called upon to support a refractory thrombocytopenic patient.

  13. Evaluation of a solid phase red cell adherence technique for platelet antibody screening.

    PubMed

    Lown, J A; Ivey, J G

    1991-09-01

    Solid-phase red-cell adherence (SPRCA) techniques in platelet serology are used mainly for crossmatching. A SPRCA method for general diagnostic application was evaluated in parallel with the platelet suspension immunofluorescence test (PIFT). Of 149 patient sera sent for investigation of thrombocytopaenia, 76 were negative and 59 positive when studied by both methods, eight positive by PIFT only and six positive by SPRCA only. The reactivity observed for 24 sera containing HLA antibodies tested with chloroquine-treated and untreated platelets was similar for both methods. All of 14 sera containing quinine-associated antibodies reacted strongly to both techniques in the presence of added quinine. In comparison, however, whereas all sera were nonreactive to SPRCA in the absence of added quinine, and with PIFT, seven of the sera reacted weakly. Titration studies with three examples of anti-PlA1 and five sera containing HLA antibodies generally showed a one doubling dilution lower titre with the SPRCA procedure. End-point interpretation, however, was more readily achieved with the SPRCA method. The SPRCA technique displays similar sensitivity and specificity to the PIFT and is recommended for use by routine hospital laboratories to screen platelet antibodies.

  14. Volatile composition of peppermint (Mentha piperita L.) commercial teas through solid phase extraction.

    PubMed

    Riachi, L G; Abi-Zaid, I E; Moreira, R F A; De Maria, C A B

    2012-12-01

    Volatiles from aqueous extract of peppermint commercial sachets were investigated through gas chromatography/flame ionization detection (GC/FID) and GC/mass spectrometry (MS). Samples were prepared under similar conditions as in homemade tea. Volatiles were isolated using solid phase extraction method (SPE) with Porapak Q trap followed by desorption with acetone. Estimated mean values for short and medium chain carboxylic acids (C2-C12) and ketones lay in the range of 50-64 microg kg(-1) whilst aliphatic alcohols and acyclic hydrocarbons had values lower than 6 microg kg(-1). The major volatiles were terpenes (275-382 microg kg(-1)) that reached 89 % of the total composition. A total of 16 compounds, among them dodecane, acetoin, acetol, citral, geraniol and octanoic acid have been described by the first time in peppermint tea. These findings could be attributed to the different analytical approach employed, mainly to the use of different extraction/pre-concentration techniques. Given the apparently lower proportion of terpenes in the aqueous extract it may be that the chemical properties of the peppermint essential oil are not entirely reproduced with homemade tea. PMID:24020260

  15. Preparation and application of poly(dimethylsiloxane)/beta-cyclodextrin solid-phase microextraction fibers.

    PubMed

    Fu, Yue-Li; Hu, Yu-Ling; Zheng, Yan-Jie; Li, Gong-Ke

    2006-11-01

    A novel poly(dimethylsiloxane)/beta-cyclodextrin (PDMS/beta-CD) coating was prepared for solid-phase microextraction (SPME). The PDMS/beta-CD coating proved to have a porous structure, providing high surface areas and allowing for high extraction efficiency. The coating had a high thermal stability (340 degrees C) and a long lifetime due to its chemical binding to the fiber surface. Polar phenols and amines were used to evaluate the character of the coating fiber by headspace (HS) extraction and thermal desorption, followed by GC-FID analysis. Parameters that affected the extraction process were investigated; these include extraction time and temperature, desorption time, pH, and ionic strength of the solution. For phenols, the range of linearity of the method was 4-500 microg/L and the LOD was 1.3-2.1 microg/L. For amines, the range of linearity was 1-1000 microg/L and the LOD was 1.2-2.8 microg/L. The presence of beta-CD not only increases the thermal stability of the fiber coating, but also enhances its selectivity. Compared with commercially available SPME fibers, the new phases show better selectivity and sensitivity towards polar compounds. PMID:17313110

  16. Application of low-temperature glassy carbon films in solid-phase microextraction.

    PubMed

    Giardina, M; Olesik, S V

    2001-12-15

    Low-temperature glassy carbon (LTGC) films were investigated as a sorbent coating for solid-phase microextraction because of its uniquely selective adsorptive characteristics. The selectivity of these coatings is primarily controlled by shape characteristics of the solute molecule and the final processing temperature used to form the LTGC, demonstrating unique adsorptive characteristics compared to commercial phases. The LTGC films were prepared by first coating porous silica particles with a diethylnyl oligomer precursor and then heat curing at temperatures between 300 and 1000 degrees C to form the LTGC. Then, using a sol-gel process, the LTGC-coated silica particles were immobilized onto stainless steel fibers and subsequently used for headspace and liquid extractions followed by GC-FID analysis. The selectivity of the LTGC is demonstrated by the extraction of a variety of aromatic hydrocarbons as well as the taste and odor contaminants geosmin, 2-methylisoborneol, and 2,4,6-trichloroanisole commonly found in water supplies. The data show that the LTGC coating has the highest affinity for molecules with the greatest cross-sectional surface area and polarizability and that this selective mechanism increases as a function of LTGC processing temperature. PMID:11791552

  17. A sol-gel based solid phase microextraction fiber for analysis of aromatic hydrocarbons.

    PubMed

    Farhadi, Khalil; Mamaghanian, Maliheh; Maleki, Ramin

    2008-04-01

    A sol-gel based solid phase microextraction fiber for headspace sampling (HP-SPME) and GC determination of benzene, toluene, ethylbenzene and xylenes (BTEX) is introduced. The influences of fiber composition, microextraction conditions such as temperature and time on the fiber performance and desorption temperature and time were investigated. Under optimal conditions, the use of proposed fiber was thermally stable up to 250 degrees C and demonstrated high sensitive and fast sampling of BTEX from gaseous phase. Depending on the analysed substance, the linear range for a selected fiber and the applied GC-FID technique was from 4 to 80 ng mL(-1)with limit of detection (LOD) 0.2-0.7 ng mL(-1) and 100-1000 ng mL(-1) with LOD 8-20 ng mL(-1) for gaseous and soil samples, respectively. HP-SPME-GC analysis was highly reproducible-relative standard deviations (R.S.D.) were between 5.0 and 7.9%. The proposed fiber was successfully used for BTEX sampling from indoor air and headspace of soil samples. PMID:17804156

  18. Multiple headspace-solid-phase microextraction: an application to quantification of mushroom volatiles.

    PubMed

    Costa, Rosaria; Tedone, Laura; De Grazia, Selenia; Dugo, Paola; Mondello, Luigi

    2013-04-01

    Multiple headspace-solid phase microextraction (MHS-SPME) followed by gas chromatography/mass spectrometry (GC-MS) and flame ionization detection (GC-FID) was applied to the identification and quantification of volatiles released by the mushroom Agaricus bisporus, also known as champignon. MHS-SPME allows to perform quantitative analysis of volatiles from solid matrices, free of matrix interferences. Samples analyzed were fresh mushrooms (chopped and homogenized) and mushroom-containing food dressings. 1-Octen-3-ol, 3-octanol, 3-octanone, 1-octen-3-one and benzaldehyde were common constituents of the samples analyzed. Method performance has been tested through the evaluation of limit of detection (LoD, range 0.033-0.078 ng), limit of quantification (LoQ, range 0.111-0.259 ng) and analyte recovery (92.3-108.5%). The results obtained showed quantitative differences among the samples, which can be attributed to critical factors, such as the degree of cell damage upon sample preparation, that are here discussed. Considerations on the mushrooms biochemistry and on the basic principles of MHS analysis are also presented. PMID:23498680

  19. [Determination of phthalate esters in Baiyangdian Lake by solid phase microextraction and gas chromatography].

    PubMed

    Liu, Pengyan; Gao, Li; Shen, Jie; Liu, Wei; Cai, Lipeng

    2010-05-01

    A simple method based on solid-phase microextraction (SPME) coupled with gas chromatography-flame ionization detection (GC-FID) was developed for the determination of trace amounts of phthalate esters (PAEs) in environment water samples. In this method, polydimethylsilane (PDMS) fiber was chosen to enrich the PAEs. The PAEs were extracted for 60 min using the PDMS fiber under stirring with a magnetic stir bar, after that the fiber was introduced into the GC injector port and the extract was desorbed at 250 degrees C for 4 min. Under the optimized conditions, 13 PAEs can be extracted completely and separated well. The limits of detection (LOD) were from 0.02 to 0. 83 microg/L (S/N = 3). The water samples collected from Baiyangdian lake were successfully analyzed using the proposed method, phthalic acid, bis-isobutyl ester (DIBP), phthalic acid, bis-butyl ester (DBP) and phthalic acid, bis-2-ethylhexyl ester (DEHP) were detected in all the samples. The spiked (2.5 microg/L and 5.0 microg/L) recoveries were in the range of 75.3-111.0% and the relative standard deviations (RSDs) were between 2.1% and 8.0% (n=3). The results showed that this would be a valuable method for PAEs analysis in environmental water samples. PMID:20812632

  20. Determination of fipronil by solid-phase microextraction and gas chromatography-mass spectrometry.

    PubMed

    Vílchez, J L; Prieto, A; Araujo, L; Navalón, A

    2001-06-01

    A method for the determination of trace amounts of the insecticide fipronil was developed using solid-phase microextraction-gas chromatography-mass spectrometry and selected ion monitoring. Fipronil was extracted with a fused-silica fiber coated with 85 microm polyacrylate. The effects of pH, ionic strength, sample volume, extraction and desorption times as well as the extraction temperature were studied. Lindane was used as an internal standard. The linear concentration range of application was 0.3-100 ng ml(-1) of fipronil, with a relative standard deviation of 9.5% (for a level of 50 ng ml(-1)) and a detection limit of 0.08 ng ml(-1). The method was applied to check the eventual existence of fipronil above this limit in water and soil samples from Granada (Spain) as well as in human urine samples. The method validation was completed with spiked matrix samples. The method can be applied as a monitoring tool for water, soil and urine, in the investigation of environmental and occupational exposure to fipronil.