Sample records for mutant encoding lipoic
-
Increased flexibility in the use of exogenous lipoic acid by Staphylococcus aureus.
Laczkovich, Irina; Teoh, Wei Ping; Flury, Sarah; Grayczyk, James P; Zorzoli, Azul; Alonzo, Francis
2018-04-16
Lipoic acid is a cofactor required for intermediary metabolism that is either synthesized de novo or acquired from environmental sources. The bacterial pathogen Staphylococcus aureus encodes enzymes required for de novo biosynthesis, but also encodes two ligases, LplA1 and LplA2, that are sufficient for lipoic acid salvage during infection. S. aureus also encodes two H proteins, GcvH of the glycine cleavage system and the homologous GcvH-L encoded in an operon with LplA2. GcvH is a recognized conduit for lipoyl transfer to α-ketoacid dehydrogenase E2 subunits, while the function of GcvH-L remains unclear. The potential to produce two ligases and two H proteins is an unusual characteristic of S. aureus that is unlike most other Gram positive Firmicutes and might allude to an expanded pathway of lipoic acid acquisition in this microorganism. Here, we demonstrate that LplA1 and LplA2 facilitate lipoic acid salvage by differentially targeting lipoyl domain-containing proteins; LplA1 targets H proteins and LplA2 targets α-ketoacid dehydrogenase E2 subunits. Furthermore, GcvH and GcvH-L both facilitate lipoyl relay to E2 subunits. Altogether, these studies identify an expanded mode of lipoic acid salvage used by S. aureus and more broadly underscore the importance of bacterial adaptations when faced with nutritional limitation. © 2018 John Wiley & Sons Ltd.
-
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823
-
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
-
Yasuno, Rie; Wada, Hajime
1998-01-01
Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738
-
Soreze, Yohan; Boutron, Audrey; Habarou, Florence; Barnerias, Christine; Nonnenmacher, Luc; Delpech, Hélène; Mamoune, Asmaa; Chrétien, Dominique; Hubert, Laurence; Bole-Feysot, Christine; Nitschke, Patrick; Correia, Isabelle; Sardet, Claude; Boddaert, Nathalie; Hamel, Yamina; Delahodde, Agnès; Ottolenghi, Chris; de Lonlay, Pascale
2013-12-17
Synthesis and apoenzyme attachment of lipoic acid have emerged as a new complex metabolic pathway. Mutations in several genes involved in the lipoic acid de novo pathway have recently been described (i.e., LIAS, NFU1, BOLA3, IBA57), but no mutation was found so far in genes involved in the specific process of attachment of lipoic acid to apoenzymes pyruvate dehydrogenase (PDHc), α-ketoglutarate dehydrogenase (α-KGDHc) and branched chain α-keto acid dehydrogenase (BCKDHc) complexes. Exome capture was performed in a boy who developed Leigh disease following a gastroenteritis and had combined PDH and α-KGDH deficiency with a unique amino acid profile that partly ressembled E3 subunit (dihydrolipoamide dehydrogenase / DLD) deficiency. Functional studies on patient fibroblasts were performed. Lipoic acid administration was tested on the LIPT1 ortholog lip3 deletion strain yeast and on patient fibroblasts. Exome sequencing identified two heterozygous mutations (c.875C > G and c.535A > G) in the LIPT1 gene that encodes a mitochondrial lipoyltransferase which is thought to catalyze the attachment of lipoic acid on PDHc, α-KGDHc, and BCKDHc. Anti-lipoic acid antibodies revealed absent expression of PDH E2, BCKDH E2 and α-KGDH E2 subunits. Accordingly, the production of 14CO2 by patient fibroblasts after incubation with 14Cglucose, 14Cbutyrate or 14C3OHbutyrate was very low compared to controls. cDNA transfection experiments on patient fibroblasts rescued PDH and α-KGDH activities and normalized the levels of pyruvate and 3OHbutyrate in cell supernatants. The yeast lip3 deletion strain showed improved growth on ethanol medium after lipoic acid supplementation and incubation of the patient fibroblasts with lipoic acid decreased lactate level in cell supernatants. We report here a putative case of impaired free or H protein-derived lipoic acid attachment due to LIPT1 mutations as a cause of PDH and α-KGDH deficiencies. Our study calls for renewed efforts to understand the mechanisms of pathology of lipoic acid-related defects and their heterogeneous biochemical expression, in order to devise efficient diagnostic procedures and possible therapies.
-
2013-01-01
Background Synthesis and apoenzyme attachment of lipoic acid have emerged as a new complex metabolic pathway. Mutations in several genes involved in the lipoic acid de novo pathway have recently been described (i.e., LIAS, NFU1, BOLA3, IBA57), but no mutation was found so far in genes involved in the specific process of attachment of lipoic acid to apoenzymes pyruvate dehydrogenase (PDHc), α-ketoglutarate dehydrogenase (α-KGDHc) and branched chain α-keto acid dehydrogenase (BCKDHc) complexes. Methods Exome capture was performed in a boy who developed Leigh disease following a gastroenteritis and had combined PDH and α-KGDH deficiency with a unique amino acid profile that partly ressembled E3 subunit (dihydrolipoamide dehydrogenase / DLD) deficiency. Functional studies on patient fibroblasts were performed. Lipoic acid administration was tested on the LIPT1 ortholog lip3 deletion strain yeast and on patient fibroblasts. Results Exome sequencing identified two heterozygous mutations (c.875C > G and c.535A > G) in the LIPT1 gene that encodes a mitochondrial lipoyltransferase which is thought to catalyze the attachment of lipoic acid on PDHc, α-KGDHc, and BCKDHc. Anti-lipoic acid antibodies revealed absent expression of PDH E2, BCKDH E2 and α-KGDH E2 subunits. Accordingly, the production of 14CO2 by patient fibroblasts after incubation with 14Cglucose, 14Cbutyrate or 14C3OHbutyrate was very low compared to controls. cDNA transfection experiments on patient fibroblasts rescued PDH and α-KGDH activities and normalized the levels of pyruvate and 3OHbutyrate in cell supernatants. The yeast lip3 deletion strain showed improved growth on ethanol medium after lipoic acid supplementation and incubation of the patient fibroblasts with lipoic acid decreased lactate level in cell supernatants. Conclusion We report here a putative case of impaired free or H protein-derived lipoic acid attachment due to LIPT1 mutations as a cause of PDH and α-KGDH deficiencies. Our study calls for renewed efforts to understand the mechanisms of pathology of lipoic acid-related defects and their heterogeneous biochemical expression, in order to devise efficient diagnostic procedures and possible therapies. PMID:24341803
-
Gurvitz, Aner
2009-01-01
Our recognition of the mitochondria as being important sites of fatty acid biosynthesis is continuously unfolding, especially in light of new data becoming available on compromised fatty acid synthase type 2 (FASII) in mammals. For example, perturbed regulation of murine 17β-HSD8 encoding a component of the mitochondrial FASII enzyme 3-oxoacyl-thioester reductase is implicated in polycystic kidney disease. In addition, over-expression in mice of the Mecr gene coding for 2-trans-enoyl-thioester reductase, also of mitochondrial FASII, leads to impaired heart function. However, mouse knockouts for mitochondrial FASII have hitherto not been reported and, hence, there is a need to develop alternate metazoan models such as nematodes or fruit flies. Here, the identification of Caenorhabditis elegans W09H1.5/MECR-1 as a 2-trans-enoyl-thioester reductase of mitochondrial FASII is reported. To identify MECR-1, Saccharomyces cerevisiae etr1Δ mutant cells were employed that are devoid of mitochondrial 2-trans-enoyl-thioester reductase Etr1p. These yeast mutants fail to synthesize sufficient levels of lipoic acid or form cytochrome complexes, and cannot respire or grow on non-fermentable carbon sources. A mutant yeast strain ectopically expressing nematode mecr-1 was shown to contain reductase activity and resemble the self-complemented mutant strain for these phenotype characteristics. Since MECR-1 was not intentionally targeted for compartmentalization using a yeast mitochondrial leader sequence, this inferred that the protein represented a physiologically functional mitochondrial 2-trans-enoyl-thioester reductase. In accordance with published findings, RNAi-mediated knockdown of mecr-1 in C. elegans resulted in life span extension, presumably due to mitochondrial dysfunction. Moreover, old mecr-1(RNAi) worms had better internal organ appearance and were more mobile than control worms, indicating a reduced physiological age. This is the first report on RNAi work dedicated specifically to curtailing mitochondrial FASII in metazoans. The availability of affected survivors will help to position C. elegans as an excellent model for future pursuits in the emerging field of mitochondrial FASII research. PMID:19924289
-
Overproduction of α-Lipoic Acid by Gene Manipulated Escherichia coli
Sun, Yirong; Zhang, Wenbin; Ma, Jincheng; Pang, Hongshen; Wang, Haihong
2017-01-01
Alpha-lipoic acid (LA) is an important enzyme cofactor widely used by organisms and is also a natural antioxidant for the treatment of pathologies driven by low levels of endogenous antioxidants. In order to establish a safer and more efficient process for LA production, we developed a new biological method for LA synthesis based on the emerging knowledge of lipoic acid biosynthesis. We first cloned the lipD gene, which encodes the lipoyl domain of the E2 subunit of pyruvate dehydrogenase, allowing high levels of LipD production. Plasmids containing genes for the biosynthesis of LA were subsequently constructed utilizing various vectors and promotors to produce high levels of LA. These plasmids were transformed into the Escherichia coli strain BL21. Octanoic acid (OA) was used as the substrate for LA synthesis. One transformant, YS61, which carried lipD, lplA, and lipA, produced LA at levels over 200-fold greater than the wild-type strain, showing that LA could be produced efficiently in E. coli using genetic engineering methods. PMID:28068366
-
NASA Astrophysics Data System (ADS)
Noothalapati, Hemanth; Ikarashi, Ryo; Iwasaki, Keita; Nishida, Tatsuro; Kaino, Tomohiro; Yoshikiyo, Keisuke; Terao, Keiji; Nakata, Daisuke; Ikuta, Naoko; Ando, Masahiro; Hamaguchi, Hiro-o.; Kawamukai, Makoto; Yamamoto, Tatsuyuki
2018-05-01
α-lipoic acid (ALA) is an essential cofactor for many enzyme complexes in aerobic metabolism, especially in mitochondria of eukaryotic cells where respiration takes place. It also has excellent anti-oxidative properties. The acid has two stereo-isomers, R- and S- lipoic acid (R-LA and S-LA), but only the R-LA has biological significance and is exclusively produced in our body. A mutant strain of fission yeast, Δdps1, cannot synthesize coenzyme Q10, which is essential during yeast respiration, leading to oxidative stress. Therefore, it shows growth delay in the minimal medium. We studied anti-oxidant properties of ALA in its free form and their inclusion complexes with γ-cyclodextrin using this mutant yeast model. Both free forms R- and S-LA as well as 1:1 inclusion complexes with γ-cyclodextrin recovered growth of Δdps1 depending on the concentration and form. However, it has no effect on the growth of wild type fission yeast strain at all. Raman microspectroscopy was employed to understand the anti-oxidant property at the molecular level. A sensitive Raman band at 1602 cm-1 was monitored with and without addition of ALAs. It was found that 0.5 mM and 1.0 mM concentrations of ALAs had similar effect in both free and inclusion forms. At 2.5 mM ALAs, free forms inhibited the growth while inclusion complexes helped in recovered. 5.0 mM ALA showed inhibitory effect irrespective of form. Our results suggest that the Raman band at 1602 cm-1 is a good measure of oxidative stress in fission yeast.
-
Tamilselvan, Jayavelu; Sivarajan, Kumarasamy; Anusuyadevi, Muthuswamy; Panneerselvam, Chinnakkannu
2007-09-01
The release of mitochondrial cytochrome c followed by activation of caspase cascade has been reported with aging in various tissues, whereas little is known about the caspase-independent pathway involved in mitochondrial dysfunction. To determine the functional impact of cytochrome c loss on mitochondrial respiratory capacity, we monitored NADH redox transitions and oxygen consumption in isolated skeletal muscle mitochondria of 4- and 24-month-old rats in the presence and absence of exogenous cytochrome c; and assessed the efficacy of cosupplementation of carnitine and lipoic acid on age-related alteration in mitochondrial respiration. The loss of mitochondrial cytochrome c with age was accompanied with alteration in respiratory transition, which in turn was not rescued by exogenous addition of cytochrome c to isolated mitochondria. The analysis of mitochondrial and nuclear-encoded cytochrome c oxidase subunits suggests that the decreased levels of cytochrome c oxidase may be attributed for the irresponsiveness to exogenously added cytochrome c on mitochondrial respiratory transitions, possibly through reduction of upstream electron carriers. Oral supplementation of carnitine and lipoic acid to aged rats help to maintaining the mitochondrial oxidative capacity by regulating the release of cytochrome c and improves cytochrome c oxidase transcript levels. Thus, carnitine and lipoic acid supplementation prevents the loss of cytochrome c and their associated decline in cytochrome c oxidase activity; thereby, effectively attenuating any putative decrease in cellular energy and redox status with age.
-
PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.
Feng, Youjun; Cronan, John E
2014-01-01
Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
-
Hirshfield, Irvin
2016-01-01
Small colony variants (SCVs) can be defined as a naturally occurring sub-population of bacteria characterized by their reduced colony size and distinct biochemical properties. SCVs of Staphylococcus aureus have been studied extensively over the past two decades due to their role in recurrent human infections. However, little work has been done on SCVs of Escherichia coli, and this work has focused on the physiology and morphology that define these colonies of E. coli, such as small size and slow growth. E. coli strain JW0623, has a null lipA mutation in the lipoic acid synthase gene (lipA), and is a lipoic acid auxotroph. When the mutant was grown in LB medium to log phase, it showed remarkable resistance to acid (pH 3), hydrogen peroxide, heat and osmotic stress compared to its parent BW25113. Using RT-PCR and real time RT-PCR, the expression of certain genes was compared in the two strains in an attempt to create a molecular profile of Escherichia coli SCVs. These include genes involved in glycolysis, TCA cycle, electron transport, iron acquisition, biofilm formation and cyclopropane fatty acid synthesis. It was also demonstrated that the addition of 5 μg/ml of lipoic acid to LB medium allows for the phenotypic rescue of the mutant; reversing its slow growth, its resistance characteristics, and elevated gene expression. These results indicate that the mutation in lipA leads to an E. coli SCV that resembles an electron transport defective SCV of S. aureus These strains are typically auxotrophs, and are phenotypically rescued by adding the missing metabolite to rich medium. There are global shifts in gene expression which are reversible and depend on whether the auxotrophic molecule is absent or present. Looking at the E. coli SCV from an evolutionary point of view, it becomes evident that its path to survival is to express genes that confer stress resistance. PMID:27310825
-
Evaluation of lipoic acid topical application on rats skin wound healing.
Külkamp-Guerreiro, Irene Clemes; Souza, Marielly Nunes; Bianchin, Mariana Domingues; Isoppo, Mateus; Freitas, Joana Sachetti; Alves, João Alex; Piovezan, Anna Paula; Pohlmann, Adriana Raffin; Guterres, Sílvia Stanisçuaski
2013-10-01
To evaluate the effects of lipoic acid (thioctic acid) topical application on wound healing on rats skin, and the consequences of lipoic acid nanoencapsulation on this process. The model used was the healing activity on wounds induced by surgical incision on rats skin (n = 44). The parameters analyzed (11 days) were wound healing rate and histology (vascular proliferation, polymorphonuclear or mononuclear cells, and collagen synthesis or reepithelialization), after application of free lipoic acid or lipoic acid- loaded nanocapsules. The antioxidant activity of these formulations was evaluated by lipid peroxidation test. It was demonstrated for the first time that the topical application of lipoic acid improves wound healing. On the seventh day after surgery, the animals treated with lipoic acid showed increased healing rate (60.7 ± 8.4%) compared to the negative control group (43.0 ± 17.4%), as so improvement of histological parameters. The nanoencapsulation reverted the pro-oxidant activity presented in vitro by lipoic acid, whereas diminished wound repair. The topical application of lipoic acid produced an increase in the skin wound healing, which may be related to its pro-oxidant activity. On the other hand, the nanoencapsulation of the lipoic acid reversed the pro-oxidant activity, although presented minor healing activity.
-
Physiological effect and therapeutic application of alpha lipoic acid.
Park, Sungmi; Karunakaran, Udayakumar; Jeoung, Nam Ho; Jeon, Jae-Han; Lee, In-Kyu
2014-01-01
Reactive oxygen species and reactive nitrogen species promote endothelial dysfunction in old age and contribute to the development of cardiovascular diseases such as atherosclerosis, diabetes, and hypertension. α-Lipoic acid was identified as a catalytic agent for oxidative decarboxylation of pyruvate and α-ketoglutarate in 1951, and it has been studied intensively by chemists, biologists, and clinicians who have been interested in its role in energetic metabolism and protection from reactive oxygen species-induced mitochondrial dysfunction. Consequently, many biological effects of α-lipoic acid supplementation can be attributed to the potent antioxidant properties of α-lipoic acid and dihydro α-lipoic acid. The reducing environments inside the cell help to protect from oxidative damage and the reduction-oxidation status of α-lipoic acid is dependent upon the degree to which the cellular components are found in the oxidized state. Although healthy young humans can synthesize enough α-lipoic acid to scavenge reactive oxygen species and enhance endogenous antioxidants like glutathione and vitamins C and E, the level of α-lipoic acid significantly declines with age and this may lead to endothelial dysfunction. Furthermore, many studies have reported α-lipoic acid can regulate the transcription of genes associated with anti-oxidant and anti-inflammatory pathways. In this review, we will discuss recent clinical studies that have investigated the beneficial effects of α-lipoic acid on endothelial dysfunction and propose possible mechanisms involved.
-
Yamasaki, Masao; Iwase, Masahiro; Kawano, Kazuo; Sakakibara, Yoichi; Suiko, Masahito; Nishiyama, Kazuo
2012-05-01
Here, we focused on the effects of racemic α-lipoic acid on proliferation and adhesion properties of 3Y1 rat fibroblasts and the v-H-ras-transformed derivative, HR-3Y1-2 cells. Racemic α-lipoic acid inhibited proliferation of HR-3Y1-2 but not 3Y1 cells at 0.3 and 1.0 mM. R-(+)-α-lipoic acid also inhibited proliferation of HR-3Y1-2 cells equivalent to that of racemic α-lipoic acid. In addition, racemic α-lipoic acid decreased intracellular reactive oxygen species levels in HR-3Y1 cells but not 3Y1 cells. Next, we evaluated the effects of racemic α-lipoic acid on cell adhesion to fibronectin. The results indicated that racemic α-lipoic acid decreased adhesive ability of HR-3Y1-2 cells to fibronectin-coated plates. As blocking antibody experiment revealed that β1-integrin plays a key role in cell adhesion in this experimental system, the effects of racemic α-lipoic acid on the expression of β1-integrin were examined. The results indicated that racemic α-lipoic acid selectively downregulated the expression of cell surface β1-integrin expression in HR-3Y1-2 cells. Intriguingly, exogenous hydrogen peroxide upregulated cell surface β1-integrin expression in 3Y1 cells. Taken together, these data suggest that reduction of intracellular reactive oxygen species levels by α-lipoic acid could be an effective means of ameliorating abnormal growth and adhesive properties in v-H-ras transformed cells.
-
Hypotensive effect of alpha-lipoic acid after a single administration in rats.
Dudek, Magdalena; Razny, Katarzyna; Bilska-Wilkosz, Anna; Iciek, Malgorzata; Sapa, Jacek; Wlodek, Lidia; Filipek, Barbara
2016-05-01
The effect of alpha-lipoic acid on blood pressure was investigated many times in chronic studies, but there are no studies on the effect of this compound after a single administration. Alpha-lipoic acid is a drug used in diabetic neuropathy, often in obese patients, to treat hypertension. Therefore, knowledge of the potential antihypertensive effect of alpha-lipoic acid even after a single dose and possibly too much pressure reduction is interesting and useful. The mechanism of the hypotensive effect of alpha-lipoic acid was examined in normotensive rats in vivo after a single intraperitoneal administration, blood pressure in the left carotid artery of the rats was measured prior to the administration of the compounds (alpha- lipoic acid and/or glibenclamide) and 80 min thereafter. Alpha-lipoic acid at a dosage of 50 mg/kg b.w. i.p. significantly decreased the blood pressure from the 50th min after drug administration. This cardiovascular effect of this compound was reversed by glibenclamide, a selective KATP blocker. Glibenclamide alone at this dose did not significantly affect the blood pressure. Statistical significance was evaluated using two-way ANOVA. This suggests that alpha-lipoic acid affects ATP-dependent potassium channels. It is possible that this is an indirect effect of hydrogen sulfide because alpha-lipoic acid can increase its concentration. The results obtained in this study are very important because the patients taking alpha-lipoic acid may be treated for co-existing hypertension. Therefore, the possibility of blood pressure lowering by alpha-lipoic acid should be taken into account, although it does not lead to excessive orthostatic hypotension.
-
Lee, Cheng-Tse; Chang, Li-Ching; Wu, Pei-Fung
2016-06-01
This study explored that lipoic acid treatment for 24 h significantly upregulated and promoted heat shock-induced catalase expression and downregulated GPx1 messenger RNA (mRNA) expression, indicating that lipoic acid exhibits antioxidant activity in the decomposition of hydrogen peroxide by upregulating catalase expression. Moreover, lipoic acid treatment for 3 h increased and promoted heat shock-induced interleukin (IL)-6 mRNA and protein levels and that for 24 h downregulated IL-6 mRNA expression, suggesting a dual effect of lipoic acid on IL-6 regulation. Lipoic acid alone failed to increase or reduce tumor necrosis factor (TNF)-α mRNA and protein levels, whereas heat shock alone downregulated TNF-α mRNA and protein expression. These data suggest that lipoic acid does not have a proinflammatory role and that heat shock acts as an anti-inflammatory agent by downregulating TNF-α expression in C2C12 myotubes. Moreover, lipoic acid or heat shock alone upregulated the IL-6 receptor (IL-6R-α) and glycoprotein 130 (gp130) mRNA expression followed by IL-6 expression; these data indicate that the regulation of lipoic acid or heat shock is mediated by IL-6R signaling, thus suggesting that C2C12 myotubes possesses a mechanism for regulating IL-6R and gp130 expression following lipoic acid treatment or heat shock.
-
Tripathy, Joytirmay; Tripathy, Anindita; Thangaraju, Muthusamy; Suar, Mrutyunjay; Elangovan, Selvakumar
2018-05-23
Invasion and metastasis are the main cause of mortality in breast cancer. Hence, novel therapeutic interventions with high specificity toward invasion and metastasis are necessary. α-Lipoic acid showed antiproliferative and cytotoxic effects on several cancers including breast cancer. However, the effect of lipoic acid on breast cancer metastasis remains unclear. In the present study, we examined the effects of lipoic acid on the migration and invasion of MDA-MB-231 and 4 T1 breast cancer cells. Our data showed that lipoic acid effectively inhibited the colony forming ability of highly invasive MDA-MB-231 and 4 T1 cells. Moreover, the nontoxic concentrations of lipoic acid significantly reduced the migration of breast cancer cells. Lipoic acid also inhibited the TGFβ-induced angiopoietin-like 4 (ANGPTL4) expression and reduced the activity of matrix metalloproteinase-9 (MMP-9), an enzyme involved in invasion and metastasis, in both the cell lines. The inhibition of cell migration by lipoic acid is accompanied by the downregulation of FAK, ERK1/2 and AKT phosphorylation, and inhibition of nuclear translocation of β-catenin. Our data demonstrated that lipoic acid inhibited the migration and invasion of metastatic breast cancer cells at least in part through inhibiting ERK1/2 and AKT signaling. Thus, our findings show that the inhibition of TGFβ signaling is a potential mechanism for the anti-invasive effects of lipoic acid. Copyright © 2017. Published by Elsevier Inc.
-
Ozgun, E; Ozgun, G S; Gokmen, S S; Eskıocak, S; Sut, N; Akıncı, M; Goncu, E; Cakır, E
2016-02-05
The aim of the present study was to investigate the effect of streptozotocin-induced diabetes mellitus and lipoic acid treatment on serum paraoxonase-1 and paraoxonase-3 protein levels and paraoxonase, arylesterase and lactonase activities.36 rats were equally and randomly divided into 4 groups as control, lipoic acid, diabetes and diabetes+lipoic acid. To induce diabetes, a single dose of streptozotocin (40 mg/kg) was injected intraperitoneally to diabetes and diabetes+lipoic acid groups. Lipoic acid (10 mg/kg/day) was injected intraperitoneally for 14 days to lipoic acid and diabetes+lipoic acid groups. Serum PON1 and PON3 protein levels were measured by western blotting. Serum paraoxonase, arylesterase and lactonase activities were determined by the measuring initial rate of substrate (paraoxon, phenylacetate and dihydrocoumarin) hydrolysis.Streptozotocin-induced diabetes mellitus caused a significant decrease whereas lipoic acid treatment caused a significant increase in serum PON1 and PON3 protein levels and paraoxonase, arylesterase and lactonase activities. The increase percent of serum PON3 protein was higher than that of serum PON1 protein and the increase percent of serum lactonase activity was higher than that of serum paraoxonase and arylesterase activities in diabetes+lipoic acid group.We can report that, like PON1 protein, PON3 protein and actually its lactonase activity may also have a role as an antioxidant in diabetes mellitus and lipoic acid treatment may be useful for the prevention of the atherosclerotic complications of diabetes by increasing serum PON1 and PON3 protein levels and serum enzyme activities. © Georg Thieme Verlag KG Stuttgart · New York.
-
Ide, Takashi; Tanaka, Ai
2017-12-01
Dietary perilla oil rich in α-linolenic acid and α-lipoic acid lowers the serum lipid level through changes in hepatic fatty acid metabolism. We therefore hypothesized that the combination of these dietary factors may ameliorate lipid metabolism more than the factors individually. Moreover, α-lipoic acid exerts strong anti-oxidative activity. Hence, we also hypothesized that α-lipoic acid may attenuate perilla oil-mediated oxidative stress. We therefore studied the combined effects of perilla oil and α-lipoic acid on lipid metabolism and parameters of oxidative stress. Male rats were fed diets supplemented with 0 or 2.0 g/kg R-α-lipoic acid and containing 120 g/kg of palm (saturated fat), corn (linoleic acid), or perilla oil (α-linolenic acid) for 23 days. Perilla oil compared with other fats decreased serum lipid concentrations in rats fed α-lipoic acid-free diets; however, the combination of perilla oil with α-lipoic acid was ineffective for observing more marked decreases in serum lipid levels. Alterations in hepatic fatty acid synthesis and oxidation may account for the observed changes. Perilla oil, compared with palm and corn oils, strongly increased the malondialdehyde level in the serum and liver. α-Lipoic acid counteracted the increases in these parameters even though the effects were attenuated in the liver. α-Lipoic acid increased the parameters of the anti-oxidant system. The results suggested that α-lipoic acid can ameliorate oxidative stress induced by perilla oil, but the combination of these dietary factors was ineffective for additionally reducing serum lipid levels. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Ide, Takashi
2018-06-01
We studied the combined effect of fish oil and α-lipoic acid on hepatic lipogenesis and fatty acid oxidation and parameters of oxidative stress in rats fed lipogenic diets high in sucrose. A control diet contained a saturated fat (palm oil) that gives high rate of hepatic lipogenesis. Male Sprague-Dawley rats were fed diets supplemented with 0 or 2.5 g/kg α-lipoic acid and containing 0, 20, or 100 g/kg fish oil, for 21 days. α-Lipoic acid significantly reduced food intake during 0-8 days but not the later period of the experiment. Fish oil and α-lipoic acid decreased serum lipid concentrations and their combination further decreased the parameters in an additive fashion. The combination of fish oil and α-lipoic acid decreased the activity and mRNA levels of hepatic lipogenic enzymes in an additive fashion. Fish oil increased the parameters of hepatic fatty acid oxidation enzymes. α-Lipoic acid appeared to antagonize the stimulating effects of fish oil of fatty acid oxidation through reductions in the activity of some fatty acid oxidation enzymes. α-Lipoic acid attenuated fish oil-dependent increases in serum and liver malondialdehyde levels, and this compound also reduced the serum 8-hydroxy-2'-deoxyguanosine level. α-Lipoic acid affected various parameters related to the antioxidant system; fish oil also affected some of the parameters. The combination of fish oil and α-lipoic acid effectively reduced serum lipid levels through the additive down-regulation of hepatic lipogenesis. α-Lipoic acid was effective in attenuating fish oil-mediated oxidative stress.
-
Zorzoli, Azul; Grayczyk, James P; Alonzo, Francis
2016-10-01
To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental in dictating pathogen proclivity for an infectious niche.
-
Alonzo, Francis
2016-01-01
To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental in dictating pathogen proclivity for an infectious niche. PMID:27701474
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
El-Gowelli, Hanan M., E-mail: dr_Hanan_el_gowali@hotmail.com; Saad, Evan I.; Abdel-Galil, Abdel-Galil A.
In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5 mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associatedmore » with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients. - Highlights: • Lipoic acid is more effective than cyclosporine in protection against colitis. • Lipoic acid elevates colon antioxidant defensive mechanism and reduces inflammation. • Co-administration of lipoic acid and cyclosporine aggravates colon damage. • NO/COX-2/miR-210 elevations mediate cyclosporine–lipoic acid interaction.« less
-
Tatar, A; Korkmaz, M; Yayla, M; Gozeler, M S; Mutlu, V; Halici, Z; Uslu, H; Korkmaz, H; Selli, J
2016-07-01
To investigate the anti-inflammatory, anti-oxidative and tissue protective effects, as well as the potential therapeutic role, of alpha-lipoic acid in experimentally induced acute otitis media. Twenty-five guinea pigs were assigned to one of five groups: a control (non-otitis) group, and otitis-induced groups treated with saline, penicillin G, alpha-lipoic acid, or alpha-lipoic acid plus penicillin G. Tissue samples were histologically analysed, and oxidative parameters in tissue samples were measured and compared between groups. The epithelial integrity was better preserved, and histological signs of inflammation and secretory metaplasia were decreased, in all groups compared to the saline treated otitis group. In the alpha-lipoic acid plus penicillin G treated otitis group, epithelial integrity was well preserved and histological findings of inflammation were significantly decreased compared to the saline, penicillin G and alpha-lipoic acid treated otitis groups. The most favourable oxidative parameters were observed in the control group, followed by the alpha-lipoic acid plus penicillin G treated otitis group. Alpha-lipoic acid, with its antioxidant, anti-inflammatory and tissue protective properties, may decrease the clinical sequelae and morbidity associated with acute otitis media.
-
Wang, Xiao-Tong; Lin, Hai-Xiong; Xu, Shu-Ai; Lu, Ying-Kun
2017-10-30
Objective To compare the clinical effectiveness of lipoic acid combined with epalrestat versus lipoic acid in treating diabetic peripheral neuropathy(DPN). Methods Randomized controlled trials(RCTs) and clinical controlled trials on lipoic acid versus epalrestat for DPN before February 2016 were searched through five databases:CNKI,CBM,VIP,Wanfang,and PubMed. The quality of the included trials were assessed using Cochrane software and Jadad scores. Data were analyzed with Review Manager 5.3 software. Results Nine studies were included in the analysis. Meta analysis showed that the lipoic aid monotherapy was significantly inferior to lipoic acid-epalerestat combination therapy [RR=0.58,95%Cl(0.47,0.71),P<0.00001]. Inferiority of the lipoic acid monotherapy was also shown in nerve conduction velocity with WMDs of-4.94 [95%Cl(-7.41,-2.46),P<0.0001] for median motor nerve conduction velocity(MNCV),-5.08 [95%Cl(-7.68,-2.49),P=0.0001] for peroneal MNCV,-4.24 [95%Cl(-6.20,-2.29),P<0.0001] for median sensory nerve conduction velocity(SNCV),and-3.66 [95%Cl(-5.02,-2.31),P<0.00001] for peroneal SNCV. Sensitivity analysis showed that the results were robust. However,the included trials were limited by simple design,few subjective indicators,and short follow-up time. Conclusions Lipoic acid combined with epalrestat is better than lipoic acid alone in the treatment of DPN,as well as the MNCV and SNCV of median or peroneal nerve. Due to the low quality of the included studies,high-quality RCTs are warranted to validate the results.
-
The effect of alpha-lipoic acid on mitochondrial superoxide and glucocorticoid-induced hypertension.
Ong, Sharon L H; Vohra, Harpreet; Zhang, Yi; Sutton, Matthew; Whitworth, Judith A
2013-01-01
To examine the effect of alpha-lipoic acid, an antioxidant with mitochondrial superoxide inhibitory properties, on adrenocorticotrophic hormone- (ACTH-HT) and dexamethasone-induced hypertensions (DEX-HT) in rats and if any antihypertensive effect is mediated via mitochondrial superoxide inhibition. In a prevention study, rats received ground food or alpha-lipoic-acid-laced food (10 mg/rat/day) for 15 nights. Saline, adrenocorticotrophic hormone (ACTH, 0.2 mg/kg/day), or dexamethasone (DEX, 10 μ g/rat/day) was injected subcutaneously from day 5 to day 11. In a reversal study, rats received alpha-lipoic-acid-laced food 4 days after commencement of saline or DEX. Tail-cuff systolic blood pressure (SBP) was measured second daily. Kidney mitochondrial superoxide was examined using (MitoSOX) Red (MitoSOX) via flow cytometry. SBP was increased by ACTH (P < 0.0005) and DEX (P < 0.0005). Alpha-lipoic acid alone did not alter SBP. With alpha-lipoic acid pretreatment, SBP was increased by ACTH (P' < 0.005) but not by DEX. Alpha-lipoic partially prevented ACTH-HT (P' < 0.0005) and fully prevented DEX-HT (P' < 0.0005) but failed to reverse DEX-HT. ACTH and DEX did not increase MitoSOX signal. In ACTH-hypertensive rats, high-dose alpha-lipoic acid (100 mg/rat/day) did not decrease SBP further but raised MitoSOX signal (P < 0.001), suggesting prooxidant activity. Glucocorticoid-induced hypertension in rats is prevented by alpha-lipoic acid via mechanisms other than mitochondrial superoxide reduction.
-
Effects of two antioxidants; α-lipoic acid and fisetin against diabetic cataract in mice.
Kan, Emrah; Kiliçkan, Elif; Ayar, Ahmet; Çolak, Ramis
2015-02-01
The purpose of this study was to determine whether α-lipoic acid and fisetin have protective effects against cataract in a streptozotocin-induced experimental cataract model. Twenty-eight male BALB/C mice were made diabetic by the intraperitoneal administration of streptozotocin (200 mg/kg). Three weeks after induction of diabetes, mice were divided randomly into 4 groups in which each group contained 7 mice; fisetin-treated group (group 1), α-lipoic acid-treated group (group 2), fisetin placebo group (group 3), α-lipoic acid placebo group (group 4). Fisetin and α-lipoic acid were administered intraperitoneally weekly for 5 weeks. Cataract development was assessed at the end of 8 weeks by slit lamp examination, and cataract formation was graded using a scale. All groups developed at least grade 1 cataract formation. In the fisetin-treated group, the cataract stages were significantly lower than in the placebo group (p = 0.02). In the α-lipoic acid-treated group, the cataract stages were lower than in the placebo group but it did not reach to a significant value. Both fisetin and α-lipoic acid had a protective effect on cataract development in a streptozotocin-induced experimental cataract model. The protective effect of fisetin appears as though more effective than α-lipoic acid.
-
Effects of lipoic Acid on acrylamide induced testicular damage.
Lebda, Mohamed; Gad, Shereen; Gaafar, Hossam
2014-06-01
Acrylamide is very toxic to various organs and associated with significant increase of oxidative stress and depletion of antioxidants. Alpha-lipoic acid enhances cellular antioxidant defense capacity, thereby protecting cells from oxidative stress. This study aimed to evaluate the protective role of alpha-lipoic acid on the oxidative damage induced by acrylamide in testicular and epididymal tissues. Forty adult male rats were divided into four groups (10 rats each). Control group; acrylamide treated group administered acrylamide 0.05% (w/v) in drinking water for 21 days; alpha-lipoic acid group received basal diet supplemented with 1% alpha-lipoic acid and forth group was exposed to acrylamide and treated with alpha-lipoic acid at the same doses and treatment regimen mentioned before. The administration of acrylamide resulted in significant elevation in testicular and epididymal malondialdehyde level (MDA) and significant reduction in the level of reduced glutathione (GSH) and the activities of glutathione-S-transferase (GST), glutathione peroxidase (GPX) and glutathione reductase (GR). Also, acrylamide significantly reduced serum total testosterone and progesterone but increased estradiol (E2) levels. Treatment with alpha-lipoic acid prior to acrylamide induced protective effects and attenuated these biochemical changes. Alpha-lipoic acid has been shown to possess antioxidant properties offering promising efficacy against oxidative stress induced by acrylamide administration.
-
Effect of lipoic acid combined with paclitaxel on breast cancer cells.
Li, B J; Hao, X Y; Ren, G H; Gong, Y
2015-12-22
Breast cancer is the most common gynecologic tumor globally that threatens women's health. Lipoic acid is a type of antioxidant that can alleviate oxidative stress damage. Studies showed that lipoic acid could inhibit the proliferation of tumor cells in cervical cancer and colon cancer. This paper intends to explore the combined effect of lipoic acid and paclitaxel on breast cancer cells. Breast cancer MCF-7 cells were divided into four groups: control group, lipoic acid group, paclitaxel group, and a combination group. MTT was applied to detect the drugs' influence on breast cancer cell proliferation. A colony formation test was used to determine the effects on breast cancer cell clone formation rate. Western blot was performed to detect the effects on nuclear factor (NF)-κB. Lipoic acid alone can inhibit tumor cell proliferation and clone formation with time dependence. Compared with the control, paclitaxel alone can significantly suppress tumor cell proliferation and clone formation (P < 0.05). Lipoic acid and paclitaxel in combination obviously strengthened their individual inhibitory effects on tumor cells (P < 0.05). Compared with the paclitaxel alone group, the combination group exhibited more remarkable inhibitory effect (P < 0.05). Lipoic acid alone or combined with paclitaxel can inhibit NF-κB expression and inhibit breast cancer cell proliferation.
-
In vitro evaluation of α-lipoic acid-loaded lipid nanocapsules for topical delivery.
Xia, Nan; Liu, Tian; Wang, Qiang; Xia, Qiang; Bian, Xiaoli
2017-09-01
This study aimed at in vitro evaluation of α-lipoic acid-loaded lipid nanocapsules for topical delivery, which was prepared by hot high-pressure homogenisation. Stable particles could be formed and particle size was 148.54 ± 2.31 nm with polydispersity index below 0.15. Encapsulation efficiency and drug loading of α-lipoic acid were 95.23 ± 0.45% and 2.81 ± 0.37%. Antioxidant study showed α-lipoic acid could be protected by lipid nanocapsules without loss of antioxidant activity. Sustained release of α-lipoic acid from lipid nanocapsules was obtained and cumulative release was 62.18 ± 1.51%. In vitro percutaneous study showed the amount of α-lipoic acid distributed in skin was 1.7-fold than permeated. Cytotoxicity assay and antioxidant activity on L929 cells indicated this formulation had low cytotoxicity and ability of protecting cells from oxidative damage within specific concentration. These studies suggested α-lipoic acid-loaded lipid nanocapsules could be potential formulation for topical delivery.
-
Ozgun, Eray; Sayilan Ozgun, Gulben; Tabakcioglu, Kiymet; Suer Gokmen, Selma; Sut, Necdet; Eskiocak, Sevgi
2017-10-01
Paraoxonase-1 (PON1) and PON3 (PON3) are anti-atherosclerotic enzymes, synthesized primarily in liver and bound to HDL in circulation. The aim of the present study was to investigate the effects of therapeutic doses of lipoic acid on PON1 and PON3 protein levels, mRNA expression and arylesterase activity in liver. We treated HepG2 cells with 10, 40 and 200 μM lipoic acid for 72 h. Cell viability was evaluated by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide assay. PON1 and PON3 protein levels were measured by Western blotting, their mRNA expression was measured by quantitative PCR and arylesterase activity was measured spectrophotometrically. 200 µM lipoic acid caused a significant increase on PON1 and PON3 protein levels and arylesterase activity as compared with control, 10 µM and 40 µM lipoic acid-treated cells. 200 µM lipoic acid also caused a significant decrease on PON1 mRNA expression whereas on a significant increase PON3 mRNA expression as compared with control, 10 µM and 40 µM lipoic acid-treated cells. Our study showed that although lipoic acid up-regulates PON3 but down-regulates PON1 mRNA expression, it increases both PON1 and PON3 protein levels and arylesterase activity in HepG2 cells. We can report that lipoic acid may be useful for preventing atherosclerosis at therapeutic doses.
-
Combined effect of sesamin and α-lipoic acid on hepatic fatty acid metabolism in rats.
Ide, Takashi; Azechi, Ayana; Kitade, Sayaka; Kunimatsu, Yoko; Suzuki, Natsuko; Nakajima, Chihiro
2013-04-01
Dietary sesamin (1:1 mixture of sesamin and episesamin) decreases fatty acid synthesis but increases fatty acid oxidation in rat liver. Dietary α-lipoic acid lowers hepatic fatty acid synthesis. These changes can account for the serum lipid-lowering effect of sesamin and α-lipoic acid. It is expected that the combination of these compounds in the diet potentially ameliorates lipid metabolism more than the individual compounds. We therefore studied the combined effect of sesamin and α-lipoic acid on lipid metabolism in rats. Male Sprague-Dawley rats were fed diets supplemented with 0 or 2 g/kg sesamin and containing 0 or 2.5 g/kg α-lipoic acid for 22 days. Sesamin and α-lipoic acid decreased serum lipid concentrations and the combination of these compounds further decreased the parameters in an additive fashion. These compounds reduced the hepatic concentration of triacylglycerol, the lignan being less effective in decreasing this value. The combination failed to cause a stronger decrease in hepatic triacylglycerol concentration. The combination of sesamin and α-lipoic acid decreased the activity and mRNA levels of hepatic lipogenic enzymes in an additive fashion. Sesamin strongly increased the parameters of hepatic fatty acid oxidation enzymes. α-Lipoic acid antagonized the stimulating effect of sesamin of fatty acid oxidation through reductions in the activity of some fatty acid oxidation enzymes and carnitine concentration in the liver. This may account for the failure to observe strong reductions in hepatic triacylglycerol concentration in rats given a diet containing both sesamin and α-lipoic acid.
-
The Effect of Alpha-Lipoic Acid on Mitochondrial Superoxide and Glucocorticoid-Induced Hypertension
Ong, Sharon L. H.; Vohra, Harpreet; Zhang, Yi; Sutton, Matthew; Whitworth, Judith A.
2013-01-01
Aims. To examine the effect of alpha-lipoic acid, an antioxidant with mitochondrial superoxide inhibitory properties, on adrenocorticotrophic hormone- (ACTH-HT) and dexamethasone-induced hypertensions (DEX-HT) in rats and if any antihypertensive effect is mediated via mitochondrial superoxide inhibition. Methods. In a prevention study, rats received ground food or alpha-lipoic-acid-laced food (10 mg/rat/day) for 15 nights. Saline, adrenocorticotrophic hormone (ACTH, 0.2 mg/kg/day), or dexamethasone (DEX, 10 μg/rat/day) was injected subcutaneously from day 5 to day 11. In a reversal study, rats received alpha-lipoic-acid-laced food 4 days after commencement of saline or DEX. Tail-cuff systolic blood pressure (SBP) was measured second daily. Kidney mitochondrial superoxide was examined using (MitoSOX) Red (MitoSOX) via flow cytometry. Results. SBP was increased by ACTH (P < 0.0005) and DEX (P < 0.0005). Alpha-lipoic acid alone did not alter SBP. With alpha-lipoic acid pretreatment, SBP was increased by ACTH (P′ < 0.005) but not by DEX. Alpha-lipoic partially prevented ACTH-HT (P′ < 0.0005) and fully prevented DEX-HT (P′ < 0.0005) but failed to reverse DEX-HT. ACTH and DEX did not increase MitoSOX signal. In ACTH-hypertensive rats, high-dose alpha-lipoic acid (100 mg/rat/day) did not decrease SBP further but raised MitoSOX signal (P < 0.001), suggesting prooxidant activity. Conclusion. Glucocorticoid-induced hypertension in rats is prevented by alpha-lipoic acid via mechanisms other than mitochondrial superoxide reduction. PMID:23533693
-
Ozkul, Yilmaz; Songu, Murat; Basoglu, Mehmet Sinan; Ozturkcan, Sedat; Katilmis, Huseyin
2014-07-01
The aim of our study was to determine the effectiveness of intratympanic α-lipoic acid injection as an otoprotective agent against cisplatin-induced ototoxicity in guinea pigs. Twenty-four adult male albino guinea pigs with normal hearing were divided into 4 groups. The guinea pigs received intraperitoneal cisplatin in group 1, intraperitoneal cisplatin and intratympanic α-lipoic acid in group 2, intratympanic α-lipoic acid in group 3, as well as intraperitoneal cisplatin and intratympanic saline in group 4. Distortion-product otoacoustic emission measurements were obtained for both ears at the following time points: before administration (baseline recording) and on day 3 (72 h later). In group 1 (cisplatin), significant deterioration was observed at all frequencies on day 3 (P < 0.05). In group 2 (cisplatin + α-lipoic acid), deterioration was observed at all frequencies on day 3; however, this deterioration did not reach a statistical significance (P > 0.05). In group 3 (α-lipoic acid), no significant difference was observed between baseline and day 3 (P > 0.05). In group 4 (cisplatin + saline), deterioration was observed at all frequencies on day 3; however, this deterioration did not reach a statistical significance (P > 0.05). Cisplatin-induced hearing loss in the guinea pigs may be limited to some extent by the concomitant use of α-lipoic acid. Dose-dependent changes in the possible effects of α-lipoic acid need further investigation. Future morphologic studies may contribute to expose clearly the protective effect of α-lipoic acid.
-
α-Lipoic acid reduced weight gain and improved the lipid profile in rats fed with high fat diet.
Seo, Eun Young; Ha, Ae Wha; Kim, Woo Kyoung
2012-06-01
The purpose of this study was to investigate the effects of α-lipoic acid on body weight and lipid profiles in Sprague-Dawley rats fed a high fat diet (HFD). After 4 weeks of feeding, rats on the HFD were divided into three groups by randomized block design; the first group received the high-fat-diet (n = 10), and the second group received the HFD administered with 0.25% α-lipoic acid (0.25LA), and the third group received the high-fat diet with 0.5% α-lipoic acid (0.5LA). The high fat diet with α-lipoic acid supplemented groups had significantly inhibited body weight gain, compared to that in the HFD group (P < 0.05). Organ weights of rats were also significantly reduced in liver, kidney, spleen, and visible fat tissues in rats supplemented with α-lipoic acid (P < 0.05). Significant differences in plasma lipid profiles, such as total lipids, total cholesterol, triglycerides, low-density lipoprotein, and high-density lipoprotein, were observed between the HFD and 0.5LA groups. The atherogenic index and the plasma high density lipoprotein-cholesterol/total cholesterol ratio improved significantly with α-lipoic acid supplementation in a dose-dependent manner (P < 0.05). Total hepatic cholesterol and total lipid concentration decreased significantly in high fat fed rats supplemented with α-lipoic acid in a dose-dependent manner (P < 0.05), whereas liver triglyceride content was not affected. In conclusion, α-lipoic acid supplementation had a positive effect on weight gain and plasma and liver lipid profiles in rats.
-
Grasso, S; Bramanti, V; Tomassoni, D; Bronzi, D; Malfa, G; Traini, E; Napoli, M; Renis, M; Amenta, F; Avola, R
2014-01-01
Lipoic acid plays a crucial role as antioxidant and metabolic component of enzymes involved in glucose metabolism of different cell types. Choline alphoscerate (α-glyceryl-phosphoryl-choline [αGPC]) is a semisynthetic derivative of phosphatidylcholines representing, among acetilcholine precursors, a cholinergic drug. In the present study, we evaluated the expression of some proliferation and differentiation markers in 15 or 21 DIV astrocyte cultures treated with 50 μM (+)lipoic acid or (+/-)lipoic acid and/or 10 mM αGPC for 24 hr. In addition, we evaluated the possible genoprotective effect by analysis of DNA status detected by alkaline comet assay. The addition of single drugs [(+)lipoic acid, (+/-)lipoic acid, or αGPC] induced an "upward modulation" of the expression of biomarkers used in our study. On the contrary, the cotreatment with either (+)lipoic acid + αGPC or (+/-)lipoic + αGPC surprisingly showed no significant modification or even a downregulation of the above-mentioned biomarkers. This latter finding demonstrated no additional effect after the cotreatment with both drugs with respect to the single treatments alone. Further studies are necessary to clarify the specific mechanism evoked by the processing of these neuroprotective agents in our in vitro models. Finally, these preliminary findings may represent a good tool with which to clarify the antioxidant and metabolic roles played by lipoic acid in proliferating and differentiating astroglial cell cultures, during an interactive cross-talk between glial and neuronal cells, after brain lesions or damage correlated with oxidative stress that may occur in some degenerative diseases. Copyright © 2013 Wiley Periodicals, Inc.
-
Diabetes and Alpha Lipoic Acid
Golbidi, Saeid; Badran, Mohammad; Laher, Ismail
2011-01-01
Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537
-
Liu, Yang; Zhang, Qinghua; Wang, Li; Wang, Hui; Sun, Tao; Xia, Hechun; Yang, Yi; Zhang, Li
2017-12-01
This study is to clarify the protective role of α-lipoic acid in high-fat diet-induced cerebral damage mice. The mice were divided into 5 groups: normal control group, high-fat diet (HFD) group, low-dose α-lipoic acid group for prevention, high-dose α-lipoic acid group for prevention, and high-dose α-lipoic acid group for treatment. The groups' weights and blood glucose changes were monitored. We used HE staining to observe morphological changes in the cerebral cortex. The expression levels of the oxidative stress proteins SOD2, catalase, and the inflammatory pathway proteins p-JNK, p-ERK were measured by western blot and immunochemistry. Compared with the control group, the quantity of cortical neurons in the HFD group was decreased, and the samples exhibited retrogression. However, the lipoic acid significantly protected and promoted the cortical neurons survival. Moreover, compared with the HFD group, the expression levels of SOD2 and catalase in the three α-lipoic acid obtained groups were significantly increased. However, the expression levels of the inflammatory pathway proteins p-JNK and p-ERK were significantly decreased. These results indicate that theα-lipoic acid greatly protects the cortical neurons, and inhibited the oxidative stress and inflammatory reactions in the high-fat diet mice. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Xiong, Min; Lai, Huangwen; Yang, Chuanhong; Huang, Weiyi; Wang, Jian; Fu, Xiaoyan; He, Qinglian
2012-01-01
Oxidative damage is a critical role which involves hearing loss induced by impulse noise. That exogenous antioxidant agents reduce noise induced hearing loss (NIHL) has been well demonstrated in both animal studies and clinical practices. Choosing a stronger and more effective antioxidant is very important for treatment of NIHL. Vitamin E, α-lipoic acid, and radix astragali are the most commonly used anti-oxidants for cochlear oxidative damage from acoustic trauma. In this study, the protective effects of radix astragali, α-lipoic acid, and vitamin E on acute acoustic trauma are investigated. Guinea pigs in the experimental groups were intragastrically administered vitamin E, α-lipoic acid, and radix astragali. Auditory thresholds were assessed by sound-evoked auditory brainstem response (ABR) at click and tone bursts of 8, 16 and 32 kHz, 24 hours before and 72 hours after exposure to impulse noise. Cochlear malondialdehyde (MDA) concentrations were detected. Hair cell damage was analyzed by scanning electron microscopy. Vitamin E, α-lipoic acid, and radix astragali significantly reduced ABR deficits, reduced hair cell damage, and decreased the concentrations of MDA. α-lipoic acid and radix astragali were better than vitamin E, and there were no significant differences between α-lipoic acid and radix astragali. α-lipoic acid or radix astragali are recommended for treatment of NIHL.
-
McLain, Aaron L; Cormier, Peter J; Kinter, Michael; Szweda, Luke I
2013-08-01
α-Ketoglutarate dehydrogenase (KGDH) is reversibly inhibited when rat heart mitochondria are exposed to hydrogen peroxide (H2O2). H2O2-induced inhibition occurs through the formation of a mixed disulfide between a protein sulfhydryl and glutathione. Upon consumption of H2O2, glutaredoxin can rapidly remove glutathione, resulting in regeneration of enzyme activity. KGDH is a key regulatory site within the Krebs cycle. Glutathionylation of the enzyme may therefore represent an important means to control mitochondrial function in response to oxidative stress. We have previously provided indirect evidence that glutathionylation occurs on lipoic acid, a cofactor covalently bound to the E2 subunit of KGDH. However, lipoic acid contains two vicinal sulfhydryls and rapid disulfide exchange might be predicted to preclude stable glutathionylation. The current study sought conclusive identification of the site and chemistry of KGDH glutathionylation and factors that control the degree and rate of enzyme inhibition. We present evidence that, upon reaction of free lipoic acid with oxidized glutathione in solution, disulfide exchange occurs rapidly, producing oxidized lipoic acid and reduced glutathione. This prevents the stable formation of a glutathione-lipoic acid adduct. Nevertheless, 1:1 lipoic acid-glutathione adducts are formed on KGDH because the second sulfhydryl on lipoic acid is unable to participate in disulfide exchange in the enzyme's native conformation. The maximum degree of KGDH inhibition that can be achieved by treatment of mitochondria with H2O2 is 50%. Results indicate that this is not due to glutathionylation of a subpopulation of the enzyme but, rather, the unique susceptibility of lipoic acid on a subset of E2 subunits within each enzyme complex. Calcium enhances the rate of glutathionylation by increasing the half-life of reduced lipoic acid during enzyme catalysis. This does not, however, alter the maximal level of inhibition, providing further evidence that specific lipoic acid residues within the E2 complex are susceptible to glutathionylation. These findings offer chemical information necessary for the identification of mechanisms and physiological implications of KGDH glutathionylation. Copyright © 2013 Elsevier Inc. All rights reserved.
-
McLain, Aaron L.; Cormier, Peter J.; Kinter, Michael; Szweda, Luke I.
2013-01-01
α-Ketoglutarate dehydrogenase (KGDH) is reversibly inhibited when rat heart mitochondria are exposed to hydrogen peroxide (H2O2). H2O2-induced inhibition occurs through the formation of a mixed disulfide between a protein sulfhydryl and glutathione. Upon consumption of H2O2, glutaredoxin can rapidly remove glutathione, resulting in regeneration of enzyme activity. KGDH is a key regulatory site within the Krebs cycle. Glutathionylation of the enzyme may therefore represent an important means to control mitochondrial function in response to oxidative stress. We have previously provided indirect evidence that glutathionylation occurs on lipoic acid, a cofactor covalently bound to the E2 subunit of KGDH. However, lipoic acid contains two vicinal sulfhydryls and rapid disulfide exchange might be predicted to preclude stable glutathionylation. The current study sought conclusive identification of the site and chemistry of KGDH glutathionylation and factors that control the degree and rate of enzyme inhibition. We present evidence that, upon reaction of free lipoic acid with oxidized glutathione in solution, disulfide exchange occurs rapidly, producing oxidized lipoic acid and reduced glutathione. This prevents the stable formation of a glutathione–lipoic acid adduct. Nevertheless, 1:1 lipoic acid–glutathione adducts are formed on KGDH because the second sulfhydryl on lipoic acid is unable to participate in disulfide exchange in the enzyme’s native conformation. The maximum degree of KGDH inhibition that can be achieved by treatment of mitochondria with H2O2 is 50%. Results indicate that this is not due to glutathionylation of a subpopulation of the enzyme but, rather, the unique susceptibility of lipoic acid on a subset of E2 subunits within each enzyme complex. Calcium enhances the rate of glutathionylation by increasing the half-life of reduced lipoic acid during enzyme catalysis. This does not, however, alter the maximal level of inhibition, providing further evidence that specific lipoic acid residues within the E2 complex are susceptible to glutathionylation. These findings offer chemical information necessary for the identification of mechanisms and physiological implications of KGDH glutathionylation. PMID:23567190
-
Antidiabetic effect of the α-lipoic acid γ-cyclodextrin complex.
Naito, Yuki; Ikuta, Naoko; Nakata, Daisuke; Terao, Keiji; Matsumoto, Kinuyo; Kajiwara, Naemi; Okano, Ayaka; Yasui, Hiroyuki; Yoshikawa, Yutaka
2014-09-01
In recent years, the number of patients suffering from diabetes mellitus has been increasing worldwide. In particular, type 2 diabetes mellitus, a lifestyle-related disease, is recognized as a serious disease with various complications. Many types of pharmaceutics or specific health foods have been used for the management of diabetes mellitus. At the same time, the relationship between diabetes mellitus and α-lipoic acid has been recognized for many years. In this study, we found that the α-lipoic acid γ-cyclodextrin complex exhibited an HbA1c lowering effect for treating type 2 diabetes mellitus in animal models. Moreover, in this study, we investigated the activation of phosphorylation of AMP-activated protein kinase, which plays a role in cellular energy homeostasis, in the liver of KKA(y) mice by using α-lipoic acid and the α-lipoic acid γ-cyclodextrin complex. Our results show that the α-lipoic acid γ-cyclodextrin complex strongly induced the phosphorylation of AMP-activated protein kinase. Thus, we concluded that intake of the α-lipoic acid γ-cyclodextrin complex exerted an antidiabetic effect by suppressing the elevation of postprandial hyperglycemia as well as doing exercise.
-
Nonlinear Optical Properties of Au-Nanoparticles Conjugated with Lipoic Acid in Water
NASA Astrophysics Data System (ADS)
Trejo-Durán, M.; Cornejo-Monroy, D.; Alvarado-Méndez, E.; Olivares-Vargas, A.; Castano, V. M.
2014-08-01
Gold nanoparticles were chemically conjugated with lipoic acid to control their optical properties. Z-scan and other optical techniques were used to characterize the non-linear behavior of the resulting nanostructured materials. The results show that the nonlinearity is of thermal origin, which can be controlled by the use of lipoic acid as well as other organic molecules conjugated onto metal nanoparticles. In particular, the presence of lipoic acid increases n_2 and dn/dT.
-
Yang, Yi; Li, Wang; Liu, Yang; Sun, Yuning; Li, Yan; Yao, Qing; Li, Jianning; Zhang, Qian; Gao, Yujing; Gao, Ling; Zhao, Jiajun
2014-11-01
Understanding the mechanism by which alpha-lipoic acid supplementation has a protective effect upon nonalcoholic fatty liver disease in vivo and in vitro may lead to targets for preventing hepatic steatosis. Male C57BL/6J mice were fed a normal diet, high-fat diet or high-fat diet supplemented with alpha-lipoic acid for 24 weeks. HepG2 cells were incubated with normal medium, palmitate or alpha-lipoic acid. The lipid-lowering effects were measured. The protein expression and distribution were analyzed by Western blot, immunoprecipitation and immunofluorescence, respectively. We found that alpha-lipoic acid enhanced sirtuin 1 deacetylase activity through liver kinase B1 and stimulated AMP-activated protein kinase. By activating the sirtuin 1/liver kinase B1/AMP-activated protein kinase pathway, the translocation of sterol regulatory element-binding protein-1 into the nucleus and forkhead box O1 into the cytoplasm was prevented. Alpha-lipoic acid increased adipose triacylglycerol lipase expression and decreased fatty acid synthase abundance. In in vivo and in vitro studies, alpha-lipoic acid also increased nuclear NF-E2-related factor 2 levels and downstream target amounts via the sirtuin 1 pathway. Alpha-lipoic acid eventually reduced intrahepatic and serum triglyceride content. The protective effects of alpha-lipoic acid on hepatic steatosis appear to be associated with the transcription factors sterol regulatory element-binding protein-1, forkhead box O1 and NF-E2-related factor 2. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
-
Ergür, Bekir Uğur; Çilaker Mıcılı, Serap; Yılmaz, Osman; Akokay, Pınar
2015-06-01
The present study was designed to investigate the effects of α-lipoic acid on the abdominal aorta and hypertension in a remnant kidney model histomorphometrically, immunohistochemically, and ultrastructurally. We surgically reduced the renal tissue mass to 5/6 by applying a remnant kidney model. The rats were divided into 4 groups: Group 1- control group, Group 2- lipoic acid group, Group 3- 5/6 nephrectomy group, and Group IV: 5/6 nephrectomy+lipoic acid-treated group. Lipoic acid solution 100 mg/kg was administered by oral gavage for 8 weeks to Groups II and IV. At the end of the experiment, systemic mean blood pressure was monitored. Then, aortic tissues were removed and fixed. After routine histological procedures, tissue sections were examined histochemically, immunohistochemically (type I angiotensin receptor, vascular endothelial growth factor, alpha-smooth muscle actin), and ultrastructurally. The blood pressure measurements in 5/6 nephrectomy group were significantly higher compared to other groups. In the 5/6 nephrectomy+lipoic acid group, measured blood pressure values and tunica media thickness were significantly lower than in the 5/6 nephrectomy group. In the 5/6 nephrectomy+lipoic acid group, decreased aortic wall thickness, regularity in the structure of elastic fibrils, and more organized elastic lamellae were seen. The expression of type I angiotensin receptor, vascular endothelial growth factor, alpha-smooth muscle actin in the 5/6 nephrectomy+lipoic acid group was decreased compared to the 5/6 nephrectomy group. In the present study, we found that α-lipoic acid could be a favorable agent for the target organ effects of secondary hypertension.
-
Chang, Mun Young; Gwon, Tae Mok; Lee, Ho Sun; Lee, Jun Ho; Oh, Seung Ha; Kim, Sung June; Park, Min-Hyun
2017-03-15
The present study aimed to evaluate the effects of systemic lipoic acid on hearing preservation after cochlear implantation. Twelve Dunkin-Hartley guinea pigs were randomly divided into two groups: the control group and the lipoic acid group. Animals in the lipoic acid group received lipoic acid intraperitoneally for 4 weeks. A sterilised silicone electrode-dummy was inserted through the round window to a depth of approximately 5 mm. The hearing level was measured using auditory brainstem responses (ABRs) prior to electrode-dummy insertion, and at 4 days and 1, 2, 3 and 4 weeks after electrode-dummy insertion. The threshold shift was defined as the difference between the pre-operative threshold and each of the post-operative thresholds. The cochleae were examined histologically 4 weeks after electrode-dummy insertion. Threshold shifts changed with frequency but not time. At 2kHz, ABR threshold shifts were statistically significantly lower in the lipoic acid group than the control group. At 8, 16 and 32kHz, there was no significant difference in the ABR threshold shift between the two groups. Histologic review revealed less intracochlear fibrosis along the electrode-dummy insertion site in the lipoic acid group than in the control group. The spiral ganglion cell densities of the basal, middle and apical turns were significantly higher in the lipoic acid group compared with the control group. Therefore, systemic lipoic acid administration appears to effectively preserve hearing at low frequencies in patients undergoing cochlear implantation. These effects may be attributed to the protection of spiral ganglion cells and prevention of intracochlear fibrosis. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Antioxidant capacity and stability of liposomes containing a triglyceride derivative of lipoic acid
USDA-ARS?s Scientific Manuscript database
The multi-functional nutritional agent lipoic acid offers numerous beneficial effects to oxidatively stressed tissues. Lipoic acid was enzymatically incorporated into a triglyceride in conjunction with oleic acid, creating lipoyl dioleoylglycerol, and then chemically reduced to form dihydrolipoyl d...
-
Long-term physical and oxidative stability of liposomes containing glycerides of lipoic acid
USDA-ARS?s Scientific Manuscript database
The acyl glycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Accelerated storage testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phosp...
-
Khalili, Mohammad; Eghtesadi, Shahryar; Mirshafiey, Abbas; Eskandari, Ghazaleh; Sanoobar, Meisam; Sahraian, Mohamad Ali; Motevalian, Abbas; Norouzi, Abbas; Moftakhar, Shirin; Azimi, Amirreza
2014-01-01
Multiple sclerosis is a neurodegenerative and demyelinating disease of central nervous system. High levels of oxidative stress are associated with inflammation and play an important role in pathogenesis of multiple sclerosis. This double-blind, randomized controlled clinical study was carried out to determine the effect of daily consumption of lipoic acid on oxidative stress among multiple sclerosis patients. A total of 52 relapsing-remitting multiple sclerosis patients, aged 18-50 years with Expanded Disability Status Scale ≤5.5 were assigned to consume either lipoic acid (1200 mg/day) or placebo capsules for 12 weeks. Fasting blood samples were collected before the first dose taken and 12 hours after the last. Dietary intakes were obtained by using 3-day dietary records. Consumption of lipoic acid resulted in a significant improvement of total antioxidant capacity (TAC) in comparison to the placebo group (P = 0.004). Although a significant change of TAC (-1511 mmol/L, P = 0.001) was found within lipoic acid group, other markers of oxidative stress including superoxide dismutase activity, glutathione peroxidase activity, and malondialdehyde levels were not affected by lipoic acid consumption. These results suggest that 1200 mg of lipoic acid improves serum TAC among multiple sclerosis patients but does not affect other markers of oxidative stress.
-
Manda, Kailash; Ueno, Megumi; Moritake, Takashi; Anzai, Kazunori
2007-02-12
Reactive oxygen species are implicated in neurodegeneration and cognitive disorders due to higher vulnerability of neuronal tissues. The cerebellum is recently reported to be involved in cognitive function. Therefore, present study aimed at investigating the role alpha-lipoic acid against radiation-induced oxidative stress and antioxidant status in cerebellum and its correlation with cognitive dysfunction. We observed spontaneous motor activities and spatial memory task of mice using pyroelectric infrared sensor and programmed video tracking system, respectively. Whole body X-irradiation (6 Gy) of mice substantially impaired the reference memory and motor activities of mice. However, acute intraperitoneal treatment of mice with alpha-lipoic acid prior to irradiation significantly attenuated such cognitive dysfunction. Alpha-lipoic acid pretreatment exerted a very high magnitude of protection against radiation-induced augmentation of protein carbonyls and thiobarbituric acid reactive substance (TBARS) in mice cerebellum. Further, radiation-induced deficit of total, nonprotein and protein-bound sulfhydryl (T-SH, NP-SH, PB-SH) contents of cerebellum and plasma ferric reducing power (FRAP) was also inhibited by alpha-lipoic acid pre-treatment. Moreover, alpha-lipoic acid treated mice showed an intact cytoarchitecture of cerebellum, higher counts of intact Purkinje cells and granular cells in comparison to untreated irradiated mice. Results clearly indicate that alpha-lipoic acid is potent neuroprotective antioxidant.
-
Pharmacokinetics of orally administered DL-α-lipoic acid in dogs.
Zicker, Steven C; Avila, Albert; Joshi, Dinesh K; Gross, Kathy L
2010-11-01
To determine the pharmacokinetics of DL-α-lipoic acid in dogs when administered at 3 dosages via 3 methods of delivery. 27 clinically normal Beagles. In a 3 × 3 factorial Latin square design, 3 dosages (2.5, 12.5, and 25 mg/kg) of DL-α-lipoic acid were administered orally in a capsule form and provided without a meal, in a capsule form and provided with a meal, and as an ingredient included in an extruded dog food. Food was withheld for 12 hours prior to DL-α-lipoic acid administration. Blood samples were collected before (0 minutes) and at 15, 30, 45, 60, and 120 minutes after administration. Plasma concentrations of DL-α-lipoic acid were determined via high-performance liquid chromatography. A generalized linear models procedure was used to evaluate the effects of method of delivery and dosage. Noncompartmental analysis was used to determine pharmacokinetic parameters of DL-α-lipoic acid. Nonparametric tests were used to detect significant differences between pharmacokinetic parameters among treatment groups. A significant effect of dosage was observed regardless of delivery method. Method of delivery also significantly affected plasma concentrations of DL-α-lipoic acid, with extruded foods resulting in lowest concentration for each dosage administered. Maximum plasma concentration was significantly affected by method of delivery at each dosage administered. Other significant changes in pharmacokinetic parameters were variable and dependent on dosage and method of delivery. Values for pharmacokinetic parameters of orally administered DL-α-lipoic acid may differ significantly when there are changes in dosage, method of administration, and fed status.
-
Safety of oral alpha-lipoic acid treatment in pregnant women: a retrospective observational study.
Parente, E; Colannino, G; Picconi, O; Monastra, G
2017-09-01
Alpha-lipoic acid is a natural molecule, which directly or by means of its reduced form, dihydrolipoic acid, exerts antioxidant, anti-inflammatory and immunomodulatory activities, very helpful also in preventing miscarriage and preterm delivery. Used as dietary supplement alpha-lipoic acid was demonstrated to be safe for living organisms even when administered at high doses. However, no study was made so far to verify the safety of its continuous administration on a substantial number of pregnant women. The present investigation was performed to answer this issue. An observational retrospective study was carried out analyzing 610 expectant mothers. They had been treated daily by oral route with 600 mg alpha-lipoic acid, for at least 7 weeks during gestation. The primary outcome was to verify alpha-lipoic acid safety in the mother and infant. Maternal safety was assessed by monitoring for adverse reactions, physical and clinical examination, including a morbidity assessment. Laboratory and clinical examinations were performed monthly. Neonatal safety was assessed by the evaluation of birth weight, gestational age, Apgar scores, neonatal death with the related cause of death. Data collected from the Birth Registry of Campania Region were used as control. This study provided a very clear and reassuring picture about the safety of alpha-lipoic acid oral treatment during pregnancy. No adverse effect was noticed in mothers or newborns. The two sets of monitored data, from treated and controls, were completely superimposable or, in some cases, better in alpha-lipoic acid group. Our results open a reassuring scenario regarding the administration of alpha-lipoic acid during pregnancy.
-
Çevik, Kübra; Ulusoy, Seyhan
2015-08-01
The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. The inhibitory activity of 2,2'-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation.
-
Sharma, Monisha; Gupta, Y K
2003-08-01
In the present study, the effect of alpha lipoic acid, a potent free radical scavenger, was investigated against the intracerebroventricular streptozotocin model of cognitive impairment in rats, which is characterized by a progressive deterioration of memory, cerebral glucose and energy metabolism, and oxidative stress. Wistar rats were injected with intracerebroventricular streptozotocin bilaterally. The rats were treated chronically with alpha lipoic acid (50, 100 and 200 mg/kg) orally for 21 days starting from day 1 of streptozotocin injection in separate groups. The learning and memory behavior was evaluated and the rats were sacrificed for estimation of oxidative stress. The intracerebroventricular streptozotocin rats treated with alpha lipoic acid (200 mg/kg, p.o.) showed significantly less cognitive impairment as compared to the vehicle treated rats. There was also an insignificant increase in oxidative stress in the alpha lipoic acid treated groups. The study demonstrated the effectiveness of alpha lipoic acid in preventing cognitive impairment and oxidative stress induced by intracerebroventricular streptozotocin and its potential in dementia associated with age and age related neurodegenerative disorders where oxidative stress is involved such as Alzheimer's disease.
-
El-Gowelli, Hanan M; Saad, Evan I; Abdel-Galil, Abdel-Galil A; Ibrahim, Einas R
2015-11-01
In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associated with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Hamano, Y
2014-01-01
1. The effects of α-lipoic acid administration on sexual differences in growth performance, heat exposure-induced metabolic response and lipid peroxidation of raw meat in broiler chickens were studied. 2. Two-week-old male and female broiler chicks were divided into two groups each, as a 2 × 2 factorial arrangement. Half the birds were fed on a diet supplemented with α-lipoic acid (100 mg/kg) and half on a control diet. All groups were reared to 6 weeks of age at 25°C and, thereafter, exposed to 33°C for 8 h per day for 3 d. 3. Under thermo-neutral conditions, α-lipoic acid decreased feed consumption and body weight gain of male chickens. However, the feed conversion rate and tissue mass of breast muscle and abdominal fat were unchanged. 4. In plasma metabolites, α-lipoic acid increased the molar ratio of non-esterified fatty acids to free glycerol, regardless of sex and heat exposure. A decrease in β-hydroxybutyrate was observed in the α-lipoic acid-fed male chickens. In the heat-exposed chickens, α-lipoic acid lowered the molar ratio of plasma lactate to pyruvate in relation to the enhanced concentrations of plasma pyruvate. However, no sexual difference was observed. 5. The value of thiobarbituric acid reactive substances in breast meat of heat-stressed chickens that was refrigerated for 3 or 7 d was higher in males than in females. An antioxidative effect of α-lipoic acid was observed in the meat of male chickens. 6. The present study suggests that the α-lipoic acid-inducing fatty acid metabolism and antioxidative effect persisted during the heat stress, even though a sexual difference in the responsiveness was seen in broiler chickens.
-
Hamano, Y
2016-08-01
The present study was conducted to determine the effects of α-lipoic acid supplementation on post-mortem changes in the fatty acid profile and concentrations of nucleotide-related substances, especially those of a taste-active compound, inosine 5'-monophosphate, in chicken meat. Mixed-sex broiler chicks aged 14 d were divided into three groups of 16 birds each and were fed on diets supplemented with α-lipoic acid at levels of 0, 100 or 200 mg/kg for 4 weeks. Blood and breast muscle samples were taken at 42 d of age under the fed condition and then after fasting for 18 h. The breast muscle obtained from fasted chickens was subsequently refrigerated at 2°C for one and 3 d. α-Lipoic acid supplementation did not affect any plasma metabolite concentration independently of feeding condition, while a slight increase in plasma glucose concentration was shown with both administration levels of α-lipoic acid. In early post-mortem breast muscle under the fed condition, α-lipoic acid had no effect on concentrations of fatty acids or nucleotides of ATP, ADP, and AMP. In post-mortem breast tissues obtained from fasted chickens, total fatty acid concentrations were markedly increased by α-lipoic acid feeding at 200 mg/kg irrespective of length of refrigeration. This effect was dependent on stearic acid, oleic acid, linoleic acid and linolenic acid. However, among fatty acids, the only predominantly increased unsaturated fatty acid was oleic acid. Dietary supplementation with α-lipoic acid at 200 mg/kg increased the inosine 5'-monophosphate concentration in breast meat and, in contrast, reduced the subsequent catabolites, inosine and xanthine, regardless of the length of refrigeration. Therefore, the present study suggests that α-lipoic acid administration altered the fatty acid profile and improved meat quality by increasing taste-active substances in the post-mortem meat obtained from fasted chickens.
-
Ide, Takashi
2014-08-14
In the present study, the mRNA levels of hepatic proteins involved in the drug metabolism of rats fed α-lipoic acid were evaluated by DNA microarray and real-time PCR analyses. Experimental diets containing 0, 0·1, 0·25 and 0·5 % (w/w) α-lipoic acid were fed to four groups of rats consisting of seven animals each for 21 d. DNA microarray analysis revealed that the diet containing 0·5 % α-lipoic acid significantly (P< 0·05) increased the mRNA levels of various phase I drug-metabolising enzymes up to 15-fold and phase II enzymes up to 52-fold in an isoenzyme-specific manner. α-Lipoic acid also up-regulated the mRNA levels of some members of the ATP-binding cassette transporter superfamily, presumed to be involved in the exportation of xenobiotics, up to 6·6-fold. In addition, we observed that α-lipoic acid increased the mRNA levels of many proteins involved in antioxidation, such as members of the thiol redox system (up to 5·5-fold), metallothioneins (up to 12-fold) and haeme oxygenase 1 (1·5-fold). These results were confirmed using real-time PCR analysis, and α-lipoic acid dose dependently increased the mRNA levels of various proteins involved in drug metabolism and antioxidation. Consistent with these observations, α-lipoic acid dose dependently increased the hepatic concentration of glutathione and the activities of glutathione reductase and glutathione transferase measured using 1-chloro-2,4-dinitrobenzene and 1,2-dichloro-4-nitrobenzene as substrates, but decreased the hepatic and serum concentrations of malondialdehyde. In conclusion, the present study unequivocally demonstrated that α-lipoic acid increases the mRNA expression of proteins involved in drug metabolism and antioxidation in the liver.
-
Zhu, C; Feng, S; Yang, Z; Davis, K; Rios, H; Kaper, J B; Boedeker, E C
2007-02-26
We previously showed that single dose orogastric immunization with an attenuated regulatory Lee-encoded regulator (ler) mutant of the rabbit enteropathogenic Escherichia coli (REPEC) strain E22 (O103:H2) protected rabbits from fatal infection with the highly virulent parent strain. In the current study we assessed the degree of homologous (serotype-specific) and heterologous (cross-serotype) protection induced by immunization with REPEC ler mutant strains of differing serotypes, or with a prototype strain RDEC-1 (O15:H-) which expresses a full array of ler up-regulated proteins. We constructed an additional ler mutant using RDEC-1 thus, permitting immunization with a ler mutant of either serotype, O15 or O103, followed by challenge with a virulent REPEC strain of the same or different serotypes. Consistent with our previous data, the current study demonstrated that rabbits immunized with a RDEC-1 ler mutant were protected from challenge with virulent RDEC-H19A (RDEC-1 transduced with Shiga toxin-producing phage H19A) of the same serotype. Rabbits immunized with RDEC-1 or E22 derivative ler mutants demonstrated significant increase in serum antibody titers to the respective whole bacterial cells expressing O antigen but not to the LEE-encoded proteins. However, immunization with the ler mutants of either E22 or RDEC-1 failed to protect rabbits from infections with virulent organisms belonging to different serotypes. In contrast, rabbits immunized with the prototype RDEC-1 were cross protected against challenge with the heterologous E22 strain as shown by normal weight gain, and the absence of clinical signs of disease or characteristic attaching and effacing (A/E) lesions. Immunization with RDEC-1 induced significantly elevated serum IgG titers to LEE-encoded proteins. We thus, demonstrated homologous protection induced by the REPEC ler mutants and heterologous protection by RDEC-1. The observed correlation between elevated immune responses to the LEE-encoded proteins and the protection against challenge with heterologous virulent REPEC strain suggests that serotype-non-specific cross protection requires the expression of, and induction of antibody to, LEE-encoded virulence factors.
-
Hamano, Y
2012-01-01
1. The present study was conducted to examine the effects of α-lipoic acid on hypothyroidism-induced negative growth performance and whether α-lipoic acid alleviates acute heat stress in relation to hypothyroid status. 2. Female broiler chickens (14 d-old) were fed diets supplemented with α-lipoic acid (100 mg/kg) and an antithyroid substance, propylthiouracil (200 mg/kg), for 20 d under thermoneutral conditions (25°C). At 42 d of age, chickens were exposed to a high ambient temperature (36°C, 60% RH) for 4 h. 3. Under the thermoneutral condition, propylthiouracil administration decreased feed efficiency and concomitantly increased adipose tissue and thyroid gland weights. Plasma nonesterified fatty acids and triacylglycerol were also increased by propylthiouracil administration. However, α-lipoic acid supplementation did not affect the hypothyroidism-induced effects. 4. In hypothyroid chickens, the rise in respiratory rate induced by heat exposure was greatly inhibited by α-lipoic acid administration at 1 h, but this effect had disappeared at 4 h. In addition, a similar inhibitory effect on the concentrations of plasma nonesterified fatty acids was subsequently observed at 4 h. 5. Therefore, the present study suggested that α-lipoic acid alleviates acute heat stress if chickens are in a hypothyroid status.
-
Liu, Zhigang; Patil, Ishan; Sancheti, Harsh; Yin, Fei; Cadenas, Enrique
2017-07-14
High-fat diet (HFD)-induced obesity is accompanied by insulin resistance and compromised brain synaptic plasticity through the impairment of insulin-sensitive pathways regulating neuronal survival, learning, and memory. Lipoic acid is known to modulate the redox status of the cell and has insulin mimetic effects. This study was aimed at determining the effects of dietary administration of lipoic acid on a HFD-induced obesity model in terms of (a) insulin signaling, (b) brain glucose uptake and neuronal- and astrocytic metabolism, and (c) synaptic plasticity. 3-Month old C57BL/6J mice were divided into 4 groups exposed to their respective treatments for 9 weeks: (1) normal diet, (2) normal diet plus lipoic acid, (3) HFD, and (4) HFD plus lipoic acid. HFD resulted in higher body weight, development of insulin resistance, lower brain glucose uptake and glucose transporters, alterations in glycolytic and acetate metabolism in neurons and astrocytes, and ultimately synaptic plasticity loss evident by a decreased long-term potentiation (LTP). Lipoic acid treatment in mice on HFD prevented several HFD-induced metabolic changes and preserved synaptic plasticity. The metabolic and physiological changes in HFD-fed mice, including insulin resistance, brain glucose uptake and metabolism, and synaptic function, could be preserved by the insulin-like effect of lipoic acid.
-
Lipoic acid metabolism and mitochondrial redox regulation.
Solmonson, Ashley D; DeBerardinis, Ralph J
2017-11-30
Lipoic acid is an essential cofactor for mitochondrial metabolism and is synthesized de novo using intermediates from mitochondrial fatty acid synthesis type II, S-adenosylmethionine and iron-sulfur clusters. This cofactor is required for catalysis by multiple mitochondrial 2-ketoacid dehydrogenase complexes, including pyruvate dehydrogenase, alpha-ketoglutarate dehydrogenase, and branched-chain ketoacid dehydrogenase. Lipoic acid also plays a critical role in stabilizing and regulating these multi-enzyme complexes. Many of these dehydrogenases are regulated by reactive oxygen species, mediated through the disulfide bond of the prosthetic lipoyl moiety. Collectively, its functions explain why lipoic acid is required for cell growth, mitochondrial activity and coordination of fuel metabolism. Lipoic acid is an essential cofactor for mitochondrial metabolism and is synthesized de novo using intermediates from mitochondrial fatty acid synthesis type II, S-adenosylmethionine and iron-sulfur clusters. This cofactor is required for catalysis by multiple mitochondrial 2-ketoacid dehydrogenase complexes, including pyruvate dehydrogenase, alpha-ketoglutarate dehydrogenase, and branched-chain ketoacid dehydrogenase. Lipoic acid also plays a critical role in stabilizing and regulating these multi-enzyme complexes. Many of these dehydrogenases are regulated by reactive oxygen species, mediated through the disulfide bond of the prosthetic lipoyl moiety. Collectively, its functions explain why lipoic acid is required for cell growth, mitochondrial activity and coordination of fuel metabolism. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.
-
Protective effect of lipoic acid on cyclophosphamide-induced testicular toxicity.
Selvakumar, Elangovan; Prahalathan, Chidambaram; Sudharsan, Periyasamy Thandavan; Varalakshmi, Palaninathan
2006-05-01
Cyclophosphamide (CP), a widely used anticancer and immunosuppressive drug causes severe testicular toxicity. We investigated the protective effect of lipoic acid in CP-induced testicular toxicity. Two groups of male Wistar rats (140+/-20 g) were administered CP (15 mg/kg body weight, oral gavage) once a week for 10 weeks to induce testicular toxicity; one of these groups received lipoic acid treatment (35 mg/kg body weight, i.p., 24 h prior to CP administration) once a week for 10 weeks. A vehicle treated control and a lipoic acid control groups were also included. The untreated CP exposed rats showed a significant increase in testicular reactive oxygen species (ROS) level, along with a significant decrease in cellular thiol levels. The activities of testicular marker enzymes such as gamma-glutamyl transferase, beta-glucuronidase, acid phosphatase and alkaline phosphatase were increased whereas the activities of sorbitol dehydrogenase and lactate dehydrogenase-X were decreased significantly in the animals treated with CP. In contrast, rats pretreated with lipoic acid showed normal marker enzymic patterns and normal levels of ROS and thiols. Testicular protection by lipoic acid is further substantiated by the normal histologic findings as against shrunken seminiferous tubules with impaired spermatogenesis in the CP administered rats. By the reversal of biochemical and morphological changes towards normalcy, the cytoprotective role of lipoic acid is illuminated in CP-induced testicular toxicity.
-
Therapeutic efficacy of DL-alpha-lipoic acid on cyclosporine A induced renal alterations.
Amudha, Ganapathy; Josephine, Anthony; Mythili, Yenjerla; Sundarapandiyan, Rajaguru; Varalakshmi, Palaninathan
2007-10-01
The present study was designed to evaluate the possible beneficial effect of lipoic acid in preventing the renal damage induced by cyclosporine A in rats. Male albino rats of Wistar strain were divided into four groups and treated as follows. Two groups received cyclosporine A by oral gavage (25 mg/kg/body weight) for 21 days to induce nephrotoxicity, one of which simultaneously received lipoic acid treatment (20 mg/kg body weight) for 21 days. A vehicle (olive oil) and a lipoic acid drug control were also included. Cyclosporine A induced renal damage was evident from the decreased activities of tissue marker enzymes (alkaline phosphatase, acid phosphatase, lactate dehydrogenase, aspartate transaminase and alanine transaminase) and decreased activities of ATPases (Na+, K+-ATPase, Ca2+-ATPase and Mg2+ ATPase). An apparent increase in the levels of serum constituents (urea, uric acid and creatinine) and urinary marker enzymes (N-acetyl-beta-D-glucosaminidase, beta-glucosidase, beta-galactosidase, cathepsin-D and gamma-glutamyl transpeptidase) along with significant decline in creatinine clearance were seen in the cyclosporine treated rats, which was reversed upon treatment with lipoic acid. Ultrastructural observations were also in agreement with the above abnormal changes. Lipoic acid effectively reverted these abnormal biochemical changes and minimized the morphological lesions in renal tissue. Hence, this study clearly exemplifies that lipoic acid might be an ideal choice against cyclosporine A induced cellular abnormalities.
-
Huang, Juan; Wang, Qiang; Li, Tong; Xia, Nan; Xia, Qiang
2018-07-01
Linseed oil and α-lipoic acid are bioactive ingredients, which play an important role in human nutrition and health. However, their application in functional foods is limited because of their instabilities and poor solubilities in hydrophilic matrices. Multilayer emulsions are particularly useful to protect encapsulated bioactive ingredients. The aim of this study was to fabricate multilayer emulsions by a high-pressure homogenization method to encapsulate linseed oil and α-lipoic acid simultaneously. Tween 20 and lecithin were used as surfactants to stabilize the oil droplets of primary emulsions. Multilayer emulsions were produced by using an electrostatic layer-by-layer deposition process of lecithin-chitosan membranes. Thermal treatment exhibited that chitosan encapsulation could improve the thermal stability of primary emulsions. During in vitro digestion, it was found that chitosan encapsulation had little effect on the lipolysis of linseed oil and bioaccessibility of α-lipoic acid. The oxidation stability of linseed oil in multilayer emulsions was improved effectively by chitosan encapsulation and α-lipoic acid. Chitosan encapsulation could inhibit the degradation of α-lipoic acid. A physical stability study indicated that multilayer emulsions had good centrifugal, dilution and storage stabilities. Multilayer emulsion is an effective delivery system to incorporate linseed oil and α-lipoic acid into functional foods and beverages. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
-
Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem
2016-01-01
Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion.
-
Banu, Liliana Danusia; Conrads, Georg; Rehrauer, Hubert; Hussain, Haitham; Allan, Elaine; van der Ploeg, Jan R.
2010-01-01
Bacteria can detect, transmit, and react to signals from the outside world by using two-component systems (TCS) and serine-threonine kinases and phosphatases. Streptococcus mutans contains one serine-threonine kinase, encoded by pknB. A gene encoding a serine-threonine phosphatase, pppL, is located upstream of pknB. In this study, the phenotypes of pknB and pppL single mutants and a pknB pppL double mutant were characterized. All mutants exhibited a reduction in genetic transformability and biofilm formation, showed abnormal cell shapes, grew slower than the wild-type strain in several complex media, and exhibited reduced acid tolerance. The mutants had reduced cariogenic capacity but no significant defects in colonization in a rat caries model. Whole-genome transcriptome analysis revealed that a pknB mutant showed reduced expression of genes involved in bacteriocin production and genetic competence. Among the genes that were differentially regulated in the pknB mutant, several were likely to be involved in cell wall metabolism. One such gene, SMU.2146c, and two genes encoding bacteriocins were shown to also be downregulated in a vicK mutant, which encodes a sensor kinase involved in the response to oxidative stress. Collectively, the results lead us to speculate that PknB may modulate the activity of the two-component signal transduction systems VicKR and ComDE. Real-time reverse transcriptase PCR (RT-PCR) showed that genes downregulated in the pknB mutant were upregulated in the pppL mutant, indicating that PppL serves to counteract PknB. PMID:20231406
-
Banu, Liliana Danusia; Conrads, Georg; Rehrauer, Hubert; Hussain, Haitham; Allan, Elaine; van der Ploeg, Jan R
2010-05-01
Bacteria can detect, transmit, and react to signals from the outside world by using two-component systems (TCS) and serine-threonine kinases and phosphatases. Streptococcus mutans contains one serine-threonine kinase, encoded by pknB. A gene encoding a serine-threonine phosphatase, pppL, is located upstream of pknB. In this study, the phenotypes of pknB and pppL single mutants and a pknB pppL double mutant were characterized. All mutants exhibited a reduction in genetic transformability and biofilm formation, showed abnormal cell shapes, grew slower than the wild-type strain in several complex media, and exhibited reduced acid tolerance. The mutants had reduced cariogenic capacity but no significant defects in colonization in a rat caries model. Whole-genome transcriptome analysis revealed that a pknB mutant showed reduced expression of genes involved in bacteriocin production and genetic competence. Among the genes that were differentially regulated in the pknB mutant, several were likely to be involved in cell wall metabolism. One such gene, SMU.2146c, and two genes encoding bacteriocins were shown to also be downregulated in a vicK mutant, which encodes a sensor kinase involved in the response to oxidative stress. Collectively, the results lead us to speculate that PknB may modulate the activity of the two-component signal transduction systems VicKR and ComDE. Real-time reverse transcriptase PCR (RT-PCR) showed that genes downregulated in the pknB mutant were upregulated in the pppL mutant, indicating that PppL serves to counteract PknB.
-
Al-Ghamdi, Maryam A; Choudhry, Hani; Al-Doghather, Huda A; Huwait, Etimad H; Kumosani, Taha A; Moselhy, Said S
2017-01-01
Body overweight and obesity were considered as a risk factor for many systemic diseases as diabetic hypertension, cardiovascular diseases, and some cancers. The lipoic acid and Co Q are considered as coenzymes needed for enhancement metabolic rate. The goal of this study is to evaluate the anti-obese effect of lipoic acid alone or combined with Co-Q in rats. Ninety male albino rats (100-150g) were used in this study, divided into six groups (15 each). Group I: Normal rats fed normal diet. Group II: Rats fed high fat diet (HFD). Group III: Rats fed HFD were given lipoic acid (10 μg/kg b w/day) intra-gastric by stomach tube. Group IV: Rats fed HFD were given Co-Q (10 μg/kg b.w/day) intra-gastric. Group V: Rats fed HFD were given lipoic acid (50 mg/kg b w/day) and Co-Q (10 μg/kg b. w/day). Group VI: Rats were given orlistat intra-gastric (10 mg/kg b w/day) as positive control for 6 weeks. Serum was subjected for determination of lipid profile, liver function tests atherogenic factor and lipoprotein lipase. It was found that treatment with lipoic acid or Co-Q or combined showed increase in the activity of lipoprotein lipase ( P < 0.001) and reduction of atherogenic effect and obesity index ( P <0.001). The effect of combined gives good results than orlistat or individual treatment. lipoic acid combined with Co-Q increase fat oxidation and prevent fat accumulation. The consumption of lipoic acid daily promotes fat oxidation and prevents its accumulation in visceral tissues. Further studies should be carried out to examine the mechanistic signals of these nutrients that helps in weight management.
-
AL-Ghamdi, Maryam A.; Choudhry, Hani; AL-Doghather, Huda A.; Huwait, Etimad H.; Kumosani, Taha A; Moselhy, Said S
2017-01-01
Background: Body overweight and obesity were considered as a risk factor for many systemic diseases as diabetic hypertension, cardiovascular diseases, and some cancers. The lipoic acid and Co Q are considered as coenzymes needed for enhancement metabolic rate. The goal of this study is to evaluate the anti-obese effect of lipoic acid alone or combined with Co-Q in rats. Materials and Methods: Ninety male albino rats (100-150g) were used in this study, divided into six groups (15 each). Group I: Normal rats fed normal diet. Group II: Rats fed high fat diet (HFD). Group III: Rats fed HFD were given lipoic acid (10 μg/kg b w/day) intra-gastric by stomach tube. Group IV: Rats fed HFD were given Co-Q (10 μg/kg b.w/day) intra-gastric. Group V: Rats fed HFD were given lipoic acid (50 mg/kg b w/day) and Co-Q (10 μg/kg b. w/day). Group VI: Rats were given orlistat intra-gastric (10 mg/kg b w/day) as positive control for 6 weeks. Serum was subjected for determination of lipid profile, liver function tests atherogenic factor and lipoprotein lipase. Results: It was found that treatment with lipoic acid or Co-Q or combined showed increase in the activity of lipoprotein lipase (P < 0.001) and reduction of atherogenic effect and obesity index (P <0.001). The effect of combined gives good results than orlistat or individual treatment. Conclusion: lipoic acid combined with Co-Q increase fat oxidation and prevent fat accumulation. The consumption of lipoic acid daily promotes fat oxidation and prevents its accumulation in visceral tissues. Further studies should be carried out to examine the mechanistic signals of these nutrients that helps in weight management. PMID:28480405
-
Wang, Min; Wang, Qiong; Gao, Xiang; Su, Zhong
2017-06-27
Lipoic acid is a cofactor for α-keto acid dehydrogenase system that is involved in the central energy metabolism. In the apicomplexan parasite, Plasmodium, lipoic acid protein ligase 1 (LplA1) and LplA2 catalyse the ligation of acquired lipoic acid to the dehydrogenase complexes in the mitochondrion. The enzymes LipB and LipA mediate lipoic acid synthesis and ligation to the enzymes in the apicoplast. These enzymes in the lipoic acid metabolism machinery have been shown to play important roles in the biology of Plasmodium parasites, but the relationship between the enzymes is not fully elucidated. We used an anhydrotetracycline (ATc)-inducible transcription system to generate transgenic P. berghei parasites in which the lplA1 gene was conditionally knocked out (LplA1-cKO). Phenotypic changes and the lplA1 and lplA2 gene expression profiles of cloned LplA1-cKO parasites were analysed. LplA1-cKO parasites showed severely impaired growth in vivo in the first 8 days of infection, and retarded blood-stage development in vitro, in the absence of ATc. However, these parasites resumed viability in the late stage of infection and mounted high levels of parasitemia leading to the death of the hosts. Although lplA1 mRNA expression was regulated tightly by ATc during the whole course of infection, lplA2 mRNA expression was significantly increased in the late stage of infection only in the LplA1-cKO parasites that were not exposed to ATc. The lplA2 gene can be activated as an alternative pathway to compensate for the loss of LplA1 activity and to maintain lipoic acid metabolism.
-
THE COMBINATION OF α-LIPOIC ACID INTAKE WITH ECCENTRIC EXERCISE MODULATES ERYTHROPOIETIN RELEASE.
Morawin, B; Turowski, D; Naczk, M; Siatkowski, I; Zembron-Lacny, A
2014-08-01
The generation of reactive nitrogen/oxygen species (RN/OS) represents an important mechanism in erythropoietin (EPO) expression and skeletal muscle adaptation to physical and metabolic stress. RN/OS generation can be modulated by intense exercise and nutrition supplements such as α-lipoic acid, which demonstrates both anti- and pro-oxidative action. The study was designed to show the changes in the haematological response through the combination of α-lipoic acid intake with running eccentric exercise. Sixteen healthy young males participated in the randomised and placebo-controlled study. The exercise trial involved a 90-min run followed by a 15-min eccentric phase at 65% VO2max (-10% gradient). It significantly increased serum concentrations of nitric oxide (NO), hydrogen peroxide (H2O2) and pro-oxidative products such as 8-isoprostanes (8-iso), lipid peroxides (LPO) and protein carbonyls (PC). α-Lipoic acid intake (Thiogamma: 1200 mg daily for 10 days prior to exercise) resulted in a 2-fold elevation of serum H2O2 concentration before exercise, but it prevented the generation of NO, 8-iso, LPO and PC at 20 min, 24 h, and 48 h after exercise. α-Lipoic acid also elevated serum EPO level, which highly correlated with NO/H2O2 ratio (r = 0.718, P < 0.01). Serum total creatine kinase (CK) activity, as a marker of muscle damage, reached a peak at 24 h after exercise (placebo 732 ± 207 IU · L(-1), α-lipoic acid 481 ± 103 IU · L(-1)), and correlated with EPO (r = 0.478, P < 0.01) in the α-lipoic acid group. In conclusion, the intake of high α-lipoic acid modulates RN/OS generation, enhances EPO release and reduces muscle damage after running eccentric exercise.
-
THE COMBINATION OF α-LIPOIC ACID INTAKE WITH ECCENTRIC EXERCISE MODULATES ERYTHROPOIETIN RELEASE
Morawin, B.; Turowski, D.; Naczk, M.; Siatkowski, I.
2014-01-01
The generation of reactive nitrogen/oxygen species (RN/OS) represents an important mechanism in erythropoietin (EPO) expression and skeletal muscle adaptation to physical and metabolic stress. RN/OS generation can be modulated by intense exercise and nutrition supplements such as α-lipoic acid, which demonstrates both anti- and pro-oxidative action. The study was designed to show the changes in the haematological response through the combination of α-lipoic acid intake with running eccentric exercise. Sixteen healthy young males participated in the randomised and placebo-controlled study. The exercise trial involved a 90-min run followed by a 15-min eccentric phase at 65% VO2max (-10% gradient). It significantly increased serum concentrations of nitric oxide (NO), hydrogen peroxide (H2O2) and pro-oxidative products such as 8-isoprostanes (8-iso), lipid peroxides (LPO) and protein carbonyls (PC). α-Lipoic acid intake (Thiogamma: 1200 mg daily for 10 days prior to exercise) resulted in a 2-fold elevation of serum H2O2 concentration before exercise, but it prevented the generation of NO, 8-iso, LPO and PC at 20 min, 24 h, and 48 h after exercise. α-Lipoic acid also elevated serum EPO level, which highly correlated with NO/H2O2 ratio (r = 0.718, P < 0.01). Serum total creatine kinase (CK) activity, as a marker of muscle damage, reached a peak at 24 h after exercise (placebo 732 ± 207 IU · L-1, α-lipoic acid 481 ± 103 IU · L-1), and correlated with EPO (r = 0.478, P < 0.01) in the α-lipoic acid group. In conclusion, the intake of high α-lipoic acid modulates RN/OS generation, enhances EPO release and reduces muscle damage after running eccentric exercise. PMID:25177095
-
Dudek, Magdalena; Knutelska, Joanna; Bednarski, Marek; Nowiński, Leszek; Zygmunt, Małgorzata; Bilska-Wilkosz, Anna; Iciek, Małgorzata; Otto, Monika; Żytka, Iwona; Sapa, Jacek; Włodek, Lidia; Filipek, Barbara
2014-06-01
The cardiovascular effects of alpha lipoic acid were evaluated in isolated rat hearts exposed to ischemia-reperfusion injury in vitro. Alpha-lipoic acid raised the level of sulfane sulfur playing an important role in the release of hydrogen sulfide. H2S was shown to prevent the post-reperfusion arrhythmias and to protect the cardiomyocytes from death caused by hypoxia. The activation of potassium ATP-sensitive channels (K(ATP) channels) is one of the most important mechanisms of action of hydrogen sulfide in the cardiovascular system. The aim of this study was to investigate whether alpha lipoic acid can prevent the occurrence of post-reperfusion arrhythmias in vitro using a Langendorff model of ischemia-reperfusion in rats affecting the K(ATP) channels. Alpha lipoic acid significantly improved post-reperfusion cardiac function (reducing incidence of arrhythmias), especially in a dose of 10(-7)M. These cardiovascular effects of this compound on the measured parameters were reversed by glibenclamide, a selective K(ATP) blocker. Alpha lipoic acid increased the level of sulfane sulfur in the hearts. This may suggest that the positive effects caused by alpha lipoic acid in the cardiovascular system are not only related to its strong antioxidant activity, and the influence on the activity of such enzymes as aldehyde dehydrogenase 2, as previously suggested, but this compound can affect K(ATP) channels. It is possible that this indirect effect of alpha lipoic acid is connected with changes in the release of sulfane sulfur and hydrogen sulfide. Copyright © 2014 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
-
Effect of alpha lipoic acid on leukotriene A4 hydrolase.
Torres, María José; Fierro, Angélica; Pessoa-Mahana, C David; Romero-Parra, Javier; Cabrera, Gonzalo; Faúndez, Mario
2017-03-15
Leukotriene A 4 hydrolase is a soluble enzyme with epoxide hydrolase and aminopeptidase activities catalysing the conversion of leukotriene A 4 to leukotriene B 4 and the hydrolysis of the peptide proline-glycine-proline. Imbalances in leukotriene B 4 synthesis are related to several pathologic conditions. Currently there are no available drugs capable to modulate the synthesis of leukotriene B 4 or to block its receptors. Here we show the inhibitory profile of alpha lipoic acid on the activity of leukotriene A 4 Hydrolase. Alpha lipoic acid inhibited both activities of the enzyme at concentrations lower than 10μM. The 5-lipoxygenase inhibitor zileuton, or the 5-lipoxygenase activating protein inhibitor MK-886, were unable to inhibit the activity of the enzyme. Acute promyelocytic leukaemia HL-60 cells were differentiated to leukotriene A 4 hydrolase expressing neutrophil-like cells. Alpha lipoic acid inhibited the aminopeptidase activity of the cytosolic fraction from neutrophil-like cells but had no effect on the cytosolic fraction from undifferentiated cells. Docking and molecular dynamic approximations revealed that alpha lipoic acid participates in electrostatic interactions with K-565 and R-563, which are key residues for the carboxylate group recognition of endogenous substrates by the enzyme. Alpha lipoic acid is a compound widely used in clinical practice, most of its therapeutic effects are associated with its antioxidants properties, however, antioxidant effect alone is unable to explain all clinical effects observed with alpha lipoic acid. Our results invite to evaluate the significance of the inhibitory effect of alpha lipoic acid on the catalytic activity of leukotriene A 4 hydrolase using in vivo models. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Gomes, Marilia Brito; Negrato, Carlos Antonio
2014-01-01
Alpha-lipoic acid is a naturally occurring substance, essential for the function of different enzymes that take part in mitochondria's oxidative metabolism. It is believed that alpha-lipoic acid or its reduced form, dihydrolipoic acid have many biochemical functions acting as biological antioxidants, as metal chelators, reducers of the oxidized forms of other antioxidant agents such as vitamin C and E, and modulator of the signaling transduction of several pathways. These above-mentioned actions have been shown in experimental studies emphasizing the use of alpha-lipoic acid as a potential therapeutic agent for many chronic diseases with great epidemiological as well economic and social impact such as brain diseases and cognitive dysfunctions like Alzheimer disease, obesity, nonalcoholic fatty liver disease, burning mouth syndrome, cardiovascular disease, hypertension, some types of cancer, glaucoma and osteoporosis. Many conflicting data have been found concerning the clinical use of alpha-lipoic acid in the treatment of diabetes and of diabetes-related chronic complications such as retinopathy, nephropathy, neuropathy, wound healing and diabetic cardiovascular autonomic neuropathy. The most frequent clinical condition in which alpha-lipoic acid has been studied was in the management of diabetic peripheral neuropathy in patients with type 1 as well type 2 diabetes. Considering that oxidative stress, a imbalance between pro and antioxidants with excessive production of reactive oxygen species, is a factor in the development of many diseases and that alpha-lipoic acid, a natural thiol antioxidant, has been shown to have beneficial effects on oxidative stress parameters in various tissues we wrote this article in order to make an up-to-date review of current thinking regarding alpha-lipoic acid and its use as an antioxidant drug therapy for a myriad of diseases that could have potential benefits from its use.
-
Alpha-lipoic acid treatment of acetaminophen-induced rat liver damage.
Mahmoud, Y I; Mahmoud, A A; Nassar, G
2015-01-01
Acetaminophen (paracetamol) is a well-tolerated analgesic and antipyretic drug when used at therapeutic doses. Overdoses, however, cause oxidative stress, which leads to acute liver failure. Alpha lipoic acid is an antioxidant that has proven effective for ameliorating many pathological conditions caused by oxidative stress. We evaluated the effect of alpha lipoic acid on the histological and histochemical alterations of liver caused by an acute overdose of acetaminophen in rats. Livers of acetaminophen-intoxicated rats were congested and showed centrilobular necrosis, vacuolar degeneration and inflammatory cell infiltration. Necrotic hepatocytes lost most of their carbohydrates, lipids and structural proteins. Liver sections from rats pre-treated with lipoic acid showed fewer pathological changes; the hepatocytes appeared moderately vacuolated with moderate staining of carbohydrates and proteins. Nevertheless, alpha lipoic acid at the dose we used did not protect the liver fully from acetaminophen-induced acute toxicity.
-
Mechanism of alpha-lipoic acid in attenuating kanamycin-induced ototoxicity☆
Wang, Aimei; Hou, Ning; Bao, Dongyan; Liu, Shuangyue; Xu, Tao
2012-01-01
In view of the theory that alpha-lipoic acid effectively prevents cochlear cells from injury caused by various factors such as cisplatin and noise, this study examined whether alpha-lipoic acid can prevent kanamycin-induced ototoxicity. To this end, healthy BALB/c mice were injected subcutaneously with alpha-lipoic acid and kanamycin for 14 days. Auditory brainstem response test showed that increased auditory brainstem response threshold shifts caused by kanamycin were significantly inhibited. Immunohistochemical staining and western blot analysis showed that the expression of phosphorylated p38 mitogen-activated protein kinase and phosphorylated c-Jun N-terminal kinase in mouse cochlea was significantly decreased. The experimental findings suggest that phosphorylated p38 and phosphorylated c-Jun N-terminal kinase mediated kanamycin-induced ototoxic injury in BALB/c mice. Alpha-lipoic acid effectively attenuated kanamycin ototoxicity by inhibiting the kanamycin-induced high expression of phosphorylated p38 and phosphorylated c-Jun N-terminal kinase. PMID:25317129
-
Acetyl-L-carnitine and alpha-lipoic acid: possible neurotherapeutic agents for mood disorders?
Soczynska, Joanna K; Kennedy, Sidney H; Chow, Cindy S M; Woldeyohannes, Hanna O; Konarski, Jakub Z; McIntyre, Roger S
2008-06-01
Mood disorders are associated with decrements in cognitive function, which are insufficiently treated with contemporary pharmacotherapies. To evaluate the putative neurotherapeutic effects of the mitochondrial cofactors, L-carnitine, acetyl-L-carnitine, and alpha-lipoic acid; and to provide a rationale for investigating their efficacy in the treatment of neurocognitive deficits associated with mood disorders. A PubMed search of English-language articles published between January 1966 and March 2007 was conducted using the search terms carnitine and lipoic acid. L-carnitine and alpha-lipoic acid may offer neurotherapeutic effects (e.g., neurocognitive enhancement) via disparate mechanisms including antioxidant, anti-inflammatory, and metabolic regulation. Preliminary controlled trials in depressed geriatric populations also suggest an antidepressant effect with acetyl-L-carnitine. L-carnitine and alpha-lipoic acid are pleiotropic agents capable of offering neuroprotective and possibly cognitive-enhancing effects for neuropsychiatric disorders in which cognitive deficits are an integral feature.
-
Topical Application of Liposomal Antioxidants for Protection Against CEES Induced Skin Damage
2007-07-01
alveolar macrophages. J Nutr Sci Vitaminol (Tokyo) 1999, 45:675-686. 13. Thirunavukkarasu V, Anuradha CV: Influence of alpha - lipoic acid on lipid...33 4 ABBREVIATIONS: ALA, α- Lipoic acid AT, α-tocopherol CEES, half mustard or 2...Vitamin E (tocopherols and tocotrienols), GSH, N-acetylcysteine (NAC), and lipoic acid are very effective antioxidants. Their antioxidative potential
-
Zicker, Steven C; Hagen, Tory M; Joisher, Neha; Golder, Christina; Joshi, Dinesh K; Miller, E Phillip
2002-01-01
Alpha-lipoic acid is touted as a powerful antioxidant and possibly a conditionally essential nutrient in older mammals. The safety and efficacy of dl-alpha-lipoic acid was evaluated in 30 adult beagles that were evenly randomized into five groups, each of which was fed one of five different foods with varying inclusion rates of dl-alpha-lipoic acid (0, 150, 1500, 3000, and 4500 ppm). All dogs were fed their respective portion of food daily as their sole source of nutrition for 6 months. Evaluations included general health, body weight, food intake, hematologic and serum biochemical parameters, and glutathione:oxidized glutathione (GSH:GSSG) ratios in lymphocytes. No signs of toxicity were observed at any except the highest level of dl-alpha-lipoic acid inclusion, and no consistent abnormalities were noted in hematologic or biochemical measures at any level. There was a significant overall effect (P< .05) of food on the difference of GSH:GSSG ratio between Day 84 and Day 0. All inclusions of dl-alpha-lipoic acid increased the ratio of GSH:GSSG with the largest numeric improvement occurring at the lowest inclusion rate (150 ppm).
-
Çevik, Kübra; Ulusoy, Seyhan
2015-01-01
Objective(s): The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. Materials and Methods: The inhibitory activity of 2,2’-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. Results: The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. Conclusion: It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation. PMID:26557964
-
Karabay, Arzu Zeynep; Koc, Aslı; Gurkan-Alp, A Selen; Buyukbingol, Zeliha; Buyukbingol, Erdem
2015-04-01
Alpha-lipoic acid (α-lipoic acid) is a potent antioxidant compound that has been shown to possess anti-inflammatory effects. RAW 264.7 macrophages produce various inflammatory mediators such as nitric oxide, IL-1β, IL-6 and TNF-alpha upon activation with LPS (Lipopolysaccharide) and IFNγ (interferon gamma). In this study, the effect of 12 synthetic indole α-lipoic acid derivatives on nitric oxide production and iNOS (inducible nitric oxide synthase) protein expression in LPS/IFNγ activated RAW 264.7 macrophages was determined. Cell proliferation, nitric oxide levels and iNOS protein expression were examined with thiazolyl blue tetrazolium blue test, griess assay and western blot, respectively. Our results showed that all of the indole α-lipoic acid derivatives showed significant inhibitory effects on nitric oxide production and iNOS protein levels (p < 0.05). The most active compounds were identified as compound I-4b, I-4e and II-3b. In conclusion, these indole α-lipoic acid derivatives may have the potential for treatment of inflammatory conditions related with high nitric oxide production. Copyright © 2015 John Wiley & Sons, Ltd.
-
Protective effect of α-lipoic acid against α-cypermethrin-induced changes in rat cerebellum.
Elsawy, H; Al-Omair, M A; Sedky, A; Al-Otaibi, L
2017-12-01
Alfa cypermethrin is a pyrethroids extensively used as ectoparasiticide in domestic animals, insecticidal spray on cotton, vegetables and other crops and to kill cockroaches, fleas and termites in house and other buildings. Previous studies have shown the adverse effect of α -cypermethrin on brain. This study was planned to evaluate the possible role of α-lipoic acid in α -cypermethrin induced toxicity in brain of male albino rats. Rats were divided into four groups. The control, α-cypermethrin, α-lipoic acid and α -cypermethrin plus α-lipoic acid treated groups. The duration of the experiment was four weeks. Our results showed that the administration of α-cypermethrin caused a significant decreased in γ- aminobutyric acid level, acetylcholinesterase, catalase, superoxide dismutase activities and increase in lipid peroxidation in cerebellum. Furthermore, the co-administration of α-lipoic acid mitigates the toxicity of α-cypermethrin by partially normalizing the biochemical parameters. The biochemical observations were supported by histopathological examinations. The findings of this investigation suggest that α-lipoic acid may play a protective role against α-cypermethrin induced toxicity in cerebellum of treated rats. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Alpha-lipoic acid supplementation protects enzymes from damage by nitrosative and oxidative stress.
Hiller, Sylvia; DeKroon, Robert; Hamlett, Eric D; Xu, Longquan; Osorio, Cristina; Robinette, Jennifer; Winnik, Witold; Simington, Stephen; Maeda, Nobuyo; Alzate, Oscar; Yi, Xianwen
2016-01-01
S-nitrosylation of mitochondrial enzymes involved in energy transfer under nitrosative stress may result in ATP deficiency. We investigated whether α-lipoic acid, a powerful antioxidant, could alleviate nitrosative stress by regulating S-nitrosylation, which could result in retaining the mitochondrial enzyme activity. In this study, we have identified the S-nitrosylated forms of subunit 1 of dihydrolipoyllysine succinyltransferase (complex III), and subunit 2 of the α-ketoglutarate dehydrogenase complex by implementing a fluorescence-based differential quantitative proteomics method. We found that the activities of these two mitochondrial enzymes were partially but reversibly inhibited by S-nitrosylation in cultured endothelial cells, and that their activities were partially restored by supplementation of α-lipoic acid. We show that protein S-nitrosylation affects the activity of mitochondrial enzymes that are central to energy supply, and that α-lipoic acid protects mitochondrial enzymes by altering S-nitrosylation levels. Inhibiting protein S-nitrosylation with α-lipoic acid seems to be a protective mechanism against nitrosative stress. Identification and characterization of these new protein targets should contribute to expanding the therapeutic power of α-lipoic acid and to a better understanding of the underlying antioxidant mechanisms.
-
Al-Otaibi, Sooad Saud; Arafah, Maha Mohamad; Sharma, Bechan; Alhomida, Abdullah Salih; Siddiqi, Nikhat Jamal
2018-01-01
The present study was carried out to study the protective effects of quercetin and α -lipoic acid alone and in combination against aluminum chloride induced neurotoxicity in rats. The study consisted of eight groups, namely, Group 1: control rats, Group 2: rats receiving aluminium chloride 7 mg/kg body weight intraperitoneal route (i.p) for two weeks, Group 3: rats receiving quercetin 50 mg/kg body weight i.p. for two weeks, Group 4: rats receiving quercetin 50 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks, Group 5: rats receiving α -lipoic acid 20 mg/kg body weight i.p. for two weeks, Group 6: rats receiving lipoic acid 20 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks, Group 7: rats receiving α -lipoic acid 20 mg/kg body weight and quercetin 50 mg/kg body weight i.p. for two weeks, and Group 8: rats receiving α -lipoic acid 20 mg/kg body weight and quercetin 50 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks. The animals were killed after 24 hours of the last dose by cervical dislocation. Aluminium chloride treatment of rats resulted in significant increases in lipid peroxidation, protein carbonyl levels, and acetylcholine esterase activity in the brain. This was accompanied with significant decreases in reduced glutathione, activities of the glutathione reductase, and superoxide dismutase. Pretreatment of AlCl 3 exposed rats to either quercetin or α -lipoic acid also restored altered lipid peroxidation and superoxide dismutase to near normal levels. Quercetin or α -lipoic acid pretreatment of AlCl 3 exposed rats improved the protein carbonyl and reduced glutathione, glutathione reductase, and acetylcholine esterase activities in rat brains towards normal levels. Combined pretreatment of AlCl3 exposed rats with quercetin and α -lipoic acid resulted in a tendency towards normalization of most of the parameters. Quercetin and α -lipoic acid complemented each other in protecting the rat brain against oxidative stress induced by aluminium chloride.
-
Al-Otaibi, Sooad Saud
2018-01-01
Objectives The present study was carried out to study the protective effects of quercetin and α-lipoic acid alone and in combination against aluminum chloride induced neurotoxicity in rats. Materials and Methods The study consisted of eight groups, namely, Group 1: control rats, Group 2: rats receiving aluminium chloride 7 mg/kg body weight intraperitoneal route (i.p) for two weeks, Group 3: rats receiving quercetin 50 mg/kg body weight i.p. for two weeks, Group 4: rats receiving quercetin 50 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks, Group 5: rats receiving α-lipoic acid 20 mg/kg body weight i.p. for two weeks, Group 6: rats receiving lipoic acid 20 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks, Group 7: rats receiving α-lipoic acid 20 mg/kg body weight and quercetin 50 mg/kg body weight i.p. for two weeks, and Group 8: rats receiving α-lipoic acid 20 mg/kg body weight and quercetin 50 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks. The animals were killed after 24 hours of the last dose by cervical dislocation. Results Aluminium chloride treatment of rats resulted in significant increases in lipid peroxidation, protein carbonyl levels, and acetylcholine esterase activity in the brain. This was accompanied with significant decreases in reduced glutathione, activities of the glutathione reductase, and superoxide dismutase. Pretreatment of AlCl3 exposed rats to either quercetin or α-lipoic acid also restored altered lipid peroxidation and superoxide dismutase to near normal levels. Quercetin or α-lipoic acid pretreatment of AlCl3 exposed rats improved the protein carbonyl and reduced glutathione, glutathione reductase, and acetylcholine esterase activities in rat brains towards normal levels. Combined pretreatment of AlCl3 exposed rats with quercetin and α-lipoic acid resulted in a tendency towards normalization of most of the parameters. Conclusions Quercetin and α-lipoic acid complemented each other in protecting the rat brain against oxidative stress induced by aluminium chloride. PMID:29861723
-
Tsai, Chia-Ju; Chen, Yen-Ling; Feng, Chia-Hsien
2013-10-04
This study explored dispersive liquid-liquid microextraction for extraction and concentration of lipoic acid in human urine. To improve the detection of lipoic acid by both capillary liquid chromatography (CapLC) with UV detection and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), microwave-assisted derivatization with 4-bromomethyl-6,7-dimethoxycoumarin was performed to render lipoic acid chromophores for UV detection and also high ionization efficiency in MALDI. All parameters that affected lipoic acid extraction and derivatization from urine were investigated and optimized. In the analyses of human urine samples, the two methods had a linear range of 0.1-20 μM with a correlation coefficient of 0.999. The detection limits of CapLC-UV and MALDI-TOF MS were 0.03 and 0.02 μM (S/N ≧ 3), respectively. The major metabolites of lipoic acid, including 6,8-bismethylthio-octanoic acid, 4,6-bismethylthio-hexanoic acid, and 2,4-bismethylthio-butanoic acid were also extracted by dispersive liquid-liquid microextraction and detected by MALDI-TOF MS. The minor metabolites (undetectable by MALDI-TOF MS), bisnorlipoic acid and tetranorlipoic acid were also extracted by dispersive liquid-liquid microextraction and identified with an LTQ Orbitrap mass spectrometer. After dispersive liquid-liquid microextraction and microwave-assisted derivatization, all lipoic acid derivatizations and metabolites were structurally confirmed by LTQ Orbitrap. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Trivedi, P P; Jena, G B
2013-09-01
Ulcerative colitis affects many people worldwide. Inflammation and oxidative stress play a vital role in its pathogenesis. Previously, we reported that ulcerative colitis leads to systemic genotoxicity in mice. The present study was aimed at elucidating the role of α-lipoic acid in ulcerative colitis-associated local and systemic damage in mice. Experimental colitis was induced using 3%w/v dextran sulfate sodium in drinking water for 2 cycles. α-Lipoic acid was administered in a co-treatment (20, 40, 80 mg/kg bw) and post-treatment (80 mg/kg bw) schedule. Various biochemical parameters, histological evaluation, comet and micronucleus assays, immunohistochemistry and western blot analysis were employed to evaluate the effect of α-lipoic acid in mice with ulcerative colitis. The protective effect of α-lipoic acid was mediated through the modulation of nuclear factor kappa B, cyclooxygenase-2, interleukin 17, signal transducer and activator of transcription 3, nuclear erythroid 2-related factor 2, NADPH: quinone oxidoreductase-1, matrix metalloproteinase-9 and connective tissue growth factor. Further, ulcerative colitis led to an increased gut permeability, plasma lipopolysaccharide level, systemic inflammation and genotoxicity in mice, which was reduced with α-lipoic acid treatment. The present study identifies the underlying mechanisms involved in α-lipoic acid-mediated protection against ulcerative colitis and the associated systemic damage in mice. Copyright © 2013 Elsevier Ltd. All rights reserved.
-
Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same
Oda, Michael N [Benicia, CA; Forte, Trudy M [Berkeley, CA
2007-05-29
Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.
-
STUDIES ON ORGANIC ACID METABOLISM,
Lipoic acid metabolism: The acetyl and succinyl thio esters of civinyl dimercapto were prepared by chemical and enzymatic means. The oxidation...reduction reactions of the disulfide-dimercapto groups in pyrimidine nucleotide-linked reactions were explored in the initial lipoic acid assay organiam...disulfide couple. The studies appeared to indicate a bound form of lipoic acid to be the coenzyme, and suggested that an amide or possibly another
-
McNeilly, Andrea M; Davison, Gareth W; Murphy, Marie H; Nadeem, Nida; Trinick, Tom; Duly, Ellie; Novials, Anna; McEneny, Jane
2011-11-22
Obese subjects with impaired glucose tolerance (IGT) are more susceptible than healthy individuals to oxidative stress and cardiovascular disease. This randomised controlled investigation was designed to test the hypothesis that α-lipoic acid supplementation and exercise training may elicit favourable clinical changes in obese subjects with IGT. All data were collected from 24 obese (BMI ≥ 30 kg/m2) IGT patients. Following participant randomisation into two groups, fasting venous blood samples were obtained at baseline, and before and following intervention. The first group consisted of 12 participants who completed a 12 week control phase followed by 12 weeks of chronic exercise at 65% HRmax for 30 minutes a day, 5 days per week, while ingesting 1 gram per day of α-lipoic acid for 12 weeks. The second group consisted of 12 participants who completed the same 12 week control phase, but this was followed by 12 weeks of 1 gram per day of α-lipoic acid supplementation only (no exercise). The main findings show a comparatively greater rate of low density lipoprotein (LDL) oxidation in the group consisting of α-lipoic acid only (p < 0.05 vs. pre intervention), although total oxidant status was lower post intervention (p < 0.05 vs. baseline) in this group. However, exercise and α-lipoic acid in combination attenuates LDL oxidation. Furthermore, in the α-lipoic acid supplement plus exercise training group, total antioxidant capacity was significantly increased (p < 0.05 vs. baseline and pre intervention). Body fat percentage and waist and hip circumference decreased following exercise training (p < 0.05 vs. post intervention). There were no selective treatment differences for a range of other clinical outcomes including glycaemic regulation (p > 0.05). These findings report that α-lipoic acid ingestion may increase the atherogenicity of LDL when ingested in isolation of exercise, suggesting that in IGT the use of this antioxidant treatment does not ameliorate metabolic disturbances, but instead may detrimentally contribute to the pathogenesis of atherosclerosis and development of CVD. However, when α-lipoic acid is combined with exercise, this atherogenic effect is abolished. © 2011 McNeilly et al; licensee BioMed Central Ltd.
-
Omran, Ola M; Omer, Osama H
2015-06-01
The wide use of the organophosphate insecticide malathion is accompanied by the risk of human exposure and may be involved in the etiology of breast cancers, especially in developing countries. Alpha (α)-lipoic acid, a natural molecule, present in our diet has antioxidant and protective effects in cases such as aging, diabetes mellitus, and vascular and neurodegenerative diseases all in which free radicals are involved. However, there is only scarce data regarding the efficacy and biological activity of α-lipoic acid on malathion-induced breast histopathological changes. To investigate whether malathion can induce mammary histopathological changes, to immunohistochemically analyze the modulations in proliferation-apoptosis balance associated with these changes, to assess the associated metabolic parameters, antioxidant stress and hormonal profile changes and to elucidate the possible protective effect of α-lipoic acid on malathion induced alterations in rats. Forty Wistar female rats weighing 150-170g were divided into four groups. Group 1: control group were injected intraperitoneally (ip) with saline solution. Group2: animals were injected (ip) with malathion twice a day for five days. Group 3: animals were orally given α-lipoic acid, after three hours of treatment with malathion at the same dose given to group 2. Group 4: animals were treated with α-lipoic acid at the same dose given to group 3. Rats were sacrificed on the 90th day, and breast tissues were analyzed for histopathological and immunohistochemical alterations. Blood samples were collected for biochemical tests. α-Lipoic acid exhibited a striking reduction of malathion-induced mammary tumor incidence, and reversed intra-tumor histopathological alterations. Alpha lipoic acid suppressed proliferating cell nuclear antigen (PCNA) and p53 expression, induced apoptosis, upregulated proapoptotic protein Bax. Our results provide the experimental evidence that α-lipoic acid exerts chemopreventive effect in the breast hyperplastic and malignant changes by suppressing abnormal cell proliferation and inducing apoptosis with an oncostatic effects during an early-stage breast cancer. Copyright © 2015 Elsevier GmbH. All rights reserved.
-
2011-01-01
Obese subjects with impaired glucose tolerance (IGT) are more susceptible than healthy individuals to oxidative stress and cardiovascular disease. This randomised controlled investigation was designed to test the hypothesis that α-lipoic acid supplementation and exercise training may elicit favourable clinical changes in obese subjects with IGT. All data were collected from 24 obese (BMI ≥ 30 kg/m2) IGT patients. Following participant randomisation into two groups, fasting venous blood samples were obtained at baseline, and before and following intervention. The first group consisted of 12 participants who completed a 12 week control phase followed by 12 weeks of chronic exercise at 65% HRmax for 30 minutes a day, 5 days per week, while ingesting 1 gram per day of α-lipoic acid for 12 weeks. The second group consisted of 12 participants who completed the same 12 week control phase, but this was followed by 12 weeks of 1 gram per day of α-lipoic acid supplementation only (no exercise). The main findings show a comparatively greater rate of low density lipoprotein (LDL) oxidation in the group consisting of α-lipoic acid only (p < 0.05 vs. pre intervention), although total oxidant status was lower post intervention (p < 0.05 vs. baseline) in this group. However, exercise and α-lipoic acid in combination attenuates LDL oxidation. Furthermore, in the α-lipoic acid supplement plus exercise training group, total antioxidant capacity was significantly increased (p < 0.05 vs. baseline and pre intervention). Body fat percentage and waist and hip circumference decreased following exercise training (p < 0.05 vs. post intervention). There were no selective treatment differences for a range of other clinical outcomes including glycaemic regulation (p > 0.05). These findings report that α-lipoic acid ingestion may increase the atherogenicity of LDL when ingested in isolation of exercise, suggesting that in IGT the use of this antioxidant treatment does not ameliorate metabolic disturbances, but instead may detrimentally contribute to the pathogenesis of atherosclerosis and development of CVD. However, when α-lipoic acid is combined with exercise, this atherogenic effect is abolished. PMID:22107734
-
Ta, Philong; Buchmeier, Nancy; Newton, Gerald L.; Rawat, Mamta; Fahey, Robert C.
2011-01-01
The mshA::Tn5 mutant of Mycobacterium smegmatis does not produce mycothiol (MSH) and was found to markedly overproduce both ergothioneine and an ∼15-kDa protein determined to be organic hydroperoxide resistance protein (Ohr). An mshA(G32D) mutant lacking MSH overproduced ergothioneine but not Ohr. Comparison of the mutant phenotypes with those of the wild-type strain indicated the following: Ohr protects against organic hydroperoxide toxicity, whereas ergothioneine does not; an additional MSH-dependent organic hydroperoxide peroxidase exists; and elevated isoniazid resistance in the mutant is associated with both Ohr and the absence of MSH. Purified Ohr showed high activity with linoleic acid hydroperoxide, indicating lipid hydroperoxides as the likely physiologic targets. The reduction of oxidized Ohr by NADH was shown to be catalyzed by lipoamide dehydrogenase and either lipoamide or DlaT (SucB). Since free lipoamide and lipoic acid levels were shown to be undetectable in M. smegmatis, the bound lipoyl residues of DlaT are the likely source of the physiological dithiol reductant for Ohr. The pattern of occurrence of homologs of Ohr among bacteria suggests that the ohr gene has been distributed by lateral transfer. The finding of multiple Ohr homologs with various sequence identities in some bacterial genomes indicates that there may be multiple physiologic targets for Ohr proteins. PMID:21335456
-
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
-
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-01-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404
-
Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L
2010-05-01
Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.
-
Deng, Ying; Nagachar, Nivedita; Xiao, Chaowen; Tien, Ming
2013-01-01
The acs operon of Gluconacetobacter is thought to encode AcsA, AcsB, AcsC, and AcsD proteins that constitute the cellulose synthase complex, required for the synthesis and secretion of crystalline cellulose microfibrils. A few other genes have been shown to be involved in this process, but their precise role is unclear. We report here the use of Tn5 transposon insertion mutagenesis to identify and characterize six non-cellulose-producing (Cel−) mutants of Gluconacetobacter hansenii ATCC 23769. The genes disrupted were acsA, acsC, ccpAx (encoding cellulose-complementing protein [the subscript “Ax” indicates genes from organisms formerly classified as Acetobacter xylinum]), dgc1 (encoding guanylate dicyclase), and crp-fnr (encoding a cyclic AMP receptor protein/fumarate nitrate reductase transcriptional regulator). Protein blot analysis revealed that (i) AcsB and AcsC were absent in the acsA mutant, (ii) the levels of AcsB and AcsC were significantly reduced in the ccpAx mutant, and (iii) the level of AcsD was not affected in any of the Cel− mutants. Promoter analysis showed that the acs operon does not include acsD, unlike the organization of the acs operon of several strains of closely related Gluconacetobacter xylinus. Complementation experiments confirmed that the gene disrupted in each Cel− mutant was responsible for the phenotype. Quantitative real-time PCR and protein blotting results suggest that the transcription of bglAx (encoding β-glucosidase and located immediately downstream from acsD) was strongly dependent on Crp/Fnr. A bglAx knockout mutant, generated via homologous recombination, produced only ∼16% of the wild-type cellulose level. Since the crp-fnr mutant did not produce any cellulose, Crp/Fnr may regulate the expression of other gene(s) involved in cellulose biosynthesis. PMID:24013627
-
Volchegorskiĭ, I A; Rassokhina, L M; Koliadich, M I; Alekseev, M I
2011-01-01
Short-term, prospective placebo-controlled simple blind randomized study of the effects of alpha-lipoic acid and mexidol on the dynamics of affective status disorders, cognitive functions, and quality of life in parallel with changes in carbohydrate metabolism and lipidemia has been conducted in diabetic patients. It is established that two-week administration of alpha-lipoic acid (600 mg once a day, i.v.) and mexidol (300 mg once a day, i.v.) reduced hyperglycemia by 13.00 with simultaneous decrease of depressive "feelings of guilt". In case of mexidol, these effects were accompanied by positive "vitality" dynamics established with SF-36 questionnaire and reflecting improvement in patients' quality of life. Additionally, course administration of alpha-lipoic acid increased attention as studied with Schulte tables. Favorable psychotropic effects of alpha-lipoic acid and mexidol were unrelated to changes in lipidemia and "lipid peroxidation - antioxidant protection" system indicators.
-
de Araújo, Dayane Pessoa; De Sousa, Caren Nádia Soares; Araújo, Paulo Victor Pontes; Menezes, Carlos Eduardo de Souza; Sousa Rodrigues, Francisca Taciana; Escudeiro, Sarah Souza; Lima, Nicole Brito Cortez; Patrocínio, Manoel Claúdio Azevedo; Aguiar, Lissiana Magna Vasconcelos; Viana, Glauce Socorro de Barros; Vasconcelos, Silvânia Maria Mendes
2013-01-01
This study aimed to investigate behavioral and neurochemical effects of α-lipoic acid (100 mg/kg or 200 mg/kg) alone or associated with L-DOPA using an animal model of Parkinson's disease induced by stereotaxic injection of 6-hydroxydopamine (6-OHDA) in rat striatum. Motor behavior was assessed by monitoring body rotations induced by apomorphine, open field test and cylinder test. Oxidative stress was accessed by determination of lipid peroxidation using the TBARS method, concentration of nitrite and evaluation of catalase activity. α-Lipoic acid decreased body rotations induced by apomorphine, as well as caused an improvement in motor performance by increasing locomotor activity in the open field test and use of contralateral paw (in the opposite side of the lesion produced by 6-OHDA) at cylinder test. α-lipoic acid showed antioxidant effects, decreasing lipid peroxidation and nitrite levels and interacting with antioxidant system by decreasing of endogenous catalase activity. Therefore, α-lipoic acid prevented the damage induced by 6-OHDA or by chronic use of L-DOPA in dopaminergic neurons, suggesting that α-lipoic could be a new therapeutic target for Parkinson's disease prevention and treatment. PMID:24023579
-
Effect of the Antioxidant Lipoic Acid in Aortic Phenotype in a Marfan Syndrome Mouse Model.
Guido, Maria C; Debbas, Victor; Salemi, Vera M; Tavares, Elaine R; Meirelles, Thayna; Araujo, Thaís L S; Nolasco, Patricia; Ferreira-Filho, Julio C A; Takimura, Celso K; Pereira, Lygia V; Laurindo, Francisco R
2018-01-01
Marfan syndrome (MFS) cardiovascular manifestations such as aortic aneurysms and cardiomyopathy carry substantial morbidity/mortality. We investigated the effects of lipoic acid, an antioxidant, on ROS production and aortic remodeling in a MFS mgΔ loxPneo mouse model. MFS and WT (wild-type) 1-month-old mice were allocated to 3 groups: untreated, treated with losartan, and treated with lipoic acid. At 6 months old, echocardiography, ROS production, and morphological analysis of aortas were performed. Aortic ROS generation in 6-month-old MFS animals was higher at advanced stages of disease in MFS. An unprecedented finding in MFS mice analyzed by OCT was the occurrence of focal inhomogeneous regions in the aortic arch, either collagen-rich extremely thickened or collagen-poor hypotrophic regions. MFS animals treated with lipoic acid showed markedly reduced ROS production and lower ERK1/2 phosphorylation; meanwhile, aortic dilation and elastic fiber breakdown were unaltered. Of note, lipoic acid treatment associated with the absence of focal inhomogeneous regions in MFS animals. Losartan reduced aortic dilation and elastic fiber breakdown despite no change in ROS generation. In conclusion, oxidant generation by itself seems neutral with respect to aneurysm progression in MFS; however, lipoic acid-mediated reduction of inhomogeneous regions may potentially associate with less anisotropy and reduced chance of dissection/rupture.
-
Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna
2015-01-01
The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1-10 μmol L(-1). Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5-50 μmol L(-1). Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value.
-
Zhao, Ran-Ran; Xu, Fei; Xu, Xiao-Chen; Tan, Guo-Jun; Liu, Liang-Min; Wu, Ning; Zhang, Wen-Zhong; Liu, Ji-Xiang
2015-02-05
Brain oxidative stress due to chronic cerebral hypoperfusion was considered to be the major risk factor in the pathogenesis of vascular dementia. In this study, we investigated the protective efficacy of alpha-lipoic acid, an antioxidant, against vascular dementia in rats, as well as the potential mechanism. Bilateral common carotid arteries occlusion (BCCAO) induced severe cognitive deficits tested by Morris water maze (MWM), along with oxidative stress and disturbance of central cholinergic system. However, administration of alpha-lipoic acid (50mg/kg, i.p.) for 28 days significantly restored cognitive deficits induced by BCCAO. Biochemical determination revealed that alpha-lipoic acid markedly decreased the production of malondialdehyde (MDA) and the generation of reactive oxidative species (ROS), and increased the level of reduced glutathione (GSH) in the hippocampal tissue. Additionally, alpha-lipoic acid raised the level of acetylcholine (ACh) and choline acetyltransferase (ChAT) and decreased the activity of acetycholinesterase (AChE) in the hippocampus. These results indicated that treatment with alpha-lipoic acid significantly improved behavioral alterations, protected against oxidative stress, and restored central cholinergic system in the rat model of vascular dementia induced by BCCAO. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
-
Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna
2015-01-01
The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1–10 μmol L−1. Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5–50 μmol L−1. Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616
-
Volchegorskii, I A; Miroshnichenko, I Yu; Rassokhina, L M; Faizullin, R M
To study an effect of reamberin and α-lipoic acid (α-LA) on the tolerance of mice with experimental diabetes mellitus (DM) to acute cerebrovascular accident (ACVA) in mice experiments. The authors studied mice with alloxan diabetes and subtotal and total brain ischemia. In additional experimental series, an effect of reamberin and α-lipoic acid on the tolerance to acute hypoxic hypoxia and intensity of hyperglycemia in experimental DM was studied. The increased vulnerability of animals to ACVA due to hyperglycemia and increased sensitivity to acute hypoxic hypoxia was established. Reamberin and α-lipoic acid administered for 14 days in doses, which are equivalent to therapeutic range in humans, enhance the tolerance to ACVA and acute hypoxic hypoxia in mice with alloxan diabetes. These medications also decrease the intensity of hyperglycemia during concurrent insulin replacement therapy. The increased tolerance to ACVA in mice with alloxan diabetes caused by reamberin and alpha-lipoic acid is associated with an antihypoxic effect of these medications and does not depend on their effect on the intensity of hyperglycemia. Reamberin outperformed α-lipoic acid in the antihypoxic activity, protection against ACVA and the rate of onset of glucose reducing effect in experimental diabetes mellitus.
-
Inhibition of Human Amylin Aggregation and Cellular Toxicity by Lipoic Acid and Ascorbic Acid.
Azzam, Sarah Kassem; Jang, Hyunwoo; Choi, Myung Chul; Alsafar, Habiba; Lukman, Suryani; Lee, Sungmun
2018-04-30
More than 30 human degenerative diseases result from protein aggregation such as Alzheimer's disease (AD) and type 2 diabetes mellitus (T2DM). Islet amyloid deposits, a hallmark in T2DM, are found in pancreatic islets of more than 90 % of T2DM patients. An association between amylin aggregation and reduction in β-cell mass was also established by post-mortem studies. A strategy in preventing protein aggregation-related disorders is to inhibit the protein aggregation and associated toxicity. In this study we demonstrated that two inhibitors, lipoic acid and ascorbic acid, significantly inhibited amylin aggregation. Compared to amylin (15 μM) as 100 %, lipoic acid and ascorbic acid reduced amylin fibril formation to 42.1 ± 17.2 % and 42.9 ± 12.8 % respectively, which is confirmed by fluorescence and TEM images. In cell viability tests, both inhibitors protected RIN-m5f β-cells from the toxicity of amylin aggregates. At 10:1 molar ratio of lipoic acid to amylin, lipoic acid with amylin increased the cell viability to 70.3 %, whereas only 42.8 % RIN-m5f β-cells survived in amylin aggregates. For ascorbic acid, an equimolar ratio achieved the highest cell viability of 63.3 % as compared to 42.8 % with amylin aggregates only. Docking results showed that lipoic acid and ascorbic acid physically interact with amylin amyloidogenic region (residues Ser20-Ser29) via hydrophobic interactions; hence reducing aggregation levels. Therefore, lipoic acid and ascorbic acid prevented amylin aggregation via hydrophobic interactions, which resulted in the prevention of cell toxicity in vitro.
-
Li, Jia-Hui; Ju, Gui-Xia; Jiang, Jun-Lin; Li, Nian-Sheng; Peng, Jun; Luo, Xiu-Ju
2016-11-01
Numerous studies demonstrate that reactive aldehydes are highly toxic and aldehyde dehydrogenase 2 (ALDH2)-mediated detoxification of reactive aldehydes is thought as an endogenous protective mechanism against reactive aldehydes-induced cell injury. This study aims to explore whether lipoic acid, a potential ALDH2 activator, is able to protect gastric mucosa from ethanol-induced injury through a mechanism involving clearance of reactive aldehydes. The rats received 60% of acidified ethanol through intragastric administration and held for 1 h to establish a mucosal injury model. Lipoic acid (10 or 30 mg/kg) or Alda-1 (a positive control, 10 mg/kg) was given 45 min before the ethanol treatment. The gastric tissues were collected for analysis of gastric ulcer index, cellular apoptosis, 4-hydroxy-2-nonenal (4-HNE) and malondialdehyde (MDA) contents, and ALDH2 activity. The results showed that acute administration of ethanol led to an increase in gastric ulcer index, cellular apoptosis, 4-HNE and MDA contents concomitant with a decrease in ALDH2 activity; these phenomena were reversed by lipoic acid or Alda-1. The gastric protection of lipoic acid was attenuated in the presence of ALDH2 inhibitor. Based on these observations, we conclude that lipoic acid exerts the beneficial effects on ethanol-induced injury through a mechanism involving, at least in part, ALDH2 activation. As a dietary supplement or a medicine already in some countries, lipoic acid can be used to treat the ethanol - induced gastric mucosal injury. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Derosa, Giuseppe; D'Angelo, Angela; Romano, Davide; Maffioli, Pamela
2016-10-28
The aim of this study was to evaluate the effect of a food supplement containing α-lipoic acid and of a placebo on glyco-metabolic control and on oxidative stress markers in type 2 diabetics. We randomized 105 diabetics to either a supplementation containing 600 mg of α-lipoic acid, 165 mg of L -carnosin, 7.5 mg of zinc, and vitamins of group B, or a placebo, for three months. We evaluated body mass index, fasting plasma glucose (FPG), post-prandial-glucose (PPG), glycated hemoglobin (HbA 1c ), fasting plasma insulin (FPI), HOMA-index (HOMA-IR), lipid profile, high sensitivity C-reactive protein (Hs-CRP), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA). There was a reduction of FPG, PPG, and HbA 1c with the food supplement containing α-lipoic acid compared with a baseline, and with the placebo. Concerning lipid profile, we observed a reduction of LDL-C, and Tg with the food supplement, compared with both the baseline, and the placebo. There was a reduction of Hs-CRP with the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. An increase of SOD, and GSH-Px, and a decrease of MDA were reached by the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. We can conclude that the food supplement containing α-lipoic acid, L -carnosin, zinc, and vitamins of group B improved glycemic control, lipid profile, and anti-oxidative stress markers.
-
Derosa, Giuseppe; D’Angelo, Angela; Romano, Davide; Maffioli, Pamela
2016-01-01
The aim of this study was to evaluate the effect of a food supplement containing α-lipoic acid and of a placebo on glyco-metabolic control and on oxidative stress markers in type 2 diabetics. We randomized 105 diabetics to either a supplementation containing 600 mg of α-lipoic acid, 165 mg of L-carnosin, 7.5 mg of zinc, and vitamins of group B, or a placebo, for three months. We evaluated body mass index, fasting plasma glucose (FPG), post-prandial-glucose (PPG), glycated hemoglobin (HbA1c), fasting plasma insulin (FPI), HOMA-index (HOMA-IR), lipid profile, high sensitivity C-reactive protein (Hs-CRP), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA). There was a reduction of FPG, PPG, and HbA1c with the food supplement containing α-lipoic acid compared with a baseline, and with the placebo. Concerning lipid profile, we observed a reduction of LDL-C, and Tg with the food supplement, compared with both the baseline, and the placebo. There was a reduction of Hs-CRP with the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. An increase of SOD, and GSH-Px, and a decrease of MDA were reached by the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. We can conclude that the food supplement containing α-lipoic acid, L-carnosin, zinc, and vitamins of group B improved glycemic control, lipid profile, and anti-oxidative stress markers. PMID:27801825
-
Deslauriers, Jessica; Desmarais, Christian; Sarret, Philippe; Grignon, Sylvain
2014-03-01
Chronic administration of antipsychotics (APs) has been associated with dopamine D2 receptor (D2R) upregulation and tardive dyskinesia. We previously showed that haloperidol, a first-generation AP, exerted a more robust increase in D2R expression than amisulpride, a second-generation AP and that (±)-α-lipoic acid pre-treatment reversed the AP-induced D2R upregulation. We also demonstrated that the Akt/GSK-3β/β-catenin pathway is involved in the control of D2R expression levels, but is unlikely implicated in the preventive effects of (±)-α-lipoic acid since co-treatment with haloperidol and (±)-α-lipoic acid exerts synergistic effects on Akt/GSK-3β activation. These findings led us to examine whether the ERK/MAPK signaling pathway may be involved in D2R upregulation elicited by APs, and in its reversal by (±)-α-lipoic acid, in SH-SY5Y human neuroblastoma cells. Our results revealed that haloperidol, in parallel with an elevation in D2R mRNA levels, induced a larger increase of ERK (p42/p44) phosphorylation than amisulpride. Pre-treatment with the selective ERK inhibitor U0126 attenuated haloperidol-induced increase in D2R upregulation. Furthermore, (±)-α-lipoic acid prevented AP-induced ERK activation. These results show that (1) the ERK/MAPK pathway is involved in haloperidol-induced D2R upregulation; (2) the preventive effect of (±)-α-lipoic acid on haloperidol-induced D2R upregulation is in part mediated by an ERK/MAPK-dependent signaling cascade. Taken together, our data suggest that (±)-α-lipoic acid exerts synergistic effects with haloperidol on the Akt/GSK-3β pathway, potentially involved in the therapeutic effects of APs, and antagonism of ERK activation and D2R upregulation, potentially involved in tardive dyskinesia and treatment resistance.
-
Wheat germ oil and α-lipoic acid predominantly improve the lipid profile of broiler meat.
Arshad, Muhammad Sajid; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Shahid, Muhammad
2013-11-20
In response to recent assertions that synthetic antioxidants may have the potential to cause toxic effects and to consumers' increased attention to consuming natural products, the poultry industry has been seeking sources of natural antioxidants, alone or in combination with synthetic antioxidants that are currently being used by the industry. The present study was conducted to determine the effect of α-lipoic acid, α-tocopherol, and wheat germ oil on the status of antioxidant enzymes, fatty acid profile, and serum biochemical profile of broiler blood. One-day-old (180) broiler birds were fed six different feeds varying in their antioxidant content: no addition (T1), natural α-tocopherol (wheat germ oil, T2), synthetic α-tocopherol (T3), α-lipoic acid (T4), α-lipoic acid together with natural α-tocopherol (T5), and α-lipoic acid together with synthetic α-tocopherol (T6). The composition of saturated and unsaturated fatty acids in the breast and leg meat was positively influenced by the different dietary supplements. The content of fatty acid was significantly greater in broilers receiving T2 both in breast (23.92%) and in leg (25.82%) meat, whereas lower fatty acid levels was found in broilers receiving diets containing T6 in the breast (19.57%) and leg (21.30%) meat. Serum total cholesterol (113.42 mg/dL) and triglycerides (52.29 mg/dL) were lowest in the group given natural α-tocopherol and α-lipoic acid. Wheat germ oil containing natural α-tocopherol alone or with α-lipoic acid was more effective than synthetic α-tocopherol in raising levels of antioxidant enzymes superoxide dismutase, catalase, and glutathione reductase while lowering plasma total cholesterol, low-density lipoprotein, and triglycerides and raising high-density lipoprotein and plasma protein significantly. It was concluded that the combination of wheat germ oil and α-lipoic acid is helpful in improving the lipid profile of broilers.
-
Wu, Jun; Tang, Huiqin; Liu, Qun; Gan, Dingyun; Zhou, Man
2016-08-08
To investigate the effect of α-lipoic acid on the oxidative stress of wound tissues and diabetic wound healing in mice with diabetic feet. Sixty male C57BL/6J mice weighting 200-300 g were randomly divided into model group (control group, n =15), α-lipoic acid-treated model group ( n =15), miR-29b mimic group ( n =15), and miR-29b mimic negative control group (NC group, n =15). All animals received intraperitoneal injection of streptozocin to establish the diabetic model. Then, a full thickness wound of 5 mm×2 mm in size was created at 4 weeks after modeling. All mice were administrated with high-sugar-fat-diet. At the same day after modeling, α-lipoic acid-treated model group was continuously given intravenous injection of 100 mg/(kg·d) α-lipoic acid for 14 days; miR-29b mimic group and NC group received the tail intravenous injection of lentiviral vector for miR-29b mimic and miR-29b mimic negative control (a total of 2×10 7 TU), respectively, with the treatment of α-lipoic acid. The wound healing was observed and wound area was measured at 7 and 14 days. The wound tissues were harvested to detect the levels of superoxide dismutase (SOD) and glutathione (GSH) using xanthine oxidase method and 5, 5-dithiobis-2-nitrobenzoic acid staining method at 14 days. At the same day, 7, and 14 days after modeling, the relative miR-29b expression in wound tissues from control and α-lipoic acid-treated model groups was detected by real-time fluorescence quantitative PCR. All mice survived to the experiment end. The wound healing was faster in α-lipoic acid-treated group than control group. At 7 and 14 days, the relative wound area and miR-29b expression level were significantly lower, while the contents of SOD and GSH were significantly higher in α-lipoic acid-treated group than control group ( P <0.05). In addition, miR-29b mimic group had significantly increased relative wound area and significantly decreased the contents of SOD and GSH when compared with NC group at 7 and 14 days ( P <0.05). α-lipoic acid could inhibit oxidative stress and promote diabetic wound healing by suppressing expression of miR-29b in mice.
-
Toh-E, Akio; Ohkusu, Misako; Shimizu, Kiminori; Yamaguchi, Masashi; Ishiwada, Naruhiko; Watanabe, Akira; Kamei, Katsuhiko
2017-12-01
We constructed deletion mutants of Cryptococcus neoformans var neoformans (serotype D) genes encoding late ergosterol biosynthetic pathway enzymes and found that the mutations enhanced susceptibility to various drugs including micafungin, one of the echinocandins, to which wild-type Cryptococcus strains show no susceptibility. Furthermore, through isolation of a mutant resistant to micafungin from a micafungin-sensitive erg mutant and genetic analysis of it, we found that the responsible mutation occurred in the hotspot 2 of FKS1 encoding β-1, 3-glucan synthase, indicating that micafungin inhibited the growth of the erg mutant via inhibiting Fks1 activity. Addition of ergosterol to the culture of the erg mutants recovered the resistance to micafungin, suggesting that the presence of ergosterol in membrane inhibits the accession of micafungin to its target. We found that a loss of one of genes encoding subunits of v-ATPase, VPH1, made Cryptococcus cells sensitive to micafungin. Our observation that the erg2 vph1 double mutant was more sensitive to micafungin than either single mutant suggests that these two genes act differently in becoming resistant to micafungin. The erg mutants allowed us to study the physiological significance of β-1, 3-glucan synthesis in C. neoformans; the inhibition of β-1, 3-glucan synthesis induced cell death and changes in cellular morphology. By observing the erg mutant cells recovering from the growth inhibition imposed by micafungin, we recognized β-1, 3-glucan synthesis would suppress filamentous growth in C. neoformans.
-
Impact evaluation of α-lipoic acid in gamma-irradiated erythrocytes
NASA Astrophysics Data System (ADS)
Desouky, Omar S.; Selim, Nabila S.; Elbakrawy, Eman M.; Rezk, Rezk A.
2011-03-01
This work is intended to study in vitro the ability of lipoic acid to protect erythrocytes against the oxidative damage resulting from exposure to gamma radiation through measurement of their rheological properties and to study the effects of detergent on their membrane solubility and permeability. Different doses of gamma radiation were applied: the most recommended and applied dose (25 Gy), and two higher doses, namely 50 and 100 Gy. The effect of addition of lipoic acid as well as its effect as a radioprotector was tested. The obtained results show changes in structural integrity of the erythrocyte cell membrane components as a result of oxidative damage due to gamma radiation that could be improved by pre-treatment with the antioxidant lipoic acid.
-
Sharma, Vijay K; Dean-Nystrom, Evelyn A; Casey, Thomas A
2011-07-12
Escherichia coli O157:H7 colonizes cattle intestines by using the locus of enterocyte effacement (LEE)-encoded proteins. The induction of systemic immune response against LEE-encoded proteins, therefore, will prove effective in reducing E. coli O157:H7 colonization in cattle. The previous studies have demonstrated that a hha (encodes for a hemolysin expression modulating protein) deletion enhances expression of LEE-encoded proteins and a sepB (encodes an ATPase required for the secretion of LEE-encoded proteins) deletion results in intracellular accumulation of LEE proteins. In this study, we demonstrate the efficacy of the hha and hha sepB deletion mutants as bacterins for reducing fecal shedding of E. coli O157:H7 in experimentally inoculated weaned calves. The weaned calves were injected intramuscularly with the bacterins containing 10(9) heat-killed cells of the hha(+) wild-type or hha or hha sepB isogenic mutants, and boosted with the same doses 2- and 4-weeks later. The evaluation of the immune response two weeks after the last booster immunization revealed that the calves vaccinated with the hha mutant bacterin had higher antibody titers against LEE proteins compared to the titers for these antibodies in the calves vaccinated with the hha sepB mutant or hha(+) wild-type bacterins. Following oral inoculations with 10(10) CFU of the wild-type E. coli O157:H7, the greater numbers of calves in the group vaccinated with the hha or hha sepB mutant bacterins stopped shedding the inoculum strain within a few days after the inoculations compared to the group of calves vaccinated with the hha(+) wild-type bacterin or PBS sham vaccine. Thus, the use of bacterins prepared from the hha and hha sepB mutants for reducing colonization of E. coli O157:H7 in cattle could represent a potentially important pre-harvest strategy to enhance post-harvest safety of bovine food products, water and produce. Copyright © 2011 Elsevier Ltd. All rights reserved.
-
Lipoic Acid Metabolism of Plasmodium - A Suitable Drug Target
Storm, Janet; Müller, Sylke
2012-01-01
α-Lipoic acid (6,8-thioctic acid; LA) is a vital co-factor of α-ketoacid dehydrogenase complexes and the glycine cleavage system. In recent years it was shown that biosynthesis and salvage of LA in Plasmodium are necessary for the parasites to complete their complex life cycle. LA salvage requires two lipoic acid protein ligases (LplA1 and LplA2). LplA1 is confined to the mitochondrion while LplA2 is located in both the mitochondrion and the apicoplast. LplA1 exclusively uses salvaged LA and lipoylates α-ketoglutarate dehydrogenase, branched chain α-ketoacid dehydrogenase and the H-protein of the glycine cleavage system. LplA2 cannot compensate for the loss of LplA1 function during blood stage development suggesting a specific function for LplA2 that has yet to be elucidated. LA salvage is essential for the intra-erythrocytic and liver stage development of Plasmodium and thus offers great potential for future drug or vaccine development. LA biosynthesis, comprising octanoyl-acyl carrier protein (ACP) : protein N-octanoyltransferase (LipB) and lipoate synthase (LipA), is exclusively found in the apicoplast of Plasmodium where it generates LA de novo from octanoyl-ACP, provided by the type II fatty acid biosynthesis (FAS II) pathway also present in the organelle. LA is the co-factor of the acetyltransferase subunit of the apicoplast located pyruvate dehydrogenase (PDH), which generates acetyl-CoA, feeding into FAS II. LA biosynthesis is not vital for intra-erythrocytic development of Plasmodium, but the deletion of several genes encoding components of FAS II or PDH was detrimental for liver stage development of the parasites indirectly suggesting that the same applies to LA biosynthesis. These data provide strong evidence that LA salvage and biosynthesis are vital for different stages of Plasmodium development and offer potential for drug and vaccine design against malaria. PMID:22607141
-
Rago, R; Marcucci, I; Leto, G; Caponecchia, L; Salacone, P; Bonanni, P; Fiori, C; Sorrenti, G; Sebastianelli, A
2015-01-01
The aim of the present study was to evaluate the effectiveness of the combined administration of myo-inositol and α-lipoic acid in polycystic ovary syndrome (PCOS) patients with normal body mass index (BMI), who had previously undergone intracytoplasmic sperm injection (ICSI) and received myo-inositol alone. Thirty-six of 65 normal-weight patients affected by PCOS who did not achieve pregnancy and one patient who had a spontaneous abortion were re-enrolled and given a cycle of treatment with myo-inositol and α-lipoic acid. For all female partners of the treated couples, the endocrine-metabolic and ultrasound parameters, ovarian volume, oocyte and embryo quality, and pregnancy rates were assessed before and after three months of treatment and compared with those of previous in vitro fertilization (IVF) cycle(s). After supplementation of myo-inositol with α-lipoic acid, insulin levels, BMI and ovarian volume were significantly reduced compared with myo-inositol alone. No differences were found in the fertilization and cleavage rate or in the mean number of transferred embryos between the two different treatments, whereas the number of grade 1 embryos was significantly increased, with a significant reduction in the number of grade 2 embryos treated with myo-inositol plus α-lipoic acid. Clinical pregnancy was not significantly different with a trend for a higher percentage for of myo-inositol and α-lipoic acid compared to the myo-inositol alone group. Our preliminary data suggest that the supplementation of myo-inositol and α-lipoic acid in PCOS patients undergoing an IVF cycle can help to improve their reproductive outcome and also their metabolic profiles, opening potential for their use in long-term prevention of PCOS.
-
Huerta, A E; Prieto-Hontoria, P L; Fernández-Galilea, M; Sáinz, N; Cuervo, M; Martínez, J A; Moreno-Aliaga, M J
2015-09-01
Irisin is a myokine/adipokine with potential role in obesity and diabetes. The objectives of the present study were to analyse the relationship between irisin and glucose metabolism at baseline and during an oral glucose tolerance test (OGTT) and to determine the effects of eicosapentaenoic acid (EPA) and/or α-lipoic acid treatment on irisin production in cultured human adipocytes and in vivo in healthy overweight/obese women following a weight loss program. Seventy-three overweight/obese women followed a 30% energy-restricted diet supplemented without (control) or with EPA (1.3 g/day), α-lipoic acid (0.3 g/day) or both EPA + α-lipoic acid (1.3 + 0.3 g/day) during 10 weeks. An OGTT was performed at baseline. Moreover, human adipocytes were treated with EPA (100-200 μM) or α-lipoic acid (100-250 μM) during 24 h. At baseline plasma, irisin circulating levels were positively associated with glucose levels; however, serum irisin concentrations were not affected by the increment in blood glucose or insulin during the OGTT. Treatment with α-lipoic acid (250 μM) upregulated Fndc5 messenger RNA (mRNA) and irisin secretion in cultured adipocytes. In overweight/obese women, irisin circulating levels decreased significantly after weight loss in all groups, while no additional differences were induced by EPA or α-lipoic acid supplementation. Moreover, plasma irisin levels were positively associated with higher glucose concentrations at beginning and at endpoint of the study. The data from the OGTT suggest that glucose is not a direct contributing factor of irisin release. The higher irisin levels observed in overweight/obese conditions could be a protective response of organism to early glucose impairments.
-
Manda, Kailash; Ueno, Megumi; Anzai, Kazunori
2008-03-05
Exposure to high-energy particle radiation (HZE) may cause oxidative stress and cognitive impairment in the same manner that seen in aged mice. This phenomenon has raised the concerns about the safety of an extended manned mission into deep space where a significant portion of the radiation burden would come from HZE particle radiation. The present study aimed at investigating the role of alpha-lipoic acid against space radiation-induced oxidative stress and antioxidant status in cerebellum and its correlation with cognitive dysfunction. We observed spontaneous motor activities and spatial memory task of mice using pyroelectric infrared sensor and programmed video tracking system, respectively. Whole body irradiation of mice with high-LET (56)Fe beams (500 MeV/nucleon, 1.5 Gy) substantially impaired the reference memory at 30 day post-irradiation; however, no significant effect was observed on motor activities of mice. Acute intraperitoneal treatment of mice with alpha-lipoic acid prior to irradiation significantly attenuated such memory dysfunction. Radiation-induced apoptotic damage in cerebellum was examined using a neuronal-specific terminal deoxynucleotidyl transferase-mediated nick end-labeling method (NeuroTACS). Radiation-induced apoptotic and necrotic cell death of granule cells and Purkinje cells were inhibited significantly by alpha-lipoic acid pretreatment. Alpha-lipoic acid pretreatment exerted a very high magnitude of protection against radiation-induced augmentation of DNA damage (comet tail movement and serum 8-OHdG), lipid proxidation products (MDA+HAE) and protein carbonyls in mice cerebellum. Further, radiation-induced decline of non-protein sulfhydryl (NP-SH) contents of cerebellum and plasma ferric reducing power (FRAP) was also inhibited by alpha-lipoic acid pre-treatment. Results clearly indicate that alpha-lipoic acid is a potent neuroprotective antioxidant. Moreover, present finding also support the idea suggesting the cerebellar involvement in cognition.
-
Antioxidant Prophylaxis in the Prevention of Prostatic Epithelial Neoplasia
2007-02-01
additional year until the end of March 2008. 105Co-enzyme Q10 105Grape seed extract 31.5Alpha Lipoic acid 10.5Lutein 10.5Lycopene...antioxidants used in the study. Ascorbic acid is a potent antioxidant that interacts synergistically with Lipoic acid to destroy many types of free radicals...co-enzyme Q10. Lycopene and lutein are fat soluble carotenoids that work synergistically and possess very high antioxidant activity. Lipoic acid not
-
Sublethal Total Body Irradiation Leads to Early Cerebellar Damage and Oxidative Stress
2010-01-01
mice: protective effect of alpha - lipoic acid . Behav Brain Res 2007b; 177(1): 7-14. [8] Manda K, Ueno M, Anzai K. Melatonin mitigates oxidative...Memory impairment, oxidative damage and apoptosis induced by space radiation: ameliorative potential of alpha - lipoic acid . Behav Brain Res 2008b...1977; 171(1): 39-50. [6] Manda K, Ueno M, Moritake T, Anzai K. - Lipoic acid attenuates x-irradiation-induced oxidative stress in mice. Cell Biol
-
Lipoic acid attenuates Aroclor 1260-induced hepatotoxicity in adult rats.
Aly, Hamdy A A; Mansour, Ahmed M; Hassan, Memy H; Abd-Ellah, Mohamed F
2016-08-01
The present study was aimed to investigate the mechanistic aspect of Aroclor 1260-induced hepatotoxicity and its protection by lipoic acid. The adult male Albino rats were divided into six groups. Group I served as control. Group II received lipoic acid (35 mg/kg/day). Aroclor 1260 was given to rats by oral gavage at doses 20, 40, or 60 mg/kg/day (Groups III, IV, and V, respectively). Group VI was pretreated with lipoic acid (35 mg/kg/day) 24 h before Aroclor 1260 (40 mg/kg/day). Treatment in all groups was continued for further 15 consecutive days. Serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, and lactate dehydrogenase activities and total bilirubin, total cholesterol, and triglycerides were significantly increased while total protein, total albumin, and high-density lipoprotein were significantly decreased. Hydrogen peroxide production and lipid peroxidation were significantly increased while superoxide dismutase and catalase activities and reduced glutathione (GSH) content was significantly decreased in liver. Caspase-3 & -9 activities were significantly increased in liver. Lipoic acid pretreatment significantly reverted all these abnormalities toward their normal levels. In conclusion, Aroclor 1260 induced liver dysfunction, at least in part, by induction of oxidative stress. Apoptotic effect of hepatic cells is involved in Aroclor 1260-induced liver injury. Lipoic acid could protect rats against Aroclor 1260-induced hepatotoxicity. © 2014 Wiley Periodicals, Inc. Environ Toxicol 31: 913-922, 2016. © 2014 Wiley Periodicals, Inc.
-
Huerta, Ana E; Prieto-Hontoria, Pedro L; Fernández-Galilea, Marta; Escoté, Xavier; Martínez, J Alfredo; Moreno-Aliaga, María J
2017-01-02
In obesity, the increment of adiposity levels disrupts the whole body homeostasis, promoting an over production of oxidants and inflammatory mediators. The current study aimed to characterize the transcriptomic changes promoted by supplementation with eicosapentaenoic acid (EPA, 1.3 g/day), α-lipoic acid (0.3 g/day), or both (EPA + α-lipoic acid, 1.3 g/day + 0.3 g/day) in subcutaneous abdominal adipose tissue from overweight/obese healthy women, who followed a hypocaloric diet (30% of total energy expenditure) during ten weeks, by using a microarray approach. At the end of the intervention, a total of 33,297 genes were analyzed using Affymetrix GeneChip arrays. EPA promoted changes in extracellular matrix remodeling gene expression, besides a rise of genes associated with either chemotaxis or wound repair. α-Lipoic acid decreased expression of genes related with cell adhesion and inflammation. Furthermore, α-lipoic acid, especially in combination with EPA, upregulated the expression of genes associated with lipid catabolism while downregulated genes involved in lipids storage. Together, all these data suggest that some of the metabolic effects of EPA and α-lipoic acid could be related to their regulatory actions on adipose tissue metabolism. © 2016 BioFactors, 43(1):117-131, 2017. © 2016 International Union of Biochemistry and Molecular Biology.
-
Effects of α-lipoic acid and eicosapentaenoic acid in overweight and obese women during weight loss.
Huerta, Ana E; Navas-Carretero, Santiago; Prieto-Hontoria, Pedro L; Martínez, J Alfredo; Moreno-Aliaga, María J
2015-02-01
To evaluate the potential body weight-lowering effects of dietary supplementation with eicosapentaenoic acid (EPA) and α-lipoic acid separately or combined in healthy overweight/obese women following a hypocaloric diet. This is a short-term double-blind placebo-controlled study with parallel design that lasted 10 weeks. Of the randomized participants, 97 women received the allocated treatment [Control, EPA (1.3 g/d), α-lipoic acid (0.3 g/d), and EPA+α-lipoic acid (1.3 g/d+0.3 g/d)], and 77 volunteers completed the study. All groups followed an energy-restricted diet of 30% less than total energy expenditure. Body weight, anthropometric measurements, body composition, resting energy expenditure, blood pressure, serum glucose, and insulin and lipid profile, as well as leptin and ghrelin levels, were assessed at baseline and after nutritional intervention. Body weight loss was significantly higher (P<0.05) in those groups supplemented with α-lipoic acid. EPA supplementation significantly attenuated (P<0.001) the decrease in leptin levels that occurs during weight loss. Body weight loss improved lipid and glucose metabolism parameters but without significant differences between groups. The intervention suggests that α-lipoic acid supplementation alone or in combination with EPA may help to promote body weight loss in healthy overweight/obese women following energy-restricted diets. © 2014 The Obesity Society.
-
Effect of the Antioxidant Lipoic Acid in Aortic Phenotype in a Marfan Syndrome Mouse Model
Debbas, Victor; Salemi, Vera M.; Tavares, Elaine R.; Meirelles, Thayna; Ferreira-Filho, Julio C. A.; Takimura, Celso K.; Pereira, Lygia V.; Laurindo, Francisco R.
2018-01-01
Marfan syndrome (MFS) cardiovascular manifestations such as aortic aneurysms and cardiomyopathy carry substantial morbidity/mortality. We investigated the effects of lipoic acid, an antioxidant, on ROS production and aortic remodeling in a MFS mgΔloxPneo mouse model. MFS and WT (wild-type) 1-month-old mice were allocated to 3 groups: untreated, treated with losartan, and treated with lipoic acid. At 6 months old, echocardiography, ROS production, and morphological analysis of aortas were performed. Aortic ROS generation in 6-month-old MFS animals was higher at advanced stages of disease in MFS. An unprecedented finding in MFS mice analyzed by OCT was the occurrence of focal inhomogeneous regions in the aortic arch, either collagen-rich extremely thickened or collagen-poor hypotrophic regions. MFS animals treated with lipoic acid showed markedly reduced ROS production and lower ERK1/2 phosphorylation; meanwhile, aortic dilation and elastic fiber breakdown were unaltered. Of note, lipoic acid treatment associated with the absence of focal inhomogeneous regions in MFS animals. Losartan reduced aortic dilation and elastic fiber breakdown despite no change in ROS generation. In conclusion, oxidant generation by itself seems neutral with respect to aneurysm progression in MFS; however, lipoic acid-mediated reduction of inhomogeneous regions may potentially associate with less anisotropy and reduced chance of dissection/rupture. PMID:29765495
-
Mochizuki, Nobuyoshi; Brusslan, Judy A.; Larkin, Robert; Nagatani, Akira; Chory, Joanne
2001-01-01
A plastid-derived signal plays an important role in the coordinated expression of both nuclear- and chloroplast-localized genes that encode photosynthesis-related proteins. Arabidopsis GUN (genomes uncoupled) loci have been identified as components of plastid-to-nucleus signal transduction. Unlike wild-type plants, gun mutants have nuclear Lhcb1 expression in the absence of chloroplast development. We observed a synergistic phenotype in some gun double-mutant combinations, suggesting there are at least two independent pathways in plastid-to-nucleus signal transduction. There is a reduction of chlorophyll accumulation in gun4 and gun5 mutant plants, and a gun4gun5 double mutant shows an albino phenotype. We cloned the GUN5 gene, which encodes the ChlH subunit of Mg-chelatase. We also show that gun2 and gun3 are alleles of the known photomorphogenic mutants, hy1 and hy2, which are required for phytochromobilin synthesis from heme. These findings suggest that certain perturbations of the tetrapyrrole biosynthetic pathway generate a signal from chloroplasts that causes transcriptional repression of nuclear genes encoding plastid-localized proteins. The comparison of mutant phenotypes of gun5 and another Mg-chelatase subunit (ChlI) mutant suggests a specific function for ChlH protein in the plastid-signaling pathway. PMID:11172074
-
[Safety and structural analysis of polymers produced in manufacturing process of alpha-lipoic acid].
Shimoda, Hiroshi; Tanaka, Junji; Seki, Azusa; Honda, Haruya; Akaogi, Seiichiro; Komatsubara, Hirobumi; Suzuki, Nobuo; Kameyama, Mayumi; Tamura, Satoru; Murakami, Nobutoshi
2007-10-01
Alpha-Lipoic acid has recently been permitted for use in foodstuffs and is contained in tablets and capsules. Although alpha-lipoic acid is synthesized from adipic acid, the safety of polymers produced during the purification and drying processes has been an issue of concern. Hence, we examined the safety profiles of thermally denatured polymer (LAP-A) and ethanol-denatured polymer (LAP-B) produced in the manufacturing process of alpha-lipoic acid. Furthermore, we conducted structural analysis of these polymers by 1H-NMR and FAB-MS spectroscopy. In a consecutive ingestion test, male and female mice ingested diet containing 0.1 and 0.2% LAP-A and -B for 4 weeks. Blood uric acid, potassium and lactate dehydrogenase (LDH) tended to increase without dose-dependency. Relative liver weights were also increased. However, male dogs that were orally administered LAP-B (500 mg/kg) once did not show any abnormalities in blood parameters or general condition. These findings indicate that alpha-lipoic acid polymers are not acutely toxic; however, chronic ingestion of these polymers may affect liver and kidney functions.
-
Dwivedi, Nidhi; Flora, Govinder; Kushwaha, Pramod; Flora, Swaran J S
2014-01-01
We investigated protective efficacy of α-lipoic acid (LA), an antioxidant against arsenic and DDVP co-exposed rats. Biochemical variables suggestive of oxidative stress, neurological dysfunction, and tissue histopathological alterations were determined. Male rats were exposed either to 50 ppm sodium arsenite in drinking water or in combination with DDVP (4 mg/kg, subcutaneously) for 10 weeks. α-Lipoic acid (50mg/kg, pos) was also co-administered in above groups. Arsenic exposure led to significant oxidative stress along, hepatotoxicity, hematotoxicity and altered brain biogenic amines levels accompanied by increased arsenic accumulation in blood and tissues. These altered biochemical variables were supported by histopathological examinations leading to oxidative stress and cell death. These biochemical alterations were significantly restored by co-administration of α-lipoic acid with arsenic and DDVP alone and concomitantly. The results indicate that arsenic and DDVP induced oxidative stress and cholinergic dysfunction can be significantly protected by the supplementation of α-lipoic acid. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Mayr, Johannes A; Zimmermann, Franz A; Fauth, Christine; Bergheim, Christa; Meierhofer, David; Radmayr, Doris; Zschocke, Johannes; Koch, Johannes; Sperl, Wolfgang
2011-12-09
Lipoic acid is an essential prosthetic group of four mitochondrial enzymes involved in the oxidative decarboxylation of pyruvate, α-ketoglutarate, and branched chain amino acids and in the glycine cleavage. Lipoic acid is synthesized stepwise within mitochondria through a process that includes lipoic acid synthetase. We identified the homozygous mutation c.746G>A (p.Arg249His) in LIAS in an individual with neonatal-onset epilepsy, muscular hypotonia, lactic acidosis, and elevated glycine concentration in plasma and urine. Investigation of the mitochondrial energy metabolism showed reduced oxidation of pyruvate and decreased pyruvate dehydrogenase complex activity. A pronounced reduction of the prosthetic group lipoamide was found in lipoylated proteins. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
-
Nodop, Anke; Pietsch, Daniel; Höcker, Ralf; Becker, Anke; Pistorius, Elfriede K.; Forchhammer, Karl; Michel, Klaus-Peter
2008-01-01
The regulatory network for acclimation of the obligate photoautotrophic fresh water cyanobacterium Synechococcus elongatus PCC 7942 to iron (Fe) limitation was studied by transcript profiling with an oligonucleotide whole genome DNA microarray. Six regions on the chromosome with several Fe-regulated genes each were identified. The irpAB and fut region encode putative Fe uptake systems, the suf region participates in [Fe-sulfur] cluster assembly under oxidative stress and Fe limitation, the isiAB region encodes CP43′ and flavodoxin, the idiCB region encodes the NuoE-like electron transport associated protein IdiC and the transcriptional activator IdiB, and the ackA/pgam region encodes an acetate kinase and a phosphoglycerate mutase. We also investigated the response of two S. elongatus PCC 7942 mutants to Fe starvation. These were mutant K10, lacking IdiB but containing IdiC, and mutant MuD, representing a idiC-merodiploid mutant with a strongly reduced amount of IdiC as well as IdiB. The absence of IdiB in mutant K10 or the strongly reduced amount of IdiB in mutant MuD allowed for the identification of additional members of the Fe-responsive IdiB regulon. Besides idiA and the irpAB operon somB(1), somA(2), ftr1, ackA, pgam, and nat also seem to be regulated by IdiB. In addition to the reduced amount of IdiB in MuD, the low concentration of IdiC may be responsible for a number of additional changes in the abundance of mainly photosynthesis-related transcripts as compared to the wild type and mutant K10. This fact may explain why it has been impossible to obtain a fully segregated IdiC-free mutant, whereas it was possible to obtain a fully segregated IdiB-free mutant. PMID:18424627
-
Electrooxidation of pyrrole-terminated self-assembled lipoic acid derivatives
NASA Astrophysics Data System (ADS)
Cabrita, Joana F.; Viana, Ana S.; Eberle, Christoph; Montforts, Franz-Peter; Mourato, Ana; Abrantes, Luisa M.
2009-08-01
New pyrrole derivatives, pyrrolyl lipoic acid (Py-LA 3) and dipyrrolyl lipoic acid (Py 2-LA 2) have been used for surface attachment and immobilisation on gold surfaces, by self-assembly. The electrooxidation of the surface-confined pyrroles was analysed by cyclic voltammetry and the modified electrodes morphological and thickness changes addressed by scanning probe microscopy and ellipsometry. The data support the formation of oligomers as a result of the pendant-pyrrolyl units ease oxidation but provide no evidence of an effective subsequent polymerisation.
-
Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi
2007-05-01
The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.
-
USDA-ARS?s Scientific Manuscript database
DH20, a new wheat mutant missing low-molecular weight glutenin subunits encoded by the Glu-B3 locus, was discovered among double haploid lines obtained from a cross between the Korean wheat cultivars Keumkang and Olgeuru. Absence of the Glu-B3 LMW-GS proteins was determined by one-dimensional gel e...
-
Bearded-Ear Encodes a MADS-box Transcription Factor Critical for Maize Floral Development
USDA-ARS?s Scientific Manuscript database
We cloned bde by positional cloning and found that it encodes zag3, a MADS-box transcription factor in the conserved AGL6 clade. Mutants in the maize homolog of AGAMOUS, zag1, have a subset of bde floral defects. bde; zag1 double mutants have a severe ear phenotype, not observed in either single m...
-
The effects of lipoic acid and methylprednisolone on nerve healing in rats with facial paralysis.
Tekdemir, Emrah; Tatlipinar, Arzu; Özbeyli, Dilek; Tekdemir, Özge; Kınal, Emrah
2018-06-01
To investigate the effects of lipoic acid and methylprednisolone on nerve healing in rats with traumatic facial paralysis. The rats were randomly divided into four groups, with six rats in the control group and eight each in the remaining three groups. The buccal branch of the facial nerve in all groups except the control group was traumatized by a vascular clamp for 40 minutes. Group 1 was given lipoic acid (LA), Group 2 was given methylprednisolone (MP), and Group 3 was given lipoic acid and methylprednisolone (LA + MP) for one week. Nerve stimulus thresholds were measured before trauma, after trauma and at the end of the one week treatment period. When the groups were compared with each other, post-treatment threshold levels of LA + MP were significantly lower than LA. Although post-treatment threshold levels of LA and MP were still higher than the control group, there was no significant difference between LA + MP and control values (p > .05). Lipoic acid has a positive effect on nerve healing and can enhance the effect of methylprednisolone treatment. It is a good alternative in cases where methylprednisolone cannot be used.
-
Okanović, Azra; Prnjavorac, Besim; Jusufović, Edin; Sejdinović, Rifat
2015-08-01
To determine an influence of alpha-lipoic acid to reduction of body weight and regulation of total cholesterol concentration, triglycerides and glucose serum levels in obese patients with diabetes mellitus type 2. A prospective study includes two groups of obese patients with diabetes mellitus and signs of peripheral polyneuropathia: examined group (30 patients; 15 females and 15 males), and control group (30 patients; 12 females and 18 males). All were treated with metformin (850-1700 mg/day). Examined patients were additionally treated with alpha-lipoic acid 600 mg/day during 20 weeks. Body mass index and concentrations of total cholesterol, triglycerides and glucose in serum were compared before and after the treatment. The group treated with 600 mg alpha-lipoic acid lost significantly more weight, and had lower triglyceride level than the control group. There were no significant differences in total cholesterol and glucose serum levels between the groups. Alpha-lipoic acid of 600 mg/day treatment have influenced weight and triglycerides loss in obese patients with diabetes mellitus type 2. It should be considered as an important additive therapy in obese patients with diabetes mellitus type 2. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.
-
[Use of alpha-lipoic acid and omega-3 in postpartum pain treatment].
Costantino, D; Guaraldi, C; Costantino, M; Bounous, V E
2015-10-01
Postpartum pain is a frequent condition that negatively affects women's quality of life, interferring with everyday life. Analgesic drugs and surgery are often contraindicated in pregnancy and during breast feeding. This review of the literature aims to evaluate the rational of the association of lipoic acid and omega-3 employ in the management of postpartum pain. Lipoic acid is a cofactor essential in mitochondrial metabolism with antioxidant and anti-inflammatory activity. Lipoic acid has been shown to be effective in neuropatic pain treatment in patients with sciatica, carpal tunnel syndrome and diabetic neuropathy. Omega-3 are known for their anti-inflammatory and neurotrophic activity. The peripheral and central activity of both substances allows to act on neuroinflammation mechanisms thus reducing cronicization of pain and also determining a potential improvement of women's emotional status. The preliminary data here presented confirm the positive effect of this association on the treatment of postpartum perineal pain. The supplementation of lipoic acid in association with omega-3 seems effective and safe for the treatment of chronic postpartum pain, allowing a pathogenetic approach to neuroinflammation, thus reducing the consumption of analgesic drugs, often contraindicated during breast-feeding.
-
Effects of alpha lipoic acid on acrylamide-induced hepatotoxicity in rats.
Al-Qahtani, F A; Arafah, M; Sharma, B; Siddiqi, N J
2017-07-31
Acrylamide (ACR) is a neurotoxicant, reproductive toxicant, and carcinogen in animal species. It is used in many industries and has been found to form naturally in foods cooked at high temperatures. Alpha-lipoic acid (ALA) is a naturally occurring antioxidant whose therapeutic effect has been related to its antioxidant activity. This study was carried out to study the protective effect of alpha lipoic acid on acrylamide induced perturbations in rat liver. Four groups of rats were studied viz., control rats, acrylamide treated rats, alpha lipoic acid treated rats, and alpha lipoic acid plus acrylamide treated rats. ACR and ALA treatment alone and together caused a signifi-cant increase in hepatic reduced glutathione content while a decrease in hepatic ascorbic content was observed when compared to control group. ALA pretreatment of acrylamide exposed rats caused no a signifi-cant alteration in superoxide dismutase activity but resulted in a tendency towards restoration of glutathione peroxidase and catalase activity to near normal levels. Gel electrophoresis showed fragmentation of DNA in the treated groups. The dose of ALA used in the present study afforded partial restoration of oxidative indices altered by ACR in rat liver.
-
Structure of adenovirus bound to cellular receptor car
Freimuth, Paul I.
2004-05-18
Disclosed is a mutant adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have significantly weakened binding affinity for CARD1 relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type. In the method, residues of the adenovirus fiber protein knob domain which are predicted to alter D1 binding when mutated, are identified from the crystal structure coordinates of the AD12knob:CAR-D1 complex. A mutation which alters one or more of the identified residues is introduced into the genome of the adenovirus to generate a mutant adenovirus. Whether or not the mutant produced exhibits altered adenovirus-CAR binding properties is then determined.
-
A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.
Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L
2017-07-15
Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.
-
Pang, Xiuhua; Aigle, Bertrand; Girardet, Jean-Michel; Mangenot, Sophie; Pernodet, Jean-Luc; Decaris, Bernard; Leblond, Pierre
2004-01-01
Streptomyces ambofaciens has an 8-Mb linear chromosome ending in 200-kb terminal inverted repeats. Analysis of the F6 cosmid overlapping the terminal inverted repeats revealed a locus similar to type II polyketide synthase (PKS) gene clusters. Sequence analysis identified 26 open reading frames, including genes encoding the β-ketoacyl synthase (KS), chain length factor (CLF), and acyl carrier protein (ACP) that make up the minimal PKS. These KS, CLF, and ACP subunits are highly homologous to minimal PKS subunits involved in the biosynthesis of angucycline antibiotics. The genes encoding the KS and ACP subunits are transcribed constitutively but show a remarkable increase in expression after entering transition phase. Five genes, including those encoding the minimal PKS, were replaced by resistance markers to generate single and double mutants (replacement in one and both terminal inverted repeats). Double mutants were unable to produce either diffusible orange pigment or antibacterial activity against Bacillus subtilis. Single mutants showed an intermediate phenotype, suggesting that each copy of the cluster was functional. Transformation of double mutants with a conjugative and integrative form of F6 partially restored both phenotypes. The pigmented and antibacterial compounds were shown to be two distinct molecules produced from the same biosynthetic pathway. High-pressure liquid chromatography analysis of culture extracts from wild-type and double mutants revealed a peak with an associated bioactivity that was absent from the mutants. Two additional genes encoding KS and CLF were present in the cluster. However, disruption of the second KS gene had no effect on either pigment or antibiotic production. PMID:14742212
-
1988-03-11
adenine dinucleotide FAD = flavin-adenine dinucleotide iipS2 = lipoic acid lip(SH)2 = dihydrolipoic acid CoA = coenzyme A. SHepatic PDH complex activity...tissues has yet to be fully characterized, but it probably involves arsenic binding to the lipoic acid and dithiol moieties of the complex (Fluharty...covalently bound lipoic acid substrate of dihydrolipoyl transacetylase is greater per mole of L and CVAA than for sodium arsenite. This is possible
-
Haselier, André; Akbari, Hana; Weth, Agnes; Baumgartner, Werner; Frentzen, Margrit
2010-01-01
Cytidinediphosphate diacylglycerol synthase (CDS) catalyzes the formation of cytidinediphosphate diacylglycerol, an essential precursor of anionic phosphoglycerolipids like phosphatidylglycerol or -inositol. In plant cells, CDS isozymes are located in plastids, mitochondria, and microsomes. Here, we show that these isozymes are encoded by five genes in Arabidopsis (Arabidopsis thaliana). Alternative translation initiation or alternative splicing of CDS2 and CDS4 transcripts can result in up to 10 isoforms. Most of the cDNAs encoding the various plant isoforms were functionally expressed in yeast and rescued the nonviable phenotype of the mutant strain lacking CDS activity. The closely related genes CDS4 and CDS5 were found to encode plastidial isozymes with similar catalytic properties. Inactivation of both genes was required to obtain Arabidopsis mutant lines with a visible phenotype, suggesting that the genes have redundant functions. Analysis of these Arabidopsis mutants provided further independent evidence for the importance of plastidial phosphatidylglycerol for structure and function of thylakoid membranes and, hence, for photoautotrophic growth. PMID:20442275
-
Hegazy, Sahar K; Tolba, Osama A; Mostafa, Tarek M; Eid, Manal A; El-Afify, Dalia R
2013-01-01
Oxidative stress plays an important role in the development of diabetic cardiomyopathy. Alpha-lipoic acid (ALA) is a powerful antioxidant that may have a protective role in diabetic cardiac dysfunction. We investigated the possible beneficial effect of alpha-lipoic acid on diabetic left ventricular (LV) dysfunction in children and adolescents with asymptomatic type 1 diabetes (T1D). Thirty T1D patients (aged 10-14) were randomized to receive insulin treatment (n = 15) or insulin plus alpha-lipoic acid 300 mg twice daily (n = 15) for four months. Age and sex matched healthy controls (n = 15) were also included. Patients were evaluated with conventional 2-dimensional echocardiographic examination (2D), pulsed tissue Doppler (PTD), and 2-dimensional longitudinal strain echocardiography (2DS) before and after therapy. Glutathione, malondialdhyde (MDA), nitric oxide (NO), tumor necrosis factor-alpha (TNF-alpha), Fas ligand (Fas-L), matrix metalloproteinase 2 (MMP-2), and troponin-I were determined and correlated to echocardiographic parameters. Diabetic patients had significantly lower levels of glutathione and significantly higher MDA, NO, TNF-alpha, Fas-L, MMP-2, and troponin-I levels than control subjects. The expression of transforming growth factor beta (TGF-beta) mRNA in peripheral blood mononuclear cells was also increased in diabetic patients. Significant correlations of mitral e'/a' ratio and left ventricular global peak systolic strain with glutathione, MDA, NO, TNF-alpha, and Fas-L were observed in diabetic patients. Alpha-lipoic acid significantly increased glutathione level and significantly decreased MDA, NO, TNF-alpha, Fas-L, MMP-2, troponin-I levels, and TGF-beta gene expression. Moreover, alpha-lipoic acid significantly increased mitral e'/a' ratio and left ventricular global peak systolic strain in diabetic patients. These findings suggest that alpha-lipoic acid may have a role in preventing the development of diabetic cardiomyopathy in type 1 diabetes.
-
Tudose, Madalina; Culita, Daniela Cristina; Musuc, Adina Magdalena; Somacescu, Simona; Ghica, Cornel; Chifiriuc, Mariana Carmen; Bleotu, Coralia
2017-10-01
A novel nanocomposite was obtained through the covalent immobilization of lipoic acid on the surface of silver nanoparticles-decorated silica nanoparticles (SiO 2 @Ag). The hybrid organic - inorganic material obtained was characterized by Fourier transform infrared spectroscopy, thermal analysis, scanning and transmision electron microscopy, X-ray photoelectron spectroscopy and UV-Visible spectroscopy. Its antioxidant, cytotoxic, antimicrobial activity and influence on mammalian cells cycle were evaluated. The results of this study have shown that the functionalization of SiO 2 @Ag with lipoic acid resulted in a composite with increased specificity of interaction with different mammalian cell lines and antioxidant activity, but with decreased cytotoxicity and antimicrobial properties. Therefore, the SiO 2 @Ag functionalized with lipoic acid could be successfully used in certain concentrations to modulate the cell cycle, in order to obtain the desired anti-proliferative or stimulatory therapeutic effect. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Patrick, Lyn
2002-12-01
Mercury exposure is the second-most common cause of toxic metal poisoning. Public health concern over mercury exposure, due to contamination of fish with methylmercury and the elemental mercury content of dental amalgams, has long been a topic of political and medical debate. Although the toxicology of mercury is complex, there is evidence for antioxidant protection in the prevention of neurological and renal damage caused by mercury toxicity. Alpha-lipoic acid, a coenzyme of pyruvate and alpha-ketoglutarate dehydrogenase, has been used in Germany as an antioxidant and approved treatment for diabetic polyneuropathy for 40 years. Research has attempted to identify the role of antioxidants, glutathione and alpha-lipoic acid specifically, in both mitigation of heavy metal toxicity and direct chelation of heavy metals. This review of the literature will assess the role of glutathione and alpha-lipoic acid in the treatment of mercury toxicity.
-
2014-01-01
Background The disaccharide trehalose is a major component of fungal spores and is released upon germination. Moreover, the sugar is well known for is protective functions, e.g. against thermal stress and dehydration. The properties and synthesis of trehalose have been well investigated in the bakers’ yeast Saccharomyces cerevisiae. In filamentous fungi, such knowledge is limited, although several gene products have been identified. Results Using Aspergillus niger as a model fungus, the aim of this study was to provide an overview of all genes involved in trehalose synthesis. This fungus has three potential trehalose-6-phosphate synthase encoding genes, tpsA-C, and three putative trehalose phosphate phosphatase encoding genes, tppA-C, of which two have not previously been identified. Expression of all six genes was confirmed using real-time PCR, and conserved orthologs could be identified in related Aspergilli. Using a two-hybrid approach, there is a strong indication that four of the proteins physically interact, as has previously been shown in S. cerevisiae. When creating null mutants of all the six genes, three of them, ΔtpsA, ΔtppA and ΔtppB, had lower internal trehalose contents. The only mutant with a pronounced morphological difference was ΔtppA, in which sporulation was severely reduced with abnormal conidiophores. This was also the only mutant with accumulated levels of trehalose-6-phosphate, indicating that the encoded protein is the main phosphatase under normal conditions. Besides ΔtppA, the most studied deletion mutant in this work was ΔtppB. This gene encodes a protein conserved in filamentous Ascomycota. The ΔtppB mutant displayed a low, but not depleted, internal trehalose content, and conidia were more susceptible to thermal stress. Conclusion A. niger contains at least 6 genes putatively involved in trehalose synthesis. Gene expressions related to germination have been quantified and deletion mutants characterized: Mutants lacking tpsA, tppA or tppB have reduced internal trehalose contents. Furthermore, tppA, under normal conditions, encodes the functional trehalose-6-phosphate-phosphatase. PMID:24725382
-
Dihydrolipoyl dioleoylglycerol antioxidant capacity in phospholipid vesicles
USDA-ARS?s Scientific Manuscript database
Antioxidants have critical roles in maintaining cellular homeostasis and disease-state prevention. The multi-functional agent alpha-lipoic acid offers numerous beneficial effects to oxidatively stressed tissues. alpha-Lipoic acid was enzymatically incorporated into a triglyceride in conjunction wi...
-
Cole, C N; Tornow, J; Clark, R; Tjian, R
1986-01-01
The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional domains. Images PMID:3003386
-
Altered gene regulation and synaptic morphology in Drosophila learning and memory mutants
Guan, Zhuo; Buhl, Lauren K.; Quinn, William G.; Littleton, J. Troy
2011-01-01
Genetic studies in Drosophila have revealed two separable long-term memory pathways defined as anesthesia-resistant memory (ARM) and long-lasting long-term memory (LLTM). ARM is disrupted in radish (rsh) mutants, whereas LLTM requires CREB-dependent protein synthesis. Although the downstream effectors of ARM and LLTM are distinct, pathways leading to these forms of memory may share the cAMP cascade critical for associative learning. Dunce, which encodes a cAMP-specific phosphodiesterase, and rutabaga, which encodes an adenylyl cyclase, both disrupt short-term memory. Amnesiac encodes a pituitary adenylyl cyclase-activating peptide homolog and is required for middle-term memory. Here, we demonstrate that the Radish protein localizes to the cytoplasm and nucleus and is a PKA phosphorylation target in vitro. To characterize how these plasticity pathways may manifest at the synaptic level, we assayed synaptic connectivity and performed an expression analysis to detect altered transcriptional networks in rutabaga, dunce, amnesiac, and radish mutants. All four mutants disrupt specific aspects of synaptic connectivity at larval neuromuscular junctions (NMJs). Genome-wide DNA microarray analysis revealed ∼375 transcripts that are altered in these mutants, suggesting defects in multiple neuronal signaling pathways. In particular, the transcriptional target Lapsyn, which encodes a leucine-rich repeat cell adhesion protein, localizes to synapses and regulates synaptic growth. This analysis provides insights into the Radish-dependent ARM pathway and novel transcriptional targets that may contribute to memory processing in Drosophila. PMID:21422168
-
Structure of adenovirus bound to cellular receptor car
Freimuth, Paul I.
2007-01-02
Disclosed is a mutant CAR-DI-binding adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have a significantly weakened binding affinity for CAR-DI relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type.
-
Wang, Pingyang; Qiu, Zhiyong; Xia, Dingguo; Tang, Shunming; Shen, Xingjia; Zhao, Qiaoling
2017-01-01
A new purple quail-like (q-lp) mutant found from the plain silkworm strain 932VR has pigment dots on the epidermis similar to the pigment mutant quail (q). In addition, q-lp mutant larvae are inactive, consume little and grow slowly, with a high death rate and other developmental abnormalities. Pigmentation of the silkworm epidermis consists of melanin, ommochrome and pteridine. Silkworm development is regulated by ecdysone and juvenile hormone. In this study, we performed RNA-Seq on the epidermis of the q-lp mutant in the 4th instar during molting, with 932VR serving as the control. The results showed 515 differentially expressed genes, of which 234 were upregulated and 281 downregulated in q-lp. BLASTGO analysis indicated that the downregulated genes mainly encode protein-binding proteins, membrane components, oxidation/reduction enzymes, and proteolytic enzymes, whereas the upregulated genes largely encode cuticle structural constituents, membrane components, transport related proteins, and protein-binding proteins. Quantitative reverse transcription PCR was used to verify the accuracy of the RNA-Seq data, focusing on key genes for biosynthesis of the three pigments and chitin as well as genes encoding cuticular proteins and several related nuclear receptors, which are thought to play key roles in the q-lp mutant. We drew three conclusions based on the results: 1) melanin, ommochrome and pteridine pigments are all increased in the q-lp mutant; 2) more cuticle proteins are expressed in q-lp than in 932VR, and the number of upregulated cuticular genes is significantly greater than downregulated genes; 3) the downstream pathway regulated by ecdysone is blocked in the q-lp mutant. Our research findings lay the foundation for further research on the developmental changes responsible for the q-lp mutant.
-
Wang, Ying; Ren, Yulong; Zhou, Kunneng; Liu, Linglong; Wang, Jiulin; Xu, Yang; Zhang, Huan; Zhang, Long; Feng, Zhiming; Wang, Liwei; Ma, Weiwei; Wang, Yunlong; Guo, Xiuping; Zhang, Xin; Lei, Cailin; Cheng, Zhijun; Wan, Jianmin
2017-01-01
Pentatricopeptide repeat (PPR) proteins comprise a large family in higher plants and perform diverse functions in organellar RNA metabolism. Despite the rice genome encodes 477 PRR proteins, the regulatory effects of PRR proteins on chloroplast development remains unknown. In this study, we report the functional characterization of the rice white stripe leaf4 (wsl4) mutant. The wsl4 mutant develops white-striped leaves during early leaf development, characterized by decreased chlorophyll content and malformed chloroplasts. Positional cloning of the WSL4 gene, together with complementation and RNA-interference tests, reveal that it encodes a novel P-family PPR protein with 12 PPR motifs, and is localized to chloroplast nucleoids. Quantitative RT-PCR analyses demonstrate that WSL4 is a low temperature response gene abundantly expressed in young leaves. Further expression analyses show that many nuclear- and plastid-encoded genes in the wsl4 mutant are significantly affected at the RNA and protein levels. Notably, the wsl4 mutant causes defects in the splicing of atpF, ndhA, rpl2, and rps12. Our findings identify WSL4 as a novel P-family PPR protein essential for chloroplast RNA group II intron splicing during early leaf development in rice. PMID:28694820
-
Aposhian, H Vasken; Morgan, Daniel L; Queen, H L Sam; Maiorino, Richard M; Aposhian, Mary M
2003-01-01
Some medical practitioners prescribe GSH and vitamin C alone or in combination with DMPS or DMSA for patients with mercury exposure that is primarily due to the mercury vapor emitted by dental amalgams. This study tested the hypothesis that GSH, vitamin C, or lipoic acid alone or in combination with DMPS or DMSA would decrease brain mercury. Young rats were exposed to elemental mercury by individual nose cone, at the rate of 4.0 mg mercury per m3 air for 2 h per day for 7 consecutive days. After a 7-day equilibrium period, DMPS, DMSA, GSH, vitamin C, lipoic acid alone, or in combination was administered for 7 days and the brain and kidneys of the animals removed and analyzed for mercury by cold vapor atomic absorption. None of these regimens reduced the mercury content of the brain. Although DMPS or DMSA was effective in reducing kidney mercury concentrations, GSH, vitamin C, lipoic acid alone, or in combination were not. One must conclude that the palliative effect, if any, of GSH, vitamin C, or lipoic acid for treatment of mercury toxicity due to mercury vapor exposure does not involve mercury mobilization from the brain and kidney.
-
A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development
Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David
2013-01-01
SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300
-
Agathos, Evangelos; Tentolouris, Anastasios; Eleftheriadou, Ioanna; Katsaouni, Panagiota; Nemtzas, Ioannis; Petrou, Alexandra; Papanikolaou, Christina; Tentolouris, Nikolaos
2018-05-01
Objective To examine the effect of α-lipoic acid on neuropathic symptoms in patients with diabetic neuropathy (DN). Methods Patients with painful DN were treated with 600 mg/day α-lipoic acid, orally, for 40 days. Neuropathy Symptom Score (NSS), Subjective Peripheral Neuropathy Screen Questionnaire (SPNSQ) and douleur neuropathique (DN)4 questionnaire scores were assessed at baseline and day 40. Quality-of-life treatment effects were assessed by Brief Pain Inventory (BPI), Neuropathic Pain Symptom Inventory (NPSI) and Sheehan Disability Scale (SDS). Changes in body weight, arterial blood pressure, fasting serum glucose and lipids were also assessed. Results Out of 72 patients included, significant reductions in neuropathic symptoms were shown by reduced NSS, SPNSQ and DN4 scores at day 40 versus baseline. BPI, NPSI, and SDS in terms of work disability, social life disability, and family life disability scores were also significantly reduced. Moreover, 50% of patients rated their health condition as 'very much better' or 'much better' following α-lipoic acid administration. Fasting triglyceride levels were reduced, but no difference was found in body weight, blood pressure, fasting glucose, or other lipids at day 40 versus baseline. Conclusions A-lipoic acid administration was associated with reduced neuropathic symptoms and triglycerides, and improved quality of life.
-
Wang, Hong; Wang, Congcong; Li, Ya; Yue, Xiaofeng; Ma, Zhonghua; Talbot, Nicholas J.; Wang, Zhengyi
2013-01-01
Methylenetetrahydrofolate reductases (MTHFRs) play a key role in the biosynthesis of methionine in both prokaryotic and eukaryotic organisms. In this study, we report the identification of a novel T-DNA-tagged mutant WH672 in the rice blast fungus Magnaporthe oryzae, which was defective in vegetative growth, conidiation and pathogenicity. Analysis of the mutation confirmed a single T-DNA insertion upstream of MET13, which encodes a 626-amino-acid protein encoding a MTHFR. Targeted gene deletion of MET13 resulted in mutants that were non-pathogenic and significantly impaired in aerial growth and melanin pigmentation. All phenotypes associated with Δmet13 mutants could be overcome by addition of exogenous methionine. The M. oryzae genome contains a second predicted MTHFR-encoding gene, MET12. The deduced amino acid sequences of Met13 and Met12 share 32% identity. Interestingly, Δmet12 mutants produced significantly less conidia compared with the isogenic wild-type strain and grew very poorly in the absence of methionine, but were fully pathogenic. Deletion of both genes resulted in Δmet13Δmet12 mutants that showed similar phenotypes to single Δmet13 mutants. Taken together, we conclude that the MTHFR gene, MET13, is essential for infection-related morphogenesis by the rice blast fungus M. oryzae. PMID:24116181
-
Nærdal, Ingemar; Netzer, Roman; Ellingsen, Trond E.; Brautaset, Trygve
2011-01-01
We investigated the regulation and roles of six aspartate pathway genes in l-lysine overproduction in Bacillus methanolicus: dapG, encoding aspartokinase I (AKI); lysC, encoding AKII; yclM, encoding AKIII; asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; and lysA, encoding meso-diaminopimelate decarboxylase. Analysis of the wild-type strain revealed that in vivo lysC transcription was repressed 5-fold by l-lysine and induced 2-fold by dl-methionine added to the growth medium. Surprisingly, yclM transcription was repressed 5-fold by dl-methionine, while the dapG, asd, dapA, and lysA genes were not significantly repressed by any of the aspartate pathway amino acids. We show that the l-lysine-overproducing classical B. methanolicus mutant NOA2#13A52-8A66 has—in addition to a hom-1 mutation—chromosomal mutations in the dapG coding region and in the lysA promoter region. No mutations were found in its dapA, lysC, asd, and yclM genes. The mutant dapG gene product had abolished feedback inhibition by meso-diaminopimelate in vitro, and the lysA mutation was accompanied by an elevated (6-fold) lysA transcription level in vivo. Moreover, yclM transcription was increased 16-fold in mutant strain NOA2#13A52-8A66 compared to the wild-type strain. Overexpression of wild-type and mutant aspartate pathway genes demonstrated that all six genes are important for l-lysine overproduction as tested in shake flasks, and the effects were dependent on the genetic background tested. Coupled overexpression of up to three genes resulted in additive (above 80-fold) increased l-lysine production levels. PMID:21724876
-
Nærdal, Ingemar; Netzer, Roman; Ellingsen, Trond E; Brautaset, Trygve
2011-09-01
We investigated the regulation and roles of six aspartate pathway genes in L-lysine overproduction in Bacillus methanolicus: dapG, encoding aspartokinase I (AKI); lysC, encoding AKII; yclM, encoding AKIII; asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; and lysA, encoding meso-diaminopimelate decarboxylase. Analysis of the wild-type strain revealed that in vivo lysC transcription was repressed 5-fold by L-lysine and induced 2-fold by dl-methionine added to the growth medium. Surprisingly, yclM transcription was repressed 5-fold by dl-methionine, while the dapG, asd, dapA, and lysA genes were not significantly repressed by any of the aspartate pathway amino acids. We show that the L-lysine-overproducing classical B. methanolicus mutant NOA2#13A52-8A66 has-in addition to a hom-1 mutation-chromosomal mutations in the dapG coding region and in the lysA promoter region. No mutations were found in its dapA, lysC, asd, and yclM genes. The mutant dapG gene product had abolished feedback inhibition by meso-diaminopimelate in vitro, and the lysA mutation was accompanied by an elevated (6-fold) lysA transcription level in vivo. Moreover, yclM transcription was increased 16-fold in mutant strain NOA2#13A52-8A66 compared to the wild-type strain. Overexpression of wild-type and mutant aspartate pathway genes demonstrated that all six genes are important for L-lysine overproduction as tested in shake flasks, and the effects were dependent on the genetic background tested. Coupled overexpression of up to three genes resulted in additive (above 80-fold) increased L-lysine production levels.
-
Puri, Basant K; Hakkarainen-Smith, Jaana S; Derham, Anne; Monro, Jean A
2015-09-01
While pharmacotherapy with intravenous ceftriaxone, a third-generation cephalosporin, is a potential treatment of Lyme neuroborreliosis, there is concern that it can cause the formation of biliary sludge, leading to hepatobiliary complications such as biliary colic, jaundice and cholelithiasis, which are reflected in changes in serum levels of bilirubin and markers of cholestatic liver injury (alkaline phosphatase and γ-glutamyltranspeptidase). It has been suggested that the naturally occurring substances α-lipoic acid and glutathione may be helpful in preventing hepatic disease. α-Lipoic acid exhibits antioxidant, anti-inflammatory and anti-apoptotic activities in the liver, while glutathione serves as a sulfhydryl buffer. The aim of this study was to determine whether co-administration of α-lipoic acid and glutathione is associated with significant changes in serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase during the treatment of Lyme neuroborreliosis with long-term intravenous ceftriaxone. Serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase were measured in 42 serologically positive Lyme neuroborreliosis patients before and after long-term treatment with intravenous ceftriaxone (2-4 g daily) with co-administration of oral/intravenous α-lipoic acid (600 mg daily) and glutathione (100 mg orally or 0.6-2.4 g intravenously daily). None of the patients developed biliary colic and there were no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels over the course of the intravenous ceftriaxone treatment (mean length 75.0 days). Co-administration of α-lipoic acid and glutathione is associated with no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels during the treatment of neuroborreliosis with intravenous ceftriaxone.
-
Tolunay, Orkun; Çelik, Tamer; Kömür, Mustafa; Gezgin, Ali Emre; Kaya, Musa Soner; Çelik, Ümit
2015-11-01
Alpha lipoic acid is a powerful antioxidant widely used for the supplementary treatment of diabetic neuropathy. Intoxication with alpha lipoic acid is very rare. There is no reported dose of safety in children. A 14-month-old previously healthy girl was referred to our hospital with the diagnosis of drug intoxication. She was admitted to the emergency department with lethargy and continuing involuntary movements for several hours after she had ingested an unknown amount of alpha lipoic acid. On admission she was lethargic and had myoclonic seizures involving all extremities. She had no fever and laboratory examinations were normal except for mild metabolic acidosis. The seizures were unresponsive to bolus midazolam, phenytoin infusion and levetiracetam infusion. She was taken to the pediatric intensive care unit with the diagnosis of status epilepticus. After failure of the treatment with midazolam infusion she was intubated and thiopental sodium infusion was started. Her myoclonic seizures were controlled with thiopental sodium infusion. After 48 h intubation and mechanical ventilation thiopental sodium was gradually reduced and then stopped. Following the withdraw of thiopental sodium, she was seizure free on her discharge on the 8th day. Alpha lipoic acid and derivatives cause side effects in children like refractory convulsions. They are frequently rendered as vitamins by diabetic patients and are left at places where children can easily access them. Therefore, when faced with refractory convulsions in children who have had no disease before, intoxication by medicaments with alpha lipoic acid should be taken into consideration. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.
-
Plasmid-borne Tn5 insertion mutation resulting in accumulation of gentisate from salicylate.
Monticello, D J; Bakker, D; Schell, M; Finnerty, W R
1985-01-01
Plasmid-borne Tn5 insertion mutants of a Pseudomonas species which accumulated 2,5-dihydroxybenzoate (gentisate) following growth on 2-hydroxybenzoate (salicylate) were obtained from a pool of mutants that were unable to grow on naphthalene. One such mutant was characterized further. The ability of this mutant to oxidize gentisate was 100-fold less than the ability of a Nah+ Sal+ strain harboring the unmutagenized plasmid, although both strains oxidized and grew on salicylate. These bacteria were presumably able to metabolize salicylate via catechol, since they possessed an inducible, plasmid-encoded catechol 2,3-dioxygenase. Our results suggest that there is an alternate, plasmid-encoded route of salicylate degradation via gentisate and that some plasmid-associated relationship between this pathway and naphthalene oxidation exists. PMID:2988437
-
Seven functional classes of Barth syndrome mutation.
Whited, Kevin; Baile, Matthew G; Currier, Pamela; Claypool, Steven M
2013-02-01
Patients with Barth syndrome (BTHS), a rare X-linked disease, suffer from skeletal and cardiomyopathy and bouts of cyclic neutropenia. The causative gene encodes tafazzin, a transacylase, which is the major determinant of the final acyl chain composition of the mitochondrial-specific phospholipid, CL. In addition to numerous frame shift and splice-site mutations, 36 missense mutations have been associated with BTHS. Previously, we established a BTHS-mutant panel in the yeast Saccharomyces cerevisiae that successfully models 18/21 conserved pathogenic missense mutations and defined the loss-of-function mechanism associated with a subset of the mutant tafazzins. Here, we report the biochemical and cell biological characterization of the rest of the yeast BTHS-mutant panel and in so doing identify three additional modes of tafazzin dysfunction. The largest group of mutant tafazzins is catalytically null, two mutants encode hypomorphic alleles, and another two mutants are temperature sensitive. Additionally, we have expanded the defects associated with previously characterized matrix-mislocalized-mutant tafazzins to include the rapid degradation of aggregation-prone polypeptides that correctly localize to the mitochondrial IMS. In sum, our in-depth characterization of the yeast BTHS-mutant panel has identified seven functional classes of BTHS mutation.
-
Arshad, Muhammad Sajid; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Shahid, Muhammad; Akhtar, Saeed; Sohaib, Muhammad
2013-11-04
Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010-11 & 2011-12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio-evaluation of this kind of functional meat in humans.
-
Ahmed, Maha A E; El-Awdan, Sally A
2015-07-01
Behavioral perturbations associated with nandrolone decanoate abuse by athletes and adolescents may be attributed to oxidative stress and inflammation. However, the underlying mechanisms are not yet fully explored. On the other hand, the natural antioxidant lipoic acid can pass the blood brain barrier and enhance Nrf2/HO-1 (nuclear factor erythroid-2 related factor 2/heme oxygenase-1) pathway. In addition, the phosphodiesterase-IV inhibitor xanthine derivative pentoxifylline has a remarkable inhibitory effect on tumor necrosis factor-alpha (TNF-α). Therefore, this study aimed at investigation of the possible protective effects of lipoic acid and/or pentoxifylline against nandrolone-induced neurobehavioral alterations in rats. Accordingly, male albino rats were randomly distributed into seven groups and treated with either vehicle, nandrolone (15mg/kg, every third day, s.c.), lipoic acid (100mg/kg/day, p.o.), pentoxifylline (200mg/kg/day, i.p.), or nandrolone with lipoic acid and/or pentoxifylline. Rats were challenged in the open field, rewarded T-maze, Morris water maze, and resident-intruder aggression behavioral tests. The present findings showed that nandrolone induced hyperlocomotion, anxiety, memory impairment, and aggression in rats. These behavioral abnormalities were accompanied by several biochemical changes, including altered levels of brain monoamines, GABA, and acetylcholine, enhanced levels of malondialdehyde and TNF-α, elevated activity of acetylcholinesterase, and up-regulated expression of TNF-α receptor-1 (TNFR1). In addition, inhibited catalase activity, down-regulated Nrf2/HO-1 pathway, and suppressed acetylcholine receptor expression were observed. Lipoic acid and pentoxifylline combination significantly mitigated all the previously mentioned deleterious effects mainly via up-regulation of Nrf2/HO-1 pathway, inhibition of TNF-α and down-regulation of TNFR1 expression. In conclusion, the biochemical and histopathological findings of this study revealed the protective mechanisms of lipoic acid and pentoxifylline against nandrolone-induced behavioral changes and neurotoxicity in rats. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Dahl, Jan-Ulrik; Radon, Christin; Bühning, Martin; Nimtz, Manfred; Leichert, Lars I.; Denis, Yann; Jourlin-Castelli, Cécile; Iobbi-Nivol, Chantal; Méjean, Vincent; Leimkühler, Silke
2013-01-01
The Escherichia coli l-cysteine desulfurase IscS mobilizes sulfur from l-cysteine for the synthesis of several biomolecules such as iron-sulfur (FeS) clusters, molybdopterin, thiamin, lipoic acid, biotin, and the thiolation of tRNAs. The sulfur transfer from IscS to various biomolecules is mediated by different interaction partners (e.g. TusA for thiomodification of tRNAs, IscU for FeS cluster biogenesis, and ThiI for thiamine biosynthesis/tRNA thiolation), which bind at different sites of IscS. Transcriptomic and proteomic studies of a ΔtusA strain showed that the expression of genes of the moaABCDE operon coding for proteins involved in molybdenum cofactor biosynthesis is increased under aerobic and anaerobic conditions. Additionally, under anaerobic conditions the expression of genes encoding hydrogenase 3 and several molybdoenzymes such as nitrate reductase were also increased. On the contrary, the activity of all molydoenzymes analyzed was significantly reduced in the ΔtusA mutant. Characterization of the ΔtusA strain under aerobic conditions showed an overall low molybdopterin content and an accumulation of cyclic pyranopterin monophosphate. Under anaerobic conditions the activity of nitrate reductase was reduced by only 50%, showing that TusA is not essential for molybdenum cofactor biosynthesis. We present a model in which we propose that the direction of sulfur transfer for each sulfur-containing biomolecule is regulated by the availability of the interaction partner of IscS. We propose that in the absence of TusA, more IscS is available for FeS cluster biosynthesis and that the overproduction of FeS clusters leads to a modified expression of several genes. PMID:23281480
-
Bernardini, Alejandra; Corona, Fernando; Dias, Ricardo; Sánchez, Maria B; Martínez, Jose L
2015-01-01
Quinolone resistance is usually due to mutations in the genes encoding bacterial topoisomerases. However, different reports have shown that neither clinical quinolone resistant isolates nor in vitro obtained Stenotrophomonas maltophilia mutants present mutations in such genes. The mechanisms so far described consist on efflux pumps' overexpression. Our objective is to get information on novel mechanisms of S. maltophilia quinolone resistance. For this purpose, a transposon-insertion mutant library was obtained in S. maltophilia D457. One mutant presenting reduced susceptibility to nalidixic acid was selected. Inverse PCR showed that the inactivated gene encodes RNase G. Complementation of the mutant with wild-type RNase G allele restored the susceptibility to quinolones. Transcriptomic and real-time RT-PCR analyses showed that several genes encoding heat-shock response proteins were expressed at higher levels in the RNase defective mutant than in the wild-type strain. In agreement with this situation, heat-shock reduces the S. maltophilia susceptibility to quinolone. We can then conclude that the inactivation of the RNase G reduces the susceptibility of S. maltophilia to quinolones, most likely by regulating the expression of heat-shock response genes. Heat-shock induces a transient phenotype of quinolone resistance in S. maltophilia.
-
Orndorff, P E; Falkow, S
1984-01-01
The recombinant plasmid pSH2 confers type 1 piliation (Pil+) on a nonpiliated (Pil-) strain of Escherichia coli K-12. At least four plasmid-encoded gene products are involved in pilus biosynthesis and expression. We present evidence which indicates that one gene encodes an inhibitor of piliation. Hyperpiliated (Hyp) mutants were isolated after Tn5 insertion mutagenesis of pSH2 and introduction of the plasmid DNA into a Pil- strain of E. coli as unique small, compact colonies. Also, Hyp mutants clumped during growth in static broth and were piliated under several cultural conditions that normally suppressed piliation. Electron microscopic examination of Hyp mutants associated an observed 40-fold increase in pilin antigen with an increase in the number and length of pili per cell. All Hyp mutants examined failed to produce a 23-kilodalton protein that was encoded by a gene adjacent to the structural (pilin) gene for type 1 pili, and all Tn5 insertion mutations that produced the Hyp phenotype mapped in this region (hyp). Piliation in Hyp mutants could be reduced to near parental levels by introducing a second plasmid containing a parental hyp gene. Thus the 23-kilodalton (hyp) protein appears to act in trans to regulate the level of piliation. Images PMID:6148338
-
Koga, Makoto; Ohshima, Yasumi
2004-02-20
Chemotaxis to water-soluble chemicals such as sodium ion is an important behavior of Caenorhabditis elegans for seeking food, and ASE chemosensory neurons have a major role in this behavior. We isolated mutants defective in chemotaxis to sodium acetate. We show here that among them ks86 had a mutation in the ceh-36 gene. ceh-36 :: gfp reporter constructs were expressed in ASE and AWC neurons. In a mutant of the che-1 gene, which encodes another transcription factor and is required for specification of ASE neurons, expression of the ceh-36 :: gfp reporter in ASE is lost. This indicates that the ceh-36 gene functions downstream of the che-1 gene in ASE. In the ceh-36(ks86) mutant, expression of the tax-2 gene encoding a cyclic nucleotide-gated channel was reduced in ASE and AWC. This affords an explanation for defects of the ceh-36 mutant in the chemotaxis mediated by ASE and AWC. When a ceh-36 cDNA was expressed in an adult ceh-36 mutant by a heat shock promoter, chemotaxis to sodium acetate was recovered. These results suggest that ceh-36 is required for functions, and not for development, of ASE.
-
Wu, Feng; Yang, Zhenle; Kuang, Tingyun
2006-01-01
Phosphatidylglycerol (PG) is a ubiquitous phospholipid in thylakoid membranes of cyanobacteria and chloroplasts and plays an important role in the structure and function of photosynthetic membranes. The last step of the PG biosynthesis is dephosphorylation of phosphatidylglycerophosphate (PGP) catalyzed by PGP phosphatase. However, the gene-encoding PGP phosphatase has not been identified and cloned from cyanobacteria or higher plants. In this study, we constructed a PG-deficient mutant from cyanobacterium Anabaena sp. PCC7120 with a disrupted gene (alr1715, a gene for Alr1715 protein, GenBank accession no. BAB78081) encoding a putative PGP phosphatase. The obtained mutant showed an approximately 30% reduction in the cellular content of PG. Following the reduction in the PG content, the photoautotrophical growth of the mutant was restrained, and the cellular content of chlorophyll was decreased. The decreases in net photosynthetic and photosystem II (PSII) activities on a cell basis also occurred in this mutant. Simultaneously, the photochemical efficiency of PSII was considerably declined, and less excitation energy was transferred toward PSII. These findings demonstrate that the alr1715 gene of Anabaena sp. PCC7120 is involved in the biosynthesis of PG and essential for photosynthesis. PMID:16815953
-
Ma, Xiaozhi; Sun, Xiaoqiu; Li, Chunmei; Huan, Rui; Sun, Changhui; Wang, Yang; Xiao, Fuliang; Wang, Qian; Chen, Purui; Ma, Furong; Zhang, Kuan; Wang, Pingrong; Deng, Xiaojian
2017-02-01
Leaf-color mutants have been extensively studied in rice, and many corresponding genes have been identified up to now. However, leaf-color mutation mechanisms are diverse and still need further research through identification of novel genes. In the present paper, we isolated a leaf-color mutant, ys83, in rice (Oryza sativa). The mutant displayed a yellow-green leaf phenotype at seedling stage, and then slowly turned into light-green leaf from late tillering stage. In its yellow leaves, photosynthetic pigment contents significantly decreased and the chloroplast development was retarded. The mutant phenotype was controlled by a recessive mutation in a nuclear gene on the short arm of rice chromosome 2. Map-based cloning and sequencing analysis suggested that the candidate gene was YS83 (LOC_Os02g05890) encoding a protein containing 165 amino acid residues. Gene YS83 was expressed in a wide range of tissues, and its encoded protein was targeted to the chloroplast. In the mutant, a T-to-A substitution occurred in coding sequence of gene YS83, which caused a premature translation of its encoded product. By introduction of the wild-type gene, the ys83 mutant recovered to normal green-leaf phenotype. Taken together, we successfully identified a novel yellow-green leaf gene YS83. In addition, number of productive panicles per plant and number of spikelets per panicle only reduced by 6.7% and 7.6%, respectively, meanwhile its seed setting rate and 1000-grain weight (seed size) were not significantly affected in the mutant, so leaf-color mutant gene ys83 could be used as a trait marker gene in commercial hybrid rice production. Copyright © 2016. Published by Elsevier Masson SAS.
-
Posner, Mareike G; Upadhyay, Abhishek; Crennell, Susan J; Watson, Andrew J A; Dorus, Steve; Danson, Michael J; Bagby, Stefan
2013-01-15
Lipoylation, the covalent attachment of lipoic acid to 2-oxoacid dehydrogenase multi-enzyme complexes, is essential for metabolism in aerobic bacteria and eukarya. In Escherichia coli, lipoylation is catalysed by LplA (lipoate protein ligase) or by LipA (lipoic acid synthetase) and LipB [lipoyl(octanoyl) transferase] combined. Whereas bacterial and eukaryotic LplAs comprise a single two-domain protein, archaeal LplA function typically involves two proteins, LplA-N and LplA-C. In the thermophilic archaeon Thermoplasma acidophilum, LplA-N and LplA-C are encoded by overlapping genes in inverted orientation (lpla-c is upstream of lpla-n). The T. acidophilum LplA-N structure is known, but the LplA-C structure is unknown and LplA-C's role in lipoylation is unclear. In the present study, we have determined the structures of the substrate-free LplA-N-LplA-C complex and E2lipD (dihydrolipoyl acyltransferase lipoyl domain) that is lipoylated by LplA-N-LplA-C, and carried out biochemical analyses of this archaeal lipoylation system. Our data reveal the following: (i) LplA-C is disordered but folds upon association with LplA-N; (ii) LplA-C induces a conformational change in LplA-N involving substantial shortening of a loop that could repress catalytic activity of isolated LplA-N; (iii) the adenylate-binding region of LplA-N-LplA-C includes two helices rather than the purely loop structure of varying order observed in other LplA structures; (iv) LplAN-LplA-C and E2lipD do not interact in the absence of substrate; (v) LplA-N-LplA-C undergoes a conformational change (the details of which are currently undetermined) during lipoylation; and (vi) LplA-N-LplA-C can utilize octanoic acid as well as lipoic acid as substrate. The elucidated functional inter-dependence of LplA-N and LplA-C is consistent with their evolutionary co-retention in archaeal genomes.
-
Lebigot, E; Gaignard, P; Dorboz, I; Slama, A; Rio, M; de Lonlay, P; Héron, B; Sabourdy, F; Boespflug-Tanguy, O; Cardoso, A; Habarou, F; Ottolenghi, C; Thérond, P; Bouton, C; Golinelli-Cohen, M P; Boutron, A
2017-11-01
Lipoic acid (LA) is the cofactor of the E2 subunit of mitochondrial ketoacid dehydrogenases and plays a major role in oxidative decarboxylation. De novo LA biosynthesis is dependent on LIAS activity together with LIPT1 and LIPT2. LIAS is an iron‑sulfur (Fe-S) cluster-containing mitochondrial protein, like mitochondrial aconitase (mt-aco) and some subunits of respiratory chain (RC) complexes I, II and III. All of them harbor at least one [Fe-S] cluster and their activity is dependent on the mitochondrial [Fe-S] cluster (ISC) assembly machinery. Disorders in the ISC machinery affect numerous Fe-S proteins and lead to a heterogeneous group of diseases with a wide variety of clinical symptoms and combined enzymatic defects. Here, we present the biochemical profiles of several key mitochondrial [Fe-S]-containing proteins in fibroblasts from 13 patients carrying mutations in genes encoding proteins involved in either the lipoic acid (LIPT1 and LIPT2) or mitochondrial ISC biogenesis (FDX1L, ISCA2, IBA57, NFU1, BOLA3) pathway. Ten of them are new patients described for the first time. We confirm that the fibroblast is a good cellular model to study these deficiencies, except for patients presenting mutations in FDX1L and a muscular clinical phenotype. We find that oxidative phosphorylation can be affected by LA defects in LIPT1 and LIPT2 patients due to excessive oxidative stress or to another mechanism connecting LA and respiratory chain activity. We confirm that NFU1, BOLA3, ISCA2 and IBA57 operate in the maturation of [4Fe-4S] clusters and not in [2Fe-2S] protein maturation. Our work suggests a functional difference between IBA57 and other proteins involved in maturation of [Fe-S] proteins. IBA57 seems to require BOLA3, NFU1 and ISCA2 for its stability and NFU1 requires BOLA3. Finally, our study establishes different biochemical profiles for patients according to their mutated protein. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Park, Joohae; Hulsman, Mark; Arentshorst, Mark; Breeman, Matthijs; Alazi, Ebru; Lagendijk, Ellen L; Rocha, Marina C; Malavazi, Iran; Nitsche, Benjamin M; van den Hondel, Cees A M J J; Meyer, Vera; Ram, Arthur F J
2016-09-01
The biosynthesis of cell surface-located galactofuranose (Galf)-containing glycostructures such as galactomannan, N-glycans and O-glycans in filamentous fungi is important to secure the integrity of the cell wall. UgmA encodes an UDP-galactopyranose mutase, which is essential for the formation of Galf. Consequently, the ΔugmA mutant lacks Galf-containing molecules. Our previous work in Aspergillus niger work suggested that loss of function of ugmA results in activation of the cell wall integrity (CWI) pathway which is characterized by increased expression of the agsA gene, encoding an α-glucan synthase. In this study, the transcriptional response of the ΔugmA mutant was further linked to the CWI pathway by showing the induced and constitutive phosphorylation of the CWI-MAP kinase in the ΔugmA mutant. To identify genes involved in cell wall remodelling in response to the absence of galactofuranose biosynthesis, a genome-wide expression analysis was performed using RNAseq. Over 400 genes were higher expressed in the ΔugmA mutant compared to the wild-type. These include genes that encode enzymes involved in chitin (gfaB, gnsA, chsA) and α-glucan synthesis (agsA), and in β-glucan remodelling (bgxA, gelF and dfgC), and also include several glycosylphosphatidylinositol (GPI)-anchored cell wall protein-encoding genes. In silico analysis of the 1-kb promoter regions of the up-regulated genes in the ΔugmA mutant indicated overrepresentation of genes with RlmA, MsnA, PacC and SteA-binding sites. The importance of these transcription factors for survival of the ΔugmA mutant was analysed by constructing the respective double mutants. The ΔugmA/ΔrlmA and ΔugmA/ΔmsnA double mutants showed strong synthetic growth defects, indicating the importance of these transcription factors to maintain cell wall integrity in the absence of Galf biosynthesis. © 2016 The Authors Cellular Microbiology Published by John Wiley & Sons Ltd.
-
Stability of a liposomal formulation containing lipoyl or dihydrolipoyl acylglycerides
USDA-ARS?s Scientific Manuscript database
The acylglycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phospholipids in which the...
-
Antonio, Angeline M.; Gillespie, Roberta A.; Druse, Mary J.
2011-01-01
This laboratory showed that ethanol augments apoptosis in fetal rhombencephalic neurons and co-treatment with alpha-lipoic acid (LA) or one of several other antioxidants prevents ethanol-associated apoptosis. Because ethanol increases oxidative stress, which causes apoptosis, it is likely that some of the neuroprotective effects of LA and other antioxidants involve classical antioxidant actions. Considering the reported link of LA with pro-survival cell signaling, it is also possible that LA’s neuroprotective effects involve additional mechanisms. The present study investigated the effects of LA on ethanol-treated fetal rhombencephalic neurons with regard to oxidative stress and up-regulation of the pro-survival genes Xiap and Bcl-2. We included parallel gene expression studies with N-acetyl cysteine (NAC) to determine whether LA’s effects on Xiap and Bcl-2 were shared by other antioxidants. We also used enzyme inhibitors to determine which signaling pathway(s) might be involved with the effects of LA. The results of this investigation showed that LA treatment of ethanol-treated neurons exerted several pro-survival effects. LA blocked two pro-apoptotic changes, i.e., the ethanol-associated rise in ROS and caspase-3. LA also up-regulated the expression genes that encode the anti-apoptotic proteins Bcl-2 and Xiap by a mechanism that involves NF-κB. NAC also up-regulated Bcl-2 and Xiap. Thus, the neuroprotective effects of LA and NAC could involve up-regulation of pro-survival genes as well as their classical antioxidant actions. PMID:21303669
-
Castro, María Cecilia; Massa, María Laura; Arbeláez, Luisa González; Schinella, Guillermo; Gagliardino, Juan J; Francini, Flavio
2015-09-15
Fructose administration induces hepatic oxidative stress, insulin resistance, inflammatory and metabolic changes. We tested their potential pathogenic relationship and whether these alterations can be prevented by R/S-α-lipoic acid. Wistar rats received during 21days a commercial diet or the same diet supplemented with 10% fructose in drinking water without/with R/S-α-lipoic acid injection. After this period, we measured a) serum glucose, triglyceride, insulin, homeostasis model assessment-insulin resistance (HOMA-IR), insulin glucose ratio (IGR) and Matsuda indexes and b) liver oxidative stress, inflammatory markers and insulin signaling pathway components. Fructose fed rats had hyperinsulinemia, hypertriglyceridemia, higher HOMA-IR, IGR and lower Matsuda indices compared to control animals, together with increased oxidative stress markers, TNFα, IL1β and PAI-1 gene expression, and TNFα and COX-2 protein content. Whereas insulin receptor level was higher in fructose fed rats, their tyrosine-residue phosphorylation was lower. IRS1/IRS2 protein levels and IRS1 tyrosine-phosphorylation rate were lower in fructose fed rats. All changes were prevented by R/S-α-lipoic acid co-administration. Fructose-induced hepatic oxidative stress, insulin resistance and inflammation form a triad that constitutes a vicious pathogenic circle. This circle can be effectively disrupted by R/S-α-lipoic acid co-administration, thus suggesting mutual positive interaction among the triad components. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Sancheti, Harsh; Akopian, Garnik; Yin, Fei; Brinton, Roberta D.; Walsh, John P.; Cadenas, Enrique
2013-01-01
Alzheimer’s disease is a progressive neurodegenerative disease that entails impairments of memory, thinking and behavior and culminates into brain atrophy. Impaired glucose uptake (accumulating into energy deficits) and synaptic plasticity have been shown to be affected in the early stages of Alzheimer’s disease. This study examines the ability of lipoic acid to increase brain glucose uptake and lead to improvements in synaptic plasticity on a triple transgenic mouse model of Alzheimer’s disease (3xTg-AD) that shows progression of pathology as a function of age; two age groups: 6 months (young) and 12 months (old) were used in this study. 3xTg-AD mice fed 0.23% w/v lipoic acid in drinking water for 4 weeks showed an insulin mimetic effect that consisted of increased brain glucose uptake, activation of the insulin receptor substrate and of the PI3K/Akt signaling pathway. Lipoic acid supplementation led to important changes in synaptic function as shown by increased input/output (I/O) and long term potentiation (LTP) (measured by electrophysiology). Lipoic acid was more effective in stimulating an insulin-like effect and reversing the impaired synaptic plasticity in the old mice, wherein the impairment of insulin signaling and synaptic plasticity was more pronounced than those in young mice. PMID:23875003
-
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
-
Simmons, Michael J; Peterson, Mark P; Thorp, Michael W; Buschette, Jared T; DiPrima, Stephanie N; Harter, Christine L; Skolnick, Matthew J
2015-03-01
Transposons, especially retrotransposons, are abundant in the genome of Drosophila melanogaster. These mobile elements are regulated by small RNAs that interact with the Piwi family of proteins-the piwi-interacting or piRNAs. The Piwi proteins are encoded by the genes argonaute3 (ago3), aubergine (aub), and piwi. Heterochromatin Protein 1 (HP1), a chromatin-organizing protein encoded by the Suppressor of variegation 205 [Su(var)205] gene, also plays a role in this regulation. To assess the mutational impact of weakening the system for transposon regulation, we measured the frequency of recessive X-linked lethal mutations occurring in the germ lines of males from stocks that were heterozygous for mutant alleles of the ago3, aub, piwi, or Su(var)205 genes. These mutant alleles are expected to deplete the wild-type proteins encoded by these genes by as much as 50%. The mutant alleles of piwi and Su(var)205 significantly increased the X-linked lethal mutation frequency, whereas the mutant alleles of ago3 did not. An increased mutation frequency was also observed in males from one of two mutant aub stocks, but this increase may not have been due to the aub mutant. The increased mutation frequency caused by depleting Piwi or HP1suggests that chromatin-organizing proteins play important roles in minimizing the germ-line mutation rate, possibly by stabilizing the structure of the heterochromatin in which many transposons are situated. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S
2014-01-01
The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-l-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., 1994), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. PMID:24286468
-
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F; Rensing, Christopher; Olsen, John E; Fresno, Ana H
2017-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed deletion mutants for genes encoding zinc exporters ( zntA , zitB , and fieF ) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium ( S. Typhimurium) 4/74. The mutants 4/74Δ zntA and 4/74Δ zntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani medium supplemented with 0.25 mM ZnCl 2 or 1.5 mM CuSO 4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected for any of the mutants compared to the WT during infection of amoebae. In natural resistance-associated macrophage protein 1 (Nramp1)-negative J774.1 murine macrophages, significantly higher bacterial counts were observed for the mutant strains 4/74Δ zntA and 4/74Δ zntA/zitB compared to the WT at 4 h post-infection although the fold net replication was similar between all the strains. All four tested mutants (4/74Δ zntA , 4/74Δ zitB , 4/74Δ fieF , and 4/74Δ zntA/zitB ) showed enhanced intracellular survival capacity within the modified Nramp1-positive murine RAW264.7 macrophages at 20 h post-infection. The fold net replication was also significantly higher for 4/74Δ zntA , 4/74Δ zitB , and 4/74Δ zntA/zitB mutants compared to the WT. Intriguingly, the ability to survive and cause infection was significantly impaired in all the three mutants tested (4/74Δ zntA , 4/74Δ zitB , and 4/74Δ zntA/zitB ) in C3H/HeN mice, particularly the double mutant 4/74Δ zntA/zitB was severely attenuated compared to the WT in all the three organs analyzed. These findings suggest that these genes encoding zinc exporters, especially zntA , contribute to the resistance of S. Typhimurium to zinc and copper stresses during infection.
-
Physicochemical Profiling of α-Lipoic Acid and Related Compounds.
Mirzahosseini, Arash; Szilvay, András; Noszál, Béla
2016-07-01
Lipoic acid, the biomolecule of vital importance following glycolysis, shows diversity in its thiol/disulfide equilibria and also in its eight different protonation forms of the reduced molecule. In this paper, lipoic acid, lipoamide, and their dihydro derivatives were studied to quantify their solubility, acid-base, and lipophilicity properties at a submolecular level. The acid-base properties are characterized in terms of six macroscopic, 12 microscopic protonation constants, and three interactivity parameters. The species-specific basicities, the pH-dependent distribution of the microspecies, and lipophilicity parameters are interpreted by various intramolecular effects, and contribute to understanding the antioxidant, chelate-forming, and enzyme cofactor behavior of the molecules observed. © 2016 Wiley-VHCA AG, Zürich.
-
Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.
-
Investigation of Enantioselective Membrane Permeability of α-Lipoic Acid in Caco-2 and MDCKII Cell.
Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi
2016-01-26
α-Lipoic acid (LA) contains a chiral carbon and exists as two enantiomers (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA)). We previously demonstrated that oral bioavailability of RLA is better than that of SLA. This difference arose from the fraction absorbed multiplied by gastrointestinal availability (F(a) × F(g)) and hepatic availability (F(h)) in the absorption phase. However, it remains unclear whether F(a) and/or F(g) are involved in enantioselectivity. In this study, Caco-2 cells and Madin-Darby canine kidney strain II cells were used to assess the enantioselectivity of membrane permeability. LA was actively transported from the apical side to basal side, regardless of the differences in its steric structure. Permeability rates were proportionally increased in the range of 10-250 µg LA/mL, and the permeability coefficient did not differ significantly between enantiomers. Hence, we conclude that enantioselective pharmacokinetics arose from the metabolism (F(h) or F(g) × F(h)), and definitely not from the membrane permeation (F(a)) in the absorption phase.
-
α-Lipoic acid inhibits sevoflurane-induced neuronal apoptosis through PI3K/Akt signalling pathway.
Ma, Rong; Wang, Xiang; Peng, Peipei; Xiong, Jingwei; Dong, Hongquan; Wang, Lixia; Ding, Zhengnian
2016-01-01
Sevoflurane is a widely used anaesthetic agent, including in anaesthesia of children and infants. Recent studies indicated that the general anaesthesia might cause the cell apoptosis in the brain. This issue raises the concerns about the neuronal toxicity induced by the application of anaesthetic agents, especially in the infants and young children. In this study, we used Morris water maze, western blotting and immunohistochemistry to elucidate the role of α-lipoic acid in the inhibition of neuronal apoptosis. We found that sevoflurane led to the long-term cognitive impairment in the young rats. This adverse effect may be caused by the neuronal death in the hippocampal region, mediated through PI3K/Akt signalling pathway. We also showed that α-lipoic acid offset the effect of sevoflurane on the neuronal apoptosis and cognitive dysfunction. This study elucidated the potential clinical role of α-lipoic acid, providing a promising way in the prevention and treatment of long-term cognitive impairment induced by sevoflurane general anesthesia. Copyright © 2016 John Wiley & Sons, Ltd.
-
Volchegorskiĭ, I A; Miroshnichenko, I Iu; Rassokhina, L M; Faĭzullin, R M; Priakhina, K E
2014-01-01
The effect of domestic derivatives of 3-oxypyridine and succinic acid (emoxipine, reamberin, and mexidol) on obsessive-compulsive behavior of mice was studied in the marble-burying test. Additionally the effect of these drugs on the behavior of animals was assessed in the open field test. Amitriptylin and alpha-lipoic acid were used as reference drugs. It was established that single administration of the investigated drugs in optimal doses, corresponding to therapeutic range in humans, inhibits obsessive-compulsive behavior of mice in the marble-burying test. Amitriptylin and alpha-lipoic acid produced similar effects. It is established that emoxipine stimulates the behavior of mice in the open field after single administration. An increase in the emoxipine dose led to decrease of stimulation and gradual development of sedative effect. Reamberin and mexidol, as well as alpha-lipoic acid and amitriptyline, caused sedation in mice tested in the open field. Inhibiting effect of emoxipine, reamberin, mexidol and alpha-lipoic acid on the obsessive-compulsive behavior in mice directly depended on sedative action of these drugs.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Medina, V.; Sudarshana, M.R.; Tian, T.
2005-03-15
Cytological, immunological, and mutagenesis approaches were used to identify the viral factors associated with the formation of plasmalemma deposits (PLDs) in whole plants and protoplasts infected by Lettuce infectious yellows virus (LIYV). Transmission electron microscopy and immunogold labeling using polyclonal antibodies to four of the five LIYV RNA 2-encoded large proteins, capsid protein (CP), minor capsid protein (CPm), HSP70 homolog (HSP70h), and P59, showed specific labeling of LIYV virions or virion aggregates around the vesiculated membranous inclusions, but not PLDs in LIYV-infected Nicotiana benthamiana, Nicotiana clevelandii, Lactuca sativa, and Chenopodium murale plants, and Nicotiana tabacum protoplasts. In contrast, antibodies tomore » the RNA 2-encoded P26 showed specific labeling of PLDs but not virions in both LIYV-infected plants and protoplasts. Virion-like particles (VLPs) were seen in protoplasts infected by all LIYV RNA 2 mutants except for the CP (major capsid protein) mutant. PLDs were more difficult to find in protoplasts, but were seen in protoplasts infected by the CP and CPm mutants, but not in protoplasts infected by the P26, HSP70h, or P59 mutants. Interestingly, although the CPm mutant showed VLPs and PLDs, the PLDs did not show associated virions/virion-like particles as was always observed for PLDs seen in protoplasts infected by wild-type LIYV. Immunoblot analyses performed on purified LIYV virions showed that P26 was not detected with purified virions, but was detected in the cell wall, 1000 g and 30,000 g pellet fractions of LIYV-infected plants. These data suggest that P26 is associated with the LIYV-induced PLDs, and in contrast to the other RNA 2-encoded large proteins, P26 is not a virion protein.« less
-
NASA Astrophysics Data System (ADS)
Panganiban, Antonito T.; Temin, Howard M.
1984-12-01
We mutagenized cloned spleen necrosis virus DNA to identify a region of the retrovirus genome encoding a polypeptide required for integration of viral DNA. Five plasmids bearing different lesions in the 3' end of the pol gene were examined for the ability to integrate or replicate following transfection of chicken embryo fibroblasts. Transfection with one of these DNAs resulted in the generation of mutant virus incapable of integrating but able to replicate at low levels; this phenotype is identical to that of mutants bearing alterations in the cis-acting region, att. To determine whether the 3' end of the pol gene encodes a protein that interacts with att, we did a complementation experiment. Cells were first infected with an att- virus and then superinfected with the integration-deficient virus containing a lesion in the pol gene and a wild-type att site. The results showed that the att- virus provided a trans-acting function allowing integration of viral DNA derived from the mutant bearing a wild-type att site. Thus, the 3' end of the pol gene serves as an ``int'' locus and encodes a protein mediating integration of retrovirus DNA through interaction with att.
-
The Moraxella catarrhalis nitric oxide reductase is essential for nitric oxide detoxification.
Wang, Wei; Kinkel, Traci; Martens-Habbena, Willm; Stahl, David A; Fang, Ferric C; Hansen, Eric J
2011-06-01
Moraxella catarrhalis is a Gram-negative obligate aerobe that is an important cause of human respiratory tract infections. The M. catarrhalis genome encodes a predicted truncated denitrification pathway that reduces nitrate to nitrous oxide. We have previously shown that expression of both the M. catarrhalis aniA (encoding a nitrite reductase) and norB (encoding a putative nitric oxide reductase) genes is repressed by the transcriptional regulator NsrR under aerobic conditions and that M. catarrhalis O35E nsrR mutants are unable to grow in the presence of low concentrations of nitrite (W. Wang, et al., J. Bacteriol. 190:7762-7772, 2008). In this study, we constructed an M. catarrhalis norB mutant and showed that planktonic growth of this mutant is inhibited by low levels of nitrite, whether or not an nsrR mutation is present. To determine the importance of NorB in this truncated denitrification pathway, we analyzed the metabolism of nitrogen oxides by norB, aniA norB, and nsrR norB mutants. We found that norB mutants are unable to reduce nitric oxide and produce little or no nitrous oxide from nitrite. Furthermore, nitric oxide produced from nitrite by the AniA protein is bactericidal for a Moraxella catarrhalis O35E norB mutant but not for wild-type O35E bacteria under aerobic growth conditions in vitro, suggesting that nitric oxide catabolism in M. catarrhalis is accomplished primarily by the norB gene product. Measurement of bacterial protein S-nitrosylation directly implicates nitrosative stress resulting from AniA-dependent nitric oxide formation as a cause of the growth inhibition of norB and nsrR mutants by nitrite.
-
Midaoui, Adil El; Talbot, Sébastien; Lahjouji, Karim; Dias, Jenny Pena; Fantus, I George; Couture, Réjean
2015-06-01
To investigate the impact of alpha-lipoic acid on superoxide anion production and NADPH oxidase activity as well as on the expression of kinin B1 and B2 receptors in key organs of obese Zucker Diabetic Fatty rats. Superoxide anion production was measured by lucigenin chemiluminescence. Kinin B1 and B2 receptors expression was measured at protein and mRNA levels by western blot and qRT-PCR in key organs of Zucker Diabetic Fatty and Zucker lean control rats treated for a period of 6 weeks with a standard diet or a diet containing the antioxidant α-lipoic acid (1 g/kg). Superoxide anion production and NADPH oxidase activity were significantly enhanced in aorta and adipose tissue of Zucker Diabetic Fatty rats. Kinin B1 and B2 receptors expression levels were also significantly increased in the liver and the gastrocnemius muscle of Zucker Diabetic Fatty rats. Expression of both receptors was not altered in the pancreas of Zucker Diabetic Fatty rats and was undetectable in white retroperitoneal adipose tissue. Alpha-lipoic acid prevented the rise in NADPH oxidase activity in aorta and epididymal adipose tissue of Zucker Diabetic Fatty rats and the upregulation of kinin B1 receptor in liver and gastrocnemius muscle and that of kinin B2 receptor in the liver. Alpha-lipoic acid treatment was found to prevent the final body weight increase without affecting significantly hyperglycemia, hyperinsulinemia and insulin resistance index in Zucker Diabetic Fatty rats. Findings support the hypothesis that oxidative stress is implicated in the induction of kinin B1 receptor in Zucker Diabetic Fatty rats. The ability of α-lipoic acid to blunt the body weight gain appears to be mediated in part by preventing NADPH oxidase activity rise in adipose tissue and reversing the hepatic upregulation of kinin B1 receptor in Zucker Diabetic Fatty rats.
-
Saboori, S; Falahi, E; Eslampour, E; Zeinali Khosroshahi, M; Yousefi Rad, E
2018-04-17
The aim of this meta-analysis was to assess effects of alpha-lipoic acid supplementation on C-reactive protein (CRP) levels in clinical trial studies. A systematic search was carried out on clinical trial studies published in PubMed, ISI Web of Science, Cochrane Library and Scopus databases completed by manual search on reference list of eligible studies accomplished by November 4, 2017. Of a total number of 508 studies found in the first step of literature search, only 11 were included with 264 participants in supplementation groups and 287 in control groups. Estimated pooled random effects size analysis showed a significant reducing effect of alpha-lipoic acid supplementation on CRP level (-0.72 mg/l, 95% CI; -1.4, -0.04; P = 0.03) with a significant heterogeneity between the selected studies. Sub-group analysis showed that alpha-lipoic acid supplementation could significantly reduce serum CRP level when the baseline CRP level was greater than 3 mg/l (-1.02 mg/l, 95% CI: -1.3, -0.73) and when trial duration was >8 weeks (-0.99 mg/l, 95% CI: -1.29, -0.70). Results of subgroup analysis also showed that alpha lipoic acid supplementation could decrease CRP level only in non-diabetic patients (-1.02 mg/l, 95% CI: -1.31, -0.74). Results of the current meta-analysis study showed that alpha-lipoic acid supplementation could significantly decrease CRP level in patients with elevated levels of this inflammatory marker. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.
-
Hayashi, J; Nishikawa, K; Hirano, R; Noguchi, T; Yoshimura, F
2000-01-01
Porphyromonas gingivalis, a periodontopathogen, is an oral anaerobic gram-negative bacterium with numerous fimbriae on the cell surface. Fimbriae have been considered to be an important virulence factor in this organism. We analyzed the genomic DNA of transposon-induced, fimbria-deficient mutants derived from ATCC 33277 and found that seven independent mutants had transposon insertions within the same restriction fragment. Cloning and sequencing of the disrupted region from one of the mutants revealed two adjacent open reading frames (ORFs) which seemed to encode a two-component signal transduction system. We also found that six of the mutants had insertions in a gene, fimS, a homologue of the genes encoding sensor kinase, and that the insertion in the remaining one disrupted the gene immediately downstream, fimR, a homologue of the response regulator genes in other bacteria. These findings suggest that this two-component regulatory system is involved in fimbriation of P. gingivalis.
-
2013-01-01
Background Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. Methods The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. Results The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010–11 & 2011–12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. Conclusion In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio-evaluation of this kind of functional meat in humans. PMID:24499336
-
Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S
2014-02-01
The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-L-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., ), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
-
USDA-ARS?s Scientific Manuscript database
Skeletal muscle mitochondrial dysfunction is associated with aging and diabetes, which decreases respiratory capacity and increases reactive oxygen species. Lipoic acid (LA) possesses antioxidative and antidiabetic properties. Metabolic action of LA is mediated by activation of adenosine monophospha...
-
Park, Joohae; Tefsen, Boris; Arentshorst, Mark; Lagendijk, Ellen; van den Hondel, Cees Amjj; van Die, Irma; Ram, Arthur Fj
2014-01-01
Galactofuranose (Gal f )-containing glycoconjugates are important to secure the integrity of the cell wall of filamentous fungi. Mutations that prevent the biosynthesis of Gal f -containing molecules compromise cell wall integrity. In response to cell wall weakening, the cell wall integrity (CWI)-pathway is activated to reinforce the strength of the cell wall. Activation of CWI-pathway in Aspergillus niger is characterized by the specific induction of the agsA gene, which encodes a cell wall α-glucan synthase. In this study, we screened a collection of cell wall mutants with an induced expression of agsA for defects in Gal f biosynthesis using a with anti-Gal f antibody (L10). From this collection of mutants, we previously identified mutants in the UDP-galactopyranose mutase encoding gene ( ugmA ). Here, we have identified six additional UDP-galactopyranose mutase ( ugmA ) mutants and one mutant (named mutant #41) in an additional complementation group that displayed strongly reduced Gal f -levels in the cell wall. By using a whole genome sequencing approach, 21 SNPs in coding regions were identified between mutant #41 and its parental strain which changed the amino acid sequence of the encoded proteins. One of these mutations was in gene An14g03820, which codes for a putative UDP-glucose-4-epimerase (UgeA). The A to G mutation in this gene causes an amino acid change of Asn to Asp at position 191 in the UgeA protein. Targeted deletion of ugeA resulted in an even more severe reduction of Gal f in N-linked glucans, indicating that the UgeA protein in mutant #41 is partially active. The ugeA gene is also required for growth on galactose despite the presence of two UgeA homologs in the A. niger genome. By using a classical mutant screen and whole genome sequencing of a new Gal f -deficient mutant, the UDP-glucose-4-epimerase gene ( ugeA ) has been identified. UgeA is required for the biosynthesis of Gal f as well as for galactose metabolism in Aspergillus niger .
-
Song, Na; Dai, Qingqing; Zhu, Baitao; Wu, Yuxing; Xu, Ming; Voegele, Ralf Thomas; Gao, Xiaoning; Kang, Zhensheng; Huang, Lili
2017-01-01
In fungi, heterotrimeric guanine-nucleotide binding proteins (G-proteins) are key elements of signal transduction pathways, which control growth, asexual and sexual development, as well as virulence. In this study, we have identified two genes encoding heterotrimeric G protein alpha subunits, named Gvm2 and Gvm3, from Valsa mali, the causal agent of apple Valsa canker. Characterization of Gvm2 and Gvm3 mutants indicates that Gvm3 may be a crucial regulator of vegetative growth. Deletion of the corresponding gene results in a 20% reduction in growth rate. Besides, Gvm2 and Gvm3 seem to be involved in asexual reproduction, and mutants are hypersensitive to oxidative and cell membrane stresses. Interestingly, both G protein alpha subunits were most probably involved in V. mali virulence. In infection assays using Malus domestica cv. 'Fuji' leaves and twigs, the size of lesions caused by deletion mutants △Gvm2, or △Gvm3 are significantly reduced. Furthermore, many genes encoding hydrolytic enzymes-important virulence factors in V. mali-are expressed at a lower level in these deletion mutants. Our results suggest that Gvm2 and Gvm3 play an important role in virulence probably by regulation of expression of cell wall degrading enzymes. △Gvm2, and △Gvm3 mutants were further analyzed with respect to their impact on the transcript levels of genes in the cAMP/PKA pathway. The expression of the genes encoding adenylate cyclase VmAC, protein kinase A (PKA) regulatory subunit VmPKR, and PKA catalytic subunit VmPKA1 are down-regulated in both mutants. Further analyses indicated that intracellular cAMP level and PKA activity are down-regulated in the △Gvm3 mutant, but are basically unchanged in the △Gvm2 mutant. Overall, our findings indicate that both Gvm2 and Gvm3 play diverse roles in the modulation of vegetative growth, asexual development, and virulence in V. mali.
-
Metaphase to Anaphase (mat) Transition–Defective Mutants inCaenorhabditis elegans
Golden, Andy; Sadler, Penny L.; Wallenfang, Matthew R.; Schumacher, Jill M.; Hamill, Danielle R.; Bates, Gayle; Bowerman, Bruce; Seydoux, Geraldine; Shakes, Diane C.
2000-01-01
The metaphase to anaphase transition is a critical stage of the eukaryotic cell cycle, and, thus, it is highly regulated. Errors during this transition can lead to chromosome segregation defects and death of the organism. In genetic screens for temperature-sensitive maternal effect embryonic lethal (Mel) mutants, we have identified 32 mutants in the nematode Caenorhabditis elegans in which fertilized embryos arrest as one-cell embryos. In these mutant embryos, the oocyte chromosomes arrest in metaphase of meiosis I without transitioning to anaphase or producing polar bodies. An additional block in M phase exit is evidenced by the failure to form pronuclei and the persistence of phosphohistone H3 and MPM-2 antibody staining. Spermatocyte meiosis is also perturbed; primary spermatocytes arrest in metaphase of meiosis I and fail to produce secondary spermatocytes. Analogous mitotic defects cause M phase delays in mitotic germline proliferation. We have named this class of mutants “mat” for metaphase to anaphase transition defective. These mutants, representing six different complementation groups, all map near genes that encode subunits of the anaphase promoting complex or cyclosome, and, here, we show that one of the genes, emb-27, encodes the C. elegans CDC16 ortholog. PMID:11134076
-
Zebrafish Meis functions to stabilize Pbx proteins and regulate hindbrain patterning.
Waskiewicz, A J; Rikhof, H A; Hernandez, R E; Moens, C B
2001-11-01
Homeodomain-containing Hox proteins regulate segmental identity in Drosophila in concert with two partners known as Extradenticle (Exd) and Homothorax (Hth). These partners are themselves DNA-binding, homeodomain proteins, and probably function by revealing the intrinsic specificity of Hox proteins. Vertebrate orthologs of Exd and Hth, known as Pbx and Meis (named for a myeloid ecotropic leukemia virus integration site), respectively, are encoded by multigene families and are present in multimeric complexes together with vertebrate Hox proteins. Previous results have demonstrated that the zygotically encoded Pbx4/Lazarus (Lzr) protein is required for segmentation of the zebrafish hindbrain and proper expression and function of Hox genes. We demonstrate that Meis functions in the same pathway as Pbx in zebrafish hindbrain development, as expression of a dominant-negative mutant Meis results in phenotypes that are remarkably similar to that of lzr mutants. Surprisingly, expression of Meis protein partially rescues the lzr(-) phenotype. Lzr protein levels are increased in embryos overexpressing Meis and are reduced for lzr mutants that cannot bind to Meis. This implies a mechanism whereby Meis rescues lzr mutants by stabilizing maternally encoded Lzr. Our results define two functions of Meis during zebrafish hindbrain segmentation: that of a DNA-binding partner of Pbx proteins, and that of a post-transcriptional regulator of Pbx protein levels.
-
Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing
USDA-ARS?s Scientific Manuscript database
Alpha-lipoic acid (ALA) is known as a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar sperm and the antioxidant effect of ALA on boar sperm during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0, and 10.0, mg/m...
-
Enantioselective Pharmacokinetics of α-Lipoic Acid in Rats
Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi
2015-01-01
α-Lipoic acid (LA) is widely used for nutritional supplements as a racemic mixture, even though the R enantiomer is biologically active. After oral administration of the racemic mixture (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA) mixed at the ratio of 50:50) to rats, RLA showed higher plasma concentration than SLA, and its area under the plasma concentration-time curve from time zero to the last (AUC) was significantly about 1.26 times higher than that of SLA. However, after intravenous administration of the racemic mixture, the pharmacokinetic profiles, initial concentration (C0), AUC, and half-life (T1/2) of the enantiomers were not significantly different. After oral and intraduodenal administration of the racemic mixture to pyrolus-ligated rats, the AUCs of RLA were significantly about 1.24 and 1.32 times higher than that of SLA, respectively. In addition, after intraportal administration the AUC of RLA was significantly 1.16 times higher than that of SLA. In conclusion, the enantioselective pharmacokinetics of LA in rats arose from the fraction absorbed multiplied by gastrointestinal availability (FaFg) and hepatic availability (Fh), and not from the total clearance. PMID:26402669
-
Enantioselective Pharmacokinetics of α-Lipoic Acid in Rats.
Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi
2015-09-21
α-Lipoic acid (LA) is widely used for nutritional supplements as a racemic mixture, even though the R enantiomer is biologically active. After oral administration of the racemic mixture (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA) mixed at the ratio of 50:50) to rats, RLA showed higher plasma concentration than SLA, and its area under the plasma concentration-time curve from time zero to the last (AUC) was significantly about 1.26 times higher than that of SLA. However, after intravenous administration of the racemic mixture, the pharmacokinetic profiles, initial concentration (C₀), AUC, and half-life (T1/2) of the enantiomers were not significantly different. After oral and intraduodenal administration of the racemic mixture to pyrolus-ligated rats, the AUCs of RLA were significantly about 1.24 and 1.32 times higher than that of SLA, respectively. In addition, after intraportal administration the AUC of RLA was significantly 1.16 times higher than that of SLA. In conclusion, the enantioselective pharmacokinetics of LA in rats arose from the fraction absorbed multiplied by gastrointestinal availability (FaFg) and hepatic availability (Fh), and not from the total clearance.
-
Bourai, Neema; Jacobs, William R; Narayanan, Sujatha
2012-02-01
Mycobacterium tuberculosis genome encodes several high and low molecular mass penicillin binding proteins. One such low molecular mass protein is DacB2 encoded by open reading frame Rv2911 of M. tuberculosis which is predicted to play a role in peptidoglycan synthesis. In this study we have tried to gain an insight into the role of this accessory cell division protein in mycobacterial physiology by performing overexpression and deletion studies. The overproduction of DacB2 in non-pathogenic, fast growing mycobacterium Mycobacterium smegmatis mc(2)155 resulted in reduced growth, an altered colony morphology, a defect in sliding motility and biofilm formation. A point mutant of DacB2 was made wherein the active site serine residue was mutated to cysteine to abolish the penicillin binding function of protein. The overexpression of mutant protein showed similar results indicating that the effects produced were independent of protein's penicillin binding function. The gene encoding DacB2 was deleted in M. tuberculosis by specialized transduction method. The deletion mutant showed reduced growth in Sauton's medium under acidic and low oxygen availability. The in vitro infection studies with THP-1 cells showed increased intracellular survival of dacB2 mutant compared to parent and complemented strains. The colony morphology and antibiotic sensitivity of mutant and wild-type strains were similar. Copyright © 2011 Elsevier Ltd. All rights reserved.
-
Duque, Estrella; Daddaoua, Abdelali; Cordero, Baldo F; De la Torre, Jesús; Antonia Molina-Henares, Maria; Ramos, Juan-Luis
2017-10-01
The genome of Pseudomonas putida KT2440 contains two open reading frames (ORFs), PP_3722 and PP_5269, that encode proteins with a Pyridoxal phosphate binding motif and a high similarity to alanine racemases. Alanine racemases play a key role in the biosynthesis of D-alanine, a crucial amino acid in the peptidoglycan layer. For these ORFs, we generated single and double mutants and found that inactivation of PP_5269 resulted in D-alanine auxotrophy, while inactivation of PP_3722 did not. Furthermore, as expected, the PP_3722/PP_5269 double mutant was a strict auxotroph for D-alanine. These results indicate that PP_5269 is an alr allele and that it is the essential alanine racemase in P. putida. We observed that the PP_5269 mutant grew very slowly, while the double PP_5269/PP_3722 mutant did not grow at all. This suggests that PP_3722 may replace PP_5269 in vivo. In fact, when the ORF encoding PP_3772 was cloned into a wide host range expression vector, ORF PP_3722 successfully complemented P. putida PP_5269 mutants. We purified both proteins to homogeneity and while they exhibit similar K M values, the V max of PP_5269 is fourfold higher than that of PP_3722. Here, we propose that PP_5269 and PP_3722 encode functional alanine racemases and that these genes be named alr-1 and alr-2 respectively. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
-
Mendel's green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway
Sato, Yutaka; Morita, Ryouhei; Nishimura, Minoru; Yamaguchi, Hiroyasu; Kusaba, Makoto
2007-01-01
Mutants that retain greenness of leaves during senescence are known as “stay-green” mutants. The most famous stay-green mutant is Mendel's green cotyledon pea, one of the mutants used in determining the law of genetics. Pea plants homozygous for this recessive mutation (known as i at present) retain greenness of the cotyledon during seed maturation and of leaves during senescence. We found tight linkage between the I locus and stay-green gene originally found in rice, SGR. Molecular analysis of three i alleles including one with no SGR expression confirmed that the I gene encodes SGR in pea. Functional analysis of sgr mutants in pea and rice further revealed that leaf functionality is lowered despite a high chlorophyll a (Chl a) and chlorophyll b (Chl b) content in the late stage of senescence, suggesting that SGR is primarily involved in Chl degradation. Consistent with this observation, a wide range of Chl–protein complexes, but not the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit, were shown to be more stable in sgr than wild-type plants. The expression of OsCHL and NYC1, which encode the first enzymes in the degrading pathways of Chl a and Chl b, respectively, was not affected by sgr in rice. The results suggest that SGR might be involved in activation of the Chl-degrading pathway during leaf senescence through translational or posttranslational regulation of Chl-degrading enzymes. PMID:17709752
-
Mendel's green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway.
Sato, Yutaka; Morita, Ryouhei; Nishimura, Minoru; Yamaguchi, Hiroyasu; Kusaba, Makoto
2007-08-28
Mutants that retain greenness of leaves during senescence are known as "stay-green" mutants. The most famous stay-green mutant is Mendel's green cotyledon pea, one of the mutants used in determining the law of genetics. Pea plants homozygous for this recessive mutation (known as i at present) retain greenness of the cotyledon during seed maturation and of leaves during senescence. We found tight linkage between the I locus and stay-green gene originally found in rice, SGR. Molecular analysis of three i alleles including one with no SGR expression confirmed that the I gene encodes SGR in pea. Functional analysis of sgr mutants in pea and rice further revealed that leaf functionality is lowered despite a high chlorophyll a (Chl a) and chlorophyll b (Chl b) content in the late stage of senescence, suggesting that SGR is primarily involved in Chl degradation. Consistent with this observation, a wide range of Chl-protein complexes, but not the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit, were shown to be more stable in sgr than wild-type plants. The expression of OsCHL and NYC1, which encode the first enzymes in the degrading pathways of Chl a and Chl b, respectively, was not affected by sgr in rice. The results suggest that SGR might be involved in activation of the Chl-degrading pathway during leaf senescence through translational or posttranslational regulation of Chl-degrading enzymes.
-
Transepithelial transport of alpha-lipoic acid across human intestinal Caco-2 cell monolayers.
Takaishi, Naoki; Yoshida, Kazutaka; Satsu, Hideo; Shimizu, Makoto
2007-06-27
Alpha-lipoic acid (LA) is used in dietary supplements or food with antioxidative functions. The mechanism for the intestinal absorption of alpha-lipoic acid was investigated in this study by using human intestinal Caco-2 cell monolayers. LA was rapidly transported across the Caco-2 cell monolayers, this transport being energy-dependent, suggesting transporter-mediated transport to be the mechanism involved. The LA transport was strongly dependent on the pH value, being accelerated in the acidic pH range. Furthermore, such monocarboxylic acids as benzoic acid and medium-chain fatty acids significantly inhibited LA transport, suggesting that a proton-linked monocarboxylic acid transporter (MCT) was involved in the intestinal transport of LA. The conversion of LA to the more antioxidative dihydrolipoic acid was also apparent during the transport process.
-
Tiner, Bethany L.; Kirtley, Michelle L.; Erova, Tatiana E.; Popov, Vsevolod L.; Baze, Wallace B.; van Lier, Christina J.; Ponnusamy, Duraisamy; Andersson, Jourdan A.; Motin, Vladimir L.; Chauhan, Sadhana
2015-01-01
Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a mouse model while retaining the required immunogenicity needed for subsequent protection against infection. PMID:25605764
-
Tiner, Bethany L; Sha, Jian; Kirtley, Michelle L; Erova, Tatiana E; Popov, Vsevolod L; Baze, Wallace B; van Lier, Christina J; Ponnusamy, Duraisamy; Andersson, Jourdan A; Motin, Vladimir L; Chauhan, Sadhana; Chopra, Ashok K
2015-04-01
Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a mouse model while retaining the required immunogenicity needed for subsequent protection against infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Smith, Mark R.; Boenzli, Matthew G.; Hindagolla, Vihangi; Ding, Jun; Miller, John M.; Hutchison, James E.; Greenwood, Jeffrey A.; Abeliovich, Hagai
2013-01-01
Positively charged gold nanoparticles (0.8-nm core diameter) reduced yeast survival, but not growth, at a concentration of 10 to 100 μg/ml. Among 17 resistant deletion mutants isolated in a genome-wide screen, highly significant enrichment was observed for respiration-deficient mutants lacking genes encoding proteins associated with the mitochondrion. PMID:23144132
-
USDA-ARS?s Scientific Manuscript database
Previously, twelve protease-deficient mutants of Xanthomonas oryzae pv. oryzicola (Xoc) RS105 strain were recovered from a Tn5-tagged mutant library. In the current study, the Tn5 insertion site in each mutant was mapped. Mutations in genes encoding components of the type II secretion apparatus, cAM...
-
Zhu, Jian-Kang [Riverside, CA; Quintero-Toscano, Francisco Javier [Sevilla, ES; Pardo-Prieto, Jose Manuel [Sevilla, ES; Qiu, Quansheng [Urbana, IL; Schumaker, Karen Sue [Tucson, AZ; Ohta, Masaru [Tsukuba, JP; Zhang, Changqing [Tucson, AZ; Guo, Yan [Beijing, CN
2007-09-04
The present invention provides a method of increasing salt tolerance in a plant by overexpressing a gene encoding a mutant SOS2 protein in at least one cell type in the plant. The present invention also provides for transgenic plants expressing the mutant SOS2 proteins.
-
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased placental inflammation and decreased infant birth weight among women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) during pregnancy. Methods. Between 2009 and 2011, delivering women without human immunodeficiency virus infection were enrolled in an observational study of IPTp-SP effectiveness in Malawi. Parasites were detected by polymerase chain reaction (PCR); positive samples were sequenced to genotype the dhfr and dhps loci. The presence of K540E in dhps was used as a marker for the quintuple mutant. Results. Samples from 1809 women were analyzed by PCR; 220 (12%) were positive for P. falciparum. A total of 202 specimens were genotyped at codon 581 of dhps; 17 (8.4%) harbored the sextuple mutant. The sextuple mutant was associated with higher risks of patent infection in peripheral blood (adjusted prevalence ratio [aPR], 2.76; 95% confidence interval [CI], 1.82–4.18) and placental blood (aPR 3.28; 95% CI, 1.88–5.78) and higher parasite densities. Recent SP use was not associated with increased parasite densities or placental pathology overall and among women with parasites carrying dhps A581G. Conclusions. IPTp-SP failed to inhibit parasite growth but did not exacerbate pathology among women infected with sextuple-mutant parasites. New interventions to prevent malaria during pregnancy are needed urgently. PMID:25564249
-
Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.
2012-01-01
ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869
-
Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D Janine; Dickstein, Rebecca
2012-10-01
The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function.
-
Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O. Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D. Janine; Dickstein, Rebecca
2012-01-01
The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function. PMID:22858636
-
Eremeeva, Marina E.; Silverman, David J.
1998-01-01
Rickettsia rickettsii infection of endothelial cells is manifested in very distinctive changes in cell morphology, consisting of extensive dilatation of the membranes of the endoplasmic reticulum and outer nuclear envelope and blebbing of the plasma membrane, as seen by transmission electron microscopy (D. J. Silverman, Infect. Immun. 44:545–553, 1984). These changes in cellular architecture are thought to be due to oxidant-mediated cell injury, since their occurrence correlates with dramatic alterations in cellular metabolism, particularly with regard to antioxidant systems. In this study, it was shown that R. rickettsii infection of human umbilical vein endothelial cells resulted in a significant depletion of intracellular reduced glutathione (thiol) content at 72 and 96 h and decreased glutathione peroxidase activity at 72 h postinfection. Infected cells displayed a dramatic increase in the concentration of intracellular peroxides by 72 h. Supplementation of the cell culture medium with 100, 200, or 500 μM α-lipoic acid, a metabolic antioxidant, after inoculation with R. rickettsii restored the intracellular levels of thiols and glutathione peroxidase and reduced the intracellular peroxide levels in infected cells. These effects were dose dependent. Treated infected monolayers maintained better viability at 96 h after inoculation with R. rickettsii than did untreated infected cells. Moreover, supplementation of the cell culture medium with 100 μM α-lipoic acid for 72 h after infection prevented the occurrence of morphological changes in the infected cells. The presence of 100 or 200 μM α-lipoic acid did not influence rickettsial growth in endothelial cells, nor did it affect the ability of R. rickettsii to form lytic plaques in Vero cells. Treatment with 500 μM α-lipoic acid decreased by 50% both the number and size of lytic plaques in Vero cells, and it also decreased the recovery of viable rickettsiae from endothelial cells. However, under all treatment conditions, a significant number of rickettsiae could be detected microscopically. Furthermore, the rickettsiae apparently retained their capacity for intracellular movement, since they possessed long polymerized actin tails after 72 and 96 h of treatment regardless of the concentration of α-lipoic acid used. Since α-lipoic acid does not seem to exhibit direct antirickettsial activity except with long-term exposure at very high concentrations, the mechanism of its protective activity for endothelial cells infected with rickettsiae may involve complex changes in cellular metabolism that only indirectly affect rickettsiae. PMID:9573120
-
Zhou, Mingxu; Duan, Qiangde; Zhu, Xiaofang; Guo, Zhiyan; Li, Yinchau; Hardwidge, Philip R; Zhu, Guoqiang
2013-05-13
The role of flagella in the pathogenesis of F4ac+ Enterotoxigenic Escherichia coli (ETEC) mediated neonatal and post-weaning diarrhea (PWD) is not currently understood. We targeted the reference C83902 ETEC strain (O8:H19:F4ac+ LT+ STa+ STb+), to construct isogenic mutants in the fliC (encoding the major flagellin protein), motA (encoding the flagella motor), and faeG (encoding the major subunit of F4 fimbriae) genes. Both the ΔfliC and ΔfaeG mutants had a reduced ability to adhere to porcine intestinal epithelial IPEC-J2 cells. F4 fimbriae expression was significantly down-regulated after deleting fliC, which revealed that co-regulation exists between flagella and F4 fimbriae. However, there was no difference in adhesion between the ΔmotA mutant and its parent strain. These data demonstrate that both flagella and F4 fimbriae are required for efficient F4ac+ ETEC adhesion in vitro.
-
Aly, Hamdy A A; Alahdal, Abdulrahman M; Nagy, Ayman A; Abdallah, Hossam M; Abdel-Sattar, Essam A; Azhar, Ahmad S
2017-04-01
Aroclor 1260 is one of the more representative polychlorinated biphenyls found in biota. This study was designed to delineate the testicular toxicity of Aroclor 1260 and to elucidate the potential protective role of Calligonum comosum (C. comosum) and lipoic acid in adult rats. Aroclor 1260 was dissolved in corn oil and given to rats by gavage at doses 0, 20, 40, or 60 mg/kg/day for 15 consecutive days (Groups I, II, III, and IV, respectively). Groups V and VI were pretreated with C. comosum (200 mg/kg/day) and lipoic acid (35 mg/kg/day) respectively 24 h before Aroclor 1260 (40 mg/kg/day) treatment for 15 consecutive days. Aroclor 1260 (20, 40 or 60 mg/kg/day) treatment significantly decreased testes weight, sperm count and motility and daily sperm production. Serum testosterone was significantly decreased in response to treatment with 40 and 60 mg/kg/day of Aroclor 1260. LDH-X activity was significantly decreased at the three dose levels. Hydrogen peroxide (H 2 O 2 ) production (in a dose-related manner) and lipid peroxidation were significantly increased in response to Aroclor 1260 (20, 40, or 60 mg/kg/day) treatment. Aroclor 1260 at the three dose levels decreased the activities of the antioxidant enzymes SOD, CAT, GPx, and GR and the non-enzymatic antioxidant GSH level. CAT, GPx and GSH showed a dose-response effect. These abnormalities were effectively attenuated by pretreatment with C. comosum (200 mg/kg/day) or lipoic acid (35 mg/kg/day). Histopathological examination showed a dose-related increase in morphological abnormalities of the testis in response to Aroclor 1260 treatment. In conclusion, Aroclor 1260 induced testicular toxicity at least, in part, by induction of oxidative stress. By reversal of biochemical and morphological changes towards normalcy, the cytoprotective role of C. comosum and lipoic acid is illuminated. In comparison, lipoic acid was more protective than C. comosum extract against testicular toxicity induced by Aroclor 1260. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1147-1157, 2017. © 2016 Wiley Periodicals, Inc.
-
Kan, Emrah; Alici, Ömer; Kan, Elif Kılıç; Ayar, Ahmet
2017-12-01
The purpose of the present study was to investigate the effect of alpha-lipoic acid (ALA) on the thicknesses of various retinal layers and on the numbers of retinal ganglion cells and vascular endothelial growth factor levels in experimental diabetic mouse retinas. Twenty-one male BALB/C mice were made diabetic by the intraperitoneal administration of streptozotocin (200 mg/kg). One week after the induction of diabetes, the mice were divided randomly into three groups: control group (non-diabetic mice treated with alpha-lipoic acid, n = 7), diabetic group (diabetic mice without treatment, n = 7), and alpha-lipoic acid treatment group (diabetic mice with alpha-lipoic acid treatment, n = 7). At the end of the 8th week, the thicknesses of the inner nuclear layer (INL), outer nuclear layer (ONL), and full-length retina were measured; also retinal ganglion cells and VEGF expressions were counted on the histological sections of the mouse retinas and compared with each other. The thicknesses of the full-length retina, ONL, and INL were significantly reduced in the diabetic group compared to the control and ALA treatment groups (p = 0.001), whereas the thicknesses of these layers did not show a significant difference between ALA treatment and control groups. The number of ganglion cells in the diabetic group was significantly lower than those in the control and ALA treatment groups (p = 0.001). The VEGF expression was significantly higher in the diabetic group and mostly observed in the ganglion cell and inner nuclear layers compared to the control and ALA treatment groups (p = 0.001). Therefore, the number of ganglion cells and VEGF levels did not show significant differences between the ALA treatment and control groups (p = 0.7). Our results show that alpha-lipoic acid treatment may have an impact on reducing VEGF levels, protecting ganglion cells, and preserving the thicknesses of the inner and outer layers in diabetic mouse retinas.
-
Choi, Ji Hyun; Cho, Soon Ok; Kim, Hyeyoung
2016-01-01
The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation.
-
Johnson, Jeremiah G; Murphy, Caitlin N; Sippy, Jean; Johnson, Tylor J; Clegg, Steven
2011-07-01
Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression.
-
Johnson, Jeremiah G.; Murphy, Caitlin N.; Sippy, Jean; Johnson, Tylor J.; Clegg, Steven
2011-01-01
Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression. PMID:21571997
-
Francis, Michael M; Evans, Susan P; Jensen, Michael; Madsen, David M; Mancuso, Joel; Norman, Kenneth R; Maricq, Andres Villu
2005-05-19
Nicotinic (cholinergic) neurotransmission plays a critical role in the vertebrate nervous system, underlies nicotine addiction, and nicotinic receptor dysfunction leads to neurological disorders. The C. elegans neuromuscular junction (NMJ) shares many characteristics with neuronal synapses, including multiple classes of postsynaptic currents. Here, we identify two genes required for the major excitatory current found at the C. elegans NMJ: acr-16, which encodes a nicotinic AChR subunit homologous to the vertebrate alpha7 subunit, and cam-1, which encodes a Ror receptor tyrosine kinase. acr-16 mutants lack fast cholinergic current at the NMJ and exhibit synthetic behavioral deficits with other known AChR mutants. In cam-1 mutants, ACR-16 is mislocalized and ACR-16-dependent currents are disrupted. The postsynaptic deficit in cam-1 mutants is accompanied by alterations in the distribution of cholinergic vesicles and associated synaptic proteins. We hypothesize that CAM-1 contributes to the localization or stabilization of postsynaptic ACR-16 receptors and presynaptic release sites.
-
Alugoju, Phaniendra; Janardhanshetty, Sudharshan Setra; Subaramanian, Subasri; Periyasamy, Latha; Dyavaiah, Madhu
2018-05-01
The yeast Saccharomyces cerevisiae PEP4 gene encodes vacuolar endopeptidase proteinase A (Pep4p), which is a homolog of the human CTSD gene that encodes cathepsin D. Mutation of CTSD gene in human resulted in a number of neurodegenerative diseases. In this study, we have shown that yeast pep4 mutant cells are highly sensitive to oxidative and apoptotic stress induced by hydrogen peroxide and acetic acid, respectively. pep4∆ cells also showed accumulation of reactive oxygen species (ROS), apoptotic markers, and reduced chronological lifespan. In contrast, quercetin pretreatment protected the pep4 mutant from oxidative and apoptotic stress-induced sensitivity by scavenging ROS and reducing apoptotic markers. The percentage viability of quercetin-treated pep4∆ cells was more pronounced and increased stress resistance against oxidant, apoptotic, and heat stress during chronological aging. From our experimental results, we concluded that quercetin protects yeast pep4 mutant cells from oxidative stress and apoptosis, thereby increasing viability during chronological aging.
-
Touch responsiveness in zebrafish requires voltage-gated calcium channel 2.1b
Low, Sean E.; Woods, Ian G.; Lachance, Mathieu; Ryan, Joel; Saint-Amant, Louis
2012-01-01
The molecular and physiological basis of the touch-unresponsive zebrafish mutant fakir has remained elusive. Here we report that the fakir phenotype is caused by a missense mutation in the gene encoding voltage-gated calcium channel 2.1b (CACNA1Ab). Injection of RNA encoding wild-type CaV2.1 restores touch responsiveness in fakir mutants, whereas knockdown of CACNA1Ab via morpholino oligonucleotides recapitulates the fakir mutant phenotype. Fakir mutants display normal current-evoked synaptic communication at the neuromuscular junction but have attenuated touch-evoked activation of motor neurons. NMDA-evoked fictive swimming is not affected by the loss of CaV2.1b, suggesting that this channel is not required for motor pattern generation. These results, coupled with the expression of CACNA1Ab by sensory neurons, suggest that CaV2.1b channel activity is necessary for touch-evoked activation of the locomotor network in zebrafish. PMID:22490555
-
Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan
2015-09-17
Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.
-
Oxidative modification of lipoic acid by HNE in Alzheimer disease brain.
Hardas, Sarita S; Sultana, Rukhsana; Clark, Amy M; Beckett, Tina L; Szweda, Luke I; Murphy, M Paul; Butterfield, D Allan
2013-01-01
Alzheimer disease (AD) is an age-related neurodegenerative disease characterized by the presence of three pathological hallmarks: synapse loss, extracellular senile plaques (SP) and intracellular neurofibrillary tangles (NFTs). The major component of SP is amyloid β-peptide (Aβ), which has been shown to induce oxidative stress. The AD brain shows increased levels of lipid peroxidation products, including 4-hydroxy-2-nonenal (HNE). HNE can react covalently with Cys, His, or Lys residues on proteins, altering structure and function of the latter. In the present study we measured the levels of the HNE-modified lipoic acid in brain of subjects with AD and age-matched controls. Lipoic acid is a key co-factor for a number of proteins including pyruvate dehydrogenase and α-ketoglutarate dehydrogenase, key complexes for cellular energetics. We observed a significant decrease in the levels of HNE-lipoic acid in the AD brain compared to that of age-matched controls. To investigate this phenomenon further, the levels and activity of lipoamide dehydrogenase (LADH) were measured in AD and control brains. Additionally, LADH activities were measured after in-vitro HNE-treatment to mice brains. Both LADH levels and activities were found to be significantly reduced in AD brain compared to age-matched control. HNE-treatment also reduced the LADH activity in mice brain. These data are consistent with a two-hit hypothesis of AD: oxidative stress leads to lipid peroxidation that, in turn, causes oxidative dysfunction of key energy-related complexes in mitochondria, triggering neurodegeneration. This study is consonant with the notion that lipoic acid supplementation could be a potential treatment for the observed loss of cellular energetics in AD and potentiate the antioxidant defense system to prevent or delay the oxidative stress in and progression of this devastating dementing disorder.
-
Lipid Lowering Effect of Antioxidant Alpha-Lipoic Acid in Experimental Atherosclerosis
Amom, Zulkhairi; Zakaria, Zaiton; Mohamed, Jamaluddin; Azlan, Azrina; Bahari, Hasnah; Taufik Hidayat Baharuldin, Mohd; Aris Moklas, Mohd; Osman, Khairul; Asmawi, Zanariyah; Kamal Nik Hassan, Mohd
2008-01-01
Accumulating data demonstrated that hypercholesterolemia and oxidative stress play an important role in the development of atherosclerosis. In the present study, a protective activity of alpha-lipoic acid; a metabolic antioxidant in hypercholesterolemic-induced animals was investigated. Eighteen adult male New Zealand White (NZW) rabbit were segregated into three groups labelled as group N, HCD and ALA (n = 6). Group N (normal control) was fed with normal chow, the rest (HCD and ALA) were fed with 100 g/head/day of 1% cholesterol rich diet to induce hypercholesterolemia. Four point two mg/body weight of alpha lipoic acid was concomintantly supplemented to the ALA group. Drinking water was given ad-libitum. The study was designed for 10 weeks. Blood sampling was taken from the ear lobe vein at the beginning, week 5 and week 10. Plasma was prepared for lipid profile estimation and microsomal lipid peroxidation index indicated with malondialdehyde (MDA) formation. At the end of the experiment, the animals were sacrificed and the aorta were excised for intimal lesion analysis. The plasma total cholesterol (TC) and low density lipoprotein (LDL) levels were found to be significantly low in ALA group compared to that of the HCD group (p<0.05). Similarly, low level of MDA (p<0.05) in ALA group was observed compared to that of the HCD group showing a significant reduction of lipid peroxidation activity. Histomorphometric intimal lesion analysis of the aorta showing less of atheromatous plaque formation in alpha lipoic acid supplemented group (p<0.05) compared to HCD group. These findings suggested that alpha lipoic acid posses a dual lipid lowering and anti-atherosclerotic properties indicated with low plasma TC and LDL levels and reduction of athero-lesion formation in hypercholesterolemic-induced rabbits. PMID:18818758
-
Tayebati, Seyed Khosrow; Tomassoni, Daniele; Di Cesare Mannelli, Lorenzo; Amenta, Francesco
2016-01-01
Endothelial cells represent an important vascular site of signaling and development of damage during ischemia, inflammation and other pathological conditions. Excessive reactive oxygen species production causes pathological activation of endothelium including exposure of cell to adhesion molecules. Intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and platelet-endothelial cell adhesion molecule-1 (PECAM-1) are members of the immunoglobulin super-family which are present on the surface of endothelial cells. These molecules represent important markers of endothelial inflammation. The present study was designed to investigate, with immunochemical and immunohistochemical techniques, the effect of treatment with (+/-)-alpha lipoic (thioctic) acid and its enantiomers on heart and kidney endothelium in spontaneously hypertensive rats (SHR). Arterial hypertension is accompanied by an increased oxidative stress status in the heart characterized by thiobarbituric acid reactive substances (TBARS) and nucleic acid oxidation increase. The higher oxidative stress also modifies adhesion molecules expression. In the heart VCAM-1, which was higher than ICAM-1 and PECAM-1, was increased in SHR. ICAM-1, VCAM-1 and PECAM-1 expression was significantly greater in the renal endothelium of SHR. (+/-)-Alpha lipoic acid and (+)-alpha lipoic acid treatment significantly decreased TBARS levels, the nucleic acid oxidation and prevented adhesion molecules expression in cardiac and renal vascular endothelium. These data suggest that endothelial molecules may be used for studying the mechanisms of vascular injury on target organs of hypertension. The effects observed after treatment with (+)-alpha lipoic acid could open new perspectives for countering heart and kidney microvascular injury which represent a common feature in hypertensive end-organs damage.
-
Hyper Accumulation of Arsenic in Mutants of Ochrobactrum tritici Silenced for Arsenite Efflux Pumps
Piedade, Ana Paula; Morais, Paula V.
2015-01-01
Ochrobactrum tritici SCII24T is a highly As-resistant bacterium, with two previously described arsenic resistance operons, ars1 and ars2. Among a large number of genes, these operons contain the arsB and Acr3 genes that encode the arsenite efflux pumps responsible for arsenic resistance. Exploring the genome of O. tritici SCII24T, an additional putative operon (ars3) was identified and revealed the presence of the Acr3_2 gene that encodes for an arsenite efflux protein but which came to prove to not be required for full As resistance. The genes encoding for arsenite efflux pumps, identified in this strain, were inactivated to develop microbial accumulators of arsenic as new tools for bioremediation. Six different mutants were produced, studied and three were more useful as biotools. O. tritici wild type and the Acr3-mutants showed the highest resistance to As(III), being able to grow up to 50 mM of arsenite. On the other hand, arsB-mutants were not able to grow at concentrations higher than 1 mM As(III), and were the most As(III) sensitive mutants. In the presence of 1 mM As(III), the strain with arsB and Acr3_1 mutated showed the highest intracellular arsenic concentration (up to 17 ng(As)/mg protein), while in assays with 5 mM As(III), the single arsB-mutant was able to accumulate the highest concentration of arsenic (up to 10 ng(As)/mg protein). Therefore, arsB is the main gene responsible for arsenite resistance in O. tritici. However, both genes arsB and Acr3_1 play a crucial role in the resistance mechanism, depending on the arsenite concentration in the medium. In conclusion, at moderate arsenite concentrations, the double arsB- and Acr3_1-mutant exhibited a great ability to accumulate arsenite and can be seen as a promising bioremediation tool for environmental arsenic detoxification. PMID:26132104
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Neill, G.P.; Michelsen, U.; Soll, D.
Ethylmethane sulfonate-induced mutants of several Escherichia coli strains that required {delta}-aminolevulinic acid (ALA) for growth were isolated by penicillin enrichment or by selection for respiratory-defective strains resistant to the aminoglycoside antibiotic kanamycin. Three classes of mutants were obtained. Two-thirds of the strains were mutants in hemA. Representative of a third of the mutations was the hem-201 mutation. This mutation was mapped to min 8.6 to 8.7. Complementation of the auxotrophic phenotype by wild-type DNA from the corresponding phage 8F10 allowed the isolation of the gene. DNA sequence analysis revealed that the hem-201 gene encoded ALA dehydratase and was similar tomore » a known hemB gene of E. coli. Complementation studies of hem-201 and hemB1 mutant strains with various hem-201 gene subfragments showed that hem-201 and the previously reported hemB1 mutation are in the same gene and that no other gene is required to complement the hem-201 mutant. ALA-forming activity from glutamate could not be detected by in vitro or in vivo assays. Extracts of hem-201 cells had drastically reduce ALA dehydratase levels, while cells transformed with the plasmid-encoded wild-type gene possessed highly elevated enzyme levels. The ALA requirement for growth, the lack of any ALA-forming enzymatic activity, and greatly reduced ALA dehydratase activity of the hem-201 strain suggest that a diffusible product of an enzyme in the heme biosynthetic pathway after ALA formation is involved in positive regulation of ALA biosynthesis. Analysis of another class of ALA-requiring mutants showed that the auxotrophy of the hem-205 mutant could be relieved by either methionine or cysteine and that the mutation maps in the cysG gene, which encodes uroporphyrinogen III methylase. The properties of these nonleaky ALA-requiring strains suggest that ALA is involved more extensively in E. coli intermediary metabolism than has been appreciated to date.« less
-
Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M
2017-06-01
Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
-
Ito, Masahiro; Kim, Yun-Gi; Tsuji, Hirokazu; Takahashi, Takuya; Kiwaki, Mayumi; Nomoto, Koji; Danbara, Hirofumi; Okada, Nobuhiko
2014-01-01
Lactobacillus casei ATCC 27139 enhances host innate immunity, and the J1 phage-resistant mutants of this strain lose the activity. A transposon insertion mutant library of L. casei ATCC 27139 was constructed, and nine J1 phage-resistant mutants out of them were obtained. Cloning and sequencing analyses identified three independent genes that were disrupted by insertion of the transposon element: asnH, encoding asparagine synthetase, and dnaJ and dnaK, encoding the molecular chaperones DnaJ and DnaK, respectively. Using an in vivo mouse model of Listeria infection, only asnH mutant showed deficiency in their ability to enhance host innate immunity, and complementation of the mutation by introduction of the wild-type asnH in the mutant strain recovered the immuno-augmenting activity. AsnH protein exhibited asparagine synthetase activity when the lysozyme-treated cell wall extracts of L. casei ATCC 27139 was added as substrate. The asnH mutants lost the thick and rigid peptidoglycan features that are characteristic to the wild-type cells, indicating that AsnH of L. casei is involved in peptidoglycan biosynthesis. These results indicate that asnH is required for the construction of the peptidoglycan composition involved in the immune-activating capacity of L. casei ATCC 27139.
-
Figaro, Sabine; Durand, Sylvain; Gilet, Laetitia; Cayet, Nadège; Sachse, Martin
2013-01-01
The genes encoding the ribonucleases RNase J1 and RNase Y have long been considered essential for Bacillus subtilis cell viability, even before there was concrete knowledge of their function as two of the most important enzymes for RNA turnover in this organism. Here we show that this characterization is incorrect and that ΔrnjA and Δrny mutants are both viable. As expected, both strains grow relatively slowly, with doubling times in the hour range in rich medium. Knockout mutants have major defects in their sporulation and competence development programs. Both mutants are hypersensitive to a wide range of antibiotics and have dramatic alterations to their cell morphologies, suggestive of cell envelope defects. Indeed, RNase Y mutants are significantly smaller in diameter than wild-type strains and have a very disordered peptidoglycan layer. Strains lacking RNase J1 form long filaments in tight spirals, reminiscent of mutants of the actin-like proteins (Mre) involved in cell shape determination. Finally, we combined the rnjA and rny mutations with mutations in other components of the degradation machinery and show that many of these strains are also viable. The implications for the two known RNA degradation pathways of B. subtilis are discussed. PMID:23504012
-
Ducasse, D A; Mushegian, A R; Shepherd, R J
1995-01-01
Gene I of peanut chlorotic streak virus (PCISV), a caulimovirus, is homologous to gene I of other caulimoviruses and may encode a protein for virus movement. To evaluate the function of gene I, several mutations were created in this gene of an infectious, partially redundant clone of PCISV. Constructs with an in-frame deletion and a single amino acid substitution in gene I were not infectious. To test for replication of these mutants in primarily infected cells, an immunosorbent PCR technique was devised. Virus particles formed by mutants in plants were recovered by binding to antivirus antibodies on a solid matrix and DNase treated to discriminate against residual inoculum, and DNA of trapped virions was subjected to PCR amplification. Gene I mutants were shown to direct formation of encapsidated DNA as revealed by a PCR product. Control gene V mutants (reverse transcriptase essential for replication) did not yield a PCR product. Quantitative PCR allowed estimation of the proportion of cells initially infected by gene I mutants and the amount of extractable virus per cell. It is concluded that PCISV gene I encodes a movement protein and that the immunoselection-PCR technique is useful in studying subliminal virus infection in plants. PMID:7543587
-
Mechanisms of Oxygen Toxicity at the Cellular Level.
1982-06-30
exposed and measured using glucose as the sole carbon source. Addition of SH containing reducing agents (cysteine, lipoic acid or dithiothreitol) before...of a Few Seconds. Biotechnology and Bioengineering 16:1645-1657 (1974). (28) Brown, O.R. Failure of Lipoic Acid to Protect Against Cellular Oxygen...respiration, and fatty acid synthesis. The interruption of fatty acid synthesis is not the result of inactivation of the fatty acid synthetase enzyme complex
-
STUDIES ON MAMMALIAN AND HUMAN PYRUVATE AND ALPHA-KETOGLUTARATE DEHYDROGENATION COMPLEXES
bound lipoic acid and 17 moles of bound FAD. Alpha -ketoglutarate dehydrogenase complex contains approximately 10 moles of protein-bound lipoic acid , 9...typical metal activators of oxidative decarboxylation reaction of alpha -keto acid . These activating effects were in good agreement with the results of...A coenzyme A- and NAD-linked pyruvate and alpha -ketoglutarate dehydrogenase complexes have been isolated from pig heart muscle as multienzyme units
-
Fukuda, K; Watanabe, M; Asano, K; Ouchi, K; Takasawa, S
1991-12-01
o-Fluoro-DL-phenylalanine (OFP)-resistant mutants which overproduce beta-phenethyl-alcohol were isolated from a laboratory strain of Saccharomyces cerevisiae. Cells of one of the mutants accumulated tyrosine and phenylalanine 1.5-3 fold more than did wild-type cells. Its 3-deoxy-D-arabino-hepturosonate-7-phosphate (DAHP) synthase (EC 4.1.2.15), encoded by ARO4, was free from feedback inhibition by tyrosine. Genetic analysis revealed that the mutation was controlled by a single dominant gene, ARO4-OFP, encoding feedback-resistant DAHP synthase by tyrosine, and that this gene caused both the OFP resistance and beta-phenethyl-alcohol overproduction. This was supported by molecular genetic studies using cloned ARO4 both from the wild-type and its mutant strain.
-
Cianci, Antonio; Panella, Marco; Fichera, Michele; Falduzzi, Cristina; Bartolo, Manuela; Caruso, Salvatore
2015-06-01
To evaluate the effects of the combination of d-chiro-inositol (DCI) and alpha lipoic acid on menses and metabolic disorders in women with polycystic ovary syndrome (PCOS). Forty-six women (26 study group subjects and 20 controls) of reproductive age with PCOS according to Rotterdam criteria were enrolled in this prospective study. Fasting serum samples were collected from each woman. Homeostasis model of insulin resistance, insulin levels, lipid profile, frequency of menstrual cycles, number of ovarian peripheral cysts and BMI of both groups were investigated at baseline and after 180 days. Clinical and metabolic aspects of women on DCI and lipoic acid treatment underwent improvement (p < 0.5) with respect to the control group. Regarding lipid profile, no statistically difference was observed in total cholesterol and triglycerides levels in both groups at follow-up with respect the baseline values (p = NS). DCI and alpha lipoic acid treatment has been thought because it plays an essential role in mitochondrial specific pathways that generate energy from glucose and its potent effect as antioxidant. The association might have a strong impact on metabolic profile even with a short-term treatment. Further investigations are needed to evaluate other effects on reproductive physiology of women with PCOS.
-
Wu, Ming-Hsiu; Huang, Chao-Ching; Chio, Chung-Ching; Tsai, Kuen-Jer; Chang, Ching-Ping; Lin, Nan-Kai; Lin, Mao-Tsun
2016-09-01
Ischemic stroke, caused by obstruction of blood flow to the brain, would initiate microglia activation which contributes to neuronal damage. Therefore, inhibition of microglia-mediated neuroinflammation could be a therapeutic strategy for ischemic stroke. This study was aimed to elucidate the anti-inflammatory effects of alpha-lipoic acid and etanercept given either singly or in combination in rats subjected to middle cerebral artery occlusion. Both α-lipoic acid and etanercept markedly reduced cerebral infarct, blood-brain barrier disruption, and neurological motor deficits with the former drug being more effective with the dosage used. Furthermore, when used in combination, the reduction was more substantial. Remarkably, a greater diminution in the serum levels of tumor necrosis factor-alpha as well as the brain levels of microglial activation (e.g., microgliosis, amoeboid microglia, and microglial overexpression of tumor necrosis factor-α) was observed with the combined drug treatment as compared to the drugs given separately. We conclude that inhibition of peripheral tumor necrosis factor-alpha as well as downregulation of brain microglial activation by alpha-lipoic acid or etanercept protect rat brain against ischemic stroke. Moreover, when both drugs were used in combination, the stroke recovery was promoted more extensively.
-
α-Lipoic acid treatment of aged type 2 diabetes mellitus complicated with acute cerebral infarction.
Zhao, L; Hu, F-X
2014-01-01
This study aims to evaluate the efficacy and safety of α-lipoic acid in the treatment of aged type 2 diabetes mellitus (T2DM) complicated with acute cerebral infarction. 90 patients were randomly divided into two groups, on the basis of conventional treatment. The experiment group was administrated with α-lipoic acid, while only Vitamin C for the control group, for 3 consecutive weeks. Before and after the experiment, superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and malondialdehyde (MDA) levels were measured and scored with the NIHSS (National Institutes of Health Stroke Scale), and the changes of blood glucose, insulin function and other indicators were observed. After the treatment, the plasma SOD and GSH-Px levels increased, while MDA decreased (p < 0.05), with statistical significance when compared with the control group (p < 0.01). NIHSS score, blood glucose, blood lipids and HOMA-IA of the experiment group decreased significantly (p < 0.01); and no significant adverse reactions were found in both groups. α-lipoic acid was safe and effective in the treatment of aged T2DM complicated with acute cerebral infarction, significantly reducing the patient's oxidative stress, blood glucose and lipid levels and being able to improve islet function.
-
Bairl, A; Müller, P
1998-11-01
The TnphoA-induced Bradyrhizobium japonicum mutant 184 shows slow growth and aberrant colonization of soybean nodules. Using a DNA fragment adjacent to the transposon insertion site as a probe, a 3.4-kb BglII fragment of B. japonicum 110spc4 DNA was identified and cloned. Sequence analysis indicated that two truncated ORFs and three complete ORFs were encoded on this fragment. A database search revealed homologies to several other prokaryotic proteins: PdxJ (an enzyme involved in vitamin B6 biosynthesis), AcpS (acyl carrier protein synthase), Lep or Sip (prokaryotic type I signal peptidase), RNase III (an endoribonuclease which processes double-stranded rRNA precursors and mRNA) and Era (a GTP-binding protein required for cell division). The mutation in strain 184 was found to lie within the signal peptidase gene, which was designated sipF. Therefore, sipF is located in a region that encodes gene products involved in posttranscriptional and posttranslational processing processes. By complementation of the lep(ts) E. coli mutant strain IT41 it was demonstrated that sipF indeed encodes a functional signal peptidase, and genetic complementation of B. japonicum mutant 184 by a 2.8-kb SalI fragment indicated that sipF is expressed from a promoter located directly upstream of sipF. Using a non-polar kanamycin resistance cassette, a specific sipF mutant was constructed which exhibited defects in symbiosis similar to those of the original mutant 184.
-
Silva, Maria C.; Yu, Qian-Chun; Enquist, Lynn; Shenk, Thomas
2003-01-01
The human cytomegalovirus UL99-encoded pp28 is a myristylated phosphoprotein that is a constituent of the virion. The pp28 protein is positioned within the tegument of the virus particle, a protein structure that resides between the capsid and envelope. In the infected cell, pp28 is found in a cytoplasmic compartment derived from the Golgi apparatus, where the virus buds into vesicles to acquire its final membrane. We have constructed two mutants of human cytomegalovirus that fail to produce the pp28 protein, a substitution mutant (BADsubUL99) and a point mutant (BADpmUL99), and we have propagated them by complementation in pp28-expressing fibroblasts. Both mutant viruses are profoundly defective for growth in normal fibroblasts; no infectious virus could be detected after infection. Whereas normal levels of viral DNA and late proteins were observed in mutant virus-infected cells, large numbers of tegument-associated capsids accumulated in the cytoplasm that failed to acquire an envelope. We conclude that pp28 is required for the final envelopment of the human cytomegalovirus virion in the cytoplasm. PMID:12970444
-
Regulation of sugar transport and metabolism by the Candida albicans Rgt1 transcriptional repressor.
Sexton, Jessica A; Brown, Victoria; Johnston, Mark
2007-10-01
The ability of the fungal pathogen Candida albicans to cause systemic infections depends in part on the function of Hgt4, a cell surface sugar sensor. The orthologues of Hgt4 in Saccharomyces cerevisiae, Snf3 and Rgt2, initiate a signalling cascade that inactivates Rgt1, a transcriptional repressor of genes encoding hexose transporters. To determine whether Hgt4 functions similarly through the C. albicans orthologue of Rgt1, we analysed Cargt1 deletion mutants. We found that Cargt1 mutants are sensitive to the glucose analogue 2-deoxyglucose, a phenotype probably due to uncontrolled expression of genes encoding glucose transporters. Indeed, transcriptional profiling revealed that expression of about two dozen genes, including multiple HGT genes encoding hexose transporters, is increased in the Cargt1 mutant in the absence of sugars, suggesting that CaRgt1 represses expression of several HGT genes under this condition. Some of the HGT genes (probably encoding high-affinity transporters) are also repressed by high levels of glucose, and we show that this repression is mediated by CaMig1, the orthologue of the major glucose-activated repressor in S. cerevisiae, but not by its paralogue CaMig2. Therefore, CaRgt1 and CaMig1 collaborate to control expression of C. albicans hexose transporters in response to different levels of sugars. We were surprised to find that CaRgt1 also regulates expression of GAL1, suggesting that regulation of galactose metabolism in C. albicans is unconventional. Finally, Cargt1 mutations cause cells to hyperfilament, and suppress the hypofilamented phenotype of an hgt4 mutant, indicating that the Hgt4 glucose sensor may affect filamentation by modulating sugar import and metabolism via CaRgt1. Copyright 2007 John Wiley & Sons, Ltd.
-
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
-
Functional Analysis of the Lactobacillus casei BL23 Sortases
Muñoz-Provencio, Diego; Rodríguez-Díaz, Jesús; Collado, María Carmen; Langella, Philippe; Bermúdez-Humarán, Luis G.
2012-01-01
Sortases are a class of enzymes that anchor surface proteins to the cell wall of Gram-positive bacteria. Lactobacillus casei BL23 harbors four sortase genes, two belonging to class A (srtA1 and srtA2) and two belonging to class C (srtC1 and srtC2). Class C sortases were clustered with genes encoding their putative substrates that were homologous to the SpaEFG and SpaCBA proteins that encode mucus adhesive pili in Lactobacillus rhamnosus GG. Twenty-three genes encoding putative sortase substrates were identified in the L. casei BL23 genome with unknown (35%), enzymatic (30%), or adhesion-related (35%) functions. Strains disrupted in srtA1, srtA2, srtC1, and srtC2 and an srtA1 srtA2 double mutant were constructed. The transcription of all four sortase encoding genes was detected, but only the mutation of srtA1 resulted in a decrease in bacterial surface hydrophobicity. The β-N-acetyl-glucosaminidase and cell wall proteinase activities of whole cells diminished in the srtA1 mutant and, to a greater extent, in the srtA1 srtA2 double mutant. Cell wall anchoring of the staphylococcal NucA reporter protein fused to a cell wall sorting sequence was also affected in the srtA mutants, and the percentages of adhesion to Caco-2 and HT-29 intestinal epithelial cells were reduced for the srtA1 srtA2 strain. Mutations in srtC1 or srtC2 result in an undetectable phenotype. Together, these results suggest that SrtA1 is the housekeeping sortase in L. casei BL23 and SrtA2 would carry out redundant or complementary functions that become evident when SrtA1 activity is absent. PMID:23042174
-
Serino, G; Tsuge, T; Kwok, S; Matsui, M; Wei, N; Deng, X W
1999-01-01
The pleiotropic constitutive photomorphogenic/deetiolated/fusca (cop/det/fus) mutants of Arabidopsis exhibit features of light-grown seedlings when grown in the dark. Cloning and biochemical analysis of COP9 have revealed that it is a component of a multiprotein complex, the COP9 signalosome (previously known as the COP9 complex). Here, we compare the immunoaffinity and the biochemical purification of the COP9 signalosome from cauliflower and confirm its eight-subunit composition. Molecular cloning of subunit 4 of the complex revealed that it is a proteasome-COP9 complex-eIF3 domain protein encoded by a gene that maps to chromosome 5, near the chromosomal location of the cop8 and fus4 mutations. Genetic complementation tests showed that the cop8 and fus4 mutations define the same locus, now designated as COP8. Molecular analysis of the subunit 4-encoding gene in both cop8 and fus4 mutants identified specific molecular lesions, and overexpression of the subunit 4 cDNA in a cop8 mutant background resulted in complete rescue of the mutant phenotype. Thus, we conclude that COP8 encodes subunit 4 of the COP9 signalosome. Examination of possible molecular interactions by using the yeast two-hybrid assay indicated that COP8 is capable of strong self-association as well as interaction with COP9, FUS6/COP11, FUS5, and Arabidopsis JAB1 homolog 1, the latter four proteins being previously defined subunits of the Arabidopsis COP9 signalosome. A comparative sequence analysis indicated that COP8 is highly conserved among multicellular eukaryotes and is also similar to a subunit of the 19S regulatory particle of the 26S proteasome. PMID:10521526
-
Liu, Yanhong; Yoo, Brian B.; Hwang, Cheng-An; Suo, Yujuan; Sheen, Shiowshuh; Khosravi, Parvaneh; Huang, Lihan
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes listeriosis, which is a major public health concern due to the high fatality rate. LMOf2365_0442, 0443, and 0444 encode for fructose-specific EIIABC components of phosphotransferase transport system (PTS) permease that is responsible for sugar transport. In previous studies, in-frame deletion mutants of a putative fructose-specific PTS permease (LMOf2365_0442, 0443, and 0444) were constructed and analyzed. However, the virulence potential of these deletion mutants has not been studied. In this study, two in vitro methods were used to analyze the virulence potential of these L. monocytogenes deletion mutants. First, invasion assays were used to measure the invasion efficiencies to host cells using the human HT-29 cell line. Second, plaque forming assays were used to measure cell-to-cell spread in host cells. Our results showed that the deletion mutant ΔLMOf2365_0442 had reduced invasion and cell-to-cell spread efficiencies in human cell line compared to the parental strain LMOf2365, indicating that LMOf2365_0442 encoding for a fructose specific PTS permease IIA may be required for virulence in L. monocytogenes strain F2365. In addition, the gene expression levels of 15 virulence and stress-related genes were analyzed in the stationary phase cells of the deletion mutants using RT-PCR assays. Virulence-related gene expression levels were elevated in the deletion mutants ΔLMOf2365_0442-0444 compared to the wild type parental strain LMOf2365, indicating the down-regulation of virulence genes by this PTS permease in L. monocytogenes. Finally, stress-related gene clpC expression levels were also increased in all of the deletion mutants, suggesting the involvement of this PTS permease in stress response. Furthermore, these deletion mutants displayed the same pressure tolerance and the same capacity for biofilm formation compared to the wild-type parental strain LMOf2365. In summary, our findings suggest that the LMOf2365_0442 gene can be used as a potential target to develop inhibitors for new therapeutic and pathogen control strategies for public health. PMID:28900418
-
Cloning and sequence analysis of the LEU2 homologue gene from Pichia anomala.
De la Rosa, J M; Pérez, J A; Gutiérrez, F; González, J M; Ruiz, T; Rodríguez, L
2001-11-01
The Pichia anomala LEU2 gene (PaLEU2) was isolated by complementation of a leu2 Saccharomyces cerevisiae mutant. The cloned gene also allowed growth of a Escherichia coli leuB mutant in leucine-lacking medium, indicating that it encodes a product able to complement the beta-isopropylmalate dehydrogenase deficiency of the mutants. The sequenced DNA fragment contains a complete ORF of 1092 bp, and the deduced polypeptide shares significant homologies with the products of the LEU2 genes from S. cerevisiae (84% identity) and other yeast species. A sequence resembling the GC-rich palindrome motif identified in the 5' region of S. cerevisiae LEU2 gene as the binding site for the transcription activating factor encoded by the LEU3 gene was found at the promoter region. In addition, upstream of the PaLEU2 the 3'-terminal half of a gene of the same orientation, encoding a homologue of the S. cerevisiae NFS1/SPL1 gene that encodes a mitochondrial cysteine desulphurase involved in both tRNA processing and mitochondrial metabolism, was found. The genomic organization of the PaNFS1-PaLEU2 gene pair is similar to that found in several other yeast species, including S. cerevisiae and Candida albicans, except that in some of them the LEU2 gene appears in the reverse orientation. Copyright 2001 John Wiley & Sons, Ltd.
-
Wiedemann, Gertrud; Hermsen, Corinna; Melzer, Michael; Büttner-Mainik, Annette; Rennenberg, Heinz; Reski, Ralf; Kopriva, Stanislav
2010-06-03
A key step in sulfate assimilation into cysteine is the reduction of sulfite to sulfide by sulfite reductase (SiR). This enzyme is encoded by three genes in the moss Physcomitrella patens. To obtain a first insight into the roles of the individual isoforms, we deleted the gene encoding the SiR1 isoform in P. patens by homologous recombination and subsequently analysed the DeltaSiR1 mutants. While DeltaSiR1 mutants showed no obvious alteration in sulfur metabolism, their regeneration from protoplasts and their ability to produce mature spores was significantly affected, highlighting an unexpected link between moss sulfate assimilation and development, that is yet to be characterized. Copyright 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
-
Castañeda-Arriaga, Romina; Alvarez-Idaboy, J Raul
2014-06-23
The free radical scavenging activity of lipoic acid (LA) and dihydrolipoic acid (DHLA) has been studied in nonpolar and aqueous solutions, using the density functional theory and several oxygen centered radicals. It was found that lipoic acid is capable of scavenging only very reactive radicals, while the dehydrogenated form is an excellent scavenger via a hydrogen transfer mechanism. The environment plays an important role in the free radical scavenging activity of DHLA because in water it is deprotonated, and this enhances its activity. In particular, the reaction rate constant of DHLA in water with an HOO(•) radical is close to the diffusion limit. This has been explained on the basis of the strong H-bonding interactions found in the transition state, which involve the carboxylate moiety, and it might have implications for other biological systems in which this group is present.
-
Guo, Jun; Gao, Shixing; Liu, Zhiqing; Zhao, Ruqian; Yang, Xiaojing
2016-10-01
Recently, white adipose tissue has been shown to exhibit immunological activity, and may play an important role in host defense and protection against bacterial infection. Αlpha-lipoic acid (α-LA) has been demonstrated to function as an anti-inflammatory and anti-oxidant agent. However, its influence on the inflammatory response and metabolic changes in white adipose tissue remains unknown. We used male C57BL/6 mice as models to study the effect of α-LA on the inflammatory response and metabolic changes in white adipose tissue after stimulation with lipopolysaccharide (LPS). The non-esterified fatty acid content was measured by an automatic biochemical analyzer. The expression of inflammation-, lipid- and energy metabolism-related genes and proteins was determined by quantitative real-time polymerase chain reaction and western blotting. The results indicated that α-LA significantly decreased the epididymis fat weight index and the non-esterified fatty acid content in plasma compared with the control group. LPS significantly increased the expression of inflammation genes and α-LA reduced their expression. The LPS-induced expression of nuclear factor-κB protein was decreased by α-LA. Regarding lipid metabolism, α-LA significantly counteracted the inhibitory effects of LPS on the expression of hormone-sensitive lipase gene and protein. α-LA evidently increased the gene expression of fatty acid transport protein 1 and cluster of differentiation 36. Regarding energy metabolism, α-LA significantly increased the expression of most of mitochondrial DNA-encoded genes compared with the control and LPS group. Accordingly, α-LA can alleviate acute inflammatory response and this action may be related with the promotion of lipid mobilization in white adipose tissue.
-
Structure-Function Analysis of Chloroplast Proteins via Random Mutagenesis Using Error-Prone PCR.
Dumas, Louis; Zito, Francesca; Auroy, Pascaline; Johnson, Xenie; Peltier, Gilles; Alric, Jean
2018-06-01
Site-directed mutagenesis of chloroplast genes was developed three decades ago and has greatly advanced the field of photosynthesis research. Here, we describe a new approach for generating random chloroplast gene mutants that combines error-prone polymerase chain reaction of a gene of interest with chloroplast complementation of the knockout Chlamydomonas reinhardtii mutant. As a proof of concept, we targeted a 300-bp sequence of the petD gene that encodes subunit IV of the thylakoid membrane-bound cytochrome b 6 f complex. By sequencing chloroplast transformants, we revealed 149 mutations in the 300-bp target petD sequence that resulted in 92 amino acid substitutions in the 100-residue target subunit IV sequence. Our results show that this method is suited to the study of highly hydrophobic, multisubunit, and chloroplast-encoded proteins containing cofactors such as hemes, iron-sulfur clusters, and chlorophyll pigments. Moreover, we show that mutant screening and sequencing can be used to study photosynthetic mechanisms or to probe the mutational robustness of chloroplast-encoded proteins, and we propose that this method is a valuable tool for the directed evolution of enzymes in the chloroplast. © 2018 American Society of Plant Biologists. All rights reserved.
-
Rice ABERRANT PANICLE ORGANIZATION 1, encoding an F-box protein, regulates meristem fate.
Ikeda, Kyoko; Ito, Momoyo; Nagasawa, Nobuhiro; Kyozuka, Junko; Nagato, Yasuo
2007-09-01
Inflorescence architecture is one of the most important agronomical traits. Characterization of rice aberrant panicle organization 1 (apo1) mutants revealed that APO1 positively controls spikelet number by suppressing the precocious conversion of inflorescence meristems to spikelet meristems. In addition, APO1 is associated with the regulation of the plastchron, floral organ identity, and floral determinacy. Phenotypic analyses of apo1 and floral homeotic double mutants demonstrate that APO1 positively regulates class-C floral homeotic genes, but not class-B genes. Molecular studies revealed that APO1 encodes an F-box protein, an ortholog of Arabidopsis UNUSUAL FLORAL ORGAN (UFO), which is a positive regulator of class-B genes. Overexpression of APO1 caused an increase in inflorescence branches and spikelets. As the mutant inflorescences and flowers differed considerably between apo1 and ufo, the functions of APO1 and UFO appear to have diverged during evolution.
-
Zhou, Mingxu; Guo, Zhiyan; Yang, Yang; Duan, Qiangde; Zhang, Qi; Yao, Fenghua; Zhu, Jun; Zhang, Xinjun; Hardwidge, Philip R; Zhu, Guoqiang
2014-01-10
Bacteria that form biofilms are often highly resistant to antibiotics and are capable of evading the host immune system. To evaluate the role of flagellin and F4 fimbriae on biofilm formation by enterotoxigenic Escherichia coli (ETEC), we deleted the fliC (encoding the major flagellin protein) and/or the faeG (encoding the major subunit of F4 fimbriae) genes from ETEC C83902. Biofilm formation was reduced in the fliC mutant but increased in the faeG mutant, as compared with the wild-type strain. The expression of AI-2 quorum sensing associated genes was regulated in the fliC and faeG mutants, consistent with the biofilm formation of these strains. But, deleting fliC and/or faeG also inhibited AI-2 quorum sensing activity. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Kim, In Seon; Yang, Si Young; Park, Seur Kee; Kim, Young Cheol
2017-01-01
Chromobacterium sp. strain C61 has strong biocontrol activity; however, the genetic and biochemical determinants of its plant disease suppression activity are not well understood. Here, we report the identification and characterization of two new determinants of its biocontrol activity. Transposon mutagenesis was used to identify mutants that were deficient in fungal suppression. One of these mutants had an insertion in a homologue of depD, a structural gene in the dep operon, that encodes a protein involved in non-ribosomal peptide synthesis. In the second mutant, the insertion was in a homologue of the luxI gene, which encodes a homoserine lactone synthase. The luxI - and depD - mutants had no antifungal activity in vitro and a dramatically reduced capacity to suppress various plant diseases in planta. Antifungal production and biocontrol were restored by complementation of the luxI - mutant. Other phenotypes associated with effective biological control, including motility and lytic enzyme secretion, were also affected by the luxI mutation. Biochemical analysis of ethyl acetate extracts of culture filtrates of the mutant and wild-type strains showed that a key antifungal compound, chromobactomycin, was produced by wild-type C61 and the complemented luxI - mutant, but not by the luxI - or depD - mutant. These data suggest that multiple biocontrol-related phenotypes are regulated by homoserine lactones in C61. Thus, quorum sensing plays an essential role in the biological control potential of diverse bacterial lineages. © 2016 BSPP and John Wiley & Sons Ltd.
-
PDF receptor signaling in Caenorhabditis elegans modulates locomotion and egg-laying.
Meelkop, Ellen; Temmerman, Liesbet; Janssen, Tom; Suetens, Nick; Beets, Isabel; Van Rompay, Liesbeth; Shanmugam, Nilesh; Husson, Steven J; Schoofs, Liliane
2012-09-25
In Caenorhabditis elegans, pdfr-1 encodes three receptors of the secretin receptor family. These G protein-coupled receptors are activated by three neuropeptides, pigment dispersing factors 1a, 1b and 2, which are encoded by pdf-1 and pdf-2. We isolated a PDF receptor loss-of-function allele (lst34) by means of a mutagenesis screen and show that the PDF signaling system is involved in locomotion and egg-laying. We demonstrate that the pdfr-1 mutant phenocopies the defective locomotor behavior of the pdf-1 mutant and that pdf-1 and pdf-2 behave antagonistically. All three PDF receptor splice variants are involved in the regulation of locomotor behavior. Cell specific rescue experiments show that this pdf mediated behavior is regulated by neurons rather than body wall muscles. We also show that egg-laying patterns of pdf-1 and pdf-2 mutants are affected, but not those of pdfr-1 mutants, pointing to a novel role for the PDF-system in the regulation of egg-laying. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
-
Kato, Takehide; Morita, Miyo Terao; Fukaki, Hidehiro; Yamauchi, Yoshiro; Uehara, Michiko; Niihama, Mitsuru; Tasaka, Masao
2002-01-01
In higher plants, the shoot and the root generally show negative and positive gravitropism, respectively. To elucidate the molecular mechanisms involved in gravitropism, we have isolated many shoot gravitropism mutants in Arabidopsis. The sgr2 and zig/sgr4 mutants exhibited abnormal gravitropism in both inflorescence stems and hypocotyls. These genes probably are involved in the early step(s) of the gravitropic response. The sgr2 mutants also had misshapen seed and seedlings, whereas the stem of the zig/sgr4 mutants elongated in a zigzag fashion. The SGR2 gene encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid–preferring phospholipase A1 containing a putative transmembrane domain. This gene family has been reported only in eukaryotes. The ZIG gene was found to encode AtVTI11, a protein that is homologous with yeast VTI1 and is involved in vesicle transport. Our observations suggest that the two genes may be involved in a vacuolar membrane system that affects shoot gravitropism. PMID:11826297
-
Adewoye, L O; Worobec, E A
2000-08-08
The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.
-
Menanteau-Ledouble, Simon; Lawrence, Mark L
2013-03-23
Initial invasion of the host is the first and vital part of any infection process. We have demonstrated that Edwardsiella ictaluri is capable of colonizing and penetrating catfish skin. Therefore, a mutant library was constructed by random insertion of the Mar2xT7 transposon into the chromosome of E. ictaluri harboring the bioluminescence plasmid pAKgfplux1. This library was then screened through a series of three consecutive challenges for mutants showing a decreased ability to colonize the catfish epithelium. Eighteen mutants were identified that have decreased adhesion and virulence. Mutated genes encoded one sensor protein, two transport proteins, five enzymes, two regulatory proteins, and five hypothetical proteins. Among the mutated genes, the first one identified was a gene encoding for RstA/B, which is known to play a role in regulating the expression of invasion genes in Salmonella enterica Typhimurium. Another mutant was lacking a putative ribonuclease similar to a Shigella protein that regulates the expression of adhesin. A third mutant was defective in a protein similar to a Brucella protein that was initially identified as a transporter, but actually is a member of a newly discovered adhesin family. Results from this study could enable development of a new strategy for blocking E. ictaluri invasion at the initial adherence stage. Copyright © 2012 Elsevier B.V. All rights reserved.
-
Biodegradation of the Organic Disulfide 4,4′-Dithiodibutyric Acid by Rhodococcus spp.
Khairy, Heba; Wübbeler, Jan Hendrik
2015-01-01
Four Rhodococcus spp. exhibited the ability to use 4,4′-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). PMID:26407888
-
2005-09-01
precursor cells in culture with uX-lipoic acid reverses the density dependent changes observed in culture; this compound may provide an effective means...inhibited growth of precursor cells in vitro; - Antioxidant treatment of neural precursor cells in culture with a-lipoic acid (ALA) reverses the...with a single lO-Gy dose, and tissues avidin-biotinylated pemxidase complex; GFAP, glial fibrillary acidic protein; DAB, 3,3’- were collected from 6 to
-
Volchegorskiĭ, I A; Rassokhina, L M; Miroshnichenko, I Iu
2011-01-01
Relationship between the antihypoxic effect of 3-hydroxypyridine and succinic acid derivatives (emoxipine, reamberin and mexidol) and their effect on conditional learning, glycemia, and lipidemia was studied in rats with alloxan-induced diabetes. In parallel, the analogous relationship was investigated for alpha-lipoic acid that is regarded as a "gold standard" in treatment of diabetic neuropathy. It was established that single administration of emoxipine and mexidol in mice in doses equivalent to therapeutic-range doses in humans produces antihypoxic effect manifested by increased resistance to acute hypoxic hypoxia in test animals. Alpha-lipoic acid is inferior to emoxipin and mexidol in the degree of antihypoxic action. Reamberin does not exhibit this effect. The introduction of emoxipin, reamberin, mexidol, and alpha-lipoic acid in rats with alloxan diabetes during 7 or 14 days in doses equivalent to therapeutic-range doses in humans corrects conditional learning disorders in direct relationship with the antihypoxic activity of these drugs. The development of the nootropic effect of emoxipin, mexidol, and alpha-lipoic acid is related to a decrease in hyperglycemia and hyperlipidemia in rats with alloxan diabetes. The nootropic action of reamberin is accompanied by a transient hypoglycemizing effect and aggravation of dyslipidemic disorders. The antihypoxic activity of investigated drugs determines the direction and expression of their lipidemic effect, but is not correlated with the hypoglycemizing action these drugs on test animals with alloxan diabetes.
-
Assembly of citrate gold nanoparticles on hydrophilic monolayers
NASA Astrophysics Data System (ADS)
Vikholm-Lundin, Inger; Rosqvist, Emil; Ihalainen, Petri; Munter, Tony; Honkimaa, Anni; Marjomäki, Varpu; Albers, Willem M.; Peltonen, Jouko
2016-08-01
Self-assembled monolayers (SAMs) as model surfaces were linked onto planar gold films thorough lipoic acid or disulfide groups. The molecules used were polyethylene glycol (EG-S-S), N-[tris-(hydroxymethyl)methyl]acrylamide polymers with and without lipoic acid (Lipa-pTHMMAA and pTHMMAA) and a lipoic acid triazine derivative (Lipa-MF). All the layers, but Lipa-MF with a primary amino group were hydroxyl terminated. The layers were characterized by contact angle measurements and atomic force microscopy, AFM. Citrate stabilized nanoparticles, AuNPs in water and phosphate buffer were allowed to assemble on the layers for 10 min and the binding was followed in real-time with surface plasmon resonance, SPR. The SPR resonance curves were observed to shift to higher angles and become increasingly damped, while also the peaks strongly broaden when large nanoparticles assembled on the surface. Both the angular shift and the damping of the curve was largest for nanoparticles assembling on the EG-S-S monolayer. High amounts of particles were also assembled on the pTHMMAA layer without the lipoic acid group, but the damping of the curve was considerably lower with a more even distribution of the particles. Topographical images confirmed that the highest number of particles were assembled on the polyethylene glycol monolayer. By increasing the interaction time more particles could be assembled on the surface.
-
A Novel Amidotransferase Required for Lipoic Acid Cofactor Assembly in Bacillus subtilis
Christensen, Quin H.; Martin, Natalia; Mansilla, Maria C.; de Mendoza, Diego; Cronan, John E.
2011-01-01
SUMMARY In the companion paper (Martin et al., 2011) we reported that Bacillus subtilis requires three proteins for lipoic acid metabolism, all of which are members of the lipoate protein ligase family. Two of the proteins, LipM and LplJ, have been shown to be an octanoyltransferase and a lipoate:protein ligase, respectively. The third protein, LipL, is essential for lipoic acid synthesis, but had no detectable octanoyltransferase or ligase activity either in vitro or in vivo. We report that LipM specifically modifies the glycine cleavage system protein, GcvH, and therefore another mechanism must exist for modification of other lipoic acid requiring enzymes (e.g., pyruvate dehydrogenase). We show that this function is provided by LipL which catalyzes the amidotransfer (transamidation) of the octanoyl moiety from octanoyl-GcvH to the E2 subunit of pyruvate dehydrogenase. LipL activity was demonstrated in vitro with purified components and proceeds via a thioester-linked acyl-enzyme intermediate. As predicted, ΔgcvH strains are lipoate auxotrophs. LipL represents a new enzyme activity. It is a GcvH:[lipoyl domain] amidotransferase that probably employs a Cys-Lys catalytic dyad. Although the active site cysteine residues of LipL and LipB are located in different positions within the polypeptide chains, alignment of their structures show these residues occupy similar positions. Thus, these two homologous enzymes have convergent architectures. PMID:21338421
-
Soylu Karapinar, Oya; Pinar, Neslihan; Özcan, Oğuzhan; Özgür, Tümay; Dolapçıoğlu, Kenan
2017-08-01
To determine whether the possible oxidative effect of methotrexate (Mtx) on ovary and to evaluate the effectiveness of alpha lipoic acid (ALA), which may be useful in many oxidative stress models. Thirty-two female Wistar-albino rats were randomly divided into four groups; control group, alpha lipoic acid group (ALA 100 mg/kg, 10 days), multiple dose Mtx group (Mtx 1 mg/kg 1, 3, 5, 7 days) and Mtx and ALA group (Mtx 1 mg/kg 1, 3, 5, 7 days and ALA 100 mg/kg, 10 days). Serum total antioxidant status (TAS), total oxidant status (TOS) and oxidative stress index (OSI), tumor necrosis factor-alpha (TNF-α), tissue malondialdehyde (MDA) and activities of glutathione peroxidase (GSH-Px) and catalase (CAT) and anti-Mullerian hormone (AMH) and total ovarian follicle count were evaluated. Mtx administration caused a significant decrease in TAS, a significant increase in TOS and OSI, a significant increase in MDA levels and a decrease in GSH-Px and CAT activity. Moreover the proinflammatory cytokine (TNF-α) was increased in the Mtx group. And AMH values and total follicle count were significantly decreased in Mtx group. However, ALA treatment reversed biochemical results and AMH levels and total follicle count. Alpha lipoic acid ameliorates methotrexate induced oxidative damage of ovarian in rats.
-
Kucukgoncu, S; Zhou, E; Lucas, K B; Tek, C
2017-05-01
Obesity is associated with significant morbidity and mortality rates. Even modest weight loss may be associated with health benefits. Alpha-lipoic acid (ALA) is a naturally occurring antioxidant. Studies have suggested anti-obesity properties of ALA; however, results are inconsistent. The purpose of this study is to conduct a meta-analysis of the effect of ALA on weight and body mass index (BMI). A comprehensive, systematic literature search identified 10 articles on randomized, double-blind, placebo-controlled studies involving ALA. We conducted a meta-analysis of mean weight and BMI change differences between ALA and placebo treatment groups. Alpha-lipoic acid treatment coincided with a statistically significant 1.27 kg (confidence interval = 0.25 to 2.29) greater mean weight loss compared with the placebo group. A significant overall mean BMI difference of -0.43 kg/ m 2 (confidence interval = -0.82 to -0.03) was found between the ALA and placebo groups. Meta-regression analysis showed no significance in ALA dose on BMI and weight changes. Study duration significantly affected BMI change, but not weight change. Alpha-lipoic acid treatment showed small, yet significant short-term weight loss compared with placebo. Further research is needed to examine the effect of different doses and the long-term benefits of ALA on weight management. © 2017 World Obesity Federation.
-
Ziegler, Dan; Low, Phillip A; Freeman, Roy; Tritschler, Hans; Vinik, Aaron I
2016-03-01
We aimed to analyze the impact of baseline factors on the efficacy of α-lipoic acid (ALA) over 4 years in the NATHAN 1 trial. This was a post-hoc analysis of the NATHAN 1 trial, a 4-year randomized study including 460 diabetic patients with mild-to-moderate polyneuropathy using ALA 600 mg qd or placebo. Amongst others, efficacy measures were the Neuropathy Impairment Score of the lower limbs (NIS-LL) and heart rate during deep breathing (HRDB). Improvement and prevention of progression of NIS-LL (ΔNIS-LL≥2 points) with ALA vs. placebo after 4 years was predicted by higher age, lower BMI, male sex, normal blood pressure, history of cardiovascular disease (CVD), insulin treatment, longer duration of diabetes and neuropathy, and higher neuropathy stage. Participants treated with ALA who received ACE inhibitors showed a better outcome in HRDB after 4 years. Better outcome in neuropathic impairments following 4-year treatment with α-lipoic acid was predicted by normal BMI and blood pressure and higher burden due to CVD, diabetes, and neuropathy, while improvement in cardiac autonomic function was predicted by ACE inhibitor treatment. Thus, optimal control of CVD risk factors could contribute to improved efficacy of α-lipoic acid in patients with higher disease burden. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Yorek, Matthew S.; Obrosov, Alexander; Shevalye, Hanna; Coppey, Lawrence J.; Kardon, Randy H.; Yorek, Mark A.
2017-01-01
We have previously demonstrated that enalapril, α-lipoic acid and menhaden (fish) oil has potential as a treatment for diabetic peripheral neuropathy. In this study we sought to determine the efficacy of these treatments individually or in combination on multiple neuropathic endpoints in a high fat fed low dose streptozotocin treated mouse, a model of type 2 diabetes, following early or late intervention. Four or twelve weeks after the onset of hyperglycemia, diabetic mice were treated with enalapril, α-lipoic acid, menhaden oil or their combination for 12 weeks. Afterwards, endpoints including glucose tolerance, motor and sensory nerve conduction velocity, thermal nociception, and intraepidermal and cornea nerve fiber density was determined. Glucose clearance was impaired in diabetic mice and significantly improved only with combination treatment and early intervention. Diabetes caused steatosis, slowing of motor and sensory nerve conduction velocity, thermal hypoalgesia and reduction in intraepidermal and cornea nerve fiber density. Treating diabetic mice with enalapril, α-lipoic acid or menhaden oil partially protected diabetic mice from these deficits, whereas the combination of these three treatments was more efficacious following early or late intervention. These studies suggest that a combination therapy may be more effective for treating neural complications of type 2 diabetes. PMID:28025096
-
Sudheesh, N P; Ajith, T A; Janardhanan, K K; Krishnan, C V
2009-08-01
Age-related decline in the capacity to withstand stress, such as ischemia and reperfusion, results in congestive heart failure. Though the mechanisms underlying cardiac decay are not clear, age dependent somatic damages to mitochondrial DNA (mtDNA), loss of mitochondrial function, and a resultant increase in oxidative stress in heart muscle cells may be responsible for the increased risk for cardiovascular diseases. The effect of a safe nutritional supplement, POLY-MVA, containing the active ingredient palladium alpha-lipoic acid complex, was evaluated on the activities of the Krebs cycle enzymes such as isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, and malate dehydrogenase as well as mitochondrial complexes I, II, III, and IV in heart mitochondria of aged male albino rats of Wistar strain. Administration of 0.05 ml/kg of POLY-MVA (which is equivalent to 0.38 mg complexed alpha-lipoic acid/kg, p.o), once daily for 30 days, was significantly (p<0.05) effective to enhance the Krebs cycle dehydrogenases, and mitochondrial electron transport chain complexes. The unique electronic and redox properties of palladium alpha-lipoic acid complex appear to be a key to this physiological effectiveness. The results strongly suggest that this formulation might be effective to protect the aging associated risk of cardiovascular and neurodegenerative diseases.
-
Yorek, Matthew S; Obrosov, Alexander; Shevalye, Hanna; Coppey, Lawrence J; Kardon, Randy H; Yorek, Mark A
2017-04-01
We have previously demonstrated that enalapril, α-lipoic acid and menhaden (fish) oil has potential as a treatment for diabetic peripheral neuropathy. In this study we sought to determine the efficacy of these treatments individually or in combination on multiple neuropathic endpoints in a high fat fed low dose streptozotocin treated mouse, a model of type 2 diabetes, following early or late intervention. Four or twelve weeks after the onset of hyperglycemia, diabetic mice were treated with enalapril, α-lipoic acid, menhaden oil or their combination for 12 weeks. Afterwards, endpoints including glucose tolerance, motor and sensory nerve conduction velocity, thermal nociception, and intraepidermal and cornea nerve fiber density was determined. Glucose clearance was impaired in diabetic mice and significantly improved only with combination treatment and early intervention. Diabetes caused steatosis, slowing of motor and sensory nerve conduction velocity, thermal hypoalgesia and reduction in intraepidermal and cornea nerve fiber density. Treating diabetic mice with enalapril, α-lipoic acid or menhaden oil partially protected diabetic mice from these deficits, whereas the combination of these three treatments was more efficacious following early or late intervention. These studies suggest that a combination therapy may be more effective for treating neural complications of type 2 diabetes. Published by Elsevier Ltd.
-
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E; Thwai, Kyaw L; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O
2015-06-15
The A581 G: mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased placental inflammation and decreased infant birth weight among women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) during pregnancy. Between 2009 and 2011, delivering women without human immunodeficiency virus infection were enrolled in an observational study of IPTp-SP effectiveness in Malawi. Parasites were detected by polymerase chain reaction (PCR); positive samples were sequenced to genotype the dhfr and dhps loci. The presence of K540 E: in dhps was used as a marker for the quintuple mutant. Samples from 1809 women were analyzed by PCR; 220 (12%) were positive for P. falciparum. A total of 202 specimens were genotyped at codon 581 of dhps; 17 (8.4%) harbored the sextuple mutant. The sextuple mutant was associated with higher risks of patent infection in peripheral blood (adjusted prevalence ratio [aPR], 2.76; 95% confidence interval [CI], 1.82-4.18) and placental blood (aPR 3.28; 95% CI, 1.88-5.78) and higher parasite densities. Recent SP use was not associated with increased parasite densities or placental pathology overall and among women with parasites carrying dhps A581 G: . IPTp-SP failed to inhibit parasite growth but did not exacerbate pathology among women infected with sextuple-mutant parasites. New interventions to prevent malaria during pregnancy are needed urgently. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
-
Barendt, Skye M.; Sham, Lok-To; Winkler, Malcolm E.
2011-01-01
Peptidoglycan (PG) hydrolases play critical roles in the remodeling of bacterial cell walls during division. PG hydrolases have been studied extensively in several bacillus species, such as Escherichia coli and Bacillus subtilis, but remain relatively uncharacterized in ovococcus species, such as Streptococcus pneumoniae (pneumococcus). In this work, we identified genes that encode proteins with putative PG hydrolytic domains in the genome of S. pneumoniae strain D39. Knockout mutations in these genes were constructed, and the resulting mutants were characterized in comparison with the parent strain for growth, cell morphology, PG peptide incorporation, and in some cases, PG peptide composition. In addition, we characterized deletion mutations in nonessential genes of unknown function in the WalRKSpn two-component system regulon, which also contains the essential pcsB cell division gene. Several mutants did not show overt phenotypes, which is perhaps indicative of redundancy. In contrast, two new mutants showed distinct defects in PG biosynthesis. One mutation was in a gene designated dacB (spd_0549), which we showed encodes an l,d-carboxypeptidase involved in PG maturation. Notably, dacB mutants, similar to dacA (d,d-carboxypeptidase) mutants, exhibited defects in cell shape and septation, consistent with the idea that the availability of PG peptide precursors is important for proper PG biosynthesis. Epistasis analysis indicated that DacA functions before DacB in d-Ala removal, and immunofluorescence microscopy showed that DacA and DacB are located over the entire surface of pneumococcal cells. The other mutation was in WalRKSpn regulon gene spd_0703, which encodes a putative membrane protein that may function as a type of conserved streptococcal shape, elongation, division, and sporulation (SEDS) protein. PMID:21378199
-
Lee, Kwanuk; Lee, Hwa Jung; Kim, Dong Hyun; Jeon, Young; Pai, Hyun-Sook; Kang, Hunseung
2014-04-16
Although several chloroplast RNA splicing and ribosome maturation (CRM) domain-containing proteins have been characterized for intron splicing and rRNA processing during chloroplast gene expression, the functional role of a majority of CRM domain proteins in plant growth and development as well as chloroplast RNA metabolism remains largely unknown. Here, we characterized the developmental and stress response roles of a nuclear-encoded chloroplast protein harboring a single CRM domain (At4g39040), designated CFM4, in Arabidopsis thaliana. Analysis of CFM4-GFP fusion proteins revealed that CFM4 is localized to chloroplasts. The loss-of-function T-DNA insertion mutants for CFM4 (cfm4) displayed retarded growth and delayed senescence, suggesting that CFM4 plays a role in growth and development of plants under normal growth conditions. In addition, cfm4 mutants showed retarded seed germination and seedling growth under stress conditions. No alteration in the splicing patterns of intron-containing chloroplast genes was observed in the mutant plants, but the processing of 16S and 4.5S rRNAs was abnormal in the mutant plants. Importantly, CFM4 was determined to possess RNA chaperone activity. These results suggest that the chloroplast-targeted CFM4, one of two Arabidopsis genes encoding a single CRM domain-containing protein, harbors RNA chaperone activity and plays a role in the Arabidopsis growth and stress response by affecting rRNA processing in chloroplasts.
-
Export of extracellular polysaccharides modulates adherence of the Cyanobacterium synechocystis.
Fisher, Michael L; Allen, Rebecca; Luo, Yingqin; Curtiss, Roy
2013-01-01
The field of cyanobacterial biofuel production is advancing rapidly, yet we know little of the basic biology of these organisms outside of their photosynthetic pathways. We aimed to gain a greater understanding of how the cyanobacterium Synechocystis PCC 6803 (Synechocystis, hereafter) modulates its cell surface. Such understanding will allow for the creation of mutants that autoflocculate in a regulated way, thus avoiding energy intensive centrifugation in the creation of biofuels. We constructed mutant strains lacking genes predicted to function in carbohydrate transport or synthesis. Strains with gene deletions of slr0977 (predicted to encode a permease component of an ABC transporter), slr0982 (predicted to encode an ATP binding component of an ABC transporter) and slr1610 (predicted to encode a methyltransferase) demonstrated flocculent phenotypes and increased adherence to glass. Upon bioinformatic inspection, the gene products of slr0977, slr0982, and slr1610 appear to function in O-antigen (OAg) transport and synthesis. However, the analysis provided here demonstrated no differences between OAg purified from wild-type and mutants. However, exopolysaccharides (EPS) purified from mutants were altered in composition when compared to wild-type. Our data suggest that there are multiple means to modulate the cell surface of Synechocystis by disrupting different combinations of ABC transporters and/or glycosyl transferases. Further understanding of these mechanisms may allow for the development of industrially and ecologically useful strains of cyanobacteria. Additionally, these data imply that many cyanobacterial gene products may possess as-yet undiscovered functions, and are meritorious of further study.
-
2014-01-01
Background Although several chloroplast RNA splicing and ribosome maturation (CRM) domain-containing proteins have been characterized for intron splicing and rRNA processing during chloroplast gene expression, the functional role of a majority of CRM domain proteins in plant growth and development as well as chloroplast RNA metabolism remains largely unknown. Here, we characterized the developmental and stress response roles of a nuclear-encoded chloroplast protein harboring a single CRM domain (At4g39040), designated CFM4, in Arabidopsis thaliana. Results Analysis of CFM4-GFP fusion proteins revealed that CFM4 is localized to chloroplasts. The loss-of-function T-DNA insertion mutants for CFM4 (cfm4) displayed retarded growth and delayed senescence, suggesting that CFM4 plays a role in growth and development of plants under normal growth conditions. In addition, cfm4 mutants showed retarded seed germination and seedling growth under stress conditions. No alteration in the splicing patterns of intron-containing chloroplast genes was observed in the mutant plants, but the processing of 16S and 4.5S rRNAs was abnormal in the mutant plants. Importantly, CFM4 was determined to possess RNA chaperone activity. Conclusions These results suggest that the chloroplast-targeted CFM4, one of two Arabidopsis genes encoding a single CRM domain-containing protein, harbors RNA chaperone activity and plays a role in the Arabidopsis growth and stress response by affecting rRNA processing in chloroplasts. PMID:24739417
-
Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.
Kirkegaard, K; Nelsen, B
1990-01-01
Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811
-
Choe, Sunghwa; Schmitz, Robert J.; Fujioka, Shozo; Takatsuto, Suguru; Lee, Mi-Ok; Yoshida, Shigeo; Feldmann, Kenneth A.; Tax, Frans E.
2002-01-01
Mutants defective in the biosynthesis or signaling of brassinosteroids (BRs), plant steroid hormones, display dwarfism. Loss-of-function mutants for the gene encoding the plasma membrane-located BR receptor BRI1 are resistant to exogenous application of BRs, and characterization of this protein has contributed significantly to the understanding of BR signaling. We have isolated two new BR-insensitive mutants (dwarf12-1D and dwf12-2D) after screening Arabidopsis ethyl methanesulfonate mutant populations. dwf12 mutants displayed the characteristic morphology of previously reported BR dwarfs including short stature, short round leaves, infertility, and abnormal de-etiolation. In addition, dwf12 mutants exhibited several unique phenotypes, including severe downward curling of the leaves. Genetic analysis indicates that the two mutations are semidominant in that heterozygous plants show a semidwarf phenotype whose height is intermediate between wild-type and homozygous mutant plants. Unlike BR biosynthetic mutants, dwf12 plants were not rescued by high doses of exogenously applied BRs. Like bri1 mutants, dwf12 plants accumulated castasterone and brassinolide, 43- and 15-fold higher, respectively, providing further evidence that DWF12 is a component of the BR signaling pathway that includes BRI1. Map-based cloning of the DWF12 gene revealed that DWF12 belongs to a member of the glycogen synthase kinase 3β family. Unlike human glycogen synthase kinase 3β, DWF12 lacks the conserved serine-9 residue in the auto-inhibitory N terminus. In addition, dwf12-1D and dwf12-2D encode changes in consecutive glutamate residues in a highly conserved TREE domain. Together with previous reports that both bin2 and ucu1 mutants contain mutations in this TREE domain, this provides evidence that the TREE domain is of critical importance for proper function of DWF12/BIN2/UCU1 in BR signal transduction pathways. PMID:12428015
-
Hanoglu, Lutfu; Yildiz, Sultan; Polat, Burcu; Demirci, Sema; Tavli, Ahmet Mithat; Yilmaz, Nesrin; Yulug, Burak
2016-01-01
Charles Bonnet Syndrome (CBS) is a rare clinical condition which is characterized by complex hallucinations in visually impaired patients. The pathophysiology of this disorder remains largely unknown, and there is still no proven treatment for this disease. In our study, we aimed to investigate the neural activity through Electroencephalography (EEG) power and evaluate the effect of rivastigmine in combination with alpha-lipoic acid on hallucination in two CBS patients with diabetic retinopathy. EEG data was recorded with standard routine EEG protocols for both patients in our electrophysiological research laboratory (REMER Clinical Electrophysiology and Neuromodulation Research and Application Laboratory) with Brain Vision Recorder (Brainproduct, Munich, Germany). All spectral analyses were processed by BrainVision Analyzer 2 (Brainproduct, Munich, Germany, 2.0.4 Version) in 128 Hz sample rates and the EEG recording and analysis was performed before the administration of rivastigmine (4.5 mg/daily and five patch daily for the first and second patients, respectively) in combination with alpha-lipoic acid (600 mg/daily) for both patients while they were not hallucinated during the time period recordings. Based on our measurement protocol, we have compared the patients in the study group with the three control subjects who were found to be normal except of visual disturbances secondary to significant diabetic retinopathy. Highest theta power values were found in right occipital and left temporo-parietal regions for first and second CBS patients, respectively. Additionally, power spectra were lower in two cases as compared to their control groups in the alpha band for all electrodes. We have also shown that acid rivastigmine in combination with alpha-lipoic exerted significant anti-hallucinatory efficiency. Our present findings could support the hypothesis that increased activation of specific areas in the source monitoring system plays an important role in the pathogenesis of CBS. In addition, rivastigmine in combination with alpha-lipoic acid could be a new valuable option for CBS patients.
-
Deslauriers, J; Racine, W; Sarret, P; Grignon, S
2014-07-11
Some pathophysiological models of schizophrenia posit that prenatal inflammation sensitizes the developing brain to second insults in early life and enhances brain vulnerability, thereby increasing the risk of developing the disorder during adulthood. We previously developed a two-hit animal model, based on the well-established prenatal immune challenge with poly-inosinic/cytidylic acid (polyI:C), followed by juvenile restraint stress (RS). We observed an additive disruption of prepulse inhibition (PPI) of acoustic startle in juvenile mice submitted to both insults. Previous studies have also reported that oxidative stress is associated with pathophysiological mechanisms of psychiatric disorders, including schizophrenia. We report here that PPI disruption in our two-hit animal model of schizophrenia is associated with an increase in oxidative stress. These findings led us to assess whether α-lipoic acid, an antioxidant, can prevent both increase in oxidative status and PPI deficits in our juvenile in vivo model of schizophrenia. In the offspring submitted to prenatal injection of polyI:C and to RS, treatment with α-lipoic acid prevented the development of PPI deficits 24h after the last period of RS. α-Lipoic acid also improved PPI performance in control mice. The reversal effect of α-lipoic acid pretreatment on these behavioral alterations was further accompanied by a normalization of the associated oxidative status and dopaminergic and GABAergic abnormalities in the prefrontal cortex. Based on our double insult paradigm, these results support the hypothesis that oxidative stress plays an important role in the development of PPI deficits, a well-known behavior associated with schizophrenia. These findings form the basis of future studies aiming to unravel mechanistic insights of the putative role of antioxidants in the treatment of schizophrenia, especially during the prodromal stage. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.
-
Metabolic treatment of cancer: intermediate results of a prospective case series.
Schwartz, Laurent; Buhler, Ludivine; Icard, Philippe; Lincet, Hubert; Steyaert, Jean-Marc
2014-02-01
The combination of hydroxycitrate and lipoic acid has been demonstrated by several laboratories to be effective in reducing murine cancer growth. All patients had failed standard chemotherapy and were offered only palliative care by their referring oncologist. Karnofsky status was between 50 and 80. Life expectancy was estimated to be between 2 and 6 months. Ten consecutive patients with chemoresistant advanced metastatic cancer were offered compassionate metabolic treatment. They were treated with a combination of lipoic acid at 600 mg i.v. (Thioctacid), hydroxycitrate at 500 mg t.i.d. (Solgar) and low-dose naltrexone at 5 mg (Revia) at bedtime. Primary sites were lung carcinoma (n=2), colonic carcinoma (n=2), ovarian carcinoma (n=1), esophageal carcinoma (n=1), uterine sarcoma (n=1), cholangiocarcinoma (n=1), parotid carcinoma (n=1) and unknown primary (n=1). The patients had been heavily pre-treated. One patient had received four lines of chemotherapy, four patients three lines, four patients two lines and one patient had received radiation therapy and chemotherapy. An eleventh patient with advanced prostate cancer resistant to hormonotherapy treated with hydroxycitrate, lipoic acid and anti-androgen is also reported. One patient was unable to receive i.v. lipoic acid and was switched to oral lipoic acid (Tiobec). Toxicity was limited to transient nausea and vomiting. Two patients died of progressive disease within two months. Two other patients had to be switched to conventional chemotherapy combined with metabolic treatment, one of when had a subsequent dramatic tumor response. Disease in the other patients was either stable or very slowly progressive. The patient with hormone-resistant prostate cancer had a dramatic fall in Prostate-Specific Antigen (90%), which is still decreasing. These very primary results suggest the lack of toxicity and the probable efficacy of metabolic treatment in chemoresistant advanced carcinoma. It is also probable that metabolic treatment enhances the efficacy of cytotoxic chemotherapy. These results are in line with published animal data. A randomized clinical trial is warranted.
-
Zhang, Songyun; Li, Hongyan; Zhang, Lihui; Li, Jie; Wang, Ruiying; Wang, Mian
2017-02-15
Increasing evidence demonstrates an association between diabetes and hippocampal neuron damage. This study aimed to determine the effects of troxerutin on cognitive deficits and glutamate cysteine ligase subunits (GCLM and GCLC) in the hippocampus of streptozotocin-induced type 1 diabetes mellitus (T1DM) rats. At 12weeks after streptozotocin injection, T1DM rats were randomly divided into 4 groups (n=15 each group) to receive no treatment (T1DM), saline (T1DM+saline), alpha-lipoic acid (T1DM+alpha-lipoic acid), and troxerutin (T1DM+troxerutin), respectively, for 6weeks. Meanwhile, 10 control animals (NC group) were assessed in parallel. Learning performance was evaluated by the Morris water maze. After treatment, hippocampi were collected for pathological examination by hematoxylin and eosin (H&E) staining. Next, hippocampal superoxide dismutase (SOD) activity, and malondialdehyde (MDA) and glutathione (GSH) levels were assessed. Finally, glutamate cysteine ligase catalytic (GCLC) and glutamate cysteine ligase modifier (GCLM) subunit mRNA and protein levels were quantified by reverse transcription polymerase chain reaction (RT-PCR) and Western blot, respectively. Compared with T1DM and T1DM+saline groups, escape latency was overtly reduced in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. Significantly increased GCLM and GCLC mRNA levels, GCLC protein amounts, SOD activity, and GSH levels, and reduced MDA amounts were observed in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. In T1DM and T1DM+saline groups, H&E staining showed less pyramidal cells in the hippocampus, with disorganized layers, karyopyknosis, decreased endochylema, and cavitation, effects relieved in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. Troxerutin alleviates oxidative stress and promotes learning in streptozotocin-induced T1DM rats, a process involving GCLC expression. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Arabidopsis cpSRP54 regulates carotenoid accumulation in Arabidopsis and Brassica napus
Gruber, Margaret Y.; Hannoufa, Abdelali
2012-01-01
An Arabidopsis thaliana mutant, cbd (carotenoid biosynthesis deficient), was recovered from a mutant population based on its yellow cotyledons, yellow-first true leaves, and stunted growth. Seven-day-old seedlings and mature seeds of this mutant had lower chlorophyll and total carotenoids than the wild type (WT). Genetic and molecular characterization revealed that cbd was a recessive mutant caused by a T-DNA insertion in the gene cpSRP54 encoding the 54kDa subunit of the chloroplast signal recognition particle. Transcript levels of most of the main carotenoid biosynthetic genes in cbd were unchanged relative to WT, but expression increased in carotenoid and abscisic acid catabolic genes. The chloroplasts of cbd also had developmental defects that contributed to decreased carotenoid and chlorophyll contents. Transcription of AtGLK1 (Golden 2-like 1), AtGLK2, and GUN4 appeared to be disrupted in the cbd mutant suggesting that the plastid-to-nucleus retrograde signal may be affected, regulating the changes in chloroplast functional and developmental states and carotenoid content flux. Transformation of A. thaliana and Brassica napus with a gDNA encoding the Arabidopsis cpSRP54 showed the utility of this gene in enhancing levels of seed carotenoids without affecting growth or seed yield. PMID:22791829
-
Ishikawa, Satoru; Ishimaru, Yasuhiro; Igura, Masato; Kuramata, Masato; Abe, Tadashi; Senoura, Takeshi; Hase, Yoshihiro; Arao, Tomohito; Nishizawa, Naoko K; Nakanishi, Hiromi
2012-11-20
Rice (Oryza sativa L.) grain is a major dietary source of cadmium (Cd), which is toxic to humans, but no practical technique exists to substantially reduce Cd contamination. Carbon ion-beam irradiation produced three rice mutants with <0.05 mg Cd⋅kg(-1) in the grain compared with a mean of 1.73 mg Cd⋅kg(-1) in the parent, Koshihikari. We identified the gene responsible for reduced Cd uptake and developed a strategy for marker-assisted selection of low-Cd cultivars. Sequence analysis revealed that these mutants have different mutations of the same gene (OsNRAMP5), which encodes a natural resistance-associated macrophage protein. Functional analysis revealed that the defective transporter protein encoded by the mutant osnramp5 greatly decreases Cd uptake by roots, resulting in decreased Cd in the straw and grain. In addition, we developed DNA markers to facilitate marker-assisted selection of cultivars carrying osnramp5. When grown in Cd-contaminated paddy fields, the mutants have nearly undetectable Cd in their grains and exhibit no agriculturally or economically adverse traits. Because mutants produced by ion-beam radiation are not transgenic plants, they are likely to be accepted by consumers and thus represent a practical choice for rice production worldwide.
-
Phenotypic characterization of ten methanol oxidation (Mox) mutant classes in methylobacterium AM1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nunn, D.N.; Lidstrom, M.E.
Twenty-five methanol oxidation mutants of the facultative methylotroph Methylobacterium strain AM1 have been characterized by complementation analysis and assigned to ten complementation groups, Mox A1,A2,A3 and B-H. We have characterized each of the mutants belonging to the ten Mox complementation groups by PMS-DCPIP dye linked methanol dehydrogenase activity, by methanol-dependent whole cell oxygen consumption, by the presence or absence of methanol dehydrogenase protein by SDS-polyacrylamide gels and Western blotting, by the absorption spectra of purified mutant methanol dehydrogenase proteins and by the presence or absence of the soluble cytochrome c proteins of Methylobacterium AM1. We propose functions for each ofmore » the genes deficient in the mutants of the ten Mox complementation groups. These functions include two linked genes that encode the methanol dehydrogenase structural protein and the soluble cytochrome c/sub L/, a gene encoding a secretion function essential for the synthesis and export of methanol dehydrogenase and cytochrome c/sub L/, three gene functions responsible for the proper association of the PQQ prosthetic group with the methanol dehydrogenase apoprotein and four positive regulatory gene functions controlling the expression of the ability to oxidize methanol. 24 refs., 5 figs., 2 tabs.« less
-
Lazar Adler, Natalie R; Stevens, Mark P; Dean, Rachel E; Saint, Richard J; Pankhania, Depesh; Prior, Joann L; Atkins, Timothy P; Kessler, Bianca; Nithichanon, Arnone; Lertmemongkolchai, Ganjana; Galyov, Edouard E
2015-01-01
Burkholderia pseudomallei is the causative agent of the severe tropical disease melioidosis, which commonly presents as sepsis. The B. pseudomallei K96243 genome encodes eleven predicted autotransporters, a diverse family of secreted and outer membrane proteins often associated with virulence. In a systematic study of these autotransporters, we constructed insertion mutants in each gene predicted to encode an autotransporter and assessed them for three pathogenesis-associated phenotypes: virulence in the BALB/c intra-peritoneal mouse melioidosis model, net intracellular replication in J774.2 murine macrophage-like cells and survival in 45% (v/v) normal human serum. From the complete repertoire of eleven autotransporter mutants, we identified eight mutants which exhibited an increase in median lethal dose of 1 to 2-log10 compared to the isogenic parent strain (bcaA, boaA, boaB, bpaA, bpaC, bpaE, bpaF and bimA). Four mutants, all demonstrating attenuation for virulence, exhibited reduced net intracellular replication in J774.2 macrophage-like cells (bimA, boaB, bpaC and bpaE). A single mutant (bpaC) was identified that exhibited significantly reduced serum survival compared to wild-type. The bpaC mutant, which demonstrated attenuation for virulence and net intracellular replication, was sensitive to complement-mediated killing via the classical and/or lectin pathway. Serum resistance was rescued by in trans complementation. Subsequently, we expressed recombinant proteins of the passenger domain of four predicted autotransporters representing each of the phenotypic groups identified: those attenuated for virulence (BcaA), those attenuated for virulence and net intracellular replication (BpaE), the BpaC mutant with defects in virulence, net intracellular replication and serum resistance and those displaying wild-type phenotypes (BatA). Only BcaA and BpaE elicited a strong IFN-γ response in a restimulation assay using whole blood from seropositive donors and were recognised by seropositive human sera from the endemic area. To conclude, several predicted autotransporters contribute to B. pseudomallei virulence and BpaC may do so by conferring resistance against complement-mediated killing.
-
Sharma, V K; Sacco, R E; Kunkle, R A; Bearson, S M D; Palmquist, D E
2012-04-01
The locus of enterocyte effacement (LEE) of Escherichia coli O157:H7 (O157) encodes a type III secretion system (T3SS) for secreting LEE-encoded and non-LEE-encoded virulence proteins that promote the adherence of O157 to intestinal epithelial cells and the persistence of this food-borne human pathogen in bovine intestines. In this study, we compared hha sepB and hha mutants of O157 for LEE transcription, T3SS activity, adherence to HEp-2 cells, persistence in bovine intestines, and the ability to induce changes in the expression of proinflammatory cytokines. LEE transcription was upregulated in the hha sepB and hha mutant strains compared to that in the wild-type strain, but the secretion of virulence proteins in the hha sepB mutant was severely compromised. This reduced secretion resulted in reduced adherence of the hha sepB mutant to Hep-2 cells, correlating with a significantly shorter duration and lower magnitude of fecal shedding in feces of weaned (n = 4 per group) calves inoculated with this mutant strain. The levels of LEE transcription, T3SS activity, and adherence to HEp-2 cells were much lower in the wild-type strain than in the hha mutant, but no significant differences were observed in the duration or the magnitude of fecal shedding in calves inoculated with these strains. Examination of the rectoanal junction (RAJ) tissues from three groups of calves showed no adherent O157 bacteria and similar proinflammatory cytokine gene expression, irrespective of the inoculated strain, with the exception that interleukin-1β was upregulated in calves inoculated with the hha sepB mutant. These results indicate that the T3SS is essential for intestinal colonization and prolonged shedding, but increased secretion of virulence proteins did not enhance the duration and magnitude of fecal shedding of O157 in cattle or have any significant impact on the cytokine gene expression in RAJ tissue compared with that in small intestinal tissue from the same calves.
-
Lüneberg, E; Mayer, B; Daryab, N; Kooistra, O; Zähringer, U; Rohde, M; Swanson, J; Frosch, M
2001-03-01
We recently described the phase-variable expression of a virulence-associated lipopolysaccharide (LPS) epitope in Legionella pneumophila. In this study, the molecular mechanism for phase variation was investigated. We identified a 30 kb unstable genetic element as the molecular origin for LPS phase variation. Thirty putative genes were encoded on the 30 kb sequence, organized in two putative opposite transcription units. Some of the open reading frames (ORFs) shared homologies with bacteriophage genes, suggesting that the 30 kb element was of phage origin. In the virulent wild-type strain, the 30 kb element was located on the chromosome, whereas excision from the chromosome and replication as a high-copy plasmid resulted in the mutant phenotype, which is characterized by alteration of an LPS epitope and loss of virulence. Mapping and sequencing of the insertion site in the genome revealed that the chromosomal attachment site was located in an intergenic region flanked by genes of unknown function. As phage release could not be induced by mitomycin C, it is conceivable that the 30 kb element is a non-functional phage remnant. The protein encoded by ORF T on the 30 kb plasmid could be isolated by an outer membrane preparation, indicating that the genes encoded on the 30 kb element are expressed in the mutant phenotype. Therefore, it is conceivable that the phenotypic alterations seen in the mutant depend on high-copy replication of the 30 kb element and expression of the encoded genes. Excision of the 30 kb element from the chromosome was found to occur in a RecA-independent pathway, presumably by the involvement of RecE, RecT and RusA homologues that are encoded on the 30 kb element.
-
USDA-ARS?s Scientific Manuscript database
Genomic analysis indicated that Edwardsiella ictaluri encodes a putative ureasepathogenicity island containing 9 open reading frames, including urea and ammonium transporters. In vitro studies with the wild-type E. ictaluri and a ureG::kan urease mutant strain indicated that E. ictaluri is significa...
-
Ivanova, Kira A; Tsyganova, Anna V; Brewin, Nicholas J; Tikhonovich, Igor A; Tsyganov, Viktor E
2015-11-01
Rhizobia are able to establish a beneficial interaction with legumes by forming a new organ, called the symbiotic root nodule, which is a unique ecological niche for rhizobial nitrogen fixation. Rhizobial infection has many similarities with pathogenic infection and induction of defence responses accompanies both interactions, but defence responses are induced to a lesser extent during rhizobial infection. However, strong defence responses may result from incompatible interactions between legumes and rhizobia due to a mutation in either macro- or microsymbiont. The aim of this research was to analyse different plant defence reactions in response to Rhizobium infection for several pea (Pisum sativum) mutants that result in ineffective symbiosis. Pea mutants were examined by histochemical and immunocytochemical analyses, light, fluorescence and transmission electron microscopy and quantitative real-time PCR gene expression analysis. It was observed that mutations in pea symbiotic genes sym33 (PsIPD3/PsCYCLOPS encoding a transcriptional factor) and sym40 (PsEFD encoding a putative negative regulator of the cytokinin response) led to suberin depositions in ineffective nodules, and in the sym42 there were callose depositions in infection thread (IT) and host cell walls. The increase in deposition of unesterified pectin in IT walls was observed for mutants in the sym33 and sym42; for mutant in the sym42, unesterified pectin was also found around degrading bacteroids. In mutants in the genes sym33 and sym40, an increase in the expression level of a gene encoding peroxidase was observed. In the genes sym40 and sym42, an increase in the expression levels of genes encoding a marker of hypersensitive reaction and PR10 protein was demonstrated. Thus, a range of plant defence responses like suberisation, callose and unesterified pectin deposition as well as activation of defence genes can be triggered by different pea single mutations that cause perception of an otherwise beneficial strain of Rhizobium as a pathogen.
-
Sabbagh, Sébastien C.; Lepage, Christine; McClelland, Michael; Daigle, France
2012-01-01
The human-adapted Salmonella enterica serovar Typhi (S. Typhi) causes a systemic infection known as typhoid fever. This disease relies on the ability of the bacterium to survive within macrophages. In order to identify genes involved during interaction with macrophages, a pool of approximately 105 transposon mutants of S. Typhi was subjected to three serial passages of 24 hours through human macrophages. Mutants recovered from infected macrophages (output) were compared to the initial pool (input) and those significantly underrepresented resulted in the identification of 130 genes encoding for cell membrane components, fimbriae, flagella, regulatory processes, pathogenesis, and many genes of unknown function. Defined deletions in 28 genes or gene clusters were created and mutants were evaluated in competitive and individual infection assays for uptake and intracellular survival during interaction with human macrophages. Overall, 26 mutants had defects in the competitive assay and 14 mutants had defects in the individual assay. Twelve mutants had defects in both assays, including acrA, exbDB, flhCD, fliC, gppA, mlc, pgtE, typA, waaQGP, SPI-4, STY1867-68, and STY2346. The complementation of several mutants by expression of plasmid-borne wild-type genes or gene clusters reversed defects, confirming that the phenotypic impairments within macrophages were gene-specific. In this study, 35 novel phenotypes of either uptake or intracellular survival in macrophages were associated with Salmonella genes. Moreover, these results reveal several genes encoding molecular mechanisms not previously known to be involved in systemic infection by human-adapted typhoidal Salmonella that will need to be elucidated. PMID:22574205
-
Zhang, Zhiyong; Zheng, Xixi; Yang, Jun; Messing, Joachim; Wu, Yongrui
2016-01-01
The maize endosperm-specific transcription factors opaque2 (O2) and prolamine-box binding factor (PBF) regulate storage protein zein genes. We show that they also control starch synthesis. The starch content in the PbfRNAi and o2 mutants was reduced by ∼5% and 11%, respectively, compared with normal genotypes. In the double-mutant PbfRNAi;o2, starch was decreased by 25%. Transcriptome analysis reveals that >1,000 genes were affected in each of the two mutants and in the double mutant; these genes were mainly enriched in sugar and protein metabolism. Pyruvate orthophosphate dikinase 1 and 2 (PPDKs) and starch synthase III (SSIII) are critical components in the starch biosynthetic enzyme complex. The expression of PPDK1, PPDK2, and SSIII and their protein levels are further reduced in the double mutants as compared with the single mutants. When the promoters of these genes were analyzed, we found a prolamine box and an O2 box that can be additively transactivated by PBF and O2. Starch synthase IIa (SSIIa, encoding another starch synthase for amylopectin) and starch branching enzyme 1 (SBEI, encoding one of the two main starch branching enzymes) are not directly regulated by PBF and O2, but their protein levels are significantly decreased in the o2 mutant and are further decreased in the double mutant, indicating that o2 and PbfRNAi may affect the levels of some other transcription factor(s) or mRNA regulatory factor(s) that in turn would affect the transcript and protein levels of SSIIa and SBEI. These findings show that three important traits—nutritional quality, calories, and yield—are linked through the same transcription factors. PMID:27621432
-
Sumby, Paul; Barbian, Kent D; Gardner, Donald J; Whitney, Adeline R; Welty, Diane M; Long, R Daniel; Bailey, John R; Parnell, Michael J; Hoe, Nancy P; Adams, Gerald G; Deleo, Frank R; Musser, James M
2005-02-01
Many pathogenic bacteria produce extracellular DNase, but the benefit of this enzymatic activity is not understood. For example, all strains of the human bacterial pathogen group A Streptococcus (GAS) produce at least one extracellular DNase, and most strains make several distinct enzymes. Despite six decades of study, it is not known whether production of DNase by GAS enhances virulence. To test the hypothesis that extracellular DNase is required for normal progression of GAS infection, we generated seven isogenic mutant strains in which the three chromosomal- and prophage-encoded DNases made by a contemporary serotype M1 GAS strain were inactivated. Compared to the wild-type parental strain, the isogenic triple-mutant strain was significantly less virulent in two mouse models of invasive infection. The triple-mutant strain was cleared from the skin injection site significantly faster than the wild-type strain. Preferential clearance of the mutant strain was related to the differential extracellular killing of the mutant and wild-type strains, possibly through degradation of neutrophil extracellular traps, innate immune structures composed of chromatin and granule proteins. The triple-mutant strain was also significantly compromised in its ability to cause experimental pharyngeal disease in cynomolgus macaques. Comparative analysis of the seven DNase mutant strains strongly suggested that the prophage-encoded SdaD2 enzyme is the major DNase that contributes to virulence in this clone. We conclude that extracellular DNase activity made by GAS contributes to disease progression, thereby resolving a long-standing question in bacterial pathogenesis research.
-
Erdoğan, Mehmet Evren; Aydın, Seval; Yanar, Karolin; Mengi, Murat; Kansu, Ahmet Doğukan; Cebe, Tamer; Belce, Ahmet; Çelikten, Mert; Çakatay, Ufuk
2017-08-01
While the deterioration of insulin-glucose metabolism (IGM), impaired redox homeostasis (IRH), β-amyloid accumulation was reported in Sporadic Alzheimer's Disease (SAD) model, aforementioned factors related to lipoic acid administration and anthropometric indexes (AIs) are not yet studied with integrative approach. β-amyloid accumulation, redox homeostasis biomarkers and AIs are investigated in SAD model. Streptozotocin-induced inhibition of insulin-signaling cascade but not GLUT-2 and GLUT-3 transporters takes a role in β-amyloid accumulation. Inhibition types are related to IRH in cortex, hippocampus and systemic circulation. Lipoic acid (LA) shows both antioxidant and prooxidant effect according to the anatomical location. LA administration also leads to improved AIs during GLUT-2 inhibition and cortical redox status in GLUT-3 inhibited group. Optimal LA action could be possible if its redox behavior is balanced to antioxidant effect. Diagnostic usage of systemic IRH parameters as biomarkers and their possible correlations with deteriorated IGM should be investigated. Graphical abstract ᅟ.
-
Li, Yang; Monteiro-Riviere, Nancy A
2016-12-01
To assess inflammation, cellular uptake and endocytic mechanisms of gold nanoparticles (AuNP) in human epidermal keratinocytes with and without a protein corona. Human epidermal keratinocytes were exposed to 40 and 80 nm AuNP with lipoic acid, polyethylene glycol (PEG) and branched polyethyleneimine (BPEI) coatings with and without a protein corona up to 48 h. Inhibitors were selected to characterize endocytosis. BPEI-AuNP showed the greatest uptake, while PEG-AuNP had the least. Protein coronas decreased uptake and affected their mechanism. AuNP uptake was energy-dependent, except for 40 nm lipoic-AuNP. Most AuNP were internalized by clathrin and lipid raft-mediated endocytosis, except for 40 nm PEG was by raft/noncaveolae mediated endocytosis. Coronas inhibited caveolae-mediated-endocytosis with lipoic acid and BPEI-AuNP and altered 40 nm PEG-AuNP from raft/noncaveolae to clathrin. Inflammatory responses decreased with a plasma corona. Results suggest protein coronas significantly affect cellular uptake and inflammatory responses of AuNP.
-
Lipoic Acid Decreases the Viability of Breast Cancer Cells and Activity of PTP1B and SHP2.
Kuban-Jankowska, Alicja; Gorska-Ponikowska, Magdalena; Wozniak, Michal
2017-06-01
Protein tyrosine phosphatases PTP1B and SHP2 are potential targets for anticancer therapy, because of the essential role they play in the development of tumors. PTP1B and SHP2 are overexpressed in breast cancer cells, thus inhibition of their activity can be potentially effective in breast cancer therapy. Lipoic acid has been previously reported to inhibit the proliferation of colon, breast and thyroid cancer cells. We investigated the effect of alpha-lipoic acid (ALA) and its reduced form of dihydrolipoic acid (DHLA) on the viability of MCF-7 cancer cells and on the enzymatic activity of PTP1B and SHP2 phosphatases. ALA and DHLA decrease the activity of PTP1B and SHP2, and have inhibitory effects on the viability and proliferation of breast cancer cells. ALA and DHLA can be considered as potential agents for the adjunctive treatment of breast cancer. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
-
Alpha lipoic acid efficacy in burning mouth syndrome. A controlled clinical trial
Palacios-Sánchez, Begoña; Cerero-Lapiedra, Rocío; Llamas-Martínez, Silvia; Esparza-Gómez, Germán
2015-01-01
Background A double-blind placebo-controlled trial was conducted in order to evaluate the efficacy of alpha lipoic acid (ALA) and determine the statistical significance of the outcome variables. Burning mouth syndrome (BMS) is defined as an oral burning sensation in the absence of clinical signs which could justify the syndrome. Recent studies suggest the existence of neurological factors as a possible cause of the disease. Material and Methods 60 patients with BMS, in two groups: case group with 600 mg/day and placebo as control group; with follow up of 2 months. Results 64% of ALA patients reported some level of improvement, with a level of maintenance of 68.75% one month after treatment. 27.6% of the placebo group also demonstrated some reduction in BMS symptoms. Conclusions Long-term evolution and the intensity of symptoms are variables that reduce the probability of improvement with ALA treatment. Key words: Burning mouth syndrome, neuropathy, alpha lipoic acid. PMID:26034927
-
α-Lipoic acid protects against cholecystokinin-induced acute pancreatitis in rats
Park, Sung-Joo; Seo, Sang-Wan; Choi, Ok-Sun; Park, Cheung-Seog
2005-01-01
AIM: α-Lipoic acid (ALA) has been used as an antioxidant. The aim of this study was to investigate the effect of α-lipoic acid on cholecystokinin (CCK)-octapeptide induced acute pancreatitis in rats. METHODS: ALA at 1 mg/kg was intra-peritoneally injected, followed by 75 μg/kg CCK-octapeptide injected thrice subcutaneously after 1, 3, and 5 h. This whole procedure was repeated for 5 d. We checked the pancreatic weight/body weight ratio, the secretion of pro-inflammatory cytokines and the levels of lipase, amylase of serum. Repeated CCK octapeptide treatment resulted in typical laboratory and morphological changes of experimentally induced pancreatitis. RESULTS: ALA significantly decreased the pancreatic weight/body weight ratio and serum amylase and lipase in CCK octapeptide-induced acute pancreatitis. However, the secretion of IL-1β, IL-6, and TNF-α were comparable in CCK octapeptide-induced acute pancreatitis. CONCLUSION: ALA may have a protective effect against CCK octapeptide-induced acute pancreatitis. PMID:16097064
-
Reinhart, Alexandria A.; Powell, Daniel A.; Nguyen, Angela T.; O'Neill, Maura; Djapgne, Louise; Wilks, Angela; Ernst, Robert K.
2014-01-01
Pseudomonas aeruginosa is an opportunistic pathogen that requires iron to cause infection, but it also must regulate the uptake of iron to avoid iron toxicity. The iron-responsive PrrF1 and PrrF2 small regulatory RNAs (sRNAs) are part of P. aeruginosa's iron regulatory network and affect the expression of at least 50 genes encoding iron-containing proteins. The genes encoding the PrrF1 and PrrF2 sRNAs are encoded in tandem in P. aeruginosa, allowing for the expression of a distinct, heme-responsive sRNA named PrrH that appears to regulate genes involved in heme metabolism. Using a combination of growth, mass spectrometry, and gene expression analysis, we showed that the ΔprrF1,2 mutant, which lacks expression of the PrrF and PrrH sRNAs, is defective for both iron and heme homeostasis. We also identified phuS, encoding a heme binding protein involved in heme acquisition, and vreR, encoding a previously identified regulator of P. aeruginosa virulence genes, as novel targets of prrF-mediated heme regulation. Finally, we showed that the prrF locus encoding the PrrF and PrrH sRNAs is required for P. aeruginosa virulence in a murine model of acute lung infection. Moreover, we showed that inoculation with a ΔprrF1,2 deletion mutant protects against future challenge with wild-type P. aeruginosa. Combined, these data demonstrate that the prrF-encoded sRNAs are critical regulators of P. aeruginosa virulence. PMID:25510881
-
Radmacher, Eva; Vaitsikova, Adela; Burger, Udo; Krumbach, Karin; Sahm, Hermann; Eggeling, Lothar
2002-01-01
Mutants of Corynebacterium glutamicum were made and enzymatically characterized to clone ilvD and ilvE, which encode dihydroxy acid dehydratase and transaminase B, respectively. These genes of the branched-chain amino acid synthesis were overexpressed together with ilvBN (which encodes acetohydroxy acid synthase) and ilvC (which encodes isomeroreductase) in the wild type, which does not excrete l-valine, to result in an accumulation of this amino acid to a concentration of 42 mM. Since l-valine originates from two pyruvate molecules, this illustrates the comparatively easy accessibility of the central metabolite pyruvate. The same genes, ilvBNCD, overexpressed in an ilvA deletion mutant which is unable to synthesize l-isoleucine increased the concentration of this amino acid to 58 mM. A further dramatic increase was obtained when panBC was deleted, making the resulting mutant auxotrophic for d-pantothenate. When the resulting strain, C. glutamicum 13032ΔilvAΔpanBC with ilvBNCD overexpressed, was grown under limiting conditions it accumulated 91 mM l-valine. This is attributed to a reduced coenzyme A availability and therefore reduced flux of pyruvate via pyruvate dehydrogenase enabling its increased drain-off via the l-valine biosynthesis pathway. PMID:11976094
-
Dhaundiyal, Ankit; Jena, Sunil K; Samal, Sanjaya K; Sonvane, Bhavin; Chand, Mahesh; Sangamwar, Abhay T
2016-12-01
This study was designed to demonstrate the potential of novel α-lipoic acid-stearylamine (ALA-SA) conjugate-based solid lipid nanoparticles in modulating the pharmacokinetics and hepatotoxicity of tamoxifen (TMX). α-lipoic acid-stearylamine bioconjugate was synthesized via carbodiimide chemistry and used as a lipid moiety for the generation of TMX-loaded solid lipid nanoparticles (TMX-SLNs). TMX-SLNs were prepared by solvent emulsification-diffusion method and optimized for maximum drug loading using rotatable central composite design. The optimized TMX-SLNs were stabilized using 10% w/w trehalose as cryoprotectant. In addition, pharmacokinetics and hepatotoxicity of freeze-dried TMX-SLNs were also evaluated in Sprague Dawley rats. Initial characterization with transmission electron microscopy revealed spherical morphology with smooth surface having an average particle size of 261.08 ± 2.13 nm. The observed entrapment efficiency was 40.73 ± 2.83%. In-vitro release study showed TMX release was slow and pH dependent. Pharmacokinetic study revealed a 1.59-fold increase in relative bioavailability as compared to TMX suspension. A decrease in hepatotoxicity of TMX is evidenced by the histopathological evaluation of liver tissues. α-lipoic acid-stearylamine conjugate-based SLNs have a great potential in enhancing the oral bioavailability of poorly soluble drugs like TMX. Moreover, this ALA-SA nanoparticulate system could be of significant value in long-term anticancer therapy with least side effects. © 2016 Royal Pharmaceutical Society.
-
Cichewicz, Allie; Pacleb, Chelsea; Connors, Ashley; Hass, Martha A.; Lopes, Luciana B.
2013-01-01
Objectives To assess whether the composition and charge of microemulsions affect their ability to simultaneously deliver α-tocopherol and lipoic acid into viable skin layers. Methods α-tocopherol and lipoic acid were added (1.1 and 0.5% w/w, respectively) to decylglucoside-based microemulsions containing mono-dicaprylin. Microemulsions containing surfactant:oil:water (w/w/w) at 60:30:10 (ME-O) and 46:23:31 (ME-W), as well as a cationic form of ME-W containing 1% phytosphingosine (ME-Wphy) were characterized, and their ability to disrupt the skin barrier and deliver the antioxidants in vitro in the skin was evaluated. Antioxidant activity in ME-Wphy-treated skin was assessed using the thiobarbituric acid-reactive substances (TBARS) assay. Key findings internal phase diameters of microemulsions ranged between 47.0–53.2 nm; phytosphingosine addition and pH adjustment to 5.0 increased zeta potential from −4.3 to +29.1 mV. ME-O displayed w/o structure, whereas ME-W and ME-Wphy were consistent with o/w. Microemulsions affected skin electrical resistance and transepidermal water loss, but did not affect lipoic acid penetration. α-Tocopherol delivery increased following the order ME-O
-
Sancheti, Harsh; Kanamori, Keiko; Patil, Ishan; Díaz Brinton, Roberta; Ross, Brian D; Cadenas, Enrique
2014-01-01
Alzheimer's disease is an age-related neurodegenerative disease characterized by deterioration of cognition and loss of memory. Several clinical studies have shown Alzheimer's disease to be associated with disturbances in glucose metabolism and the subsequent tricarboxylic acid (TCA) cycle-related metabolites like glutamate (Glu), glutamine (Gln), and N-acetylaspartate (NAA). These metabolites have been viewed as biomarkers by (a) assisting early diagnosis of Alzheimer's disease and (b) evaluating the efficacy of a treatment regimen. In this study, 13-month-old triple transgenic mice (a mouse model of Alzheimer's disease (3xTg-AD)) were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C NMR to determine the concentrations of 13C-labeled isotopomers of Glu, Gln, aspartate (Asp), GABA, myo-inositol, and NAA. Total (12C+13C) Glu, Gln, and Asp were quantified by high-performance liquid chromatography to calculate enrichment. Furthermore, we examined the effects of lipoic acid in modulating these metabolites, based on its previously established insulin mimetic effects. Total 13C labeling and percent enrichment decreased by ∼50% in the 3xTg-AD mice. This hypometabolism was partially or completely restored by lipoic acid feeding. The ability of lipoic acid to restore glucose metabolism and subsequent TCA cycle-related metabolites further substantiates its role in overcoming the hypometabolic state inherent in early stages of Alzheimer's disease. PMID:24220168
-
Alpha-lipoic acid as a new treatment option for Alzheimer's disease--a 48 months follow-up analysis.
Hager, K; Kenklies, M; McAfoose, J; Engel, J; Münch, G
2007-01-01
Oxidative stress and neuronal energy depletion are characteristic biochemical hallmarks of Alzheimer's disease (AD). It is therefore conceivable that pro-energetic and antioxidant drugs such as alpha-lipoic acid might delay the onset or slow down the progression of the disease. In a previous study, 600mg alpha-lipoic acid was given daily to nine patients with AD (receiving a standard treatment with choline-esterase inhibitors) in an open-label study over an observation period of 12 months. The treatment led to a stabilization of cognitive functions in the study group, demonstrated by constant scores in two neuropsychological tests (the mini mental state exam, MMSE and the Alzheimer's disease assessment score cognitive subscale, ADAScog). In this report, we have extended the analysis to 43 patients over an observation period of up to 48 months. In patients with mild dementia (ADAScog < 15), the disease progressed extremely slowly (ADAScog: +1.2 points/year, MMSE: -0.6 points/year), in patients with moderate dementia at approximately twice the rate. However, the progression appears dramatically lower than data reported for untreated patients or patients on choline-esterase inhibitors in the second year of long-term studies. Despite the fact that this study was not double-blinded, placebo-controlled and randomized, our data suggest that treatment with alpha-lipoic acid might be a successful 'neuroprotective' therapy option for AD. However, a state-of-the-art phase II trial is needed urgently.
-
Stevens, Marc J A; Vollenweider, Sabine; Meile, Leo; Lacroix, Christophe
2011-08-03
Lactobacillus reuteri metabolizes glycerol to 3-hydroxypropionaldehyde (3-HPA) and further to 1,3-propanediol (1,3-PDO), the latter step catalysed by a propanediol dehydrogenase (PDH). The last step in this pathway regenerates NAD+ and enables therefore the energetically more favourable production of acetate over ethanol during growth on glucose. A search throughout the genome of L. reuteri DSM 20016 revealed two putative PDHs encoded by ORFs lr_0030 and lr_1734. ORF lr_1734 is situated in the pdu operon encoding the glycerol conversion machinery and therefore likely involved in 1,3-PDO formation. ORF lr_0030 has not been associated with PDH-activity so far. To elucidate the role of these two PDHs, gene deletion mutant strains were constructed. Growth behaviour on glucose was comparable between the wild type and both mutant strains. However, on glucose + glycerol, the exponential growth rate of Δlr_0030 was lower compared to the wild type and the lr_1734 mutant. Furthermore, glycerol addition resulted in decreased ethanol production in the wild type and Δlr_1734, but not in Δlr_0030. PDH activity measurements using 3-HPA as a substrate revealed lower activity of Δlr_0030 extracts from exponential growing cells compared to wild type and Δlr_1734 extracts.During biotechnological 3-HPA production using non-growing cells, the ratio 3-HPA to 1,3-PDO was approximately 7 in the wild type and Δlr_0030, whereas this ratio was 12.5 in the mutant Δlr_1734. The enzyme encoded by lr_0030 plays a pivotal role in 3-HPA conversion in exponential growing L. reuteri cells. The enzyme encoded by lr_1734 is active during 3-HPA production by non-growing cells and this enzyme is a useful target to enhance 3-HPA production and minimize formation of the by-product 1,3-PDO.
-
Liu, Chong-Bin; Feng, Yan-Hong; Ye, Guang-Hua; Xiao, Min
2010-12-01
To explore arsenic-induced oxidative stress and the protective efficacy of α-lipoic acid and vitamin c. 50 male SD rats were randomly divided into 5 groups. Ten rats (the control group) were exposed to deionized water for 6 weeks, and the others were alone exposed to sodium arsenite (50 mg/L water) for 6 weeks, at the same time, three group rats were administered intragastrically (i.g.) with α-lipoic acid 10 mg×kg(-1)×d(-1) and vitamin C 25 mg×kg(-1)×d(-1) either alone or in combination. At the end of experiment, blood was drawn from abdominal aorta, and then the blood, brain and liver of rats were used for biochemical assays, including blood glutathione (GSH), δ-aminolevulinic acid dehydratase (δ-ALAD ), reactive oxygen species (ROS) and oxidized glutathione (GSSG) level. At the same time, the super oxide dismutase (SOD) activity, glutathione peroxidase (GSH-Px) activity, catalase (CAT) activity, ATPase activity of brain and liver were determined. The caspase activity of brain were also determined. There were a significant increase in ROS level (P < 0.05), but a significant decrease in δ-ALAD activity (P < 0.01) in the chronic arsenic toxicity model group compared with the control group. These alterations were marginally restored by co-administration of vitamin C and α-lipoic acid individually, while significant recovery was observed in the animals supplemented with both the antioxidants together with arsenite in rat (P < 0.05). At the same time, there was a significant increase in the ROS and TBARS level of the brain and liver (P < 0.05), and caspase activity of the brain (P < 0.05), while there was a significant decrease in antioxidant enzymes and ATPase activity on arsenite exposure in rats (P < 0.05). These alterations were also marginally restored by co-administration of vitamin C and α-lipoic acid individually, while significant recovery was observed in the animals supplemented with both the antioxidants together with arsenite in rat (P < 0.05). Arsenite-induced oxidative stress can be significantly protected by co-administration of α-lipoic acid and vitamin C individually, but the best effects could be observed with combined administration of two antioxidants during arsenite exposure in animals. The dietary intervention of or supplementation with natural dietary nutrients is possible to prevent the effects of arsenic in populations of risk.
-
Ayyagari, R; Impellizzeri, K J; Yoder, B L; Gary, S L; Burgers, P M
1995-01-01
The saccharomyces cerevisiae proliferating cell nuclear antigen (PCNA), encoded by the POL30 gene, is essential for DNA replication and DNA repair processes. Twenty-one site-directed mutations were constructed in the POL30 gene, each mutation changing two adjacently located charged amino acids to alanines. Although none of the mutant strains containing these double-alanine mutations as the sole source of PCNA were temperature sensitive or cold sensitive for growth, about a third of the mutants showed sensitivity to UV light. Some of those UV-sensitive mutants had elevated spontaneous mutation rates. In addition, several mutants suppressed a cold-sensitive mutation in the CDC44 gene, which encodes the large subunit of replication factor C. A cold-sensitive mutant, which was isolated by random mutagenesis, showed a terminal phenotype at the restrictive temperature consistent with a defect in DNA replication. Several mutant PCNAs were expressed and purified from Escherichia coli, and their in vitro properties were determined. The cold-sensitive mutant (pol30-52, S115P) was a monomer, rather than a trimer, in solution. This mutant was deficient for DNA synthesis in vitro. Partial restoration of DNA polymerase delta holoenzyme activity was achieved at 37 degrees C but not at 14 degrees C by inclusion of the macromolecular crowding agent polyethylene glycol in the assay. The only other mutant (pol30-6, DD41,42AA) that showed a growth defect was partially defective for interaction with replication factor C and DNA polymerase delta but completely defective for interaction with DNA polymerase epsilon. Two other mutants sensitive to DNA damage showed no defect in vitro. These results indicate that the latter mutants are specifically impaired in one or more DNA repair processes whereas pol30-6 and pol30-52 mutants show their primary defects in the basic DNA replication machinery with probable associated defects in DNA repair. Therefore, DNA repair requires interactions between repair-specific protein(s) and PCNA, which are distinct from those required for DNA replication. PMID:7623835
-
Casonato, Stefano; Cervantes Sánchez, Axel; Haruki, Hirohito; Rengifo González, Monica; Provvedi, Roberta; Dainese, Elisa; Jaouen, Thomas; Gola, Susanne; Bini, Estela; Vicente, Miguel; Johnsson, Kai; Ghisotti, Daniela; Palù, Giorgio; Hernández-Pando, Rogelio
2012-01-01
The proteins belonging to the WhiB superfamily are small global transcriptional regulators typical of actinomycetes. In this paper, we characterize the role of WhiB5, a Mycobacterium tuberculosis protein belonging to this superfamily. A null mutant was constructed in M. tuberculosis H37Rv and was shown to be attenuated during both progressive and chronic mouse infections. Mice infected with the mutant had smaller bacillary burdens in the lungs but a larger inflammatory response, suggesting a role of WhiB5 in immunomodulation. Most interestingly, the whiB5 mutant was not able to resume growth after reactivation from chronic infection, suggesting that WhiB5 controls the expression of genes involved in this process. The mutant was also more sensitive than the wild-type parental strain to S-nitrosoglutathione (GSNO) and was less metabolically active following prolonged starvation, underscoring the importance of GSNO and starvation in development and maintenance of chronic infection. DNA microarray analysis identified 58 genes whose expression is influenced by WhiB5, including sigM, encoding an alternative sigma factor, and genes encoding the constituents of two type VII secretion systems, namely, ESX-2 and ESX-4. PMID:22733573
-
Expression of acrA and acrB Genes in Esherichia coli Mutants with or without marR or acrR Mutations.
Pourahmad Jaktaji, Razieh; Jazayeri, Nasim
2013-12-01
The major antibiotic efflux pump of Esherichia coli is AcrAB-TolC. The first part of the pump, AcrAB, is encoded by acrAB operon. The expression of this operon can be kept elevated by overexpression of an activator, MarA following inactivation of MarR and AcrR repressors due to mutation in encoding genes, marR and acrR, respectively. The aims of this research were to use E. coli mutants with or without mutation in marR to search for the presence of possible mutation in acrR and to quantify the expression of acrAB. The DNA binding region of acrR gene in these mutants were amplified by PCR and sequenced. The relative expression of acrA and acrB were determined by real time PCR. RESULTS showed that W26 and C14 had the same mutation in acrR, but none of the mutants overexpressed acrA and acrB in comparison with wild type strain. The effect of marR or acrR mutation on acrAB overexpression is dependent on levels of resistance to tetracycline and ciprofloxacin.
-
Fuchs, W; Ziemann, K; Teifke, J P; Werner, O; Mettenleiter, T C
2000-03-01
The DNA sequence of the infectious laryngotracheitis virus (ILTV) UL50, UL51 and UL52 gene homologues was determined. Although the deduced UL50 protein lacks the first of five conserved domains of the corresponding proteins of mammalian alphaherpesviruses, the ILTV gene product was also shown to possess dUTPase activity. The generation of UL50-negative ILTV mutants was facilitated by recombination plasmids encoding green fluorescent protein (GFP), and expression constructs of predicted transactivator proteins of ILTV (alphaTIF, ICP4) were successfully used to increase the infectivity of viral genomic DNA. A GFP-expressing UL50-deletion mutant of ILTV showed reduced cell-to-cell spread in vitro, and was attenuated in vivo. A similar deletion mutant without the foreign gene, however, propagated like wild-type ILTV in cell culture and was pathogenic in chickens. We conclude that the viral dUTPase is not required for efficient replication of ILTV in the respiratory tract of infected animals. The replication defect of the GFP-expressing ILTV recombinant is most likely caused by toxic effects of the reporter gene product, since spontaneously occurring inactivation mutants exhibited wild-type-like growth.
-
Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos
1998-01-01
The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476
-
Zaragoza, O; Blazquez, M A; Gancedo, C
1998-08-01
The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30 degreesC was indistinguishable from that of the wild type. However, at 42 degreesC it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37 degreesC, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42 degreesC, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 10(6) CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation.
-
Retinoic acid deficiency impairs the vestibular function.
Romand, Raymond; Krezel, Wojciech; Beraneck, Mathieu; Cammas, Laura; Fraulob, Valérie; Messaddeq, Nadia; Kessler, Pascal; Hashino, Eri; Dollé, Pascal
2013-03-27
The retinaldehyde dehydrogenase 3 (Raldh3) gene encodes a major retinoic acid synthesizing enzyme and is highly expressed in the inner ear during embryogenesis. We found that mice deficient in Raldh3 bear severe impairment in vestibular functions. These mutant mice exhibited spontaneous circling/tilted behaviors and performed poorly in several vestibular-motor function tests. In addition, video-oculography revealed a complete loss of the maculo-ocular reflex and a significant reduction in the horizontal angular vestibulo-ocular reflex, indicating that detection of both linear acceleration and angular rotation were compromised in the mutants. Consistent with these behavioral and functional deficiencies, morphological anomalies, characterized by a smaller vestibular organ with thinner semicircular canals and a significant reduction in the number of otoconia in the saccule and the utricle, were consistently observed in the Raldh3 mutants. The loss of otoconia in the mutants may be attributed, at least in part, to significantly reduced expression of Otop1, which encodes a protein known to be involved in calcium regulation in the otolithic organs. Our data thus reveal a previously unrecognized role of Raldh3 in structural and functional development of the vestibular end organs.
-
GOLD HULL AND INTERNODE2 encodes a primarily multifunctional cinnamyl-alcohol dehydrogenase in rice.
Zhang, Kewei; Qian, Qian; Huang, Zejun; Wang, Yiqin; Li, Ming; Hong, Lilan; Zeng, Dali; Gu, Minghong; Chu, Chengcai; Cheng, Zhukuan
2006-03-01
Lignin content and composition are two important agronomic traits for the utilization of agricultural residues. Rice (Oryza sativa) gold hull and internode phenotype is a classical morphological marker trait that has long been applied to breeding and genetics study. In this study, we have cloned the GOLD HULL AND INTERNODE2 (GH2) gene in rice using a map-based cloning approach. The result shows that the gh2 mutant is a lignin-deficient mutant, and GH2 encodes a cinnamyl-alcohol dehydrogenase (CAD). Consistent with this finding, extracts from roots, internodes, hulls, and panicles of the gh2 plants exhibited drastically reduced CAD activity and undetectable sinapyl alcohol dehydrogenase activity. When expressed in Escherichia coli, purified recombinant GH2 was found to exhibit strong catalytic ability toward coniferaldehyde and sinapaldehyde, while the mutant protein gh2 completely lost the corresponding CAD and sinapyl alcohol dehydrogenase activities. Further phenotypic analysis of the gh2 mutant plants revealed that the p-hydroxyphenyl, guaiacyl, and sinapyl monomers were reduced in almost the same ratio compared to the wild type. Our results suggest GH2 acts as a primarily multifunctional CAD to synthesize coniferyl and sinapyl alcohol precursors in rice lignin biosynthesis.
-
Deletion of Citrate Synthase Restores Growth of Sinorhizobium meliloti 1021 Aconitase Mutants▿
Koziol, Uriel; Hannibal, Luciana; Rodríguez, María Cecilia; Fabiano, Elena; Kahn, Michael L.; Noya, Francisco
2009-01-01
The symbiotic nitrogen-fixing bacterium Sinorhizobium meliloti 1021 encodes only one predicted aconitase (AcnA) in its genome. AcnA has a significant degree of similarity with other bacterial aconitases that behave as dual proteins: enzymes and posttranscriptional regulators of gene expression. Similar to the case with these bacterial aconitases, AcnA activity was reversibly labile and was regained upon reconstitution with reduced iron. The aconitase promoter was active in root nodules. acnA mutants grew very poorly, had secondary mutations, and were quickly outgrown by pseudorevertants. The acnA gene was stably interrupted in a citrate synthase (gltA) null background, indicating that the intracellular accumulation of citrate may be deleterious for survival of strain 1021. No aconitase activity was detected in this mutant, suggesting that the acnA gene encodes the only functional aconitase of strain 1021. To uncover a function of AcnA beyond its catalytic role in the tricarboxylic acid cycle pathway, the gltA acnA double mutant was compared with the gltA single mutant for differences in motility, resistance to oxidative stress, nodulation, and growth on different substrates. However, no differences in any of these characteristics were found. PMID:19820082
-
Zhu, Qiang; Dugardeyn, Jasper; Zhang, Chunyi; Mühlenbock, Per; Eastmond, Peter J; Valcke, Roland; De Coninck, Barbara; Oden, Sevgi; Karampelias, Michael; Cammue, Bruno P A; Prinsen, Els; Van Der Straeten, Dominique
2014-02-01
Recently, we reported that the novel mitochondrial RNA editing factor SLO2 is essential for mitochondrial electron transport, and vital for plant growth through regulation of carbon and energy metabolism. Here, we show that mutation in SLO2 causes hypersensitivity to ABA and insensitivity to ethylene, suggesting a link with stress responses. Indeed, slo2 mutants are hypersensitive to salt and osmotic stress during the germination stage, while adult plants show increased drought and salt tolerance. Moreover, slo2 mutants are more susceptible to Botrytis cinerea infection. An increased expression of nuclear-encoded stress-responsive genes, as well as mitochondrial-encoded NAD genes of complex I and genes of the alternative respiratory pathway, was observed in slo2 mutants, further enhanced by ABA treatment. In addition, H2O2 accumulation and altered amino acid levels were recorded in slo2 mutants. We conclude that SLO2 is required for plant sensitivity to ABA, ethylene, biotic, and abiotic stress. Although two stress-related RNA editing factors were reported very recently, this study demonstrates a unique role of SLO2, and further supports a link between mitochondrial RNA editing events and stress response.
-
Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo
2013-01-25
The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins.
-
Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo
2013-01-01
The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins. PMID:23132861
-
Export of Extracellular Polysaccharides Modulates Adherence of the Cyanobacterium Synechocystis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fisher, ML; Allen, R; Luo, YQ
2013-09-10
The field of cyanobacterial biofuel production is advancing rapidly, yet we know little of the basic biology of these organisms outside of their photosynthetic pathways. We aimed to gain a greater understanding of how the cyanobacterium Synechocystis PCC 6803 (Synechocystis, hereafter) modulates its cell surface. Such understanding will allow for the creation of mutants that autoflocculate in a regulated way, thus avoiding energy intensive centrifugation in the creation of biofuels. We constructed mutant strains lacking genes predicted to function in carbohydrate transport or synthesis. Strains with gene deletions of slr0977 (predicted to encode a permease component of an ABC transporter),more » slr0982 (predicted to encode an ATP binding component of an ABC transporter) and slr1610 (predicted to encode a methyltransferase) demonstrated flocculent phenotypes and increased adherence to glass. Upon bioinformatic inspection, the gene products of slr0977, slr0982, and slr1610 appear to function in O-antigen (OAg) transport and synthesis. However, the analysis provided here demonstrated no differences between OAg purified from wild-type and mutants. However, exopolysaccharides (EPS) purified from mutants were altered in composition when compared to wild-type. Our data suggest that there are multiple means to modulate the cell surface of Synechocystis by disrupting different combinations of ABC transporters and/or glycosyl transferases. Further understanding of these mechanisms may allow for the development of industrially and ecologically useful strains of cyanobacteria. Additionally, these data imply that many cyanobacterial gene products may possess as-yet undiscovered functions, and are meritorious of further study.« less
-
Morris, C J; Lidstrom, M E
1992-01-01
In Methylobacterium extorquens AM1, gene encoding methanol dehydrogenase polypeptides are transcriptionally regulated in response to C1 compounds, including methanol (M. E. Lidstrom and D. I. Stirling, Annu. Rev. Microbiol. 44:27-57, 1990). In order to study this regulation, a transcriptional fusion has been constructed between a beta-galactosidase reporter gene and a 1.55-kb XhoI-SalI fragment of M. extorquens AM1rif DNA encoding the N terminus of the methanol dehydrogenase large subunit (moxF) and 1,289 bp of upstream DNA. The fusion exhibited orientation-specific promoter activity in M. extorquens AM1rif but was expressed constitutively when the transcriptional fusion was located on the plasmid. However, correct regulation was restored when the construction was inserted in the M. extorquens AM1rif chromosome. This DNA fragment was shown to contain both the moxFJGI promoter and the sequences necessary in cis for its transcriptional regulation by methanol. Transcription from this promoter was studied in the M. extorquens AM1rif moxB mutant strains UV4rif and UV25rif, which have a pleiotropic phenotype with regard to the components of methanol oxidation. In these mutants, beta-galactosidase activity from the fusion was reduced to a level equal to that of the vector background when the fusion was present in both plasmid and chromosomal locations. Since both constitutive and methanol-inducible promoter activities were lost in the mutants, moxB appears to be required for transcription of the genes encoding the methanol dehydrogenase polypeptides. Images PMID:1624436
-
Increasing leaf longevity and disease resistance by altering salicylic acid catabolism
Gan, Susheng; Zhang, Kewei
2018-01-23
The present invention relates to a transgenic plant having an altered level of salicylic acid 3-hydroxylase ("S3H") protein, compared to that of a non-transgenic plant, where the transgenic plant displays an altered leaf senescence phenotype, relative to a non-transgenic plant. The present invention relates to a mutant plant comprising an inactivated gene encoding S3H protein, where the mutant plant displays a premature or precocious leaf senescence phenotype, relative to a non-mutant plant. The present invention also relates to methods for promoting premature or precocious leaf senescence in a plant, delaying leaf senescence in a plant, and making a mutant plant having a decreased level of S3H protein compared to that of a non-mutant plant, where the mutant plant displays a premature or precocious leaf senescence phenotype relative to a non-mutant plant. The present invention also relates to inducing or promoting pathogen resistance in plants.
-
Friendly fire: redirecting herpes simplex virus-1 for therapeutic applications.
Advani, S J; Weichselbaum, R R; Whitley, R J; Roizman, B
2002-09-01
Herpes simplex virus-1 (HSV-1) is a relatively large double-stranded DNA virus encoding at least 89 proteins with well characterized disease pathology. An understanding of the functions of viral proteins together with the ability to genetically engineer specific viral mutants has led to the development of attenuated HSV-1 for gene therapy. This review highlights the progress in creating attenuated genetically engineered HSV-1 mutants that are either replication competent (viral non-essential gene deleted) or replication defective (viral essential gene deleted). The choice between a replication-competent or -defective virus is based on the end-goal of the therapeutic intervention. Replication-competent HSV-1 mutants have primarily been employed as antitumor oncolytic viruses, with the lytic nature of the virus harnessed to destroy tumor cells selectively. In replacement gene therapy, replication-defective viruses have been utilized as delivery vectors. The advantages of HSV-1 vectors are that they infect quiescent and dividing cells efficiently and can encode for relatively large transgenes.
-
Galactose transport in Kluyveromyces lactis: major role of the glucose permease Hgt1.
Baruffini, Enrico; Goffrini, Paola; Donnini, Claudia; Lodi, Tiziana
2006-12-01
In Kluyveromyces lactis, galactose transport has been thought to be mediated by the lactose permease encoded by LAC12. In fact, a lac12 mutant unable to grow on lactose did not grow on galactose either and showed low and uninducible galactose uptake activity. The existence of other galactose transport systems, at low and at high affinity, had, however, been hypothesized on the basis of galactose uptake kinetics studies. Here we confirmed the existence of a second galactose transporter and we isolated its structural gene. It turned out to be HGT1, previously identified as encoding the high-affinity glucose carrier. Analysis of galactose transporter mutants, hgt1 and lac12, and the double mutant hgt1lac12, suggested that Hgt1 was the high-affinity and Lac12 was the low-affinity galactose transporter. HGT1 expression was strongly induced by galactose and insensitive to glucose repression. This could explain the rapid adaptation to galactose observed in K. lactis after a shift from glucose to galactose medium.
-
Asano, Kenji; Miyao, Akio; Hirochika, Hirohiko; Kitano, Hidemi; Matsuoka, Makoto; Ashikari, Motoyuki
2010-01-01
Plant height is one of the most important traits in crop improvement. Therefore revealing the mechanism of plant elongation and controlling plant height in accordance with breeding object is important. In this study we analyzed a novel dwarf mutant, ssd1, of which phenotype is different from typical GA- or BR-related dwarf phenotype. ssd1 exhibits pleiotropic defects in elongation of various organs such as stems, roots, leaves, and flowers. ssd1 also shows abnormal cell files and shapes, which suggests defects of normal cell division in the mutant. Map-based cloning and complementation test demonstrated that the dwarf phenotype in ssd1 mutant was caused by insertion of retrotransposon in a gene, which encodes plant-specific protein with unknown biochemical function. A BLAST search revealed that SSD1-like genes exist in diverse plant species, including monocots and dicots, but not fern and moss. Our results demonstrate that SSD1 controls plant elongation by controlling cell division in higher plants.
-
Kao, L R; Megraw, T L; Chae, C B
1993-06-15
The yeast mitochondrial histone protein HM is required for maintenance of the mitochondrial genome, and disruption of the gene encoding HM (HIM1/ABF2) results in formation of a respiration-deficient petite mutant phenotype. HM contains two homologous regions, which share sequence similarity with the eukaryotic nuclear nonhistone protein, HMG-1. Experiments with various deletion mutants of HM show that a single HMG domain of HM is functional and can restore respiration competency to cells that lack HM protein (him1 mutant cells). The gene encoding the putative yeast nuclear HMG-1 homolog, the NHP6A protein, can functionally complement the him1 mutation. These results suggest that the HMG domain is the basic unit for the function of HM in mitochondria and that the function of HMG-1 proteins in the nucleus and HM in the mitochondrion may be equivalent.
-
2008-04-01
IID on A pril 23, 2008 jb.asm .org D ow nloaded from metabolite-producing clusters encoding nonribosomal peptide or polyketide synthetases...BMA1848) encod- ing a subunit of acetolactate synthase III. The resultant mutant was not able to grow on minimal glucose medium and, similar to what has...caused by the wild type. BMAA1204 is a 4,200-residue CDS annotated as encoding a putative polyketide synthase (PKS) in COG family 0332. PKSs are
-
Microwave-Assisted Resolution of α-Lipoic Acid Catalyzed by an Ionic Liquid Co-Lyophilized Lipase.
Liu, Ning; Wang, Lei; Wang, Zhi; Jiang, Liyan; Wu, Zhuofu; Yue, Hong; Xie, Xiaona
2015-05-29
The combination of the ionic liquid co-lyophilized lipase and microwave irradiation was used to improve enzyme performance in enantioselective esterification of α-lipoic acid. Effects of various reaction conditions on enzyme activity and enantioselectivity were investigated. Under optimal condition, the highest enantioselectivity (E = 41.2) was observed with a high enzyme activity (178.1 μmol/h/mg) when using the ionic liquid co-lyophilized lipase with microwave assistance. Furthermore, the ionic liquid co-lyophilized lipase exhibited excellent reusability under low power microwave.
-
Research and Application of Lipoic Acid in Plants
NASA Astrophysics Data System (ADS)
Xiao, Renjie; Wang, Xiran; Jiang, Leiyu; Tang, Haoru
2018-01-01
Lipoic acid is a kind of small molecular compound with strong oxidizing properties. It has been widely used in medicine and has achieved good results since its discovery. However, it is less used in plants, and the biosynthetic pathway is not clear. The content in the plant is mainly measured by high-performance liquid chromatography(HPLC). At present, it is mainly used as an additive to the culture medium for plant tissue culture and Agrobacterium-mediated plant genetic transformation, in order to reduce the browning rate of explants, improve Agrobacterium-mediated genetic transformation efficiency.
-
Process Research and Development of Antibodies as Countermeasures for C. Botulinum
2006-03-01
acid , lipoic acid , phenol red, putrescine 2HCl, sodium pyruvate, and HEPES is same as HAM’SF12:IMDM (1:1). The concentrations of the glucose...Na2SeO3 0.0085 D-glucose 4000 Linoleic Acid 0.04 Lipoic Acid 0.105 Phenol Red 8.1 Putrescine 2HCl 0.0805 Sodium Pyruvate 110 HEPES 2979 L-Alanine...0.0134 Arachidonic acid 0.014 cholestrol 1.54 DL- alpha -tocopherol- acetate 0.49 Linoleic acid 0.07 linolenic acid 0.07 myristic acid 0.07
-
Cloning, Sequencing, and Characterization of the SdeAB Multidrug Efflux Pump of Serratia marcescens
Kumar, Ayush; Worobec, Elizabeth A.
2005-01-01
Serratia marcescens is an important nosocomial agent known for causing various infections in immunocompromised individuals. Resistance of this organism to a broad spectrum of antibiotics makes the treatment of infections very difficult. This study was undertaken to identify multidrug resistance efflux pumps in S. marcescens. Three mutant strains of S. marcescens were isolated in vitro by the serial passaging of a wild-type strain in culture medium supplemented with ciprofloxacin, norfloxacin, or ofloxacin. Fluoroquinolone accumulation assays were performed to detect the presence of a proton gradient-dependent efflux mechanism. Two of the mutant strains were found to be effluxing norfloxacin, ciprofloxacin, and ofloxacin, while the third was found to efflux only ofloxacin. A genomic library of S. marcescens wild-type strain UOC-67 was constructed and screened for RND pump-encoding genes by using DNA probes for two putative RND pump-encoding genes. Two different loci were identified: sdeAB, encoding an MFP and an RND pump, and sdeCDE, encoding an MFP and two different RND pumps. Northern blot analysis revealed overexpression of sdeB in two mutant strains effluxing fluoroquinolones. Analysis of the sdeAB and sdeCDE loci in Escherichia coli strain AG102MB, deficient in the RND pump (AcrB), revealed that gene products of sdeAB are responsible for the efflux of a diverse range of substrates that includes ciprofloxacin, norfloxacin, ofloxacin, chloramphenicol, sodium dodecyl sulfate, ethidium bromide, and n-hexane, while those of sdeCDE did not result in any change in susceptibilities to any of these agents. PMID:15793131
-
Cloning, sequencing, and characterization of the SdeAB multidrug efflux pump of Serratia marcescens.
Kumar, Ayush; Worobec, Elizabeth A
2005-04-01
Serratia marcescens is an important nosocomial agent known for causing various infections in immunocompromised individuals. Resistance of this organism to a broad spectrum of antibiotics makes the treatment of infections very difficult. This study was undertaken to identify multidrug resistance efflux pumps in S. marcescens. Three mutant strains of S. marcescens were isolated in vitro by the serial passaging of a wild-type strain in culture medium supplemented with ciprofloxacin, norfloxacin, or ofloxacin. Fluoroquinolone accumulation assays were performed to detect the presence of a proton gradient-dependent efflux mechanism. Two of the mutant strains were found to be effluxing norfloxacin, ciprofloxacin, and ofloxacin, while the third was found to efflux only ofloxacin. A genomic library of S. marcescens wild-type strain UOC-67 was constructed and screened for RND pump-encoding genes by using DNA probes for two putative RND pump-encoding genes. Two different loci were identified: sdeAB, encoding an MFP and an RND pump, and sdeCDE, encoding an MFP and two different RND pumps. Northern blot analysis revealed overexpression of sdeB in two mutant strains effluxing fluoroquinolones. Analysis of the sdeAB and sdeCDE loci in Escherichia coli strain AG102MB, deficient in the RND pump (AcrB), revealed that gene products of sdeAB are responsible for the efflux of a diverse range of substrates that includes ciprofloxacin, norfloxacin, ofloxacin, chloramphenicol, sodium dodecyl sulfate, ethidium bromide, and n-hexane, while those of sdeCDE did not result in any change in susceptibilities to any of these agents.
-
Suwa, Y; Wright, A D; Fukimori, F; Nummy, K A; Hausinger, R P; Holben, W E; Forney, L J
1996-01-01
The findings of previous studies indicate that the genes required for metabolism of the pesticide 2,4-dichlorophenoxyacetic acid (2,4-D) are typically encoded on broad-host-range plasmids. However, characterization of plasmid-cured strains of Burkholderia sp. strain RASC, as well as mutants obtained by transposon mutagenesis, suggested that the 2,4-D catabolic genes were located on the chromosome of this strain. Mutants of Burkholderia strain RASC unable to degrade 2,4-D (2,4-D- strains) were obtained by insertional inactivation with Tn5. One such mutant (d1) was shown to have Tn5 inserted in tfdARASC, which encodes 2,4-D/alpha-ketoglutarate dioxygenase. This is the first reported example of a chromosomally encoded tfdA. The tfdARASC gene was cloned from a library of wild-type Burkholderia strain RASC DNA and shown to express 2,4-D/alpha-ketoglutarate dioxygenase activity in Escherichia coli. The DNA sequence of the gene was determined and shown to be similar, although not identical, to those of isofunctional genes from other bacteria. Moreover, the gene product (TfdARASC) was purified and shown to be similar in molecular weight, amino-terminal sequence, and reaction mechanism to the canonical TfdA of Alcaligenes eutrophus JMP134. The data presented here indicate that tfdA genes can be found on the chromosome of some bacterial species and suggest that these catabolic genes are rather mobile and may be transferred by means other than conjugation. PMID:8779585
-
Hsieh, J; Liu, J; Kostas, S A; Chang, C; Sternberg, P W; Fire, A
1999-11-15
Context-dependent gene silencing is used by many organisms to stably modulate gene activity for large chromosomal regions. We have used tandem array transgenes as a model substrate in a screen for Caenorhabditis elegans mutants that affect context-dependent gene silencing in somatic tissues. This screen yielded multiple alleles of a previously uncharacterized gene, designated tam-1 (for tandem-array-modifier). Loss-of-function mutations in tam-1 led to a dramatic reduction in the activity of numerous highly repeated transgenes. These effects were apparently context dependent, as nonrepetitive transgenes retained activity in a tam-1 mutant background. In addition to the dramatic alterations in transgene activity, tam-1 mutants showed modest alterations in expression of a subset of endogenous cellular genes. These effects include genetic interactions that place tam-1 into a group called the class B synMuv genes (for a Synthetic Multivulva phenotype); this family plays a negative role in the regulation of RAS pathway activity in C. elegans. Loss-of-function mutants in other members of the class-B synMuv family, including lin-35, which encodes a protein similar to the tumor suppressor Rb, exhibit a hypersilencing in somatic transgenes similar to that of tam-1 mutants. Molecular analysis reveals that tam-1 encodes a broadly expressed nuclear protein with RING finger and B-box motifs.
-
Bozue, Joel; Cote, Christopher K; Webster, Wendy; Bassett, Anthony; Tobery, Steven; Little, Stephen; Swietnicki, Wieslaw
2012-07-01
Yersinia pestis is the causative agent responsible for bubonic and pneumonic plague. The bacterium uses the pLcr plasmid-encoded type III secretion system to deliver virulence factors into host cells. Delivery requires ATP hydrolysis by the YscN ATPase encoded by the yscN gene also on pLcr. A yscN mutant was constructed in the fully virulent CO92 strain containing a nonpolar, in-frame internal deletion within the gene. We demonstrate that CO92 with a yscN mutation was not able to secrete the LcrV protein (V-Antigen) and attenuated in a subcutaneous model of plague demonstrating that the YscN ATPase was essential for virulence. However, if the yscN mutant was complemented with a functional yscN gene in trans, virulence was restored. To evaluate the mutant as a live vaccine, Swiss-Webster mice were vaccinated twice with the ΔyscN mutant at varying doses and were protected against bubonic plague in a dose-dependent manner. Antibodies to F1 capsule but not to LcrV were detected in sera from the vaccinated mice. These preliminary results suggest a proof-of-concept for an attenuated, genetically engineered, live vaccine effective against bubonic plague. Published 2012. This article is a US Government work and is in the public domain in the USA.
-
Zaragoza, Oscar; de Virgilio, Claudio; Pontón, José; Gancedo, Carlos
2002-05-01
The gene CaTPS2 encoding trehalose-6-phosphate (T6P) phosphatase from Candida albicans has been cloned and disrupted in this organism. The Catps2/Catps2 mutant did not accumulate trehalose but accumulated high levels of T6P. Disruption of the two copies of the CaTPS2 gene did not abolish growth even at 42 degrees C, but decreased the growth rate. In the stationary phase, the Catps2/Catps2 mutant aggregated, more than 50% of its cells became permeable to propidium iodide and a large amount of protein was found in the culture medium. Aggregation occurred only at pH values higher than 7 and was avoided by osmoprotectants; it was never observed during the exponential phase of growth. The mutant formed colonies with a smooth border on Spider medium. Mice inoculated with 1.5 x 10(6) c.f.u. of wild-type cells died after 8 days, while 80% of those inoculated with the same number of c.f.u. of the Catps2/Catps2 mutant survived for at least 1 month. Reintroduction of the wild-type CaTPS2 gene in the Catps2/Catps2 mutant abolished the phenotypes described. It is hypothesized that the accumulation of T6P interferes with the assembly of a normal cell wall.
-
Fu, Fang-Fang; Dawe, R Kelly; Gent, Jonathan I
2018-06-08
Plants make use of distinct types of DNA methylation characterized by their DNA methyltransferases and modes of regulation. One type, RNA-directed DNA methylation (RdDM), is guided by small interfering RNAs (siRNAs) to the edges of transposons that are close to genes, areas called mCHH islands in maize (Zea mays). Another type, chromomethylation, is guided by histone H3 lysine 9 methylation to heterochromatin across the genome. We examined DNA methylation and small RNA expression in plant tissues that were mutant for both copies of the genes encoding chromomethylases as well as mutants for both copies of the genes encoding DECREASED DNA METHYLATION1 (DDM1)-type nucleosome remodelers, which facilitate chromomethylation. Both sets of double mutants were nonviable but produced embryos and endosperm. RdDM was severely compromised in the double mutant embryos, both in terms of DNA methylation and siRNAs. Loss of 24-nt siRNA from mCHH islands was coupled with a gain of 21-, 22-, and 24-nt siRNAs in heterochromatin. These results reveal a requirement for both chromomethylation and DDM1-type nucleosome remodeling for RdDM in mCHH islands, which we hypothesize is due to dilution of RdDM components across the genome when heterochromatin is compromised. © 2018 American Society of Plant Biologists. All rights reserved.
-
Analysis of isoniazid-resistant transposon mutants of Mycobacterium smegmatis.
Billman-Jacobe, H; Sloan, J; Coppel, R L
1996-10-15
The emergence of multidrug-resistant tuberculosis has renewed interest in the study of drug resistance in mycobacteria with the objective of improved chemotherapy. The genetic basis of isoniazid resistance in a model mycobacterium was studied. Eleven isoniazid-resistant mutants of Mycobacterium smegmatis were created using transposon mutagenesis. Genetic and enzymatic characterisation of the mutants showed that katG, encoding T-catalase, was inactivated. The nucleotide sequence of M. smegmatis katG was determined and the mutation sites mapped demonstrating that both the amino and carboxyl halves of T-catalase are important for enzymatic activity.
-
Kamerewerd, Jens; Jansson, Malin; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich
2008-09-01
Sordaria macrospora, a self-fertile filamentous ascomycete, carries genes encoding three different alpha-subunits of heterotrimeric G proteins (gsa, G protein Sordaria alpha subunit). We generated knockout strains for all three gsa genes (Deltagsa1, Deltagsa2, and Deltagsa3) as well as all combinations of double mutants. Phenotypic analysis of single and double mutants showed that the genes for Galpha-subunits have distinct roles in the sexual life cycle. While single mutants show some reduction of fertility, double mutants Deltagsa1Deltagsa2 and Deltagsa1Deltagsa3 are completely sterile. To test whether the pheromone receptors PRE1 and PRE2 mediate signaling via distinct Galpha-subunits, two recently generated Deltapre strains were crossed with all Deltagsa strains. Analyses of the corresponding double mutants revealed that compared to GSA2, GSA1 is a more predominant regulator of a signal transduction cascade downstream of the pheromone receptors and that GSA3 is involved in another signaling pathway that also contributes to fruiting body development and fertility. We further isolated the gene encoding adenylyl cyclase (AC) (sac1) for construction of a knockout strain. Analyses of the three DeltagsaDeltasac1 double mutants and one Deltagsa2Deltagsa3Deltasac1 triple mutant indicate that SAC1 acts downstream of GSA3, parallel to a GSA1-GSA2-mediated signaling pathway. In addition, the function of STE12 and PRO41, two presumptive signaling components, was investigated in diverse double mutants lacking those developmental genes in combination with the gsa genes. This analysis was further completed by expression studies of the ste12 and pro41 transcripts in wild-type and mutant strains. From the sum of all our data, we propose a model for how different Galpha-subunits interact with pheromone receptors, adenylyl cyclase, and STE12 and thus cooperatively regulate sexual development in S. macrospora.
-
Amiour, Nardjis; Imbaud, Sandrine; Clément, Gilles; Agier, Nicolas; Zivy, Michel; Valot, Benoît; Balliau, Thierry; Quilleré, Isabelle; Tercé-Laforgue, Thérèse; Dargel-Graffin, Céline; Hirel, Bertrand
2014-11-20
To identify the key elements controlling grain production in maize, it is essential to have an integrated view of the responses to alterations in the main steps of nitrogen assimilation by modification of gene expression. Two maize mutant lines (gln1.3 and gln1.4), deficient in two genes encoding cytosolic glutamine synthetase, a key enzyme involved in nitrogen assimilation, were previously characterized by a reduction of kernel size in the gln1.4 mutant and by a reduction of kernel number in the gln1.3 mutant. In this work, the differences in leaf gene transcripts, proteins and metabolite accumulation in gln1.3 and gln1.4 mutants were studied at two key stages of plant development, in order to identify putative candidate genes, proteins and metabolic pathways contributing on one hand to the control of plant development and on the other to grain production. The most interesting finding in this study is that a number of key plant processes were altered in the gln1.3 and gln1.4 mutants, including a number of major biological processes such as carbon metabolism and transport, cell wall metabolism, and several metabolic pathways and stress responsive and regulatory elements. We also found that the two mutants share common or specific characteristics across at least two or even three of the "omics" considered at the vegetative stage of plant development, or during the grain filling period. This is the first comprehensive molecular and physiological characterization of two cytosolic glutamine synthetase maize mutants using a combined transcriptomic, proteomic and metabolomic approach. We find that the integration of the three "omics" procedures is not straight forward, since developmental and mutant-specific levels of regulation seem to occur from gene expression to metabolite accumulation. However, their potential use is discussed with a view to improving our understanding of nitrogen assimilation and partitioning and its impact on grain production.
-
Blázquez, M A; Gamo, F J; Gancedo, C
1995-12-18
Yeasts with disruptions in the genes PYC1 and PYC2 encoding the isoenzymes of pyruvate carboxylase cannot grow in a glucose-ammonium medium (Stucka et al. (1991) Mol. Gen. Genet. 229, 307-315). We have isolated a dominant mutation, BPC1-1, that allows growth in this medium of yeasts with interrupted PYC1 and PYC2 genes. The BPC1-1 mutation abolishes catabolite repression of a series of genes and allows expression of the enzymes of the glyoxylate cycle during growth in glucose. A functional glyoxylate cycle is necessary for suppression as a disruption of gene ICL1 encoding isocitrate lyase abolished the phenotypic effect of BPC1-1 on growth in glucose-ammonium. Concurrent expression from constitutive promoters of genes ICL1 and MLS1 (encoding malate synthase) also suppressed the growth phenotype of pyc1 pyc2 mutants. The mutation BPC1-1 is either allelic or closely linked to the mutation DGT1-1.
-
Wang, L; Hu, X; Tao, G; Wang, X
2012-05-01
To investigate the role of lipopolysaccharide (LPS) structure in the stability of outer membrane and the ability of biofilm formation in Cronobacter sakazakii. A C. sakazakii mutant strain LWW02 was constructed by inactivating the gene ESA_04107 encoding for heptosyltransferase I. LPS were purified from LWW02, and changes in their structure were confirmed by thin-layer chromatography and electrospray ionization mass spectrometry. Comparing with the wild-type strain BAA-894, slower growth, higher membrane permeability, higher surface hydrophobicity, stronger ability of autoaggregation and biofilm formation were observed for the mutant strain LWW02. The gene ESA_04107 encodes heptosyltransferase I in C. sakazakii ATCC BAA-894. The cleavage of LPS in C. sakazakii could cause its outer membrane defects and increase its ability to form biofilms. The study is important for understanding the pathogenic mechanism and efficient control of C. sakazakii. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.
-
Brown, Dean G; Brown, Giles A; Centrella, Paolo; Certel, Kaan; Cooke, Robert M; Cuozzo, John W; Dekker, Niek; Dumelin, Christoph E; Ferguson, Andrew; Fiez-Vandal, Cédric; Geschwindner, Stefan; Guié, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Schlenker, Oliver; Sigel, Eric A; Snijder, Arjan; Soutter, Holly T; Sundström, Linda; Troast, Dawn M; Wiggin, Giselle; Zhang, Jing; Zhang, Ying; Clark, Matthew A
2018-06-01
The discovery of ligands via affinity-mediated selection of DNA-encoded chemical libraries is driven by the quality and concentration of the protein target. G-protein-coupled receptors (GPCRs) and other membrane-bound targets can be difficult to isolate in their functional state and at high concentrations, and therefore have been challenging for affinity-mediated selection. Here, we report a successful selection campaign against protease-activated receptor 2 (PAR2). Using a thermo-stabilized mutant of PAR2, we conducted affinity selection using our >100-billion-compound DNA-encoded library. We observed a number of putative ligands enriched upon selection, and subsequent cellular profiling revealed these ligands to comprise both agonists and antagonists. The agonist series shared structural similarity with known agonists. The antagonists were shown to bind in a novel allosteric binding site on the PAR2 protein. This report serves to demonstrate that cell-free affinity selection against GPCRs can be achieved with mutant stabilized protein targets.
-
Involvement of Clostridium botulinum ATCC 3502 Sigma Factor K in Early-Stage Sporulation
Kirk, David G.; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu
2012-01-01
A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σK is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods. PMID:22544236
-
Involvement of Clostridium botulinum ATCC 3502 sigma factor K in early-stage sporulation.
Kirk, David G; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu; Lindström, Miia
2012-07-01
A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σ(K) is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods.
-
Sasaki, Yoshie; Kojima, Ayumi; Shibata, Yuriko; Mitsuzawa, Hiroshi
2017-01-01
The fission yeast Schizosaccharomyces pombe undergoes a switch from yeast to filamentous invasive growth in response to certain environmental stimuli. Among them is ammonium limitation. Amt1, one of the three ammonium transporters in this yeast, is required for the ammonium limitation-induced morphological transition; however, the underlying molecular mechanism remains to be understood. Cells lacking Amt1 became capable of invasive growth upon increasing concentrations of ammonium in the medium, suggesting that the ammonium taken up into the cell or a metabolic intermediate in ammonium assimilation might serve as a signal for the ammonium limitation-induced morphological transition. To investigate the possible role of ammonium-metabolizing enzymes in the signaling process, deletion mutants were constructed for the gdh1, gdh2, gln1, and glt1 genes, which were demonstrated by enzyme assays to encode NADP-specific glutamate dehydrogenase, NAD-specific glutamate dehydrogenase, glutamine synthetase, and glutamate synthase, respectively. Growth tests on various nitrogen sources revealed that a gln1Δ mutant was a glutamine auxotroph and that a gdh1Δ mutant had a defect in growth on ammonium, particularly at high concentrations. The latter observation indicates that the NADP-specific glutamate dehydrogenase of S. pombe plays a major role in ammonium assimilation under high ammonium concentrations. Invasive growth assays showed that gdh1Δ and glt1Δ mutants underwent invasive growth to a lesser extent than did wild-type strains. Increasing the ammonium concentration in the medium suppressed the invasive growth defect of the glt1Δ mutant, but not the gdh1Δ mutant. These results suggest that the nitrogen status of the cell is important in the induction of filamentous invasive growth in S. pombe.
-
Characterization of Haemophilus ducreyi cdtA, cdtB, and cdtC Mutants in In Vitro and In Vivo Systems
Lewis, David A.; Stevens, Marla K.; Latimer, Jo L.; Ward, Christine K.; Deng, Kaiping; Blick, Robert; Lumbley, Sheryl R.; Ison, Catherine A.; Hansen, Eric J.
2001-01-01
Haemophilus ducreyi expresses a soluble cytolethal distending toxin (CDT) that is encoded by the cdtABC gene cluster and can be detected in culture supernatant fluid by its ability to kill HeLa cells. The cdtA, cdtB, and cdtC genes of H. ducreyi were cloned independently into plasmid vectors, and their encoded proteins expressed singly or in various combinations in an Escherichia coli background. All three gene products had to be expressed in order for E. coli-derived culture supernatant fluids to demonstrate cytotoxicity for HeLa cells. Isogenic H. ducreyi cdtA and cdtB mutants were constructed and used in combination with the wild-type parent strain and a previously described H. ducreyi cdtC mutant (M. K. Stevens, J. L. Latimer, S. R. Lumbley, C. K. Ward, L. D. Cope, T. Lagergard, and E. J. Hansen, Infect. Immun. 67:3900–3908, 1999) to determine the relative contributions of the CdtA, CdtB, and CdtC proteins to CDT activity. Expression of CdtA, CdtB, and CdtC appeared necessary for H. ducreyi-derived culture supernatant fluid to exhibit cytotoxicity for HeLa cells. Whole-cell sonicates and periplasmic extracts from the cdtB and cdtC mutants had no effect on HeLa cells, whereas these same fractions from a cdtA mutant had a very modest cytotoxic effect on these same human cells. CdtA appeared to be primarily associated with the H. ducreyi cell envelope, whereas both CdtB and CdtC were present primarily in the soluble fraction from sonicated cells. Both the cdtA mutant and the cdtB mutant were found to be fully virulent in the temperature-dependent rabbit model for experimental chancroid. PMID:11500438
-
Ratliff, Miriam; Hill-Harfe, Katherine L; Gleason, Elizabeth J; Ling, Huiping; Kroft, Tim L; L'Hernault, Steven W
2018-05-01
Covalent attachment of ubiquitin to substrate proteins changes their function or marks them for proteolysis, and the specificity of ubiquitin attachment is mediated by the numerous E3 ligases encoded by animals. Mind Bomb is an essential E3 ligase during Notch pathway signaling in insects and vertebrates. While Caenorhabditis elegans encodes a Mind Bomb homolog ( mib-1 ), it has never been recovered in the extensive Notch suppressor/enhancer screens that have identified numerous pathway components. Here, we show that C. elegans mib-1 null mutants have a spermatogenesis-defective phenotype that results in a heterogeneous mixture of arrested spermatocytes, defective spermatids, and motility-impaired spermatozoa. mib-1 mutants also have chromosome segregation defects during meiosis, molecular null mutants are intrinsically temperature-sensitive, and many mib-1 spermatids contain large amounts of tubulin. These phenotypic features are similar to the endogenous RNA intereference (RNAi) mutants, but mib-1 mutants do not affect RNAi. MIB-1 protein is expressed throughout the germ line with peak expression in spermatocytes followed by segregation into the residual body during spermatid formation. C. elegans mib-1 expression, while upregulated during spermatogenesis, also occurs somatically, including in vulva precursor cells. Here, we show that mib-1 mutants suppress both lin-12 and glp-1 ( C. elegans Notch) gain-of-function mutants, restoring anchor cell formation and a functional vulva to the former and partly restoring oocyte production to the latter. However, suppressed hermaphrodites are only observed when grown at 25°, and they are self-sterile. This probably explains why mib-1 was not previously recovered as a Notch pathway component in suppressor/enhancer selection experiments. Copyright © 2018 by the Genetics Society of America.
-
Kaniak, Aneta; Dzierzbicki, Piotr; Rogowska, Agata T; Malc, Ewa; Fikus, Marta; Ciesla, Zygmunt
2009-03-01
The proximity of the mitochondrial genome to the respiratory chain, a major source of ROS (radical oxygen species), makes mtDNA more vulnerable to oxidative damage than nuclear DNA. Mitochondrial BER (base excision repair) is generally considered to be the main pathway involved in the prevention of oxidative lesion-induced mutations in mtDNA. However, we previously demonstrated that the increased frequency of mitochondrial Oli(r) mutants in an ogg1Delta strain, lacking the activity of a crucial mtBER glycosylase, is reduced in the presence of plasmids encoding Msh1p, the mitochondrial homologue of the bacterial mismatch protein MutS. This finding suggested that Msh1p might be involved in the prevention of mitochondrial mutagenesis induced by oxidative stress. Here we show that a double mutant carrying the msh1-R813W allele, encoding a variant of the protein defective in the ATP hydrolysis activity, combined with deletion of SOD2, encoding the mitochondrial superoxide dismutase, displays a synergistic effect on the frequency of Oli(r) mutants, indicating that Msh1p prevents generation of oxidative lesion-induced mitochondrial mutations. We also show that double mutants carrying the msh1-R813W allele, combined with deletion of either OGG1 or APN1, the latter resulting in deficiency of the Apn1 endonuclease, exhibit a synergistic effect on the frequency of respiration-defective mutants having gross rearrangements of the mitochondrial genome. This suggests that Msh1p, Ogg1p and Apn1p play overlapping functions in maintaining the stability of mtDNA. In addition, we demonstrate, using a novel ARG8(m) recombination assay, that a surplus of Msh1p results in enhanced mitochondrial recombination. Interestingly, the mutant forms of the protein, msh1p-R813W and msh1p-G776D, fail to stimulate recombination. We postulate that the Msh1p-enhanced homologous recombination may play an important role in the prevention of oxidative lesion-induced rearrangements of the mitochondrial genome.
-
Galvan, Veronica; Brandimarti, Renato; Munger, Joshua; Roizman, Bernard
2000-01-01
Earlier reports have shown that herpes simplex virus 1 (HSV-1) mutants induce programmed cell death and that wild-type virus blocks the execution of the cell death program triggered by expression of viral genes, by the Fas and tumor necrosis factor pathways, or by nonspecific stress agents. In particular, an earlier report from this laboratory showed that the mutant virus d120 lacking the genes encoding infected cell protein 4 (ICP4), the major regulatory protein of the virus, induces a caspase-3-independent pathway of apoptosis in human SK-N-SH cells. Here we report that the pathway of apoptosis induced by the d120 mutant in human HEp-2 cells is caspase dependent. Specifically, in HEp-2 cells infected with d120, (i) a broad-range inhibitor of caspase activity, z-vad-FMK, efficiently blocked DNA fragmentation, (ii) cytochrome c was released into the cytoplasm, (iii) caspase-3 was activated inasmuch as poly(ADP-ribose) polymerase was cleaved, and (iv) chromatin condensation and fragmentation of cellular DNA were observed. In parallel studies, HEp-2 cells were transfected with a plasmid encoding human Bcl-2 and a clone (VAX-3) expressing high levels of Bcl-2 was selected. This report shows that Bcl-2 blocked all of the manifestations associated with programmed cell death caused by infection with the d120 mutant. Consistent with their resistance to programmed cell death, VAX-3 cells overproduced infected cell protein 0 (ICP0). An unexpected observation was that ICP0 encoded by the d120 mutant accumulated late in infection in small, quasi-uniform vesicle-like structures in all cell lines tested. Immunofluorescence-based colocalization studies indicated that these structures were not mitochondria or components of the endoplasmic reticulum or the late endosomal compartment. These studies affirm the conclusion that HSV can induce programmed cell death at multiple steps in the course of its replication, that the d120 mutant can induce both caspase-dependent and -independent pathways of programmed cell death, and that virus-induced stimuli of programmed cell death may differ with respect to the pathway that they activate. PMID:10644366
-
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses biotin operon transcription and ligates biotin to its cognate protein. PMID:26442940
-
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two enterobactin receptors probably illustrates a more general phenomenon of siderophore receptor redundancy in P. aeruginosa.
-
Biodegradation of the organic disulfide 4,4'-dithiodibutyric acid by Rhodococcus spp.
Khairy, Heba; Wübbeler, Jan Hendrik; Steinbüchel, Alexander
2015-12-01
Four Rhodococcus spp. exhibited the ability to use 4,4'-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Keith, Dove; Finlay, Liam; Butler, Judy
Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve thesemore » results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks.« less
-
Arikan, Murat; Togral, Guray; Hasturk, Askin Esen; Horasanli, Bahriye; Helvacioglu, Fatma; Dagdeviren, Atilla; Tekindal, Mustafa Agah; Parpucu, Murat
2016-01-01
To analyze the therapeutic effects of long-term alpha lipoic acid (A-LA) and vitamin B12 use via histomorphometric methods and electron microscopy in the transected sciatic nerves of rats. Forty rats were randomized into five groups (n=8/group). In group I, 1 cm segment of sciatic nerve was resected without any other intervention. In group II (sham), following right sciatic nerve transection, primary epineurial anastomosis was performed by placing the edges of the nerve end-to-end. In group III (saline), after right sciatic nerve transection, the ends of the nerves were brought together and closed after application of intraperitoneal physiologic saline. In group IV, 2 mg/kg of alpha lipoic acid and in group V, 2 mg/kg of vitamin B12 was administered intraperitoneally before surgical intervention. Histomorphometric and electron microscopic analyses revealed that vitamin B12 did not prevent structural changes, abnormal myelination and g-ratio deviations regarding the functional aspects of the sciatic nerve. Alpha lipoic acid was more effective in restructuring the histomorphometric and structural aspects of the nerve with more myelinated fibers with optimal values (0.55-0.68) than vitamin B12 groups, in which the number of myelinated nerve fibers significantly decreased at optimal intervals (0.55-0.68). A-LA administration following peripheral nerve transection injury is more effective in promoting nerve healing regarding the structural aspects of the sciatic nerve compared to vitamin B12 and also myelination of nerve fibers by increasing g-values.
-
NCI established the RAS Initiative to explore innovative approaches for attacking the proteins encoded by mutant forms of RAS genes and to ultimately create effective, new therapies for RAS-related cancers.
-
Mutations in sit B and sit D genes affect manganese-growth requirements in Sinorhizobium meliloti.
Platero, Raúl A; Jaureguy, Melina; Battistoni, Federico J; Fabiano, Elena R
2003-01-21
Two transposon-induced mutants of Sinorhizobium meliloti 242 were isolated based on their inability to grow on rich medium supplemented with the metal chelator ethylenediamine di-o-hydroxyphenylacetic acid (EDDHA) and either heme-compounds or siderophores as iron sources. Tagged loci of these mutants were identified as sit B and sit D genes. These genes encode components of an ABC (ATP-binding cassette) metal-type permease in several Gram-negative bacteria. In this work, the phenotypes of these two mutants were compared with those of two siderophore-mediated iron transport mutants. The results strongly implicate a role of the sit genes in manganese acquisition when this metal is limiting in S. meliloti.
-
Liu, Ziwen; Wang, Zhiyuan; Gu, Han; You, Jia; Hu, Manman; Zhang, Yujun; Zhu, Ze; Wang, Yihua; Liu, Shijia; Chen, Liangming; Liu, Xi; Tian, Yunlu; Zhou, Shirong; Jiang, Ling; Liu, Linglong; Wan, Jianmin
2018-01-01
The chloroplast is a self-independent organelle and contains its own transcription and translation systems. The establishment of genetic systems is vital for normal plant growth and development. We isolated a rice zebra leaf 16 (zl16) mutant derived from rice cultivar 9311. The zl16 mutant showed chlorotic abnormalities in the transverse sectors of the young leaves of seedlings. The use of transmission electron microscopy (TEM) demonstrated that dramatic defects occurred in variegated zl16 leaves during the early development of a chloroplast. Map-based cloning revealed that ZL16 encodes a β-hydroxyacyl-ACP dehydratase (HAD) involved in de novo fatty acid synthesis. Compared with the wild type, a missense mutation (Arg164Trp) in the zl16 mutant was identified, which significantly reduced enzymatic activity and altered the three-dimensional modeling structure of the putative protein. ZL16 was ubiquitously expressed in various plant organs, with a pronounced level in the young leaf. A subcellular localization experiment indicated that ZL16 was targeted in the chloroplast. Furthermore, we analyzed the expression of some nuclear genes involved in chloroplast development, and found they were altered in the zl16 mutant. RNA-Seq analysis indicated that some genes related to cell membrane constituents were downregulated in the mutant. An in vivo metabolic assay revealed that the total fatty acid content in the mutant was significantly decreased relative to the wild type. Our results indicate that HAD is essential for the development of chloroplasts by regulating the synthesis of fatty acids in rice. PMID:29946330
-
Takos, Adam; Lai, Daniela; Mikkelsen, Lisbeth; Abou Hachem, Maher; Shelton, Dale; Motawia, Mohammed Saddik; Olsen, Carl Erik; Wang, Trevor L.; Martin, Cathie; Rook, Fred
2010-01-01
Cyanogenesis, the release of hydrogen cyanide from damaged plant tissues, involves the enzymatic degradation of amino acid–derived cyanogenic glucosides (α-hydroxynitrile glucosides) by specific β-glucosidases. Release of cyanide functions as a defense mechanism against generalist herbivores. We developed a high-throughput screening method and used it to identify cyanogenesis deficient (cyd) mutants in the model legume Lotus japonicus. Mutants in both biosynthesis and catabolism of cyanogenic glucosides were isolated and classified following metabolic profiling of cyanogenic glucoside content. L. japonicus produces two cyanogenic glucosides: linamarin (derived from Val) and lotaustralin (derived from Ile). Their biosynthesis may involve the same set of enzymes for both amino acid precursors. However, in one class of mutants, accumulation of lotaustralin and linamarin was uncoupled. Catabolic mutants could be placed in two complementation groups, one of which, cyd2, encoded the β-glucosidase BGD2. Despite the identification of nine independent cyd2 alleles, no mutants involving the gene encoding a closely related β-glucosidase, BGD4, were identified. This indicated that BGD4 plays no role in cyanogenesis in L. japonicus in vivo. Biochemical analysis confirmed that BGD4 cannot hydrolyze linamarin or lotaustralin and in L. japonicus is specific for breakdown of related hydroxynitrile glucosides, such as rhodiocyanoside A. By contrast, BGD2 can hydrolyze both cyanogenic glucosides and rhodiocyanosides. Our genetic analysis demonstrated specificity in the catabolic pathways for hydroxynitrile glucosides and implied specificity in their biosynthetic pathways as well. In addition, it has provided important tools for elucidating and potentially modifying cyanogenesis pathways in plants. PMID:20453117
-
Duarte, M.; Sousa, R.; Videira, A.
1995-01-01
We have isolated and characterized the nuclear genes encoding the 12.3-kD subunit of the membrane arm and the 29.9-kD subunit of the peripheral arm of complex I from Neurospora crassa. The former gene was known to be located in linkage group I and the latter is now assigned to linkage group IV of the fungal genome. The genes were separately transformed into different N. crassa strains and transformants with duplicated DNA sequences were isolated. Selected transformants were then mated with other strains to generate repeat-induced point mutations in both copies of the genes present in the nucleus of the parental transformant. From the progeny of the crosses, we were then able to recover two individual mutants lacking the 12.3- and 29.9-kD proteins in their mitochondria, mutants nuo12.3 and nuo29.9, respectively. Several other subunits of complex I are present in the mutant organelles, although with altered stoichiometries as compared with those in the wild-type strain. Based on the analysis of Triton-solubilized mitochondrial complexes in sucrose gradients, neither mutant is able to fully assemble complex I. Our results indicate that mutant nuo12.3 separately assembles the peripheral arm and most of the membrane arm of the enzyme. Mutant nuo29.9 seems to accumulate the membrane arm of complex I and being devoid of the peripheral part. This implicates the 29.9-kD protein in an early step of complex I assembly. PMID:7768434
-
Zhang, Yanan; Niu, Xiangfeng; Shi, Mengliang; Pei, Guangsheng; Zhang, Xiaoqing; Chen, Lei; Zhang, Weiwen
2015-01-01
Cyanobacteria have been engineered to produce ethanol through recent synthetic biology efforts. However, one major challenge to the cyanobacterial systems for high-efficiency ethanol production is their low tolerance to the ethanol toxicity. With a major goal to identify novel transporters involved in ethanol tolerance, we constructed gene knockout mutants for 58 transporter-encoding genes of Synechocystis sp. PCC 6803 and screened their tolerance change under ethanol stress. The efforts allowed discovery of a mutant of slr0982 gene encoding an ATP-binding cassette transporter which grew poorly in BG11 medium supplemented with 1.5% (v/v) ethanol when compared with the wild type, and the growth loss could be recovered by complementing slr0982 in the Δslr0982 mutant, suggesting that slr0982 is involved in ethanol tolerance in Synechocystis. To decipher the tolerance mechanism involved, a comparative metabolomic and network-based analysis of the wild type and the ethanol-sensitive Δslr0982 mutant was performed. The analysis allowed the identification of four metabolic modules related to slr0982 deletion in the Δslr0982 mutant, among which metabolites like sucrose and L-pyroglutamic acid which might be involved in ethanol tolerance, were found important for slr0982 deletion in the Δslr0982 mutant. This study reports on the first transporter related to ethanol tolerance in Synechocystis, which could be a useful target for further tolerance engineering. In addition, metabolomic and network analysis provides important findings for better understanding of the tolerance mechanism to ethanol stress in Synechocystis. PMID:26052317
-
α2-COP is involved in early secretory traffic in Arabidopsis and is required for plant growth
Gimeno-Ferrer, Fátima; Pastor-Cantizano, Noelia; Bernat-Silvestre, César; Selvi-Martínez, Pilar; Vera-Sirera, Francisco; Gao, Caiji; Perez-Amador, Miguel Angel; Jiang, Liwen; Aniento, Fernando
2017-01-01
Abstract COP (coat protein) I-coated vesicles mediate intra-Golgi transport and retrograde transport from the Golgi to the endoplasmic reticulum. These vesicles form through the action of the small GTPase ADP-ribosylation factor 1 (ARF1) and the COPI heptameric protein complex (coatomer), which consists of seven subunits (α-, β-, β′-, γ-, δ-, ε- and ζ-COP). In contrast to mammals and yeast, several isoforms for coatomer subunits, with the exception of γ and δ, have been identified in Arabidopsis. To understand the role of COPI proteins in plant biology, we have identified and characterized a loss-of-function mutant of α2-COP, an Arabidopsis α-COP isoform. The α2-cop mutant displayed defects in plant growth, including small rosettes, stems and roots and mislocalization of p24δ5, a protein of the p24 family containing a C-terminal dilysine motif involved in COPI binding. The α2-cop mutant also exhibited abnormal morphology of the Golgi apparatus. Global expression analysis of the α2-cop mutant revealed altered expression of plant cell wall-associated genes. In addition, a strong upregulation of SEC31A, which encodes a subunit of the COPII coat, was observed in the α2-cop mutant; this also occurs in a mutant of a gene upstream of COPI assembly, GNL1, which encodes an ARF-guanine nucleotide exchange factor (GEF). These findings suggest that loss of α2-COP affects the expression of secretory pathway genes. PMID:28025315
-
Metabolic pathway profiling of mitochondrial respiratory chain mutants in C. elegans
MJ, Falk; Z, Zhang; Rosenjack; Nissim; E, Daikhin; Nissim; MM, Sedensky; M, Yudkoff; PG, Morgan
2008-01-01
C. elegans affords a model of primary mitochondrial dysfunction that provides insight into cellular adaptations which accompany mutations in nuclear gene that encode mitochondrial proteins. To this end, we characterized genome-wide expression profiles of C. elegans strains with mutations in nuclear-encoded subunits of respiratory chain complexes. Our goal was to detect concordant changes among clusters of genes that comprise defined metabolic pathways. Results indicate that respiratory chain mutants significantly upregulate a variety of basic cellular metabolic pathways involved in carbohydrate, amino acid, and fatty acid metabolism, as well as cellular defense pathways such as the metabolism of P450 and glutathione. To further confirm and extend expression analysis findings, quantitation of whole worm free amino acid levels was performed in C. elegans mitochondrial mutants for subunits of complexes I, II, and III. Significant differences were seen for 13 of 16 amino acid levels in complex I mutants compared with controls, as well as overarching similarities among profiles of complex I, II, and III mutants compared with controls. The specific pattern of amino acid alterations observed provides novel evidence to suggest that an increase in glutamate-linked transamination reactions caused by the failure of NAD+ dependent oxidation of ketoacids occurs in primary mitochondrial respiratory chain mutants. Recognition of consistent alterations among patterns of nuclear gene expression for multiple biochemical pathways and in quantitative amino acid profiles in a translational genetic model of mitochondrial dysfunction allows insight into the complex pathogenesis underlying primary mitochondrial disease. Such knowledge may enable the development of a metabolomic profiling diagnostic tool applicable to human mitochondrial disease. PMID:18178500
-
Brockmann-Gretza, Olaf; Kalinowski, Jörn
2006-01-01
Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (p)ppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (p)ppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX) in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be responsible for the complex transcriptional patterns detected in the rel mutant when compared directly with its rel-proficient parent strain. Conclusion In C. glutamicum the stringent response enfolds a fast answer to an induced amino acid starvation on the transcriptome level. It also showed some significant differences to the transcriptional reactions occuring in Escherichia coli and Bacillus subtilis. Notable are the rel-dependent regulation of the nitrogen metabolism genes and the rel-independent regulation of the genes encoding ribosomal proteins. PMID:16961923
-
Safadi, Rim Al; Mereghetti, Laurent; Salloum, Mazen; Lartigue, Marie-Frédérique; Virlogeux-Payant, Isabelle; Quentin, Roland; Rosenau, Agnès
2011-01-01
Group B streptococcus (GBS) strains with the highest ability to bind to human fibrinogen belong to the highly invasive clonal complex (CC) 17. To investigate the fibrinogen-binding mechanisms of CC17 strains, we determined the prevalence of fibrinogen-binding genes (fbsA and fbsB), and fbs regulator genes (rogB encoding an fbsA activator, rovS encoding an fbsA repressor and rgf encoding a two-component system [TCS] whose role on fbs genes was not determined yet) in a collection of 134 strains representing the major CCs of the species. We showed that specific gene combinations were related to particular CCs; only CC17 strains contained the fbsA, fbsB, and rgf genes combination. Non polar rgfAC deletion mutants of three CC17 serotype III strains were constructed. They showed a 3.2- to 5.1-fold increase of fbsA transcripts, a 4.8- to 6.7-fold decrease of fbsB transcripts, and a 52% to 68% decreased fibrinogen-binding ability, demonstrating that the RgfA/RgfC TCS inhibits the fbsA gene and activates the fbsB gene. The relative contribution of the two fbs genes in fibrinogen-binding ability was determined by constructing isogenic fbsA, fbsB, deletion mutants of the three CC17 strains. The ability to bind to fibrinogen was reduced by 49% to 57% in ΔfbsA mutants, and by 78% to 80% in ΔfbsB mutants, suggesting that FbsB protein plays a greater role in the fibrinogen-binding ability of CC17 strains. Moreover, the relative transcription level of fbsB gene was 9.2- to 12.7-fold higher than that of fbsA gene for the three wild type strains. Fibrinogen-binding ability could be restored by plasmid-mediated expression of rgfAC, fbsA, and fbsB genes in the corresponding deletion mutants. Thus, our results demonstrate that a specific combination of fbs genes and fbs regulator genes account for the high fibrinogen-binding ability of CC17 strains that may participate to their enhanced invasiveness for neonates as compared to strains of other CCs. PMID:21326613
-
Chronic antioxidant therapy reduces oxidative stress in a mouse model of Alzheimer's disease.
Siedlak, Sandra L; Casadesus, Gemma; Webber, Kate M; Pappolla, Miguel A; Atwood, Craig S; Smith, Mark A; Perry, George
2009-02-01
Oxidative modifications are a hallmark of oxidative imbalance in the brains of individuals with Alzheimer's, Parkinson's and prion diseases and their respective animal models. While the causes of oxidative stress are relatively well-documented, the effects of chronically reducing oxidative stress on cognition, pathology and biochemistry require further clarification. To address this, young and aged control and amyloid-beta protein precursor-over-expressing mice were fed a diet with added R-alpha lipoic acid for 10 months to determine the effect of chronic antioxidant administration on the cognition and neuropathology and biochemistry of the brain. Both wild type and transgenic mice treated with R-alpha lipoic acid displayed significant reductions in markers of oxidative modifications. On the other hand, R-alpha lipoic acid had little effect on Y-maze performance throughout the study and did not decrease end-point amyloid-beta load. These results suggest that, despite the clear role of oxidative stress in mediating amyloid pathology and cognitive decline in ageing and AbetaPP-transgenic mice, long-term antioxidant therapy, at levels within tolerable nutritional guidelines and which reduce oxidative modifications, have limited benefit.
-
Zhang, Yongjun; Zhao, Jianhua; Fang, Weiguo; Zhang, Jianqing; Luo, Zhibing; Zhang, Mi; Fan, Yanhua; Pei, Yan
2009-06-01
Beauveria bassiana is an economically important insect-pathogenic fungus which is widely used as a biocontrol agent to control a variety of insect pests. However, its insecticide efficacy in the field is often influenced by adverse environmental factors. Thus, understanding the genetic regulatory processes involved in the response to environmental stress would facilitate engineering and production of a more efficient biocontrol agent. Here, a mitogen-activated protein kinase (MAPK)-encoding gene, Bbhog1, was isolated from B. bassiana and shown to encode a functional homolog of yeast HIGH-OSMOLARITY GLYCEROL 1 (HOG1). A Bbhog1 null mutation was generated in B. bassiana by targeted gene replacement, and the resulting mutants were more sensitive to hyperosmotic stress, high temperature, and oxidative stress than the wild-type controls. These results demonstrate the conserved function of HOG1 MAPKs in the regulation of abiotic stress responses. Interestingly, DeltaBbhog1 mutants exhibited greatly reduced pathogenicity, most likely due to a decrease in spore viability, a reduced ability to attach to insect cuticle, and a reduction in appressorium formation. The transcript levels of two hydrophobin-encoding genes, hyd1 and hyd2, were dramatically decreased in a DeltaBbhog1 mutant, suggesting that Bbhog1 may regulate the expression of the gene associated with hydrophobicity or adherence.
-
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
-
A Shigella flexneri Virulence Plasmid Encoded Factor Controls Production of Outer Membrane Vesicles
Sidik, Saima; Kottwitz, Haila; Benjamin, Jeremy; Ryu, Julie; Jarrar, Ameer; Garduno, Rafael; Rohde, John R.
2014-01-01
Shigella spp. use a repertoire of virulence plasmid-encoded factors to cause shigellosis. These include components of a Type III Secretion Apparatus (T3SA) that is required for invasion of epithelial cells and many genes of unknown function. We constructed an array of 99 deletion mutants comprising all genes encoded by the virulence plasmid (excluding those known to be required for plasmid maintenance) of Shigella flexneri. We screened these mutants for their ability to bind the dye Congo red: an indicator of T3SA function. This screen focused our attention on an operon encoding genes that modify the cell envelope including virK, a gene of partially characterized function. We discovered that virK is required for controlled release of proteins to the culture supernatant. Mutations in virK result in a temperature-dependent overproduction of outer membrane vesicles (OMVs). The periplasmic chaperone/protease DegP, a known regulator of OMV production in Escherichia coli (encoded by a chromosomal gene), was found to similarly control OMV production in S. flexneri. Both virK and degP show genetic interactions with mxiD, a structural component of the T3SA. Our results are consistent with a model in which VirK and DegP relieve the periplasmic stress that accompanies assembly of the T3SA. PMID:25378474
-
Zheng, Hong; Yu, Wen-Mei; Waclaw, Ronald R; Kontaridis, Maria I; Neel, Benjamin G; Qu, Cheng-Kui
2018-03-20
Catalytically activating mutations in Ptpn11 , which encodes the protein tyrosine phosphatase SHP2, cause 50% of Noonan syndrome (NS) cases, whereas inactivating mutations in Ptpn11 are responsible for nearly all cases of the similar, but distinct, developmental disorder Noonan syndrome with multiple lentigines (NSML; formerly called LEOPARD syndrome). However, both types of disease mutations are gain-of-function mutations because they cause SHP2 to constitutively adopt an open conformation. We found that the catalytic activity of SHP2 was required for the pathogenic effects of gain-of-function, disease-associated mutations on the development of hydrocephalus in the mouse. Targeted pan-neuronal knockin of a Ptpn11 allele encoding the active SHP2 E76K mutant resulted in hydrocephalus due to aberrant development of ependymal cells and their cilia. These pathogenic effects of the E76K mutation were suppressed by the additional mutation C459S, which abolished the catalytic activity of SHP2. Moreover, ependymal cells in NSML mice bearing the inactive SHP2 mutant Y279C were also unaffected. Mechanistically, the SHP2 E76K mutant induced developmental defects in ependymal cells by enhancing dephosphorylation and inhibition of the transcription activator STAT3. Whereas STAT3 activity was reduced in Ptpn11 E76K/+ cells, the activities of the kinases ERK and AKT were enhanced, and neural cell-specific Stat3 knockout mice also manifested developmental defects in ependymal cells and cilia. These genetic and biochemical data demonstrate a catalytic-dependent role of SHP2 gain-of-function disease mutants in the pathogenesis of hydrocephalus. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
-
Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan
2018-06-01
Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.
-
López-Fernández, Loida; Ruiz-Roldán, Carmen; Pareja-Jaime, Yolanda; Prieto, Alicia; Khraiwesh, Husam; Roncero, M. Isabel G.
2013-01-01
With the aim to decipher the molecular dialogue and cross talk between Fusarium oxysporum f.sp. lycopersci and its host during infection and to understand the molecular bases that govern fungal pathogenicity, we analysed genes presumably encoding N-acetylglucosaminyl transferases, involved in glycosylation of glycoproteins, glycolipids, proteoglycans or small molecule acceptors in other microorganisms. In silico analysis revealed the existence of seven putative N-glycosyl transferase encoding genes (named gnt) in F. oxysporum f.sp. lycopersici genome. gnt2 deletion mutants showed a dramatic reduction in virulence on both plant and animal hosts. Δgnt2 mutants had αalterations in cell wall properties related to terminal αor β-linked N-acetyl glucosamine. Mutant conidia and germlings also showed differences in structure and physicochemical surface properties. Conidial and hyphal aggregation differed between the mutant and wild type strains, in a pH independent manner. Transmission electron micrographs of germlings showed strong cell-to-cell adherence and the presence of an extracellular chemical matrix. Δgnt2 cell walls presented a significant reduction in N-linked oligosaccharides, suggesting the involvement of Gnt2 in N-glycosylation of cell wall proteins. Gnt2 was localized in Golgi-like sub-cellular compartments as determined by fluorescence microscopy of GFP::Gnt2 fusion protein after treatment with the antibiotic brefeldin A or by staining with fluorescent sphingolipid BODIPY-TR ceramide. Furthermore, density gradient ultracentrifugation allowed co-localization of GFP::Gnt2 fusion protein and Vps10p in subcellular fractions enriched in Golgi specific enzymatic activities. Our results suggest that N-acetylglucosaminyl transferases are key components for cell wall structure and influence interactions of F. oxysporum with both plant and animal hosts during pathogenicity. PMID:24416097
-
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
-
Chaperone-mediated autophagy degrades mutant p53
Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying
2013-01-01
Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924
-
USDA-ARS?s Scientific Manuscript database
The latency-related (LR)-RNA encoded by bovine herpes virus 1 (BoHV-1) is abundantly expressed in latently infected sensory neurons. Although the LR gene encodes several products, ORF2 appears to play a dominant role during the latency-reactivation cycle because a mutant virus containing stop codons...
-
USDA-ARS?s Scientific Manuscript database
Escherichia coli O157:H7 colonizes cattle intestines by using locus of enterocyte effacement (LEE)-encoded proteins. Induction of systemic immune response against LEE-encoded proteins, therefore, will prove effective in reducing E. coli O157:H7 colonization in cattle. Previous studies have demonstra...
-
Buczynski, Kimberly A; Kim, Seong K; O'Callaghan, Dennis J
2005-10-01
The sole immediate-early (IE) gene of equine herpesvirus 1 (EHV-1) encodes a major regulatory protein of 1487 amino acids (aa) capable of modulating gene expression from both early and late promoters and also of trans-repressing its own promoter. Using a specially designed recombination system and a library of IE linker-insertion, deletion, point, and nonsense mutant constructs that encode forms of the IE protein (IEP) harboring mutations within all five regions, 17 mutant viruses were generated and characterized. Ribonuclease protection analyses revealed that all 17 mutants synthesize the IE mRNA in RK-13 cells, whereas those that failed to replicate on non-complementing RK-13 cells displayed a defect in the transcription of either an important early gene (EICP0) and/or an essential late gene (glycoprotein D). Western blot analyses showed that the IEP was synthesized and detectable in cells infected with each mutant virus, including those mutants that failed to replicate on non-complementing RK-13 cells. Eleven of the 17 mutants were capable of growth on non-complementing RK-13 cells, whereas mutant viruses with deletions within the serine-rich tract (SRT), nucleus localization signal (NLS), or DNA-binding domain (DBD) were capable of growth only on the IEP-producing cell line (IE13.1). Lastly, temperature shift experiments revealed that mutant viruses containing deletions within the C-terminus (KyAn1029 and KyAn1411) or within the SRT (KyADeltaSRT2) of the IEP exhibited a temperature-sensitive phenotype in that these viruses, in contrast to the parent KyA, failed to replicate at 39 degrees C. Overall, these results indicate that the C-terminus of the IEP is not essential for IEP function in cell culture, but this region contains elements that enhance the function(s) of the IEP. The initial characterization of these 17 EHV-1 mutants has shown that sequences totaling at least 43% of the IEP are not essential for virus replication in cell culture.
-
Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane
2016-11-10
Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.
-
Yang, Hongfang; Medeiros, Patricia F; Raha, Kaushik; Elkins, Patricia; Lind, Kenneth E; Lehr, Ruth; Adams, Nicholas D; Burgess, Joelle L; Schmidt, Stanley J; Knight, Steven D; Auger, Kurt R; Schaber, Michael D; Franklin, G Joseph; Ding, Yun; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Skinner, Steven R; Clark, Matthew A; Cuozzo, John W; Evindar, Ghotas
2015-05-14
In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein.
-
2015-01-01
In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein. PMID:26005528
-
Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-10-01
For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase (FAS-II) system. In this study, we reported genetic evidence demonstrating that the FAS-I system is the source of the biotin precursor in vivo in the engineered biotin-prototrophic C. glutamicum strain. This study also uncovered the important physiological role of FasB in lipoic acid biosynthesis. Here, we present an FAS-I enzyme that functions in supplying the lipoic acid precursor, although its biosynthesis has been believed to exclusively depend on FAS-II in organisms. The findings obtained here provide new insights into the metabolic engineering of this industrially important microorganism to produce these compounds effectively. Copyright © 2017 American Society for Microbiology.
-
Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-01-01
ABSTRACT For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI. Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA. These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum. IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis, which use an individual nonaggregating type II fatty acid synthase (FAS-II) system. In this study, we reported genetic evidence demonstrating that the FAS-I system is the source of the biotin precursor in vivo in the engineered biotin-prototrophic C. glutamicum strain. This study also uncovered the important physiological role of FasB in lipoic acid biosynthesis. Here, we present an FAS-I enzyme that functions in supplying the lipoic acid precursor, although its biosynthesis has been believed to exclusively depend on FAS-II in organisms. The findings obtained here provide new insights into the metabolic engineering of this industrially important microorganism to produce these compounds effectively. PMID:28754705
-
Shima, Jun; Sakata-Tsuda, Yuko; Suzuki, Yasuo; Nakajima, Ryouichi; Watanabe, Hajime; Kawamoto, Shinichi; Takano, Hiroyuki
2003-01-01
The effect of intracellular charged amino acids on freeze tolerance in dough was determined by constructing homozygous diploid arginase-deficient mutants of commercial baker's yeast. An arginase mutant accumulated higher levels of arginine and/or glutamate and showed increased leavening ability during the frozen-dough baking process, suggesting that disruption of the CAR1 gene enhances freeze tolerance.
-
Brown, Steven; Guss, Adam; Yang, Shihui; Karpinets, Tatiana; Lynd, Lee; Shao, Xiongjun
2014-01-14
The present invention provides isolated nucleic acid molecules which encode a mutant acetaldehyde-CoA/alcohol dehydrogenase or mutant alcohol dehydrogenase and confer enhanced tolerance to ethanol. The invention also provides related expression vectors, genetically engineered microorganisms having enhanced tolerance to ethanol, as well as methods of making and using such genetically modified microorganisms for production of biofuels based on fermentation of biomass materials.
-
Phosphate assimilation in Rhizobium (Sinorhizobium) meliloti: identification of a pit-like gene.
Bardin, S D; Voegele, R T; Finan, T M
1998-08-01
Rhizobium meliloti mutants defective in the phoCDET-encoded phosphate transport system form root nodules on alfalfa plants that fail to fix nitrogen (Fix-). We have previously reported that two classes of second-site mutations can suppress the Fix- phenotype of phoCDET mutants to Fix+. Here we show that one of these suppressor loci (sfx1) contains two genes, orfA and pit, which appear to form an operon transcribed in the order orfA-pit. The Pit protein is homologous to various phosphate transporters, and we present evidence that three suppressor mutations arose from a single thymidine deletion in a hepta-thymidine sequence centered 54 nucleotides upstream of the orfA transcription start site. This mutation increased the level of orfA-pit transcription. These data, together with previous biochemical evidence, show that the orfA-pit genes encode a Pi transport system that is expressed in wild-type cells grown with excess Pi but repressed in cells under conditions of Pi limitation. In phoCDET mutant cells, orfA-pit expression is repressed, but this repression is alleviated by the second-site suppressor mutations. Suppression increases orfA-pit expression compensating for the deficiencies in phosphate assimilation and symbiosis of the phoCDET mutants.
-
King, Amy M; Bartpho, Thanatchaporn; Sermswan, Rasana W; Bulach, Dieter M; Eshghi, Azad; Picardeau, Mathieu; Adler, Ben; Murray, Gerald L
2013-08-01
Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.
-
The ADAR RNA editing enzyme controls neuronal excitability in Drosophila melanogaster
Li, Xianghua; Overton, Ian M.; Baines, Richard A.; Keegan, Liam P.; O’Connell, Mary A.
2014-01-01
RNA editing by deamination of specific adenosine bases to inosines during pre-mRNA processing generates edited isoforms of proteins. Recoding RNA editing is more widespread in Drosophila than in vertebrates. Editing levels rise strongly at metamorphosis, and Adar5G1 null mutant flies lack editing events in hundreds of CNS transcripts; mutant flies have reduced viability, severely defective locomotion and age-dependent neurodegeneration. On the other hand, overexpressing an adult dADAR isoform with high enzymatic activity ubiquitously during larval and pupal stages is lethal. Advantage was taken of this to screen for genetic modifiers; Adar overexpression lethality is rescued by reduced dosage of the Rdl (Resistant to dieldrin), gene encoding a subunit of inhibitory GABA receptors. Reduced dosage of the Gad1 gene encoding the GABA synthetase also rescues Adar overexpression lethality. Drosophila Adar5G1 mutant phenotypes are ameliorated by feeding GABA modulators. We demonstrate that neuronal excitability is linked to dADAR expression levels in individual neurons; Adar-overexpressing larval motor neurons show reduced excitability whereas Adar5G1 null mutant or targeted Adar knockdown motor neurons exhibit increased excitability. GABA inhibitory signalling is impaired in human epileptic and autistic conditions, and vertebrate ADARs may have a relevant evolutionarily conserved control over neuronal excitability. PMID:24137011
-
Expression of acrA and acrB Genes in Esherichia coli Mutants with or without marR or acrR Mutations
Pourahmad Jaktaji, Razieh; Jazayeri, Nasim
2013-01-01
Objective(s): The major antibiotic efflux pump of Esherichia coli is AcrAB-TolC. The first part of the pump, AcrAB, is encoded by acrAB operon. The expression of this operon can be kept elevated by overexpression of an activator, MarA following inactivation of MarR and AcrR repressors due to mutation in encoding genes, marR and acrR, respectively. The aims of this research were to use E. coli mutants with or without mutation in marR to search for the presence of possible mutation in acrR and to quantify the expression of acrAB. Materials and Methods: The DNA binding region of acrR gene in these mutants were amplified by PCR and sequenced. The relative expression of acrA and acrB were determined by real time PCR. Results: Results showed that W26 and C14 had the same mutation in acrR, but none of the mutants overexpressed acrA and acrB in comparison with wild type strain. Conclusions: The effect of marR or acrR mutation on acrAB overexpression is dependent on levels of resistance to tetracycline and ciprofloxacin. PMID:24570831
-
Li, Ya; Zhu, Jindong; Hu, Jiexiong; Meng, Xiuli; Zhang, Qi; Zhu, Kunpeng; Chen, Xiaomin; Chen, Xuehang; Li, Guangpu; Wang, Zonghua; Lu, Guodong
2016-01-01
Electron-transferring flavoprotein (ETF) and its dehydrogenase (ETFDH) are highly conserved electron carriers which mainly function in mitochondrial fatty acid β oxidation. Here, we report the identification and characterization of ETF α and β subunit encoding genes (ETFA and ETFB) and ETFDH encoding gene (ETFDH) in the rice blast fungus Magnaporthe oryzae. It was demonstrated that, by impacting fatty acid metabolism, ETF and ETFDH mutations led to severe growth and conidiation defects, which could be largely rescued by exogenous acetate or carbonate. Furthermore, although conidium germination and appressorium formation appeared to be normal in ETF and ETFDH mutants, most appressoria failed to penetrate the host epidermis due to low turgor pressure. The few appressoria that succeeded in penetration were severely restricted in invasive growth and consequently failed to cause disease. Moreover, ETF mutant etfb− induced ROS accumulation in infected host cells and exogenous antioxidant GSH accelerated mutant invading growth without increasing the penetration rate. In addition, mutant etfb− displayed elevated lipid body accumulation and reduced ATP synthesis. Taken together, ETF and ETFDH play an important role in fungal development and plant infection in M. oryzae by regulation of fatty acid metabolism, turgor establishment and induction of host ROS accumulation. PMID:27113712
-
Li, Ya; Zhu, Jindong; Hu, Jiexiong; Meng, Xiuli; Zhang, Qi; Zhu, Kunpeng; Chen, Xiaomin; Chen, Xuehang; Li, Guangpu; Wang, Zonghua; Lu, Guodong
2016-04-26
Electron-transferring flavoprotein (ETF) and its dehydrogenase (ETFDH) are highly conserved electron carriers which mainly function in mitochondrial fatty acid β oxidation. Here, we report the identification and characterization of ETF α and β subunit encoding genes (ETFA and ETFB) and ETFDH encoding gene (ETFDH) in the rice blast fungus Magnaporthe oryzae. It was demonstrated that, by impacting fatty acid metabolism, ETF and ETFDH mutations led to severe growth and conidiation defects, which could be largely rescued by exogenous acetate or carbonate. Furthermore, although conidium germination and appressorium formation appeared to be normal in ETF and ETFDH mutants, most appressoria failed to penetrate the host epidermis due to low turgor pressure. The few appressoria that succeeded in penetration were severely restricted in invasive growth and consequently failed to cause disease. Moreover, ETF mutant etfb(-) induced ROS accumulation in infected host cells and exogenous antioxidant GSH accelerated mutant invading growth without increasing the penetration rate. In addition, mutant etfb(-) displayed elevated lipid body accumulation and reduced ATP synthesis. Taken together, ETF and ETFDH play an important role in fungal development and plant infection in M. oryzae by regulation of fatty acid metabolism, turgor establishment and induction of host ROS accumulation.
-
GOLD HULL AND INTERNODE2 Encodes a Primarily Multifunctional Cinnamyl-Alcohol Dehydrogenase in Rice1
Zhang, Kewei; Qian, Qian; Huang, Zejun; Wang, Yiqin; Li, Ming; Hong, Lilan; Zeng, Dali; Gu, Minghong; Chu, Chengcai; Cheng, Zhukuan
2006-01-01
Lignin content and composition are two important agronomic traits for the utilization of agricultural residues. Rice (Oryza sativa) gold hull and internode phenotype is a classical morphological marker trait that has long been applied to breeding and genetics study. In this study, we have cloned the GOLD HULL AND INTERNODE2 (GH2) gene in rice using a map-based cloning approach. The result shows that the gh2 mutant is a lignin-deficient mutant, and GH2 encodes a cinnamyl-alcohol dehydrogenase (CAD). Consistent with this finding, extracts from roots, internodes, hulls, and panicles of the gh2 plants exhibited drastically reduced CAD activity and undetectable sinapyl alcohol dehydrogenase activity. When expressed in Escherichia coli, purified recombinant GH2 was found to exhibit strong catalytic ability toward coniferaldehyde and sinapaldehyde, while the mutant protein gh2 completely lost the corresponding CAD and sinapyl alcohol dehydrogenase activities. Further phenotypic analysis of the gh2 mutant plants revealed that the p-hydroxyphenyl, guaiacyl, and sinapyl monomers were reduced in almost the same ratio compared to the wild type. Our results suggest GH2 acts as a primarily multifunctional CAD to synthesize coniferyl and sinapyl alcohol precursors in rice lignin biosynthesis. PMID:16443696
-
Rijpma, Sanna R; van der Velden, Maarten; González-Pons, Maria; Annoura, Takeshi; van Schaijk, Ben C L; van Gemert, Geert-Jan; van den Heuvel, Jeroen J M W; Ramesar, Jai; Chevalley-Maurel, Severine; Ploemen, Ivo H; Khan, Shahid M; Franetich, Jean-Francois; Mazier, Dominique; de Wilt, Johannes H W; Serrano, Adelfa E; Russel, Frans G M; Janse, Chris J; Sauerwein, Robert W; Koenderink, Jan B; Franke-Fayard, Blandine M
2016-03-01
Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC transporter subfamily C protein, whereas human parasites encode two: MRP1 and MRP2. Although associated with drug resistance, their biological function and substrates remain unknown. To elucidate the role of MRP throughout the parasite life cycle, Plasmodium berghei and Plasmodium falciparum mutants lacking MRP expression were generated. P. berghei mutants lacking expression of the single MRP as well as P. falciparum mutants lacking MRP1, MRP2 or both proteins have similar blood stage growth kinetics and drug-sensitivity profiles as wild type parasites. We show that MRP1-deficient parasites readily invade primary human hepatocytes and develop into mature liver stages. In contrast, both P. falciparum MRP2-deficient parasites and P. berghei mutants lacking MRP protein expression abort in mid to late liver stage development, failing to produce mature liver stages. The combined P. berghei and P. falciparum data are the first demonstration of a critical role of an ABC transporter during Plasmodium liver stage development. © 2015 John Wiley & Sons Ltd.
-
Bjelland, Ane Mohn; Sørum, Henning; Tegegne, Daget Ayana; Winther-Larsen, Hanne C.; Willassen, Nils Peder
2012-01-01
Vibrio (Aliivibrio) salmonicida is the causal agent of cold-water vibriosis, a fatal bacterial septicemia primarily of farmed salmonid fish. The molecular mechanisms of invasion, colonization, and growth of V. salmonicida in the host are still largely unknown, and few virulence factors have been identified. Quorum sensing (QS) is a cell-to-cell communication system known to regulate virulence and other activities in several bacterial species. The genome of V. salmonicida LFI1238 encodes products presumably involved in several QS systems. In this study, the gene encoding LitR, a homolog of the master regulator of QS in V. fischeri, was deleted. Compared to the parental strain, the litR mutant showed increased motility, adhesion, cell-to-cell aggregation, and biofilm formation. Furthermore, the litR mutant produced less cryptic bioluminescence, whereas production of acylhomoserine lactones was unaffected. Our results also indicate a salinity-sensitive regulation of LitR. Finally, reduced mortality was observed in Atlantic salmon infected with the litR mutant, implying that the fish were more susceptible to infection with the wild type than with the mutant strain. We hypothesize that LitR inhibits biofilm formation and favors planktonic growth, with the latter being more adapted for pathogenesis in the fish host. PMID:22371373
-
Cocquempot, Olivier; Brault, Véronique; Babinet, Charles; Herault, Yann
2009-09-01
Polyalanine expansion diseases are proposed to result from unequal crossover of sister chromatids that increases the number of repeats. In this report we suggest an alternative mechanism we put forward while we investigated a new spontaneous mutant that we named "Dyc" for "Digit in Y and Carpe" phenotype. Phenotypic analysis revealed an abnormal limb patterning similar to that of the human inherited congenital disease synpolydactyly (SPD) and to the mouse mutant model Spdh. Both human SPD and mouse Spdh mutations affect the Hoxd13 gene within a 15-residue polyalanine-encoding repeat in the first exon of the gene, leading to a dominant negative HOXD13. Genetic analysis of the Dyc mutant revealed a trinucleotide expansion in the polyalanine-encoding region of the Hoxd13 gene resulting in a 7-alanine expansion. However, unlike the Spdh mutation, this expansion cannot result from a simple duplication of a short segment. Instead, we propose the fork stalling and template switching (FosTeS) described for generation of nonrecurrent genomic rearrangements as a possible mechanism for the Dyc polyalanine extension, as well as for other polyalanine expansions described in the literature and that could not be explained by unequal crossing over.
-
Cocquempot, Olivier; Brault, Véronique; Babinet, Charles; Herault, Yann
2009-01-01
Polyalanine expansion diseases are proposed to result from unequal crossover of sister chromatids that increases the number of repeats. In this report we suggest an alternative mechanism we put forward while we investigated a new spontaneous mutant that we named “Dyc” for “Digit in Y and Carpe” phenotype. Phenotypic analysis revealed an abnormal limb patterning similar to that of the human inherited congenital disease synpolydactyly (SPD) and to the mouse mutant model Spdh. Both human SPD and mouse Spdh mutations affect the Hoxd13 gene within a 15-residue polyalanine-encoding repeat in the first exon of the gene, leading to a dominant negative HOXD13. Genetic analysis of the Dyc mutant revealed a trinucleotide expansion in the polyalanine-encoding region of the Hoxd13 gene resulting in a 7-alanine expansion. However, unlike the Spdh mutation, this expansion cannot result from a simple duplication of a short segment. Instead, we propose the fork stalling and template switching (FosTeS) described for generation of nonrecurrent genomic rearrangements as a possible mechanism for the Dyc polyalanine extension, as well as for other polyalanine expansions described in the literature and that could not be explained by unequal crossing over. PMID:19546318
-
Yoshiyama, Kaoru; Conklin, Phillip A.; Huefner, Neil D.; Britt, Anne B.
2009-01-01
The Arabidopsis sog1-1 (suppressor of gamma response) mutant was originally isolated as a second-site suppressor of the radiosensitive phenotype of seeds defective in the repair endonuclease XPF. Here, we report that SOG1 encodes a putative transcription factor. This gene is a member of the NAC domain [petunia NAM (no apical meristem) and Arabidopsis ATAF1, 2 and CUC2] family (a family of proteins unique to land plants). Hundreds of genes are normally up-regulated in Arabidopsis within an hour of treatment with ionizing radiation; the induction of these genes requires the damage response protein kinase ATM, but not the related kinase ATR. Here, we find that SOG1 is also required for this transcriptional up-regulation. In contrast, the SOG1-dependent checkpoint response observed in xpf mutant seeds requires ATR, but does not require ATM. Thus, phenotype of the sog1-1 mutant mimics aspects of the phenotypes of both atr and atm mutants in Arabidopsis, suggesting that SOG1 participates in pathways governed by both of these sensor kinases. We propose that, in plants, signals related to genomic stress are processed through a single, central transcription factor, SOG1. PMID:19549833
-
Charizanis, C; Juhnke, H; Krems, B; Entian, K D
1999-10-01
In Saccharomyces cerevisiae two transcription factors, Pos9 (Skn7) and Yap1, are involved in the response to oxidative stress. Fusion of the Pos9 response-regulator domain to the Gal4 DNA-binding domain results in a transcription factor which renders the expression of a GAL1-lacZ reporter gene dependent on oxidative stress. To identify genes which are involved in the oxygen-dependent activation of the Gal4-Pos9 hybrid protein we screened for mutants that failed to induce the heterologous test system upon oxidative stress (fap mutants for factors activating Pos9). We isolated several respiration-deficient and some respiration-competent mutants by this means. We selected for further characterization only those mutants which also displayed an oxidative-stress-sensitive phenotype. One of the respiration-deficient mutants (complementation groupfap6) could be complemented by the ISM1 gene, which encodes mitochondrial isoleucyl tRNA synthetase, suggesting that respiration competence was important for signalling of oxidative stress. In accordance with this notion a rho0 strain and a wild-type strain in which respiration had been blocked (by treatment with antimycin A or with cyanide) also failed to activate Gal4-Pos9 upon imposition of oxidative stress. Another mutant, fap24, which was respiration-competent, could be complemented by CCP1, which encodes the mitochondrial cytochrome c peroxidase. Mitochondrial cytochrome c peroxidase degrades reactive oxygen species within the mitochondria. This suggested a possible sensor function for the enzyme in the oxidative stress response. To test this we used the previously described point mutant ccp1 W191F, which is characterized by a 10(4)-fold decrease in electron flux between cytochrome c and cytochrome c peroxidase. The Ccp1W191F mutant was still capable of activating the Pos9 transcriptional activation domain, suggesting that the signalling function of Ccp1 is independent of electron flux rates.
-
Horinouchi, Masae; Hayashi, Toshiaki; Koshino, Hiroyuki; Yamamoto, Takako; Kudo, Toshiaki
2003-01-01
In a previous study we isolated the meta-cleavage enzyme gene, tesB, that encodes an enzyme that carries out a meta-cleavage reaction in the breakdown of testosterone by Comamonas testeroni TA441 (M. Horinouchi et al., Microbiology 147:3367-3375, 2001). Here we report the isolation of a gene, tesD, that encodes a hydrolase which acts on the product of the meta-cleavage reaction. We isolated tesD by using a Tn5 mutant of TA441 that showed limited growth on testosterone. TesD exhibited ca. 40% identity in amino acid sequence with BphDs, known hydrolases of biphenyl degradation in Pseudomonas spp. The TesD-disrupted mutant showed limited growth on testosterone, and the culture shows an intense yellow color. High-pressure liquid chromatography analysis of the culture of TesD-disrupted mutant incubated with testosterone detected five major intermediate compounds, one of which, showing yellow color under neutral conditions, was considered to be the product of the meta-cleavage reaction. The methylation product was analyzed and identified as methyl-4,5-9,10-diseco-3-methoxy-5,9,17-trioxoandrosta-1(10),2-dien-4-oate, indicating that the substrate of TesD in testosterone degradation is 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-dien-4-oic acid. 4,5-9,10-Diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-dien-4-oic acid was transformed by Escherichia coli-expressed TesD. Downstream of tesD, we identified tesE, F, and G, which encode for enzymes that degrade one of the products of 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-dien-4-oic acid converted by TesD. PMID:12676694
-
Liu, Xingwang; Bartholomew, Ezra; Cai, Yanling; Ren, Huazhong
2016-01-01
Trichomes are specialized epidermal cells located in aerial parts of plants that function in plant defense against biotic and abiotic stresses. The simple unicellular trichomes of Arabidopsis serve as an excellent model to study the molecular mechanism of cell differentiation and pattern formation in plants. Loss-of-function mutations in Arabidopsis thaliana have suggested that the core genes GL1 (which encodes a MYB transcription factor) and TTG1 (which encodes a WD40 repeat-containing protein) are important for the initiation and spacing of leaf trichomes, while for normal trichome initiation, the genes GL3, and EGL3 (which encode a bHLH protein) are needed. However, the positive regulatory genes involved in multicellular trichrome development in cucumber remain unclear. This review focuses on the phenotype of mutants (csgl3, tril, tbh, mict, and csgl1) with disturbed trichomes in cucumber and then infers which gene(s) play key roles in trichome initiation and development in those mutants. Evidence indicates that MICT, TBH, and CsGL1 are allelic with alternative splicing. CsGL3 and TRIL are allelic and override the effect of TBH, MICT, and CsGL1 on the regulation of multicellular trichome development; and affect trichome initiation. CsGL3, TRIL, MICT, TBH, and CsGL1 encode HD-Zip proteins with different subfamilies. Genetic and molecular analyses have revealed that CsGL3, TRIL, MICT, TBH, and CsGL1 are responsible for the differentiation of epidermal cells and the development of trichomes. Based on current knowledge, a positive regulator pathway model for trichome development in cucumber was proposed and compared to a model in Arabidopsis. These data suggest that trichome development in cucumber may differ from that in Arabidopsis. PMID:27559338
-
Loewen, Carin A; Ganetzky, Barry
2018-04-01
Proper mitochondrial activity depends upon proteins encoded by genes in the nuclear and mitochondrial genomes that must interact functionally and physically in a precisely coordinated manner. Consequently, mito-nuclear allelic interactions are thought to be of crucial importance on an evolutionary scale, as well as for manifestation of essential biological phenotypes, including those directly relevant to human disease. Nonetheless, detailed molecular understanding of mito-nuclear interactions is still lacking, and definitive examples of such interactions in vivo are sparse. Here we describe the characterization of a mutation in Drosophila ND23 , a nuclear gene encoding a highly conserved subunit of mitochondrial complex 1. This characterization led to the discovery of a mito-nuclear interaction that affects the ND23 mutant phenotype. ND23 mutants exhibit reduced lifespan, neurodegeneration, abnormal mitochondrial morphology, and decreased ATP levels. These phenotypes are similar to those observed in patients with Leigh syndrome, which is caused by mutations in a number of nuclear genes that encode mitochondrial proteins, including the human ortholog of ND23 A key feature of Leigh syndrome, and other mitochondrial disorders, is unexpected and unexplained phenotypic variability. We discovered that the phenotypic severity of ND23 mutations varies depending on the maternally inherited mitochondrial background. Sequence analysis of the relevant mitochondrial genomes identified several variants that are likely candidates for the phenotypic interaction with mutant ND23 , including a variant affecting a mitochondrially encoded component of complex I. Thus, our work provides an in vivo demonstration of the phenotypic importance of mito-nuclear interactions in the context of mitochondrial disease. Copyright © 2018 by the Genetics Society of America.
-
Characterization of Escherichia coli Type 1 Pilus Mutants with Altered Binding Specificities
Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Hamrick, Terri S.; Horton, John R.; Orndorff, Paul E.
2001-01-01
PCR mutagenesis and a unique enrichment scheme were used to obtain two mutants, each with a single lesion in fimH, the chromosomal gene that encodes the adhesin protein (FimH) of Escherichia coli type 1 pili. These mutants were noteworthy in part because both were altered in the normal range of cell types bound by FimH. One mutation altered an amino acid at a site previously shown to be involved in temperature-dependent binding, and the other altered an amino acid lining the predicted FimH binding pocket. PMID:11395476
-
Chia, Catherine P.; Duesing, John H.; Arntzen, Charles J.
1986-01-01
Lutescens-1, a tobacco mutant with a maternally inherited dysfunction, displayed an unusual developmental phenotype. In vivo measurement of chlorophyll fluorescence revealed deterioration in photosystem II (PSII) function as leaves expanded. Analysis of thylakoid membrane proteins by polyacrylamide gel electrophoresis indicated the physical loss of nuclear- and chloroplast-encoded polypeptides comprising the PSII core complex concomitant with loss of activity. Freeze fracture electron micrographs of mutant thylakoids showed a reduced density, compared to wild type, of the EFs particles which have been shown previously to be the structural entity containing PSII core complexes and associated pigment-proteins. The selective loss of PSII cores from thylakoids resulted in a higher ratio of antenna chlorophyll to reaction centers and an altered 77 K chlorophyll fluorescence emission spectra; these data are interpreted to indicate functional isolation of light-harvesting chlorophyll a/b complexes in the absence of PSII centers. Examination of PSII reaction centers (which were present at lower levels in mutant membranes) by monitoring the light-dependent phosphorylation of PSII polypeptides and flash-induced O2 evolution patterns demonstrated that the PSII cores which were assembled in mutant thylakoids were functionally identical to those of wild type. We conclude that the lutescens-1 mutation affected the correct stoichiometry of PSII centers, in relation to other membrane constituents, by disrupting the proper assembly and maintenance of PSII complexes in lutescens-1 thylakoid membranes. Images Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:16664990
-
Development of a Markerless Knockout Method for Actinobacillus succinogenes
Joshi, Rajasi V.; Schindler, Bryan D.; McPherson, Nikolas R.; Tiwari, Kanupriya
2014-01-01
Actinobacillus succinogenes is one of the best natural succinate-producing organisms, but it still needs engineering to further increase succinate yield and productivity. In this study, we developed a markerless knockout method for A. succinogenes using natural transformation or electroporation. The Escherichia coli isocitrate dehydrogenase gene with flanking flippase recognition target sites was used as the positive selection marker, making use of A. succinogenes's auxotrophy for glutamate to select for growth on isocitrate. The Saccharomyces cerevisiae flippase recombinase (Flp) was used to remove the selection marker, allowing its reuse. Finally, the plasmid expressing flp was cured using acridine orange. We demonstrate that at least two consecutive deletions can be introduced into the same strain using this approach, that no more than a total of 1 kb of DNA is needed on each side of the selection cassette to protect from exonuclease activity during transformation, and that no more than 200 bp of homologous DNA is needed on each side for efficient recombination. We also demonstrate that electroporation can be used as an alternative transformation method to obtain knockout mutants and that an enriched defined medium can be used for direct selection of knockout mutants on agar plates with high efficiency. Single-knockout mutants of the fumarate reductase and of the pyruvate formate lyase-encoding genes were obtained using this knockout strategy. Double-knockout mutants were also obtained by deleting the citrate lyase-, β-galactosidase-, and aconitase-encoding genes in the pyruvate formate lyase knockout mutant strain. PMID:24610845
-
Development of a markerless knockout method for Actinobacillus succinogenes.
Joshi, Rajasi V; Schindler, Bryan D; McPherson, Nikolas R; Tiwari, Kanupriya; Vieille, Claire
2014-05-01
Actinobacillus succinogenes is one of the best natural succinate-producing organisms, but it still needs engineering to further increase succinate yield and productivity. In this study, we developed a markerless knockout method for A. succinogenes using natural transformation or electroporation. The Escherichia coli isocitrate dehydrogenase gene with flanking flippase recognition target sites was used as the positive selection marker, making use of A. succinogenes's auxotrophy for glutamate to select for growth on isocitrate. The Saccharomyces cerevisiae flippase recombinase (Flp) was used to remove the selection marker, allowing its reuse. Finally, the plasmid expressing flp was cured using acridine orange. We demonstrate that at least two consecutive deletions can be introduced into the same strain using this approach, that no more than a total of 1 kb of DNA is needed on each side of the selection cassette to protect from exonuclease activity during transformation, and that no more than 200 bp of homologous DNA is needed on each side for efficient recombination. We also demonstrate that electroporation can be used as an alternative transformation method to obtain knockout mutants and that an enriched defined medium can be used for direct selection of knockout mutants on agar plates with high efficiency. Single-knockout mutants of the fumarate reductase and of the pyruvate formate lyase-encoding genes were obtained using this knockout strategy. Double-knockout mutants were also obtained by deleting the citrate lyase-, β-galactosidase-, and aconitase-encoding genes in the pyruvate formate lyase knockout mutant strain.
-
Liu, Dong
2013-01-01
Isoleucine is one of the branched-chain amino acids (BCAAs) that are essential substrates for protein synthesis in all organisms. Although the metabolic pathway for isoleucine has been well characterized in higher plants, it is not known whether it plays a specific role in plant development. In this study, an Arabidopsis mutant, lib (low isoleucine biosynthesis), that has defects in both cell proliferation and cell expansion processes during root development, was characterized. The lib mutant carries a T-DNA insertion in the last exon of the OMR1 gene that encodes a threonine deaminase/dehydratase (TD). TD catalyses the deamination and dehydration of threonine, which is the first and also the committed step in the biosynthesis of isoleucine. This T-DNA insertion results in a partial deficiency of isoleucine in lib root tissues but it does not affect its total protein content. Application of exogenous isoleucine or introduction of a wild-type OMR1 gene into the lib mutant can completely rescue the mutant phenotypes. These results reveal an important role for isoleucine in plant development. In addition, microarray analysis indicated that the partial deficiency of isoleucine in the lib mutant triggers a decrease in transcript levels of the genes encoding the major enzymes involved in the BCAA degradation pathway; the analysis also indicated that many genes involved in the biosynthesis of methionine-derived glucosinolates are up-regulated. PMID:23230023
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nunn, D.N.; Lidstrom, M.E.
Twenty-five methanol oxidation mutants of the facultative methylotroph Methylobacterium sp. strain AM1 have been characterized by complementation analysis and assigned to 10 complementation groups, Mox A1, A2, A3, and B through H. In this study we have characterized each of the mutants belonging to the 10 Mox complementation groups for the following criteria: (i) phenazine methosulfate-dichlorophenolindophenol dye-linked methanol dehydrogenase activity; (ii) methanol-dependent whole-cell oxygen consumption; (iii) the presence or absence of methanol dehydrogenase protein by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting; (iv) the absorption spectra of purified mutant methanol dehydrogenase proteins; and (v) the presence or absence ofmore » the soluble cytochrome c proteins of Methylobacterium sp. strain AM1, as determined by reduced-oxidized difference spectra and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. With this information, we have proposed functions for each of the genes deficient in the mutants of the 10 Mox complementation groups. These proposed gene functions include two linked genes that encode the methanol dehydrogenase structural protein and the soluble cytochrome c/sub L/, a gene encoding a secretion function essential for the synthesis and export of methanol dehydrogenase and cytochrome c/sub L/, three gene functions responsible for the proper association of the pyrrolo-quinoline quinone prosthetic group with the methanol dehydrogenase apoprotein, and four positive regulatory gene functions controlling the expression of the ability to oxidize methanol.« less
-
Bonifield, Heather R.; Yamaguchi, Shigeru; Hughes, Kelly T.
2000-01-01
We investigated the posttranscriptional regulation of flgE, a class 2 gene that encodes the hook subunit protein of the flagella. RNase protection assays demonstrated that the flgE gene was transcribed at comparable levels in numerous strains defective in known steps of flagellar assembly. However, Western analyses of these strains demonstrated substantial differences in FlgE protein levels. Although wild-type FlgE levels were observed in strains with deletions of genes encoding components of the switch complex and the flagellum-specific secretion apparatus, no protein was detected in a strain with deletions of the rod, ring, and hook-associated proteins. To determine whether FlgE levels were affected by the stage of hook–basal-body assembly, Western analysis was performed on strains with mutations at individual loci encompassed by the deletion. FlgE protein was undetectable in rod mutants, intermediate in ring mutants, and wild type in hook-associated protein mutants. The lack of negative regulation in switch complex and flagellum-specific secretion apparatus deletion mutants blocked for flagellar construction prior to rod assembly suggests that these structures play a role in the negative regulation of FlgE. Quantitative Western analyses of numerous flagellar mutants indicate that FlgE levels reflect the stage at which flagellar assembly is blocked. These data provide evidence for negative posttranscriptional regulation of FlgE in response to the stage of flagellar assembly. PMID:10869084
-
Directed mutagenesis of the Rickettsia prowazekii pld gene encoding phospholipase D.
Driskell, Lonnie O; Yu, Xue-jie; Zhang, Lihong; Liu, Yan; Popov, Vsevolod L; Walker, David H; Tucker, Aimee M; Wood, David O
2009-08-01
Rickettsia prowazekii, the causative agent of epidemic typhus, is an obligately intracytoplasmic bacterium, a lifestyle that imposes significant barriers to genetic manipulation. The key to understanding how this unique bacterium evades host immunity is the mutagenesis of selected genes hypothesized to be involved in virulence. The R. prowazekii pld gene, encoding a protein with phospholipase D activity, has been associated with phagosomal escape. To demonstrate the feasibility of site-directed knockout mutagenesis of rickettsial genes and to generate a nonrevertible vaccine strain, we utilized homologous recombination to generate a pld mutant of the virulent R. prowazekii strain Madrid Evir. Using linear DNA for transformation, a double-crossover event resulted in the replacement of the rickettsial wild-type gene with a partially deleted pld gene. Linear DNA was used to prevent potentially revertible single-crossover events resulting in plasmid insertion. Southern blot and PCR analyses were used to confirm the presence of the desired mutation and to demonstrate clonality. While no phenotypic differences were observed between the mutant and wild-type strains when grown in tissue culture, the pld mutant exhibited attenuated virulence in the guinea pig model. In addition, animals immunized with the mutant strain were protected against subsequent challenge with the virulent Breinl strain, suggesting that this transformant could serve as a nonrevertible, attenuated vaccine strain. This study demonstrates the feasibility of generating site-directed rickettsial gene mutants, providing a new tool for understanding rickettsial biology and furthering advances in the prevention of epidemic typhus.
-
Das, Sankar; Kanamoto, Taisei; Ge, Xiuchun; Xu, Ping; Unoki, Takeshi; Munro, Cindy L; Kitten, Todd
2009-07-01
Streptococcus sanguinis is an important cause of infective endocarditis. Previous studies have identified lipoproteins as virulence determinants in other streptococcal species. Using a bioinformatic approach, we identified 52 putative lipoprotein genes in S. sanguinis strain SK36 as well as genes encoding the lipoprotein-processing enzymes prolipoprotein diacylglyceryl transferase (lgt) and signal peptidase II (lspA). We employed a directed signature-tagged mutagenesis approach to systematically disrupt these genes and screen each mutant for the loss of virulence in an animal model of endocarditis. All mutants were viable. In competitive index assays, mutation of a putative phosphate transporter reduced in vivo competitiveness by 14-fold but also reduced in vitro viability by more than 20-fold. Mutations in lgt, lspA, or an uncharacterized lipoprotein gene reduced competitiveness by two- to threefold in the animal model and in broth culture. Mutation of ssaB, encoding a putative metal transporter, produced a similar effect in culture but reduced in vivo competiveness by >1,000-fold. [(3)H]palmitate labeling and Western blot analysis confirmed that the lgt mutant failed to acylate lipoproteins, that the lspA mutant had a general defect in lipoprotein cleavage, and that SsaB was processed differently in both mutants. These results indicate that the loss of a single lipoprotein, SsaB, dramatically reduces endocarditis virulence, whereas the loss of most other lipoproteins or of normal lipoprotein processing has no more than a minor effect on virulence.
-
Das, Sankar; Kanamoto, Taisei; Ge, Xiuchun; Xu, Ping; Unoki, Takeshi; Munro, Cindy L.; Kitten, Todd
2009-01-01
Streptococcus sanguinis is an important cause of infective endocarditis. Previous studies have identified lipoproteins as virulence determinants in other streptococcal species. Using a bioinformatic approach, we identified 52 putative lipoprotein genes in S. sanguinis strain SK36 as well as genes encoding the lipoprotein-processing enzymes prolipoprotein diacylglyceryl transferase (lgt) and signal peptidase II (lspA). We employed a directed signature-tagged mutagenesis approach to systematically disrupt these genes and screen each mutant for the loss of virulence in an animal model of endocarditis. All mutants were viable. In competitive index assays, mutation of a putative phosphate transporter reduced in vivo competitiveness by 14-fold but also reduced in vitro viability by more than 20-fold. Mutations in lgt, lspA, or an uncharacterized lipoprotein gene reduced competitiveness by two- to threefold in the animal model and in broth culture. Mutation of ssaB, encoding a putative metal transporter, produced a similar effect in culture but reduced in vivo competiveness by >1,000-fold. [3H]palmitate labeling and Western blot analysis confirmed that the lgt mutant failed to acylate lipoproteins, that the lspA mutant had a general defect in lipoprotein cleavage, and that SsaB was processed differently in both mutants. These results indicate that the loss of a single lipoprotein, SsaB, dramatically reduces endocarditis virulence, whereas the loss of most other lipoproteins or of normal lipoprotein processing has no more than a minor effect on virulence. PMID:19395487
-
Borziak, Kirill; Posner, Mareike G; Upadhyay, Abhishek; Danson, Michael J; Bagby, Stefan; Dorus, Steve
2014-01-01
Metagenomic analyses have advanced our understanding of ecological microbial diversity, but to what extent can metagenomic data be used to predict the metabolic capacity of difficult-to-study organisms and their abiotic environmental interactions? We tackle this question, using a comparative genomic approach, by considering the molecular basis of aerobiosis within archaea. Lipoylation, the covalent attachment of lipoic acid to 2-oxoacid dehydrogenase multienzyme complexes (OADHCs), is essential for metabolism in aerobic bacteria and eukarya. Lipoylation is catalysed either by lipoate protein ligase (LplA), which in archaea is typically encoded by two genes (LplA-N and LplA-C), or by a lipoyl(octanoyl) transferase (LipB or LipM) plus a lipoic acid synthetase (LipA). Does the genomic presence of lipoylation and OADHC genes across archaea from diverse habitats correlate with aerobiosis? First, analyses of 11,826 biotin protein ligase (BPL)-LplA-LipB transferase family members and 147 archaeal genomes identified 85 species with lipoylation capabilities and provided support for multiple ancestral acquisitions of lipoylation pathways during archaeal evolution. Second, with the exception of the Sulfolobales order, the majority of species possessing lipoylation systems exclusively retain LplA, or either LipB or LipM, consistent with archaeal genome streamlining. Third, obligate anaerobic archaea display widespread loss of lipoylation and OADHC genes. Conversely, a high level of correspondence is observed between aerobiosis and the presence of LplA/LipB/LipM, LipA and OADHC E2, consistent with the role of lipoylation in aerobic metabolism. This correspondence between OADHC lipoylation capacity and aerobiosis indicates that genomic pathway profiling in archaea is informative and that well characterized pathways may be predictive in relation to abiotic conditions in difficult-to-study extremophiles. Given the highly variable retention of gene repertoires across the archaea, the extension of comparative genomic pathway profiling to broader metabolic and homeostasis networks should be useful in revealing characteristics from metagenomic datasets related to adaptations to diverse environments.
-
Regulation of leaf organ size by the Arabidopsis RPT2a 19S proteasome subunit.
Sonoda, Yutaka; Sako, Kaori; Maki, Yuko; Yamazaki, Naoko; Yamamoto, Hiroko; Ikeda, Akira; Yamaguchi, Junji
2009-10-01
The ubiquitin/26S proteasome pathway plays a central role in the degradation of short-lived regulatory proteins, to control many cellular events. To further understand this pathway, we focused on the RPT2 subunit of the 26S proteasome regulatory particle. The Arabidopsis genome contains two genes, AtRPT2a and AtRPT2b, which encode paralog molecules of the RPT2 subunit, with a difference of only three amino acids in the protein sequences. Both genes showed similar mRNA accumulation patterns. However, the rpt2a mutant showed a specific phenotype of enlarged leaves caused by increased cell size, in correlation with increased ploidy. Detailed analyses revealed that cell expansion is increased in the rpt2a mutant by extended endoreduplication early in leaf development. The transcription of genes encoding cell cycle-related components, for DNA replication licensing and the G2/M phase, was also promoted in the rpt2a mutant, suggesting that extended endoreduplication was caused by increased DNA replication, and disrupted regulation of the G2/M checkpoint, at the proliferation stage of leaf development.
-
Blázquez, M A; Gancedo, C
1995-12-20
Mutations in the TPS1 gene, which encodes trehalose-6-P synthase, cause a glucose-negative phenotype in Saccharomyces cerevisiae. Antimycin A or disruption of the QCR9 gene, which encodes one subunit of the cytochrome bc1 complex, restore the ability to grow in glucose-containing media. Under these conditions the cell excreted a large amount of glycerol, corresponding to about 20% of the glucose taken up. Suppression appears to be achieved by diversion of accumulated glycolytic intermediates to the production of glycerol, thereby providing NAD+ and phosphate for the glyceraldehyde-3-P dehydrogenase reaction. Analysis of the mutation sci1-1, which also suppresses the glucose-negative phenotype of tps1 mutants, showed that glucose transport was decreased in sci1-1 mutants. The gene SCI1 was cloned and its nucleotide sequence revealed it to be identical to CAT3/SNF4. The suppression mediated by sci1-1 is attributable to a decrease in glycolytic flux.
-
Actin dynamics involved in gravity perception in Arabidopsis inflorescense stem
NASA Astrophysics Data System (ADS)
Tasaka, Masao; Nakamura, Moritaka; Morita, Miyo T.
The amyloplasts sedimentation in the endodermal cells is important for gravity perception in Arabidopsis shoot. Our previous study suggests that SGR5(SHOOT GRAVITROPISM 5) and SGR9 are synergistically involved in regulation of amyloplast movement in these cells, and shows that sgr5 sgr9 double mutant completely loses gravitropic response. SGR5 encodes putative transcription factor and SGR9 encodes a ring finger containing protein, which surrounds amyloplasts. It has been reported that amyloplasts are surrounded by actin microfilaments (MFs), and that treatment with actin polymerization inhibitor enhances gravitropic organ curvature. However, not only the molecular link between amyolplasts and MFs, but also regulatory role of MFs in gravitropic response is still unclear. Here, we found that treatment with actin polymerization inhibitor restored gravitropic response of sgr5 sgr9 double mutant stems. The result suggests that abnormal amyloplasts movement in the double mutant could result from inhibition of MFs depolymerization, leading to abnormal gravitropism. We are investigating whether SGR5 and SGR9 are involved in amyloplasts movement by regulating actin remodeling in gravity perceptive cells.
-
Zhu, Y; Lin, E C
1988-05-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.
-
Zhu, Y; Lin, E C
1988-01-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341
-
Coonrod, Emily M; Stevens, Tom H
2010-12-01
In 1992, Raymond et al. published a compilation of the 41 yeast vacuolar protein sorting (vps) mutant groups and described a large class of mutants (class E vps mutants) that accumulated an exaggerated prevacuolar endosome-like compartment. Further analysis revealed that this "class E compartment" contained soluble vacuolar hydrolases, vacuolar membrane proteins, and Golgi membrane proteins unable to recycle back to the Golgi complex, yet these class E vps mutants had what seemed to be normal vacuoles. The 13 class E VPS genes were later shown to encode the proteins that make up the complexes required for formation of intralumenal vesicles in late endosomal compartments called multivesicular bodies, and for the sorting of ubiquitinated cargo proteins into these internal vesicles for eventual delivery to the vacuole or lysosome.
-
Tricarboxylic acid cycle without malate dehydrogenase in Streptomyces coelicolor M-145.
Takahashi-Íñiguez, Tóshiko; Barrios-Hernández, Joana; Rodríguez-Maldonado, Marion; Flores, María Elena
2018-06-23
The oxidation of malate to oxaloacetate is catalysed only by a nicotinamide adenine dinucleotide-dependent malate dehydrogenase encoded by SCO4827 in Streptomyces coelicolor. A mutant lacking the malate dehydrogenase gene was isolated and no enzymatic activity was detected. As expected, the ∆mdh mutant was unable to grow on malate as the sole carbon source. However, the mutant grew less in minimal medium with glucose and there was a delay of 36 h. The same behaviour was observed when the mutant was grown on minimal medium with casamino acids or glycerol. For unknown reasons, the mutant was not able to grow in YEME medium with glucose. The deficiency of malate dehydrogenase affected the expression of the isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase genes, decreasing the expression of both genes by approximately two- to threefold.
-
Mason, Jeffrey L; Xuan, Shouhong; Dragatsis, Ioannis; Efstratiadis, Argiris; Goldman, James E
2003-08-20
We examined the role of IGF signaling in the remyelination process by disrupting the gene encoding the type 1 IGF receptor (IGF1R) specifically in the mouse brain by Cre-mediated recombination and then exposing these mutants and normal siblings to cuprizone. This neurotoxicant induces a demyelinating lesion in the corpus callosum that is reversible on termination of the insult. Acute demyelination and oligodendrocyte depletion were the same in mutants and controls, but the mutants did not remyelinate adequately. We observed that oligodendrocyte progenitors did not accumulate, proliferate, or survive within the mutant mice, compared with wild type, indicating that signaling through the IGF1R plays a critical role in remyelination via effects on oligodendrocyte progenitors.
-
Zhang, L; Zhang, H-Y; Huang, F-C; Huang, Q; Liu, C; Li, J-R
2016-09-01
We investigated the clinical value of alprostadil combined with the α-lipoic acid in treating type 2 diabetes mellitus with erectile dysfunction (DMED). We selected a total of 76 cases of patients who were admitted to endocrinology department of our hospital from June 2014 to June 2015 and diagnosed as DMED, and the average age was (46.7 ± 7.2) years old, average course of diabetes mellitus was (6.2 ± 2.8) years and average body mass index was (25.4 ± 1.3) kg/m2. 40 cases were randomly divided in the observation group while 36 cases were divided in the control group. They received blood glucose control therapy. The patients in the observation group received 60 mg alprostadil hydrochloride and 600 mg α-lipoic acid added into 250 mL normal saline, intravenous drip once per day for 2 weeks. The patients in the control group took tadalafil 5 mg orally, once per night for 2 weeks as a course of treatment. There were no cases of loss. The effective rate of treatment in observation group is significantly higher than that in the control group (95.0% vs. 80.5%, p < 0.05). The score of IIEF-5, EHGS and the FMD value of brachial artery of the observation group after the operation were significantly higher than that of the control group (p < 0.05). The adverse reaction rate in the observation group was lower than that in the control group (7.5% vs. 13.9%, p < 0.05). Alprostadil combined with α-lipoic acid can improve DMED patients' vascular endothelial function and erection hardness to treat erectile dysfunction with less adverse effects and better safety.
-
Davidson, Eric P; Holmes, Amey; Coppey, Lawrence J; Yorek, Mark A
2015-10-15
We have previously demonstrated that treating diabetic rats with enalapril, an angiotensin converting enzyme (ACE) inhibitor, α-lipoic acid, an antioxidant, or menhaden oil, a natural source of omega-3 fatty acids can partially improve diabetic peripheral neuropathy. In this study we sought to determine the efficacy of combining these three treatments on vascular and neural complications in a high fat fed low dose streptozotocin treated rat, a model of type 2 diabetes. Rats were fed a high fat diet for 8 weeks followed by a 30 mg/kg dose of streptozotocin. Eight weeks after the onset of hyperglycemia diabetic rats were treated with a combination of enalapril, α-lipoic acid and menhaden oil. Diabetic rats not receiving treatment were continued on the high fat diet. Glucose clearance was impaired in diabetic rats and significantly improved with treatment. Diabetes caused steatosis, elevated serum lipid levels, slowing of motor and sensory nerve conduction, thermal hypoalgesia, reduction in intraepidermal nerve fiber profiles, decrease in cornea sub-basal nerve fiber length and corneal sensitivity and impairment in vascular relaxation to acetylcholine and calcitonin gene-related peptide in epineurial arterioles of the sciatic nerve. Treating diabetic rats with the combination of enalapril, α-lipoic acid and menhaden oil reversed all these deficits to near control levels except for motor nerve conduction velocity which was also significantly improved compared to diabetic rats but remained significantly decreased compared to control rats. These studies suggest that a combination therapeutic approach may be most effective for treating vascular and neural complications of type 2 diabetes. Published by Elsevier B.V.
-
Zheng, Zhi-Liang
2008-01-01
The balance between carbon (C) and nitrogen (N) nutrients must be tightly coordinated so that cells can optimize their opportunity for metabolism, growth and development. However, the C and N nutrient balance perception and signaling mechanism remains poorly understood. Here, we report the isolation and characterization of two allelic oversensitive to sugar1 mutants (osu1-1, osu1-2) in Arabidopsis thaliana. Using the cotyledon anthocyanin accumulation and root growth inhibition assays, we show that the osu1 mutants are more sensitive than wild-type to both of the imbalanced C/N conditions, high C/low N and low C/high N. However, under the balanced C/N conditions (low C/low N or high C/high N), the osu1 mutants have similar anthocyanin levels and root lengths as wild-type. Consistently, the genes encoding two MYB transcription factors (MYB75 and MYB90) and an Asn synthetase isoform (ASN1) are strongly up-regulated by the OSU1 mutation in response to high C/low N and low C/high N, respectively. Furthermore, the enhanced sensitivity of osu1-1 to high C/low N with respect to anthocyanin accumulation but not root growth inhibition can be suppressed by co-suppression of MYB75, indicating that MYB75 acts downstream of OSU1 in the high C/low N imbalance response. Map-based cloning reveals that OSU1 encodes a member of a large family of putative methyltransferases and is allelic to the recently reported QUA2/TSD2 locus identified in genetic screens for cell-adhesion-defective mutants. Accumulation of OSU1/QUA2/TSD2 transcript was not regulated by C and N balance, but the OSU1 promoter was slightly more active in the vascular system. Taken together, our results show that the OSU1/QUA2/TSD2-encoded putative methyltransferase is required for normal C/N nutrient balance response in plants. PMID:18167546
-
Iuchi, S; Cole, S T; Lin, E C
1990-01-01
In Escherichia coli, sn-glycerol-3-phosphate can be oxidized by two different flavo-dehydrogenases, an anaerobic enzyme encoded by the glpACB operon and an aerobic enzyme encoded by the glpD operon. These two operons belong to the glp regulon specifying the utilization of glycerol, sn-glycerol-3-phosphate, and glycerophosphodiesters. In glpR mutant cells grown under conditions of low catabolite repression, the glpA operon is best expressed anaerobically with fumarate as the exogenous electron acceptor, whereas the glpD operon is best expressed aerobically. Increased anaerobic expression of glpA is dependent on the fnr product, a pleiotropic activator of genes involved in anaerobic respiration. In this study we found that the expression of a glpA1(Oxr) (oxygen-resistant) mutant operon, selected for increased aerobic expression, became less dependent on the FNR protein but more dependent on the cyclic AMP-catabolite gene activator protein complex mediating catabolite repression. Despite the increased aerobic expression of glpA1(Oxr), a twofold aerobic repressibility persisted. Moreover, anaerobic repression by nitrate respiration remained normal. Thus, there seems to exist a redox control apart from the FNR-mediated one. We also showed that the anaerobic repression of the glpD operon was fully relieved by mutations in either arcA (encoding a presumptive DNA recognition protein) or arcB (encoding a presumptive redox sensor protein). The arc system is known to mediate pleiotropic control of genes of aerobic function.
-
Intracistronic complementation in the simian virus 40 A gene.
Tornow, J; Cole, C N
1983-01-01
A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452
-
Khater, Fida; Balestrino, Damien; Charbonnel, Nicolas; Dufayard, Jean François; Brisse, Sylvain; Forestier, Christiane
2015-01-01
Chaperone/usher (CU) assembly pathway is used by a wide range of Enterobacteriaceae to assemble adhesive surface structures called pili or fimbriae that play a role in bacteria-host cell interactions. In silico analysis revealed that the genome of Klebsiella pneumoniae LM21 harbors eight chromosomal CU loci belonging to γκп and ϭ clusters. Of these, only two correspond to previously described operons, namely type 1 and type 3-encoding operons. Isogenic usher deletion mutants of K. pneumoniae LM21 were constructed for each locus and their role in adhesion to animal (Intestine 407) and plant (Arabidopsis thaliana) cells, biofilm formation and murine intestinal colonization was investigated. Type 3 pili usher deleted mutant was impaired in all assays, whereas type 1 pili usher deleted mutant only showed attenuation in adhesion to plant cells and in intestinal colonization. The LM21ΔkpjC mutant was impaired in its capacity to adhere to Arabidopsis cells and to colonize the murine intestine, either alone or in co-inoculation experiments. Deletion of LM21kpgC induced a significant decrease in biofilm formation, in adhesion to animal cells and in colonization of the mice intestine. The LM21∆kpaC and LM21∆kpeC mutants were only attenuated in biofilm formation and the adhesion abilities to Arabidopsis cells, respectively. No clear in vitro or in vivo effect was observed for LM21∆kpbC and LM21∆kpdC mutants. The multiplicity of CU loci in K. pneumoniae genome and their specific adhesion pattern probably reflect the ability of the bacteria to adhere to different substrates in its diverse ecological niches. PMID:25751658
-
Carland, Francine; Fujioka, Shozo; Nelson, Timothy
2010-01-01
Plant sterols are structural components of cell membranes that provide rigidity, permeability, and regional identity to membranes. Sterols are also the precursors to the brassinosteroid signaling molecules. Evidence is accumulating that specific sterols have roles in pattern formation during development. COTYLEDON VASCULAR PATTERNING1 (CVP1) encodes C-24 STEROL METHYLTRANSFERASE2 (SMT2), one of three SMTs in Arabidopsis (Arabidopsis thaliana). SMT2 and SMT3, which also encodes a C-24 SMT, catalyze the reaction that distinguishes the synthesis of structural sterols from signaling brassinosteroid derivatives and are highly regulated. The deficiency of SMT2 in the cvp1 mutant results in moderate developmental defects, including aberrant cotyledon vein patterning, serrated floral organs, and reduced stature, but plants are viable, suggesting that SMT3 activity can substitute for the loss of SMT2. To test the distinct developmental roles of SMT2 and SMT3, we identified a transcript null smt3 mutant. Although smt3 single mutants appear wild type, cvp1 smt3 double mutants show enhanced defects relative to cvp1 mutants, such as discontinuous cotyledon vein pattern, and produce novel phenotypes, including defective root growth, loss of apical dominance, sterility, and homeotic floral transformations. These phenotypes are correlated with major alterations in the profiles of specific sterols but without significant alterations to brassinosteroid profiles. The alterations to sterol profiles in cvp1 mutants affect auxin response, demonstrated by weak auxin insensitivity, enhanced axr1 auxin resistance, ectopically expressed DR5:β-glucuronidase in developing embryos, and defective response to auxin-inhibited PIN2-green fluorescent protein endocytosis. We discuss the developmental roles of sterols implied by these results. PMID:20421456
-
Ribosome Biogenesis Modulates Ty1 Copy Number Control in Saccharomyces cerevisiae
Ahn, Hyo Won; Tucker, Jessica M.; Arribere, Joshua A.; Garfinkel, David J.
2017-01-01
Transposons can impact the host genome by altering gene expression and participating in chromosome rearrangements. Therefore, organisms evolved different ways to minimize the level of transposition. In Saccharomyces cerevisiae and its close relative S. paradoxus, Ty1 copy number control (CNC) is mediated by the self-encoded restriction factor p22, which is derived from the GAG capsid gene and inhibits virus-like particle (VLP) assembly and function. Based on secondary screens of Ty1 cofactors, we identified LOC1, a RNA localization/ribosome biogenesis gene that affects Ty1 mobility predominantly in strains harboring Ty1 elements. Ribosomal protein mutants rps0bΔ and rpl7aΔ displayed similar CNC-specific phenotypes as loc1Δ, suggesting that ribosome biogenesis is critical for CNC. The level of Ty1 mRNA and Ty1 internal (Ty1i) transcripts encoding p22 was altered in these mutants, and displayed a trend where the level of Ty1i RNA increased relative to full-length Ty1 mRNA. The level of p22 increased in these mutants, and the half-life of p22 also increased in a loc1Δ mutant. Transcriptomic analyses revealed small changes in the level of Ty1 transcripts or efficiency of translation initiation in a loc1Δ mutant. Importantly, a loc1Δ mutant had defects in assembly of Gag complexes and packaging Ty1 RNA. Our results indicate that defective ribosome biogenesis enhances CNC by increasing the level of p22, and raise the possibility for versatile links between VLP assembly, its cytoplasmic environment, and a novel stress response. PMID:29046400
-
Naikare, Hemant; Palyada, Kiran; Panciera, Roger; Marlow, Denver; Stintzi, Alain
2006-10-01
To assess the importance of ferrous iron acquisition in Campylobacter physiology and pathogenesis, we disrupted and characterized the Fe2+ iron transporter, FeoB, in Campylobacter jejuni NCTC 11168, 81-176, and ATCC 43431. The feoB mutant was significantly affected in its ability to transport 55Fe2+. It accumulated half the amount of iron than the wild-type strain during growth in an iron-containing medium. The intracellular iron of the feoB mutant was localized in the periplasmic space versus the cytoplasm for the wild-type strain. These results indicate that the feoB gene of C. jejuni encodes a functional ferrous iron transport system. Reverse transcriptase PCR analysis revealed the cotranscription of feoB and Cj1397, which encodes a homolog of Escherichia coli feoA. C. jejuni 81-176 feoB mutants exhibited reduced ability to persist in human INT-407 embryonic intestinal cells and porcine IPEC-1 small intestinal epithelial cells compared to the wild type. C. jejuni NCTC 11168 feoB mutant was outcompeted by the wild type for colonization and/or survival in the rabbit ileal loop. The feoB mutants of the three C. jejuni strains were significantly affected in their ability to colonize the chick cecum. And finally, the three feoB mutants were outcompeted by their respective wild-type strains for infection of the intestinal tracts of colostrum-deprived piglets. Taken together, these results demonstrate that FeoB-mediated ferrous iron acquisition contributes significantly to colonization of the gastrointestinal tract during both commensal and infectious relationship, and thus it plays an important role in Campylobacter pathogenesis.
-
lbtA and lbtB Are Required for Production of the Legionella pneumophila Siderophore Legiobactin
Allard, Kimberly A.; Viswanathan, V. K.; Cianciotto, Nicholas P.
2006-01-01
Under iron stress, Legionella pneumophila secretes legiobactin, a nonclassical siderophore that is reactive in the chrome azurol S (CAS) assay. Here, we have optimized conditions for legiobactin expression, shown its biological activity, and identified two genes, lbtA and lbtB, which are involved in legiobactin production. lbtA appears to be iron repressed and encodes a protein that has significant homology with siderophore synthetases, and FrgA, a previously described iron-regulated protein of L. pneumophila. lbtB encodes a protein homologous with members of the major facilitator superfamily of multidrug efflux pumps. Mutants lacking lbtA or lbtB were defective for legiobactin, producing 40 to 70% less CAS reactivity in deferrated chemically defined medium (CDM). In bioassays, mutant CDM culture supernatants, unlike those of the wild type, did not support growth of iron-limited wild-type bacteria in 2′,2′-dipyridyl-containing buffered charcoal yeast extract (BCYE) agar and a ferrous iron transport mutant on BCYE agar without added iron. The lbtA mutant was modestly defective for growth in deferrated CDM containing the iron chelator citrate, indicating that legiobactin is required in conditions of severe iron limitation. Complementation of the lbt mutants restored both siderophore expression, as measured by the CAS assay and bioassays, and bacterial growth in deferrated, citrate-containing media. The lbtA mutant replicated as the wild type did in macrophages, amoebae, and the lungs of mice. However, L. pneumophila expresses lbtA in the macrophage, suggesting that legiobactin, though not required, may play a dispensable role in intracellular growth. The discovery of lbtAB represents the first identification of genes required for L. pneumophila siderophore expression. PMID:16452417
-
Marroquin-Guzman, Margarita; Wilson, Richard A.
2015-01-01
Fungal plant pathogens are persistent and global food security threats. To invade their hosts they often form highly specialized infection structures, known as appressoria. The cAMP/ PKA- and MAP kinase-signaling cascades have been functionally delineated as positive-acting pathways required for appressorium development. Negative-acting regulatory pathways that block appressorial development are not known. Here, we present the first detailed evidence that the conserved Target of Rapamycin (TOR) signaling pathway is a powerful inhibitor of appressorium formation by the rice blast fungus Magnaporthe oryzae. We determined TOR signaling was activated in an M. oryzae mutant strain lacking a functional copy of the GATA transcription factor-encoding gene ASD4. Δasd4 mutant strains could not form appressoria and expressed GLN1, a glutamine synthetase-encoding orthologue silenced in wild type. Inappropriate expression of GLN1 increased the intracellular steady-state levels of glutamine in Δasd4 mutant strains during axenic growth when compared to wild type. Deleting GLN1 lowered glutamine levels and promoted appressorium formation by Δasd4 strains. Furthermore, glutamine is an agonist of TOR. Treating Δasd4 mutant strains with the specific TOR kinase inhibitor rapamycin restored appressorium development. Rapamycin was also shown to induce appressorium formation by wild type and Δcpka mutant strains on non-inductive hydrophilic surfaces but had no effect on the MAP kinase mutant Δpmk1. When taken together, we implicate Asd4 in regulating intracellular glutamine levels in order to modulate TOR inhibition of appressorium formation downstream of cPKA. This study thus provides novel insight into the metabolic mechanisms that underpin the highly regulated process of appressorium development. PMID:25901357
-
Lee, Gileung; Lee, Kang-Ie; Lee, Yunjoo; Kim, Backki; Lee, Dongryung; Seo, Jeonghwan; Jang, Su; Chin, Joong Hyoun; Koh, Hee-Jong
2018-07-01
The split-hull phenotype caused by reduced lemma width and low lignin content is under control of SPH encoding a type-2 13-lipoxygenase and contributes to high dehulling efficiency. Rice hulls consist of two bract-like structures, the lemma and palea. The hull is an important organ that helps to protect seeds from environmental stress, determines seed shape, and ensures grain filling. Achieving optimal hull size and morphology is beneficial for seed development. We characterized the split-hull (sph) mutant in rice, which exhibits hull splitting in the interlocking part between lemma and palea and/or the folded part of the lemma during the grain filling stage. Morphological and chemical analysis revealed that reduction in the width of the lemma and lignin content of the hull in the sph mutant might be the cause of hull splitting. Genetic analysis indicated that the mutant phenotype was controlled by a single recessive gene, sph (Os04g0447100), which encodes a type-2 13-lipoxygenase. SPH knockout and knockdown transgenic plants displayed the same split-hull phenotype as in the mutant. The sph mutant showed significantly higher linoleic and linolenic acid (substrates of lipoxygenase) contents in spikelets compared to the wild type. It is probably due to the genetic defect of SPH and subsequent decrease in lipoxygenase activity. In dehulling experiment, the sph mutant showed high dehulling efficiency even by a weak tearing force in a dehulling machine. Collectively, the results provide a basis for understanding of the functional role of lipoxygenase in structure and maintenance of hulls, and would facilitate breeding of easy-dehulling rice.
-
Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cho, Yangrae; Ohm, Robin A.; Grigoriev, Igor V.
Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. To identify molecular determinants of pathogenicity, we created non-pathogenic mutants of a transcription factor-encoding gene, AbPf2. The frequency and timing of germination and appressorium formation on host plants were similar between the non-pathogenic abpf2 mutants and wild-type A. brassicicola. The mutants were also similar in vitro to wild-type A. brassicicola in terms of vegetative growth, conidium production, and responses to a phytoalexin, reactive oxygen species and osmolites. The hyphae of the mutants grew slowly but did not cause disease symptoms on the surface of host plants. Transcripts of the AbPf2more » gene increased exponentially soon after wild-type conidia contacted their host plants . A small amount of AbPf2 protein, as monitored using GFP fusions, was present in young, mature conidia. The protein level decreased during saprophytic growth, but increased and was located primarily in fungal nuclei during pathogenesis. Levels of the proteins and transcripts sharply decreased following colonization of host tissues beyond the initial infection site. When expression of the transcription factor was induced in the wild-type during early pathogenesis, 106 fungal genes were also induced in the wild-type but not in the abpf2 mutants. Notably, 33 of the 106 genes encoded secreted proteins, including eight putative effector proteins. Plants inoculated with abpf2 mutants expressed higher levels of genes associated with photosynthesis, the pentose phosphate pathway and primary metabolism, but lower levels of defense-related genes. Our results suggest that AbPf2 is an important regulator of pathogenesis, but does not affect other cellular processes in A. brassicicola.« less
-
USDA-ARS?s Scientific Manuscript database
A seed-specific maize mutant, defective endosperm18 (de18), accumulates approximately 40% less dry mass and 10- to 15- fold less auxin (IAA) as compared to the De18; however, a causal basis of these changes is not known. Cellular analyses here showed that the de18 developing endosperm had lower tota...
-
Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James
2001-01-01
We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076
-
Carpenter, Dale; Singh, Sukhpreet; Osorio, Nelson; Hsiang, Chinhui; Jiang, Xianzhi; Jin, Ling; Jones, Clinton; Wechsler, Steven L
2010-01-01
During herpes simplex virus-1 (HSV-1) latency in sensory neurons, LAT (latency-associated transcript) is the only abundantly expressed viral gene. LAT plays an important role in the HSV-1 latency-reactivation cycle, because LAT deletion mutants have a significantly decreased reactivation phenotype. Based solely on sequence analysis, it was speculated that LAT encodes a ribozyme that plays an important role in how LAT enhances the virus’ reactivation phenotype. Because LAT ribozyme activity has never been reported, we decided to test the converse hypothesis, namely, that this region of LAT does not encode a ribozyme function important for LAT’s ability to enhance the reactivation phenotype. We constructed a viral mutant (LAT-Rz) in which the speculated ribozyme consensus sequence was altered such that no ribozyme was encoded. We report here that LAT-Rz had a wild-type reactivation phenotype in mice, confirming the hypothesis that the speculated LAT ribozyme is not a dominant factor in stimulating the latency-reactivation cycle in mice. PMID:18982533
-
Kamerewerd, Jens; Jansson, Malin; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich
2008-01-01
Sordaria macrospora, a self-fertile filamentous ascomycete, carries genes encoding three different α-subunits of heterotrimeric G proteins (gsa, G protein Sordaria alpha subunit). We generated knockout strains for all three gsa genes (Δgsa1, Δgsa2, and Δgsa3) as well as all combinations of double mutants. Phenotypic analysis of single and double mutants showed that the genes for Gα-subunits have distinct roles in the sexual life cycle. While single mutants show some reduction of fertility, double mutants Δgsa1Δgsa2 and Δgsa1Δgsa3 are completely sterile. To test whether the pheromone receptors PRE1 and PRE2 mediate signaling via distinct Gα-subunits, two recently generated Δpre strains were crossed with all Δgsa strains. Analyses of the corresponding double mutants revealed that compared to GSA2, GSA1 is a more predominant regulator of a signal transduction cascade downstream of the pheromone receptors and that GSA3 is involved in another signaling pathway that also contributes to fruiting body development and fertility. We further isolated the gene encoding adenylyl cyclase (AC) (sac1) for construction of a knockout strain. Analyses of the three ΔgsaΔsac1 double mutants and one Δgsa2Δgsa3Δsac1 triple mutant indicate that SAC1 acts downstream of GSA3, parallel to a GSA1–GSA2-mediated signaling pathway. In addition, the function of STE12 and PRO41, two presumptive signaling components, was investigated in diverse double mutants lacking those developmental genes in combination with the gsa genes. This analysis was further completed by expression studies of the ste12 and pro41 transcripts in wild-type and mutant strains. From the sum of all our data, we propose a model for how different Gα-subunits interact with pheromone receptors, adenylyl cyclase, and STE12 and thus cooperatively regulate sexual development in S. macrospora. PMID:18723884
-
Human AZU-1 gene, variants thereof and expressed gene products
Chen, Huei-Mei; Bissell, Mina
2004-06-22
A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.
-
Lipoic acid functionalized amino acids cationic lipids as gene vectors.
Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zheng, Li-Ting; Zhao, Zhi-Gang
2016-10-01
A series of reducible cationic lipids 4a-4f with different amino acid polar-head groups were prepared. The novel lipid contains a hydrophobic lipoic acid (LA) moiety, which can be reduced under reductive conditions to release of the encapsulated plasmid DNA. The particle size, zeta potential and cellular uptake of lipoplexes formed with DNA, as well as the transfection efficacy (TE) were characterized. The TE of the cationic lipid based on arginine was especially high, and was 2.5times higher than that of a branched polyethylenimine in the presence of 10% serum. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida
2015-01-01
The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA. PMID:26788510
-
Monserrat, José Maria; Lima, Juliane Ventura; Ferreira, Josencler Luis Ribas; Acosta, Daiane; Garcia, Márcia Longaray; Ramos, Patricia Baptista; Moraes, Tarsila Barros; Dos Santos, Luciane Cougo; Amado, Lílian Lund
2008-09-01
Lipoic acid (LA) has been reported as a potential therapeutic agent due its antioxidants proprieties. It was considered its effect in different organs (gills, brain, muscle and liver) of the fish Corydoras paleatus (Callychthyidae). LA (70 mg/kg of body mass) was added to a commercial fish diet, organisms being fed daily (1% body weight). Sixty animals (mean mass: 2.37+/-0.09 g) were placed randomly in aquariums and received (+LA) or not (-LA) lipoic acid enriched diet during four weeks. After, fish were killed and the brain, muscle, gills and liver were dissected. LA treatment reduced significantly (p<0.05) reactive oxygen species concentration in brain and increased (p<0.05) glutamate-cysteine ligase activity in brain and liver of the same experimental group. LA fed organisms showed higher (p<0.05) brain glutathione-S-transferase activity, indicating that LA improves the detoxification and antioxidant capacity face components that waste glutathione in phase II reactions. A conspicuous reduction of protein oxidation was observed in muscle and liver of +LA organisms, indicating that the treatment was also effective in reducing oxidative stress parameters.
-
Kulikova, Olga I; Berezhnoy, Daniil S; Stvolinsky, Sergey L; Lopachev, Alexander V; Orlova, Valentina S; Fedorova, Tatiana N
2018-06-01
In a model of early-stage Parkinson's disease induced by a single intranasal administration of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) to Wistar rats, a neuroprotective effect of a new derivative of carnosine and α-lipoic acid (C/LA nanomicellar complex) was demonstrated. Acute intraperitoneal administration of carnosine, α-lipoic acid and C/LA complex following MPTP administration normalized the total antioxidant activity in the brain tissue. Of all the compounds tested only C/LA complex normalized the metabolism of dopamine (DA) and serotonin (5-HT), while its components did not show similar effects when used separately. C/LA complex effectively restored the level of DA metabolites: the level of DOPAC was increased by 24.7 ± 5.6% compared to the animals that had received MPTP only, and the level of HVA was restored to the values observed in the intact animals. Integral metabolic indices of DA (DOPAC/DA and HVA/DA ratios) and 5-HT turnover (5-HIAA/5-HT ratio) in the striatum tended to increase in case of C/LA complex administration. Copyright © 2018 Elsevier Inc. All rights reserved.
-
Alpha lipoic acid in obstetrics and gynecology.
Di Tucci, Chiara; Di Feliciantonio, Mara; Vena, Flaminia; Capone, Carmela; Schiavi, Michele Carlo; Pietrangeli, Daniela; Muzii, Ludovico; Benedetti Panici, Pierluigi
2018-05-04
Alpha-Lipoic acid (ALA) is a natural antioxidant synthetized by plants and animals, identified as a catalytic agent for oxidative decarboxylation of pyruvate and α-ketoglutarate. In this review, we analyzed the action of ALA in gynecology and obstetrics focusing in particular on neuropathic pain and antioxidant and anti-inflammatory action. A comprehensive literature search was performed in PubMed and Cochrane Library for retrieving articles in English language on the antioxidant and anti-inflammatory effects of ALA in gynecological and obstetrical conditions. ALA reduces oxidative stress and insulin resistance in women with polycystic ovary syndrome (PCOS). The association of N-acetyl cysteine (NAC), alpha-lipoic acid (ALA), and bromelain (Br) is used for prevention and treatment of endometriosis. In association with omega-3 polyunsaturated fatty acids (n-3 PUFAs) with amitriptyline is used for treatment of vestibulodynia/painful bladder syndrome (VBD/PBS). A promising area of research is ALA supplementation in patients with threatened miscarriage to improve the subchorionic hematoma resorption. Furthermore, ALA could be used in prevention of diabetic embryopathy and premature rupture of fetal membranes induced by inflamation. In conclusion, ALA can be safely used for treatment of neuropatic pain and as a dietary support during pregnancy.
-
Jiang, Tianyi; Yin, Fei; Yao, Jia; Brinton, Roberta Díaz; Cadenas, Enrique
2013-01-01
Summary This study examines the progress of a hypometabolic state inherent in brain aging with an animal model consisting of Fischer 344 rats of young, middle, and old ages. Dynamic microPET scanning demonstrated a significant decline in brain glucose uptake at old ages, which was associated with a decrease in the expression of insulin-sensitive neuronal glucose transporters GLUT3/4 and of microvascular endothelium GLUT1. Brain aging was associated with an imbalance of the PI3K/Akt pathway of insulin signaling and JNK signaling and a downregulation of the PGC1α – mediated transcriptional pathway of mitochondrial biogenesis that impinged on multiple aspects of energy homeostasis. R-(+)-lipoic acid treatment increased glucose uptake, restored the balance of Akt/JNK signaling, and enhanced mitochondrial bioenergetics and the PGC1α-driven mitochondrial biogenesis. It may be surmised that impairment of a mitochondria-cytosol-nucleus communication is underlying the progression of the age-related hypometabolic state in brain; the effects of lipoic acid are not organelle-limited but reside on the functional and effective coordination of this communication that results in improved energy metabolism. PMID:23815272
-
Lin, Liangcai; Chen, Yong; Li, Jingen; Wang, Shanshan; Sun, Wenliang; Tian, Chaoguang
2017-04-01
To elucidate the mechanism of cellulase signal transduction in filamentous fungi including the components of the cellulase induction pathway. Neurospora crassa ncw-1 encodes a non-anchored cell wall protein. The absence of ncw-1 increased cellulase gene expression and this is not due to relieving carbon catabolite repression mediated by the cre-1 pathway. A mutant lacking genes encoding both three major β-glucosidase enzymes and NCW-1 (Δ3βGΔncw-1) was constructed. Transcriptome analysis of the quadruple mutant demonstrated enhanced expression of cellodextrin transporters after ncw-1 deletion, indicating that ncw-1 affects cellulase expression and production by inhibiting the uptake of the cellodextrin. NCW-1 is a novel component that plays a critical role in the cellulase induction signaling pathway.
-
Yong, K J; Scott, D J
2015-03-01
Directed evolution is a powerful method for engineering proteins towards user-defined goals and has been used to generate novel proteins for industrial processes, biological research and drug discovery. Typical directed evolution techniques include cellular display, phage display, ribosome display and water-in-oil compartmentalization, all of which physically link individual members of diverse gene libraries to their translated proteins. This allows the screening or selection for a desired protein function and subsequent isolation of the encoding gene from diverse populations. For biotechnological and industrial applications there is a need to engineer proteins that are functional under conditions that are not compatible with these techniques, such as high temperatures and harsh detergents. Cellular High-throughput Encapsulation Solubilization and Screening (CHESS), is a directed evolution method originally developed to engineer detergent-stable G proteins-coupled receptors (GPCRs) for structural biology. With CHESS, library-transformed bacterial cells are encapsulated in detergent-resistant polymers to form capsules, which serve to contain mutant genes and their encoded proteins upon detergent mediated solubilization of cell membranes. Populations of capsules can be screened like single cells to enable rapid isolation of genes encoding detergent-stable protein mutants. To demonstrate the general applicability of CHESS to other proteins, we have characterized the stability and permeability of CHESS microcapsules and employed CHESS to generate thermostable, sodium dodecyl sulfate (SDS) resistant green fluorescent protein (GFP) mutants, the first soluble proteins to be engineered using CHESS. © 2014 Wiley Periodicals, Inc.
-
BeGora, Michael D; Macleod, Mitchell J R; McCarry, Brian E; Summers, Peter S; Weretilnyk, Elizabeth A
2010-09-17
Three sequential methylations of phosphoethanolamine (PEA) are required for the synthesis of phosphocholine (PCho) in plants. A cDNA encoding an N-methyltransferase that catalyzes the last two methylation steps was cloned from Arabidopsis by heterologous complementation of a Saccharomyces cerevisiae cho2, opi3 mutant. The cDNA encodes phosphomethylethanolamine N-methyltransferase (PMEAMT), a polypeptide of 475 amino acids that is organized as two tandem methyltransferase domains. PMEAMT shows 87% amino acid identity to a related enzyme, phosphoethanolamine N-methyltransferase, an enzyme in plants that catalyzes all three methylations of PEA to PCho. PMEAMT cannot use PEA as a substrate, but assays using phosphomethylethanolamine as a substrate result in both phosphodimethylethanolamine and PCho as products. PMEAMT is inhibited by the reaction products PCho and S-adenosyl-l-homocysteine, a property reported for phosphoethanolamine N-methyltransferase from various plants. An Arabidopsis mutant with a T-DNA insertion associated with locus At1g48600 showed no transcripts encoding PMEAMT. Shotgun lipidomic analyses of leaves of atpmeamt and wild-type plants generated phospholipid profiles showing the content of phosphatidylmethylethanolamine to be altered relative to wild type with the content of a 34:3 lipid molecular species 2-fold higher in mutant plants. In S. cerevisiae, an increase in PtdMEA in membranes is associated with reduced viability. This raises a question regarding the role of PMEAMT in plants and whether it serves to prevent the accumulation of PtdMEA to potentially deleterious levels.
-
Basse, Christoph W.; Kerschbamer, Christine; Brustmann, Markus; Altmann, Thomas; Kahmann, Regine
2002-01-01
We have identified a gene (udh1) in the basidiomycete Ustilago maydis that is induced during the parasitic interaction with its host plant maize (Zea mays). udh1 encodes a protein with high similarity to mammalian and plant 5α-steroid reductases. Udh1 differs from those of known 5α-steroid reductases by six additional domains, partially predicted to be membrane-spanning. A fusion protein of Udh1 and the green fluorescent protein provided evidence for endoplasmic reticulum localization in U. maydis. The function of the Udh1 protein was demonstrated by complementing Arabidopsis det2-1 mutants, which display a dwarf phenotype due to a mutation in the 5α-steroid reductase encoding DET2 gene. det2-1 mutant plants expressing either the udh1 or the DET2 gene controlled by the cauliflower mosaic virus 35S promoter differed from wild-type Columbia plants by accelerated stem growth, flower and seed development and a reduction in size and number of rosette leaves. The accelerated growth phenotype of udh1 transgenic plants was stably inherited and was favored under reduced light conditions. Truncation of the N-terminal 70 amino acids of the Udh1 protein abolished the ability to restore growth in det2-1 plants. Our results demonstrate the existence of a 5α-steroid reductase encoding gene in fungi and suggest a common ancestor between fungal, plant, and mammalian proteins. PMID:12068114
-
Basse, Christoph W; Kerschbamer, Christine; Brustmann, Markus; Altmann, Thomas; Kahmann, Regine
2002-06-01
We have identified a gene (udh1) in the basidiomycete Ustilago maydis that is induced during the parasitic interaction with its host plant maize (Zea mays). udh1 encodes a protein with high similarity to mammalian and plant 5alpha-steroid reductases. Udh1 differs from those of known 5alpha-steroid reductases by six additional domains, partially predicted to be membrane-spanning. A fusion protein of Udh1 and the green fluorescent protein provided evidence for endoplasmic reticulum localization in U. maydis. The function of the Udh1 protein was demonstrated by complementing Arabidopsis det2-1 mutants, which display a dwarf phenotype due to a mutation in the 5alpha-steroid reductase encoding DET2 gene. det2-1 mutant plants expressing either the udh1 or the DET2 gene controlled by the cauliflower mosaic virus 35S promoter differed from wild-type Columbia plants by accelerated stem growth, flower and seed development and a reduction in size and number of rosette leaves. The accelerated growth phenotype of udh1 transgenic plants was stably inherited and was favored under reduced light conditions. Truncation of the N-terminal 70 amino acids of the Udh1 protein abolished the ability to restore growth in det2-1 plants. Our results demonstrate the existence of a 5alpha-steroid reductase encoding gene in fungi and suggest a common ancestor between fungal, plant, and mammalian proteins.
-
van der Ploeg, Jan R.
2005-01-01
In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhongchi Liu
2004-10-01
Unlike animals, plants are constantly exposed to environmental mutagens including ultraviolet light and reactive oxygen species. Further, plant cells are totipotent with highly plastic developmental programs. An understanding of molecular mechanisms underlying the ability of plants to monitor and repair its DNA and to eliminate damaged cells are of great importance. Previously we have identified two genes, TSO1 and TSO2, from a flowering plant Arabidopsis thaliana. Mutations in these two genes cause callus-like flowers, fasciated shoot apical meristems, and abnormal cell division, indicating that TSO1 and TSO2 may encode important cell cycle regulators. Previous funding from DOE led to themore » molecular cloning of TSO1, which was shown to encode a novel nuclear protein with two CXC domains suspected to bind DNA. This DOE grant has allowed us to characterize and isolate TSO2 that encodes the small subunit of the ribonucleotide reductase (RNR). RNR comprises two large subunits (R1) an d two small subunits (R2), catalyzes a rate-limiting step in the production of deoxyribonucleotides needed for DNA replication and repair. Previous studies in yeast and mammals indicated that defective RNR often led to cell cycle arrest, growth retardation and p53-dependent apoptosis while abnormally elevated RNR activities led to higher mutation rates. Subsequently, we identified two additional R2 genes, R2A and R2B in the Arabidopsis genome. Using reverse genetics, mutations in R2A and R2B were isolated, and double and triple mutants among the three R2 genes (TSO2, R2A and R2B) were constructed and analyzed. We showed that Arabidopsis tso2 mutants, with reduced dNTP levels, were more sensitive to UV-C. While r2a or r2b single mutants did not exhibit any phenotypes, tso2 r2b double mutants were embryonic lethal and tso2 r2a double mutants were seedling lethal indicating redundant functions among the three R2 genes. Furthermore, tso2 r2a double mutants exhibited increased DNA dam age, massive programmed cell death, and the release of transcriptional gene silencing. Our data suggests that plants can initiate programmed cell death to eliminate damaged cells despite the absence of p53 in plant genome.« less
-
2013-01-01
Background The bacterium Escherichia coli can be grown employing various carbohydrates as sole carbon and energy source. Among them, glucose affords the highest growth rate. This sugar is nowadays widely employed as raw material in industrial fermentations. When E. coli grows in a medium containing non-limiting concentrations of glucose, a metabolic imbalance occurs whose main consequence is acetate secretion. The production of this toxic organic acid reduces strain productivity and viability. Solutions to this problem include reducing glucose concentration by substrate feeding strategies or the generation of mutant strains with impaired glucose import capacity. In this work, a collection of E. coli strains with inactive genes encoding proteins involved in glucose transport where generated to determine the effects of reduced glucose import capacity on growth rate, biomass yield, acetate and production of an experimental plasmid DNA vaccine (pHN). Results A group of 15 isogenic derivatives of E. coli W3110 were generated with single and multiple deletions of genes encoding glucose, mannose, beta-glucoside, maltose and N-acetylglucosamine components of the phosphoenolpyruvate:sugar phosphotransferase system (PTS), as well as the galactose symporter and the Mgl galactose/glucose ABC transporter. These strains were characterized by growing them in mineral salts medium supplemented with 2.5 g/L glucose. Maximum specific rates of glucose consumption (qs) spanning from 1.33 to 0.32 g/g h were displayed by the group of mutants and W3110, which resulted in specific growth rates ranging from 0.65-0.18 h-1. Acetate accumulation was reduced or abolished in cultures with all mutant strains. W3110 and five selected mutant derivatives were transformed with pHN. A 3.2-fold increase in pHN yield on biomass was observed in cultures of a mutant strain with deletion of genes encoding the glucose and mannose PTS components, as well as Mgl. Conclusions The group of E. coli mutants generated in this study displayed a reduction or elimination of overflow metabolism and a linear correlation between qs and the maximum specific growth rate as well as the acetate production rate. By comparing DNA vaccine production parameters among some of these mutants, it was possible to identify a near-optimal glucose import rate value for this particular application. The strains employed in this study should be a useful resource for studying the effects of different predefined qs values on production capacity for various biotechnological products. PMID:23638701
-
Duchêne, Thierry; Cogez, Virginie; Cousin, Charlotte; Peltier, Gilles; Ball, Steven G.; Dauvillée, David
2013-01-01
A screen was recently developed to study the mobilization of starch in the unicellular green alga Chlamydomonas reinhardtii. This screen relies on starch synthesis accumulation during nitrogen starvation followed by the supply of nitrogen and the switch to darkness. Hence multiple regulatory networks including those of nutrient starvation, cell cycle control and light to dark transitions are likely to impact the recovery of mutant candidates. In this paper we monitor the specificity of this mutant screen by characterizing the nature of the genes disrupted in the selected mutants. We show that one third of the mutants consisted of strains mutated in genes previously reported to be of paramount importance in starch catabolism such as those encoding β-amylases, the maltose export protein, and branching enzyme I. The other mutants were defective for previously uncharacterized functions some of which are likely to define novel proteins affecting starch mobilization in green algae. PMID:24019981
-
Forebrain-Specific Loss of BMPRII in Mice Reduces Anxiety and Increases Object Exploration.
McBrayer, Zofeyah L; Dimova, Jiva; Pisansky, Marc T; Sun, Mu; Beppu, Hideyuki; Gewirtz, Jonathan C; O'Connor, Michael B
2015-01-01
To investigate the role of Bone Morphogenic Protein Receptor Type II (BMPRII) in learning, memory, and exploratory behavior in mice, a tissue-specific knockout of BMPRII in the post-natal hippocampus and forebrain was generated. We found that BMPRII mutant mice had normal spatial learning and memory in the Morris water maze, but showed significantly reduced swimming speeds with increased floating behavior. Further analysis using the Porsolt Swim Test to investigate behavioral despair did not reveal any differences in immobility between mutants and controls. In the Elevated Plus Maze, BMPRII mutants and Smad4 mutants showed reduced anxiety, while in exploratory tests, BMPRII mutants showed more interest in object exploration. These results suggest that loss of BMPRII in the mouse hippocampus and forebrain does not disrupt spatial learning and memory encoding, but instead impacts exploratory and anxiety-related behaviors.
-
Forebrain-Specific Loss of BMPRII in Mice Reduces Anxiety and Increases Object Exploration
McBrayer, Zofeyah L.; Dimova, Jiva; Pisansky, Marc T.; Sun, Mu; Beppu, Hideyuki; Gewirtz, Jonathan C.; O’Connor, Michael B.
2015-01-01
To investigate the role of Bone Morphogenic Protein Receptor Type II (BMPRII) in learning, memory, and exploratory behavior in mice, a tissue-specific knockout of BMPRII in the post-natal hippocampus and forebrain was generated. We found that BMPRII mutant mice had normal spatial learning and memory in the Morris water maze, but showed significantly reduced swimming speeds with increased floating behavior. Further analysis using the Porsolt Swim Test to investigate behavioral despair did not reveal any differences in immobility between mutants and controls. In the Elevated Plus Maze, BMPRII mutants and Smad4 mutants showed reduced anxiety, while in exploratory tests, BMPRII mutants showed more interest in object exploration. These results suggest that loss of BMPRII in the mouse hippocampus and forebrain does not disrupt spatial learning and memory encoding, but instead impacts exploratory and anxiety-related behaviors. PMID:26444546
-
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis
Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-01-01
Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587
-
Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao
2018-01-01
A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea. A novel pathogenicity-related gene BcKMO, which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO-complementing mutant (BCG183/BcKMO) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/BcKMO. Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H2O2, and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1, Pka2, PkaR, Bcg2, Bcg3, bmp1, and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea. Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea. PMID:29867912
-
NASA Astrophysics Data System (ADS)
Zhang, Xiaolin; Li, Nan; Qin, Ting; Huang, Bei; Nie, Pin
2017-11-01
Flavobacterium columnare is the pathogenic agent of columnaris disease in aquaculture. Using a recently developed gene deletion strategy, two genes that encode the Glyco_hydro_19 domain (GH19 domain) containing proteins, ghd-1 and ghd-2, were deleted separately and together from the F. columnare G4 wild type strain. Surprisingly, the single-, Δ ghd-1 and Δ ghd-2, and double-gene mutants, Δ ghd-1 Δghd -2, all had rhizoid and non-rhizoid colony morphotypes, which we named Δ ghd-1, Δ ghd-2, Δ ghd-1 Δ ghd-2, and NΔ ghd-1, NΔ ghd-2, and NΔ ghd-1 Δ ghd-2. However, chitin utilization was not detected in either these mutants or in the wild type. Instead, skimmed milk degradation was observed for the mutants and the wild type; the non-rhizoid strain NΔ ghd-2 exhibited higher degradation activity as revealed by the larger transparent circle on the skimmed milk plate. Using zebrafish as the model organism, we found that non-rhizoid mutants had higher LD50 values and were less virulent because zebrafish infected with these survived longer. Transcriptome analysis between the non-rhizoid and rhizoid colony morphotypes of each mutant, i.e., NΔ ghd -1 versus (vs) Δ ghd-1, NΔ ghd-2 vs Δ ghd-2, and NΔ ghd-1 Δ ghd-2 vs Δ ghd-1 Δ ghd-2, revealed a large number of differentially expressed genes, among which 39 genes were common in three of the pairs compared. Although most of these genes encode hypothetical proteins, a few molecules such as phage tail protein, rhs element Vgr protein, thiol-activated cytolysin, and TonB-dependent outer membrane receptor precursor, expression of which was down-regulated in non-rhizoid mutants but up-regulated in rhizoid mutants, may play a role F. columnare virulence.
-
Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao
2018-01-01
A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea . A novel pathogenicity-related gene BcKMO , which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO -complementing mutant (BCG183/ BcKMO ) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/ BcKMO . Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H 2 O 2 , and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1 , Pka2 , PkaR , Bcg2 , Bcg3 , bmp1 , and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea . Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea .
-
Herbert, Andrew P; Kavanagh, David; Johansson, Conny; Morgan, Hugh P; Blaum, Bärbel S; Hannan, Jonathan P; Barlow, Paul N; Uhrín, Dušan
2012-03-06
Numerous complement factor H (FH) mutations predispose patients to atypical hemolytic uremic syndrome (aHUS) and other disorders arising from inadequately regulated complement activation. No unifying structural or mechanistic consequences have been ascribed to these mutants beyond impaired self-cell protection. The S1191L and V1197A mutations toward the C-terminus of FH, which occur in patients singly or together, arose from gene conversion between CFH encoding FH and CFHR1 encoding FH-related 1. We show that neither single nor double mutations structurally perturbed recombinant proteins consisting of the FH C-terminal modules, 19 and 20 (FH19-20), although all three FH19-20 mutants were poor, compared to wild-type FH19-20, at promoting hemolysis of C3b-coated erythrocytes through competition with full-length FH. Indeed, our new crystal structure of the S1191L mutant of FH19-20 complexed with an activation-specific complement fragment, C3d, was nearly identical to that of the wild-type FH19-20:C3d complex, consistent with mutants binding to C3b with wild-type-like affinity. The S1191L mutation enhanced thermal stability of module 20, whereas the V1197A mutation dramatically decreased it. Thus, although mutant proteins were folded at 37 °C, they differ in conformational rigidity. Neither single substitutions nor double substitutions increased measurably the extent of FH19-20 self-association, nor did these mutations significantly affect the affinity of FH19-20 for three glycosaminoglycans, despite critical roles of module 20 in recognizing polyanionic self-surface markers. Unexpectedly, FH19-20 mutants containing Leu1191 self-associated on a heparin-coated surface to a higher degree than on surfaces coated with dermatan or chondroitin sulfates. Thus, potentially disease-related functional distinctions between mutants, and between FH and FH-related 1, may manifest in the presence of specific glycosaminoglycans.
-
Genetic analysis of vertebrate sensory hair cell mechanosensation: the zebrafish circler mutants.
Nicolson, T; Rüsch, A; Friedrich, R W; Granato, M; Ruppersberg, J P; Nüsslein-Volhard, C
1998-02-01
The molecular basis of sensory hair cell mechanotransduction is largely unknown. In order to identify genes that are essential for mechanosensory hair cell function, we characterized a group of recently isolated zebrafish motility mutants. These mutants are defective in balance and swim in circles but have no obvious morphological defects. We examined the mutants using calcium imaging of acoustic-vibrational and tactile escape responses, high resolution microscopy of sensory neuroepithelia in live larvae, and recordings of extracellular hair cell potentials (microphonics). Based on the analyses, we have identified several classes of genes. Mutations in sputnik and mariner affect hair bundle integrity. Mutant astronaut and cosmonaut hair cells have relatively normal microphonics and thus appear to affect events downstream of mechanotransduction. Mutant orbiter, mercury, and gemini larvae have normal hair cell morphology and yet do not respond to acoustic-vibrational stimuli. The microphonics of lateral line hair cells of orbiter, mercury, and gemini larvae are absent or strongly reduced. Therefore, these genes may encode components of the transduction apparatus.
-
Cho, Suk-Woo; Cho, Jeong-Hoon; Song, Hyun-Ok; Park, Chul-Seung
2005-02-28
Cyclic nucleotide-gated (CNG) channels encoded by the tax-4 and tax-2 genes are required for chemosensing and thermosensing in the nematode C. elegans. We identified a gene in the C. elegans genome, which we designated cng-1, that is highly homologous to tax-4. Partial CNG-1 protein tagged with green fluorescent protein was expressed in several sensory neurons of the amphid. We created a deletion mutant of cng-1, cng-1 (jh111), to investigate its in vivo function. The mutant worms had no detectable abnormalities in terms of their basic behavior or morphology. Whereas tax-4 and tax-2 mutants failed to respond to water-soluble or volatile chemical attractants, the cng-1 null mutant exhibited normal chemotaxis to such chemicals and a tax-4;cng-1 double mutant had a similar phenotype to tax-4 single mutants. Interestingly, cng-1 and tax-4 had a synergistic effect on brood size.
-
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd
2016-01-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704
-
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-05-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.
-
Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A
1993-01-01
A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064
-
Kohzuma, Kaori; Chiba, Motoko; Nagano, Soichiro; Anai, Toyoaki; Ueda, Miki U.; Oguchi, Riichi; Shirai, Kazumasa; Hanada, Kousuke; Hikosaka, Kouki; Fujii, Nobuharu
2017-01-01
Radish (Raphanus sativus L. var. sativus), a widely cultivated root vegetable crop, possesses a large sink organ (the root), implying that photosynthetic activity in radish can be enhanced by altering both the source and sink capacity of the plant. However, since radish is a self-incompatible plant, improved mutation-breeding strategies are needed for this crop. TILLING (Targeting Induced Local Lesions IN Genomes) is a powerful method used for reverse genetics. In this study, we developed a new TILLING strategy involving a two-step mutant selection process for mutagenized radish plants: the first selection is performed to identify a BC1M1 line, that is, progenies of M1 plants crossed with wild-type, and the second step is performed to identify BC1M1 individuals with mutations. We focused on Rubisco as a target, since Rubisco is the most abundant plant protein and a key photosynthetic enzyme. We found that the radish genome contains six RBCS genes and one pseudogene encoding small Rubisco subunits. We screened 955 EMS-induced BC1M1 lines using our newly developed TILLING strategy and obtained six mutant lines for the six RsRBCS genes, encoding proteins with four different types of amino acid substitutions. Finally, we selected a homozygous mutant and subjected it to physiological measurements. PMID:28744180
-
Shi, Huazhong; Kim, YongSig; Guo, Yan; Stevenson, Becky; Zhu, Jian-Kang
2003-01-01
Cell surface proteoglycans have been implicated in many aspects of plant growth and development, but genetic evidence supporting their function has been lacking. Here, we report that the Salt Overly Sensitive5 (SOS5) gene encodes a putative cell surface adhesion protein and is required for normal cell expansion. The sos5 mutant was isolated in a screen for Arabidopsis salt-hypersensitive mutants. Under salt stress, the root tips of sos5 mutant plants swell and root growth is arrested. The root-swelling phenotype is caused by abnormal expansion of epidermal, cortical, and endodermal cells. The SOS5 gene was isolated through map-based cloning. The predicted SOS5 protein contains an N-terminal signal sequence for plasma membrane localization, two arabinogalactan protein–like domains, two fasciclin-like domains, and a C-terminal glycosylphosphatidylinositol lipid anchor signal sequence. The presence of fasciclin-like domains, which typically are found in animal cell adhesion proteins, suggests a role for SOS5 in cell-to-cell adhesion in plants. The SOS5 protein was present at the outer surface of the plasma membrane. The cell walls are thinner in the sos5 mutant, and those between neighboring epidermal and cortical cells in sos5 roots appear less organized. SOS5 is expressed ubiquitously in all plant organs and tissues, including guard cells in the leaf. PMID:12509519
-
Cytochrome oxidase assembly does not require catalytically active cytochrome C.
Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander
2003-03-14
Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.
-
Erect panicle2 encodes a novel protein that regulates panicle erectness in indica rice.
Zhu, Keming; Tang, Ding; Yan, Changjie; Chi, Zhengchang; Yu, Hengxiu; Chen, Jianmin; Liang, Jiansheng; Gu, Minghong; Cheng, Zhukuan
2010-02-01
Rice (Oryza sativa L.) inflorescence (panicle) architecture is an important agronomic trait for rice breeding. A number of high-yielding japonica rice strains, characterized by an erect panicle (EP) of their architecture, have been released as commercial varieties in China. But no EP-type indica varieties are released so far. Here, we identified two allelic erect-panicle mutants in indica rice, erect panicle2-1 (ep2-1) and erect panicle2-2 (ep2-2), exhibiting the characteristic erect panicle phenotype. Both mutants were derived from spontaneous mutation. We cloned the EP2 gene by way of a map-based cloning strategy, and a transgenic complementation test rescued the phenotype of ep2-1. Anatomical investigations revealed that the ep2 mutants have more vascular bundles and a thicker stem than that of wild-type plants, explaining the panicle erectness phenotype in ep2 mutants. It was shown that EP2 was specifically expressed in the vascular bundles of internodes by GUS staining and RT-PCR. EP2 encodes a novel plant-specific protein, which localizes to the endoplasmic reticulum with unknown biochemical function. In addition, EP2 also regulates other panicle characteristics, such as panicle length and grain size, but grain number per panicle shows little change, indicating that the mutation of the ep2 gene could be applied in EP-type indica rice breeding.
-
Sidhu-Muñoz, Rebeca S; Sancho, Pilar; Vizcaíno, Nieves
2016-04-15
Mutants in several genes have been obtained on the genetic background of virulent rough (lacking O-polysaccharide) Brucella ovis PA. The target genes encode outer membrane proteins previously associated with the virulence of smooth (bearing O-polysaccharide chains in the lipopolysaccharide) Brucella strains. Multiple attempts to delete omp16, coding for a homologue to peptidoglycan-associated lipoproteins, were unsuccessful, which suggests that Omp16 is probably essential for in vitro survival of B. ovis PA. Single deletion of omp10 or omp19-that encode two other outer membrane lipoproteins--was achieved, but the simultaneous removal of both genes failed, suggesting an essential complementary function between both proteins. Two other deletion mutants, defective in the Tol-C-homologue BepC or in the SP41 adhesin, were also obtained. Surprisingly when compared to previous results obtained with smooth Brucella, none of the B. ovis mutants showed attenuation in the virulence, either in the mouse model or in cellular models of professional and non-professional phagocytes. Additionally, and in contrast to the observations reported with smooth Brucella strains, several properties related to the outer membrane remained almost unaltered. These results evidence new distinctive traits between naturally rough B. ovis and smooth brucellae. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Gey, Manuel; Wanner, Renate; Schilling, Corinna; Pedro, Maria T.; Sinske, Daniela
2016-01-01
Axon injury in the peripheral nervous system (PNS) induces a regeneration-associated gene (RAG) response. Atf3 (activating transcription factor 3) is such a RAG and ATF3's transcriptional activity might induce ‘effector’ RAGs (e.g. small proline rich protein 1a (Sprr1a), Galanin (Gal), growth-associated protein 43 (Gap43)) facilitating peripheral axon regeneration. We provide a first analysis of Atf3 mouse mutants in peripheral nerve regeneration. In Atf3 mutant mice, facial nerve regeneration and neurite outgrowth of adult ATF3-deficient primary dorsal root ganglia neurons was decreased. Using genome-wide transcriptomics, we identified a neuropeptide-encoding RAG cluster (vasoactive intestinal peptide (Vip), Ngf, Grp, Gal, Pacap) regulated by ATF3. Exogenous administration of neuropeptides enhanced neurite growth of Atf3 mutant mice suggesting that these molecules might be effector RAGs of ATF3's pro-regenerative function. In addition to the induction of growth-promoting molecules, we present data that ATF3 suppresses growth-inhibiting molecules such as chemokine (C-C motif) ligand 2. In summary, we show a pro-regenerative ATF3 function during PNS nerve regeneration involving transcriptional activation of a neuropeptide-encoding RAG cluster. ATF3 is a general injury-inducible factor, therefore ATF3-mediated mechanisms identified herein might apply to other cell and injury types. PMID:27581653
-
Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas
2010-03-01
Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.
-
Ishii, Tasuku; Funato, Yosuke; Hashizume, Osamu; Yamazaki, Daisuke; Hirata, Yusuke; Nishiwaki, Kiyoji; Kono, Nozomu; Arai, Hiroyuki; Miki, Hiroaki
2016-01-01
Mg2+ serves as an essential cofactor for numerous enzymes and its levels are tightly regulated by various Mg2+ transporters. Here, we analyzed Caenorhabditis elegans strains carrying mutations in genes encoding cyclin M (CNNM) Mg2+ transporters. We isolated inactivating mutants for each of the five Caenorhabditis elegans cnnm family genes, cnnm-1 through cnnm-5. cnnm-1; cnnm-3 double mutant worms showed various phenotypes, among which the sterile phenotype was rescued by supplementing the media with Mg2+. This sterility was caused by a gonadogenesis defect with severely attenuated proliferation of germ cells. Using this gonadogenesis defect as an indicator, we performed genome-wide RNAi screening, to search for genes associated with this phenotype. The results revealed that RNAi-mediated inactivation of several genes restores gonad elongation, including aak-2, which encodes the catalytic subunit of AMP-activated protein kinase (AMPK). We then generated triple mutant worms for cnnm-1; cnnm-3; aak-2 and confirmed that the aak-2 mutation also suppressed the defective gonadal elongation in cnnm-1; cnnm-3 mutant worms. AMPK is activated under low-energy conditions and plays a central role in regulating cellular metabolism to adapt to the energy status of cells. Thus, we provide genetic evidence linking Mg2+ homeostasis to energy metabolism via AMPK. PMID:27564576
-
Park, Sang-Kyu; Link, Christopher D; Johnson, Thomas E
2010-02-01
Recent studies have shown that the rate of aging can be modulated by diverse interventions. Dietary restriction is the most widely used intervention to promote longevity; however, the mechanisms underlying the effect of dietary restriction remain elusive. In a previous study, we identified two novel genes, nlp-7 and cup-4, required for normal longevity in Caenorhabditis elegans. nlp-7 is one of a set of neuropeptide-like protein genes; cup-4 encodes an ion-channel involved in endocytosis by coelomocytes. Here, we assess whether nlp-7 and cup-4 mediate longevity increases by dietary restriction. RNAi of nlp-7 or cup-4 significantly reduces the life span of the eat-2 mutant, a genetic model of dietary restriction, but has no effect on the life span of long-lived mutants resulting from reduced insulin/IGF-1 signaling or dysfunction of the mitochondrial electron transport chain. The life-span extension observed in wild-type N2 worms by dietary restriction using bacterial dilution is prevented significantly in nlp-7 and cup-4 mutants. RNAi knockdown of genes encoding candidate receptors of NLP-7 and genes involved in endocytosis by coelomocytes also specifically shorten the life span of the eat-2 mutant. We conclude that two novel pathways, NLP-7 signaling and endocytosis by coelomocytes, are required for life extension under dietary restriction in C. elegans.
-
Gates, Julie; Lam, Geanette; Ortiz, José A; Losson, Régine; Thummel, Carl S
2004-01-01
Pulses of the steroid hormone ecdysone trigger the major developmental transitions in Drosophila, including molting and puparium formation. The ecdysone signal is transduced by the EcR/USP nuclear receptor heterodimer that binds to specific response elements in the genome and directly regulates target gene transcription. We describe a novel nuclear receptor interacting protein encoded by rigor mortis (rig) that is required for ecdysone responses during larval development. rig mutants display defects in molting, delayed larval development, larval lethality, duplicated mouth parts, and defects in puparium formation--phenotypes that resemble those seen in EcR, usp, E75A and betaFTZ-F1 mutants. Although the expression of these nuclear receptor genes is essentially normal in rig mutant larvae, the ecdysone-triggered switch in E74 isoform expression is defective. rig encodes a protein with multiple WD-40 repeats and an LXXLL motif, sequences that act as specific protein-protein interaction domains. Consistent with the presence of these elements and the lethal phenotypes of rig mutants, Rig protein interacts with several Drosophila nuclear receptors in GST pull-down experiments, including EcR, USP, DHR3, SVP and betaFTZ-F1. The ligand binding domain of betaFTZ-F1 is sufficient for this interaction, which can occur in an AF-2-independent manner. Antibody stains reveal that Rig protein is present in the brain and imaginal discs of second and third instar larvae, where it is restricted to the cytoplasm. In larval salivary gland and midgut cells, however, Rig shuttles between the cytoplasm and nucleus in a spatially and temporally regulated manner, at times that correlate with the major lethal phase of rig mutants and major switches in ecdysone-regulated gene expression. Taken together, these data indicate that rig exerts essential functions during larval development through gene-specific effects on ecdysone-regulated transcription, most likely as a cofactor for one or more nuclear receptors. Furthermore, the dynamic intracellular redistribution of Rig protein suggests that it may act to refine spatial and temporal responses to ecdysone during development.
-
Sutter, Jan-Moritz; Tästensen, Julia-Beate; Johnsen, Ulrike; Soppa, Jörg; Schönheit, Peter
2016-08-15
The halophilic archaeon Haloferax volcanii has been proposed to degrade glucose via the semiphosphorylative Entner-Doudoroff (spED) pathway. So far, the key enzymes of this pathway, glucose dehydrogenase (GDH), gluconate dehydratase (GAD), and 2-keto-3-deoxy-6-phosphogluconate (KDPG) aldolase (KDPGA), have not been characterized, and their functional involvement in glucose degradation has not been demonstrated. Here we report that the genes HVO_1083 and HVO_0950 encode GDH and KDPGA, respectively. The recombinant enzymes show high specificity for glucose and KDPG and did not convert the corresponding C4 epimers galactose and 2-keto-3-deoxy-6-phosphogalactonate at significant rates. Growth studies of knockout mutants indicate the functional involvement of both GDH and KDPGA in glucose degradation. GAD was purified from H. volcanii, and the encoding gene, gad, was identified as HVO_1488. GAD catalyzed the specific dehydration of gluconate and did not utilize galactonate at significant rates. A knockout mutant of GAD lost the ability to grow on glucose, indicating the essential involvement of GAD in glucose degradation. However, following a prolonged incubation period, growth of the Δgad mutant on glucose was recovered. Evidence is presented that under these conditions, GAD was functionally replaced by xylonate dehydratase (XAD), which uses both xylonate and gluconate as substrates. Together, the characterization of key enzymes and analyses of the respective knockout mutants present conclusive evidence for the in vivo operation of the spED pathway for glucose degradation in H. volcanii The work presented here describes the identification and characterization of the key enzymes glucose dehydrogenase, gluconate dehydratase, and 2-keto-3-deoxy-6-phosphogluconate aldolase and their encoding genes of the proposed semiphosphorylative Entner-Doudoroff pathway in the haloarchaeon Haloferax volcanii The functional involvement of the three enzymes was proven by analyses of the corresponding knockout mutants. These results provide evidence for the in vivo operation of the semiphosphorylative Entner-Doudoroff pathway in haloarchaea and thus expand our understanding of the unusual sugar degradation pathways in the domain Archaea. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
-
Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Seong, Young Rim; Kim, Bum-Kyeng; Kim, Samyong; Im, Dong-Soo
2004-06-01
We report here that gene transfer using recombinant adenoviruses encoding interleukin (IL)-18 mutants induces potent antitumor activity in vivo. The precursor form of IL-18 (ProIL-18) is processed by caspase-1 to produce bioactive IL-18, but its cleavage by caspase-3 (CPP32) produces an inactive form. To prepare IL-18 molecules with an effective antitumor activity, a murine IL-18 mutant with the signal sequence of murine granulocyte-macrophage (GM)- colony stimulating factor (CSF) at the 5'-end of mature IL-18 cDNA (GMmIL-18) and human IL-18 mutant with the prepro leader sequence of trypsin (PPT), which is not cleaved by caspase-3 (PPThIL-18CPP32-), respectively, were constructed. Adenovirus vectors carrying GMmIL-18 or PPThIL-18CPP32- produced bioactive IL-18. Ad.GMmIL-18 had a more potent antitumor effect than Ad.mProIL-18 encoding immature IL-18 in renal cell adenocarcinoma (Renca) tumor-bearing mice. Tumor-specific cytotoxic T lymphocytes, the induction of Th1 cytokines, and an augmented natural killer (NK) cell activity were detected in Renca tumor-bearing mice treated with Ad.GMmIL-18. An immunohistological analysis revealed that CD4+ and CD8+ T cells abundantly infiltrated into tumors of mice treated with Ad.GMmIL-18. Huh-7 human hepatoma tumor growth in nude mice with a defect of T cell function was significantly inhibited by Ad.PPThIL-18CPP32- compared with Ad.hProIL-18 encoding immature IL-18. Nude mice treated with Ad.PPThIL-18CPP32- contained NK cells with increased cytotoxicity. The results suggest that the release of mature IL-18 in tumors is required for achieving an antitumor effect including tumor-specific cellular immunity and augmented NK cell-mediated cytotoxicity. These optimally designed IL-18 mutants could be useful for improving the antitumor effectiveness of wild-type IL-18. Copyright 2004 Nature Publishing Group
-
2016-01-01
CYTIDINE DEAMINASE (CDA) catalyzes the deamination of cytidine to uridine and ammonia in the catabolic route of C nucleotides. The Arabidopsis (Arabidopsis thaliana) CDA gene family comprises nine members, one of which (AtCDA) was shown previously in vitro to encode an active CDA. A possible role in C-to-U RNA editing or in antiviral defense has been discussed for other members. A comprehensive bioinformatic analysis of plant CDA sequences, combined with biochemical functionality tests, strongly suggests that all Arabidopsis CDA family members except AtCDA are pseudogenes and that most plants only require a single CDA gene. Soybean (Glycine max) possesses three CDA genes, but only two encode functional enzymes and just one has very high catalytic efficiency. AtCDA and soybean CDAs are located in the cytosol. The functionality of AtCDA in vivo was demonstrated with loss-of-function mutants accumulating high amounts of cytidine but also CMP, cytosine, and some uridine in seeds. Cytidine hydrolysis in cda mutants is likely caused by NUCLEOSIDE HYDROLASE1 (NSH1) because cytosine accumulation is strongly reduced in a cda nsh1 double mutant. Altered responses of the cda mutants to fluorocytidine and fluorouridine indicate that a dual specific nucleoside kinase is involved in cytidine as well as uridine salvage. CDA mutants display a reduction in rosette size and have fewer leaves compared with the wild type, which is probably not caused by defective pyrimidine catabolism but by the accumulation of pyrimidine catabolism intermediates reaching toxic concentrations. PMID:27208239
-
Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming
2013-05-01
A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.
-
Hackett, Justin B; Lu, Yan
2017-05-04
In land plants, plastid and mitochondrial RNAs are subject to post-transcriptional C-to-U RNA editing. T-DNA insertions in the ORGANELLE RNA RECOGNITION MOTIF PROTEIN6 gene resulted in reduced photosystem II (PSII) activity and smaller plant and leaf sizes. Exon coverage analysis of the ORRM6 gene showed that orrm6-1 and orrm6-2 are loss-of-function mutants. Compared to other ORRM proteins, ORRM6 affects a relative small number of RNA editing sites. Sanger sequencing of reverse transcription-PCR products of plastid transcripts revealed 2 plastid RNA editing sites that are substantially affected in the orrm6 mutants: psbF-C77 and accD-C794. The psbF gene encodes the β subunit of cytochrome b 559 , an essential component of PSII. The accD gene encodes the β subunit of acetyl-CoA carboxylase, a protein required in plastid fatty acid biosynthesis. Whole-transcriptome RNA-seq demonstrated that editing at psbF-C77 is nearly absent and the editing extent at accD-C794 was significantly reduced. Gene set enrichment pathway analysis showed that expression of multiple gene sets involved in photosynthesis, especially photosynthetic electron transport, is significantly upregulated in both orrm6 mutants. The upregulation could be a mechanism to compensate for the reduced PSII electron transport rate in the orrm6 mutants. These results further demonstrated that Organelle RNA Recognition Motif protein ORRM6 is required in editing of specific RNAs in the Arabidopsis (Arabidopsis thaliana) plastid.
-
Botkin, Douglas J.; Abbott, April N.; Stewart, Philip E.; Rosa, Patricia A.; Kawabata, Hiroki; Watanabe, Haruo; Norris, Steven J.
2006-01-01
Lyme disease Borrelia organisms are highly invasive spirochetes that alternate between vertebrate and arthropod hosts and that establish chronic infections and elicit inflammatory reactions in mammals. Although progress has been made in the targeted mutagenesis of individual genes in infectious Borrelia burgdorferi, the roles of the vast majority of gene products in pathogenesis remain unresolved. In this study, we examined the feasibility of using transposon mutagenesis to identify infectivity-related factors in B. burgdorferi. The transformable, infectious strain 5A18 NP1 was transformed with the spirochete-adapted Himar1 transposon delivery vector pMarGent to create a small library of 33 insertion mutants. Single mouse inoculations followed by culture of four tissue sites and serology were used to screen the mutants for infectivity phenotypes. Mutants that appeared attenuated (culture positive at some sites) or noninfectious (negative at all sites) and contained the virulence-associated plasmids lp25 and lp28-1 were examined in more extensive animal studies. Three of these mutants (including those with insertions in the putative fliG-1-encoded flagellar motor switch protein and the guaB-encoded IMP dehydrogenase) were noninfectious, whereas four clones appeared to exhibit reduced infectivity. Serological reactivity in VlsE enzyme-linked immunosorbent assays correlated with the assignment of mutants to the noninfectious or attenuated-infectivity groups. The results of this study indicate that random transposon mutagenesis of infectious B. burgdorferi is feasible and will be of value in studying the pathogenesis of Lyme disease Borrelia. PMID:17015459
-
tassel-less1 encodes a boron channel protein required for inflorescence development in maize.
Leonard, April; Holloway, Beth; Guo, Mei; Rupe, Mary; Yu, GongXin; Beatty, Mary; Zastrow-Hayes, Gina; Meeley, Robert; Llaca, Victor; Butler, Karlene; Stefani, Tony; Jaqueth, Jennifer; Li, Bailin
2014-06-01
tassel-less1 (tls1) is a classical maize (Zea mays) inflorescence mutant. Homozygous mutant plants have no tassels or very small tassels, and ear development is also impaired. Using a positional cloning approach, ZmNIP3;1 (a NOD26-like intrinsic protein) was identified as the candidate gene for tls1. The ZmNIP3;1 gene is completely deleted in the tls1 mutant genome. Two Mutator-insertional TUSC alleles of ZmNIP3;1 exhibited tls1-like phenotypes, and allelism tests confirmed that the tls1 gene encodes ZmNIP3;1. Transgenic plants with an RNA interference (RNAi) construct to down-regulate ZmNIP3;1 also showed tls1-like phenotypes, further demonstrating that TLS1 is ZmNIP3;1. Sequence analysis suggests that ZmNIP3;1 is a boron channel protein. Foliar application of boron could rescue the tls1 phenotypes and restore the normal tassel and ear development. Gene expression analysis indicated that in comparison with that of the wild type or tls1 plants treated with boron, the transition from the vegetative to reproductive phase or the development of the floral meristem is impaired in the shoot apical meristem of the tls1 mutant plants. It is concluded that the tls1 mutant phenotypes are caused by impaired boron transport, and boron is essential for inflorescence development in maize. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
-
Subashchandrabose, Sargurunathan; Leveque, Rhiannon M.; Kirkwood, Roy N.; Kiupel, Matti
2013-01-01
Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia, an economically important disease of pigs. The hfq gene in A. pleuropneumoniae, encoding the RNA chaperone and posttranscriptional regulator Hfq, is upregulated during infection of porcine lungs. To investigate the role of this in vivo-induced gene in A. pleuropneumoniae, an hfq mutant strain was constructed. The hfq mutant was defective in biofilm formation on abiotic surfaces. The level of pgaC transcript, encoding the biosynthesis of poly-β-1,6-N-acetylglucosamine (PNAG), a major biofilm matrix component, was lower and PNAG content was 10-fold lower in the hfq mutant than in the wild-type strain. When outer membrane proteins were examined, cysteine synthase, implicated in resistance to oxidative stress and tellurite, was not found at detectable levels in the absence of Hfq. The hfq mutant displayed enhanced sensitivity to superoxide generated by methyl viologen and tellurite. These phenotypes were readily reversed by complementation with the hfq gene expressed from its native promoter. The role of Hfq in the fitness of A. pleuropneumoniae was assessed in a natural host infection model. The hfq mutant failed to colonize porcine lungs and was outcompeted by the wild-type strain (median competitive index of 2 × 10−5). Our data demonstrate that the in vivo-induced gene hfq is involved in the regulation of PNAG-dependent biofilm formation, resistance to superoxide stress, and the fitness and virulence of A. pleuropneumoniae in pigs and begin to elucidate the role of an in vivo-induced gene in the pathogenesis of pleuropneumonia. PMID:23732171
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kishino, Hideyuki; Eguchi, Hiroki; Takagi, Keiko
2014-03-07
Highlights: • Dioctanoyl-PC (diC8PC) supported growth of a yeast mutant defective in PC synthesis. • diC8PC was converted to PC species containing longer acyl residues in the mutant. • Both acyl residues of diC8PC were replaced by longer fatty acids in vitro. • This system will contribute to the elucidation of the acyl chain remodeling of PC. - Abstract: A yeast strain, in which endogenous phosphatidylcholine (PC) synthesis is controllable, was constructed by the replacement of the promoter of PCT1, encoding CTP:phosphocholine cytidylyltransferase, with GAL1 promoter in a double deletion mutant of PEM1 and PEM2, encoding phosphatidylethanolamine methyltransferase and phospholipidmore » methyltransferase, respectively. This mutant did not grow in the glucose-containing medium, but the addition of dioctanoyl-phosphatidylcholine (diC8PC) supported its growth. Analyses of the metabolism of {sup 13}C-labeled diC8PC ((methyl-{sup 13}C){sub 3}-diC8PC) in this strain using electrospray ionization tandem mass spectrometry revealed that it was converted to PC species containing acyl residues of 16 or 18 carbons at both sn-1 and sn-2 positions. In addition, both acyl residues of (methyl-{sup 13}C){sub 3}-diC8PC were replaced with 16:1 acyl chains in the in vitro reaction using the yeast cell extract in the presence of palmitoleoyl-CoA. These results indicate that PC containing short acyl residues was remodeled to those with acyl chains of physiological length in yeast.« less
-
B56δ-related protein phosphatase 2A dysfunction identified in patients with intellectual disability
Houge, Gunnar; Haesen, Dorien; Vissers, Lisenka E.L.M.; Mehta, Sarju; Parker, Michael J.; Wright, Michael; Vogt, Julie; McKee, Shane; Tolmie, John L.; Cordeiro, Nuno; Kleefstra, Tjitske; Willemsen, Marjolein H.; Reijnders, Margot R.F.; Berland, Siren; Hayman, Eli; Lahat, Eli; Brilstra, Eva H.; van Gassen, Koen L.I.; Zonneveld-Huijssoon, Evelien; de Bie, Charlotte I.; Hoischen, Alexander; Eichler, Evan E.; Holdhus, Rita; Steen, Vidar M.; Døskeland, Stein Ove; Hurles, Matthew E.; FitzPatrick, David R.; Janssens, Veerle
2015-01-01
Here we report inherited dysregulation of protein phosphatase activity as a cause of intellectual disability (ID). De novo missense mutations in 2 subunits of serine/threonine (Ser/Thr) protein phosphatase 2A (PP2A) were identified in 16 individuals with mild to severe ID, long-lasting hypotonia, epileptic susceptibility, frontal bossing, mild hypertelorism, and downslanting palpebral fissures. PP2A comprises catalytic (C), scaffolding (A), and regulatory (B) subunits that determine subcellular anchoring, substrate specificity, and physiological function. Ten patients had mutations within a highly conserved acidic loop of the PPP2R5D-encoded B56δ regulatory subunit, with the same E198K mutation present in 6 individuals. Five patients had mutations in the PPP2R1A-encoded scaffolding Aα subunit, with the same R182W mutation in 3 individuals. Some Aα cases presented with large ventricles, causing macrocephaly and hydrocephalus suspicion, and all cases exhibited partial or complete corpus callosum agenesis. Functional evaluation revealed that mutant A and B subunits were stable and uncoupled from phosphatase activity. Mutant B56δ was A and C binding–deficient, while mutant Aα subunits bound B56δ well but were unable to bind C or bound a catalytically impaired C, suggesting a dominant-negative effect where mutant subunits hinder dephosphorylation of B56δ-anchored substrates. Moreover, mutant subunit overexpression resulted in hyperphosphorylation of GSK3β, a B56δ-regulated substrate. This effect was in line with clinical observations, supporting a correlation between the ID degree and biochemical disturbance. PMID:26168268
-
Hyde, Annastasia S.; Farmer, Erin L.; Easley, Katherine E.; van Lammeren, Kristy; Christoffels, Vincent M.; Barycki, Joseph J.; Bakkers, Jeroen; Simpson, Melanie A.
2012-01-01
Cardiac valve defects are a common congenital heart malformation and a significant clinical problem. Defining molecular factors in cardiac valve development has facilitated identification of underlying causes of valve malformation. Gene disruption in zebrafish revealed a critical role for UDP-glucose dehydrogenase (UGDH) in valve development, so this gene was screened for polymorphisms in a patient population suffering from cardiac valve defects. Two genetic substitutions were identified and predicted to encode missense mutations of arginine 141 to cysteine and glutamate 416 to aspartate, respectively. Using a zebrafish model of defective heart valve formation caused by morpholino oligonucleotide knockdown of UGDH, transcripts encoding the UGDH R141C or E416D mutant enzymes were unable to restore cardiac valve formation and could only partially rescue cardiac edema. Characterization of the mutant recombinant enzymes purified from Escherichia coli revealed modest alterations in the enzymatic activity of the mutants and a significant reduction in the half-life of enzyme activity at 37 °C. This reduction in activity could be propagated to the wild-type enzyme in a 1:1 mixed reaction. Furthermore, the quaternary structure of both mutants, normally hexameric, was destabilized to favor the dimeric species, and the intrinsic thermal stability of the R141C mutant was highly compromised. The results are consistent with the reduced function of both missense mutations significantly reducing the ability of UGDH to provide precursors for cardiac cushion formation, which is essential to subsequent valve formation. The identification of these polymorphisms in patient populations will help identify families genetically at risk for valve defects. PMID:22815472
-
Mutant fatty acid desaturase and methods for directed mutagenesis
Shanklin, John [Shoreham, NY; Whittle, Edward J [Greenport, NY
2008-01-29
The present invention relates to methods for producing fatty acid desaturase mutants having a substantially increased activity towards substrates with fewer than 18 carbon atom chains relative to an unmutagenized precursor desaturase having an 18 carbon chain length specificity, the sequences encoding the desaturases and to the desaturases that are produced by the methods. The present invention further relates to a method for altering a function of a protein, including a fatty acid desaturase, through directed mutagenesis involving identifying candidate amino acid residues, producing a library of mutants of the protein by simultaneously randomizing all amino acid candidates, and selecting for mutants which exhibit the desired alteration of function. Candidate amino acids are identified by a combination of methods. Enzymatic, binding, structural and other functions of proteins can be altered by the method.
-
Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles
1999-01-01
Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625
-
Vermaas, Wim F. J.; Williams, John G. K.; Rutherford, A. William; Mathis, Paul; Arntzen, Charles J.
1986-01-01
CP-47 is absent in a genetically engineered mutant of cyanobacterium Synechocystis 6803, in which the psbB gene [encoding the chlorophyll-binding photosystem II (PSII) protein CP-47] was interrupted. Another chlorophyll-binding PSII protein, CP-43, is present in the mutant, and functionally inactive PSII-enriched particles can be isolated from mutant thylakoids. We interpret these data as indicating that the PSII core complex of the mutant still assembles in the absence of CP-47. The mutant lacks a 77 K fluorescence emission maximum at 695 nm, suggesting that the PSII reaction center is not functional. The absence of primary photochemistry was indicated by EPR and optical measurements: no chlorophyll triplet originating from charge recombination between P680+ and Pheo- was observed in the mutant, and there were no flash-induced absorption changes at 820 nm attributable to chlorophyll P680 oxidation. These observations lead us to conclude that CP-47 plays an essential role in the activity of the PSII reaction center. Images PMID:16593788
-
Han, Gil-Soo; Carman, George M
2017-08-11
The PAH1 -encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae , exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1 -encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1 Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1 Δ mutant is induced through the inositol-sensitive upstream activation sequence (UAS INO ), a cis -acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UAS INO mutation suppressed pah1 Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1 -encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1 Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kita, Ayako; Higa, Mari; Doi, Akira
Cytokinesis is a highly ordered process that divides one cell into two cells, which is functionally linked to the dynamic remodeling of the plasma membrane coordinately with various events such as membrane trafficking. Calcineurin is a highly conserved serine/threonine protein phosphatase, which regulates multiple biological functions, such as membrane trafficking and cytokinesis. Here, we isolated imp2-c3, a mutant allele of the imp2{sup +} gene, encoding a homolog of the mouse PSTPIP1 (proline-serine-threonine phosphatase interacting protein 1), using a genetic screen for mutations that are synthetically lethal with calcineurin deletion in fission yeast. The imp2-c3 mutants showed a defect in cytokinesis withmore » multi-septated phenotypes, which was further enhanced upon treatment with the calcineurin inhibitor FK506. Notably, electron micrographs revealed that the imp2-c3 mutant cells accumulated aberrant multi-lamella Golgi structures and putative post-Golgi secretory vesicles, and exhibited fragmented vacuoles in addition to thickened septa. Consistently, imp2-c3 mutants showed a reduced secretion of acid phosphatase and defects in vacuole fusion. The imp2-c3 mutant cells exhibited a weakened cell wall, similar to the membrane trafficking mutants identified in the same genetic screen such as ypt3-i5. These findings implicate the PSTPIP1 homolog Imp2 in Golgi/vacuole function, thereby affecting various cellular processes, including cytokinesis and cell integrity. - Highlights: • We isolated imp2-c3, in a synthetic lethal screen with calcineurin in fission yeast. • The imp2{sup +} gene encodes a component of the actin contractile ring similar to Cdc15. • The imp2-c3 mutants showed defects in cytokinesis, which were exacerbated by FK506. • The imp2-c3 mutants were defective in membrane trafficking and cell wall integrity. • Our study revealed a novel role for Imp2 in the Golgi/vacuolar membrane trafficking.« less
-
Fetherston, Jacqueline D; Kirillina, Olga; Bobrov, Alexander G; Paulley, James T; Perry, Robert D
2010-05-01
Iron acquisition from the host is an important step in the pathogenic process. While Yersinia pestis has multiple iron transporters, the yersiniabactin (Ybt) siderophore-dependent system plays a major role in iron acquisition in vitro and in vivo. In this study, we determined that the Ybt system is required for the use of iron bound by transferrin and lactoferrin and examined the importance of the Ybt system for virulence in mouse models of bubonic and pneumonic plague. Y. pestis mutants unable to either transport Ybt or synthesize the siderophore were both essentially avirulent via subcutaneous injection (bubonic plague model). Surprisingly, via intranasal instillation (pneumonic plague model), we saw a difference in the virulence of Ybt biosynthetic and transport mutants. Ybt biosynthetic mutants displayed an approximately 24-fold-higher 50% lethal dose (LD(50)) than transport mutants. In contrast, under iron-restricted conditions in vitro, a Ybt transport mutant had a more severe growth defect than the Ybt biosynthetic mutant. Finally, a Delta pgm mutant had a greater loss of virulence than the Ybt biosynthetic mutant, indicating that the 102-kb pgm locus encodes a virulence factor, in addition to Ybt, that plays a role in the pathogenesis of pneumonic plague.
-
Kinoshita, Ayumi; Niwa, Yoshimi; Onai, Kiyoshi; Fukuzawa, Hideya; Ishiura, Masahiro
2017-01-01
The green alga Chlamydomonas reinhardtii shows various light responses in behavior and physiology. One such photoresponse is the circadian clock, which can be reset by external light signals to entrain its oscillation to daily environmental cycles. In a previous report, we suggested that a light-induced degradation of the clock protein ROC15 is a trigger to reset the circadian clock in Chlamydomonas. However, light signaling pathways of this process remained unclear. Here, we screened for mutants that show abnormal ROC15 diurnal rhythms, including the light-induced protein degradation at dawn, using a luciferase fusion reporter. In one mutant, ROC15 degradation and phase resetting of the circadian clock by light were impaired. Interestingly, the impairments were observed in response to red and violet light, but not to blue light. We revealed that an uncharacterized gene encoding a protein similar to RAS-signaling-related leucine-rich repeat (LRR) proteins is responsible for the mutant phenotypes. Our results indicate that a previously uncharacterized red/violet light signaling pathway is involved in the phase resetting of circadian clock in Chlamydomonas. PMID:28333924
-
Trivigno, Catherine; Haerry, Theodor E
2011-02-25
Mutations in the human mitochondrial elongation factor G1 (EF-G1) are recessive lethal and cause death shortly after birth. We have isolated mutations in iconoclast (ico), which encodes the highly conserved Drosophila orthologue of EF-G1. We find that EF-G1 is essential during fly development, but its function is not required in every tissue. In contrast to null mutations, missense mutations exhibit stronger, possibly neomorphic phenotypes that lead to premature death during embryogenesis. Our experiments show that EF-G1 contains a secondary C-terminal nuclear localization signal. Expression of missense mutant forms of EF-G1 can accumulate in the nucleus and cause growth and patterning defects and animal lethality. We find that transgenes that encode mutant human EF-G1 proteins can rescue ico mutants, indicating that the underlying problem of the human disease is not just the loss of enzymatic activity. Our results are consistent with a model where EF-G1 acts as a retrograde signal from mitochondria to the nucleus to slow down cell proliferation if mitochondrial energy output is low.
-
Trivigno, Catherine; Haerry, Theodor E.
2011-01-01
Mutations in the human mitochondrial elongation factor G1 (EF-G1) are recessive lethal and cause death shortly after birth. We have isolated mutations in iconoclast (ico), which encodes the highly conserved Drosophila orthologue of EF-G1. We find that EF-G1 is essential during fly development, but its function is not required in every tissue. In contrast to null mutations, missense mutations exhibit stronger, possibly neomorphic phenotypes that lead to premature death during embryogenesis. Our experiments show that EF-G1 contains a secondary C-terminal nuclear localization signal. Expression of missense mutant forms of EF-G1 can accumulate in the nucleus and cause growth and patterning defects and animal lethality. We find that transgenes that encode mutant human EF-G1 proteins can rescue ico mutants, indicating that the underlying problem of the human disease is not just the loss of enzymatic activity. Our results are consistent with a model where EF-G1 acts as a retrograde signal from mitochondria to the nucleus to slow down cell proliferation if mitochondrial energy output is low. PMID:21364917
-
Gandhi, Manish J; Pendergrass, Thomas W; Cummings, Carrie C; Ihara, Kenji; Blau, C Anthony; Drachman, Jonathan G
2005-10-01
An 11-year-old girl, presenting with fatigue and bruising, was found to be profoundly pancytopenic. Bone marrow exam and clinical evaluation were consistent with aplastic anemia. Family members were studied as potential stem cell donors, revealing that both younger siblings displayed significant thrombocytopenia, whereas both parents had normal blood counts. We evaluated this pedigree to understand the unusually late presentation of congenital amegakaryocytic thrombocytopenia (CAMT). The coding region and the intron/exon junctions of MPL were sequenced from each family member. Vectors representing each of the mutations were constructed and tested for the ability to support growth of Baf3/Mpl(mutant) cells. All three siblings had elevated thrombopoietin levels. Analysis of genomic DNA demonstrated that each parent had mutations/polymorphisms in a single MPL allele and that each child was a compound heterozygote, having inherited both abnormal alleles. The maternal allele encoded a mutation of the donor splice-junction at the exon-3/intron-3 boundary. A mini-gene construct encoding normal vs mutant versions of the intron-3 donor-site demonstrated that physiologic splicing was significantly reduced in the mutant construct. Mutations that incompletely eliminate Mpl expression/function may result in delayed diagnosis of CAMT and confusion with aplastic anemia.
-
Sitkiewicz, Izabela; Nagiec, Michal J; Sumby, Paul; Butler, Stephanie D; Cywes-Bentley, Colette; Musser, James M
2006-10-24
The molecular basis of pathogen clone emergence is relatively poorly understood. Acquisition of a bacteriophage encoding a previously unknown secreted phospholipase A(2) (designated SlaA) has been implicated in the rapid emergence in the mid-1980s of a new hypervirulent clone of serotype M3 group A Streptococcus. Although several lines of circumstantial evidence suggest that SlaA is a virulence factor, this issue has not been addressed experimentally. We found that an isogenic DeltaslaA mutant strain was significantly impaired in ability to adhere to and kill human epithelial cells compared with the wild-type parental strain. The mutant strain was less virulent for mice than the wild-type strain, and immunization with purified SlaA significantly protected mice from invasive disease. Importantly, the mutant strain was significantly attenuated for colonization in a monkey model of pharyngitis. We conclude that transductional acquisition of the ability of a GAS strain to produce SlaA enhanced the spread and virulence of the serotype M3 precursor strain. Hence, these studies identified a crucial molecular event underlying the evolution, rapid emergence, and widespread dissemination of unusually severe human infections caused by a distinct bacterial clone.
-
Regulation of Compound Leaf Development by PHANTASTICA in Medicago truncatula1[C][W][OPEN
Ge, Liangfa; Peng, Jianling; Berbel, Ana; Madueño, Francisco; Chen, Rujin
2014-01-01
Plant leaves, simple or compound, initiate as peg-like structures from the peripheral zone of the shoot apical meristem, which requires class I KNOTTED-LIKE HOMEOBOXI (KNOXI) transcription factors to maintain its activity. The MYB domain protein encoded by the ASYMMETRIC LEAVES1/ROUGH SHEATH2/PHANTASTICA (ARP) gene, together with other factors, excludes KNOXI gene expression from incipient leaf primordia to initiate leaves and specify leaf adaxial identity. However, the regulatory relationship between ARP and KNOXI is more complex in compound-leafed species. Here, we investigated the role of ARP and KNOXI genes in compound leaf development in Medicago truncatula. We show that the M. truncatula phantastica mutant exhibited severe compound leaf defects, including curling and deep serration of leaf margins, shortened petioles, increased rachises, petioles acquiring motor organ characteristics, and ectopic development of petiolules. On the other hand, the M. truncatula brevipedicellus mutant did not exhibit visible compound leaf defects. Our analyses show that the altered petiole development requires ectopic expression of ELONGATED PETIOLULE1, which encodes a lateral organ boundary domain protein, and that the distal margin serration requires the auxin efflux protein M. truncatula PIN-FORMED10 in the M. truncatula phantastica mutant. PMID:24218492