Sample records for mutant expression resulted

  1. Differentially expressed genes in the ovary of the sixth day of pupal "Ming" lethal egg mutant of silkworm, Bombyx mori.

    PubMed

    Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng

    2013-09-15

    The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  3. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  4. Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

    PubMed Central

    Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

    2008-01-01

    Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

  5. The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females

    PubMed Central

    Sakai, Takaomi; Kasuya, Junko; Kitamoto, Toshihiro; Aigaki, Toshiro

    2009-01-01

    Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. Here we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNAi in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. On the other hand, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity. PMID:19531155

  6. The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females.

    PubMed

    Sakai, T; Kasuya, J; Kitamoto, T; Aigaki, T

    2009-07-01

    Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. In this study, we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNA interference (RNAi) in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. However, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity.

  7. Candidate genes for panhypopituitarism identified by gene expression profiling

    PubMed Central

    Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis

    2011-01-01

    Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248

  8. Effects of mutant human Ki-ras{sup G12C} gene dosage on murine lung tumorigenesis and signaling to its downstream effectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dance-Barnes, Stephanie T.; Kock, Nancy D.; Floyd, Heather S.

    2008-08-15

    Studies in cell culture have suggested that the level of RAS expression can influence the transformation of cells and the signaling pathways stimulated by mutant RAS expression. However, the levels of RAS expression in vivo appear to be subject to feedback regulation, limiting the total amount of RAS protein that can be expressed. We utilized a bitransgenic mouse lung tumor model that expressed the human Ki-ras{sup G12C} allele in a tetracycline-inducible, lung-specific manner. Treatment for 12 months with 500 {mu}g/ml of doxycycline (DOX) allowed for maximal expression of the human Ki-ras{sup G12C} allele in the lung, and resulted in themore » development of focal hyperplasia and adenomas. We determined if different levels of mutant RAS expression would influence the phenotype of the lung lesions. Treatment with 25, 100 and 500 {mu}g/ml of DOX resulted in dose-dependent increases in transgene expression and tumor multiplicity. Microscopic analysis of the lungs of mice treated with the 25 {mu}g/ml dose of DOX revealed infrequent foci of hyperplasia, whereas mice treated with the 100 and 500 {mu}g/ml doses exhibited numerous hyperplastic foci and also adenomas. Immunohistochemical and RNA analysis of the downstream effector pathways demonstrated that different levels of mutant RAS transgene expression resulted in differences in the expression and/or phosphorylation of specific signaling molecules. Our results suggest that the molecular alterations driving tumorigenesis may differ at different levels of mutant Ki-ras{sup G12C} expression, and this should be taken into consideration when inducible transgene systems are utilized to promote tumorigenesis in mouse models.« less

  9. Analysis of Distinct Roles of CaMKK Isoforms Using STO-609-Resistant Mutants in Living Cells.

    PubMed

    Fujiwara, Yuya; Hiraoka, Yuri; Fujimoto, Tomohito; Kanayama, Naoki; Magari, Masaki; Tokumitsu, Hiroshi

    2015-06-30

    To assess the isoform specificity of the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK)-mediated signaling pathway using a CaMKK inhibitor (STO-609) in living cells, we have established A549 cell lines expressing STO-609-resistant mutants of CaMKK isoforms. Following serial mutagenesis studies, we have succeeded in obtaining an STO-609-resistant CaMKKα mutant (Ala292Thr/Leu233Phe) and a CaMKKβ mutant (Ala328Thr/Val269Phe), which showed sensitivity to STO-609 that was 2-3 orders of magnitude lower without an appreciable effect on kinase activity or CaM requirement. These results are consistent with the results obtained for CaMKK activities in the extracts of A549 cells stably expressing the mutants of CaMKK isoforms. Ionomycin-induced 5'-AMP-activated protein kinase (AMPK) phosphorylation at Thr172 in A549 cells expressing either the wild-type or the STO-609-resistant mutant of CaMKKα was completely suppressed by STO-609 treatment but resistant to the inhibitor in the presence of the CaMKKβ mutant (Ala328Thr/Val269Phe). This result strongly suggested that CaMKKβ is responsible for ionomycin-induced AMPK activation, which supported previous reports. In contrast, ionomycin-induced CaMKIV phosphorylation at Thr196 was resistant to STO-609 treatment in A549 cells expressing STO-609-resistant mutants of both CaMKK isoforms, indicating that both CaMKK isoforms are capable of phosphorylating and activating CaMKIV in living cells. Considering these results together, STO-609-resistant CaMKK mutants developed in this study may be useful for distinguishing CaMKK isoform-mediated signaling pathways in combination with the use of an inhibitor compound.

  10. Characterization of Staphylococcus aureus mutants expressing reduced susceptibility to common house-cleaners

    PubMed Central

    Davis, A.O.; O’Leary, J.O.; Muthaiyan, A.; Langevin, M.J.; Delgado, A.; Abalos, A.T.; Fajardo, A.R.; Marek, J.; Wilkinson, B.J.; Gustafson, J.E.

    2013-01-01

    Aims To characterize mutants of Staphylococcus aureus expressing reduced susceptibility to house cleaners (HC), assess the impact of the alternative sigma factor SigB on HC susceptibility, and determine the MIC of clinical methicillin-resistant S. aureus (MRSA) to a HC. Methods and Results Susceptibility to HC, HC components, H2O2, vancomycin and oxacillin and physiological parameters were determined for HC-reduced susceptibility (HCRS) mutants, parent strain COL and COLsigB::kan. HCRS mutants selected with three HC expressed reduced susceptibility to multiple HC, HC components, H2O2 and vancomycin. Two unique HCRS mutants also lost the methicillin resistance determinant. In addition, all HCRS mutants exhibited better growth at two temperatures, and one HCRS mutant expressed reduced carotenoid production. COLsigB::kan demonstrated increased susceptibility to all HC and many HC components. sigB operon mutations were not detected in one HCRS mutant background. Of 76 clinical MRSA, 20 exhibited reduced susceptibility to a HC. Conclusions HCRS mutants demonstrate altered susceptibility to multiple antimicrobials. While sigB is required for full HC resistance, one HCRS mechanism does not involve sigB operon mutations. Clinical MRSA expressing reduced susceptibility to a common HC were detected. Significance and Impact of the Study This study suggests that HCRS mutants are not protected against, nor selected by, practical HC concentrations. PMID:15659191

  11. P01.29 Mutant (R132H) IDH1-driven cellular transformation makes cells dependent on continued wild type IDH1 expression in a model of in vitro gliomagenesis

    PubMed Central

    Johannessen, T.; Mukherjee, J.; Wood, M.; Viswanath, P.; Ohba, S.; Ronen, S.; Berkvig, R.; Pieper, R.

    2017-01-01

    Abstract Introduction: Missense R132H mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. We recently showed (Mol Cancer Res 14: 976–983, 2016) that although mutant IDH1 expression in hTERT-immortalized, p53/pRb-deficient astrocytes can drive cellular transformation and gliomagenesis, selective pharmacologic inhibition and elimination of 2-HG by the mutant IDH1 inhibitor AGI-5198 has little effect on the growth or clonagenicity of these transformed cells. To address the possible role of WT IDH1 in the growth of mutant IDH-driven tumor cells, we used a slightly different gliomagenesis model in which the transformation of TERT-deficient, p53/pRb-deficient astrocytes (pre-crisis cells) occurs only after prolonged expression of mutant IDH and passage through cellular crisis (post-crisis cells, Cancer Res 76:6680–6689, 2016). METHODS AND MATERIALS: Using this system we introduced AGI-5198, or siRNA targeting both WT and mutant forms of IDH1 into p53/pRb-deficient, mutant IDH1-expressing human astrocytes prior to or following their transformation, and compared the effects on cell growth and clonagenicity. Results: AGI-5198 exposure decreased levels of 2HG by greater than 90%, and as previously reported had no effect on the growth of either the pre-or post-crisis cell populations. A one-day exposure to a pan IDH1 siRNA resulted in a similar, prolonged (greater than 6 day), 80% inhibition of both WT and mutant IDH1 protein levels and 2HG in both cell groups. While the growth of the mutant IDH-expressing, non-transformed cells was similar to that of scramble siRNA controls, the growth of the mutant IDH-transformed cells was significantly reduced. This growth suppression was also accompanied by a four-fold increase in annexin V-positive apoptotic cells. Furthermore, the growth suppression in the cells transformed by mutant IDH1 expression could not be reversed by addition of a cell-permeable form of 2-HG. Conclusions: These results show that the in vitro transformative events driven by expression of mutant IDH1 make cells dependent not on continued mutant IDH1 expression, but rather on continued WT IDH1 expression. The data also support the development and testing of agents that can inhibit both the WT and mutant forms of IDH1.

  12. Diabetes and exocrine pancreatic insufficiency in E2F1/E2F2 double-mutant mice.

    PubMed

    Iglesias, Ainhoa; Murga, Matilde; Laresgoiti, Usua; Skoudy, Anouchka; Bernales, Irantzu; Fullaondo, Asier; Moreno, Bernardino; Lloreta, José; Field, Seth J; Real, Francisco X; Zubiaga, Ana M

    2004-05-01

    E2F transcription factors are thought to be key regulators of cell growth control. Here we use mutant mouse strains to investigate the function of E2F1 and E2F2 in vivo. E2F1/E2F2 compound-mutant mice develop nonautoimmune insulin-deficient diabetes and exocrine pancreatic dysfunction characterized by endocrine and exocrine cell dysplasia, a reduction in the number and size of acini and islets, and their replacement by ductal structures and adipose tissue. Mutant pancreatic cells exhibit increased rates of DNA replication but also of apoptosis, resulting in severe pancreatic atrophy. The expression of genes involved in DNA replication and cell cycle control was upregulated in the E2F1/E2F2 compound-mutant pancreas, suggesting that their expression is repressed by E2F1/E2F2 activities and that the inappropriate cell cycle found in the mutant pancreas is likely the result of the deregulated expression of these genes. Interestingly, the expression of ductal cell and adipocyte differentiation marker genes was also upregulated, whereas expression of pancreatic cell marker genes were downregulated. These results suggest that E2F1/E2F2 activity negatively controls growth of mature pancreatic cells and is necessary for the maintenance of differentiated pancreatic phenotypes in the adult.

  13. Purkinje Cell Compartmentation in the Cerebellum of the Lysosomal Acid Phosphatase 2 Mutant Mouse (Nax - Naked-Ataxia Mutant Mouse)

    PubMed Central

    Bailey, Karen; Rahimi Balaei, Maryam; Mannan, Ashraf; Del Bigio, Marc R.; Marzban, Hassan

    2014-01-01

    The Acp2 gene encodes the beta subunit of lysosomal acid phosphatase, which is an isoenzyme that hydrolyzes orthophosphoric monoesters. In mice, a spontaneous mutation in Acp2 results in severe cerebellar defects. These include a reduced size, abnormal lobulation, and an apparent anterior cerebellar disorder with an absent or hypoplastic vermis. Based on differential gene expression in the cerebellum, the mouse cerebellar cortex can normally be compartmentalized anteroposteriorly into four transverse zones and mediolaterally into parasagittal stripes. In this study, immunohistochemistry was performed using various Purkinje cell compartmentation markers to examine their expression patterns in the Acp2 mutant. Despite the abnormal lobulation and anterior cerebellar defects, zebrin II and PLCβ4 showed similar expression patterns in the nax mutant and wild type cerebellum. However, fewer stripes were found in the anterior zone of the nax mutant, which could be due to a lack of Purkinje cells or altered expression of the stripe markers. HSP25 expression was uniform in the central zone of the nax mutant cerebellum at around postnatal day (P) 18–19, suggesting that HSP25 immunonegative Purkinje cells are absent or delayed in stripe pattern expression compared to the wild type. HSP25 expression became heterogeneous around P22–23, with twice the number of parasagittal stripes in the nax mutant compared to the wild type. Aside from reduced size and cortical disorganization, both the posterior zone and nodular zone in the nax mutant appeared less abnormal than the rest of the cerebellum. From these results, it is evident that the anterior zone of the nax mutant cerebellum is the most severely affected, and this extends beyond the primary fissure into the rostral central zone/vermis. This suggests that ACP2 has critical roles in the development of the anterior cerebellum and it may regulate anterior and central zone compartmentation. PMID:24722417

  14. Synthetic Lethality of a Novel Small Molecule Against Mutant KRAS-Expressing Cancer Cells Involves AKT-Dependent ROS Production.

    PubMed

    Iskandar, Kartini; Rezlan, Majidah; Yadav, Sanjiv Kumar; Foo, Chuan Han Jonathan; Sethi, Gautam; Qiang, Yu; Bellot, Gregory L; Pervaiz, Shazib

    2016-05-10

    We recently reported the death-inducing activity of a small-molecule compound, C1, which triggered reactive oxygen species (ROS)-dependent autophagy-associated apoptosis in a variety of human cancer cell lines. In this study, we examine the ability of the compound to specifically target cancer cells harboring mutant KRAS with minimal activity against wild-type (WT) RAS-expressing cells. HCT116 cells expressing mutated KRAS are susceptible, while the WT-expressing HT29 cells are resistant. Interestingly, C1 triggers activation of mutant RAS, which results in the downstream phosphorylation and activation of AKT/PKB. Gene knockdown of KRAS or AKT or their pharmacological inhibition resulted in the abrogation of C1-induced ROS production and rescued tumor colony-forming ability. We also made use of HCT116 mutant KRAS knockout (KO) cells, which express only a single WT KRAS allele. Exposure of KO cells to C1 failed to increase mitochondrial ROS and cell death, unlike the parental cells harboring mutant KRAS. Similarly, mutant KRAS-transformed prostate epithelial cells (RWPE-1-RAS) were more sensitive to the ROS-producing and death-inducing effects of C1 than the vector only expressing RWPE-1 cells. An in vivo model of xenograft tumors generated with HCT116 KRAS(WT/MUT) or KRAS(WT/-) cells showed the efficacy of C1 treatment and its ability to affect the relative mitotic index in tumors harboring KRAS mutant. These data indicate a synthetic lethal effect against cells carrying mutant KRAS, which could have therapeutic implications given the paucity of KRAS-specific chemotherapeutic strategies. Antioxid. Redox Signal. 24, 781-794.

  15. Cellular and molecular mechanisms of autosomal dominant form of progressive hearing loss, DFNA2.

    PubMed

    Kim, Hyo Jeong; Lv, Ping; Sihn, Choong-Ryoul; Yamoah, Ebenezer N

    2011-01-14

    Despite advances in identifying deafness genes, determination of the underlying cellular and functional mechanisms for auditory diseases remains a challenge. Mutations of the human K(+) channel hKv7.4 lead to post-lingual progressive hearing loss (DFNA2), which affects world-wide population with diverse racial backgrounds. Here, we have generated the spectrum of point mutations in the hKv7.4 that have been identified as diseased mutants. We report that expression of five point mutations in the pore region, namely L274H, W276S, L281S, G285C, and G296S, as well as the C-terminal mutant G321S in the heterologous expression system, yielded non-functional channels because of endoplasmic reticulum retention of the mutant channels. We mimicked the dominant diseased conditions by co-expressing the wild-type and mutant channels. As compared with expression of wild-type channel alone, the blend of wild-type and mutant channel subunits resulted in reduced currents. Moreover, the combinatorial ratios of wild type:mutant and the ensuing current magnitude could not be explained by the predictions of a tetrameric channel and a dominant negative effect of the mutant subunits. The results can be explained by the dependence of cell surface expression of the mutant on the wild-type subunit. Surprisingly, a transmembrane mutation F182L, which has been identified in a pre-lingual progressive hearing loss patient in Taiwan, yielded cell surface expression and functional features that were similar to that of the wild type, suggesting that this mutation may represent redundant polymorphism. Collectively, these findings provide traces of the cellular mechanisms for DFNA2.

  16. Role of CTGF in White Matter Development in Tuberous Sclerosis

    DTIC Science & Technology

    2015-02-01

    previously shown to affect CTGF expression. Our preliminary results show that SRF is downregulated in Tsc1 mutant brains and this can be rescued by rapamycin ...expression. Our preliminary results show that SRF is downregulated in Tsc1 mutant brains and this can be rescued by rapamycin treatment suggesting a...on SRF pathway in our previous report, here we show that SRF levels are decreased in vivo in mutant mice, and this can be rescued by rapamycin

  17. Dominant-negative action of disease-causing gonadotropin-releasing hormone receptor (GnRHR) mutants: a trait that potentially coevolved with decreased plasma membrane expression of GnRHR in humans.

    PubMed

    Leaños-Miranda, Alfredo; Ulloa-Aguirre, Alfredo; Ji, Tae H; Janovick, Jo Ann; Conn, P Michael

    2003-07-01

    Loss of function by 11 of 13 naturally occurring mutations in the human GnRH receptor (hGnRHR) was thought to result from impaired ligand binding or effector coupling, but actually results from receptor misrouting. Homo- or heterodimerization of mutant receptors with wild-type (WT) receptors occurs for other G protein-coupled receptors and may result in dominant-negative or -positive effects on the WT receptor. We tested the hypothesis that WT hGnRHR function was affected by misfolded hGnRHR mutants. hGnRHR mutants were found to inhibit the function of WT GnRHR (measured by activation of effector and ligand binding). Inhibition varied depending on the particular hGnRHR mutant coexpressed and the ratio of hGnRHR mutant to WT hGnRHR cDNA cotransfected. The hGnRHR mutants did not interfere with the function of genetically modified hGnRHRs bearing either a deletion of primate-specific Lys(191) or the carboxyl-terminal tail of the catfish GnRHR; these show intrinsically enhanced expression. Moreover, a peptidomimetic antagonist of GnRH enhanced the expression of WT hGnRHR, but not of genetically modified hGnRHR species. The dominant-negative effect of the naturally occurring receptor mutants occurred only for the WT hGnRHR, which has intrinsic low maturation efficiency. The data suggest that this dominant negative effect accompanies the diminished plasma membrane expression as a recent evolutionary event.

  18. Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gu Ning; Laboratory of Neurochemistry, Graduate School of Human and Environmental Studies, Kyoto University, Kyoto; Adachi, Tetsuya

    2006-08-04

    Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2more » mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.« less

  19. RNA interference-mediated silencing of mutant superoxide dismutase rescues cyclosporin A-induced death in cultured neuroblastoma cells

    PubMed Central

    Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.

    2004-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234

  20. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    PubMed

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  1. Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

    PubMed

    Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

    2015-07-16

    p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

  2. Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein

    PubMed Central

    Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles

    1999-01-01

    Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625

  3. Mutants with Enhanced Nitrogenase Activity in Hydroponic Azospirillum brasilense-Wheat Associations

    PubMed Central

    Pereg Gerk, Lily; Gilchrist, Kate; Kennedy, Ivan R.

    2000-01-01

    The effect of a mutation affecting flocculation, differentiation into cyst-like forms, and root colonization on nitrogenase expression by Azospirillum brasilense is described. The gene flcA of strain Sp7 restored these phenotypes in spontaneous mutants of both strains Sp7 and Sp245. Employing both constitutive pLA-lacZ and nifH-lacZ reporter fusions expressed in situ, the colony morphology, colonization pattern, and potential for nitrogenase activity of spontaneous mutants and flcA Tn5-induced mutants were established. The results of this study show that the ability of Sp7 and Sp245 mutant strains to remain in a vegetative form improved their ability to express nitrogenase activity in association with wheat in a hydroponic system. Restoring the cyst formation and colonization pattern to the spontaneous mutant Sp7-S reduced nitrogenase activity rates in association with plants to that of the wild-type Sp7. Although Tn5-induced flcA mutants showed higher potentials for nitrogenase expression than Sp7, their potentials were lower than that of Sp7-S, indicating that other factors in this strain contribute to its exceptional nitrogenase activity rates on plants. The lack of lateral flagella is not one of these factors, as Sp7-PM23, a spontaneous mutant impaired in swarming and lateral-flagellum production but not in flocculation, showed wild-type nitrogenase activity and expression. The results also suggest factors of importance in evolving an effective symbiosis between Azospirillum and wheat, such as increasing the availability of microaerobic niches along the root, increased supply of carbon sources by the plant, and the retention of the bacterial cells in vegetative form for faster metabolism. PMID:10788397

  4. Detection of receptor ligands by monitoring selective stabilization of a Renilla luciferase-tagged, constitutively active mutant, G-protein-coupled receptor

    PubMed Central

    Ramsay, Douglas; Bevan, Nicola; Rees, Stephen; Milligan, Graeme

    2001-01-01

    The wild-type β2-adrenoceptor and a constitutively active mutant of this receptor were C-terminally tagged with luciferase from the sea pansy Renilla reniformis. C-terminal addition of Renilla luciferase did not substantially alter the levels of expression of either form of the receptor, the elevated constitutive activity of the mutant β2-adrenoceptor nor the capacity of isoprenaline to elevate cyclic AMP levels in intact cells expressing these constructs. Treatment of cells expressing constitutively active mutant β2-adrenoceptor-Renilla luciferase with antagonist/inverse agonist ligands resulted in upregulation of levels of this polypeptide which could be monitored by the elevated luciferase activity. The pEC50 for ligand-induced luciferase upregulation and ligand affinity to bind the receptor were highly correlated. Similar upregulation could be observed following sustained treatment with agonist ligands. These effects were only observed at a constitutively active mutant of the β2-adrenoceptor. Co-expression of the wild-type β2-adrenoceptor C-terminally tagged with the luciferase from Photinus pyralis did not result in ligand-induced upregulation of the levels of activity of this luciferase. Co-expression of the constitutively active mutant β2-adrenoceptor-Renilla luciferase and an equivalent mutant of the α1b-adrenoceptor C-terminally tagged with green fluorescent protein allowed pharmacological selectivity of adrenoceptor antagonists to be demonstrated. This approach offers a sensitive and convenient means, which is amenable to high throughput analysis, to monitor ligand binding to a constitutively active mutant receptor. As no prior knowledge of receptor ligands is required this approach may be suitable to identify ligands at orphan G protein-coupled receptors. PMID:11350868

  5. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    PubMed Central

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  6. Mutant Huntingtin Causes a Selective Decrease in the Expression of Synaptic Vesicle Protein 2C.

    PubMed

    Peng, Chaohua; Zhu, Gaochun; Liu, Xiangqian; Li, He

    2018-04-30

    Huntington's disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion in the huntingtin (Htt) protein. Mutant Htt causes synaptic transmission dysfunctions by interfering in the expression of synaptic proteins, leading to early HD symptoms. Synaptic vesicle proteins 2 (SV2s), a family of synaptic vesicle proteins including 3 members, SV2A, SV2B, and SV2C, plays important roles in synaptic physiology. Here, we investigated whether the expression of SV2s is affected by mutant Htt in the brains of HD transgenic (TG) mice and Neuro2a mouse neuroblastoma cells (N2a cells) expressing mutant Htt. Western blot analysis showed that the protein levels of SV2A and SV2B were not significantly changed in the brains of HD TG mice expressing mutant Htt with 82 glutamine repeats. However, in the TG mouse brain there was a dramatic decrease in the protein level of SV2C, which has a restricted distribution pattern in regions particularly vulnerable in HD. Immunostaining revealed that the immunoreactivity of SV2C was progressively weakened in the basal ganglia and hippocampus of TG mice. RT-PCR demonstrated that the mRNA level of SV2C progressively declined in the TG mouse brain without detectable changes in the mRNA levels of SV2A and SV2B, indicating that mutant Htt selectively inhibits the transcriptional expression of SV2C. Furthermore, we found that only SV2C expression was progressively inhibited in N2a cells expressing a mutant Htt containing 120 glutamine repeats. These findings suggest that the synaptic dysfunction in HD results from the mutant Htt-mediated inhibition of SV2C transcriptional expression. These data also imply that the restricted distribution and decreased expression of SV2C contribute to the brain region-selective pathology of HD.

  7. Spontaneous hepatic repopulation in transgenic mice expressing mutant human α1-antitrypsin by wild-type donor hepatocytes.

    PubMed

    Ding, Jianqiang; Yannam, Govardhana R; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I; Wong, Ronald J; Avsar, Yesim; Guha, Chandan; Perlmutter, David H; Fox, Ira J; Roy-Chowdhury, Jayanta

    2011-05-01

    α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z-expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%-98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z-expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals.

  8. Prominent dominant negative effect of a mutant Fas molecule lacking death domain on cell-mediated induction of apoptosis.

    PubMed

    Yokota, Aya; Takeuchi, Emiko; Iizuka, Misao; Ikegami, Yuko; Takayama, Hajime; Shinohara, Nobukata

    2005-01-01

    Using a panel of transfectant B lymphoma cells expressing varying amounts of the mutant Fas together with the endogenous wild type Fas, semi-quantitative studies on the dominant negative effect of a murine mutant Fas molecule lacking death domain were carried out. In anti-Fas antibody-mediated induction of apoptosis, the mutant molecules exerted significant dominant-negative effect only when their expression level was comparable to or higher than that of wild type molecules, or when exposed to low amounts of the antibody. The inhibitory effect was accompanied by the failure in DISC formation in spite of Fas aggregation. When they were subjected to T cell-mediated Fas-based induction of apoptosis, however, the dominant negative effect was prominent such that the expression of even a small amount of the mutant molecules resulted in significant inhibition. Such a strong inhibitory effect explains the dominant phenotype of this type of mutant Fas molecules in ALPS heterozygous patients and also implies that the physiological effectors for Fas in vivo are cells, i.e., FasL-expressing activated T cells.

  9. A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

    PubMed Central

    Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

    2015-01-01

    Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

  10. The role of dileucine in the expression and function of human organic anion transporter 1 (hOAT1)

    PubMed Central

    Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng

    2011-01-01

    Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1. PMID:21494320

  11. The Role of Dileucine in the Expression and Function of Human Organic Anion Transporter 1 (hOAT1).

    PubMed

    Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng

    2011-01-01

    Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1.

  12. Rha1, a new mutant of Arabidopsis disturbed in root slanting, gravitropism and auxin physiology.

    PubMed

    Fortunati, Alessio; Piconese, Silvia; Tassone, Paola; Ferrari, Simone; Migliaccio, Fernando

    2008-11-01

    A new Arabidopsis mutant is characterized (rha1) that shows, in the roots, reduced right-handed slanting, reduced gravitropism and resistance to 2,4-D, TIBA, NPA and ethylene. It also shows reduced length in the shoot and root, reduced number of lateral roots and shorter siliques. The gene was cloned through TAIL-PCR and resulted in a HSF. Because none of the known gravitropic and auxinic mutants result from damage in a HSF, rha1 seems to belong to a new class of this group of mutants. Quantitative PCR analysis showed that the expression of the gene is increased by heat and cold shock, and by presence of 2,4-D in the media. Study of the expression through the GUS reporter gene revealed increased expression in clinostated and gravistimulated plants, but only in adult tissues, and not in the apical meristems of shoots and roots.

  13. Rha1, a new mutant of Arabidopsis disturbed in root slanting, gravitropism and auxin physiology

    PubMed Central

    Fortunati, Alessio; Piconese, Silvia; Tassone, Paola; Ferrari, Simone

    2008-01-01

    A new Arabidopsis mutant is characterized (rha1) that shows, in the roots, reduced right-handed slanting, reduced gravitropism and resistance to 2,4-D, TIBA, NPA and ethylene. It also shows reduced length in the shoot and root, reduced number of lateral roots and shorter siliques. The gene was cloned through TAIL-PCR and resulted in a HSF. Because none of the known gravitropic and auxinic mutants result from damage in a HSF, rha1 seems to belong to a new class of this group of mutants. Quantitative PCR analysis showed that the expression of the gene is increased by heat and cold shock, and by presence of 2,4-D in the media. Study of the expression through the GUS reporter gene revealed increased expression in clinostated and gravistimulated plants, but only in adult tissues, and not in the apical meristems of shoots and roots. PMID:19704429

  14. E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis.

    PubMed

    Park, Kyeong-Su; Kim, Ju Hee; Shin, Hee Won; Chung, Kyung-Sook; Im, Dong-Soo; Lim, Jung Hwa; Jung, Cho-Rok

    2015-10-26

    Missense mutation of VHL gene is frequently detected in type 2 VHL diseases and linked to a wide range of pVHL functions and stability. Certain mutant pVHLs retain ability to regulate HIFs but lose their function by instability. In this case, regulating of degradation of mutant pVHLs, can be postulated as therapeutic method. The stability and cellular function of missense mutant pVHLs were determine in HEK293T transient expressing cell and 786-O stable cell line. Ubiquitination assay of mutant VHL proteins was performed in vitro system. Anticancer effect of adenovirus mediated shUCP expressing was evaluated using ex vivo mouse xenograft assay. Three VHL missense mutants (V155A, L158Q, and Q164R) are directly ubiquitinated by E2-EPF UCP (UCP) in vitro. Mutant pVHLs are more unstable than wild type in cell. Missense mutant pVHLs interact with UCP directly in both in vitro and cellular systems. Lacking all of lysine residues of pVHL result in resistance to ubiquitination thereby increase its stability. Missense mutant pVHLs maintained the function of E3 ligase to ubiquitinate HIF-1α in vitro. In cells expressing mutant pVHLs, Glut-1 and VEGF were relatively upregulated compared to their levels in cells expressing wild-type. Depletion of UCP restored missense mutant pVHLs levels and inhibited cell growth. Adenovirus-mediated shUCP RNA delivery inhibited tumor growth in ex vivo mouse xenograft model. These data suggest that targeting of UCP can be one of therapeutic method in type 2 VHL disease caused by unstable but functional missense mutant pVHL.

  15. Spontaneous hepatic repopulation in transgenic mice expressing mutant human α1-antitrypsin by wild-type donor hepatocytes

    PubMed Central

    Ding, Jianqiang; Yannam, Govardhana R.; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I.; Wong, Ronald J.; Avsar, Yesim; Guha, Chandan; Perlmutter, David H.; Fox, Ira J.; Roy-Chowdhury, Jayanta

    2011-01-01

    α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z–expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%–98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z–expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals. PMID:21505264

  16. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    PubMed

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  17. Amino acids Thr56 and Thr58 are not essential for elongation factor 2 function in yeast.

    PubMed

    Bartish, Galyna; Moradi, Hossein; Nygård, Odd

    2007-10-01

    Yeast elongation factor 2 is an essential protein that contains two highly conserved threonine residues, T56 and T58, that could potentially be phosphorylated by the Rck2 kinase in response to environmental stress. The importance of residues T56 and T58 for elongation factor 2 function in yeast was studied using site directed mutagenesis and functional complementation. Mutations T56D, T56G, T56K, T56N and T56V resulted in nonfunctional elongation factor 2 whereas mutated factor carrying point mutations T56M, T56C, T56S, T58S and T58V was functional. Expression of mutants T56C, T56S and T58S was associated with reduced growth rate. The double mutants T56M/T58W and T56M/T58V were also functional but the latter mutant caused increased cell death and considerably reduced growth rate. The results suggest that the physiological role of T56 and T58 as phosphorylation targets is of little importance in yeast under standard growth conditions. Yeast cells expressing mutants T56C and T56S were less able to cope with environmental stress induced by increased growth temperatures. Similarly, cells expressing mutants T56M and T56M/T58W were less capable of adapting to increased osmolarity whereas cells expressing mutant T58V behaved normally. All mutants tested were retained their ability to bind to ribosomes in vivo. However, mutants T56D, T56G and T56K were under-represented on the ribosome, suggesting that these nonfunctional forms of elongation factor 2 were less capable of competing with wild-type elongation factor 2 in ribosome binding. The presence of nonfunctional but ribosome binding forms of elongation factor 2 did not affect the growth rate of yeast cells also expressing wild-type elongation factor 2.

  18. Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development.

    PubMed

    Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang

    2014-02-10

    Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Tyrosine Phosphorylation of the Human Serotonin Transporter: A Role in the Transporter Stability and Function

    PubMed Central

    Annamalai, Balasubramaniam; Mannangatti, Padmanabhan; Arapulisamy, Obulakshmi; Shippenberg, Toni S.; Jayanthi, Lankupalle D.

    2012-01-01

    The serotonin (5-HT) transporter (SERT) regulates serotoninergic neurotransmission by clearing 5-HT released into the synaptic space. Phosphorylation of SERT on serine and threonine mediates SERT regulation. Whether tyrosine phosphorylation regulates SERT is unknown. Here, we tested the hypothesis that tyrosine-phosphorylation of SERT regulates 5-HT transport. In support of this, alkali-resistant 32P-labeled SERT was found in rat platelets, and Src-tyrosine kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo [3,4,d]pyrimidine (PP2) decreased platelet SERT function and expression. In human placental trophoblast cells expressing SERT, PP2 reduced transporter function, expression, and stability. Although siRNA silencing of Src expression decreased SERT function and expression, coexpression of Src resulted in PP2-sensitive increases in SERT function and expression. PP2 treatment markedly decreased SERT protein stability. Compared with WT-SERT, SERT tyrosine mutants Y47F and Y142F exhibited reduced 5-HT transport despite their higher total and cell surface expression levels. Moreover, Src-coexpression increased total and cell surface expression of Y47F and Y142F SERT mutants without affecting their 5-HT transport capacity. It is noteworthy that Y47F and Y142F mutants exhibited higher protein stability compared with WT-SERT. However, similar to WT-SERT, PP2 treatment decreased the stability of Y47F and Y142F mutants. Furthermore, compared with WT-SERT, Y47F and Y142F mutants exhibited lower basal tyrosine phosphorylation and no further enhancement of tyrosine phosphorylation in response to Src coexpression. These results provide the first evidence that SERT tyrosine phosphorylation supports transporter protein stability and 5HT transport. PMID:21992875

  20. Disruption of LACCASE4 and 17 Results in Tissue-Specific Alterations to Lignification of Arabidopsis thaliana Stems[W

    PubMed Central

    Berthet, Serge; Demont-Caulet, Nathalie; Pollet, Brigitte; Bidzinski, Przemyslaw; Cézard, Laurent; Le Bris, Phillipe; Borrega, Nero; Hervé, Jonathan; Blondet, Eddy; Balzergue, Sandrine; Lapierre, Catherine; Jouanin, Lise

    2011-01-01

    Peroxidases have been shown to be involved in the polymerization of lignin precursors, but it remains unclear whether laccases (EC 1.10.3.2) participate in constitutive lignification. We addressed this issue by studying laccase T-DNA insertion mutants in Arabidopsis thaliana. We identified two genes, LAC4 and LAC17, which are strongly expressed in stems. LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers. We produced two double mutants by crossing the LAC17 (lac17) mutant with two LAC4 mutants (lac4-1 and lac4-2). The single and double mutants grew normally in greenhouse conditions. The single mutants had moderately low lignin levels, whereas the stems of lac4-1 lac17 and lac4-2 lac17 mutants had lignin contents that were 20 and 40% lower than those of the control, respectively. These lower lignin levels resulted in higher saccharification yields. Thioacidolysis revealed that disrupting LAC17 principally affected the deposition of G lignin units in the interfascicular fibers and that complementation of lac17 with LAC17 restored a normal lignin profile. This study provides evidence that both LAC4 and LAC17 contribute to the constitutive lignification of Arabidopsis stems and that LAC17 is involved in the deposition of G lignin units in fibers. PMID:21447792

  1. TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain

    PubMed Central

    Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A.; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

    2014-01-01

    Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology. PMID:24381309

  2. TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain.

    PubMed

    Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

    2014-05-15

    Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology.

  3. Determining the Advantages, Costs, and Trade-Offs of a Novel Sodium Channel Mutation in the Copepod Acartia hudsonica to Paralytic Shellfish Toxins (PST)

    PubMed Central

    Finiguerra, Michael; Avery, David E.; Dam, Hans G.

    2015-01-01

    The marine copepod Acartia hudsonica was shown to be adapted to dinoflagellate prey, Alexandrium fundyense, which produce paralytic shellfish toxins (PST). Adaptation to PSTs in other organisms is caused by a mutation in the sodium channel. Recently, a mutation in the sodium channel in A. hudsonica was found. In this study, we rigorously tested for advantages, costs, and trade-offs associated with the mutant isoform of A. hudsonica under toxic and non-toxic conditions. We combined fitness with wild-type: mutant isoform ratio measurements on the same individual copepod to test our hypotheses. All A. hudsonica copepods express both the wild-type and mutant sodium channel isoforms, but in different proportions; some individuals express predominantly mutant (PMI) or wild-type isoforms (PWI), while most individuals express relatively equal amounts of each (EI). There was no consistent pattern of improved performance as a function of toxin dose for egg production rate (EPR), ingestion rate (I), and gross growth efficiency (GGE) for individuals in the PMI group relative to individuals in the PWI expression group. Neither was there any evidence to indicate a fitness benefit to the mutant isoform at intermediate toxin doses. No clear advantage under toxic conditions was associated with the mutation. Using a mixed-diet approach, there was also no observed relationship between individual wild-type: mutant isoform ratios and among expression groups, on both toxic and non-toxic diets, for eggs produced over three days. Lastly, expression of the mutant isoform did not mitigate the negative effects of the toxin. That is, the reductions in EPR from a toxic to non-toxic diet for copepods were independent of expression groups. Overall, the results did not support our hypotheses; the mutant sodium channel isoform does not appear to be related to adaptation to PST in A. hudsonica. Other potential mechanisms responsible for the adaptation are discussed. PMID:26075900

  4. Genetic requirements for high constitutive SOS expression in recA730 mutants of Escherichia coli.

    PubMed

    Vlašić, Ignacija; Šimatović, Ana; Brčić-Kostić, Krunoslav

    2011-09-01

    The RecA protein in its functional state is in complex with single-stranded DNA, i.e., in the form of a RecA filament. In SOS induction, the RecA filament functions as a coprotease, enabling the autodigestion of the LexA repressor. The RecA filament can be formed by different mechanisms, but all of them require three enzymatic activities essential for the processing of DNA double-stranded ends. These are helicase, 5'-3' exonuclease, and RecA loading onto single-stranded DNA (ssDNA). In some mutants, the SOS response can be expressed constitutively during the process of normal DNA metabolism. The RecA730 mutant protein is able to form the RecA filament without the help of RecBCD and RecFOR mediators since it better competes with the single-strand binding (SSB) protein for ssDNA. As a consequence, the recA730 mutants show high constitutive SOS expression. In the study described in this paper, we studied the genetic requirements for constitutive SOS expression in recA730 mutants. Using a β-galactosidase assay, we showed that the constitutive SOS response in recA730 mutants exhibits different requirements in different backgrounds. In a wild-type background, the constitutive SOS response is partially dependent on RecBCD function. In a recB1080 background (the recB1080 mutation retains only helicase), constitutive SOS expression is partially dependent on RecBCD helicase function and is strongly dependent on RecJ nuclease. Finally, in a recB-null background, the constitutive SOS expression of the recA730 mutant is dependent on the RecJ nuclease. Our results emphasize the importance of the 5'-3' exonuclease for high constitutive SOS expression in recA730 mutants and show that RecBCD function can further enhance the excellent intrinsic abilities of the RecA730 protein in vivo. Copyright © 2011, American Society for Microbiology. All Rights Reserved.

  5. Expression in Bacillus subtilis of the Bacillus thuringiensis cryIIIA toxin gene is not dependent on a sporulation-specific sigma factor and is increased in a spo0A mutant.

    PubMed

    Agaisse, H; Lereclus, D

    1994-08-01

    Expression of the Bacillus thuringiensis cryIIIA gene encoding a Coleoptera-specific toxin is weak during vegetative growth and is activated at the onset of the stationary phase. cryIIIA'-'lacZ fusions and primer extension analysis show that the regulation of cryIIIA expression is similar in Bacillus subtilis and in B. thuringiensis. Activation of cryIIIA expression was not altered in B. subtilis mutant strains deficient for the sigma H and sigma E sporulation-specific sigma factors or for minor sigma factors such as sigma B, sigma D, or sigma L. This result and the nucleotide sequence of the -35 and -10 regions of the cryIIIA promoter suggest that cryIIIA expression might be directed by the E sigma A form of RNA polymerase. Expression of the cryIIIA'-'lacZ fusion is shut off after t2 (2 h after time zero) of sporulation in the B. subtilis wild-type strain grown on nutrient broth sporulation medium. However, no decrease in cryIIIA-directed beta-galactosidase activity occurred in sigma H, kinA, or spo0A mutant strains. Moreover, beta-galactosidase activity was higher and remained elevated after t2 in the spo0A mutant strain. beta-Galactosidase activity was weak in abrB and spo0A abrB mutant strains, suggesting that AbrB is responsible for the higher level of cryIIIA expression observed in a spo0A mutant. However, both in spo0A and spo0A abrB mutant strains, beta-galactosidase activity remained elevated after t2, suggesting that even in the absence of AbrB, cryIIIA expression is controlled through modulation of the phosphorylated form of Spo0A. When the cryIIIA gene is expressed in a B. subtilis spo0A mutant strain or in the 168 wild-type strain, large amounts of toxins are produced and accumulate to form a flat rectangular crystal characteristic of the coleopteran-specific B. thuringiensis strains.

  6. Synergistic Toxicity of Polyglutamine-Expanded TATA-Binding Protein in Glia and Neuronal Cells: Therapeutic Implications for Spinocerebellar Ataxia 17

    PubMed Central

    Yang, Yang; Cui, Yiting; Tang, Beisha

    2017-01-01

    Spinocerebellar ataxia 17 (SCA17) is caused by polyglutamine (polyQ) repeat expansion in the TATA-binding protein (TBP) and is among a family of neurodegenerative diseases in which polyQ expansion leads to preferential neuronal loss in the brain. Although previous studies have demonstrated that expression of polyQ-expanded proteins in glial cells can cause neuronal injury via noncell-autonomous mechanisms, these studies investigated animal models that overexpress transgenic mutant proteins. Since glial cells are particularly reactive to overexpressed mutant proteins, it is important to investigate the in vivo role of glial dysfunction in neurodegeneration when mutant polyQ proteins are endogenously expressed. In the current study, we generated two conditional TBP-105Q knock-in mouse models that specifically express mutant TBP at the endogenous level in neurons or in astrocytes. We found that mutant TBP expression in neuronal cells or astrocytes alone only caused mild neurodegeneration, whereas severe neuronal toxicity requires the expression of mutant TBP in both neuronal and glial cells. Coculture of neurons and astrocytes further validated that mutant TBP in astrocytes promoted neuronal injury. We identified activated inflammatory signaling pathways in mutant TBP-expressing astrocytes, and blocking nuclear factor κB (NF-κB) signaling in astrocytes ameliorated neurodegeneration. Our results indicate that the synergistic toxicity of mutant TBP in neuronal and glial cells plays a critical role in SCA17 pathogenesis and that targeting glial inflammation could be a potential therapeutic approach for SCA17 treatment. SIGNIFICANCE STATEMENT Mutant TBP with polyglutamine expansion preferentially affects neuronal viability in SCA17 patients. Whether glia, the cells that support and protect neurons, contribute to neurodegeneration in SCA17 remains mostly unexplored. In this study, we provide both in vivo and in vitro evidence arguing that endogenous expression of mutant TBP in neurons and glia synergistically impacts neuronal survival. Hyperactivated inflammatory signaling pathways, particularly the NF-κB pathway, underlie glia-mediated neurotoxicity. Moreover, blocking NF-κB activity with small chemical inhibitors alleviated such neurotoxicity. Our study establishes glial dysfunction as an important component of SCA17 pathogenesis and suggests targeting glial inflammation as a potential therapeutic approach for SCA17 treatment. PMID:28821675

  7. Root-expressed maize lipoxygenase 3 negatively regulates induced systemic resistance to Colletotrichum graminicola in shoots

    PubMed Central

    Constantino, Nasie N.; Mastouri, Fatemeh; Damarwinasis, Ramadhika; Borrego, Eli J.; Moran-Diez, Maria E.; Kenerley, Charley M.; Gao, Xiquan; Kolomiets, Michael V.

    2013-01-01

    We have previously reported that disruption of a maize root-expressed 9-lipoxygenase (9-LOX) gene, ZmLOX3, results in dramatic increase in resistance to diverse leaf and stalk pathogens. Despite evident economic significance of these findings, the mechanism behind this increased resistance remained elusive. In this study, we found that increased resistance of the lox3-4 mutants is due to constitutive activation of induced systemic resistance (ISR) signaling. We showed that ZmLOX3 lacked expression in leaves in response to anthracnose leaf blight pathogen Colletotrichum graminicola, but was expressed constitutively in the roots, thus, prompting our hypothesis: the roots of lox3-4 mutants are the source of increased resistance in leaves. Supporting this hypothesis, treatment of wild-type plants (WT) with xylem sap of lox3-4 mutant induced resistance to C. graminicola to the levels comparable to those observed in lox3-4 mutant. Moreover, treating mutants with the sap collected from WT plants partially restored the susceptibility to C. graminicola. lox3-4 mutants showed primed defense responses upon infection, which included earlier and greater induction of defense-related PAL and GST genes compared to WT. In addition to the greater expression of the octadecanoid pathway genes, lox3-4 mutant responded earlier and with a greater accumulation of H2O2 in response to C. graminicola infection or treatment with alamethicin. These findings suggest that lox3-4 mutants display constitutive ISR-like signaling. In support of this idea, root colonization by Trichoderma virens strain GV29-8 induced the same level of disease resistance in WT as the treatment with the mutant sap, but had no additional resistance effect in lox3-4 mutant. While treatment with T. virens GV29 strongly and rapidly suppressed ZmLOX3 expression in hydroponically grown WT roots, T. virens Δsml mutant, which is deficient in ISR induction, was unable to suppress expression of ZmLOX3, thus, providing genetic evidence that SM1 function in ISR, at least in part, by suppressing host ZmLOX3 gene. This study and the genetic tools generated herein will allow the identification of the signals regulating the induction of resistance to aboveground attackers by beneficial soil microorganisms in the future. PMID:24391653

  8. Tlx and Pax6 co-operate genetically to establish the pallio-subpallial boundary in the embryonic mouse telencephalon.

    PubMed

    Stenman, Jan; Yu, Ruth T; Evans, Ronald M; Campbell, Kenneth

    2003-03-01

    We have examined the role of Tlx, an orphan nuclear receptor, in dorsal-ventral patterning of the mouse telencephalon. Tlx is expressed broadly in the ventricular zone, with the exception of the dorsomedial and ventromedial regions. The expression spans the pallio-subpallial boundary, which separates the dorsal (i.e. pallium) and ventral (i.e. subpallium) telencephalon. Despite being expressed on both sides of the pallio-subpallial boundary, Tlx homozygous mutants display alterations in the development of this boundary. These alterations include a dorsal shift in the expression limits of certain genes that abut at the pallio-subpallial boundary as well as the abnormal formation of the radial glial palisade that normally marks this boundary. The Tlx mutant phenotype is similar to, but less severe than, that seen in Small eye (i.e. Pax6) mutants. Interestingly, removal of one allele of Pax6 on the homozygous Tlx mutant background significantly worsens the phenotype. Thus Tlx and Pax6 cooperate genetically to regulate the establishment of the pallio-subpallial boundary. The patterning defects in the Tlx mutant telencephalon result in a loss of region-specific gene expression in the ventral-most pallial region. This correlates well with the malformation of the lateral and basolateral amygdala in Tlx mutants, both of which have been suggested to derive from ventral portions of the pallium.

  9. BIM and mTOR expression levels predict outcome to erlotinib in EGFR-mutant non-small-cell lung cancer.

    PubMed

    Karachaliou, Niki; Codony-Servat, Jordi; Teixidó, Cristina; Pilotto, Sara; Drozdowskyj, Ana; Codony-Servat, Carles; Giménez-Capitán, Ana; Molina-Vila, Miguel Angel; Bertrán-Alamillo, Jordi; Gervais, Radj; Massuti, Bartomeu; Morán, Teresa; Majem, Margarita; Felip, Enriqueta; Carcereny, Enric; García-Campelo, Rosario; Viteri, Santiago; González-Cao, María; Morales-Espinosa, Daniela; Verlicchi, Alberto; Crisetti, Elisabetta; Chaib, Imane; Santarpia, Mariacarmela; Luis Ramírez, José; Bosch-Barrera, Joaquim; Felipe Cardona, Andrés; de Marinis, Filippo; López-Vivanco, Guillermo; Miguel Sánchez, José; Vergnenegre, Alain; Sánchez Hernández, José Javier; Sperduti, Isabella; Bria, Emilio; Rosell, Rafael

    2015-12-07

    BIM is a proapoptotic protein that initiates apoptosis triggered by EGFR tyrosine kinase inhibitors (TKI). mTOR negatively regulates apoptosis and may influence response to EGFR TKI. We examined mRNA expression of BIM and MTOR in 57 patients with EGFR-mutant NSCLC from the EURTAC trial. Risk of mortality and disease progression was lower in patients with high BIM compared with low/intermediate BIM mRNA levels. Analysis of MTOR further divided patients with high BIM expression into two groups, with those having both high BIM and MTOR experiencing shorter overall and progression-free survival to erlotinib. Validation of our results was performed in an independent cohort of 19 patients with EGFR-mutant NSCLC treated with EGFR TKIs. In EGFR-mutant lung adenocarcinoma cell lines with high BIM expression, concomitant high mTOR expression increased IC50 of gefitinib for cell proliferation. We next sought to analyse the signalling pattern in cell lines with strong activation of mTOR and its substrate P-S6. We showed that mTOR and phosphodiesterase 4D (PDE4D) strongly correlate in resistant EGFR-mutant cancer cell lines. These data suggest that the combination of EGFR TKI with mTOR or PDE4 inhibitors could be adequate therapy for EGFR-mutant NSCLC patients with high pretreatment levels of BIM and mTOR.

  10. The Thiamine Biosynthesis Gene THI1 Promotes Nodule Growth and Seed Maturation1

    PubMed Central

    Nagae, Miwa; Kawaguchi, Masayoshi; Takeda, Naoya

    2016-01-01

    Thiamine (vitamin B1) is essential for living organisms. Unlike animals, plants can synthesize thiamine. In Lotus japonicus, the expression of two thiamine biosynthesis genes, THI1 and THIC, was enhanced by inoculation with rhizobia but not by inoculation with arbuscular mycorrhizal fungi. THIC and THI2 (a THI1 paralog) were expressed in uninoculated leaves. THI2-knockdown plants and the transposon insertion mutant thiC had chlorotic leaves. This typical phenotype of thiamine deficiency was rescued by an exogenous supply of thiamine. In wild-type plants, THI1 was expressed mainly in roots and nodules, and the thi1 mutant had green leaves even in the absence of exogenous thiamine. THI1 was highly expressed in actively dividing cells of nodule primordia. The thi1 mutant had small nodules, and this phenotype was rescued by exogenous thiamine and by THI1 complementation. Exogenous thiamine increased nodule diameter, but the level of arbuscular mycorrhizal colonization was unaffected in the thi1 mutant or by exogenous thiamine. Expression of symbiotic marker genes was induced normally, implying that mainly nodule growth was delayed in the thi1 mutant. Furthermore, this mutant formed many immature seeds with reduced seed weight. These results indicate that thiamine biosynthesis mediated by THI1 enhances nodule enlargement and is required for seed development in L. japonicus. PMID:27702844

  11. Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

    PubMed Central

    Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

    1993-01-01

    Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

  12. Akt mediated ROS-dependent selective targeting of mutant KRAS tumors.

    PubMed

    Iskandar, Kartini; Rezlan, Majidah; Pervaiz, Shazib

    2014-10-01

    Reactive oxygen species (ROS) play a critical role in a variety of cellular processes, ranging from cell survival and proliferation to cell death. Previously, we reported the ability of a small molecule compound, C1, to induce ROS dependent autophagy associated apoptosis in human cancer cell lines and primary tumor cells (Wong C. et al. 2010). Our ongoing investigations have unraveled a hitherto undefined novel signaling network involving hyper-phosphorylation of Akt and Akt-mediated ROS production in cancer cell lines. Interestingly, drug-induced Akt activation is selectively seen in cell lines that carry mutant KRAS; HCT116 cells that carry the V13D KRAS mutation respond favorably to C1 while HT29 cells expressing wild type KRAS are relatively resistant. Of note, not only does the compound target mutant KRAS expressing cells but also induces RAS activation as evidenced by the PAK pull down assay. Corroborating this, pharmacological inhibition as well as siRNA mediated silencing of KRAS or Akt, blocked C1-induced ROS production and rescued tumor colony forming ability in HCT116 cells. To further confirm the involvement of KRAS, we made use of mutant KRAS transformed RWPE-1 prostate epithelial cells. Notably, drug-induced ROS generation and death sensitivity was significantly higher in RWPE-1-KRAS cells than the RWPE-1-vector cells, thus confirming the results obtained with mutant KRAS colorectal carcinoma cell line. Lastly, we made use of HCT116 mutant KRAS knockout cells (KO) where the mutant KRAS allele had been deleted, thus expressing a single wild-type KRAS allele. Exposure of the KO cells to C1 failed to induce Akt activation and mitochondrial ROS production. Taken together, results show the involvement of activated Akt in ROS-mediated selective targeting of mutant KRAS expressing tumors, which could have therapeutic implications given the paucity of chemotherapeutic strategies specifically targeting KRAS mutant cancers. Copyright © 2014. Published by Elsevier Inc.

  13. Characterization of the R162W Kir7.1 mutation associated with snowflake vitreoretinopathy

    PubMed Central

    Zhang, Wei; Zhang, Xiaoming; Wang, Hui; Sharma, Anil K.; Edwards, Albert O.

    2013-01-01

    KCNJ13 encodes Kir7.1, an inwardly rectifying K+ channel that is expressed in multiple ion-transporting epithelia. A mutation in KCNJ13 resulting in an arginine-to-tryptophan change at residue 162 (R162W) of Kir7.1 was associated with snowflake vitreoretinal degeneration, an inherited autosomal-dominant disease characterized by vitreous degeneration and mild retinal degeneration. We used the Xenopus laevis oocyte expression system to assess the functional properties of the R162W (mutant) Kir7.1 channel and determine how wild-type (WT) Kir7.1 is affected by the presence of the mutant subunit. Recordings obtained via the two-electrode voltage-clamp technique revealed that injection of oocytes with mutant Kir7.1 cRNA resulted in currents and cation selectivity that were indistinguishable from those in water-injected oocytes, suggesting that the mutant protein does not form functional channels in the plasma membrane. Coinjection of oocytes with equal amounts of mutant and WT Kir7.1 cRNAs resulted in inward K+ and Rb+ currents with amplitudes that were ∼17% of those in oocytes injected with WT Kir7.1 cRNA alone, demonstrating a dominant-negative effect of the mutant subunit. Similar to oocytes injected with WT Kir7.1 cRNA alone, coinjected oocytes exhibited inwardly rectifying Rb+ currents that were more than seven times larger than K+ currents, indicating that mutant subunits did not alter Kir7.1 channel selectivity. Immunostaining of Xenopus oocytes or Madin-Darby canine kidney cells expressing mutant or WT Kir7.1 demonstrated distribution of both proteins primarily in the plasma membrane. Our data suggest that the R162W mutation suppresses Kir7.1 channel activity, possibly by negatively impacting gating by membrane phosphadidylinositol 4,5-bisphosphate. PMID:23255580

  14. Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

    PubMed Central

    Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

    1997-01-01

    We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

  15. Effective non-denaturing purification method for improving the solubility of recombinant actin-binding proteins produced by bacterial expression.

    PubMed

    Chung, Jeong Min; Lee, Sangmin; Jung, Hyun Suk

    2017-05-01

    Bacterial expression is commonly used to produce recombinant and truncated mutant eukaryotic proteins. However, heterologous protein expression may render synthesized proteins insoluble. The conventional method used to express a poorly soluble protein, which involves denaturation and refolding, is time-consuming and inefficient. There are several non-denaturing approaches that can increase the solubility of recombinant proteins that include using different bacterial cell strains, altering the time of induction, lowering the incubation temperature, and employing different detergents for purification. In this study, we compared several non-denaturing protocols to express and purify two insoluble 34 kDa actin-bundling protein mutants. The solubility of the mutant proteins was not affected by any of the approaches except for treatment with the detergent sarkosyl. These results indicate that sarkosyl can effectively improve the solubility of insoluble proteins during bacterial expression. Copyright © 2016. Published by Elsevier Inc.

  16. Interaction theory of mammalian mitochondria.

    PubMed

    Nakada, K; Inoue, K; Hayashi, J

    2001-11-09

    We generated mice with deletion mutant mtDNA by its introduction from somatic cells into mouse zygotes. Expressions of disease phenotypes are limited to tissues expressing mitochondrial dysfunction. Considering that all these mice share the same nuclear background, these observations suggest that accumulation of the mutant mtDNA and resultant expressions of mitochondrial dysfunction are responsible for expression of disease phenotypes. On the other hand, mitochondrial dysfunction and expression of clinical abnormalities were not observed until the mutant mtDNA accumulated predominantly. This protection is due to the presence of extensive and continuous interaction between exogenous mitochondria from cybrids and recipient mitochondria from embryos. Thus, we would like to propose a new hypothesis on mitochondrial biogenesis, interaction theory of mitochondria: mammalian mitochondria exchange genetic contents, and thus lost the individuality and function as a single dynamic cellular unit. Copyright 2001 Academic Press.

  17. Induction of CD69 expression by cagPAI-positive Helicobacter pylori infection

    PubMed Central

    Mori, Naoki; Ishikawa, Chie; Senba, Masachika

    2011-01-01

    AIM: To investigate and elucidate the molecular mechanism that regulates inducible expression of CD69 by Helicobacter pylori (H. pylori) infection. METHODS: The expression levels of CD69 in a T-cell line, Jurkat, primary human peripheral blood mononuclear cells (PBMCs), and CD4+ T cells, were assessed by immunohistochemistry, reverse transcription polymerase chain reaction, and flow cytometry. Activation of CD69 promoter was detected by reporter gene. Nuclear factor (NF)-κB activation in Jurkat cells infected with H. pylori was evaluated by electrophoretic mobility shift assay. The role of NF-κB signaling in H. pylori-induced CD69 expression was analyzed using inhibitors of NF-κB and dominant-negative mutants. The isogenic mutants with disrupted cag pathogenicity island (cagPAI) and virD4 were used to elucidate the role of cagPAI-encoding type IV secretion system and CagA in CD69 expression. RESULTS: CD69 staining was detected in mucosal lymphocytes and macrophages in specimens of patients with H. pylori-positive gastritis. Although cagPAI-positive H. pylori and an isogenic mutant of virD4 induced CD69 expression, an isogenic mutant of cagPAI failed to induce this in Jurkat cells. H. pylori also induced CD69 expression in PBMCs and CD4+ T cells. The activation of the CD69 promoter by H. pylori was mediated through NF-κB. Transfection of dominant-negative mutants of IκBs, IκB kinases, and NF-κB-inducing kinase inhibited H. pylori-induced CD69 activation. Inhibitors of NF-κB suppressed H. pylori-induced CD69 mRNA expression. CONCLUSION: The results suggest that H. pylori induces CD69 expression through the activation of NF-κB. cagPAI might be relevant in the induction of CD69 expression in T cells. CD69 in T cells may play a role in H. pylori-induced gastritis. PMID:21990950

  18. ATF3 plays a protective role against toxicity by N-terminal fragment of mutant huntingtin in stable PC12 cell line

    PubMed Central

    Liang, Yideng; Jiang, Haibing; Ratovitski, Tamara; Jie, Chunfa; Nakamura, Masayuki; Hirschhorn, Ricky R.; Wang, Xiaofang; Smith, Wanli W.; Hai, Tsonwin; Poirier, Michelle A.; Ross, Christopher A.

    2009-01-01

    Huntington's disease is a progressive neurodegenerative disorder caused by a polyglutamine expansion near the N-terminus of huntingtin. The mechanisms of polyglutamine neurotoxicity, and cellular responses are not fully understood. We have studied gene expression profiles by cDNA array using an inducible PC12 cell model expressing an N-terminal huntingtin fragment with expanded polyglutamine (Htt-N63-148Q). Mutant huntingtin Htt-N63 induced cell death and increased the mRNA and protein levels of activating transcription factor 3 (ATF3). Mutant Htt-N63 also significantly enhanced ATF3 transcriptional activity by a promoter-based reporter assay. Overexpression of ATF3 protects against mutant Htt-N63 toxicity and knocking down ATF3 expression reduced Htt-N63 toxicity in a stable PC12 cell line. These results indicated that ATF3 plays a critical role in toxicity induced by mutant Htt-N63 and may lead to a useful therapeutic target. PMID:19559011

  19. Chaperone-mediated autophagy degrades mutant p53

    PubMed Central

    Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

    2013-01-01

    Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

  20. The evolutionarily conserved interaction between LC3 and p62 selectively mediates autophagy-dependent degradation of mutant huntingtin.

    PubMed

    Tung, Ying-Tsen; Hsu, Wen-Ming; Lee, Hsinyu; Huang, Wei-Pang; Liao, Yung-Feng

    2010-07-01

    Mammalian p62/sequestosome-1 protein binds to both LC3, the mammalian homologue of yeast Atg8, and polyubiquitinated cargo proteins destined to undergo autophagy-mediated degradation. We previously identified a cargo receptor-binding domain in Atg8 that is essential for its interaction with the cargo receptor Atg19 in selective autophagic processes in yeast. We, thus, sought to determine whether this interaction is evolutionally conserved from yeast to mammals. Using an amino acid replacement approach, we demonstrate that cells expressing mutant LC3 (LC3-K30D, LC3-K51A, or LC3-L53A) all exhibit defective lipidation of LC3, a disrupted LC3-p62 interaction, and impaired autophagic degradation of p62, suggesting that the p62-binding site of LC3 is localized within an evolutionarily conserved domain. Importantly, whereas cells expressing these LC3 mutants exhibited similar overall autophagic activity comparable to that of cells expressing wild-type LC3, autophagy-mediated clearance of the aggregation-prone mutant Huntingtin was defective in the mutant-expressing cells. Together, these results suggest that p62 directly binds to the evolutionarily conserved cargo receptor-binding domain of Atg8/LC3 and selectively mediates the clearance of mutant Huntingtin.

  1. Serum response factor: positive and negative regulation of an epithelial gene expression network in the destrin mutant cornea

    PubMed Central

    Kawakami-Schulz, Sharolyn V.; Verdoni, Angela M.; Sattler, Shannon G.; Jessen, Erik; Kao, Winston W.-Y.; Ikeda, Akihiro

    2014-01-01

    Increased angiogenesis, inflammation, and proliferation are hallmarks of diseased tissues, and in vivo models of these disease phenotypes can provide insight into disease pathology. Dstncorn1 mice, deficient for the actin depolymerizing factor destrin (DSTN), display an increase of serum response factor (SRF) that results in epithelial hyperproliferation, inflammation, and neovascularization in the cornea. Previous work demonstrated that conditional ablation of Srf from the corneal epithelium of Dstncorn1 mice returns the cornea to a wild-type (WT) like state. This result implicated SRF as a major regulator of genes that contributes to abnormal phenotypes in Dstncorn1 cornea. The purpose of this study is to identify gene networks that are affected by increased expression of Srf in the Dstncorn1 cornea. Microarray analysis led to characterization of gene expression changes that occur when conditional knockout of Srf rescues mutant phenotypes in the cornea of Dstncorn1 mice. Comparison of gene expression values from WT, Dstncorn1 mutant, and Dstncorn1 rescued cornea identified >400 differentially expressed genes that are downstream from SRF. Srf ablation had a significant effect on genes associated with epithelial cell-cell junctions and regulation of actin dynamics. The majority of genes affected by SRF are downregulated in the Dstncorn1 mutant cornea, suggesting that increased SRF negatively affects transcription of SRF gene targets. ChIP-seq analysis on Dstncorn1 mutant and WT tissue revealed that, despite being present in higher abundance, SRF binding is significantly decreased in the Dstncorn1 mutant cornea. This study uses a unique model combining genetic and genomic approaches to identify genes that are regulated by SRF. These findings expand current understanding of the role of SRF in both normal and abnormal tissue homeostasis. PMID:24550211

  2. The Transcription Factor Foxg1 Promotes Optic Fissure Closure in the Mouse by Suppressing Wnt8b in the Nasal Optic Stalk

    PubMed Central

    Smith, Rowena; Huang, Yu-Ting; Tian, Tian; Vojtasova, Dominika; Mesalles-Naranjo, Oscar; Price, David J.

    2017-01-01

    During vertebrate eye morphogenesis, a transient fissure forms at its inferior part, known as the optic fissure. This will gradually close, giving rise to a healthy, spherical optic cup. Failure of the optic fissure to close gives rise to an ocular disorder known as coloboma. During this developmental process, Foxg1 is expressed in the optic neuroepithelium, with highest levels of expression in the nasal optic stalk. Foxg1−/− mutant mice have microphthalmic eyes with a large ventral coloboma. We found Wnt8b expression upregulated in the Foxg1−/− optic stalk and hypothesized that, similar to what is observed in telencephalic development, Foxg1 directs development of the optic neuroepithelium through transcriptional suppression of Wnt8b. To test this, we generated Foxg1−/−;Wnt8b−/− double mutants of either sex and found that the morphology of the optic cup and stalk and the closure of the optic fissure were substantially rescued in these embryos. This rescue correlates with restored Pax2 expression in the anterior tip of the optic fissure. In addition, although we do not find evidence implicating altered proliferation in the rescue, we observe a significant increase in apoptotic cell density in Foxg1−/−;Wnt8b−/− double mutants compared with the Foxg1−/− single mutant. Upregulation of Wnt/β-catenin target molecules in the optic cup and stalk may underlie the molecular and morphological defects in the Foxg1−/− mutant. Our results show that proper optic fissure closure relies on Wnt8b suppression by Foxg1 in the nasal optic stalk to maintain balanced apoptosis and Pax2 expression in the nasal and temporal edges of the fissure. SIGNIFICANCE STATEMENT Coloboma is an ocular disorder that may result in a loss of visual acuity and accounts for ∼10% of childhood blindness. It results from errors in the sealing of the optic fissure (OF), a transient structure at the bottom of the eye. Here, we investigate the colobomatous phenotype of the Foxg1−/− mutant mouse. We identify upregulated expression of Wnt8b in the optic stalk of Foxg1−/− mutants before OF closure initiates. Foxg1−/−;Wnt8b−/− double mutants show a substantial rescue of the Foxg1−/− coloboma phenotype, which correlates with a rescue in molecular and cellular defects of Foxg1−/− mutants. Our results unravel a new role of Foxg1 in promoting OF closure providing additional knowledge about the molecules and cellular mechanisms underlying coloboma formation. PMID:28729440

  3. A Phex Mutation in a Murine Model of X-linked Hypophosphatemia Alters Phosphate Responsiveness of Bone Cells

    PubMed Central

    Ichikawa, Shoji; Austin, Anthony M.; Gray, Amie K.; Econs, Michael J.

    2011-01-01

    Mutations in the PHEX gene cause X-linked hypophosphatemia (XLH). Hypophosphatemia in XLH results from increased circulating levels of a phosphaturic hormone, fibroblast growth factor 23 (FGF23), which inhibits renal phosphate reabsorption and 1,25-dihydroxyvitamin D (calcitriol) synthesis. The current standard therapy for XLH – high dose phosphate and calcitriol – further increases FGF23 concentrations, suggesting that patients with XLH may have an altered response to extracellular phosphate. To test for the presence of abnormal phosphate responsiveness, we compared serum biochemistries and femoral Fgf23 mRNA expression between wild-type mice, murine models of XLH (PhexK496X) and hyperphosphatemic tumoral calcinosis (Galnt3 -/-), and Galnt3/Phex double mutant mice. Phex mutant mice had not only increased Fgf23 expression, but also reduced proteolytic cleavage of intact Fgf23 protein, resulting in markedly elevated intact Fgf23 levels and consequent hypophosphatemia. In contrast, despite markedly increased Fgf23 expression, Galnt3 knockout mice had significantly high proteolytic cleavage of Fgf23 protein, leading to low intact Fgf23 concentrations and hyperphosphatemia. Galnt3/Phex double mutant mice had an intermediate biochemical phenotype between wild-type and Phex mutant mice, including slightly elevated intact Fgf23 concentrations with milder hypophosphatemia. Despite the hypophosphatemia, double mutant mice attempted to reduce serum phosphate back to the level of Phex mutant mice by up-regulating Fgf23 expression as much as 24 fold higher than Phex mutant mice. These data suggest that Phex mutations alter the responsiveness of bone cells to extracellular phosphate concentrations and may create a lower set point for “normal” phosphate levels. PMID:22006791

  4. A Phex mutation in a murine model of X-linked hypophosphatemia alters phosphate responsiveness of bone cells.

    PubMed

    Ichikawa, Shoji; Austin, Anthony M; Gray, Amie K; Econs, Michael J

    2012-02-01

    Mutations in the PHEX gene cause X-linked hypophosphatemia (XLH). Hypophosphatemia in XLH results from increased circulating levels of a phosphaturic hormone, fibroblast growth factor 23 (FGF23), which inhibits renal phosphate reabsorption and 1,25-dihydroxyvitamin D (calcitriol) synthesis. The current standard therapy for XLH--high-dose phosphate and calcitriol--further increases FGF23 concentrations, suggesting that patients with XLH may have an altered response to extracellular phosphate. To test for the presence of abnormal phosphate responsiveness, we compared serum biochemistries and femoral Fgf23 mRNA expression between wild-type mice, murine models of XLH (Phex(K496X)) and hyperphosphatemic tumoral calcinosis (Galnt3(-/-)), and Galnt3/Phex double-mutant mice. Phex mutant mice had not only increased Fgf23 expression but also reduced proteolytic cleavage of intact Fgf23 protein, resulting in markedly elevated intact Fgf23 levels and consequent hypophosphatemia. In contrast, despite markedly increased Fgf23 expression, Galnt3 knockout mice had significantly high proteolytic cleavage of Fgf23 protein, leading to low intact Fgf23 concentrations and hyperphosphatemia. Galnt3/Phex double-mutant mice had an intermediate biochemical phenotype between wild-type and Phex mutant mice, including slightly elevated intact Fgf23 concentrations with milder hypophosphatemia. Despite the hypophosphatemia, double-mutant mice attempted to reduce serum phosphate back to the level of Phex mutant mice by upregulating Fgf23 expression as much as 24-fold higher than Phex mutant mice. These data suggest that Phex mutations alter the responsiveness of bone cells to extracellular phosphate concentrations and may create a lower set point for "normal" phosphate levels.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu Xiaohong; Zhang Shuhui; Lin Jing

    The role of the hepatitis B virus X protein (HBx) in hepatocarcinogenesis remains controversial. To investigate the biological impact of hepatitis B virus x gene (HBx) mutation on hepatoma cells, plasmids expressing the full-length HBx or HBx deletion mutants were constructed. The biological activities in these transfectants were analyzed by a series of assays. Results showed that HBx3'-20 and HBx3'-40 amino acid deletion mutants exhibited an increase in cellular proliferation, focus formation, tumorigenicity, and invasive growth and metastasis through promotion of the cell cycle from G0/G1 to the S phase, when compared with the full-length HBx. In contrast, HBx3'-30 aminomore » acid deletion mutant repressed cell proliferation by blocking in G1 phase. The expression of P53, p21{sup WAF1}, p14{sup ARF}, and MDM2 proteins was regulated by expression of HBx mutants. In conclusions, HBx variants showed different effects and functions on cell proliferation and invasion by regulation of the cell cycle progression and its associated proteins expression.« less

  6. Lon Protease of Azorhizobium caulinodans ORS571 Is Required for Suppression of reb Gene Expression

    PubMed Central

    Nakajima, Azusa; Tsukada, Shuhei; Siarot, Lowela; Ogawa, Tetsuhiro; Oyaizu, Hiroshi

    2012-01-01

    Bacterial Lon proteases play important roles in a variety of biological processes in addition to housekeeping functions. In this study, we focused on the Lon protease of Azorhizobium caulinodans, which can fix nitrogen both during free-living growth and in stem nodules of the legume Sesbania rostrata. The nitrogen fixation activity of an A. caulinodans lon mutant in the free-living state was not significantly different from that of the wild-type strain. However, the stem nodules formed by the lon mutant showed little or no nitrogen fixation activity. By microscopic analyses, two kinds of host cells were observed in the stem nodules formed by the lon mutant. One type has shrunken host cells containing a high density of bacteria, and the other type has oval or elongated host cells containing a low density or no bacteria. This phenotype is similar to a praR mutant highly expressing the reb genes. Quantitative reverse transcription-PCR analyses revealed that reb genes were also highly expressed in the lon mutant. Furthermore, a lon reb double mutant formed stem nodules showing higher nitrogen fixation activity than the lon mutant, and shrunken host cells were not observed in these stem nodules. These results suggest that Lon protease is required to suppress the expression of the reb genes and that high expression of reb genes in part causes aberrance in the A. caulinodans-S. rostrata symbiosis. In addition to the suppression of reb genes, it was found that Lon protease was involved in the regulation of exopolysaccharide production and autoagglutination of bacterial cells. PMID:22752172

  7. Low-energy N-ion beam biotechnology application in the induction of Thai jasmine rice mutant with improved seed storability

    NASA Astrophysics Data System (ADS)

    Semsang, Nuananong; Techarang, Jiranat; Yu, Liangdeng; Phanchaisri, Boonrak

    2018-06-01

    Low-energy heavy-ion beam is a novel biotechnology used for mutation induction in plants. We used a low-energy N-ion beam to induce mutations in Thai jasmine rice (Oryza sativa L. cv. KDML 105) to improve the yield and seed quality. Seeds of BKOS6, a Thai jasmine rice mutant previously induced by ion beams, were re-bombarded with 60-kV-accelerated N-ions (N++N2+) to fluences of 1-2 × 1016 ions/cm2. The resulting mutant, named HyKOS21, exhibited photoperiod insensitivity, semi-dwarfness, and high yield potential. Seed storability of the mutant was studied in natural and accelerated ageing conditions and compared to that of KDML 105 and six other Thai rice varieties. In both testing conditions, HyKOS21 mutant had the highest seed storability among the tested varieties. After storage in the natural condition for 18 months, HyKOS21 had a seed germination percentage nearly two times as that of the original KDML 105. Biochemical analysis showed that the lipid peroxidation level of the mutant seeds was the lowest among those of the tested varieties. Furthermore, an expression analysis of genes encoding lipoxygenase isoenzyme (lox1, lox2, and lox3) revealed that the mutant lacked expression of lox1 and lox2 and expressed only lox3 in seeds. These results may explain the improved seed longevity of the mutant after storage. This work provides further evidence of the modification of biological materials using a low-energy ion beam to produce rice mutants with improved yield and seed storability. The benefits of this technology, to create new varieties with improved values, could serve for local economic development.

  8. Methylation of Gibberellins by Arabidopsis GAMT1 and GAMT2[W

    PubMed Central

    Varbanova, Marina; Yamaguchi, Shinjiro; Yang, Yue; McKelvey, Katherine; Hanada, Atsushi; Borochov, Roy; Yu, Fei; Jikumaru, Yusuke; Ross, Jeannine; Cortes, Diego; Ma, Choong Je; Noel, Joseph P.; Mander, Lew; Shulaev, Vladimir; Kamiya, Yuji; Rodermel, Steve; Weiss, David; Pichersky, Eran

    2007-01-01

    Arabidopsis thaliana GAMT1 and GAMT2 encode enzymes that catalyze formation of the methyl esters of gibberellins (GAs). Ectopic expression of GAMT1 or GAMT2 in Arabidopsis, tobacco (Nicotiana tabacum), and petunia (Petunia hybrida) resulted in plants with GA deficiency and typical GA deficiency phenotypes, such as dwarfism and reduced fertility. GAMT1 and GAMT2 are both expressed mainly in whole siliques (including seeds), with peak transcript levels from the middle until the end of silique development. Within whole siliques, GAMT2 was previously shown to be expressed mostly in developing seeds, and we show here that GAMT1 expression is also localized mostly to seed, suggesting a role in seed development. Siliques of null single GAMT1 and GAMT2 mutants accumulated high levels of various GAs, with particularly high levels of GA1 in the double mutant. Methylated GAs were not detected in wild-type siliques, suggesting that methylation of GAs by GAMT1 and GAMT2 serves to deactivate GAs and initiate their degradation as the seeds mature. Seeds of homozygous GAMT1 and GAMT2 null mutants showed reduced inhibition of germination, compared with the wild type, when placed on plates containing the GA biosynthesis inhibitor ancymidol, with the double mutant showing the least inhibition. These results suggest that the mature mutant seeds contained higher levels of active GAs than wild-type seeds. PMID:17220201

  9. Mutant calreticulin-expressing cells induce monocyte hyperreactivity through a paracrine mechanism

    PubMed Central

    Garbati, Michael R.; Welgan, Catherine A.; Landefeld, Sally H.; Newell, Laura F.; Agarwal, Anupriya; Dunlap, Jennifer B.; Chourasia, Tapan K.; Lee, Hyunjung; Elferich, Johannes; Traer, Elie; Rattray, Rogan; Cascio, Michael J.; Press, Richard D.; Bagby, Grover C.; Tyner, Jeffrey W.; Druker, Brian J.; Dao, Kim-Hien T.

    2016-01-01

    Mutations in the calreticulin gene (CALR) were recently identified in approximately 70–80% of patients with JAK2-V617F-negative essential thrombocytosis and primary myelofibrosis. All frameshift mutations generate a recurring novel C-terminus. Here we provide evidence that mutant calreticulin does not accumulate efficiently in cells and is abnormally enriched in the nucleus and extracellular space compared to wildtype calreticulin. The main determinant of these findings is the loss of the calcium-binding and KDEL domains. Expression of type I mutant CALR in Ba/F3 cells confers minimal IL-3-independent growth. Interestingly, expression of type I and type II mutant CALR in a non-hematopoietic cell line does not directly activate JAK/STAT signaling compared to JAK2-V617F expression. These results led us to investigate paracrine mechanisms of JAK/STAT activation. Here we show that conditioned media from cells expressing type I mutant CALR exaggerate cytokine production from normal monocytes with or without treatment with a toll-like receptor agonist. These effects are not dependent on the novel C-terminus. These studies offer novel insights into the mechanism of JAK/STAT activation in patients with JAK2-V617F-negative essential thrombocytosis and primary myelofibrosis. PMID:26573090

  10. VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.

    PubMed

    Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G

    1993-04-01

    Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.

  11. Temperature-responsive genetic loci in the plant pathogen Pseudomonas syringae pv. glycinea.

    PubMed

    Ullrich, M S; Schergaut, M; Boch, J; Ullrich, B

    2000-10-01

    Plant-pathogenic bacteria may sense variations in environmental factors, such as temperature, to adapt to plant-associated habitats during pathogenesis or epiphytic growth. The bacterial blight pathogen of soybean, Pseudomonas syringae pv. glycinea PG4180, preferentially produces the phytotoxin coronatine at 18 degrees C and infects the host plant under conditions of low temperature and high humidity. A miniTn5-based promoterless glucuronidase (uidA) reporter gene was used to identify genetic loci of PG4180 preferentially expressed at 18 or 28 degrees C. Out of 7500 transposon mutants, 61 showed thermoregulated uidA expression as determined by a three-step screening procedure. Two-thirds of these mutants showed an increased reporter gene expression at 18 degrees C whilst the remainder exhibited higher uidA expression at 28 degrees C. MiniTn5-uidA insertion loci from these mutants were subcloned and their nucleotide sequences were determined. Several of the mutants induced at 18 degrees C contained the miniTn5-uidA insertion within the 32.8 kb coronatine biosynthetic gene cluster. Among the other mutants with increased uidA expression at 18 degrees C, insertions were found in genes encoding formaldehyde dehydrogenase, short-chain dehydrogenase and mannuronan C-5-epimerase, in a plasmid-borne replication protein, and in the hrpT locus, involved in pathogenicity of P. syringae. Among the mutants induced at 28 degrees C, insertions disrupted loci with similarities to a repressor of conjugal plasmid transfer, UV resistance determinants, an isoflavanoid-degrading enzyme, a HU-like DNA-binding protein, two additional regulatory proteins, a homologue of bacterial adhesins, transport proteins, LPS synthesis enzymes and two proteases. Genetic loci from 13 mutants did not show significant similarities to any database entries. Results of plant inoculations showed that three of the mutants tested were inhibited in symptom development and in planta multiplication rates. Temperature-shift experiments suggested that all of the identified loci showed a rather slow induction of expression upon change of temperature.

  12. AmyR Is a Novel Negative Regulator of Amylovoran Production in Erwinia amylovora

    PubMed Central

    Wang, Dongping; Korban, Schuyler S.; Pusey, P. Lawrence; Zhao, Youfu

    2012-01-01

    In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora. PMID:23028751

  13. AmyR is a novel negative regulator of amylovoran production in Erwinia amylovora.

    PubMed

    Wang, Dongping; Korban, Schuyler S; Pusey, P Lawrence; Zhao, Youfu

    2012-01-01

    In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora.

  14. Identification of endogenous inducers of the mal regulon in Escherichia coli.

    PubMed Central

    Ehrmann, M; Boos, W

    1987-01-01

    The expression of the maltose regulon in Escherichia coli is induced when maltose or maltodextrins are present in the growth medium. Mutations in malK, which codes for a component of the transport system, result in the elevated expression of the remaining mal genes. Uninduced expression in the wild type, as well as elevated expression in malK mutants, is strongly repressed at high osmolarity. In the absence of malQ-encoded amylomaltase, expression remains high at high osmolarity. We found that uninduced expression in the wild type and elevated expression in malK mutants were paralleled by the appearance of two types of endogenous carbohydrates. One, produced primarily at high osmolarity, was identified as comprising maltodextrins that are derived from glycogen or glycogen-synthesizing enzymes. The other, produced primarily at low osmolarity, consisted of an oligosaccharide that was not derived from glycogen. We isolated a mutant that no longer synthesized this oligosaccharide. The gene carrying this mutation, termed malI, was mapped at min 36 on the E. coli linkage map. A Tn10 insertion in malI also resulted in the loss of constitutivity at low osmolarity and delayed the induction of the maltose regulon by exogenous inducers. Images PMID:3038842

  15. Two-Pore Channels: Lessons from Mutant Mouse Models

    PubMed Central

    Ruas, Margarida; Galione, Antony; Parrington, John

    2016-01-01

    Recent interest in two-pore channels (TPCs) has resulted in a variety of studies dealing with the functional role and mechanism of action of these endo-lysosomal proteins in diverse physiological processes. With the availability of mouse lines harbouring mutant alleles for Tpcnl and/or Tpcn2 genes, several studies have made use of them to validate, consolidate and discover new roles for these channels not only at the cellular level but, importantly, also at the level of the whole organism. The different mutant mouse lines that have been used were derived from distinct genetic manipulation strategies, with the aim of knocking out expression of TPC proteins. However, the expression of different residual TPC sequences predicted to occur in these mutant mouse lines, together with the varied degree to which the effects on Tpcn expression have been studied, makes it important to assess the true knockout status of some of the lines. In this review we summarize these Tpcn mutant mouse lines with regard to their predicted effect on Tpcn expression and the extent to which they have been characterized. Additionally, we discuss how results derived from studies using these Tpcn mutant mouse lines have consolidated previously proposed roles for TPCs, such as mediators of NAADP signalling, endo-lysosomal functions, and pancreatic β cell physiology. We will also review how they have been instrumental in the assignment of new physiological roles for these cation channels in processes such as membrane electrical excitability, neoangiogenesis, viral infection and brown adipose tissue and heart function, revealing, in some cases, a specific contribution of a particular TPC isoform. PMID:27330869

  16. Nuclear Photosynthetic Gene Expression Is Synergistically Modulated by Rates of Protein Synthesis in Chloroplasts and Mitochondria[W

    PubMed Central

    Pesaresi, Paolo; Masiero, Simona; Eubel, Holger; Braun, Hans-Peter; Bhushan, Shashi; Glaser, Elzbieta; Salamini, Francesco; Leister, Dario

    2006-01-01

    Arabidopsis thaliana mutants prors1-1 and -2 were identified on the basis of a decrease in effective photosystem II quantum yield. Mutations were localized to the 5′-untranslated region of the nuclear gene PROLYL-tRNA SYNTHETASE1 (PRORS1), which acts in both plastids and mitochondria. In prors1-1 and -2, PRORS1 expression is reduced, along with protein synthesis in both organelles. PRORS1 null alleles (prors1-3 and -4) result in embryo sac and embryo development arrest. In mutants with the leaky prors1-1 and -2 alleles, transcription of nuclear genes for proteins involved in photosynthetic light reactions is downregulated, whereas genes for other chloroplast proteins are upregulated. Downregulation of nuclear photosynthetic genes is not associated with a marked increase in the level of reactive oxygen species in leaves and persists in the dark, suggesting that the transcriptional response is light and photooxidative stress independent. The mrpl11 and prpl11 mutants are impaired in the mitochondrial and plastid ribosomal L11 proteins, respectively. The prpl11 mrpl11 double mutant, but neither of the single mutants, resulted in strong downregulation of nuclear photosynthetic genes, like that seen in leaky mutants for PRORS1, implying that, when organellar translation is perturbed, signals derived from both types of organelles cooperate in the regulation of nuclear photosynthetic gene expression. PMID:16517761

  17. First somatic mutation of E2F1 in a critical DNA binding residue discovered in well-differentiated papillary mesothelioma of the peritoneum

    PubMed Central

    2011-01-01

    Background Well differentiated papillary mesothelioma of the peritoneum (WDPMP) is a rare variant of epithelial mesothelioma of low malignancy potential, usually found in women with no history of asbestos exposure. In this study, we perform the first exome sequencing of WDPMP. Results WDPMP exome sequencing reveals the first somatic mutation of E2F1, R166H, to be identified in human cancer. The location is in the evolutionarily conserved DNA binding domain and computationally predicted to be mutated in the critical contact point between E2F1 and its DNA target. We show that the R166H mutation abrogates E2F1's DNA binding ability and is associated with reduced activation of E2F1 downstream target genes. Mutant E2F1 proteins are also observed in higher quantities when compared with wild-type E2F1 protein levels and the mutant protein's resistance to degradation was found to be the cause of its accumulation within mutant over-expressing cells. Cells over-expressing wild-type E2F1 show decreased proliferation compared to mutant over-expressing cells, but cell proliferation rates of mutant over-expressing cells were comparable to cells over-expressing the empty vector. Conclusions The R166H mutation in E2F1 is shown to have a deleterious effect on its DNA binding ability as well as increasing its stability and subsequent accumulation in R166H mutant cells. Based on the results, two compatible theories can be formed: R166H mutation appears to allow for protein over-expression while minimizing the apoptotic consequence and the R166H mutation may behave similarly to SV40 large T antigen, inhibiting tumor suppressive functions of retinoblastoma protein 1. PMID:21955916

  18. Gibberellin regulates pollen viability and pollen tube growth in rice.

    PubMed

    Chhun, Tory; Aya, Koichiro; Asano, Kenji; Yamamoto, Eiji; Morinaka, Yoichi; Watanabe, Masao; Kitano, Hidemi; Ashikari, Motoyuki; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako

    2007-12-01

    Gibberellins (GAs) play many biological roles in higher plants. We collected and performed genetic analysis on rice (Oryza sativa) GA-related mutants, including GA-deficient and GA-insensitive mutants. Genetic analysis of the mutants revealed that rice GA-deficient mutations are not transmitted as Mendelian traits to the next generation following self-pollination of F1 heterozygous plants, although GA-insensitive mutations are transmitted normally. To understand these differences in transmission, we examined the effect of GA on microsporogenesis and pollen tube elongation in rice using new GA-deficient and GA-insensitive mutants that produce semifertile flowers. Phenotypic analysis revealed that the GA-deficient mutant reduced pollen elongation1 is defective in pollen tube elongation, resulting in a low fertilization frequency, whereas the GA-insensitive semidominant mutant Slr1-d3 is mainly defective in viable pollen production. Quantitative RT-PCR revealed that GA biosynthesis genes tested whose mutations are transmitted to the next generation at a lower frequency are preferentially expressed after meiosis during pollen development, but expression is absent or very low before the meiosis stage, whereas GA signal-related genes are actively expressed before meiosis. Based on these observations, we predict that the transmission of GA-signaling genes occurs in a sporophytic manner, since the protein products and/or mRNA transcripts of these genes may be introduced into pollen-carrying mutant alleles, whereas GA synthesis genes are transmitted in a gametophytic manner, since these genes are preferentially expressed after meiosis.

  19. Comparative Study on Different Expression Hosts for Alkaline Phytase Engineered in Escherichia coli.

    PubMed

    Chen, Weiwei; Yu, Hongwei; Ye, Lidan

    2016-07-01

    The application of alkaline phytase as a feed additive is restricted by the poor specific activity. Escherichia coli is a frequently used host for directed evolution of proteins including alkaline phytase towards improved activity. However, it is not suitable for production of food-grade products due to potential pathogenicity. To combine the advantages of different expression systems, mutants of the alkaline phytase originated from Bacillus subtilis 168 (phy168) were first generated via directed evolution in E. coli and then transformed to food-grade hosts B. subtilis and Pichia pastoris for secretory expression. In order to investigate the suitability of different expression systems, the phy168 mutants expressed in different hosts were characterized and compared in terms of specific activity, pH profile, pH stability, temperature profile, and thermostability. The specific activity of B. subtilis-expressed D24G/K70R/K111E/N121S mutant at pH 7.0 and 60 °C was 30.4 U/mg, obviously higher than those in P. pastoris (22.7 U/mg) and E. coli (19.7 U/mg). Moreover, after 10 min incubation at 80 °C, the B. subtilis-expressed D24G/K70R/K111E/N121S retained about 70 % of the activity at pH 7.0 and 37 °C, whereas the values were only about 25 and 50 % when expressed in P. pastoris and E. coli, respectively. These results suggested B. subtilis as an appropriate host for expression of phy168 mutants and that the strategy of creating mutants in one host and expressing them in another might be a new solution to industrial production of proteins with desired properties.

  20. Arabidopsis shaker pollen inward K+ channel SPIK functions in SnRK1 complex-regulated pollen hydration on the stigma.

    PubMed

    Li, Dan-Dan; Guan, Huan; Li, Fei; Liu, Chang-Zhen; Dong, Yu-Xiu; Zhang, Xian-Sheng; Gao, Xin-Qi

    2017-09-01

    Pollen hydration is a critical step that determines pollen germination on the stigma. KINβγ is a plant-specific subunit of the SNF1-related protein kinase 1 complex (SnRK1 complex). In pollen of the Arabidopsis kinβγ mutant, the levels of reactive oxygen species were decreased which lead to compromised hydration of the mutant pollen on the stigma. In this study, we analyzed gene expression in kinβγ mutant pollen by RNA-seq and found the expression of inward shaker K + channel SPIK was down-regulated in the kinβγ pollen. Furthermore, we showed that the pollen hydration of the Arabidopsis spik mutant was defective on the wild-type stigma, although the mutant pollen demonstrated normal hydration in vitro. Additionally, the defective hydration of spik mutant pollen could not be rescued by the wild-type pollen on the stigma, indicating that the spik mutation deprived the capability of pollen absorption on the stigma. Our results suggest that the Arabidopsis SnRK1 complex regulates SPIK expression, which functions in determining pollen hydration on the stigma. © 2017 Institute of Botany, Chinese Academy of Sciences.

  1. Role of PII proteins in nitrogen fixation control of Herbaspirillum seropedicae strain SmR1

    PubMed Central

    2011-01-01

    Background The PII protein family comprises homotrimeric proteins which act as transducers of the cellular nitrogen and carbon status in prokaryotes and plants. In Herbaspirillum seropedicae, two PII-like proteins (GlnB and GlnK), encoded by the genes glnB and glnK, were identified. The glnB gene is monocistronic and its expression is constitutive, while glnK is located in the nlmAglnKamtB operon and is expressed under nitrogen-limiting conditions. Results In order to determine the involvement of the H. seropedicae glnB and glnK gene products in nitrogen fixation, a series of mutant strains were constructed and characterized. The glnK- mutants were deficient in nitrogen fixation and they were complemented by plasmids expressing the GlnK protein or an N-truncated form of NifA. The nitrogenase post-translational control by ammonium was studied and the results showed that the glnK mutant is partially defective in nitrogenase inactivation upon addition of ammonium while the glnB mutant has a wild-type phenotype. Conclusions Our results indicate that GlnK is mainly responsible for NifA activity regulation and ammonium-dependent post-translational regulation of nitrogenase in H. seropedicae. PMID:21223584

  2. Study the Expression of marA Gene in Ciprofloxacin and Tetracycline Resistant Mutants of Esherichia coli

    PubMed Central

    Pourahmad Jaktaji, Razieh; Ebadi, Rayhaneh

    2013-01-01

    MarA activates two membrane dependent mechanisms of resistance to different antibiotics, such as ciprofloxacin and tetracycline, including promotion of outflux and inhibition of influx of antibiotics. Thus, MarA causes multiple antibiotic resistance phenotype. The activation of these mechanisms needs overexpression of marA. This could happen through mutation in marR. Thus, the aim of this study was to measure marA expression in ciprofloxacin resistant E. coli gyrA mutants and clones with or without marR mutation. For this purpose, real time PCR was used to measure relative expression of marA in above mutants and clones. Results showed that two clones, C14 and C17 overexpressed marA. It is concluded that the level of marA expression is important for activation of above mechanisms. PMID:24523773

  3. Study the Expression of marA Gene in Ciprofloxacin and Tetracycline Resistant Mutants of Esherichia coli.

    PubMed

    Pourahmad Jaktaji, Razieh; Ebadi, Rayhaneh

    2013-01-01

    MarA activates two membrane dependent mechanisms of resistance to different antibiotics, such as ciprofloxacin and tetracycline, including promotion of outflux and inhibition of influx of antibiotics. Thus, MarA causes multiple antibiotic resistance phenotype. The activation of these mechanisms needs overexpression of marA. This could happen through mutation in marR. Thus, the aim of this study was to measure marA expression in ciprofloxacin resistant E. coli gyrA mutants and clones with or without marR mutation. For this purpose, real time PCR was used to measure relative expression of marA in above mutants and clones. Results showed that two clones, C14 and C17 overexpressed marA. It is concluded that the level of marA expression is important for activation of above mechanisms.

  4. Outgrowth of Rice Tillers Requires Availability of Glutamine in the Basal Portions of Shoots.

    PubMed

    Ohashi, Miwa; Ishiyama, Keiki; Kojima, Soichi; Konishi, Noriyuki; Sasaki, Kazuhiro; Miyao, Mitsue; Hayakawa, Toshihiko; Yamaya, Tomoyuki

    2018-05-09

    Our previous studies concluded that metabolic disorder in the basal portions of rice shoots caused by a lack of cytosolic glutamine synthetase1;2 (GS1;2) resulted in a severe reduction in the outgrowth of tillers. Rice mutants lacking GS1;2 (gs1;2 mutants) showed a remarkable reduction in the contents of both glutamine and asparagine in the basal portions of shoots. In the current study, we attempted to reveal the mechanisms for this decrease in asparagine content using rice mutants lacking either GS1;2 or asparagine synthetase 1 (AS1). The contributions of the availability of glutamine and asparagine to the outgrowth of rice tillers were investigated. Rice has two AS genes, and the enzymes catalyse asparagine synthesis from glutamine. In the basal portions of rice shoots, expression of OsAS1, the major species in this tissue, was reduced in gs1;2 mutants, whereas OsAS2 expression was relatively constant. OsAS1 was expressed in phloem companion cells of the nodal vascular anastomoses connected to the axillary bud vasculatures in the basal portions of wild-type shoots, whereas cell-specific expression was markedly reduced in gs1;2 mutants. OsAS1 was up-regulated significantly by NH 4 + supply in the wild type but not in gs1;2 mutants. When GS reactions were inhibited by methionine sulfoximine, OsAS1 was up-regulated by glutamine but not by NH 4 + . The rice mutants lacking AS1 (as1 mutants) showed a decrease in asparagine content in the basal portions of shoots. However, glutamine content and tiller number were less affected by the lack of AS1. These results indicate that in phloem companion cells of the nodal vascular anastomoses, asparagine synthesis is largely dependent on glutamine or its related metabolite-responsive AS1. Thus, the decrease in glutamine content caused by a lack of GS1;2 is suggested to result in low expression of OsAS1, decreasing asparagine content. However, the availability of asparagine generated from AS1 reactions is apparently less effective for the outgrowth of tillers. With respect to the tiller number and the contents of glutamine and asparagine in gs1;2 and as1 mutants, the availability of glutamine rather than asparagine in basal portions of rice shoots may be required for the outgrowth of rice tillers.

  5. A proof of the DBRF-MEGN method, an algorithm for deducing minimum equivalent gene networks

    PubMed Central

    2011-01-01

    Background We previously developed the DBRF-MEGN (difference-based regulation finding-minimum equivalent gene network) method, which deduces the most parsimonious signed directed graphs (SDGs) consistent with expression profiles of single-gene deletion mutants. However, until the present study, we have not presented the details of the method's algorithm or a proof of the algorithm. Results We describe in detail the algorithm of the DBRF-MEGN method and prove that the algorithm deduces all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. Conclusions The DBRF-MEGN method provides all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. PMID:21699737

  6. Efficacy of BET bromodomain inhibition in Kras-mutant non-small cell lung cancer

    PubMed Central

    Shimamura, Takeshi; Chen, Zhao; Soucheray, Margaret; Carretero, Julian; Kikuchi, Eiki; Tchaicha, Jeremy H.; Gao, Yandi; Cheng, Katherine A.; Cohoon, Travis J.; Qi, Jun; Akbay, Esra; Kimmelman, Alec C.; Kung, Andrew L.; Bradner, James E.; Wong, Kwok-Kin

    2013-01-01

    Purpose Amplification of MYC is one of the most common genetic alterations in lung cancer, contributing to a myriad of phenotypes associated with growth, invasion and drug resistance. Murine genetics has established both the centrality of somatic alterations of Kras in lung cancer, as well as the dependency of mutant Kras tumors on MYC function. Unfortunately, drug-like small-molecule inhibitors of KRAS and MYC have yet to be realized. The recent discovery, in hematologic malignancies, that BET bromodomain inhibition impairs MYC expression and MYC transcriptional function established the rationale of targeting KRAS-driven NSCLC with BET inhibition. Experimental Design We performed functional assays to evaluate the effects of JQ1 in genetically defined NSCLC cells lines harboring KRAS and/or LKB1 mutations. Furthermore, we evaluated JQ1 in transgenic mouse lung cancer models expressing mutant kras or concurrent mutant kras and lkb1. Effects of bromodomain inhibition on transcriptional pathways were explored and validated by expression analysis. Results While JQ1 is broadly active in NSCLC cells, activity of JQ1 in mutant KRAS NSCLC is abrogated by concurrent alteration or genetic knock-down of LKB1. In sensitive NSCLC models, JQ1 treatment results in the coordinate downregulation of the MYC-dependent transcriptional program. We found that JQ1 treatment produces significant tumor regression in mutant kras mice. As predicted, tumors from mutant kras and lkb1 mice did not respond to JQ1. Conclusion Bromodomain inhibition comprises a promising therapeutic strategy for KRAS mutant NSCLC with wild-type LKB1, via inhibition of MYC function. Clinical studies of BET bromodomain inhibitors in aggressive NSCLC will be actively pursued. PMID:24045185

  7. Characterization and proteomic analysis of the Pseudomonas sp. HK-6 xenB knockout mutant under RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) stress.

    PubMed

    Lee, Bheong-Uk; Choi, Moon-Seop; Oh, Kye-Heon

    2015-01-01

    Pseudomonas sp. HK-6 is able to utilize RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) as its sole nitrogen source. The role of the xenB gene, encoding xenobiotic reductase B, was investigated using HK-6 xenB knockout mutants. The xenB mutant degraded RDX to a level that was 10-fold less than that obtained with the wild-type HK-6 strain. After 60 days of culture with 25 or 50 μM RDX, no residual RDX was detected in the supernatants of the wild-type aerobically grown cultures, whereas approximately 90 % of the RDX remained in the xenB mutant cultures. The xenB mutant bacteria exhibited a 10(2)-10(4)-fold decrease in survival rate compared to the wild-type. The expression of DnaK and GroEL proteins, two typical stress shock proteins (SSPs), in the xenB mutant increased after immediate exposure to RDX, yet dramatically decreased after 4 h of exposure. In addition, DnaK and GroEL were more highly expressed in the cultures with 25 μM RDX in the medium but showed low expression in the cultures with 50 or 75 μM RDX. The expression levels of the dnaK and groEL genes measured by RT-qPCR were also much lower in the xenB genetic background. Analyses of the proteomes of the HK-6 and xenB mutant cells grown under conditions of RDX stress showed increased induction of several proteins, such as Alg8, alginate biosynthesis sensor histidine kinase, and OprH in the xenB mutants when compared to wild-type. However, many proteins, including two SSPs (DnaK and GroEL) and proteins involved in metabolism, exhibited lower expression levels in the xenB mutant than in the wild-type HK-6 strain. The xenB knockout mutation leads to reduced RDX degradation ability, which renders the mutant more sensitive to RDX stress and results in a lower survival rate and an altered proteomic profile under RDX stress.

  8. Lovastatin synergizes with itraconazole against planktonic cells and biofilms of Candida albicans through the regulation on ergosterol biosynthesis pathway.

    PubMed

    Zhou, Yujie; Yang, Hong; Zhou, Xuedong; Luo, Hongke; Tang, Fan; Yang, Jin; Alterovitz, Gil; Cheng, Lei; Ren, Biao

    2018-06-01

    The increase of fungal infectious diseases and lack of safe and efficacious antifungal drugs result in the urgent need of new therapeutic strategies. Here, we repurposed the lovastatin (LOV) as a synergistic antifungal potentiator to itraconazole (ITZ) against Candida albicans planktonic cells and biofilms in vitro for the first time. Mutants from ergosterol biosynthesis pathway were employed and key gene expression profiles of ergosterol pathway were also measured. LOV single treatment was unable to inhibit C. albicans strains except the ERG3 and ERG11 double mutant. LOV and ITZ combination was capable of inhibiting the C. albicans planktonic cells and biofilms synergistically including the ITZ resistant mutants. The synergistic antifungal ability was stronger in either ERG11 or ERG3 dysfunctional mutants compared to wild type. The combination lost the synergistic activities in the ERG11 and ERG3 double mutant, while it was sensitive to LOV single treatment. The expression of HMG1, encoding HMG-CoA the target of LOV, was significantly upregulated in ERG11 and ERG3 double mutant strain by the treatment of the combination at 1.5 and 3 h. The combination also significantly increased the HMG1 expression in mutants from ergosterol pathway compared with wild type. The ERG11 and ERG3 gene expressions were upregulated by ITZ and its combination with LOV, but seemingly not by LOV single treatment after 1.5 and 3 h. The combination of LOV and ITZ on C. albicans planktonic cells and biofilms highlights its potential clinical practice especially against the azole drug-resistant mutants.

  9. Mutant number distribution in an exponentially growing population

    NASA Astrophysics Data System (ADS)

    Keller, Peter; Antal, Tibor

    2015-01-01

    We present an explicit solution to a classic model of cell-population growth introduced by Luria and Delbrück (1943 Genetics 28 491-511) 70 years ago to study the emergence of mutations in bacterial populations. In this model a wild-type population is assumed to grow exponentially in a deterministic fashion. Proportional to the wild-type population size, mutants arrive randomly and initiate new sub-populations of mutants that grow stochastically according to a supercritical birth and death process. We give an exact expression for the generating function of the total number of mutants at a given wild-type population size. We present a simple expression for the probability of finding no mutants, and a recursion formula for the probability of finding a given number of mutants. In the ‘large population-small mutation’ limit we recover recent results of Kessler and Levine (2014 J. Stat. Phys. doi:10.1007/s10955-014-1143-3) for a fully stochastic version of the process.

  10. Overexpression of OsSAP16 Regulates Photosynthesis and the Expression of a Broad Range of Stress Response Genes in Rice (Oryza sativa L.).

    PubMed

    Wang, Fei; Coe, Robert A; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul

    2016-01-01

    This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes.

  11. Overexpression of OsSAP16 Regulates Photosynthesis and the Expression of a Broad Range of Stress Response Genes in Rice (Oryza sativa L.)

    PubMed Central

    Wang, Fei; Coe, Robert A.; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul

    2016-01-01

    This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes. PMID:27303811

  12. PiggyBac Transposon-Mediated Mutagenesis in Rats Reveals a Crucial Role of Bbx in Growth and Male Fertility1

    PubMed Central

    Wang, Chieh-Ying; Tang, Ming-Chu; Chang, Wen-Chi; Furushima, Kenryo; Jang, Chuan-Wei; Behringer, Richard R; Chen, Chun-Ming

    2016-01-01

    Bobby sox homolog (Bbx) is an evolutionally conserved gene, but its biological function remains elusive. Here, we characterized defects of Bbx mutant rats that were created by PiggyBac-mediated insertional mutagenesis. Smaller body size and male infertility were the two major phenotypes of homozygous Bbx mutants. Bbx expression profile analysis showed that Bbx was more highly expressed in the testis and pituitary gland than in other organs. Histology and hormonal gene expression analysis of control and Bbx-null pituitary glands showed that loss of Bbx appeared to be dispensable for pituitary histogenesis and the expression of major hormones. BBX was localized in the nuclei of postmeiotic spermatids and Sertoli cells in wild-type testes, but absent in mutant testes. An increased presence of aberrant multinuclear giant cells and apoptotic cells was observed in mutant seminiferous tubules. TUNEL-positive cells costained with CREM (round spermatid marker), but not PLZF (spermatogonia marker), gammaH2Ax (meiotic spermatocyte marker), or GATA4 (Sertoli cell marker). Finally, there were drastically reduced numbers and motility of epididymal sperm from Bbx-null rats. These results suggest that loss of BBX induces apoptosis of postmeiotic spermatids and results in spermiogenesis defects and infertility. PMID:27465138

  13. Expression of acrA and acrB Genes in Esherichia coli Mutants with or without marR or acrR Mutations

    PubMed Central

    Pourahmad Jaktaji, Razieh; Jazayeri, Nasim

    2013-01-01

    Objective(s): The major antibiotic efflux pump of Esherichia coli is AcrAB-TolC. The first part of the pump, AcrAB, is encoded by acrAB operon. The expression of this operon can be kept elevated by overexpression of an activator, MarA following inactivation of MarR and AcrR repressors due to mutation in encoding genes, marR and acrR, respectively. The aims of this research were to use E. coli mutants with or without mutation in marR to search for the presence of possible mutation in acrR and to quantify the expression of acrAB. Materials and Methods: The DNA binding region of acrR gene in these mutants were amplified by PCR and sequenced. The relative expression of acrA and acrB were determined by real time PCR. Results: Results showed that W26 and C14 had the same mutation in acrR, but none of the mutants overexpressed acrA and acrB in comparison with wild type strain. Conclusions: The effect of marR or acrR mutation on acrAB overexpression is dependent on levels of resistance to tetracycline and ciprofloxacin. PMID:24570831

  14. Molecular and immunohistochemical analyses of cardiac troponin T during cardiac development in the Mexican axolotl, Ambystoma mexicanum.

    PubMed

    Zhang, C; Pietras, K M; Sferrazza, G F; Jia, P; Athauda, G; Rueda-de-Leon, E; Rveda-de-Leon, E; Maier, J A; Dube, D K; Lemanski, S L; Lemanski, L F

    2007-01-01

    The Mexican axolotl, Ambystoma mexicanum, is an excellent animal model for studying heart development because it carries a naturally occurring recessive genetic mutation, designated gene c, for cardiac nonfunction. The double recessive mutants (c/c) fail to form organized myofibrils in the cardiac myoblasts resulting in hearts that fail to beat. Tropomyosin expression patterns have been studied in detail and show dramatically decreased expression in the hearts of homozygous mutant embryos. Because of the direct interaction between tropomyosin and troponin T (TnT), and the crucial functions of TnT in the regulation of striated muscle contraction, we have expanded our studies on this animal model to characterize the expression of the TnT gene in cardiac muscle throughout normal axolotl development as well as in mutant axolotls. In addition, we have succeeded in cloning the full-length cardiac troponin T (cTnT) cDNA from axolotl hearts. Confocal microscopy has shown a substantial, but reduced, expression of TnT protein in the mutant hearts when compared to normal during embryonic development. 2006 Wiley-Liss, Inc.

  15. Rice PLASTOCHRON genes regulate leaf maturation downstream of the gibberellin signal transduction pathway.

    PubMed

    Mimura, Manaki; Nagato, Yasuo; Itoh, Jun-Ichi

    2012-05-01

    Rice PLASTOCHRON 1 (PLA1) and PLA2 genes regulate leaf maturation and plastochron, and their loss-of-function mutants exhibit small organs and rapid leaf emergence. They encode a cytochrome P450 protein CYP78A11 and an RNA-binding protein, respectively. Their homologs in Arabidopsis and maize are also associated with plant development/organ size. Despite the importance of PLA genes in plant development, their molecular functions remain unknown. Here, we investigated how PLA1 and PLA2 genes are related to phytohormones. We found that gibberellin (GA) is the major phytohormone that promotes PLA1 and PLA2 expression. GA induced PLA1 and PLA2 expression, and conversely the GA-inhibitor uniconazole suppressed PLA1 and PLA2 expression. In pla1-4 and pla2-1 seedlings, expression levels of GA biosynthesis genes and the signal transduction gene were similar to those in wild-type seedlings. GA treatment slightly down-regulated the GA biosynthesis gene GA20ox2 and up-regulated the GA-catabolizing gene GA2ox4, whereas the GA biosynthesis inhibitor uniconazole up-regulated GA20ox2 and down-regulated GA2ox4 both in wild-type and pla mutants, suggesting that the GA feedback mechanism is not impaired in pla1 and pla2. To reveal how GA signal transduction affects the expression of PLA1 and PLA2, PLA expression in GA-signaling mutants was examined. In GA-insensitive mutant, gid1 and less-sensitive mutant, Slr1-d1, PLA1 and PLA2 expression was down-regulated. On the other hand, the expression levels of PLA1 and PLA2 were highly enhanced in a GA-constitutive-active mutant, slr1-1, causing ectopic overexpression. These results indicate that both PLA1 and PLA2 act downstream of the GA signal transduction pathway to regulate leaf development.

  16. Mutation in Torenia fournieri Lind. UFO homolog confers loss of TfLFY interaction and results in a petal to sepal transformation.

    PubMed

    Sasaki, Katsutomo; Yamaguchi, Hiroyasu; Aida, Ryutaro; Shikata, Masahito; Abe, Tomoko; Ohtsubo, Norihiro

    2012-09-01

    We identified a Torenia fournieri Lind. mutant (no. 252) that exhibited a sepaloid phenotype in which the second whorls were changed to sepal-like organs. This mutant had no stamens, and the floral organs consisted of sepals and carpels. Although the expression of a torenia class B MADS-box gene, GLOBOSA (TfGLO), was abolished in the 252 mutant, no mutation of TfGLO was found. Among torenia homologs such as APETALA1 (AP1), LEAFY (LFY), and UNUSUAL FLORAL ORGANS (UFO), which regulate expression of class B genes in Arabidopsis, only accumulation of the TfUFO transcript was diminished in the 252 mutant. Furthermore, a missense mutation was found in the coding region of the mutant TfUFO. Intact TfUFO complemented the mutant phenotype whereas mutated TfUFO did not; in addition, the transgenic phenotype of TfUFO-knockdown torenias coincided with the mutant phenotype. Yeast two-hybrid analysis revealed that the mutated TfUFO lost its ability to interact with TfLFY protein. In situ hybridization analysis indicated that the transcripts of TfUFO and TfLFY were partially accumulated in the same region. These results clearly demonstrate that the defect in TfUFO caused the sepaloid phenotype in the 252 mutant due to the loss of interaction with TfLFY. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  17. The Mechanism of Starch Over-Accumulation in Chlamydomonas reinhardtii High-Starch Mutants Identified by Comparative Transcriptome Analysis

    PubMed Central

    Koo, Kwang M.; Jung, Sera; Lee, Beom S.; Kim, Jin-Baek; Jo, Yeong D.; Choi, Hong-Il; Kang, Si-Yong; Chung, Gook-H.; Jeong, Won-Joong; Ahn, Joon-Woo

    2017-01-01

    The focus of this study was the mechanism of starch accumulation in Chlamydomonas reinhardtii high-starch mutants. Three C. reinhardtii mutants showing high-starch content were generated using gamma irradiation. When grown under nitrogen-deficient conditions, these mutants had more than twice as much starch than a wild-type control. The mechanism of starch over-accumulation in these mutants was studied with comparative transcriptome analysis. In all mutants, induction of phosphoglucomutase 1 (PGM1) expression was detected; PGM1 catalyzes the inter-conversion of glucose 1-phosphate and glucose 6-phosphate in both starch biosynthetic and glycolytic pathway. Interestingly, transcript levels of phosphoglucose isomerase 1 (PGI1), fructose 1,6-bisphosphate aldolase 1 and 2 (FBA1 and FBA2) were down-regulated in all mutants; PGI1, FBA1, and FBA2 act on downstream of glucose 6-phosphate conversion in glycolytic pathway. Therefore, down-regulations of PGI1, FBA1, and FBA2 may lead to accumulation of upstream metabolites, notably glucose 6-phosphate, resulting in induction of PGM1 expression through feed-forward regulation and that PGM1 overexpression caused starch over-accumulation in mutants. These results suggest that PGI1, FBA1, FBA2, and PGM1 correlate with each other in terms of coordinated transcriptional regulation and play central roles for starch over-accumulation in C. reinhardtii. PMID:28588557

  18. Rescue of protein expression defects may not be enough to abolish the pro-arrhythmic phenotype of long QT type 2 mutations.

    PubMed

    Perry, Matthew D; Ng, Chai Ann; Phan, Kevin; David, Erikka; Steer, Kieran; Hunter, Mark J; Mann, Stefan A; Imtiaz, Mohammad; Hill, Adam P; Ke, Ying; Vandenberg, Jamie I

    2016-07-15

    Most missense long QT syndrome type 2 (LQTS2) mutations result in Kv11.1 channels that show reduced levels of membrane expression. Pharmacological chaperones that rescue mutant channel expression could have therapeutic potential to reduce the risk of LQTS2-associated arrhythmias and sudden cardiac death, but only if the mutant Kv11.1 channels function normally (i.e. like WT channels) after membrane expression is restored. Fewer than half of mutant channels exhibit relatively normal function after rescue by low temperature. The remaining rescued missense mutant Kv11.1 channels have perturbed gating and/or ion selectivity characteristics. Co-expression of WT subunits with gating defective missense mutations ameliorates but does not eliminate the functional abnormalities observed for most mutant channels. For patients with mutations that affect gating in addition to expression, it may be necessary to use a combination therapy to restore both normal function and normal expression of the channel protein. In the heart, Kv11.1 channels pass the rapid delayed rectifier current (IKr ) which plays critical roles in repolarization of the cardiac action potential and in the suppression of arrhythmias caused by premature stimuli. Over 500 inherited mutations in Kv11.1 are known to cause long QT syndrome type 2 (LQTS2), a cardiac electrical disorder associated with an increased risk of life threatening arrhythmias. Most missense mutations in Kv11.1 reduce the amount of channel protein expressed at the membrane and, as a consequence, there has been considerable interest in developing pharmacological agents to rescue the expression of these channels. However, pharmacological chaperones will only have clinical utility if the mutant Kv11.1 channels function normally after membrane expression is restored. The aim of this study was to characterize the gating phenotype for a subset of LQTS2 mutations to assess what proportion of mutations may be suitable for rescue. As an initial screen we used reduced temperature to rescue expression defects of mutant channels expressed in Xenopus laevis oocytes. Over half (∼56%) of Kv11.1 mutants exhibited functional gating defects that either dramatically reduced the amount of current contributing to cardiac action potential repolarization and/or reduced the amount of protective current elicited in response to premature depolarizations. Our data demonstrate that if pharmacological rescue of protein expression defects is going to have clinical utility in the treatment of LQTS2 then it will be important to assess the gating phenotype of LQTS2 mutations before attempting rescue. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

  19. Gli function is essential for motor neuron induction in zebrafish.

    PubMed

    Vanderlaan, Gary; Tyurina, Oksana V; Karlstrom, Rolf O; Chandrasekhar, Anand

    2005-06-15

    The Gli family of zinc-finger transcription factors mediates Hedgehog (Hh) signaling in all vertebrates. However, their roles in ventral neural tube patterning, in particular motor neuron induction, appear to have diverged across species. For instance, cranial motor neurons are essentially lost in zebrafish detour (gli1(-)) mutants, whereas motor neuron development is unaffected in mouse single gli and some double gli knockouts. Interestingly, the expression of some Hh-regulated genes (ptc1, net1a, gli1) is mostly unaffected in the detour mutant hindbrain, suggesting that other Gli transcriptional activators may be involved. To better define the roles of the zebrafish gli genes in motor neuron induction and in Hh-regulated gene expression, we examined these processes in you-too (yot) mutants, which encode dominant repressor forms of Gli2 (Gli2(DR)), and following morpholino-mediated knockdown of gli1, gli2, and gli3 function. Motor neuron induction at all axial levels was reduced in yot (gli2(DR)) mutant embryos. In addition, Hh target gene expression at all axial levels except in rhombomere 4 was also reduced, suggesting an interference with the function of other Glis. Indeed, morpholino-mediated knockdown of Gli2(DR) protein in yot mutants led to a suppression of the defective motor neuron phenotype. However, gli2 knockdown in wild-type embryos generated no discernable motor neuron phenotype, while gli3 knockdown reduced motor neuron induction in the hindbrain and spinal cord. Significantly, gli2 or gli3 knockdown in detour (gli1(-)) mutants revealed roles for Gli2 and Gli3 activator functions in ptc1 expression and spinal motor neuron induction. Similarly, gli1 or gli3 knockdown in yot (gli2(DR)) mutants resulted in severe or complete loss of motor neurons, and of ptc1 and net1a expression, in the hindbrain and spinal cord. In addition, gli1 expression was greatly reduced in yot mutants following gli3, but not gli1, knockdown, suggesting that Gli3 activator function is specifically required for gli1 expression. These observations demonstrate that Gli activator function (encoded by gli1, gli2, and gli3) is essential for motor neuron induction and Hh-regulated gene expression in zebrafish.

  20. Altered Expression of Retinal Molecular Markers in the Canine RPE65 Model of Leber Congenital Amaurosis

    PubMed Central

    Hernández, Maria; Pearce-Kelling, Susan E.; Rodriguez, F. David; Aguirre, Gustavo D.; Vecino, Elena

    2010-01-01

    Purpose. Leber congenital amaurosis (LCA) is a group of childhood-onset retinal diseases characterized by severe visual impairment or blindness. One form is caused by mutations in the RPE65 gene, which encodes the retinal pigment epithelium (RPE) isomerase. In this study, the retinal structure and expression of molecular markers for different retinal cell types were characterized, and differences between control and RPE65 mutant dogs during the temporal evolution of the disease were analyzed. Methods. Retinas from normal and mutant dogs of different ages were examined by immunofluorescence with a panel of 16 different antibodies. Results. Cones and rods were preserved in the mutant retinas, and the number of cones was normal. However, there was altered expression of cone arrestin and delocalization of rod opsin. The ON bipolar cells showed sprouting of the dendritic arbors toward the outer nuclear layer (ONL) and retraction of their axons in the inner nuclear layer (INL). A decreased expression of GABA, and an increased expression of intermediate filament glial markers was also found in the mutant retinas. These changes were more evident in the adult than the young mutant retinas. Conclusions. The structure of the retina is well preserved in the mutant retina, but several molecular changes take place in photoreceptors and in bipolar and amacrine cells. Some of these changes are structural, whereas others reflect a change in localization of the examined proteins. This study provides new information that can be applied to the interpretation of outcomes of retinal gene therapy in animal models and humans. PMID:20671290

  1. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells.

    PubMed

    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

    2016-01-01

    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future.

  2. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells

    PubMed Central

    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

    2016-01-01

    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future. PMID:27362942

  3. The C. elegans ceh-36 gene encodes a putative homemodomain transcription factor involved in chemosensory functions of ASE and AWC neurons.

    PubMed

    Koga, Makoto; Ohshima, Yasumi

    2004-02-20

    Chemotaxis to water-soluble chemicals such as sodium ion is an important behavior of Caenorhabditis elegans for seeking food, and ASE chemosensory neurons have a major role in this behavior. We isolated mutants defective in chemotaxis to sodium acetate. We show here that among them ks86 had a mutation in the ceh-36 gene. ceh-36 :: gfp reporter constructs were expressed in ASE and AWC neurons. In a mutant of the che-1 gene, which encodes another transcription factor and is required for specification of ASE neurons, expression of the ceh-36 :: gfp reporter in ASE is lost. This indicates that the ceh-36 gene functions downstream of the che-1 gene in ASE. In the ceh-36(ks86) mutant, expression of the tax-2 gene encoding a cyclic nucleotide-gated channel was reduced in ASE and AWC. This affords an explanation for defects of the ceh-36 mutant in the chemotaxis mediated by ASE and AWC. When a ceh-36 cDNA was expressed in an adult ceh-36 mutant by a heat shock promoter, chemotaxis to sodium acetate was recovered. These results suggest that ceh-36 is required for functions, and not for development, of ASE.

  4. An analysis of microvessel density, androgen receptor, p53 and HER-2/neu expression and Gleason score in prostate cancer . preliminary results and therapeutic implications.

    PubMed

    Mydlo, J H; Kral, J G; Volpe, M; Axotis, C; Macchia, R J; Pertschuk, L P

    1998-01-01

    To investigate relationships between microvessel density (MVD), androgen receptors (AR), mutant p53 and HER-2/neu expression and Gleason score (GS) to further understand the tumor biology of prostate cancer (CAP). Slides of CAP from patients who underwent radical prostatectomy or channel transurethral resection of the prostate (TURP) were tested for androgen receptors by immunocytochemical assay and MVD was analyzed by staining with antibodies to the endothelial cell membrane molecule PECAM-1/CD-31. The p53 monoclonal antibody D07 and HER-2 9G6 mouse monoclonal antibody were used to assess p53 and HER-2/neu expression, respectively. The results were correlated with GS and clinical stage by multivariate analysis. We found a fourfold greater expression of MVD in prostate cancer specimens compared to neighboring normal prostate tissue. We observed a greater concentration of MVD in the higher Gleason scores (r = 0.40, p = 0. 06), and a correlation of Gleason score with mutant p53 expression (r = 0.57, p <0.05). We did not observe any associations between AR or HER-2/neu to Gleason score. More than half of the patients with specimens with 50% or greater expression of mutant p53 were in stage D2 (T4NxM1b) at the time of biopsy. We observed a correlation between mutant p53 and GS, and a greater concentration of MVD in the higher GS. Since the neovascularity of prostate tumors can be attenuated by radiation and hormones, while mutant p53 may confer resistance to such treatment, it appears that p53 expression may also play an important role in addition to angiogenesis in the virulence of prostate cancer. These data may aid in allocating patients to different treatment modalities.

  5. Mimicking the BIM BH3 domain overcomes resistance to EGFR tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer

    PubMed Central

    Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui

    2017-01-01

    Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo, erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity. PMID:29312548

  6. Mimicking the BIM BH3 domain overcomes resistance to EGFR tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer.

    PubMed

    Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui

    2017-12-12

    Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo , erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity.

  7. Leptin gene promoter DNA methylation in WNIN obese mutant rats

    PubMed Central

    2014-01-01

    Background Obesity has become an epidemic in worldwide population. Leptin gene defect could be one of the causes for obesity. Two mutant obese rats WNIN/Ob and WNIN/GROb, isolated at National Centre for Laboratory Animal Sciences (NCLAS), Hyderabad, India, were found to be leptin resistant. The present study aims to understand the regulatory mechanisms underlying the resistance by promoter DNA methylation of leptin gene in these mutant obese rats. Methods Male obese mutant homozygous, carrier and heterozygous rats of WNIN/Ob and WNIN/GROb strain of 6 months old were studied to check the leptin gene expression (RT-PCR) and promoter DNA methylation (MassARRAY Compact system, SEQUENOM) of leptin gene by invivo and insilico approach. Results Homozygous WNIN/Ob and WNIN/GROb showed significantly higher leptin gene expression compared to carrier and lean counterparts. Leptin gene promoter DNA sequence region was analyzed ranging from transcription start site (TSS) to-550 bp length and found four CpGs in this sequence among them only three CpG loci (-309, -481, -502) were methylated in these WNIN mutant rat phenotypes. Conclusion The increased percentage of methylation in WNIN mutant lean and carrier phenotypes is positively correlated with transcription levels. Thus genetic variation may have effect on methylation percentages and subsequently on the regulation of leptin gene expression which may lead to obesity in these obese mutant rat strains. PMID:24495350

  8. Modulation of mutant Huntingtin aggregates and toxicity by human myeloid leukemia factors.

    PubMed

    Banerjee, Manisha; Datta, Moumita; Bhattacharyya, Nitai P

    2017-01-01

    Increased poly glutamine (polyQ) stretch at N-terminal of Huntingtin (HTT) causes Huntington's disease. HTT interacts with large number of proteins, although the preference for such interactions with wild type or mutated HTT protein remains largely unknown. HYPK, an intrinsically unstructured protein chaperone and interactor of mutant HTT was found to interact with myeloid leukemia factor 1 (MLF1) and 2 (MLF2). To identify the role of these two proteins in mutant HTT mediated aggregate formation and toxicity in a cell model, both the proteins were found to preferentially interact with the mutated N-terminal HTT. They significantly reduced the number of cells containing mutant HTT aggregates and subsequent apoptosis in Neuro2A cells. Additionally, in FRAP assay, mobile fraction of mutant HTT aggregates was increased in the presence of MLF1 or MLF2. Further, MLF1 could release transcription factors like p53, CBP and CREB from mutant HTT aggregates. Moreover, in HeLa cell co-expressing mutant HTT exon1 and full length MLF1, p53 was released from the aggregates, leading to the recovery of the expression of the GADD45A transcript, a p53 regulated gene. Taking together, these results showed that MLF1 and MLF2 modulated the formation of aggregates and induction of apoptosis as well as the expressions of genes indirectly. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Phosphorodiamidate morpholino oligomers suppress mutant huntingtin expression and attenuate neurotoxicity

    PubMed Central

    Sun, Xin; Marque, Leonard O.; Cordner, Zachary; Pruitt, Jennifer L.; Bhat, Manik; Li, Pan P.; Kannan, Geetha; Ladenheim, Ellen E.; Moran, Timothy H.; Margolis, Russell L.; Rudnicki, Dobrila D.

    2014-01-01

    Huntington's disease (HD) is a neurodegenerative disorder caused by a CAG trinucleotide repeat expansion in the huntingtin (HTT) gene. Disease pathogenesis derives, at least in part, from the long polyglutamine tract encoded by mutant HTT. Therefore, considerable effort has been dedicated to the development of therapeutic strategies that significantly reduce the expression of the mutant HTT protein. Antisense oligonucleotides (ASOs) targeted to the CAG repeat region of HTT transcripts have been of particular interest due to their potential capacity to discriminate between normal and mutant HTT transcripts. Here, we focus on phosphorodiamidate morpholino oligomers (PMOs), ASOs that are especially stable, highly soluble and non-toxic. We designed three PMOs to selectively target expanded CAG repeat tracts (CTG22, CTG25 and CTG28), and two PMOs to selectively target sequences flanking the HTT CAG repeat (HTTex1a and HTTex1b). In HD patient–derived fibroblasts with expanded alleles containing 44, 77 or 109 CAG repeats, HTTex1a and HTTex1b were effective in suppressing the expression of mutant and non-mutant transcripts. CTGn PMOs also suppressed HTT expression, with the extent of suppression and the specificity for mutant transcripts dependent on the length of the targeted CAG repeat and on the CTG repeat length and concentration of the PMO. PMO CTG25 reduced HTT-induced cytotoxicity in vitro and suppressed mutant HTT expression in vivo in the N171-82Q transgenic mouse model. Finally, CTG28 reduced mutant HTT expression and improved the phenotype of HdhQ7/Q150 knock-in HD mice. These data demonstrate the potential of PMOs as an approach to suppressing the expression of mutant HTT. PMID:25035419

  10. Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume.

    PubMed

    Grassini, Daniela R; Lagendijk, Anne K; De Angelis, Jessica E; Da Silva, Jason; Jeanes, Angela; Zettler, Nicole; Bower, Neil I; Hogan, Benjamin M; Smith, Kelly A

    2018-05-11

    Atrial natriuretic peptide ( nppa/anf ) and brain natriuretic peptide ( nppb/bnp ) form a gene cluster with expression in the chambers of the developing heart. Despite restricted expression, a function in cardiac development has not been demonstrated by mutant analysis. This is attributed to functional redundancy however their genomic location in cis has impeded formal analysis. Using genome-editing, we generated mutants for nppa and nppb and found single mutants indistinguishable from wildtype whereas nppa / nppb double mutants display heart morphogenesis defects and pericardial oedema. Analysis of atrioventricular canal (AVC) markers show expansion of bmp4 , tbx2b, has2 and versican expression into the atrium of double mutants. This expanded expression correlates with increased extracellular matrix in the atrium. Using a biosensor for Hyaluronic acid to measure the cardiac jelly (cardiac extracellular matrix), we confirm cardiac jelly expansion in nppa / nppb double mutants. Finally, bmp4 knockdown rescues the expansion of has2 expression and cardiac jelly in double mutants. This definitively shows that nppa and nppb function redundantly during cardiac development to restrict gene expression to the AVC, preventing excessive cardiac jelly synthesis in the atrial chamber. © 2018. Published by The Company of Biologists Ltd.

  11. Individual Substitution Mutations in the AID C Terminus That Ablate IgH Class Switch Recombination

    PubMed Central

    Kadungure, Tatenda; Ucher, Anna J.; Linehan, Erin K.; Schrader, Carol E.; Stavnezer, Janet

    2015-01-01

    Activation-induced cytidine deaminase (AID) is essential for class switch recombination (CSR) and somatic hypermutation (SHM) of Ig genes. The C terminus of AID is required for CSR but not for SHM, but the reason for this is not entirely clear. By retroviral transduction of mutant AID proteins into aid -/- mouse splenic B cells, we show that 4 amino acids within the C terminus of mouse AID, when individually mutated to specific amino acids (R190K, A192K, L196S, F198S), reduce CSR about as much or more than deletion of the entire C terminal 10 amino acids. Similar to ΔAID, the substitutions reduce binding of UNG to Ig Sμ regions and some reduce binding of Msh2, both of which are important for introducing S region DNA breaks. Junctions between the IgH donor switch (S)μ and acceptor Sα regions from cells expressing ΔAID or the L196S mutant show increased microhomology compared to junctions in cells expressing wild-type AID, consistent with problems during CSR and the use of alternative end-joining, rather than non-homologous end-joining (NHEJ). Unlike deletion of the AID C terminus, 3 of the substitution mutants reduce DNA double-strand breaks (DSBs) detected within the Sμ region in splenic B cells undergoing CSR. Cells expressing these 3 substitution mutants also have greatly reduced mutations within unrearranged Sμ regions, and they decrease with time after activation. These results might be explained by increased error-free repair, but as the C terminus has been shown to be important for recruitment of NHEJ proteins, this appears unlikely. We hypothesize that Sμ DNA breaks in cells expressing these C terminus substitution mutants are poorly repaired, resulting in destruction of Sμ segments that are deaminated by these mutants. This could explain why these mutants cannot undergo CSR. PMID:26267846

  12. Role of Arginine decarboxylase (ADC) in Arabidopsis thaliana defence against the pathogenic bacterium Pseudomonas viridiflava.

    PubMed

    Rossi, F R; Marina, M; Pieckenstain, F L

    2015-07-01

    Polyamine biosynthesis starts with putrescine production through the decarboxylation of arginine or ornithine. In Arabidopsis thaliana, putrescine is synthesised exclusively by arginine decarboxylase (ADC), which exists as two isoforms (ADC1 and 2) that are differentially regulated by abiotic stimuli, but their role in defence against pathogens has not been studied in depth. This work analysed the participation of ADC in Arabidopsis defence against Pseudomonas viridiflava. ADC activity and expression, polyamine levels and bacterial resistance were analysed in null mutants of each ADC isoform. In non-infected wild-type (WT) plants, ADC2 expression was much higher than ADC1. Analysis of adc mutants demonstrated that ADC2 contributes to a much higher extent than ADC1 to basal ADC activity and putrescine biosynthesis. In addition, adc2 mutants showed increased basal expression of salicylic acid- and jasmonic acid-dependent PR genes. Bacterial infection induced putrescine accumulation and ADC1 expression in WT plants, but pathogen-induced putrescine accumulation was blocked in adc1 mutants. Results suggest a specific participation of ADC1 in defence, although basal resistance was not decreased by dysfunction of either of the two ADC genes. In addition, and as opposed to WT plants, bacterial infection increased ADC2 expression and ADC activity in adc1 mutants, which could counterbalance the lack of ADC1. Results demonstrate a major contribution of ADC2 to total ADC activity and the specific induction of ADC1 in response to infection. A certain degree of functional redundancy between the two isoforms in relation to their contribution to basal resistance is also evident. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

  13. Characterization of an activation-tagged mutant uncovers a role of GLABRA2 in anthocyanin biosynthesis in Arabidopsis

    DOE PAGES

    Wang, Xiaoyu; Wang, Xianling; Hu, Qingnan; ...

    2015-06-17

    In Arabidopsis, anthocyanin biosynthesis is controlled by a MYB-bHLH-WD40 (MBW) transcriptional activator complex. The MBW complex activates the transcription of late biosynthesis genes in the flavonoid pathway, leading to the production of anthocyanins. A similar MBW complex regulates epidermal cell fate by activating the transcription of GLABRA2 (GL2), a homeodomain transcription factor required for trichome formation in shoots and non-hair cell formation in roots. Here we provide experimental evidence to show that GL2 also plays a role in regulating anthocyanin biosynthesis in Arabidopsis. From an activation-tagged mutagenized population of Arabidopsis plants, we isolated a dominant, gain-of-function mutant with reduced anthocyanins.more » Molecular cloning revealed that this phenotype is caused by an elevated expression of GL2, thus the mutant was named gl2-1D. Consistent with the view that GL2 acts as a negative regulator of anthocyanin biosynthesis, gl2-1D seedlings accumulated less whereas gl2-3 seedlings accumulated more anthocyanins in response to sucrose. Gene expression analysis indicated that expression of late, but not early, biosynthesis genes in the flavonoid pathway was dramatically reduced in gl2-1D but elevated in gl2-3 mutants. Further analysis showed that expression of some MBW component genes involved in the regulation of late biosynthesis genes was reduced in gl2-1D but elevated in gl2-3 mutants, and chromatin immunoprecipitation results indicated that some MBW component genes are targets of GL2. We also showed that GL2 functions as a transcriptional repressor. Altogether, these results indicate that GL2 negatively regulates anthocyanin biosynthesis in Arabidopsis by directly repressing the expression of some MBW component genes.« less

  14. Characterization of an activation-tagged mutant uncovers a role of GLABRA2 in anthocyanin biosynthesis in Arabidopsis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Xiaoyu; Wang, Xianling; Hu, Qingnan

    In Arabidopsis, anthocyanin biosynthesis is controlled by a MYB-bHLH-WD40 (MBW) transcriptional activator complex. The MBW complex activates the transcription of late biosynthesis genes in the flavonoid pathway, leading to the production of anthocyanins. A similar MBW complex regulates epidermal cell fate by activating the transcription of GLABRA2 (GL2), a homeodomain transcription factor required for trichome formation in shoots and non-hair cell formation in roots. Here we provide experimental evidence to show that GL2 also plays a role in regulating anthocyanin biosynthesis in Arabidopsis. From an activation-tagged mutagenized population of Arabidopsis plants, we isolated a dominant, gain-of-function mutant with reduced anthocyanins.more » Molecular cloning revealed that this phenotype is caused by an elevated expression of GL2, thus the mutant was named gl2-1D. Consistent with the view that GL2 acts as a negative regulator of anthocyanin biosynthesis, gl2-1D seedlings accumulated less whereas gl2-3 seedlings accumulated more anthocyanins in response to sucrose. Gene expression analysis indicated that expression of late, but not early, biosynthesis genes in the flavonoid pathway was dramatically reduced in gl2-1D but elevated in gl2-3 mutants. Further analysis showed that expression of some MBW component genes involved in the regulation of late biosynthesis genes was reduced in gl2-1D but elevated in gl2-3 mutants, and chromatin immunoprecipitation results indicated that some MBW component genes are targets of GL2. We also showed that GL2 functions as a transcriptional repressor. Altogether, these results indicate that GL2 negatively regulates anthocyanin biosynthesis in Arabidopsis by directly repressing the expression of some MBW component genes.« less

  15. Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

    PubMed

    Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

    2016-05-01

    Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

  16. The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

    PubMed Central

    Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

    2016-01-01

    The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

  17. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Wentao; Du, Bojing; Liu, Di

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerancemore » in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.« less

  18. The role played by the group A streptococcal negative regulator Nra on bacterial interactions with epithelial cells.

    PubMed

    Molinari, G; Rohde, M; Talay, S R; Chhatwal, G S; Beckert, S; Podbielski, A

    2001-04-01

    Group A streptococci (GAS) specifically attach to and internalize into human epithelial host cells. In some GAS isolates, fibronectin-binding proteins were identified as being responsible for these virulence traits. In the present study, the previously identified global negative regulator Nra was shown to control the binding of soluble fibronectin probably via regulation of protein F2 and/or SfbII expression in the serotype M49 strain 591. According to results from a conventional invasion assay based on the recovery of viable intracellular bacteria, the increased fibronectin binding did not affect bacterial adherence to HEp-2 epithelial cells, but was associated with a reduction in the internalization rates. However, when examined by confocal and electron microscopy techniques, the nra-mutant bacteria were shown to exhibit higher adherence and internalization rates than the corresponding wild type. The mutant bacteria escaped from the phagocytic vacuoles much faster, promoting consistent morphological changes which resulted in severe host cell damage. The apoptotic and lytic processes observed in nra-mutant infected host cells were correlated with an increased expression of the genes encoding superantigen SpeA, the cysteine protease SpeB, and streptolysin S in the nra-mutant bacteria. Adherence and internalization rates of a nra/speB-double mutant at wild-type levels indicated that the altered speB expression in the nra mutant contributed to the observed changes in both processes. The Nra-dependent effects on bacterial virulence were confined to infections carried out with stationary growth phase bacteria. In conclusion, the obtained results demonstrated that the global GAS regulator Nra modulates virulence genes, which are involved in host cell damage. Thus, by helping to achieve a critical balance of virulence factor expression that avoids the injury of target cells, Nra may facilitate GAS persistence in a safe intracellular niche.

  19. Phosphorylation on Ser-279 and Ser-282 of connexin43 regulates endocytosis and gap junction assembly in pancreatic cancer cells

    PubMed Central

    Johnson, Kristen E.; Mitra, Shalini; Katoch, Parul; Kelsey, Linda S.; Johnson, Keith R.; Mehta, Parmender P.

    2013-01-01

    The molecular mechanisms regulating the assembly of connexins (Cxs) into gap junctions are poorly understood. Using human pancreatic tumor cell lines BxPC3 and Capan-1, which express Cx26 and Cx43, we show that, upon arrival at the cell surface, the assembly of Cx43 is impaired. Connexin43 fails to assemble, because it is internalized by clathrin-mediated endocytosis. Assembly is restored upon expressing a sorting-motif mutant of Cx43, which does not interact with the AP2 complex, and by expressing mutants that cannot be phosphorylated on Ser-279 and Ser-282. The mutants restore assembly by preventing clathrin-mediated endocytosis of Cx43. Our results also document that the sorting-motif mutant is assembled into gap junctions in cells in which the expression of endogenous Cx43 has been knocked down. Remarkably, Cx43 mutants that cannot be phosphorylated on Ser-279 or Ser-282 are assembled into gap junctions only when connexons are composed of Cx43 forms that can be phosphorylated on these serines and forms in which phosphorylation on these serines is abolished. Based on the subcellular fate of Cx43 in single and contacting cells, our results document that the endocytic itinerary of Cx43 is altered upon cell–cell contact, which causes Cx43 to traffic by EEA1-negative endosomes en route to lysosomes. Our results further show that gap-junctional plaques formed of a sorting motif–deficient mutant of Cx43, which is unable to be internalized by the clathrin-mediated pathway, are predominantly endocytosed in the form of annular junctions. Thus the differential phosphorylation of Cx43 on Ser-279 and Ser-282 is fine-tuned to control Cx43’s endocytosis and assembly into gap junctions. PMID:23363606

  20. [Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

    PubMed

    Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

    2008-10-01

    To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

  1. Zebrafish Meis functions to stabilize Pbx proteins and regulate hindbrain patterning.

    PubMed

    Waskiewicz, A J; Rikhof, H A; Hernandez, R E; Moens, C B

    2001-11-01

    Homeodomain-containing Hox proteins regulate segmental identity in Drosophila in concert with two partners known as Extradenticle (Exd) and Homothorax (Hth). These partners are themselves DNA-binding, homeodomain proteins, and probably function by revealing the intrinsic specificity of Hox proteins. Vertebrate orthologs of Exd and Hth, known as Pbx and Meis (named for a myeloid ecotropic leukemia virus integration site), respectively, are encoded by multigene families and are present in multimeric complexes together with vertebrate Hox proteins. Previous results have demonstrated that the zygotically encoded Pbx4/Lazarus (Lzr) protein is required for segmentation of the zebrafish hindbrain and proper expression and function of Hox genes. We demonstrate that Meis functions in the same pathway as Pbx in zebrafish hindbrain development, as expression of a dominant-negative mutant Meis results in phenotypes that are remarkably similar to that of lzr mutants. Surprisingly, expression of Meis protein partially rescues the lzr(-) phenotype. Lzr protein levels are increased in embryos overexpressing Meis and are reduced for lzr mutants that cannot bind to Meis. This implies a mechanism whereby Meis rescues lzr mutants by stabilizing maternally encoded Lzr. Our results define two functions of Meis during zebrafish hindbrain segmentation: that of a DNA-binding partner of Pbx proteins, and that of a post-transcriptional regulator of Pbx protein levels.

  2. The failure to express a protein disulphide isomerase-like protein results in a floury endosperm and an endoplasmic reticulum stress response in rice.

    PubMed

    Han, Xiaohua; Wang, Yihua; Liu, Xi; Jiang, Ling; Ren, Yulong; Liu, Feng; Peng, Cheng; Li, Jingjing; Jin, Ximing; Wu, Fuqing; Wang, Jiulin; Guo, Xiuping; Zhang, Xin; Cheng, Zhijun; Wan, Jianmin

    2012-01-01

    The rice somaclonal mutant T3612 produces small grains with a floury endosperm, caused by the loose packing of starch granules. The positional cloning of the mutation revealed a deletion in a gene encoding a protein disulphide isomerase-like enzyme (PDIL1-1). In the wild type, PDIL1-1 was expressed throughout the plant, but most intensely in the developing grain. In T3612, its expression was abolished, resulting in a decrease in the activity of plastidial phosphorylase and pullulanase, and an increase in that of soluble starch synthase I and ADP-glucose pyrophosphorylase. The amylopectin in the T3612 endosperm showed an increase in chains with a degree of polymerization 8-13 compared with the wild type. The expression in the mutant's endosperm of certain endoplasmic reticulum stress-responsive genes was noticeably elevated. PDIL1-1 appears to play an important role in starch synthesis. Its absence is associated with endoplasmic reticulum stress in the endosperm, which is likely to underlie the formation of the floury endosperm in the T3612 mutant.

  3. A genetic screen for temperature-sensitive cell-division mutants of Caenorhabditis elegans.

    PubMed Central

    O'Connell, K F; Leys, C M; White, J G

    1998-01-01

    A novel screen to isolate conditional cell-division mutants in Caenorhabditis elegans has been developed. The screen is based on the phenotypes associated with existing cell-division mutations: some disrupt postembryonic divisions and affect formation of the gonad and ventral nerve cord-resulting in sterile, uncoordinated animals-while others affect embryonic divisions and result in lethality. We obtained 19 conditional mutants that displayed these phenotypes when shifted to the restrictive temperature at the appropriate developmental stage. Eighteen of these mutations have been mapped; 17 proved to be single alleles of newly identified genes, while 1 proved to be an allele of a previously identified gene. Genetic tests on the embryonic lethal phenotypes indicated that for 13 genes, embryogenesis required maternal expression, while for 6, zygotic expression could suffice. In all cases, maternal expression of wild-type activity was found to be largely sufficient for embryogenesis. Cytological analysis revealed that 10 mutants possessed embryonic cell-division defects, including failure to properly segregate DNA, failure to assemble a mitotic spindle, late cytokinesis defects, prolonged cell cycles, and improperly oriented mitotic spindles. We conclude that this approach can be used to identify mutations that affect various aspects of the cell-division cycle. PMID:9649522

  4. Role of PII proteins in nitrogen fixation control of Herbaspirillum seropedicae strain SmR1.

    PubMed

    Noindorf, Lilian; Bonatto, Ana C; Monteiro, Rose A; Souza, Emanuel M; Rigo, Liu U; Pedrosa, Fabio O; Steffens, Maria B R; Chubatsu, Leda S

    2011-01-11

    The PII protein family comprises homotrimeric proteins which act as transducers of the cellular nitrogen and carbon status in prokaryotes and plants. In Herbaspirillum seropedicae, two PII-like proteins (GlnB and GlnK), encoded by the genes glnB and glnK, were identified. The glnB gene is monocistronic and its expression is constitutive, while glnK is located in the nlmAglnKamtB operon and is expressed under nitrogen-limiting conditions. In order to determine the involvement of the H. seropedicae glnB and glnK gene products in nitrogen fixation, a series of mutant strains were constructed and characterized. The glnK- mutants were deficient in nitrogen fixation and they were complemented by plasmids expressing the GlnK protein or an N-truncated form of NifA. The nitrogenase post-translational control by ammonium was studied and the results showed that the glnK mutant is partially defective in nitrogenase inactivation upon addition of ammonium while the glnB mutant has a wild-type phenotype. Our results indicate that GlnK is mainly responsible for NifA activity regulation and ammonium-dependent post-translational regulation of nitrogenase in H. seropedicae.

  5. Host range and cell cycle activation properties of polyomavirus large T-antigen mutants defective in pRB binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Freund, R.; Bauer, P.H.; Benjamin, T.L.

    1994-11-01

    The authors have examined the growth properties of polyomavirus large T-antigen mutants that ar unable to bind pRB, the product of the retinoblastoma tumor suppressor gene. These mutants grow poorly on primary mouse cells yet grow well on NIH 3T3 and other established mouse cell lines. Preinfection of primary baby mouse kidney (BMK) epithelial cells with wild-type simian virus 40 renders these cells permissive to growth of pRB-binding polyomavirus mutants. Conversely, NIH 3T3 cells transfected by and expressing wild-type human pRB become nonpermissive. Primary fibroblasts for mouse embryos that carry a homozygous knockout of the RB gene are permissive, whilemore » those from normal littermates are nonpermissive. The host range of polyomavirus pRB-binding mutants is thus determined by expression or lack of expression of functional pRB by the host. These results demonstrate the importance of pRB binding by large T antigen for productive viral infection in primary cells. Failure of pRB-binding mutants to grow well in BMK cells correlates with their failure to induce progression from G{sub 0} or G{sub 1} through the S phase of the cell cycle. Time course studies show delayed synthesis and lower levels of accumulation of large T antigen, viral DNA, and VP1 in mutant compared with wild-type virus-infected BMK cells. These results support a model in which productive infection by polyomavirus in normal mouse cells is tightly coupled to the induction and progression of the cell cycle. 48 refs., 6 figs., 5 tabs.« less

  6. Phosphoglycerate Kinases Are Co-Regulated to Adjust Metabolism and to Optimize Growth.

    PubMed

    Rosa-Téllez, Sara; Anoman, Armand Djoro; Flores-Tornero, María; Toujani, Walid; Alseek, Saleh; Fernie, Alisdair R; Nebauer, Sergio G; Muñoz-Bertomeu, Jesús; Segura, Juan; Ros, Roc

    2018-02-01

    In plants, phosphoglycerate kinase (PGK) converts 1,3-bisphosphoglycerate into 3-phosphoglycerate in glycolysis but also participates in the reverse reaction in gluconeogenesis and the Calvin-Benson cycle. In the databases, we found three genes that encode putative PGKs. Arabidopsis ( Arabidopsis thaliana ) PGK1 was localized exclusively in the chloroplasts of photosynthetic tissues, while PGK2 was expressed in the chloroplast/plastid of photosynthetic and nonphotosynthetic cells. PGK3 was expressed ubiquitously in the cytosol of all studied cell types. Measurements of carbohydrate content and photosynthetic activities in PGK mutants and silenced lines corroborated that PGK1 was the photosynthetic isoform, while PGK2 and PGK3 were the plastidial and cytosolic glycolytic isoforms, respectively. The pgk1.1 knockdown mutant displayed reduced growth, lower photosynthetic capacity, and starch content. The pgk3.2 knockout mutant was characterized by reduced growth but higher starch levels than the wild type. The pgk1.1 pgk3.2 double mutant was bigger than pgk3.2 and displayed an intermediate phenotype between the two single mutants in all measured biochemical and physiological parameters. Expression studies in PGK mutants showed that PGK1 and PGK3 were down-regulated in pgk3.2 and pgk1.1 , respectively. These results indicate that the down-regulation of photosynthetic activity could be a plant strategy when glycolysis is impaired to achieve metabolic adjustment and optimize growth. The double mutants of PGK3 and the triose-phosphate transporter ( pgk3.2 tpt3) displayed a drastic growth phenotype, but they were viable. This implies that other enzymes or nonspecific chloroplast transporters could provide 3-phosphoglycerate to the cytosol. Our results highlight both the complexity and the plasticity of the plant primary metabolic network. © 2018 American Society of Plant Biologists. All Rights Reserved.

  7. Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit.

    PubMed

    Liu, Cheng-Qian; Hu, Kang-Di; Li, Ting-Ting; Yang, Ying; Yang, Feng; Li, Yan-Hong; Liu, He-Ping; Chen, Xiao-Yan; Zhang, Hua

    2017-01-01

    Aspergillus niger, a saprophytic fungus, is widely distributed in soil, air and cereals, and can cause postharvest diseases in fruit. Polygalacturonase (PG) is one of the main enzymes in fungal pathogens to degrade plant cell wall. To evaluate whether the deletion of an exo-polygalacturonase gene pgxB would influence fungal pathogenicity to fruit, pgxB gene was deleted in Aspergillus niger MA 70.15 (wild type) via homologous recombination. The ΔpgxB mutant showed similar growth behavior compared with the wild type. Pectin medium induced significant higher expression of all pectinase genes in both wild type and ΔpgxB in comparison to potato dextrose agar medium. However, the ΔpgxB mutant was less virulent on apple fruits as the necrosis diameter caused by ΔpgxB mutant was significantly smaller than that of wild type. Results of quantitive-PCR showed that, in the process of infection in apple fruit, gene expressions of polygalacturonase genes pgaI, pgaII, pgaA, pgaC, pgaD and pgaE were enhanced in ΔpgxB mutant in comparison to wild type. These results prove that, despite the increased gene expression of other polygalacturonase genes in ΔpgxB mutant, the lack of pgxB gene significantly reduced the virulence of A. niger on apple fruit, suggesting that pgxB plays an important role in the infection process on the apple fruit.

  8. New phenotypes generated by the G57R mutation of BUD23 in Saccharomyces cerevisiae.

    PubMed

    Lin, Jyun-Liang; Yu, Hui-Chia; Chao, Ju-Lan; Wang, Chung; Cheng, Ming-Yuan

    2012-12-01

    BUD23 in Saccharomyces cerevisiae encodes for a class I methyltransferase, and deletion of the gene results in slow growth and random budding phenotypes. Herein, two BUD23 mutants defective in methyltransferase activity were generated to investigate whether the phenotypes of the null mutant might be correlated with a loss in enzymatic activity. Expression at the physiological level of both D77A and G57R mutants was able to rescue the phenotypes of the bud23-null mutant. The result implied that the methyltransferase activity of the protein was not necessary for supporting normal growth and bud site selection of the cells. High-level expression of Bud23 (G57R), but not Bud23 or Bud23 (D77A), in BUD23 deletion cells failed to complement these phenotypes. However, just like Bud23, Bud23 (G57R) was localized in a DAPI-poor region in the nucleus. Distinct behaviour in Bud23 (G57R) could not be originated from a mislocalization of the protein. Over-expression of Bud23 (G57R) in null cells also produced changes in actin organization and additional septin mutant-like phenotypes. Therefore, the absence of Bud23, Bud23 (G57R) at a high level might affect the cell division of yeast cells through an as yet unidentified mechanism. Copyright © 2012 John Wiley & Sons, Ltd.

  9. Two Seven-Transmembrane Domain MILDEW RESISTANCE LOCUS O Proteins Cofunction in Arabidopsis Root Thigmomorphogenesis[C][W

    PubMed Central

    Chen, Zhongying; Noir, Sandra; Kwaaitaal, Mark; Hartmann, H. Andreas; Wu, Ming-Jing; Mudgil, Yashwanti; Sukumar, Poornima; Muday, Gloria; Panstruga, Ralph; Jones, Alan M.

    2009-01-01

    Directional root expansion is governed by nutrient gradients, positive gravitropism and hydrotropism, negative phototropism and thigmotropism, as well as endogenous oscillations in the growth trajectory (circumnutation). Null mutations in phylogenetically related Arabidopsis thaliana genes MILDEW RESISTANCE LOCUS O 4 (MLO4) and MLO11, encoding heptahelical, plasma membrane–localized proteins predominantly expressed in the root tip, result in aberrant root thigmomorphogenesis. mlo4 and mlo11 mutant plants show anisotropic, chiral root expansion manifesting as tightly curled root patterns upon contact with solid surfaces. The defect in mlo4 and mlo11 mutants is nonadditive and dependent on light and nutrients. Genetic epistasis experiments demonstrate that the mutant phenotype is independently modulated by the Gβ subunit of the heterotrimeric G-protein complex. Analysis of expressed chimeric MLO4/MLO2 proteins revealed that the C-terminal domain of MLO4 is necessary but not sufficient for MLO4 action in root thigmomorphogenesis. The expression of the auxin efflux carrier fusion, PIN1-green fluorescent protein, the pattern of auxin-induced gene expression, and acropetal as well as basipetal auxin transport are altered at the root tip of mlo4 mutant seedlings. Moreover, addition of auxin transport inhibitors or the loss of EIR1/AGR1/PIN2 function abolishes root curling of mlo4, mlo11, and wild-type seedlings. These results demonstrate that the exaggerated root curling phenotypes of the mlo4 and mlo11 mutants depend on auxin gradients and suggest that MLO4 and MLO11 cofunction as modulators of touch-induced root tropism. PMID:19602625

  10. Two seven-transmembrane domain MILDEW RESISTANCE LOCUS O proteins cofunction in Arabidopsis root thigmomorphogenesis.

    PubMed

    Chen, Zhongying; Noir, Sandra; Kwaaitaal, Mark; Hartmann, H Andreas; Wu, Ming-Jing; Mudgil, Yashwanti; Sukumar, Poornima; Muday, Gloria; Panstruga, Ralph; Jones, Alan M

    2009-07-01

    Directional root expansion is governed by nutrient gradients, positive gravitropism and hydrotropism, negative phototropism and thigmotropism, as well as endogenous oscillations in the growth trajectory (circumnutation). Null mutations in phylogenetically related Arabidopsis thaliana genes MILDEW RESISTANCE LOCUS O 4 (MLO4) and MLO11, encoding heptahelical, plasma membrane-localized proteins predominantly expressed in the root tip, result in aberrant root thigmomorphogenesis. mlo4 and mlo11 mutant plants show anisotropic, chiral root expansion manifesting as tightly curled root patterns upon contact with solid surfaces. The defect in mlo4 and mlo11 mutants is nonadditive and dependent on light and nutrients. Genetic epistasis experiments demonstrate that the mutant phenotype is independently modulated by the Gbeta subunit of the heterotrimeric G-protein complex. Analysis of expressed chimeric MLO4/MLO2 proteins revealed that the C-terminal domain of MLO4 is necessary but not sufficient for MLO4 action in root thigmomorphogenesis. The expression of the auxin efflux carrier fusion, PIN1-green fluorescent protein, the pattern of auxin-induced gene expression, and acropetal as well as basipetal auxin transport are altered at the root tip of mlo4 mutant seedlings. Moreover, addition of auxin transport inhibitors or the loss of EIR1/AGR1/PIN2 function abolishes root curling of mlo4, mlo11, and wild-type seedlings. These results demonstrate that the exaggerated root curling phenotypes of the mlo4 and mlo11 mutants depend on auxin gradients and suggest that MLO4 and MLO11 cofunction as modulators of touch-induced root tropism.

  11. The cleft lip and palate defects in Dancer mutant mice result from gain of function of the Tbx10 gene

    PubMed Central

    Bush, Jeffrey O.; Lan, Yu; Jiang, Rulang

    2004-01-01

    Cleft lip and palate (CL/P) is a common disfiguring birth defect with complex, poorly understood etiology. Mice carrying a spontaneous mutation, Dancer (Dc), exhibit CL/P in homozygotes and show significantly increased susceptibility to CL/P in heterozygotes [Deol, M. S. & Lane, P. W. (1966) J. Embryol. Exp. Morphol. 16, 543–558 and Trasler, D. G., Kemp, D. & Trasler, T. A. (1984) Teratology 29, 101–104], providing an animal model for understanding the molecular pathogenesis of CL/P. We genetically mapped Dc to within a 1-cM region near the centromere of chromosome 19. In situ hybridization analysis showed that one positional candidate gene, Tbx10, is ectopically expressed in Dc mutant embryos. Positional cloning of the Dc locus revealed an insertion of a 3.3-kb sequence containing the 5′ region of the p23 gene into the first intron of Tbx10, which causes ectopic expression of a p23-Tbx10 chimeric transcript encoding a protein product identical to a normal variant of the Tbx10 protein. Furthermore, we show that ectopic expression of Tbx10 in transgenic mice recapitulates the Dc mutant phenotype, indicating that CL/Pin Dc mutant mice results from the p23 insertion-induced ectopic Tbx10 expression. These results identify gain of function of a T-box transcription factor gene as a mechanism underlying CL/P pathogenesis. PMID:15118109

  12. AGO1 controls arabidopsis inflorescence architecture possibly by regulating TFL1 expression.

    PubMed

    Fernández-Nohales, P; Domenech, M J; Martínez de Alba, A E; Micol, J L; Ponce, M R; Madueño, F

    2014-11-01

    The TERMINAL FLOWER 1 (TFL1) gene is pivotal in the control of inflorescence architecture in arabidopsis. Thus, tfl1 mutants flower early and have a very short inflorescence phase, while TFL1-overexpressing plants have extended vegetative and inflorescence phases, producing many coflorescences. TFL1 is expressed in the shoot meristems, never in the flowers. In the inflorescence apex, TFL1 keeps the floral genes LEAFY (LFY) and APETALA1 (AP1) restricted to the flower, while LFY and AP1 restrict TFL1 to the inflorescence meristem. In spite of the central role of TFL1 in inflorescence architecture, regulation of its expression is poorly understood. This study aims to expand the understanding of inflorescence development by identifying and studying novel TFL1 regulators. Mutagenesis of an Arabidopsis thaliana line carrying a TFL1::GUS (β-glucuronidase) reporter construct was used to isolate a mutant with altered TFL1 expression. The mutated gene was identified by positional cloning. Expression of TFL1 and TFL1::GUS was analysed by real-time PCR and histochemical GUS detection. Double-mutant analysis was used to assess the contribution of TFL1 to the inflorescence mutant phenotype. A mutant with both an increased number of coflorescences and high and ectopic TFL1 expression was isolated. Cloning of the mutated gene showed that both phenotypes were caused by a mutation in the ARGONAUTE1 (AGO1) gene, which encodes a key component of the RNA silencing machinery. Analysis of another ago1 allele indicated that the proliferation of coflorescences and ectopic TFL1 expression phenotypes are not allele specific. The increased number of coflorescences is suppressed in ago1 tfl1 double mutants. The results identify AGO1 as a repressor of TFL1 expression. Moreover, they reveal a novel role for AGO1 in inflorescence development, controlling the production of coflorescences. AGO1 seems to play this role through regulating TFL1 expression. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)

    DOE PAGES

    Hon, Shuen; Lanahan, Anthony; Tian, Liang; ...

    2016-04-22

    Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less

  14. Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hon, Shuen; Lanahan, Anthony; Tian, Liang

    Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less

  15. Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs).

    PubMed

    Hon, Shuen; Lanahan, Anthony A; Tian, Liang; Giannone, Richard J; Hettich, Robert L; Olson, Daniel G; Lynd, Lee R

    2016-12-01

    Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE . To explore the effects of overexpressing wild-type, mutant, and exogenous adhE s, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum . As proof of concept, we used this plasmid to express 12 different adhE genes (both wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kreysing, J.; Bohne, W.; Boesenberg, C.

    The authors identified a patient suffering from late-infantile metachromatic leukodystrophy (MLD) who has a residual arylsulfatase A (ARSA) activity of about 10%. Fibroblasts of the patient show significant sulfatide degradation activity exceeding that of adult MLD patients. Analysis of the ARSA gene in this patient revealed heterozygosity for two new mutant alleles: in one allele, deletion of C 447 in exon 2 leads to a frameshift and to a premature stop codon at amino acid position 105; in the second allele, a G[yields]A transition in exon 5 causes a Gly[sup 309][yields]Ser substitution. Transient expression of the mutant Ser[sup 309]-ARSA resultedmore » in only 13% enzyme activity of that observed in cells expressing normal ARSA. The mutant ARSA is correctly targeted to the lyosomes but is unstable. These findings are in contrast to previous results showing that the late-infantile type of MLD is always associated with the complete absence of ARSA activity. The expression of the mutant ARSA protein may be influenced by particular features of oligodendrocytes, such that the level of mutant enzymes is lower in these cells than in others. 23 refs., 4 figs., 2 tabs.« less

  17. Mutant matrix metalloproteinase-9 reduces postoperative peritoneal adhesions in rats.

    PubMed

    Atta, Hussein; El-Rehany, Mahmoud; Roeb, Elke; Abdel-Ghany, Hend; Ramzy, Maggie; Gaber, Shereen

    2016-02-01

    Postoperative peritoneal adhesions continue to be a major source of morbidity and occasional mortality. Studies have shown that matrix metalloproteinase-9 (MMP-9) levels are decreased postoperatively which may limits matrix degradation and participate in the development of peritoneal adhesions. In this proof-of-principle study, we evaluated the effect of gene therapy with catalytically inactive mutant MMP-9 on postoperative peritoneal adhesions in rats. Adenovirus encoding mutant MMP-9 (Ad-mMMP-9) or saline was instilled in the peritoneal cavity after cecal and parietal peritoneal injury in rats. Expression of mutant MMP-9 transcript was verified by sequencing. Adenovirus E4 gene expression, adhesion scores, MMP-9, tissue plasminogen activator (tPA), plasminogen activator inhibitor-1 (PAI-1) and transforming growth factor-β1 (TGF-β1) expression were evaluated at sacrifice one week after treatment. Both mutant MMP-9 transcripts and adenovirus E4 gene were expressed in Ad-mMMP-9 treated adhesions. Adhesions severity decreased significantly (p = 0.036) in the Ad-mMMP-9-treated compared with saline-treated adhesions. Expression of MMP-9 mRNA and protein were elevated (p = 0.001 and p = 0.029, respectively) in the Ad-mMMP-9-treated adhesions compared with saline-treated adhesions. While tPA levels were increased (p = 0.02) in Ad-mMMP-9 treated adhesions compared with saline-treated adhesions, TGF-β1 and PAI-1 levels were decreased (p = 0.017 and p = 0.042, respectively). No difference in mortality were found between groups (p = 0.64). Mutant MMP-9 gene therapy effectively transduced peritoneal adhesions resulting in reduction of severity of primary peritoneal adhesions. Copyright © 2016 IJS Publishing Group Limited. Published by Elsevier Ltd. All rights reserved.

  18. Reduction of mutant huntingtin accumulation and toxicity by lysosomal cathepsins D and B in neurons

    PubMed Central

    2011-01-01

    Background Huntington's disease is caused by aggregation of mutant huntingtin (mHtt) protein containing more than a 36 polyQ repeat. Upregulation of macroautophagy was suggested as a neuroprotective strategy to degrade mutant huntingtin. However, macroautophagy initiation has been shown to be highly efficient in neurons whereas lysosomal activities are rate limiting. The role of the lysosomal and other proteases in Huntington is not clear. Some studies suggest that certain protease activities may contribute to toxicity whereas others are consistent with protection. These discrepancies may be due to a number of mechanisms including distinct effects of the specific intermediate digestion products of mutant huntingtin generated by different proteases. These observations suggested a critical need to investigate the consequence of upregulation of individual lysosomal enzyme in mutant huntingtin accumulation and toxicity. Results In this study, we used molecular approaches to enhance lysosomal protease activities and examined their effects on mutant huntingtin level and toxicity. We found that enhanced expression of lysosomal cathepsins D and B resulted in their increased enzymatic activities and reduced both full-length and fragmented huntingtin in transfected HEK cells. Furthermore, enhanced expression of cathepsin D or B protected against mutant huntingtin toxicity in primary neurons, and their neuroprotection is dependent on macroautophagy. Conclusions These observations demonstrate a neuroprotective effect of enhancing lysosomal cathepsins in reducing mutant huntingtin level and toxicity in transfected cells. They highlight the potential importance of neuroprotection mediated by cathepsin D or B through macroautophagy. PMID:21631942

  19. Downregulation of aldose reductase is responsible for developmental abnormalities of the silkworm purple quail-like mutant (q-lp).

    PubMed

    Wang, Pingyang; Bi, Simin; Wei, Weiyang; Qiu, Zhiyong; Xia, Dingguo; Shen, Xingjia; Zhao, Qiaoling

    2018-05-03

    Aldose reductase (AR) is a rate-limiting enzyme in the polyol pathway and is also the key enzyme involved in diabetic complications. The silkworm purple quail-like mutant (q-l p ) exhibits pigmented dots on its epidermis. The q-l p mutant also shows developmental abnormalities and decreased vitality. In this study, fat bodies from the q-l p mutant and the wildtype 932VR strain were subjected to two-dimensional gel electrophoresis (2-DE) analysis, and the Bombyx mori AR (BmAR) protein was found to be significantly downregulated in the q-l p mutant. The expression of BmAR at the mRNA level was also significantly downregulated, as verified through quantitative reverse transcription PCR (qRT-PCR). Knockdown of the expression of BmAR via RNAi resulted in a reduction of silkworm weight. The sorbitol level in q-l p was significantly lower than in the wildtype. These results suggested that the BmAR gene is closely related to the development of the q-l p mutant. Investigation of the cause of BmAR downregulation in the q-l p mutant could contribute to revealing the function of AR in insects and offers a new method of identifying AR inhibitors for the treatment of diabetic complications. Copyright © 2017. Published by Elsevier B.V.

  20. Murine Denys-Drash syndrome: evidence of podocyte de-differentiation and systemic mediation of glomerulosclerosis.

    PubMed

    Patek, Charles E; Fleming, Stewart; Miles, Colin G; Bellamy, Christopher O; Ladomery, Michael; Spraggon, Lee; Mullins, John; Hastie, Nicholas D; Hooper, Martin L

    2003-09-15

    Denys-Drash syndrome (DDS) is caused by dominant mutations of the Wilms' tumour suppressor gene, WT1, and characterized by a nephropathy involving diffuse mesangial sclerosis, male pseudohermaphroditism and/or Wilms' tumourigenesis. Previously, we reported that heterozygosity for the Wt1tmT396 mutation induces DDS in heterozygous and chimeric (Wt1tmT396/+<-->+/+) mice. In the present study, the fate of Wt1 mutant cells in chimeric kidneys was assessed by in situ marker analysis, and immunocytochemistry was used to re-examine the claim that glomerulosclerosis (GS) is caused by loss of WT1 and persistent Pax-2 expression by podocytes. Wt1 mutant cells colonized glomeruli efficiently, including podocytes, but some sclerotic glomeruli contained no detectable Wt1 mutant cells. The development of GS was preceded by widespread loss of ZO-1 signal in podocytes (even in kidneys where <5% of glomeruli contained Wt1 mutant podocytes), increased intra-renal renin expression, and de novo podocyte TGF-beta1 expression, but not podocyte Pax-2 expression or loss of WT1, synaptopodin, alpha-actinin-4 or nephrin expression. However, podocytes in partially sclerotic glomeruli that still expressed WT1 at high levels showed reduced vimentin expression, cell cycle re-entry, and re-expressed desmin, cytokeratin and Pax-2. The results suggest that: (i) GS is not due to loss of WT1 expression by podocytes; (ii) podocyte Pax-2 expression reflects re-expression rather than persistent expression, and is the consequence of GS; (iii) GS is mediated systemically and the mechanism involves activation of the renin-angiotensin system; and (iv) podocytes undergo typical maturational changes but subsequently de-differentiate and revert to an immature phenotype during disease progression.

  1. Deciphering the role of the signal- and Sty1 kinase-dependent phosphorylation of the stress-responsive transcription factor Atf1 on gene activation.

    PubMed

    Salat-Canela, Clàudia; Paulo, Esther; Sánchez-Mir, Laura; Carmona, Mercè; Ayté, José; Oliva, Baldo; Hidalgo, Elena

    2017-08-18

    Adaptation to stress triggers the most dramatic shift in gene expression in fission yeast ( Schizosaccharomyces pombe ), and this response is driven by signaling via the MAPK Sty1. Upon activation, Sty1 accumulates in the nucleus and stimulates expression of hundreds of genes via the nuclear transcription factor Atf1, including expression of atf1 itself. However, the role of stress-induced, Sty1-mediated Atf1 phosphorylation in transcriptional activation is unclear. To this end, we expressed Atf1 phosphorylation mutants from a constitutive promoter to uncouple Atf1 activity from endogenous, stress-activated Atf1 expression. We found that cells expressing a nonphosphorylatable Atf1 variant are sensitive to oxidative stress because of impaired transcription of a subset of stress genes whose expression is also controlled by another transcription factor, Pap1. Furthermore, cells expressing a phospho-mimicking Atf1 mutant display enhanced stress resistance, and although expression of the Pap1-dependent genes still relied on stress induction, another subset of stress-responsive genes was constitutively expressed in these cells. We also observed that, in cells expressing the phospho-mimicking Atf1 mutant, the presence of Sty1 was completely dispensable, with all stress defects of Sty1-deficient cells being suppressed by expression of the Atf1 mutant. We further demonstrated that Sty1-mediated Atf1 phosphorylation does not stimulate binding of Atf1 to DNA but, rather, establishes a platform of interactions with the basal transcriptional machinery to facilitate transcription initiation. In summary, our results provide evidence that Atf1 phosphorylation by the MAPK Sty1 is required for oxidative stress responses in fission yeast cells by promoting transcription initiation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Amino- and carboxy-terminal deletion mutants of Gs alpha are localized to the particulate fraction of transfected COS cells

    PubMed Central

    1992-01-01

    To elucidate the structural basis for membrane attachment of the alpha subunit of the stimulatory G protein (Gs alpha), mutant Gs alpha cDNAs with deletions of amino acid residues in the amino and/or carboxy termini were transiently expressed in COS-7 cells. The particulate and soluble fractions prepared from these cells were analyzed by immunoblot using peptide specific antibodies to monitor distribution of the expressed proteins. Transfection of mutant forms of Gs alpha with either 26 amino terminal residues deleted (delta 3-28) or with 59 amino terminal residues deleted (delta 1-59) resulted in immunoreactive proteins which localized primarily to the particulate fraction. Similarly, mutants with 10 (delta 385-394), 32 (delta 353-384), or 42 (delta 353-394) amino acid residues deleted from the carboxy terminus also localized to the particulate fraction, as did a mutant form of Gs alpha lacking amino acid residues at both the amino and carboxy termini (delta 3-28)/(delta 353-384). Mutant and wild type forms of Gs alpha demonstrated a similar degree of tightness in their binding to membranes as demonstrated by treatment with 2.5 M NaCl or 6 M urea, but some mutant forms were relatively resistant compared with wild type Gs alpha to solubilization by 15 mM NaOH or 1% sodium cholate. We conclude that: (a) deletion of significant portions of the amino and/or carboxyl terminus of Gs alpha is still compatible with protein expression; (b) deletion of these regions is insufficient to cause cytosolic localization of the expressed protein. The basis of Gs alpha membrane targeting remains to be elucidated. PMID:1400589

  3. Functional rescue of mutant ABCA1 proteins by sodium 4-phenylbutyrate.

    PubMed

    Sorrenson, Brie; Suetani, Rachel J; Williams, Michael J A; Bickley, Vivienne M; George, Peter M; Jones, Gregory T; McCormick, Sally P A

    2013-01-01

    Mutations in the ATP-binding cassette transporter A1 (ABCA1) are a major cause of decreased HDL cholesterol (HDL-C), which infers an increased risk of cardiovascular disease (CVD). Many ABCA1 mutants show impaired localization to the plasma membrane. The aim of this study was to investigate whether the chemical chaperone, sodium 4-phenylbutyrate (4-PBA) could improve cellular localization and function of ABCA1 mutants. Nine different ABCA1 mutants (p.A594T, p.I659V, p.R1068H, p.T1512M, p.Y1767D, p.N1800H, p.R2004K, p.A2028V, p.Q2239N) expressed in HEK293 cells, displaying different degrees of mislocalization to the plasma membrane and discrete impacts on cholesterol efflux, were subject to treatment with 4-PBA. Treatment restored localization to the plasma membrane and increased cholesterol efflux function for the majority of mutants. Treatment with 4-PBA also increased ABCA1 protein expression in all transfected cell lines. In fibroblast cells obtained from low HDL-C subjects expressing two of the ABCA1 mutants (p.R1068H and p.N1800H), 4-PBA increased cholesterol efflux without any increase in ABCA1 expression. Our study is the first to investigate the effect of the chemical chaperone, 4-PBA on ABCA1 and shows that it is capable of restoring plasma membrane localization and enhancing the cholesterol efflux function of mutant ABCA1s both in vitro and ex vivo. These results suggest 4-PBA may warrant further investigation as a potential therapy for increasing cholesterol efflux and HDL-C levels.

  4. CKB1 is involved in abscisic acid and gibberellic acid signaling to regulate stress responses in Arabidopsis thaliana.

    PubMed

    Yuan, Congying; Ai, Jianping; Chang, Hongping; Xiao, Wenjun; Liu, Lu; Zhang, Cheng; He, Zhuang; Huang, Ji; Li, Jinyan; Guo, Xinhong

    2017-05-01

    Casein kinase II (CK2), an evolutionarily well-conserved Ser/Thr kinase, plays critical roles in all higher organisms including plants. CKB1 is a regulatory subunit beta of CK2. In this study, homozygous T-DNA mutants (ckb1-1 and ckb1-2) and over-expression plants (35S:CKB1-1, 35S:CKB1-2) of Arabidopsis thaliana were studied to understand the role of CKB1 in abiotic stress and gibberellic acid (GA) signaling. Histochemical staining showed that although CKB1 was expressed in all organs, it had a relatively higher expression in conducting tissues. The ckb1 mutants showed reduced sensitivity to abscisic acid (ABA) during seed germination and seedling growth. The increased stomatal aperture, leaf water loss and proline accumulation were observed in ckb1 mutants. In contrast, the ckb1 mutant had increased sensitivity to polyaluminum chloride during seed germination and hypocotyl elongation. We obtained opposite results in over-expression plants. The expression levels of a number of genes in the ABA and GA regulatory network had changed. This study demonstrates that CKB1 is an ABA signaling-related gene, which subsequently influences GA metabolism, and may play a positive role in ABA signaling.

  5. Lysine 206 in Arabidopsis phytochrome A is the major site for ubiquitin-dependent protein degradation.

    PubMed

    Rattanapisit, Kaewta; Cho, Man-Ho; Bhoo, Seong Hee

    2016-02-01

    Phytochrome A (phyA) is a light labile phytochrome that mediates plant development under red/far-red light condition. Degradation of phyA is initiated by red light-induced phyA-ubiquitin conjugation through the 26S proteasome pathway. The N-terminal of phyA is known to be important in phyA degradation. To determine the specific lysine residues in the N-terminal domain of phyA involved in light-induced ubiquitination and protein degradation, we aligned the amino acid sequence of the N-terminal domain of Arabidopsis phyA with those of phyA from other plant species. Based on the alignment results, phytochrome over-expressing Arabidopsis plants were generated. In particular, wild-type and mutant (substitutions of conserved lysines by arginines) phytochromes fused with GFP were expressed in phyA(-)211 Arabidopsis plants. Degradation kinetics of over-expressed phyA proteins revealed that degradation of the K206R phyA mutant protein was delayed. Delayed phyA degradation of the K206R phyA mutant protein resulted in reduction of red-light-induced phyA-ubiquitin conjugation. Furthermore, seedlings expressing the K206R phyA mutant protein showed an enhanced phyA response under far-red light, resulting in inhibition of hypocotyl elongation as well as cotyledon opening. Together, these results suggest that lysine 206 is the main lysine for rapid ubiquitination and protein degradation of Arabidopsis phytochrome A. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  6. Endoplasmic reticulum polymers impair luminal protein mobility and sensitise to cellular stress in α1-antitrypsin deficiency

    PubMed Central

    Ordóñez, Adriana; Snapp, Erik L; Tan, Lu; Miranda, Elena; Marciniak, Stefan J; Lomas, David A

    2013-01-01

    Point mutants of α1-antitrypsin form ordered polymers that are retained as inclusions within the endoplasmic reticulum (ER) of hepatocytes in association with neonatal hepatitis, cirrhosis and hepatocellular carcinoma. These inclusions cause cell damage and predispose to ER stress in the absence of the classical unfolded protein response (UPR). The pathophysiology underlying this ER stress was explored by generating cell models that conditionally express wildtype α1-antitrypsin, two mutants that cause polymer-mediated inclusions and liver disease (E342K [the Z allele] and H334D) and a truncated mutant (Null Hong Kong, NHK) that induces classical ER stress and is removed by ER associated degradation. Expression of the polymeric mutants resulted in gross changes in the ER luminal environment that recapitulated the changes seen in liver sections from individuals with PI*ZZ α1-antitrypsin deficiency. In contrast expression of NHK α1-antitrypsin caused electron lucent dilatation and expansion of the ER throughout the cell. Photobleaching microscopy in live cells demonstrated a decrease in the mobility of soluble luminal proteins in cells that express E342K and H334D α1-antitrypsin when compared to those that express wildtype and NHK α1-antitrypsin (0.34±0.05, 0.22±0.03, 2.83±0.30 and 2.84±0.55 μm2/s respectively). There was no effect on protein mobility within ER membranes indicating that cisternal connectivity was not disrupted. Polymer expression alone was insufficient to induce the UPR but the resulting protein overload rendered cells hypersensitive to ER stress induced by either tunicamycin or glucose depletion. Conclusion Changes in protein diffusion provide an explanation for the cellular consequences of ER protein overload in mutants that cause inclusion body formation and α1-antitrypsin deficiency. PMID:23197448

  7. Reduced mycorrhizal colonization (rmc) tomato mutant lacks expression of SymRK signaling pathway genes

    PubMed Central

    Nair, Aswathy; Bhargava, Sujata

    2012-01-01

    Comparison of the expression of 13 genes involved in arbuscular mycorrhizal (AM) symbiosis was performed in a wild type tomato (Solanum lycopersicum cv 76R) and its reduced mycorrhizal colonization mutant rmc in response to colonization with Glomus fasiculatum. Four defense-related genes were induced to a similar extent in the mutant and wild type AM colonized plants, indicating a systemic response to AM colonization. Genes related to nutrient exchange between the symbiont partners showed higher expression in the AM roots of wild type plants than the mutant plants, which correlated with their arbuscular frequency. A symbiosis receptor kinase that is involved in both nodulation and AM symbiosis was not expressed in the rmc mutant. The fact that some colonization was observed in rmc was suggestive of the existence of an alternate colonization signaling pathway for AM symbiosis in this mutant. PMID:23221680

  8. A mutation in the rice chalcone isomerase gene causes the golden hull and internode 1 phenotype.

    PubMed

    Hong, Lilan; Qian, Qian; Tang, Ding; Wang, Kejian; Li, Ming; Cheng, Zhukuan

    2012-07-01

    The biosynthesis of flavonoids, important secondary plant metabolites, has been investigated extensively, but few mutants of genes in this pathway have been identified in rice (Oryza sativa). The rice gold hull and internode (gh) mutants exhibit a reddish-brown pigmentation in the hull and internode and their phenotype has long been used as a morphological marker trait for breeding and genetic study. Here, we characterized that the gh1 mutant was a mutant of the rice chalcone isomerase gene (OsCHI). The result showed that gh1 had a Dasheng retrotransposon inserted in the 5′ UTR of the OsCHI gene, which resulted in the complete loss of OsCHI expression. gh1 exhibited golden pigmentation in hulls and internodes once the panicles were exposed to light. The total flavonoid content in gh1 hulls was increased threefold compared to wild type. Consistent with the gh1 phenotype, OsCHI transcripts were expressed in most tissues of rice and most abundantly in internodes. It was also expressed at high levels in panicles before heading, distributed mainly in lemmas and paleae, but its expression decreased substantially after the panicles emerged from the sheath. OsCHI encodes a protein functionally and structurally conserved to chalcone isomerases in other species. Our findings demonstrated that the OsCHI gene was indispensable for flux of the flavonoid pathway in rice.

  9. The E3 ubiquitin ligase CHIP selectively regulates mutant epidermal growth factor receptor by ubiquitination and degradation.

    PubMed

    Chung, Chaeuk; Yoo, Geon; Kim, Tackhoon; Lee, Dahye; Lee, Choong-Sik; Cha, Hye Rim; Park, Yeon Hee; Moon, Jae Young; Jung, Sung Soo; Kim, Ju Ock; Lee, Jae Cheol; Kim, Sun Young; Park, Hee Sun; Park, Myoungrin; Park, Dong Il; Lim, Dae-Sik; Jang, Kang Won; Lee, Jeong Eun

    2016-10-14

    Somatic mutation in the tyrosine kinase domain of epidermal growth factor receptor (EGFR) is a decisive factor for the therapeutic response to EGFR tyrosine kinase inhibitors (EGFR-TKIs) in lung adenocarcinoma. The stability of mutant EGFR is maintained by various regulators, including heat shock protein 90 (Hsp90). The C terminus of Hsc70-interacting protein (CHIP) is a Hsp70/Hsp90 co-chaperone and exhibits E3 ubiquitin ligase activity. The high-affinity Hsp90-CHIP complex recognizes and selectively regulates their client proteins. CHIP also works with its own E3 ligase activity independently of Hsp70/Hsp90. Here, we investigated the role of CHIP in regulating EGFR in lung adenocarcinoma and also evaluated the specificity of CHIP's effects on mutant EGFR. In HEK 293T cells transfected with either WT EGFR or EGFR mutants, the overexpression of CHIP selectively decreased the expression of certain EGFR mutants (G719S, L747_E749del A750P and L858R) but not WT EGFR. In a pull-down assay, CHIP selectively interacted with EGFR mutants and simultaneously induced their ubiquitination and proteasomal degradation. The expressions of mutant EGFR in PC9 and H1975 were diminished by CHIP, while the expression of WT EGFR in A549 was nearly not affected. In addition, CHIP overexpression inhibited cell proliferation and xenograft's tumor growth of EGFR mutant cell lines, but not WT EGFR cell lines. EGFR mutant specific ubiquitination by CHIP may provide a crucial regulating mechanism for EGFR in lung adenocarcinoma. Our results suggest that CHIP can be novel therapeutic target for overcoming the EGFR TKI resistance. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. A 76-bp deletion in the Mip gene causes autosomal dominant cataract in Hfi mice.

    PubMed

    Sidjanin, D J; Parker-Wilson, D M; Neuhäuser-Klaus, A; Pretsch, W; Favor, J; Deen, P M; Ohtaka-Maruyama, C; Lu, Y; Bragin, A; Skach, W R; Chepelinsky, A B; Grimes, P A; Stambolian, D E

    2001-06-15

    Hfi is a dominant cataract mutation where heterozygotes show hydropic lens fibers and homozygotes show total lens opacity. The Hfi locus was mapped to the distal part of mouse chromosome 10 close to the major intrinsic protein (Mip), which is expressed only in cell membranes of lens fibers. Molecular analysis of Mip revealed a 76-bp deletion that resulted in exon 2 skipping in Mip mRNA. In Hfi/Hfi this deletion resulted in a complete absence of the wildtype Mip. In contrast, Hfi/+ animals had the same amount of wildtype Mip as +/+. Results from pulse-chase expression studies excluded hetero-oligomerization of wildtype and mutant Mip as a possible mechanism for cataract formation in the Hfi/+. We propose that the cataract phenotype in the Hfi heterozygote mutant is due to a detrimental gain of function by the mutant Mip resulting in either cytotoxicity or disruption in processing of other proteins important for the lens. Cataract formation in the Hfi/Hfi mouse is probably a combined result of both the complete loss of wildtype Mip and a gain of function of the mutant Mip. Copyright 2001 Academic Press.

  11. Stimulation of d- and l-lactate dehydrogenases transcriptional levels in presence of diammonium hydrogen phosphate resulting to enhanced lactic acid production by Lactobacillus strain.

    PubMed

    Singhvi, Mamata; Zendo, Takeshi; Iida, Hiroshi; Gokhale, Digambar; Sonomoto, Kenji

    2017-12-01

    The present study revealed the effect of nitrogen sources on lactic acid production and stimulation of d- and l-lactate dehydrogenases (LDH) of parent Lactobacillus lactis NCIM 2368 and its mutant RM2-24 generated after UV mutagenesis. Both the parent and mutant strains were evaluated for d-lactic acid production in control and modified media. The modified media did not show remarkable effect on lactic acid production in case of parent whereas mutant exhibited significant enhancement in d-lactic acid production along with the appearance of l-lactic acid in the broth. Both LDH activities and specific activities were found to be higher in mutant than the parent strain. These results suggested that the diammonium hydrogen phosphate in modified media triggered the expression of LDH genes leading to enhanced lactic acid production. This observation has been proved by studying the expression levels of d- and l-LDH genes of parent and mutant in control and modified media using quantitative RT-PCR technique. In case of mutant, the transcriptional levels of d-LDH and l-LDH increased ∼17 fold and ∼1.38 fold respectively in modified medium compared to the values obtained with control medium. In case of parent, no significant change in transcriptional levels of d- and l-LDH was found when the cells were grown in either control medium or modified medium. This study suggested that the mutant, RM2-24 has l-LDH gene which is expressed in presence of (NH 4 ) 2 HPO 4 resulting in l-lactic acid production. Co-production of l-lactic acid in d-lactic acid fermentation may be detrimental in the PLA production. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Brucella Rough Mutant Induce Macrophage Death via Activating IRE1α Pathway of Endoplasmic Reticulum Stress by Enhanced T4SS Secretion

    PubMed Central

    Li, Peng; Tian, Mingxing; Bao, Yanqing; Hu, Hai; Liu, Jiameng; Yin, Yi; Ding, Chan; Wang, Shaohui; Yu, Shengqing

    2017-01-01

    Brucella is a Gram-negative facultative intracellular pathogen that causes the worldwide zoonosis, known as brucellosis. Brucella virulence relies mostly on its ability to invade and replicate within phagocytic cells. The type IV secretion system (T4SS) and lipopolysaccharide are two major Brucella virulence factors. Brucella rough mutants reportedly induce the death of infected macrophages, which is T4SS dependent. However, the underlying molecular mechanism remains unclear. In this study, the T4SS secretion capacities of Brucella rough mutant and its smooth wild-type strain were comparatively investigated, by constructing the firefly luciferase fused T4SS effector, BPE123 and VceC. In addition, quantitative real-time PCR and western blotting were used to analyze the T4SS expression. The results showed that T4SS expression and secretion were enhanced significantly in the Brucella rough mutant. We also found that the activity of the T4SS virB operon promoter was notably increased in the Brucella rough mutant, which depends on quorum sensing-related regulators of VjbR upregulation. Cell infection and cell death assays revealed that deletion of vjbR in the Brucella rough mutant absolutely abolished cytotoxicity within macrophages by downregulating T4SS expression. This suggests that up-regulation of T4SS promoted by VjbR in rough mutant ΔrfbE contribute to macrophage death. In addition, we found that the Brucella rough mutant induce macrophage death via activating IRE1α pathway of endoplasmic reticulum stress. Taken together, our study provide evidence that in comparison to the Brucella smooth wild-type strain, VjbR upregulation in the Brucella rough mutant increases transcription of the virB operon, resulting in overexpression of the T4SS gene, accompanied by the over-secretion of effecter proteins, thereby causing the death of infected macrophages via activating IRE1α pathway of endoplasmic reticulum stress, suggesting novel insights into the molecular mechanisms associated with Brucella rough mutant-induced macrophage cytotoxicity. PMID:29021973

  13. Brucella Rough Mutant Induce Macrophage Death via Activating IRE1α Pathway of Endoplasmic Reticulum Stress by Enhanced T4SS Secretion.

    PubMed

    Li, Peng; Tian, Mingxing; Bao, Yanqing; Hu, Hai; Liu, Jiameng; Yin, Yi; Ding, Chan; Wang, Shaohui; Yu, Shengqing

    2017-01-01

    Brucella is a Gram-negative facultative intracellular pathogen that causes the worldwide zoonosis, known as brucellosis. Brucella virulence relies mostly on its ability to invade and replicate within phagocytic cells. The type IV secretion system (T4SS) and lipopolysaccharide are two major Brucella virulence factors. Brucella rough mutants reportedly induce the death of infected macrophages, which is T4SS dependent. However, the underlying molecular mechanism remains unclear. In this study, the T4SS secretion capacities of Brucella rough mutant and its smooth wild-type strain were comparatively investigated, by constructing the firefly luciferase fused T4SS effector, BPE123 and VceC. In addition, quantitative real-time PCR and western blotting were used to analyze the T4SS expression. The results showed that T4SS expression and secretion were enhanced significantly in the Brucella rough mutant. We also found that the activity of the T4SS virB operon promoter was notably increased in the Brucella rough mutant, which depends on quorum sensing-related regulators of VjbR upregulation. Cell infection and cell death assays revealed that deletion of vjbR in the Brucella rough mutant absolutely abolished cytotoxicity within macrophages by downregulating T4SS expression. This suggests that up-regulation of T4SS promoted by VjbR in rough mutant Δ rfbE contribute to macrophage death. In addition, we found that the Brucella rough mutant induce macrophage death via activating IRE1α pathway of endoplasmic reticulum stress. Taken together, our study provide evidence that in comparison to the Brucella smooth wild-type strain, VjbR upregulation in the Brucella rough mutant increases transcription of the virB operon, resulting in overexpression of the T4SS gene, accompanied by the over-secretion of effecter proteins, thereby causing the death of infected macrophages via activating IRE1α pathway of endoplasmic reticulum stress, suggesting novel insights into the molecular mechanisms associated with Brucella rough mutant-induced macrophage cytotoxicity.

  14. Sex Reversal in Zebrafish fancl Mutants Is Caused by Tp53-Mediated Germ Cell Apoptosis

    PubMed Central

    Rodríguez-Marí, Adriana; Cañestro, Cristian; BreMiller, Ruth A.; Nguyen-Johnson, Alexandria; Asakawa, Kazuhide; Kawakami, Koichi; Postlethwait, John H.

    2010-01-01

    The molecular genetic mechanisms of sex determination are not known for most vertebrates, including zebrafish. We identified a mutation in the zebrafish fancl gene that causes homozygous mutants to develop as fertile males due to female-to-male sex reversal. Fancl is a member of the Fanconi Anemia/BRCA DNA repair pathway. Experiments showed that zebrafish fancl was expressed in developing germ cells in bipotential gonads at the critical time of sexual fate determination. Caspase-3 immunoassays revealed increased germ cell apoptosis in fancl mutants that compromised oocyte survival. In the absence of oocytes surviving through meiosis, somatic cells of mutant gonads did not maintain expression of the ovary gene cyp19a1a and did not down-regulate expression of the early testis gene amh; consequently, gonads masculinized and became testes. Remarkably, results showed that the introduction of a tp53 (p53) mutation into fancl mutants rescued the sex-reversal phenotype by reducing germ cell apoptosis and, thus, allowed fancl mutants to become fertile females. Our results show that Fancl function is not essential for spermatogonia and oogonia to become sperm or mature oocytes, but instead suggest that Fancl function is involved in the survival of developing oocytes through meiosis. This work reveals that Tp53-mediated germ cell apoptosis induces sex reversal after the mutation of a DNA–repair pathway gene by compromising the survival of oocytes and suggests the existence of an oocyte-derived signal that biases gonad fate towards the female developmental pathway and thereby controls zebrafish sex determination. PMID:20661450

  15. Melatonin induction and its role in high light stress tolerance in Arabidopsis thaliana.

    PubMed

    Lee, Hyoung Yool; Back, Kyoungwhan

    2018-05-16

    In plants, melatonin is a potent bioactive molecule involved in the response against various biotic and abiotic stresses. However, little is known of its defensive role against high light (HL) stress. In this study, we found that melatonin was transiently induced in response to HL stress in Arabidopsis thaliana with a simultaneous increase in the expression of melatonin biosynthetic genes, including serotonin N-acetyltransferase1 (SNAT1). Transient induction of melatonin was also observed in the flu mutant, a singlet oxygen ( 1 O 2 )-producing mutant, upon light exposure, suggestive of melatonin induction by chloroplastidic 1 O 2 against HL stress. An Arabidopsis snat1 mutant was devoid of melatonin induction upon HL stress, resulting in high susceptibility to HL stress. Exogenous melatonin treatment mitigated damage caused by HL stress in the snat1 mutant by reducing O 2 - production and increasing the expression of various ROS-responsive genes. In analogy, an Arabidopsis SNAT1-overexpressing line showed increased tolerance of HL stress concomitant with a reduction in malondialdehyde and ion leakage. A complementation line expressing an Arabidopsis SNAT1 genomic fragment in the snat1 mutant completely restored HL stress susceptibility in the snat1 mutant to levels comparable to that of wild-type Col-0 plants. The results of the analysis of several Arabidopsis genetic lines reveal for the first time at the genetic level that melatonin is involved in conferring HL stress tolerance in plants. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. The Drosophila Neurally Altered Carbohydrate Mutant Has a Defective Golgi GDP-fucose Transporter*

    PubMed Central

    Geisler, Christoph; Kotu, Varshika; Sharrow, Mary; Rendić, Dubravko; Pöltl, Gerald; Tiemeyer, Michael; Wilson, Iain B. H.; Jarvis, Donald L.

    2012-01-01

    Studying genetic disorders in model organisms can provide insights into heritable human diseases. The Drosophila neurally altered carbohydrate (nac) mutant is deficient for neural expression of the HRP epitope, which consists of N-glycans with core α1,3-linked fucose residues. Here, we show that a conserved serine residue in the Golgi GDP-fucose transporter (GFR) is substituted by leucine in nac1 flies, which abolishes GDP-fucose transport in vivo and in vitro. This loss of function is due to a biochemical defect, not to destabilization or mistargeting of the mutant GFR protein. Mass spectrometry and HPLC analysis showed that nac1 mutants lack not only core α1,3-linked, but also core α1,6-linked fucose residues on their N-glycans. Thus, the nac1 Gfr mutation produces a previously unrecognized general defect in N-glycan core fucosylation. Transgenic expression of a wild-type Gfr gene restored the HRP epitope in neural tissues, directly demonstrating that the Gfr mutation is solely responsible for the neural HRP epitope deficiency in the nac1 mutant. These results validate the Drosophila nac1 mutant as a model for the human congenital disorder of glycosylation, CDG-IIc (also known as LAD-II), which is also the result of a GFR deficiency. PMID:22745127

  17. Expression of acrA and acrB Genes in Esherichia coli Mutants with or without marR or acrR Mutations.

    PubMed

    Pourahmad Jaktaji, Razieh; Jazayeri, Nasim

    2013-12-01

    The major antibiotic efflux pump of Esherichia coli is AcrAB-TolC. The first part of the pump, AcrAB, is encoded by acrAB operon. The expression of this operon can be kept elevated by overexpression of an activator, MarA following inactivation of MarR and AcrR repressors due to mutation in encoding genes, marR and acrR, respectively. The aims of this research were to use E. coli mutants with or without mutation in marR to search for the presence of possible mutation in acrR and to quantify the expression of acrAB. The DNA binding region of acrR gene in these mutants were amplified by PCR and sequenced. The relative expression of acrA and acrB were determined by real time PCR. RESULTS showed that W26 and C14 had the same mutation in acrR, but none of the mutants overexpressed acrA and acrB in comparison with wild type strain. The effect of marR or acrR mutation on acrAB overexpression is dependent on levels of resistance to tetracycline and ciprofloxacin.

  18. Bradyrhizobium japonicum mutants with enhanced sensitivity to genistein resulting in altered nod gene regulation.

    PubMed

    Ip, H; D'Aoust, F; Begum, A A; Zhang, H; Smith, D L; Driscoll, B T; Charles, T C

    2001-12-01

    Bradyrhizobium japonicum mutants with altered nod gene induction characteristics were isolated by screening mutants for genistein-independent nod gene expression. Plasmid pZB32, carrying a nodY::lacZ transcriptional gene fusion, was introduced into B. japonicum cells that had been subjected to UV mutagenesis. Ten independent transformants producing a blue color on plates containing 5bromo-4chloro-3indolyl-beta-D-galactopyranoside but lacking genistein, indicative of constitutive expression of the nodY::lacZ reporter gene, were isolated. Beta-galactosidase activity assays revealed that while all of the 10 strains were sensitive to low concentrations of genistein, none exhibited truly constitutive nodY::lacZ expression in liquid culture. Soybean plants inoculated with three of the mutants were chlorotic and stunted, with shoot dry weights close to those of the uninoculated plants, indicating the absence of nitrogen fixation. Differences in the kinetics of nodY::lacZ expression and lipochitin oligosaccharide Nod signal production suggested that the strains carried different mutations. Some of these strains may be useful in mitigating the low root zone temperature-associated delay in soybean nodulation at the northern extent of soybean cultivation.

  19. Inducing mutations through γ-irradiation in seeds of Mucuna pruriens for developing high L-DOPA-yielding genotypes.

    PubMed

    Singh, Susheel Kumar; Yadav, Deepti; Lal, Raj Kishori; Gupta, Madan M; Dhawan, Sunita Singh

    2017-04-01

    To develop elite genotypes in Mucuna pruriens (L.) DC with high L-DOPA (L-3, 4 dihydroxyphenylalanine) yields, with non-itching characteristics and better adaptability by applying γ-irradiation. Molecular and chemical analysis was performed for screening based on specific characteristics desired for developing suitable genotypes. Developed, mutant populations were analyzed for L-DOPA % in seeds through TLC (thin layer chromatography), and the results obtained were validated with the HPLC (High performance liquid chromatography). The DNA (Deoxyribonucleic acid) was isolated from the leaf at the initial stage and used for DNA polymorphism. RNA (Ribonucleic acid) was isolated from the leaf during maturity and used for expression analysis. The selected mutant T-I-7 showed 5.7% L-DOPA content compared to 3.18% of parent CIM-Ajar. The total polymorphism obtained was 57% with the molecular marker analysis. The gene expression analysis showed higher fold change expression of the dopadecarboxylase gene (DDC) in control compared to selected mutants (T-I-7, T-II-23, T-IV-9, T-VI-1). DNA polymorphism was used for the screening of mutants for efficient screening at an early stage. TLC was found suitable for the large-scale comparative chemical analysis of L-DOPA. The expression profile of DDC clearly demonstrated the higher yields of L-DOPA in selected mutants developed by γ-irradiation in the seeds of the control.

  20. Superoxide overproduction and kidney fibrosis: a new animal model

    PubMed Central

    Guimarães-Souza, Nadia Karina; Yamaleyeva, Liliya Marsovna; Lu, Baisong; Ramos, Ana Claudia Mallet de Souza; Bishop, Colin Edward; Andersson, Karl Erik

    2015-01-01

    Objective To establish whether the mutation in the Immp2L gene induces renal fibrosis and whether aging exacerbates renal morphology in mice. Methods Female mutant mice with mutation in the inner mitochondrial membrane peptidase 2-like protein at 3 and 18 months of age were used. Renal fibrosis was analyzed using classic fibrosis score, Masson’s trichrome staining, and analysis of profibrotic markers using real time polymerase chain reaction (superoxide dismutase 1, metalloproteinase-9, erythropoietin, transforming growth factor beta), and immunostaining (fibroblasts and Type IV collagen). Oxidative stress markers were determined by immunohistochemistry. The number of renal apoptotic cells was determined. Renal function was estimated by serum creatinine. Results Young mutant mice had significantly more glomerulosclerosis than age-matched mice (p=0.034). Mutant mice had more tubular casts (p=0.025), collagen deposition (p=0.019), and collagen type IV expression (p<0.001). Superoxide dismutase 1 expression was significantly higher in young mutants (p=0.038). Old mutants exhibited significantly higher expression of the fibroblast marker and macrophage marker (p=0.007 and p=0.012, respectively). The real time polymerase chain reaction of metalloproteinase-9 and erythropoietin were enhanced 2.5- and 6-fold, respectively, in old mutants. Serum creatinine was significantly higher in old mutants (p<0.001). Conclusion This mutation altered renal architecture by increasing the deposition of extracellular matrix, oxidative stress, and inflammation, suggesting a protective role of Immp2L against renal fibrosis. PMID:25993073

  1. pigk Mutation underlies macho behavior and affects Rohon-Beard cell excitability

    PubMed Central

    Carmean, V.; Yonkers, M. A.; Tellez, M. B.; Willer, J. R.; Willer, G. B.; Gregg, R. G.; Geisler, R.; Neuhauss, S. C.

    2015-01-01

    The study of touch-evoked behavior allows investigation of both the cells and circuits that generate a response to tactile stimulation. We investigate a touch-insensitive zebrafish mutant, macho (maco), previously shown to have reduced sodium current amplitude and lack of action potential firing in sensory neurons. In the genomes of mutant but not wild-type embryos, we identify a mutation in the pigk gene. The encoded protein, PigK, functions in attachment of glycophosphatidylinositol anchors to precursor proteins. In wild-type embryos, pigk mRNA is present at times when mutant embryos display behavioral phenotypes. Consistent with the predicted loss of function induced by the mutation, knock-down of PigK phenocopies maco touch insensitivity and leads to reduced sodium current (INa) amplitudes in sensory neurons. We further test whether the genetic defect in pigk underlies the maco phenotype by overexpressing wild-type pigk in mutant embryos. We find that ubiquitous expression of wild-type pigk rescues the touch response in maco mutants. In addition, for maco mutants, expression of wild-type pigk restricted to sensory neurons rescues sodium current amplitudes and action potential firing in sensory neurons. However, expression of wild-type pigk limited to sensory cells of mutant embryos does not allow rescue of the behavioral touch response. Our results demonstrate an essential role for pigk in generation of the touch response beyond that required for maintenance of proper INa density and action potential firing in sensory neurons. PMID:26133798

  2. Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant

    PubMed Central

    Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A.; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K.; Altenbach, Christian; Hong, Yuan; Hanson, Susan M.; Palazzo, Maria C.; Chen, Jeannie; Hubbell, Wayne L.; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2013-01-01

    Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. PMID:24012956

  3. Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant.

    PubMed

    Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K; Altenbach, Christian; Hong, Yuan; Hanson, Susan M; Palazzo, Maria C; Chen, Jeannie; Hubbell, Wayne L; Gurevich, Eugenia V; Gurevich, Vsevolod V

    2013-12-01

    Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. © 2013.

  4. Gα proteins Gvm2 and Gvm3 regulate vegetative growth, asexual development, and pathogenicityon apple in Valsa mali.

    PubMed

    Song, Na; Dai, Qingqing; Zhu, Baitao; Wu, Yuxing; Xu, Ming; Voegele, Ralf Thomas; Gao, Xiaoning; Kang, Zhensheng; Huang, Lili

    2017-01-01

    In fungi, heterotrimeric guanine-nucleotide binding proteins (G-proteins) are key elements of signal transduction pathways, which control growth, asexual and sexual development, as well as virulence. In this study, we have identified two genes encoding heterotrimeric G protein alpha subunits, named Gvm2 and Gvm3, from Valsa mali, the causal agent of apple Valsa canker. Characterization of Gvm2 and Gvm3 mutants indicates that Gvm3 may be a crucial regulator of vegetative growth. Deletion of the corresponding gene results in a 20% reduction in growth rate. Besides, Gvm2 and Gvm3 seem to be involved in asexual reproduction, and mutants are hypersensitive to oxidative and cell membrane stresses. Interestingly, both G protein alpha subunits were most probably involved in V. mali virulence. In infection assays using Malus domestica cv. 'Fuji' leaves and twigs, the size of lesions caused by deletion mutants △Gvm2, or △Gvm3 are significantly reduced. Furthermore, many genes encoding hydrolytic enzymes-important virulence factors in V. mali-are expressed at a lower level in these deletion mutants. Our results suggest that Gvm2 and Gvm3 play an important role in virulence probably by regulation of expression of cell wall degrading enzymes. △Gvm2, and △Gvm3 mutants were further analyzed with respect to their impact on the transcript levels of genes in the cAMP/PKA pathway. The expression of the genes encoding adenylate cyclase VmAC, protein kinase A (PKA) regulatory subunit VmPKR, and PKA catalytic subunit VmPKA1 are down-regulated in both mutants. Further analyses indicated that intracellular cAMP level and PKA activity are down-regulated in the △Gvm3 mutant, but are basically unchanged in the △Gvm2 mutant. Overall, our findings indicate that both Gvm2 and Gvm3 play diverse roles in the modulation of vegetative growth, asexual development, and virulence in V. mali.

  5. Functional redundancy and/or ongoing pseudogenization among F-box protein genes expressed in Arabidopsis male gametophyte.

    PubMed

    Ikram, Sobia; Durandet, Monique; Vesa, Simona; Pereira, Serge; Guerche, Philippe; Bonhomme, Sandrine

    2014-06-01

    F-box protein genes family is one of the largest gene families in plants, with almost 700 predicted genes in the model plant Arabidopsis. F-box proteins are key components of the ubiquitin proteasome system that allows targeted protein degradation. Transcriptome analyses indicate that half of these F-box protein genes are found expressed in microspore and/or pollen, i.e., during male gametogenesis. To assess the role of F-box protein genes during this crucial developmental step, we selected 34 F-box protein genes recorded as highly and specifically expressed in pollen and isolated corresponding insertion mutants. We checked the expression level of each selected gene by RT-PCR and confirmed pollen expression for 25 genes, but specific expression for only 10 of the 34 F-box protein genes. In addition, we tested the expression level of selected F-box protein genes in 24 mutant lines and showed that 11 of them were null mutants. Transmission analysis of the mutations to the progeny showed that none of the single mutations was gametophytic lethal. These unaffected transmission efficiencies suggested leaky mutations or functional redundancy among F-box protein genes. Cytological observation of the gametophytes in the mutants confirmed these results. Combinations of mutations in F-box protein genes from the same subfamily did not lead to transmission defect either, further highlighting functional redundancy and/or a high proportion of pseudogenes among these F-box protein genes.

  6. NTL8 Regulates Trichome Formation in Arabidopsis by Directly Activating R3 MYB Genes TRY and TCL11[OPEN

    PubMed Central

    Tian, Hainan; Wang, Xianling; Guo, Hongyan; Cheng, Yuxin; Hou, Chunjiang

    2017-01-01

    The NAM, ATAF1/2, and CUC (NAC) are plant-specific transcription factors that regulate multiple aspects of plant growth and development and plant response to environmental stimuli. We report here the identification of NTM1-LIKE8 (NTL8), a membrane-associated NAC transcription factor, as a novel regulator of trichome formation in Arabidopsis (Arabidopsis thaliana). From an activation-tagged Arabidopsis population, we identified a dominant, gain-of-function mutant with glabrous inflorescence stem. By using plasmid rescue and RT-PCR analyses, we found that NTL8 was tagged; thus, the mutant was named ntl8-1 Dominant (ntl8-1D). Recapitulation experiment further confirmed that the phenotype observed in the ntl8-1D mutant was caused by elevated expression of NTL8. Quantitative RT-PCR results showed that the expression level of the single-repeat R3 MYB genes TRIPTYCHON (TRY) and TRICHOMELESS1 (TCL1) was elevated in the ntl8-1D mutant. Genetic analyses demonstrated that NTL8 acts upstream of TRY and TCL1 in the regulation of trichome formation. When recruited to the promoter region of the reporter gene Gal4:GUS by a fused GAL4 DNA-binding domain, NTL8 activated the expression of the reporter gene. Chromatin immunoprecipitation results indicated that TRY and TCL1 are direct targets of NTL8. However, NTL8 did not interact with SQUAMOSA PROMOTER BINDING PROTEIN LIKE9, another transcription factor that regulates the expression of TRY and TCL1, in yeast and plant cells. Taken together, our results suggest that NTL8 negatively regulates trichome formation in Arabidopsis by directly activating the expression of TRY and TCL1. PMID:28649093

  7. A Fiberless Seed Mutation in Cotton Is Associated with Lack of Fiber Cell Initiation in Ovule Epidermis and Alterations in Sucrose Synthase Expression and Carbon Partitioning in Developing Seeds1

    PubMed Central

    Ruan, Yong-Ling; Chourey, Prem S.

    1998-01-01

    Fiber cell initiation in the epidermal cells of cotton (Gossypium hirsutum L.) ovules represents a unique example of trichome development in higher plants. Little is known about the molecular and metabolic mechanisms controlling this process. Here we report a comparative analysis of a fiberless seed (fls) mutant (lacking fibers) and a normal (FLS) mutant to better understand the initial cytological events in fiber development and to analyze the metabolic changes that are associated with the loss of a major sink for sucrose during cellulose biosynthesis in the mutant seeds. On the day of anthesis (0 DAA), the mutant ovular epidermal cells lacked the typical bud-like projections that are seen in FLS ovules and are required for commitment to the fiber development pathway. Cell-specific gene expression analyses at 0 DAA showed that sucrose synthase (SuSy) RNA and protein were undetectable in fls ovules but were in abundant, steady-state levels in initiating fiber cells of the FLS ovules. Tissue-level analyses of developing seeds 15 to 35 DAA revealed an altered temporal pattern of SuSy expression in the mutant relative to the normal genotype. Whether the altered programming of SuSy expression is the cause or the result of the mutation is unknown. The developing seeds of the fls mutant have also shown several correlated changes that represent altered carbon partitioning in seed coats and cotyledons as compared with the FLS genotype. PMID:9765525

  8. A fiberless seed mutation in cotton is associated with lack of fiber cell initiation in ovule epidermis and alterations in sucrose synthase expression and carbon partitioning in developing seeds

    PubMed

    Ruan; Chourey

    1998-10-01

    Fiber cell initiation in the epidermal cells of cotton (Gossypium hirsutum L.) ovules represents a unique example of trichome development in higher plants. Little is known about the molecular and metabolic mechanisms controlling this process. Here we report a comparative analysis of a fiberless seed (fls) mutant (lacking fibers) and a normal (FLS) mutant to better understand the initial cytological events in fiber development and to analyze the metabolic changes that are associated with the loss of a major sink for sucrose during cellulose biosynthesis in the mutant seeds. On the day of anthesis (0 DAA), the mutant ovular epidermal cells lacked the typical bud-like projections that are seen in FLS ovules and are required for commitment to the fiber development pathway. Cell-specific gene expression analyses at 0 DAA showed that sucrose synthase (SuSy) RNA and protein were undetectable in fls ovules but were in abundant, steady-state levels in initiating fiber cells of the FLS ovules. Tissue-level analyses of developing seeds 15 to 35 DAA revealed an altered temporal pattern of SuSy expression in the mutant relative to the normal genotype. Whether the altered programming of SuSy expression is the cause or the result of the mutation is unknown. The developing seeds of the fls mutant have also shown several correlated changes that represent altered carbon partitioning in seed coats and cotyledons as compared with the FLS genotype.

  9. Altered fast- and slow-twitch muscle fibre characteristics in female mice with a (S248F) knock-in mutation of the brain neuronal nicotinic acetylcholine receptor.

    PubMed

    Cannata, David J; Finkelstein, David I; Gantois, Ilse; Teper, Yaroslav; Drago, John; West, Jan M

    2009-01-01

    We generated a mouse line with a missense mutation (S248F) in the gene (CHRNA4) encoding the alpha4 subunit of neuronal nicotinic acetylcholine receptor (nAChR). Mutant mice demonstrate brief nicotine induced dystonia that resembles the clinical events seen in patients with the same mutation. Drug-induced dystonia is more pronounced in female mice, thus our aim was to determine if the S248F mutation changed the properties of fast- and slow-twitch muscle fibres from female mutant mice. Reverse transcriptase-PCR confirmed CHRNA4 gene expression in the brain but not skeletal muscles in normal and mutant mice. Ca(2+) and Sr(2+) force activation curves were obtained using skinned muscle fibres prepared from slow-twitch (soleus) and fast-twitch (EDL) muscles. Two significant results were found: (1) the (pCa(50) - pSr(50)) value from EDL fibres was smaller in mutant mice than in wild type (1.01 vs. 1.30), (2) the percentage force produced at pSr 5.5 was larger in mutants than in wild type (5.76 vs. 0.24%). Both results indicate a shift to slow-twitch characteristics in the mutant. This conclusion is supported by the identification of the myosin heavy chain (MHC) isoforms. Mutant EDL fibres expressed MHC I (usually only found in slow-twitch fibres) as well as MHC IIa. Despite the lack of spontaneous dystonic events, our findings suggest that mutant mice may be having subclinical events or the mutation results in a chronic alteration to muscle neural input.

  10. The Agrobacterium tumefaciens rnd Homolog Is Required for TraR-Mediated Quorum-Dependent Activation of Ti Plasmid tra Gene Expression

    PubMed Central

    Luo, Zhao-Qing; Farrand, Stephen K.

    2001-01-01

    Conjugal transfer of Agrobacterium tumefaciens Ti plasmids is regulated by quorum sensing via TraR and its cognate autoinducer, N-(3-oxo-octanoyl)-l-homoserine lactone. We isolated four Tn5-induced mutants of A. tumefaciens C58 deficient in TraR-mediated activation of tra genes on pTiC58ΔaccR. These mutations also affected the growth of the bacterium but had no detectable influence on the expression of two tester gene systems that are not regulated by quorum sensing. In all four mutants Tn5 was inserted in a chromosomal open reading frame (ORF) coding for a product showing high similarity to RNase D, coded for by rnd of Escherichia coli, an RNase known to be involved in tRNA processing. The wild-type allele of the rnd homolog cloned from C58 restored the two phenotypes to each mutant. Several ORFs, including a homolog of cya2, surround A. tumefaciens rnd, but none of these genes exerted a detectable effect on the expression of the tra reporter. In the mutant, traR was expressed from the Ti plasmid at a level about twofold lower than that in NT1. The expression of tra, but not the growth rate, was partially restored by increasing the copy number of traR or by disrupting traM, a Ti plasmid gene coding for an antiactivator specific for TraR. The mutation in rnd also slightly reduced expression of two tested vir genes but had no detectable effect on tumor induction by this mutant. Our data suggest that the defect in tra gene induction in the mutants results from lowered levels of TraR. In turn, production of sufficient amounts of TraR apparently is sensitive to a cellular function requiring RNase D. PMID:11395455

  11. Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ -ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation

    PubMed Central

    Jobe, Timothy O.; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A.; Mendoza-Cózatl, David G.; Schroeder, Julian I.

    2015-01-01

    Summary Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M2 seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. PMID:22283708

  12. Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.

    PubMed

    Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y

    2016-10-07

    CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.

  13. Ectopic expression of pMADS3 in transgenic petunia phenocopies the petunia blind mutant.

    PubMed Central

    Tsuchimoto, S; van der Krol, A R; Chua, N H

    1993-01-01

    We cloned a MADS-box gene, pMADS3, from Petunia hybrida, which shows high sequence homology to the Arabidopsis AGAMOUS and Antirrhinum PLENA. pMADS3 is expressed exclusively in stamens and carpels of wild-type petunia plants. In the petunia mutant blind, which shows homeotic conversions of corolla limbs into antheroid structures with pollen grains and small parts of sepals into carpelloid tissue, pMADS3 is expressed in all floral organs as well as in leaves. Ectopic expression of pMADS3 in transgenic petunia leads to phenocopies of the blind mutant, i.e., the formation of antheroid structures on limbs and carpelloid tissue on sepals. Transgenic tobacco plants that overexpress pMADS3 exhibit an even more severe phenotype, with the sepals forming a carpel-like structure encasing the interior floral organs. Our results identify BLIND as a negative regulator of pMADS3, which specifies stamens and carpels during petunia flower development. PMID:8104573

  14. Proteomic analysis of high yield rice variety mutated from spaceflight

    NASA Astrophysics Data System (ADS)

    Ma, Y.; Cheng, Z.; Wang, W.; Sun, Y.

    Seeds of pure rice varieties were flown on Chinese recoverable satellite, JB-1, for a 15-day flight in 1996. Many mutant rice varieties with various phenotypes were generated after continuous selection and breeding. Among the mutants, a variety 971-5 showed a significant increase in grain yield compared to its control (971ck). In this study, proteomic analysis of both mutant variety 971-5 and control variety 971ck were carried out to investigate the changes of protein expression level in their leaves at three different growth stages (early and middle stage of tillering, and booting stage). Results showed that (1) almost all differentially expressed proteins were down-regulated in 971-5 with only one exception, (2) the percentages of differentially expressed proteins were 3.1%, 2.1% and 3.1% at the three stages, respectively, and (3) one protein showed a significant alteration in its molecular weight (MW). These data demonstrated that the space environment can alter the expression level of rice proteins both quantitatively and qualitatively.

  15. Aggressive behavior of the white-eye mutant crickets, Gryllus bimaculatus.

    PubMed

    Sakura, Midori; Watanabe, T; Aonuma, H

    2012-01-01

    Aggressive behavior of white-eye mutant crickets was investigated and compared with that of wild-type crickets. In the dark, wild-type pairs performed long-lasting fights with significantly higher aggressive levels compared to those in the light. In contrast, fights between two white-eye mutants were not significantly different with those between two wild-type crickets both in duration and the aggressive levels. Ethograms of aggressive behavior showed that the mutants could show typical sequentially escalating fight with the same behavioral categories as the wild-type crickets. These results indicate that the white-eye mutants are able to express normal aggressive behavior.

  16. GBF1 differentially regulates CAT2 and PAD4 transcription to promote pathogen defense in Arabidopsis thaliana.

    PubMed

    Giri, Mrunmay K; Singh, Nidhi; Banday, Zeeshan Z; Singh, Vijayata; Ram, Hathi; Singh, Deepjyoti; Chattopadhyay, Sudip; Nandi, Ashis K

    2017-09-01

    G-BOX BINDING FACTOR 1 (GBF1) influences light-regulated seedling development in Arabidopsis, and inhibits CATALASE 2 (CAT2) expression during senescence. CAT2 functions as a scavenger of hydrogen peroxide. The role of GBF1 in the defense response is not known. We report here that GBF1 positively influences the defense against virulent and avirulent strains of Pseudomonas syringae. The gbf1 mutants are susceptible, whereas GBF1 over-expresser transgenic plants are resistant to bacterial pathogens. GBF1 negatively regulates pathogen-induced CAT2 expression and thereby positively regulates the hypersensitive response. In addition to CAT2 promoter, GBF1 binds to the G-box-like element present in the intron of PHYTOALEXIN DEFICIENT 4 (PAD4). This association of GBF1 with PAD4 intron is enhanced upon pathogenesis. GBF1 positively regulates PAD4 transcription in an intron-dependent manner. GBF1-mediated positive regulation of PAD4 expression is also evident in gbf1 mutant and GBF1 over-expression lines. Similar to pad4 mutants, pathogen-induced camalexin and salicylic acid (SA) accumulation, and expression of SA-inducible PATHOGENESIS RELATED1 (PR1) gene are compromised in the gbf1 mutant. Exogenous application of SA rescues the loss-of-defense phenotypes of gbf1 mutant. Thus, altogether, our results demonstrate that GBF1 is an important component of the plant defense response that functions upstream of SA accumulation and, by oppositely regulating CAT2 and PAD4, promotes disease resistance in Arabidopsis. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  17. Overexpression of the active diacylglycerol acyltransferase variant transforms Saccharomyces cerevisiae into an oleaginous yeast.

    PubMed

    Kamisaka, Yasushi; Kimura, Kazuyoshi; Uemura, Hiroshi; Yamaoka, Masakazu

    2013-08-01

    Lipid production by Saccharomyces cerevisiae was improved by overexpression of the yeast diacylglycerol acyltransferase Dga1p lacking the N-terminal 29 amino acids (Dga1∆Np), which was previously found to be an active form in the ∆snf2 mutant. Overexpression of Dga1∆Np in the ∆snf2 mutant, however, did not increase lipid content as expected, which prompted us to search for a more suitable strain in which to study the role of Dga1∆Np in lipid accumulation. We found that the overexpression of Dga1∆Np in the ∆dga1 mutant effectively increased the lipid content up to about 45 % in the medium containing 10 % glucose. The high lipid content of the transformant was dependent on glucose concentration, nitrogen limitation, and active leucine biosynthesis. To better understand the effect of dga1 disruption on the ability of Dga1∆Np to stimulate lipid accumulation, the ∆dga1-1 mutant, in which the 3'-terminal 36 bp of the dga1 open reading frame (ORF) remained, and the ∆dga1-2 mutant, in which the 3'-terminal 36 bp were also deleted, were prepared with URA3 disruption cassettes. Surprisingly, the overexpression of Dga1∆Np in the ∆dga1-1 mutant had a lower lipid content than the original ∆dga1 mutant, whereas overexpression in the ∆dga1-2 mutant led to a high lipid content of about 45 %. These results indicated that deletion of the 3' terminal region of the dga1 ORF, rather than abrogation of genomic Dga1p expression, was crucial for the effect of Dga1∆Np on lipid accumulation. To investigate whether dga1 disruption affected gene expression adjacent to DGA1, we found that the overexpression of Esa1p together with Dga1∆Np in the ∆dga1 mutant reverted the lipid content to the level of the wild-type strain overexpressing Dga1∆Np. In addition, RT-qPCR analysis revealed that ESA1 mRNA expression in the ∆dga1 mutant was decreased compared to the wild-type strain at the early stages of culture, suggesting that lowered Esa1p expression is involved in the effect of dga1 disruption on Dga1∆Np-dependent lipid accumulation. These results provide a new strategy to engineer S. cerevisiae for optimal lipid production.

  18. Epidermal Phytochrome B Inhibits Hypocotyl Negative Gravitropism Non-Cell-Autonomously.

    PubMed

    Kim, Jaewook; Song, Kijong; Park, Eunae; Kim, Keunhwa; Bae, Gabyong; Choi, Giltsu

    2016-11-01

    Seedling hypocotyls display negative gravitropism in the dark but agravitropism in the light. The Arabidopsis thaliana pif quadruple mutant (pifQ), which lacks four PHYTOCHROME-INTERACTING FACTORS (PIFs), is agravitropic in the dark. Endodermis-specific expression of PIF1 rescues gravitropism in pifQ mutant seedlings. Since phytochromes induce light responses by inhibiting PIFs and the COP1-SPA ubiquitin E3 ligase complex in the nucleus, we asked whether phyB can cell autonomously inhibit hypocotyl negative gravitropism in the endodermis. We found that while epidermis-specific expression of PHYB rescues hypocotyl negative gravitropism and all other phyB mutant phenotypes, endodermis-specific expression of PHYB does not. Epidermal phyB induces the phosphorylation and degradation of endodermal PIFs in response to red light. This induces a global gene expression pattern similar to that induced by red light treatment of seedlings expressing PHYB under the control of its own endogenous promoter. Our results imply that epidermal phyB generates an unidentified mobile signal that travels to the endodermis where it promotes PIF degradation and inhibits hypocotyl negative gravitropism. © 2016 American Society of Plant Biologists. All rights reserved.

  19. Epidermal Phytochrome B Inhibits Hypocotyl Negative Gravitropism Non-Cell-Autonomously

    PubMed Central

    Kim, Jaewook; Song, Kijong; Park, Eunae; Kim, Keunhwa; Choi, Giltsu

    2016-01-01

    Seedling hypocotyls display negative gravitropism in the dark but agravitropism in the light. The Arabidopsis thaliana pif quadruple mutant (pifQ), which lacks four PHYTOCHROME-INTERACTING FACTORS (PIFs), is agravitropic in the dark. Endodermis-specific expression of PIF1 rescues gravitropism in pifQ mutant seedlings. Since phytochromes induce light responses by inhibiting PIFs and the COP1-SPA ubiquitin E3 ligase complex in the nucleus, we asked whether phyB can cell autonomously inhibit hypocotyl negative gravitropism in the endodermis. We found that while epidermis-specific expression of PHYB rescues hypocotyl negative gravitropism and all other phyB mutant phenotypes, endodermis-specific expression of PHYB does not. Epidermal phyB induces the phosphorylation and degradation of endodermal PIFs in response to red light. This induces a global gene expression pattern similar to that induced by red light treatment of seedlings expressing PHYB under the control of its own endogenous promoter. Our results imply that epidermal phyB generates an unidentified mobile signal that travels to the endodermis where it promotes PIF degradation and inhibits hypocotyl negative gravitropism. PMID:27758895

  20. Overexpression of SOS genes in ciprofloxacin resistant Escherichia coli mutants.

    PubMed

    Pourahmad Jaktaji, Razieh; Pasand, Shirin

    2016-01-15

    Fluoroquinolones are important antibiotics for the treatment of urinary tract infections caused by Escherichia coli. Mutational studies have shown that ciprofloxacin, a member of fluoroquinolones induces SOS response and mutagenesis in pathogenic bacteria which in turn develop antibiotic resistance. However, inhibition of SOS response can increase recombination activity which in turn leads to genetic variation. The aim of this study was to measure 5 SOS genes expressions in nine E. coli mutants with different MICs for ciprofloxacin following exposure to ciprofloxacin. Gene expression was assessed by quantitative real time PCR. Gene alteration assessment was conducted by PCR amplification and DNA sequencing. Results showed that the expression of recA was increased in 5 mutants. This overexpression is not related to gene alteration, and enhances the expression of polB and umuCD genes encoding nonmutagenic and mutagenic polymerases, respectively. The direct relationship between the level of SOS expression and the level of resistance to ciprofloxacin was also indicated. It was concluded that novel therapeutic strategy that inhibits RecA activity would enhance the efficiency of common antibiotics against pathogenic bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Stromal deletion of the APC tumor suppressor in mice triggers development of endometrial cancer

    PubMed Central

    Tanwar, Pradeep S.; Zhang, LiHua; Roberts, Drucilla J.; Teixeira, Jose M.

    2011-01-01

    The contribution of the stromal microenvironment to the progression of endometrial cancer (EC) has not been well explored. We have conditionally expressed a mutant allele of adenomatous polyposis coli (APCcKO) in murine uterine stroma cells to study its effect on uterine development and function. In addition to metrorrhagia, the mice develop complex atypical endometrial gland hyperplasia that progresses to endometrial carcinoma in situ and endometrial adenocarcinoma as evidenced by myometrial invasion. Stromal cells subjacent to the carcinoma cells express αSMA with fewer cells expressing PDGFR-α compared to normal stromal cells suggesting that the mutant stromal cells have acquired a more myofibroblastic phenotype, which have been described as cancer-associated fibroblasts and have been shown to induce carcinogenesis in other organ systems. Analyses of human EC specimens showed substantial αSMA expression in the stroma compared with normal endometrial stroma cells. We also show that APCcKO mutant uteri and human EC have decreased stromal levels of TGFβ and BMP activities and that the mutant uteri failed to respond to exogenous estradiol stimulation. The mutant stroma cells also had higher levels of VEGF and SDF signaling components and diminished expression of ERα and PR which is common in advanced stages of human EC and is an indicator of poor prognosis. Our results indicate that de novo mutation or loss of heterozygosity in stromal APC is sufficient to induce endometrial hyperplasia and endometrial carcinogenesis by mechanisms that are consistent with unopposed estrogen signaling in the endometrial epithelium. PMID:21363919

  2. The Role of Ethylene and Wound Signaling in Resistance of Tomato to Botrytis cinerea1

    PubMed Central

    Díaz, José; ten Have, Arjen; van Kan, Jan A.L.

    2002-01-01

    Ethylene, jasmonate, and salicylate play important roles in plant defense responses to pathogens. To investigate the contributions of these compounds in resistance of tomato (Lycopersicon esculentum) to the fungal pathogen Botrytis cinerea, three types of experiments were conducted: (a) quantitative disease assays with plants pretreated with ethylene, inhibitors of ethylene perception, or salicylate; (b) quantitative disease assays with mutants or transgenes affected in the production of or the response to either ethylene or jasmonate; and (c) expression analysis of defense-related genes before and after inoculation of plants with B. cinerea. Plants pretreated with ethylene showed a decreased susceptibility toward B. cinerea, whereas pretreatment with 1-methylcyclopropene, an inhibitor of ethylene perception, resulted in increased susceptibility. Ethylene pretreatment induced expression of several pathogenesis-related protein genes before B. cinerea infection. Proteinase inhibitor I expression was repressed by ethylene and induced by 1-methylcyclopropene. Ethylene also induced resistance in the mutant Never ripe. RNA analysis showed that Never ripe retained some ethylene sensitivity. The mutant Epinastic, constitutively activated in a subset of ethylene responses, and a transgenic line producing negligible ethylene were also tested. The results confirmed that ethylene responses are important for resistance of tomato to B. cinerea. The mutant Defenseless, impaired in jasmonate biosynthesis, showed increased susceptibility to B. cinerea. A transgenic line with reduced prosystemin expression showed similar susceptibility as Defenseless, whereas a prosystemin-overexpressing transgene was highly resistant. Ethylene and wound signaling acted independently on resistance. Salicylate and ethylene acted synergistically on defense gene expression, but antagonistically on resistance. PMID:12114587

  3. Unravelling the contribution of the Penicillium expansum PeSte12 transcription factor to virulence during apple fruit infection.

    PubMed

    Sánchez-Torres, Paloma; Vilanova, Laura; Ballester, Ana Rosa; López-Pérez, Mario; Teixidó, Neus; Viñas, Inmaculada; Usall, Josep; González-Candelas, Luis; Torres, Rosario

    2018-02-01

    Blue mould disease caused by Penicillium expansum infection is one of the most important diseases of pome fruit accounting for important economic losses. In the present study, the PeSte12 transcription factor gene was identified, and deletant mutants were produced by gene replacement. Knockout mutants showed a significant decrease of virulence during apple fruit infection. Virulence was affected by the maturity stage of the fruit (immature, mature and over-mature), and disease severity was notably reduced when the apples were stored at 0 °C. The ΔPeSte12 mutants resulted defective in asexual reproduction, producing less conidia, but this characteristic did not correlate with differences in microscopic morphology. In addition, the ΔPeSte12 mutants produced higher quantity of hydrogen peroxide than the wild type strain. Gene expression analysis revealed that PeSte12 was induced over time during apple infection compared to axenic growth, particularly from 2 dpi, reinforcing its role in virulence. Analysis of transcriptional abundance of several genes in ΔPeSte12 mutants showed that in most of the evaluated genes, PeSte12 seemed to act as a negative regulator during axenic growth, as most of them exhibited an increasing expression pattern along the time period evaluated. The highest expression values corresponded to detoxification, ATPase activity, protein folding and basic metabolism. Gene expression analysis during apple infection showed that 3 out of 9 analysed genes were up regulated; thus, PeSte12 seemed to exert a positive control to particular type of aldolase. These results demonstrate the PeSte12 transcription factor could play an important role in P. expansum's virulence and asexual reproduction. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Reduced expression of the NMDA receptor-interacting protein SynGAP causes behavioral abnormalities that model symptoms of Schizophrenia.

    PubMed

    Guo, Xiaochuan; Hamilton, Peter J; Reish, Nicholas J; Sweatt, J David; Miller, Courtney A; Rumbaugh, Gavin

    2009-06-01

    Abnormal function of NMDA receptors is believed to be a contributing factor to the pathophysiology of schizophrenia. NMDAR subunits and postsynaptic-interacting proteins of these channels are abnormally expressed in some patients with this illness. In mice, reduced NMDAR expression leads to behaviors analogous to symptoms of schizophrenia, but reports of animals with mutations in core postsynaptic density proteins having similar a phenotype have yet to be reported. Here we show that reduced expression of the neuronal RasGAP and NMDAR-associated protein, SynGAP, results in abnormal behaviors strikingly similar to that reported in mice with reduced NMDAR function. SynGAP mutant mice exhibited nonhabituating and persistent hyperactivity that was ameliorated by the antipsychotic clozapine. An NMDAR antagonist, MK-801, induced hyperactivity in normal mice but SynGAP mutants were less responsive, suggesting that NMDAR hypofunction contributes to this behavioral abnormality. SynGAP mutants exhibited enhanced startle reactivity and impaired sensory-motor gating. These mice also displayed a complete lack of social memory and a propensity toward social isolation. Finally, SynGAP mutants had deficits in cued fear conditioning and working memory, indicating abnormal function of circuits that control emotion and choice. Our results demonstrate that SynGAP mutant mice have gross neurological deficits similar to other mouse models of schizophrenia. Because SynGAP interacts with NMDARs, and the signaling activity of this protein is regulated by these channels, our data in dicate that SynGAP lies downstream of NMDARs and is a required intermediate for normal neural circuit function and behavior. Taken together, these data support the idea that schizophrenia may arise from abnormal signaling pathways that are mediated by NMDA receptors.

  5. Down regulation of miR-124 in both Werner syndrome DNA helicase mutant mice and mutant Caenorhabditis elegans wrn-1 reveals the importance of this microRNA in accelerated aging

    PubMed Central

    Dallaire, Alexandra; Garand, Chantal; Paquet, Eric R.; Mitchell, Sarah J.; de Cabo, Rafael; Simard, Martin J.

    2012-01-01

    Small non-coding microRNAs are believed to be involved in the mechanism of aging but nothing is known on the impact of microRNAs in the progeroid disorder Werner syndrome (WS). WS is a premature aging disorder caused by mutations in a RecQ-like DNA helicase. Mice lacking the helicase domain of the WRN ortholog exhibit many phenotypic features of WS, including a pro-oxidant status and a shorter mean life span. Caenorhabditis elegans (C. elegans) with a nonfunctional wrn-1 DNA helicase also exhibit a shorter life span. Thus, both models are relevant to study the expression of microRNAs involved in WS. In this study, we show that miR-124 expression is lost in the liver of Wrn helicase mutant mice. Interestingly, the expression of this conserved miR-124 in whole wrn-1 mutant worms is also significantly reduced. The loss of mir-124 in C. elegans increases reactive oxygen species formation and accumulation of the aging marker lipofuscin, reduces whole body ATP levels and results in a reduction in life span. Finally, supplementation of vitamin C normalizes the median life span of wrn-1 and mir-124 mutant worms. These results suggest that biological pathways involving WRN and miR-124 are conserved in the aging process across different species. PMID:23075628

  6. Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit

    PubMed Central

    Yang, Ying; Yang, Feng; Li, Yan-Hong; Liu, He-Ping; Chen, Xiao-Yan

    2017-01-01

    Aspergillus niger, a saprophytic fungus, is widely distributed in soil, air and cereals, and can cause postharvest diseases in fruit. Polygalacturonase (PG) is one of the main enzymes in fungal pathogens to degrade plant cell wall. To evaluate whether the deletion of an exo-polygalacturonase gene pgxB would influence fungal pathogenicity to fruit, pgxB gene was deleted in Aspergillus niger MA 70.15 (wild type) via homologous recombination. The ΔpgxB mutant showed similar growth behavior compared with the wild type. Pectin medium induced significant higher expression of all pectinase genes in both wild type and ΔpgxB in comparison to potato dextrose agar medium. However, the ΔpgxB mutant was less virulent on apple fruits as the necrosis diameter caused by ΔpgxB mutant was significantly smaller than that of wild type. Results of quantitive-PCR showed that, in the process of infection in apple fruit, gene expressions of polygalacturonase genes pgaI, pgaII, pgaA, pgaC, pgaD and pgaE were enhanced in ΔpgxB mutant in comparison to wild type. These results prove that, despite the increased gene expression of other polygalacturonase genes in ΔpgxB mutant, the lack of pgxB gene significantly reduced the virulence of A. niger on apple fruit, suggesting that pgxB plays an important role in the infection process on the apple fruit. PMID:28257463

  7. Mutational and Functional Analysis of the β-Carotene Ketolase Involved in the Production of Canthaxanthin and Astaxanthin

    PubMed Central

    Ye, Rick W.; Stead, Kristen J.; Yao, Henry; He, Hongxian

    2006-01-01

    Biosynthesis of the commercial carotenoids canthaxanthin and astaxanthin requires β-carotene ketolase. The functional importance of the conserved amino acid residues of this enzyme from Paracoccus sp. strain N81106 (formerly classified as Agrobacterium aurantiacum) was analyzed by alanine-scanning mutagenesis. Mutations in the three highly conserved histidine motifs involved in iron coordination abolished its ability to catalyze the formation of ketocarotenoids. This supports the hypothesis that the CrtW ketolase belongs to the family of iron-dependent integral membrane proteins. Most of the mutations generated at other highly conserved residues resulted in partial activity. All partially active mutants showed a higher amount of adonixanthin accumulation than did the wild type when expressed in Escherichia coli cells harboring the zeaxanthin biosynthetic gene cluster. Some of the partially active mutants also produced a significant amount of echinenone when expressed in cells producing β-carotene. In fact, expression of a mutant carrying D117A resulted in the accumulation of echinenone as the predominant carotenoid. These observations indicate that partial inactivation of the CrtW ketolase can often lead to the production of monoketolated intermediates. In order to improve the conversion rate of astaxanthin catalyzed by the CrtW ketolase, a color screening system was developed. Three randomly generated mutants, carrying L175M, M99V, and M99I, were identified to have improved activity. These mutants are potentially useful in pathway engineering for the production of astaxanthin. PMID:16957201

  8. Valosin-containing protein VCP/p97 is essential for the intracellular development of Leishmania and its survival under heat stress.

    PubMed

    Guedes Aguiar, Bruno; Padmanabhan, Prasad K; Dumas, Carole; Papadopoulou, Barbara

    2018-06-12

    Valosin-containing protein (VCP)/p97/Cdc48 is one of the best-characterised type II cytosolic AAA+ ATPases most known for their role in ubiquitin-dependent protein quality control. Here, we provide functional insights into the role of the Leishmania VCP/p97 homologue (LiVCP) in the parasite intracellular development. We demonstrate that although LiVCP is an essential gene, Leishmania infantum promastigotes can grow with less VCP. In contrast, growth of axenic and intracellular amastigotes is dramatically affected upon decreased LiVCP levels in heterozygous and temperature sensitive (ts) LiVCP mutants or the expression of dominant negative mutants known to specifically target the second conserved VCP ATPase domain, a major contributor of the VCP overall ATPase activity. Interestingly, these VCP mutants are also unable to survive heat stress, and a ts VCP mutant is defective in amastigote growth. Consistent with LiVCP's essential function in amastigotes, LiVCP messenger ribonucleic acid undergoes 3'Untranslated Region (UTR)-mediated developmental regulation, resulting in higher VCP expression in amastigotes. Furthermore, we show that parasite mutant lines expressing lower VCP levels or dominant negative VCP forms exhibit high accumulation of polyubiquitinated proteins and increased sensitivity to proteotoxic stress, supporting the ubiquitin-selective chaperone function of LiVCP. Together, these results emphasise the crucial role LiVCP plays under heat stress and during the parasite intracellular development. © 2018 John Wiley & Sons Ltd.

  9. Drosophila Fatty Acid Transport Protein Regulates Rhodopsin-1 Metabolism and Is Required for Photoreceptor Neuron Survival

    PubMed Central

    Dourlen, Pierre; Bertin, Benjamin; Chatelain, Gilles; Robin, Marion; Napoletano, Francesco; Roux, Michel J.; Mollereau, Bertrand

    2012-01-01

    Tight regulation of the visual response is essential for photoreceptor function and survival. Visual response dysregulation often leads to photoreceptor cell degeneration, but the causes of such cell death are not well understood. In this study, we investigated a fatty acid transport protein (fatp) null mutation that caused adult-onset and progressive photoreceptor cell death. Consistent with fatp having a role in the retina, we showed that fatp is expressed in adult photoreceptors and accessory cells and that its re-expression in photoreceptors rescued photoreceptor viability in fatp mutants. The visual response in young fatp-mutant flies was abnormal with elevated electroretinogram amplitudes associated with high levels of Rhodopsin-1 (Rh1). Reducing Rh1 levels in rh1 mutants or depriving flies of vitamin A rescued photoreceptor cell death in fatp mutant flies. Our results indicate that fatp promotes photoreceptor survival by regulating Rh1 abundance. PMID:22844251

  10. Transcription factors WRKY11 and WRKY17 are involved in abiotic stress responses in Arabidopsis.

    PubMed

    Ali, Muhammad Amjad; Azeem, Farrukh; Nawaz, Muhammad Amjad; Acet, Tuba; Abbas, Amjad; Imran, Qari Muhammad; Shah, Kausar Hussain; Rehman, Hafiz Mamoon; Chung, Gyuhwa; Yang, Seung Hwan; Bohlmann, Holger

    2018-04-17

    Plant WRKY transcription factors play a vital role in abiotic stress tolerance and regulation of plant defense responses. This study examined AtWRKY11 and AtWRKY17 expression under ABA, salt, and osmotic stress at different developmental stages in Arabidopsis. We used reverse transcriptase PCR, quantitative real-time PCR, and promoter:GUS lines to analyze expression. Both genes were upregulated in response to abiotic stress. Next, we applied the same stressors to seedlings of T-DNA insertion wrky11 and 17 knock-out mutants (single and double). Under stress, the mutants exhibited slower germination and compromised root growth compared with the wild type. In most cases, double-mutant seedlings were more affected than single mutants. These results suggest that wrky11 and wrky17 are not strictly limited to plant defense responses but are also involved in conferring stress tolerance. Copyright © 2018 Elsevier GmbH. All rights reserved.

  11. [MicroRNA in neurodegenerative disorders].

    PubMed

    Sobue, Gen

    2013-01-01

    MicroRNAs (miRNAs) bind to the 3'-untranslated region of mRNA, and thereby suppress the gene expression. Recent studies suggest that miRNAs modify the pathogenesis of cancer and neurodegeneration. Our study demonstrated that the expression levels of miR-196a is increased in a mouse model of spinal and bulbar muscular atrophy (SBMA), a neurodegenerative disease caused by the expansion of polyglutamine in androgen receptor (AR). In cultured neuronal cells, miR-196a decayed the mutant AR mRNA via silencing CUG triplet repeat RNA binding protein 2, a potent miR-196a targeting mRNA, which contributed to stabilize the mutant AR mRNA. Adeno-associated virus vector-mediated delivery of this miRNA attenuates the expression of the mutant AR, resulting in the mitigation of motor neuron degeneration in the SBMA mice. Introduction of miRNA appears to be a novel therapeutic strategy for devastating neurodegenerative diseases.

  12. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica.

    PubMed

    Maluf, Mirian Perez; da Silva, Carla Cristina; de Oliveira, Michelle de Paula Abreu; Tavares, Aline Gomes; Silvarolla, Maria Bernadete; Guerreiro, Oliveiro

    2009-10-01

    In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  13. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    PubMed Central

    2009-01-01

    In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence. PMID:21637458

  14. A gibberellin-stimulated transcript, OsGASR1, controls seedling growth and α-amylase expression in rice.

    PubMed

    Lee, Sang-Choon; Kim, Soo-Jin; Han, Soon-Ki; An, Gynheung; Kim, Seong-Ryong

    2017-07-01

    From a T-DNA-tagging population in rice, we identified OsGASR1 (LOC_Os03g55290), a member of the GAST (gibberellin (GA)-Stimulated Transcript) family that is induced by salt stress and ABA treatment. This gene was highly expressed in the regions of cell proliferation and panicle development, as revealed by a GUS assay of the mutant line. In the osgasr1 mutants, the second leaf blades were much longer than those of the segregating wild type due to an increase in cell length. In addition, five α-amylase genes were up-regulated in the mutants, implying that OsGASR1 is a negative regulator of those genes. These results suggest that OsGASR1 plays important roles in seedling growth and α-amylase gene expression. Copyright © 2017 Elsevier GmbH. All rights reserved.

  15. Engineering the bacterial shapes for enhanced inclusion bodies accumulation.

    PubMed

    Jiang, Xiao-Ran; Wang, Huan; Shen, Rui; Chen, Guo-Qiang

    2015-05-01

    Many bacteria can accumulate inclusion bodies such as sulfur, polyphosphate, glycogen, proteins or polyhydroxyalkanoates. To exploit bacteria as factories for effective production of inclusion bodies, a larger intracellular space is needed for more inclusion body accumulation. In this study, polyhydroxybutyrate (PHB) was investigated as an inclusion bodies representative to be accumulated by Escherichia coli JM109SG. Various approaches were taken to increase the bacterial cell sizes including deletion on actin-like protein gene mreB, weak expression of mreB in mreB deletion mutant, and weak expression of mreB in mreB deletion mutant under inducible expression of SulA, the inhibitor of division ring protein FtsZ. All of the methods resulted in different levels of increases in bacterial sizes and PHB granules accumulation. Remarkably, an increase of over 100% PHB accumulation was observed in recombinant E. coli overexpressing mreB in an mreB deletion mutant under inducible expression of FtsZ inhibiting protein SulA. The molecular mechanism of enlarged bacterial size was found to be directly relate to weakened cytoskeleton which was the result of broken skeleton helix. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  16. Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice

    PubMed Central

    Yamanaka, Koji; Boillee, Severine; Roberts, Elizabeth A.; Garcia, Michael L.; McAlonis-Downes, Melissa; Mikse, Oliver R.; Cleveland, Don W.; Goldstein, Lawrence S. B.

    2008-01-01

    Dominant mutations in ubiquitously expressed superoxide dismutase (SOD1) cause familial ALS by provoking premature death of adult motor neurons. To test whether mutant damage to cell types beyond motor neurons is required for the onset of motor neuron disease, we generated chimeric mice in which all motor neurons and oligodendrocytes expressed mutant SOD1 at a level sufficient to cause fatal, early-onset motor neuron disease when expressed ubiquitously, but did so in a cellular environment containing variable numbers of non-mutant, non-motor neurons. Despite high-level mutant expression within 100% of motor neurons and oligodendrocytes, in most of these chimeras, the presence of WT non-motor neurons substantially delayed onset of motor neuron degeneration, increasing disease-free life by 50%. Disease onset is therefore non-cell autonomous, and mutant SOD1 damage within cell types other than motor neurons and oligodendrocytes is a central contributor to initiation of motor neuron degeneration. PMID:18492803

  17. Transcriptome analysis of the epidermis of the purple quail-like (q-lp) mutant of silkworm, Bombyx mori.

    PubMed

    Wang, Pingyang; Qiu, Zhiyong; Xia, Dingguo; Tang, Shunming; Shen, Xingjia; Zhao, Qiaoling

    2017-01-01

    A new purple quail-like (q-lp) mutant found from the plain silkworm strain 932VR has pigment dots on the epidermis similar to the pigment mutant quail (q). In addition, q-lp mutant larvae are inactive, consume little and grow slowly, with a high death rate and other developmental abnormalities. Pigmentation of the silkworm epidermis consists of melanin, ommochrome and pteridine. Silkworm development is regulated by ecdysone and juvenile hormone. In this study, we performed RNA-Seq on the epidermis of the q-lp mutant in the 4th instar during molting, with 932VR serving as the control. The results showed 515 differentially expressed genes, of which 234 were upregulated and 281 downregulated in q-lp. BLASTGO analysis indicated that the downregulated genes mainly encode protein-binding proteins, membrane components, oxidation/reduction enzymes, and proteolytic enzymes, whereas the upregulated genes largely encode cuticle structural constituents, membrane components, transport related proteins, and protein-binding proteins. Quantitative reverse transcription PCR was used to verify the accuracy of the RNA-Seq data, focusing on key genes for biosynthesis of the three pigments and chitin as well as genes encoding cuticular proteins and several related nuclear receptors, which are thought to play key roles in the q-lp mutant. We drew three conclusions based on the results: 1) melanin, ommochrome and pteridine pigments are all increased in the q-lp mutant; 2) more cuticle proteins are expressed in q-lp than in 932VR, and the number of upregulated cuticular genes is significantly greater than downregulated genes; 3) the downstream pathway regulated by ecdysone is blocked in the q-lp mutant. Our research findings lay the foundation for further research on the developmental changes responsible for the q-lp mutant.

  18. Transcript profiling of crown rootless1 mutant stem base reveals new elements associated with crown root development in rice

    PubMed Central

    2011-01-01

    Background In rice, the major part of the post-embryonic root system is made of stem-derived roots named crown roots (CR). Among the few characterized rice mutants affected in root development, crown rootless1 mutant is unable to initiate crown root primordia. CROWN ROOTLESS1 (CRL1) is induced by auxin and encodes an AS2/LOB-domain transcription factor that acts upstream of the gene regulatory network controlling CR development. Results To identify genes involved in CR development, we compared global gene expression profile in stem bases of crl1 mutant and wild-type (WT) plants. Our analysis revealed that 250 and 236 genes are down- and up-regulated respectively in the crl1 mutant. Auxin induces CRL1 expression and consequently it is expected that auxin also alters the expression of genes that are early regulated by CRL1. To identify genes under the early control of CRL1, we monitored the expression kinetics of a selected subset of genes, mainly chosen among those exhibiting differential expression, in crl1 and WT following exogenous auxin treatment. This analysis revealed that most of these genes, mainly related to hormone, water and nutrient, development and homeostasis, were likely not regulated directly by CRL1. We hypothesized that the differential expression for these genes observed in the crl1 mutant is likely a consequence of the absence of CR formation. Otherwise, three CRL1-dependent auxin-responsive genes: FSM (FLATENNED SHOOT MERISTEM)/FAS1 (FASCIATA1), GTE4 (GENERAL TRANSCRIPTION FACTOR GROUP E4) and MAP (MICROTUBULE-ASSOCIATED PROTEIN) were identified. FSM/FAS1 and GTE4 are known in rice and Arabidopsis to be involved in the maintenance of root meristem through chromatin remodelling and cell cycle regulation respectively. Conclusion Our data showed that the differential regulation of most genes in crl1 versus WT may be an indirect consequence of CRL1 inactivation resulting from the absence of CR in the crl1 mutant. Nevertheless some genes, FAS1/FSM, GTE4 and MAP, require CRL1 to be induced by auxin suggesting that they are likely directly regulated by CRL1. These genes have a function related to polarized cell growth, cell cycle regulation or chromatin remodelling. This suggests that these genes are controlled by CRL1 and involved in CR initiation in rice. PMID:21806801

  19. A eukaryotic-type signalling system of Pseudomonas aeruginosa contributes to oxidative stress resistance, intracellular survival and virulence

    PubMed Central

    2011-01-01

    Background The genome of Pseudomonas aeruginosa contains at least three genes encoding eukaryotic-type Ser/Thr protein kinases, one of which, ppkA, has been implicated in P. aeruginosa virulence. Together with the adjacent pppA phosphatase gene, they belong to the type VI secretion system (H1-T6SS) locus, which is important for bacterial pathogenesis. To determine the biological function of this protein pair, we prepared a pppA-ppkA double mutant and characterised its phenotype and transcriptomic profiles. Results Phenotypic studies revealed that the mutant grew slower than the wild-type strain in minimal media and exhibited reduced secretion of pyoverdine. In addition, the mutant had altered sensitivity to oxidative and hyperosmotic stress conditions. Consequently, mutant cells had an impaired ability to survive in murine macrophages and an attenuated virulence in the plant model of infection. Whole-genome transcriptome analysis revealed that pppA-ppkA deletion affects the expression of oxidative stress-responsive genes, stationary phase σ-factor RpoS-regulated genes, and quorum-sensing regulons. The transcriptome of the pppA-ppkA mutant was also analysed under conditions of oxidative stress and showed an impaired response to the stress, manifested by a weaker induction of stress adaptation genes as well as the genes of the SOS regulon. In addition, expression of either RpoS-regulated genes or quorum-sensing-dependent genes was also affected. Complementation analysis confirmed that the transcription levels of the differentially expressed genes were specifically restored when the pppA and ppkA genes were expressed ectopically. Conclusions Our results suggest that in addition to its crucial role in controlling the activity of P. aeruginosa H1-T6SS at the post-translational level, the PppA-PpkA pair also affects the transcription of stress-responsive genes. Based on these data, it is likely that the reduced virulence of the mutant strain results from an impaired ability to survive in the host due to the limited response to stress conditions. PMID:21880152

  20. Mistargeting of a truncated Na-K-2Cl cotransporter in epithelial cells.

    PubMed

    Koumangoye, Rainelli; Omer, Salma; Delpire, Eric

    2018-05-02

    We recently reported the case of a young patient with multi-system failure carrying a de novo mutation in SLC12A2, the gene encoding the Na-K-2Cl cotransporter-1. Heterologous expression studies in non-epithelial cells failed to demonstrate dominant-negative effects. In this study, we examined expression of the mutant cotransporter in epithelial cells. Using MDCK cells grown on glass coverslips, permeabilized support, and matrigel, we show that the fluorescently-tagged mutant cotransporter is expressed in cytoplasm and at the apical membrane and affects epithelium integrity. Expression of the mutant transporter at the apical membrane also results in the mislocalization of some of the wild-type transporter to the apical membrane. This mistargeting is specific to NKCC1 as the Na + /K + -ATPase remains localized on the basolateral membrane. To assess transporter localization in vivo, we created a mouse model using CRISPR/cas9 that reproduces the 11 bp deletion in exon 22 of Slc12a2. While the mice do not display an overt phenotype, we show that the colon and salivary gland expresses wild-type NKCC1 abundantly at the apical pole, confirming the data obtained in cultured epithelial cells. Enough cotransporter must remain, however, on the basolateral membrane to participate in saliva secretion, as no significant decrease in saliva production was observed in the mutant mice.

  1. The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

    PubMed

    Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

    2017-11-24

    To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

  2. Expression of Mutant Human DISC1 in Mice Supports Abnormalities in Differentiation of Oligodendrocytes

    PubMed Central

    Katsel, Pavel; Tan, Weilun; Abazyan, Bagrat; Davis, Kenneth L; Ross, Christopher; Pletnikov, Mikhail V; Haroutunian, Vahram

    2011-01-01

    Abnormalities in oligodendrocyte (OLG) differentiation and OLG gene expression deficit have been described in schizophrenia (SZ). Recent studies revealed a critical requirement for Disrupted-in-Schizophrenia 1 (DISC1) in neural development. Transgenic mice with forebrain restricted expression of mutant human DISC1 (ΔhDISC1) are characterized by neuroanatomical and behavioral abnormalities reminiscent of some features of SZ. We sought to determine whether the expression of ΔhDISC1 may influence the development of OLGs in this mouse model. OLG- and cell cycle-associated gene and protein expression were characterized in the forebrain of ΔhDISC1 mice during different stages of neurodevelopment (E15 and P1 days) and in adulthood. The results suggest that the expression of ΔhDISC1 exerts a significant influence on oligodendrocyte differentiation and function, evidenced by premature OLG differentiation and increased proliferation of their progenitors. Additional findings showed that neuregulin 1 and its receptors may be contributing factors to the observed upregulation of OLG genes. Thus, OLG function may be perturbed by mutant hDISC1 in a model system that provides new avenues for studying aspects of the pathogenesis of SZ. PMID:21605958

  3. notch3 is essential for oligodendrocyte development and vascular integrity in zebrafish

    PubMed Central

    Zaucker, Andreas; Mercurio, Sara; Sternheim, Nitzan; Talbot, William S.; Marlow, Florence L.

    2013-01-01

    SUMMARY Mutations in the human NOTCH3 gene cause CADASIL syndrome (cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy). CADASIL is an inherited small vessel disease characterized by diverse clinical manifestations including vasculopathy, neurodegeneration and dementia. Here we report two mutations in the zebrafish notch3 gene, one identified in a previous screen for mutations with reduced expression of myelin basic protein (mbp) and another caused by a retroviral insertion. Reduced mbp expression in notch3 mutant embryos is associated with fewer oligodendrocyte precursor cells (OPCs). Despite an early neurogenic phenotype, mbp expression recovered at later developmental stages and some notch3 homozygous mutants survived to adulthood. These mutants, as well as adult zebrafish carrying both mutant alleles together, displayed a striking stress-associated accumulation of blood in the head and fins. Histological analysis of mutant vessels revealed vasculopathy, including: an enlargement (dilation) of vessels in the telencephalon and fin, disorganization of the normal stereotyped arrangement of vessels in the fin, and an apparent loss of arterial morphological structure. Expression of hey1, a well-known transcriptional target of Notch signaling, was greatly reduced in notch3 mutant fins, suggesting that Notch3 acts via a canonical Notch signaling pathway to promote normal vessel structure. Ultrastructural analysis confirmed the presence of dilated vessels in notch3 mutant fins and revealed that the vessel walls of presumed arteries showed signs of deterioration. Gaps in the arterial wall and the presence of blood cells outside of vessels in mutants indicated that compromised vessel structure led to hemorrhage. In notch3 heterozygotes, we found elevated expression of both notch3 itself and target genes, indicating that specific alterations in gene expression due to partial loss of Notch3 function might contribute to the abnormalities observed in heterozygous larvae and adults. Our analysis of zebrafish notch3 mutants indicates that Notch3 regulates OPC development and mbp gene expression in larvae, and maintains vascular integrity in adults. PMID:23720232

  4. Defective phagosome motility and degradation in cell nonautonomous RPE pathogenesis of a dominant macular degeneration.

    PubMed

    Esteve-Rudd, Julian; Hazim, Roni A; Diemer, Tanja; Paniagua, Antonio E; Volland, Stefanie; Umapathy, Ankita; Williams, David S

    2018-05-22

    Stargardt macular dystrophy 3 (STGD3) is caused by dominant mutations in the ELOVL4 gene. Like other macular degenerations, pathogenesis within the retinal pigment epithelium (RPE) appears to contribute to the loss of photoreceptors from the central retina. However, the RPE does not express ELOVL4 , suggesting photoreceptor cell loss in STGD3 occurs through two cell nonautonomous events: mutant photoreceptors first affect RPE cell pathogenesis, and then, second, RPE dysfunction leads to photoreceptor cell death. Here, we have investigated how the RPE pathology occurs, using a STGD3 mouse model in which mutant human ELOVL4 is expressed in the photoreceptors. We found that the mutant protein was aberrantly localized to the photoreceptor outer segment (POS), and that resulting POS phagosomes were degraded more slowly in the RPE. In cell culture, the mutant POSs are ingested by primary RPE cells normally, but the phagosomes are processed inefficiently, even by wild-type RPE. The mutant phagosomes excessively sequester RAB7A and dynein, and have impaired motility. We propose that the abnormal presence of ELOVL4 protein in POSs results in phagosomes that are defective in recruiting appropriate motor protein linkers, thus contributing to slower degradation because their altered motility results in slower basal migration and fewer productive encounters with endolysosomes. In the transgenic mouse retinas, the RPE accumulated abnormal-looking phagosomes and oxidative stress adducts; these pathological changes were followed by pathology in the neural retina. Our results indicate inefficient phagosome degradation as a key component of the first cell nonautonomous event underlying retinal degeneration due to mutant ELOVL4.

  5. Cucumber (Cucumis sativus L.) Nitric Oxide Synthase Associated Gene1 (CsNOA1) Plays a Role in Chilling Stress

    PubMed Central

    Liu, Xingwang; Liu, Bin; Xue, Shudan; Cai, Yanlinq; Qi, Wenzhu; Jian, Chen; Xu, Shuo; Wang, Ting; Ren, Huazhong

    2016-01-01

    Nitric oxide (NO) is a gaseous signaling molecule in plants, transducing information as a result of exposure to low temperatures. However, the underlying molecular mechanism linking NO with chilling stress is not well understood. Here, we functionally characterized the cucumber (Cucumis sativus L.) nitric oxide synthase-associated gene, NITRIC OXIDE ASSOCIATED 1 (CsNOA1). Expression analysis of CsNOA1, using quantitative real-time PCR, in situ hybridization, and a promoter::β-glucuronidase (GUS) reporter assay, revealed that it is expressed mainly in the root and shoot apical meristem (SAM), and that expression is up-regulated by low temperatures. A CsNOA1-GFP fusion protein was found to be localized in the mitochondria, and ectopic expression of CsNOA1 in the A. thaliana noa1 mutant partially rescued the normal phenotype. When overexpressing CsNOA1 in the Atnoa1 mutant under normal condition, no obvious phenotypic differences was observed between its wild type and transgenic plants. However, the leaves from mutant plant grown under chilling conditions showed hydrophanous spots and wilting. Physiology tolerance markers, chlorophyll fluorescence parameter (Fv/Fm), and electrolyte leakage, were observed to dramatically change, compared mutant to overexpressing lines. Transgenic cucumber plants revealed that the gene is required by seedlings to tolerate chilling stress: constitutive over-expression of CsNOA1 led to a greater accumulation of soluble sugars, starch, and an up-regulation of Cold-regulatory C-repeat binding factor3 (CBF3) expression as well as a lower chilling damage index (CI). Conversely, suppression of CsNOA1 expression resulted in the opposite phenotype and a reduced NO content compared to wild type plants. Those results suggest that CsNOA1 regulates cucumber seedlings chilling tolerance. Additionally, under normal condition, we took several classic inhibitors to perform, and detect endogenous NO levels in wild type cucumber seedling. The results suggest that generation of endogenous NO in cucumber leaves occurs largely independently in the (CsNOA1) and nitrate reductase (NR) pathway. PMID:27891134

  6. Directed evolution to re-adapt a co-evolved network within an enzyme.

    PubMed

    Strafford, John; Payongsri, Panwajee; Hibbert, Edward G; Morris, Phattaraporn; Batth, Sukhjeet S; Steadman, David; Smith, Mark E B; Ward, John M; Hailes, Helen C; Dalby, Paul A

    2012-01-01

    We have previously used targeted active-site saturation mutagenesis to identify a number of transketolase single mutants that improved activity towards either glycolaldehyde (GA), or the non-natural substrate propionaldehyde (PA). Here, all attempts to recombine the singles into double mutants led to unexpected losses of specific activity towards both substrates. A typical trade-off occurred between soluble expression levels and specific activity for all single mutants, but many double mutants decreased both properties more severely suggesting a critical loss of protein stability or native folding. Statistical coupling analysis (SCA) of a large multiple sequence alignment revealed a network of nine co-evolved residues that affected all but one double mutant. Such networks maintain important functional properties such as activity, specificity, folding, stability, and solubility and may be rapidly disrupted by introducing one or more non-naturally occurring mutations. To identify variants of this network that would accept and improve upon our best D469 mutants for activity towards PA, we created a library of random single, double and triple mutants across seven of the co-evolved residues, combining our D469 variants with only naturally occurring mutations at the remaining sites. A triple mutant cluster at D469, E498 and R520 was found to behave synergistically for the specific activity towards PA. Protein expression was severely reduced by E498D and improved by R520Q, yet variants containing both mutations led to improved specific activity and enzyme expression, but with loss of solubility and the formation of inclusion bodies. D469S and R520Q combined synergistically to improve k(cat) 20-fold for PA, more than for any previous transketolase mutant. R520Q also doubled the specific activity of the previously identified D469T to create our most active transketolase mutant to date. Our results show that recombining active-site mutants obtained by saturation mutagenesis can rapidly destabilise critical networks of co-evolved residues, whereas beneficial single mutants can be retained and improved upon by randomly recombining them with natural variants at other positions in the network. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. The MCK mouse heart model of Friedreich's ataxia: Alterations in iron-regulated proteins and cardiac hypertrophy are limited by iron chelation

    PubMed Central

    Whitnall, Megan; Rahmanto, Yohan Suryo; Sutak, Robert; Xu, Xiangcong; Becker, Erika M.; Mikhael, Marc R.; Ponka, Prem; Richardson, Des R.

    2008-01-01

    There is no effective treatment for the cardiomyopathy of the most common autosomal recessive ataxia, Friedreich's ataxia (FA). The identification of potentially toxic mitochondrial (MIT) iron (Fe) deposits in FA suggests that Fe plays a role in its pathogenesis. This study used the muscle creatine kinase conditional frataxin (Fxn) knockout (mutant) mouse model that reproduces the classical traits associated with cardiomyopathy in FA. We examined the mechanisms responsible for the increased cardiac MIT Fe loading in mutants. Moreover, we explored the effect of Fe chelation on the pathogenesis of the cardiomyopathy. Our investigation showed that increased MIT Fe in the myocardium of mutants was due to marked transferrin Fe uptake, which was the result of enhanced transferrin receptor 1 expression. In contrast to the mitochondrion, cytosolic ferritin expression and the proportion of cytosolic Fe were decreased in mutant mice, indicating cytosolic Fe deprivation and markedly increased MIT Fe targeting. These studies demonstrated that loss of Fxn alters cardiac Fe metabolism due to pronounced changes in Fe trafficking away from the cytosol to the mitochondrion. Further work showed that combining the MIT-permeable ligand pyridoxal isonicotinoyl hydrazone with the hydrophilic chelator desferrioxamine prevented cardiac Fe loading and limited cardiac hypertrophy in mutants but did not lead to overt cardiac Fe depletion or toxicity. Fe chelation did not prevent decreased succinate dehydrogenase expression in the mutants or loss of cardiac function. In summary, we show that loss of Fxn markedly alters cellular Fe trafficking and that Fe chelation limits myocardial hypertrophy in the mutant. PMID:18621680

  8. Role of Myofibril-Inducing RNA in cardiac TnT expression in developing Mexican axolotl

    PubMed Central

    Sferrazza, Gian-Franco; Zhang, Chi; Jia, Pingping; Lemanski, Sharon L.; Athauda, Gagani; Stassi, Alyssa; Halager, Kristine; Maier, Jennifer A.; Rueda-de-Leon, Elena; Gupta, Amit; Dube, Syamalima; Huang, Xupei; Prentice, Howard M.; Dube, Dipak K.; Lemanski, Larry F.

    2007-01-01

    The Mexican axolotl, Ambystoma mexicanum, has been a useful animal model to study heart development and cardiac myofibrillogenesis. A naturally-occurring recessive mutant, gene “c”, for cardiac non-function in the Mexican axolotl causes a failure of myofibrillogenesis due to a lack of tropomyosin expression in homozygous mutant (c/c) embryonic hearts.. Myofibril-Inducing RNA (MIR) rescues mutant hearts in vitro by promoting tropomyosin expression and myofibril formation thereafter. We have studied the effect of MIR on the expression of various isoforms of cardiac Troponin-T (cTnT), a component of the thin filament that binds with tropomyosin. Four alternatively spliced cTnT isoforms have been characterized from developing axolotl heart. The expression of various cTnT isoforms in normal, mutant, and mutant hearts corrected with MIR, is evaluated by real-time RT-PCR using isoform specific primer pairs; MIR affects the total transcription as well as the splicing of the cTnT in axolotl heart PMID:17408593

  9. The Bmi-1 helix-turn and ring finger domains are required for Bmi-1 antagonism of (-) epigallocatechin-3-gallate suppression of skin cancer cell survival.

    PubMed

    Balasubramanian, Sivaprakasam; Scharadin, Tiffany M; Han, Bingshe; Xu, Wen; Eckert, Richard L

    2015-07-01

    The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (-) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21(Cip1) and p27(Kip1) expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix-turn-helix-turn-helix-turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Newborn mouse lens proteome and its alteration by lysine 6 mutant ubiquitin

    USDA-ARS?s Scientific Manuscript database

    Ubiquitin is a tag that often initiates degradation of proteins by the proteasome in the ubiquitin proteasome system. Targeted expression of K6W mutant ubiquitin (K6W-Ub) in the lens results in defects in lens development and cataract formation, suggesting critical functions for ubiquitin in lens. T...

  11. Integration Host Factor Is Required for RpoN-Dependent hrpL Gene Expression and Controls Motility by Positively Regulating rsmB sRNA in Erwinia amylovora.

    PubMed

    Lee, Jae Hoon; Zhao, Youfu

    2016-01-01

    Erwinia amylovora requires an hrp-type III secretion system (T3SS) to cause disease. It has been reported that HrpL, the master regulator of T3SS, is transcriptionally regulated by sigma factor 54 (RpoN), YhbH, and HrpS. In this study, the role of integration host factor (IHF) in regulating hrpL and T3SS gene expression was investigated. IHF is a nucleoid-associated protein that regulates gene expression by influencing nucleoid structure and DNA bending. Our results showed that both ihfA and ihfB mutants of E. amylovora did not induce necrotic lesions on pear fruits. Growth of both mutants was greatly reduced, and expression of the hrpL and T3SS genes was significantly down-regulated as compared with those of the wild type. In addition, expression of the ihfA, but not the ihfB gene, was under auto-suppression by IHF. Furthermore, both ihfA and ihfB mutants were hypermotile, due to significantly reduced expression of small RNA (sRNA) rsmB. Electrophoresis mobility shift assay further confirmed that IHF binds to the promoters of the hrpL and ihfA genes, as well as the rsmB sRNA gene. These results indicate that IHF is required for RpoN-dependent hrpL gene expression and virulence, and controls motility by positively regulating the rsmB sRNA in E. amylovora.

  12. Mutant PFN1 causes ALS phenotypes and progressive motor neuron degeneration in mice by a gain of toxicity

    PubMed Central

    Yang, Chunxing; Danielson, Eric W.; Qiao, Tao; Metterville, Jake; Brown, Robert H.; Landers, John E.; Xu, Zuoshang

    2016-01-01

    Mutations in the profilin 1 (PFN1) gene cause amyotrophic lateral sclerosis (ALS), a neurodegenerative disease caused by the loss of motor neurons leading to paralysis and eventually death. PFN1 is a small actin-binding protein that promotes formin-based actin polymerization and regulates numerous cellular functions, but how the mutations in PFN1 cause ALS is unclear. To investigate this problem, we have generated transgenic mice expressing either the ALS-associated mutant (C71G) or wild-type protein. Here, we report that mice expressing the mutant, but not the wild-type, protein had relentless progression of motor neuron loss with concomitant progressive muscle weakness ending in paralysis and death. Furthermore, mutant, but not wild-type, PFN1 forms insoluble aggregates, disrupts cytoskeletal structure, and elevates ubiquitin and p62/SQSTM levels in motor neurons. Unexpectedly, the acceleration of motor neuron degeneration precedes the accumulation of mutant PFN1 aggregates. These results suggest that although mutant PFN1 aggregation may contribute to neurodegeneration, it does not trigger its onset. Importantly, these experiments establish a progressive disease model that can contribute toward identifying the mechanisms of ALS pathogenesis and the development of therapeutic treatments. PMID:27681617

  13. A gain-of-function mutation of plastidic invertase alters nuclear gene expression with sucrose treatment partially via GENOMES UNCOUPLED1-mediated signaling.

    PubMed

    Maruta, Takanori; Miyazaki, Nozomi; Nosaka, Ryota; Tanaka, Hiroyuki; Padilla-Chacon, Daniel; Otori, Kumi; Kimura, Ayako; Tanabe, Noriaki; Yoshimura, Kazuya; Tamoi, Masahiro; Shigeoka, Shigeru

    2015-05-01

    Plastid gene expression (PGE) is one of the signals that regulate the expression of photosynthesis-associated nuclear genes (PhANGs) via GENOMES UNCOUPLED1 (GUN1)-dependent retrograde signaling. We recently isolated Arabidopsis sugar-inducible cotyledon yellow-192 (sicy-192), a gain-of-function mutant of plastidic invertase, and showed that following the treatment of this mutant with sucrose, the expression of PhANGs as well as PGE decreased, suggesting that the sicy-192 mutation activates a PGE-evoked and GUN1-mediated retrograde pathway. To clarify the relationship between the sicy-192 mutation, PGE, and GUN1-mediated pathway, plastid and nuclear gene expression in a double mutant of sicy-192 and gun1-101, a null mutant of GUN1 was studied. Plastid-encoded RNA polymerase (PEP)-dependent PGE was markedly suppressed in the sicy-192 mutant by the sucrose treatment, but the suppression as well as cotyledon yellow phenotype was not mitigated by GUN1 disruption. Microarray analysis revealed that the altered expression of nuclear genes such as PhANG in the sucrose-treated sicy-192 mutant was largely dependent on GUN1. The present findings demonstrated that the sicy-192 mutation alters nuclear gene expression with sucrose treatment via GUN1, which is possibly followed by inhibiting PEP-dependent PGE, providing a new insight into the role of plastid sugar metabolism in nuclear gene expression. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  14. Nodal patterning without Lefty inhibitory feedback is functional but fragile

    PubMed Central

    Gagnon, James A; Pauli, Andrea; Zimmerman, Steven; Aksel, Deniz C; Reyon, Deepak; Tsai, Shengdar Q; Joung, J Keith

    2017-01-01

    Developmental signaling pathways often activate their own inhibitors. Such inhibitory feedback has been suggested to restrict the spatial and temporal extent of signaling or mitigate signaling fluctuations, but these models are difficult to rigorously test. Here, we determine whether the ability of the mesendoderm inducer Nodal to activate its inhibitor Lefty is required for development. We find that zebrafish lefty mutants exhibit excess Nodal signaling and increased specification of mesendoderm, resulting in embryonic lethality. Strikingly, development can be fully restored without feedback: Lethal patterning defects in lefty mutants can be rescued by ectopic expression of lefty far from its normal expression domain or by spatially and temporally uniform exposure to a Nodal inhibitor drug. While drug-treated mutants are less tolerant of mild perturbations to Nodal signaling levels than wild type embryos, they can develop into healthy adults. These results indicate that patterning without inhibitory feedback is functional but fragile. PMID:29215332

  15. Pharmacochaperoning in a Drosophila model system rescues human dopamine transporter variants associated with infantile/juvenile parkinsonism

    PubMed Central

    Asjad, H. M. Mazhar; Kasture, Ameya; El-Kasaby, Ali; Sackel, Michael; Hummel, Thomas; Freissmuth, Michael; Sucic, Sonja

    2017-01-01

    Point mutations in the gene encoding the human dopamine transporter (hDAT, SLC6A3) cause a syndrome of infantile/juvenile dystonia and parkinsonism. To unravel the molecular mechanism underlying these disorders and investigate possible pharmacological therapies, here we examined 13 disease-causing DAT mutants that were retained in the endoplasmic reticulum when heterologously expressed in HEK293 cells. In three of these mutants, i.e. hDAT-V158F, hDAT-G327R, and hDAT-L368Q, the folding deficit was remedied with the pharmacochaperone noribogaine or the heat shock protein 70 (HSP70) inhibitor pifithrin-μ such that endoplasmic reticulum export of and radioligand binding and substrate uptake by these DAT mutants were restored. In Drosophila melanogaster, DAT deficiency results in reduced sleep. We therefore exploited the power of targeted transgene expression of mutant hDAT in Drosophila to explore whether these hDAT mutants could also be pharmacologically rescued in an intact organism. Noribogaine or pifithrin-μ treatment supported hDAT delivery to the presynaptic terminals of dopaminergic neurons and restored sleep to normal length in DAT-deficient (fumin) Drosophila lines expressing hDAT-V158F or hDAT-G327R. In contrast, expression of hDAT-L368Q in the Drosophila DAT mutant background caused developmental lethality, indicating a toxic action not remedied by pharmacochaperoning. Our observations identified those mutations most likely amenable to pharmacological rescue in the affected children. In addition, our findings also highlight the challenges of translating insights from pharmacochaperoning in cell culture to the clinical situation. Because of the evolutionary conservation in dopaminergic neurotransmission between Drosophila and people, pharmacochaperoning of DAT in D. melanogaster may allow us to bridge that gap. PMID:28972153

  16. Evaluation of the effects of sdiA, a luxR homologue, on adherence and motility of Escherichia coli O157 : H7.

    PubMed

    Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L

    2010-05-01

    Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.

  17. A Factor Linking Floral Organ Identity and Growth Revealed by Characterization of the Tomato Mutant unfinished flower development (ufd).

    PubMed

    Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Yuste-Lisbona, Fernando J; Pons, Clara; Giménez, Estela; Angosto, Trinidad; Granell, Antonio; Capel, Juan; Lozano, Rafael

    2016-01-01

    Floral organogenesis requires coordinated interactions between genes specifying floral organ identity and those regulating growth and size of developing floral organs. With the aim to isolate regulatory genes linking both developmental processes (i.e., floral organ identity and growth) in the tomato model species, a novel mutant altered in the formation of floral organs was further characterized. Under normal growth conditions, floral organ primordia of mutant plants were correctly initiated, however, they were unable to complete their development impeding the formation of mature and fertile flowers. Thus, the growth of floral buds was blocked at an early stage of development; therefore, we named this mutant as unfinished flower development ( ufd ). Genetic analysis performed in a segregating population of 543 plants showed that the abnormal phenotype was controlled by a single recessive mutation. Global gene expression analysis confirmed that several MADS-box genes regulating floral identity as well as other genes participating in cell division and different hormonal pathways were affected in their expression patterns in ufd mutant plants. Moreover, ufd mutant inflorescences showed higher hormone contents, particularly ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) and strigol compared to wild type. Such results indicate that UFD may have a key function as positive regulator of the development of floral primordia once they have been initiated in the four floral whorls. This function should be performed by affecting the expression of floral organ identity and growth genes, together with hormonal signaling pathways.

  18. The effects of disruption of phosphoglucose isomerase gene on carbon utilisation and cellulase production in Trichoderma reesei Rut-C30

    PubMed Central

    2011-01-01

    Background Cellulase and hemicellulase genes in the fungus Trichoderma reesei are repressed by glucose and induced by lactose. Regulation of the cellulase genes is mediated by the repressor CRE1 and the activator XYR1. T. reesei strain Rut-C30 is a hypercellulolytic mutant, obtained from the natural strain QM6a, that has a truncated version of the catabolite repressor gene, cre1. It has been previously shown that bacterial mutants lacking phosphoglucose isomerase (PGI) produce more nucleotide precursors and amino acids. PGI catalyzes the second step of glycolysis, the formation of fructose-6-P from glucose-6-P. Results We deleted the gene pgi1, encoding PGI, in the T. reesei strain Rut-C30 and we introduced the cre1 gene in a Δpgi1 mutant. Both Δpgi1 and cre1+Δpgi1 mutants showed a pellet-like and growth as well as morphological alterations compared with Rut-C30. None of the mutants grew in media with fructose, galactose, xylose, glycerol or lactose but they grew in media with glucose, with fructose and glucose, with galactose and fructose or with lactose and fructose. No growth was observed in media with xylose and glucose. On glucose, Δpgi1 and cre1+Δpgi1 mutants showed higher cellulase activity than Rut-C30 and QM6a, respectively. But in media with lactose, none of the mutants improved the production of the reference strains. The increase in the activity did not correlate with the expression of mRNA of the xylanase regulator gene, xyr1. Δpgi1 mutants were also affected in the extracellular β-galactosidase activity. Levels of mRNA of the glucose 6-phosphate dehydrogenase did not increase in Δpgi1 during growth on glucose. Conclusions The ability to grow in media with glucose as the sole carbon source indicated that Trichoderma Δpgi1 mutants were able to use the pentose phosphate pathway. But, they did not increase the expression of gpdh. Morphological characteristics were the result of the pgi1 deletion. Deletion of pgi1 in Rut-C30 increased cellulase production, but only under repressing conditions. This increase resulted partly from the deletion itself and partly from a genetic interaction with the cre1-1 mutation. The lower cellulase activity of these mutants in media with lactose could be attributed to a reduced ability to hydrolyse this sugar but not to an effect on the expression of xyr1. PMID:21609467

  19. Modulation of yeast genome expression in response to defective RNA polymerase III-dependent transcription.

    PubMed

    Conesa, Christine; Ruotolo, Roberta; Soularue, Pascal; Simms, Tiffany A; Donze, David; Sentenac, André; Dieci, Giorgio

    2005-10-01

    We used genome-wide expression analysis in Saccharomyces cerevisiae to explore whether and how the expression of protein-coding, RNA polymerase (Pol) II-transcribed genes is influenced by a decrease in RNA Pol III-dependent transcription. The Pol II transcriptome was characterized in four thermosensitive, slow-growth mutants affected in different components of the RNA Pol III transcription machinery. Unexpectedly, we found only a modest correlation between altered expression of Pol II-transcribed genes and their proximity to class III genes, a result also confirmed by the analysis of single tRNA gene deletants. Instead, the transcriptome of all of the four mutants was characterized by increased expression of genes known to be under the control of the Gcn4p transcriptional activator. Indeed, GCN4 was found to be translationally induced in the mutants, and deleting the GCN4 gene eliminated the response. The Gcn4p-dependent expression changes did not require the Gcn2 protein kinase and could be specifically counteracted by an increased gene dosage of initiator tRNA(Met). Initiator tRNA(Met) depletion thus triggers a GCN4-dependent reprogramming of genome expression in response to decreased Pol III transcription. Such an effect might represent a key element in the coordinated transcriptional response of yeast cells to environmental changes.

  20. The Transcriptional Response of Lactobacillus sanfranciscensis DSM 20451T and Its tcyB Mutant Lacking a Functional Cystine Transporter to Diamide Stress

    PubMed Central

    Stetina, Mandy; Behr, Jürgen

    2014-01-01

    As a result of its strong adaptation to wheat and rye sourdoughs, Lactobacillus sanfranciscensis has the smallest genome within the genus Lactobacillus. The concomitant absence of some important antioxidative enzymes and the inability to synthesize glutathione suggest a role of cystine transport in maintenance of an intracellular thiol balance. Diamide [synonym 1,1′-azobis(N,N-dimethylformamide)] disturbs intracellular and membrane thiol levels in oxidizing protein thiols depending on its initial concentration. In this study, RNA sequencing was used to reveal the transcriptional response of L. sanfranciscensis DSM 20451T (wild type [WT]) and its ΔtcyB mutant with a nonfunctional cystine transporter after thiol stress caused by diamide. Along with the different expression of genes involved in amino acid starvation, pyrimidine synthesis, and energy production, our results show that thiol stress in the wild type can be compensated through activation of diverse chaperones and proteases whereas the ΔtcyB mutant shifts its metabolism in the direction of survival. Only a small set of genes are significantly differentially expressed between the wild type and the mutant. In the WT, mainly genes which are associated with a heat shock response are upregulated whereas glutamine import and synthesis genes are downregulated. In the ΔtcyB mutant, the whole opp operon was more highly expressed, as well as a protein which probably includes enzymes for methionine transport. The two proteins encoded by spxA and nrdH, which are involved in direct or indirect oxidative stress responses, are also upregulated in the mutant. This work emphasizes that even in the absence of definitive antioxidative enzymes, bacteria with a small genome and a high frequency of gene inactivation and elimination use small molecules such as the cysteine/cystine couple to overcome potential cell damage resulting from oxidative stress. PMID:24795368

  1. The transcriptional response of Lactobacillus sanfranciscensis DSM 20451T and its tcyB mutant lacking a functional cystine transporter to diamide stress.

    PubMed

    Stetina, Mandy; Behr, Jürgen; Vogel, Rudi F

    2014-07-01

    As a result of its strong adaptation to wheat and rye sourdoughs, Lactobacillus sanfranciscensis has the smallest genome within the genus Lactobacillus. The concomitant absence of some important antioxidative enzymes and the inability to synthesize glutathione suggest a role of cystine transport in maintenance of an intracellular thiol balance. Diamide [synonym 1,1'-azobis(N,N-dimethylformamide)] disturbs intracellular and membrane thiol levels in oxidizing protein thiols depending on its initial concentration. In this study, RNA sequencing was used to reveal the transcriptional response of L. sanfranciscensis DSM 20451(T) (wild type [WT]) and its ΔtcyB mutant with a nonfunctional cystine transporter after thiol stress caused by diamide. Along with the different expression of genes involved in amino acid starvation, pyrimidine synthesis, and energy production, our results show that thiol stress in the wild type can be compensated through activation of diverse chaperones and proteases whereas the ΔtcyB mutant shifts its metabolism in the direction of survival. Only a small set of genes are significantly differentially expressed between the wild type and the mutant. In the WT, mainly genes which are associated with a heat shock response are upregulated whereas glutamine import and synthesis genes are downregulated. In the ΔtcyB mutant, the whole opp operon was more highly expressed, as well as a protein which probably includes enzymes for methionine transport. The two proteins encoded by spxA and nrdH, which are involved in direct or indirect oxidative stress responses, are also upregulated in the mutant. This work emphasizes that even in the absence of definitive antioxidative enzymes, bacteria with a small genome and a high frequency of gene inactivation and elimination use small molecules such as the cysteine/cystine couple to overcome potential cell damage resulting from oxidative stress. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  2. Silicon decreases both uptake and root-to-shoot translocation of manganese in rice

    PubMed Central

    Che, Jing; Yamaji, Naoki; Shao, Ji Feng; Ma, Jian Feng; Shen, Ren Fang

    2016-01-01

    Silicon (Si) is known to alleviate manganese (Mn) toxicity in a number of plant species; however, the mechanisms responsible for this effect are poorly understood. Here, we investigated the interaction between Si and Mn in rice (Oryza sativa) by using a mutant defective in Si uptake. Silicon alleviated Mn toxicity in the wild-type (WT) rice, but not in the mutant exposed to high Mn. The Mn concentration in the shoots was decreased, but that in the roots was increased by Si in the WT. In contrast, the Mn concentration in the roots and shoots was unaffected by Si in the mutant. Furthermore, Si supply resulted in an increased Mn in the root cell sap, decreased Mn in the xylem sap in the WT, but these effects of Si were not observed in the mutant. A short-term labelling experiment with 54Mn showed that the uptake of Mn was similar between plants with and without Si and between WT and the mutant. However, Si decreased root-to-shoot translocation of Mn in the WT, but not in the mutant. The expression of a Mn transporter gene for uptake, OsNramp5, was unaffected by a short exposure (<1 d) to Si, but down-regulated by relatively long-term exposure to Si in WT. In contrast, the expression of OsNramp5 was unaffected by Si in the mutant. These results indicated that Si-decreased Mn accumulation results from both Si-decreased root-to-shoot translocation of Mn, probably by the formation of Mn-Si complex in root cells, and uptake by down-regulating Mn transporter gene. PMID:26733690

  3. Metabolic characterization of isocitrate dehydrogenase (IDH) mutant and IDH wildtype gliomaspheres uncovers cell type-specific vulnerabilities.

    PubMed

    Garrett, Matthew; Sperry, Jantzen; Braas, Daniel; Yan, Weihong; Le, Thuc M; Mottahedeh, Jack; Ludwig, Kirsten; Eskin, Ascia; Qin, Yue; Levy, Rachelle; Breunig, Joshua J; Pajonk, Frank; Graeber, Thomas G; Radu, Caius G; Christofk, Heather; Prins, Robert M; Lai, Albert; Liau, Linda M; Coppola, Giovanni; Kornblum, Harley I

    2018-01-01

    There is considerable interest in defining the metabolic abnormalities of IDH mutant tumors to exploit for therapy. While most studies have attempted to discern function by using cell lines transduced with exogenous IDH mutant enzyme, in this study, we perform unbiased metabolomics to discover metabolic differences between a cohort of patient-derived IDH1 mutant and IDH wildtype gliomaspheres. Using both our own microarray and the TCGA datasets, we performed KEGG analysis to define pathways differentially enriched in IDH1 mutant and IDH wildtype cells and tumors. Liquid chromatography coupled to mass spectrometry analysis with labeled glucose and deoxycytidine tracers was used to determine differences in overall cellular metabolism and nucleotide synthesis. Radiation-induced DNA damage and repair capacity was assessed using a comet assay. Differences between endogenous IDH1 mutant metabolism and that of IDH wildtype cells transduced with the IDH1 (R132H) mutation were also investigated. Our KEGG analysis revealed that IDH wildtype cells were enriched for pathways involved in de novo nucleotide synthesis, while IDH1 mutant cells were enriched for pathways involved in DNA repair. LC-MS analysis with fully labeled 13 C-glucose revealed distinct labeling patterns between IDH1 mutant and wildtype cells. Additional LC-MS tracing experiments confirmed increased de novo nucleotide synthesis in IDH wildtype cells relative to IDH1 mutant cells. Endogenous IDH1 mutant cultures incurred less DNA damage than IDH wildtype cultures and sustained better overall growth following X-ray radiation. Overexpression of mutant IDH1 in a wildtype line did not reproduce the range of metabolic differences observed in lines expressing endogenous mutations, but resulted in depletion of glutamine and TCA cycle intermediates, an increase in DNA damage following radiation, and a rise in intracellular ROS. These results demonstrate that IDH1 mutant and IDH wildtype cells are easily distinguishable metabolically by analyzing expression profiles and glucose consumption. Our results also highlight important differences in nucleotide synthesis utilization and DNA repair capacity that could be exploited for therapy. Altogether, this study demonstrates that IDH1 mutant gliomas are a distinct subclass of glioma with a less malignant, but also therapy-resistant, metabolic profile that will likely require distinct modes of therapy.

  4. Mapping heterogeneity in patient-derived melanoma cultures by single-cell RNA-seq

    PubMed Central

    Loeffler-Wirth, Henry; Hopp, Lydia; Schadendorf, Dirk; Schartl, Manfred; Anderegg, Ulf; Camp, Gray; Treutlein, Barbara; Binder, Hans; Kunz, Manfred

    2017-01-01

    Recent technological advances in single-cell genomics make it possible to analyze cellular heterogeneity of tumor samples. Here, we applied single-cell RNA-seq to measure the transcriptomes of 307 single cells cultured from three biopsies of three different patients with a BRAF/NRAS wild type, BRAF mutant/NRAS wild type and BRAF wild type/NRAS mutant melanoma metastasis, respectively. Analysis based on self-organizing maps identified sub-populations defined by multiple gene expression modules involved in proliferation, oxidative phosphorylation, pigmentation and cellular stroma. Gene expression modules had prognostic relevance when compared with gene expression data from published melanoma samples and patient survival data. We surveyed kinome expression patterns across sub-populations of the BRAF/NRAS wild type sample and found that CDK4 and CDK2 were consistently highly expressed in the majority of cells, suggesting that these kinases might be involved in melanoma progression. Treatment of cells with the CDK4 inhibitor palbociclib restricted cell proliferation to a similar, and in some cases greater, extent than MAPK inhibitors. Finally, we identified a low abundant sub-population in this sample that highly expressed a module containing ABC transporter ABCB5, surface markers CD271 and CD133, and multiple aldehyde dehydrogenases (ALDHs). Patient-derived cultures of the BRAF mutant/NRAS wild type and BRAF wild type/NRAS mutant metastases showed more homogeneous single-cell gene expression patterns with gene expression modules for proliferation and ABC transporters. Taken together, our results describe an intertumor and intratumor heterogeneity in melanoma short-term cultures which might be relevant for patient survival, and suggest promising targets for new treatment approaches in melanoma therapy. PMID:27903987

  5. FvSNF1, the sucrose non-fermenting protein kinase gene of Fusarium virguliforme, is required for cell-wall-degrading enzymes expression and sudden death syndrome development in soybean.

    PubMed

    Islam, Kazi T; Bond, Jason P; Fakhoury, Ahmad M

    2017-08-01

    Fusarium virguliforme is a soil-borne pathogenic fungus that causes sudden death syndrome (SDS) in soybean. Its pathogenicity is believed to require the activity of cell-wall-degrading enzymes (CWDEs). The sucrose non-fermenting protein kinase 1 gene (SNF1) is a key component of the glucose de-repression pathway in yeast, and a regulator of gene expression for CWDEs in some plant pathogenic fungi. To elucidate the functional role of the SNF1 homolog in F. virguliforme, FvSNF1 was disrupted using a split-marker strategy. Disruption of FvSNF1 in F. virguliforme abolishes galactose utilization and causes poor growth on xylose, arabinose and sucrose. However, the resulting Fvsnf1 mutant grew similar to wild-type and ectopic transformants on glucose, fructose, maltose, or pectin as the main source of carbon. The Fvsnf1 mutant displayed no expression of the gene-encoding galactose oxidase (GAO), a secretory enzyme that catalyzes oxidation of D-galactose. It also exhibited a significant reduction in the expression of several CWDE-coding genes in contrast to the wild-type strain. Greenhouse pathogenicity assays revealed that the Fvsnf1 mutant was severely impaired in its ability to cause SDS on challenged soybean plants. Microscopy and microtome studies on infected roots showed that the Fvsnf1 mutant was defective in colonizing vascular tissue of infected plants. Cross and longitudinal sections of infected roots stained with fluorescein-labeled wheat germ agglutinin and Congo red showed that the Fvsnf1 mutant failed to colonize the xylem vessels and phloem tissue at later stages of infection. Quantification of the fungal biomass in inoculated roots further confirmed a reduced colonization of roots by the Fvsnf1 mutant when compared to the wild type. These findings suggest that FvSNF1 regulates the expression of CWDEs in F. virguliforme, thus affecting the virulence of the fungus on soybean.

  6. A zebrafish model for Waardenburg syndrome type IV reveals diverse roles for Sox10 in the otic vesicle.

    PubMed

    Dutton, Kirsten; Abbas, Leila; Spencer, Joanne; Brannon, Claire; Mowbray, Catriona; Nikaido, Masataka; Kelsh, Robert N; Whitfield, Tanya T

    2009-01-01

    In humans, mutations in the SOX10 gene are a cause of the auditory-pigmentary disorder Waardenburg syndrome type IV (WS4) and related variants. SOX10 encodes an Sry-related HMG box protein essential for the development of the neural crest; deafness in WS4 and other Waardenburg syndromes is usually attributed to loss of neural-crest-derived melanocytes in the stria vascularis of the cochlea. However, SOX10 is strongly expressed in the developing otic vesicle and so direct roles for SOX10 in the otic epithelium might also be important. Here, we examine the otic phenotype of zebrafish sox10 mutants, a model for WS4. As a cochlea is not present in the fish ear, the severe otic phenotype in these mutants cannot be attributed to effects on this tissue. In zebrafish sox10 mutants, we see abnormalities in all otic placodal derivatives. Gene expression studies indicate deregulated expression of several otic genes, including fgf8, in sox10 mutants. Using a combination of mutant and morphant data, we show that the three sox genes belonging to group E (sox9a, sox9b and sox10) provide a link between otic induction pathways and subsequent otic patterning: they act redundantly to maintain sox10 expression throughout otic tissue and to restrict fgf8 expression to anterior macula regions. Single-cell labelling experiments indicate a small and transient neural crest contribution to the zebrafish ear during normal development, but this is unlikely to account for the strong defects seen in the sox10 mutant. We discuss the implication that the deafness in WS4 patients with SOX10 mutations might reflect a haploinsufficiency for SOX10 in the otic epithelium, resulting in patterning and functional abnormalities in the inner ear.

  7. Resistance to collagen-induced arthritis in SHPS-1 mutant mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okuzawa, Chie; Kaneko, Yoriaki; Murata, Yoji

    SHPS-1 is a transmembrane protein that binds the protein tyrosine phosphatases SHP-1 and SHP-2 through its cytoplasmic region and is abundantly expressed on dendritic cells and macrophages. Here we show that mice expressing a mutant form of SHPS-1 fail to develop type-II collagen (CII)-induced arthritis (CIA), a model for rheumatoid arthritis in humans. Histological examinations of the arthritic paws from immunized wild-type mice revealed that cartilage was destroyed in association with marked mononuclear cell infiltration, while only mild cell infiltration was observed in immunized SHPS-1 mutant mice. Consistently, the serum levels of both IgG and IgG2a specific to CII andmore » of IL-1{beta} in immunized SHPS-1 mutant mice were markedly reduced compared with those apparent for wild-type mice. The CII-induced proliferation of, and production of cytokines by, T cells from immunized SHPS-1 mutant mice were reduced compared to wild-type cells. These results suggest that SHPS-1 is essential for development of CIA.« less

  8. Distribution and threshold expression of the tRNA[sup Lys] mutation in skeletal muscle of patients with myoclonic epilepsy and ragged-red fibers (MERRF)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boulet, L.; Karpati, G.; Shoubridge, E.A.

    1992-12-01

    The authors investigated the distribution and expression of mutant mtDNAs carrying the A-to-G mutation at position 8344 in the tRNA[sup Lys] gene in the skeletal muscle of four patients with myoclonus epilepsy and ragged-red fibers (MERRF). The proportion of mutant genomes was greater than 80% of total mtDNAs in muscle samples of all patients and was associated with a decrease in the activity of cytochrome c oxidase (COX). The vast majority of myoblasts, cloned from the satellite-cell population in the same muscles, were homoplasmic for the mutation. The overall proportion of mutant mtDNAs in this population was similar to thatmore » in differentiated muscle, suggesting that the ratio of mutant to wild-type mtDNAs in skeletal muscle is determined either in the ovum or during early development and changes little with age. Translation of all mtDNA-encoded genes was severely depressed in homoplasmic mutant myoblast clones but not in heteroplasmic or wild-type clones. The threshold for biochemical expression of the mutation was determined in heteroplasmic myotubes formed by fusion of different proportions of mutant and wild-type myoblasts. The magnitude of the decrease in translation in myotubes containing mutant mtDNAs was protein specific. Complex I and IV subunits were more affected than complex V subunits, and there was a rough correlation with both protein size and number of lysine residues. Approximately 15% wild-type mtDNAs restored translation and COX activity to near normal levels. These results show that the A-to-G substitution in tRNA[sup Lys] is a functionally recessive mutation that can be rescued by intraorganellar complementation with a small proportion of wild-type mtDNAs and explain the steep threshold for expression of the MERRF clinical phenotype. 40 refs., 7 figs., 2 tabs.« less

  9. Transgenic mice expressing mutant Pinin exhibit muscular dystrophy, nebulin deficiency and elevated expression of slow-type muscle fiber genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai

    Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species.more » The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.« less

  10. Modification of SR-PSOX functions by multi-point mutations of basic amino acid residues.

    PubMed

    Liu, Weiwei; Yin, Lan; Dai, Yalei

    2013-02-01

    SR-PSOX can function as a scavenger receptor, a chemokine and an adhesion molecule, and it could be an interesting player in the formation of atherosclerotic lesions. Our previous studies demonstrated that basic amino acid residues in the chemokine domain of SR-PSOX are critical for its functions. In this study the combinations of the key basic amino acids in the chemokine domain of SR-PSOX have been identified. Five combinations of basic amino acid residues that may form conformational motif for SR-PSOX functions were selected for multi-point mutants. The double mutants of K61AR62A, R76AK79A, R82AH85A, and treble mutants of R76AR78AK79A, R78AR82AH85A were successfully constructed by replacing the combinations of two or three basic amino acid residues with alanine. After successful expression of these mutants on the cells, the functional studies showed that the cells expressing R76AK79A and R82AH85A mutants significantly increased the activity of oxLDL uptake compared with that of wild-type SR-PSOX. Meanwhile, the cells expressing R76AK79A mutant also dramatically enhanced the phagocytotic activity of SR-PSOX. However, the cells expressing the construct of combination of R78A mutation in R76AK79A or R82AH85A could abolish these effects. More interestingly, the adhesive activities were remarkably down regulated in the cells expressing the multi-point mutants respectively. This study revealed that some conformational motifs of basic amino acid residues, especially R76 with K79 in SR-PSOX, may form a common functional motif for its critical functions. R78 in SR-PSOX has the potential action to stabilize the function of oxLDL uptake and bacterial phagocytosis. The results obtained may provide new insight for the development of drug target of atherosclerosis. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  11. Structural abnormalities of corpus callosum and cortical axonal tracts accompanied by decreased anxiety-like behavior and lowered sociability in spock3- mutant mice.

    PubMed

    Yamamoto, Ayako; Uchiyama, Koji; Nara, Tomoka; Nishimura, Naomichi; Hayasaka, Michiko; Hanaoka, Kazunori; Yamamoto, Tatsuro

    2014-01-01

    Spock3/Testican-3 is a nervous system-expressed heparan sulfate proteoglycan belonging to a subgroup of the BM-40/SPARC/osteonectin family, the role of which in brain development is unclear. Because Spock1, a member of the Spock family, inhibits their attachment to substrates and the neurite outgrowth of cultured neuronal cells, Spock3 is also thought to be similarly involved in the neuronal development. In the present study, we established a Spock3-mutant mouse harboring a deletion extending from the presumptive upstream regulatory region to exon 4 of the Spock3 locus and performed histological and behavioral studies on these mutant mice. In wild-type (WT) mice, all Spock members were clearly expressed during brain development. In adults, intense Spock1 and Spock2 expressions were observed throughout the entire brain; whereas, Spock3 expression was no longer visible except in the thalamic nuclei. Thus, Spock3 expression is mostly confined to the developmental stage of the brain. In adult mutant mice, the cells of all cortical layers were swollen. The corpus callosum was narrowed around the central region along the rostral-caudal axis and many small spaces were observed without myelin sheaths throughout the entire corpus callosum. In addition, the cortical input and output fibers did not form into thick bundled fibers as well as the WT counterparts did. Moreover, a subpopulation of corticospinal axonal fibers penetrated into the dorsal striatum with moderately altered orientations. Consistent with these modifications of brain structures, the mutant mice exhibited decreased anxiety-like behavior and lowered sociability. Together, these results demonstrate that Spock3 plays an important role in the formation or maintenance of major neuronal structures in the brain. © 2014 S. Karger AG, Basel.

  12. The impact of the IGF-1 system of cancer cells on radiation response - An in vitro study.

    PubMed

    Venkatachalam, Senthiladipan; Mettler, Esther; Fottner, Christian; Miederer, Matthias; Kaina, Bernd; Weber, Matthias M

    2017-12-01

    Overexpression of the insulin-like growth factor-1 receptor (IGF-1R) is associated with increased cell proliferation, differentiation, transformation, and tumorigenicity. Additionally, signaling involved in the resistance of cancer cells to radiotherapy originates from IGF-1R. The purpose of this study was to investigate the role of the IGF-1 system in the radiation response and further evaluate its effect on the expression of DNA repair pathway genes. To inhibit the IGF-1 system, we stably transfected the Caco-2 cell line to express a kinase-deficient IGF-1R mutant. We then studied the effects of this mutation on cell growth, the response to radiation, and clonogenic survival, as well as using a cell viability assay to examine DNA damage and repair. Finally, we performed immunofluorescence for γ-H2AX to examine double-strand DNA breaks and evaluated the expression of 84 key genes involved in DNA repair with a real-time PCR array. Mutant IGF-1R cells exhibited significantly blunted cell growth and viability, compared to wild-type cells, as well as reduced clonogenic survival after γ-irradiation. However, mutant IGF-1R cells did not show any significant delays in the repair of radiation-induced DNA double-strand breaks. Furthermore, expression of mutant IGF-1R significantly down-regulated the mRNA levels of BRCA2, a major protein involved in homologous recombination DNA repair. These results indicate that blocking the IGF-1R-mediated signaling cascade, through the expression of a kinase-deficient IGF-1R mutant, reduces cell growth and sensitizes cancer cells to ionizing radiation. Therefore, the IGF-1R system could be a potential target to enhance radio-sensitivity and the efficacy of cancer treatments.

  13. Inhibition of Early Stages of HIV-1 Assembly by INI1/hSNF5 Transdominant Negative Mutant S6 ▿

    PubMed Central

    Cano, Jennifer; Kalpana, Ganjam V.

    2011-01-01

    INI1/hSNF5 is an HIV-1 integrase (IN) binding protein specifically incorporated into virions. A truncated mutant of INI1 (S6, amino acids 183 to 294) harboring the minimal IN binding Rpt1 domain potently inhibits HIV-1 particle production in a transdominant manner. The inhibition requires interaction of S6 with IN within Gag-Pol. While INI1 is a nuclear protein and harbors a masked nuclear export signal (NES), the transdominant negative mutant S6 is cytoplasmic, due to the unmasking of NES. Here, we examined the effects of subcellular localization of S6 on HIV-1 inhibition and further investigated the stages of assembly that are affected. We found that targeting a nuclear localization signal-containing S6 variant [NLS-S6(Rpt1)] to the nucleoplasm (but not to the nucleolus) resulted in complete reversal of inhibition of particle production. Electron microscopy indicated that although no electron-dense particles at any stage of assembly were seen in cells expressing S6, virions were produced in cells expressing the rescue mutant NLS-S6(Rpt1) to wild-type levels. Immunofluorescence analysis revealed that p24 exhibited a diffuse pattern of localization within the cytoplasm in cells expressing S6 in contrast to accumulation along the membrane in controls. Pulse-chase analysis indicated that in S6-expressing cells, although Gag(Pr55gag) protein translation was unaffected, processing and release of p24 were defective. Together, these results indicate that expression of S6 in the cytoplasm interferes with trafficking of Gag-Pol/Gag to the membrane and causes a defective processing leading to inhibition of assembly at an early stage prior to particle formation and budding. PMID:21159874

  14. The effect of classical swine fever virus NS5A and NS5A mutants on oxidative stress and inflammatory response in swine testicular cells.

    PubMed

    Dong, Wang; Lv, Huifang; Wang, Yifan; Li, Xiaomeng; Li, Cheng; Wang, Lu; Wang, Chengbao; Guo, Kangkang; Zhang, Yanming

    2017-06-01

    Infection with classical swine fever virus (CSFV) results in highly significant economic losses; this infection is characterized by being highly contagious and accompanied by hyperthermia and systemic bleeding. Oxidative stress (OS) plays a critical role in the pathological process of viral infection. The function of the nonstructural protein 5A (NS5A) in the pathogenesis of CSFV has not been completely understood. Here, OS and the inflammatory response were studied with NS5A and substitution mutants in swine testicular (ST) cells. ST cell lines stably expressing CSFV NS5A or substitution mutants were established. Reactive oxygen species (ROS) production, antioxidant protein expression and inflammatory response were analyzed by quantitative real-time PCR (qRT-PCR), ELISA and flow cytometry analysis. The results showed that CSFV NS5A did not increase ROS production or the antioxidant protein (Trx, HO-1 and PRDX-6) expression in ST cells. However, NS5A inhibited cyclooxygenase-2 (COX-2) expression, a pro-inflammatory protein related to OS. Further studies have shown that NS5A mutants S15A and S92A increased ROS production and inhibited antioxidant protein expression. S15A, S81A and T274A affected the inflammatory response. This study suggested that CSFV NS5A did not induce OS, and amino acids Ser15 and Ser92 of CSFV NS5A were essential for inhibiting OS. Additionally, Ser15, Ser81 and Thr274 played important roles in the inflammatory response in ST cells. These observations provided insight into the function of CSFV NS5A and the mechanism of CSFV persistent infection in ST cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.

    PubMed

    Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang

    2013-02-01

    Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.

  16. Co-Occurrence of Two Allelic Variants of CYP51 in Erysiphe necator and Their Correlation with Over-Expression for DMI Resistance

    PubMed Central

    Rallos, Lynn Esther E.; Baudoin, Anton B.

    2016-01-01

    Demethylation inhibitors (DMIs) have been an important tool in the management of grapevine powdery mildew caused by Erysiphe necator. Long-term, intensive use of DMIs has resulted in reduced sensitivity in field populations. To further characterize DMI resistance and understand resistance mechanisms in this pathogen, we investigated the cyp51 sequence of 24 single-spored isolates from Virginia and surrounding states and analyzed gene expression in isolates representing a wide range of sensitivity. Two cyp51 alleles were found with respect to the 136th codon of the predicted EnCYP51 sequence: the wild-type (TAT) and the mutant (TTT), which results in the known Y136F amino acid change. Some isolates possessed both alleles, demonstrating gene duplication or increased gene copy number and possibly a requirement for at least one mutant copy of CYP51 for resistance. Cyp51 was over-expressed 1.4- to 19-fold in Y136F-mutant isolates. However, the Y136F mutation was absent in one isolate with moderate to high resistance factor. Two additional synonymous mutations were detected as well, one of which, A1119C was present only in isolates with high cyp51 expression. Overall, our results indicate that at least two mechanisms, cyp51 over-expression and the known target-site mutation in CYP51, contribute to resistance in E. necator, and may be working in conjunction with each other. PMID:26839970

  17. Modulation of intracellular Ca(2+) via alpha(1B)-adrenoreceptor signaling molecules, G alpha(h) (transglutaminase II) and phospholipase C-delta 1.

    PubMed

    Kang, Sung Koo; Kim, Dae Kyong; Damron, Derek S; Baek, Kwang Jin; Im, Mie-Jae

    2002-04-26

    We characterized the alpha(1B)-adrenoreceptor (alpha(1B)-AR)-mediated intracellular Ca(2+) signaling involving G alpha(h) (transglutaminase II, TGII) and phospholipase C (PLC)-delta 1 using DDT1-MF2 cell. Expression of wild-type TGII and a TGII mutant lacking transglutaminase activity resulted in significant increases in a rapid peak and a sustained level of intracellular Ca(2+) concentration ([Ca(2+)](i)) in response to activation of the alpha(1B)-AR. Expression of a TGII mutant lacking the interaction with the receptor or PLC-delta 1 substantially reduced both the peak and sustained levels of [Ca(2+)](i). Expression of TGII mutants lacking the interaction with PLC-delta 1 resulted in a reduced capacitative Ca(2+) entry. Reduced expression of PLC-delta 1 displayed a transient elevation of [Ca(2+)](i) and a reduction in capacitative Ca(2+) entry. Expression of the C2-domain of PLC-delta 1, which contains the TGII interaction site, resulted in reduction of the alpha(1B)-AR-evoked peak increase in [Ca(2+)](i), while the sustained elevation in [Ca(2+)](i) and capacitative Ca(2+) entry remained unchanged. These findings demonstrate that stimulation of PLC-delta 1 via coupling of the alpha(1B)-AR with TGII evokes both Ca(2+) release and capacitative Ca(2+) entry and that capacitative Ca(2+) entry is mediated by the interaction of TGII with PLC-delta 1.

  18. Trafficking Defect and Proteasomal Degradation Contribute to the Phenotype of a Novel KCNH2 Long QT Syndrome Mutation

    PubMed Central

    Mihic, Anton; Chauhan, Vijay S.; Gao, Xiaodong; Oudit, Gavin Y.; Tsushima, Robert G.

    2011-01-01

    The Kv11.1 (hERG) K+ channel plays a fundamental role in cardiac repolarization. Missense mutations in KCNH2, the gene encoding Kv11.1, cause long QT syndrome (LQTS) and frequently cause channel trafficking-deficiencies. This study characterized the properties of a novel KCNH2 mutation discovered in a LQT2 patient resuscitated from a ventricular fibrillation arrest. Proband genotyping was performed by SSCP and DNA sequencing. The electrophysiological and biochemical properties of the mutant channel were investigated after expression in HEK293 cells. The proband manifested a QTc of 554 ms prior to electrolyte normalization. Mutation analysis revealed an autosomal dominant frameshift mutation at proline 1086 (P1086fs+32X; 3256InsG). Co-immunoprecipitation demonstrated that wild-type Kv11.1 and mutant channels coassemble. Western blot showed that the mutation did not produce mature complex-glycosylated Kv11.1 channels and coexpression resulted in reduced channel maturation. Electrophysiological recordings revealed mutant channel peak currents to be similar to untransfected cells. Co-expression of channels in a 1∶1 ratio demonstrated dominant negative suppression of peak Kv11.1 currents. Immunocytochemistry confirmed that mutant channels were not present at the plasma membrane. Mutant channel trafficking rescue was attempted by incubation at reduced temperature or with the pharmacological agents E-4031. These treatments did not significantly increase peak mutant currents or induce the formation of mature complex-glycosylated channels. The proteasomal inhibitor lactacystin increased the protein levels of the mutant channels demonstrating proteasomal degradation, but failed to induce mutant Kv11.1 protein trafficking. Our study demonstrates a novel dominant-negative Kv11.1 mutation, which results in degraded non-functional channels leading to a LQT2 phenotype. PMID:21483829

  19. Structure-activity relations of successful pharmacologic chaperones for rescue of naturally occurring and manufactured mutants of the gonadotropin-releasing hormone receptor.

    PubMed

    Janovick, Jo Ann; Goulet, Mark; Bush, Eugene; Greer, Jonathan; Wettlaufer, David G; Conn, P Michael

    2003-05-01

    We expressed a test system of wild-type (WT) rat (r) and human (h) gonadotropin-releasing hormone (GnRH) receptors (GnRHRs), including naturally occurring (13) and manufactured (five) "loss-of-function" mutants of the GnRHR. These were used to assess the ability of different GnRH peptidomimetics to rescue defective GnRHR mutants and determine their effect on the level of membrane expression of the WT receptors. Among the manufactured mutants were the shortest rGnRHR C-terminal truncation mutant that resulted in receptor loss-of-function (des(325-327)-rGnRHR), two nonfunctional deletion mutants (des(237-241)-rGnRHR and des(260-265)-rGnRHR), two nonfunctional Cys mutants (C(229)A-rGnRHR and C(278)A-rGnRHR); the naturally occurring mutants included all 13 full-length GnRHR point mutations reported to date that result in full or partial human hypogonadotropic hypogonadism. The 10 peptidomimetics assessed as potential rescue molecules ("pharmacoperones") are from three differing chemical pedigrees (indoles, quinolones, and erythromycin-derived macrolides) and were originally developed as GnRH peptidomimetic antagonists. These structures were selected for this study because of their predicted ability to permeate the cell membrane and interact with a defined affinity with the GnRH receptor. All peptidomimetics studied with an IC(50) value (for hGnRHR)

  20. A Mutant Connexin50 with Enhanced Hemichannel Function Leads to Cell Death

    PubMed Central

    Minogue, Peter J.; Tong, Jun-Jie; Arora, Anita; Russell-Eggitt, Isabelle; Hunt, David M.; Moore, Anthony T.; Ebihara, Lisa; Beyer, Eric C.; Berthoud, Viviana M.

    2009-01-01

    PURPOSE To determine the consequences of expression of a novel connexin50 (CX50) mutant identified in a child with congenital total cataracts. METHODS The GJA8 gene was directly sequenced. Formation of functional channels was assessed by two-microelectrode voltage-clamp. Connexin protein levels and distribution were assessed by immunoblotting and immunofluorescence. The proportion of apoptotic cells was determined by flow cytometry. RESULTS Direct sequencing of the GJA8 gene identified a 137 G>T transition that resulted in the replacement of glycine by valine at position 46 of the coding region of CX50 (CX50G46V). Both CX50 and CX50G46V induced gap junctional currents in pairs of Xenopus oocytes. In single Xenopus oocytes, CX50G46V induced connexin hemichannel currents that were activated by removal of external calcium; their magnitudes were much higher than those in oocytes injected with similar amounts of CX50 cRNA. When expressed in HeLa cells under the control of an inducible promoter, both CX50 and CX50G46V formed gap junctional plaques. Induction of CX50G46V expression led to a decrease in cell number and an increase in the proportion of apoptotic cells. CX50G46V-induced cell death was prevented by high concentrations of extracellular calcium ions. CONCLUSIONS Unlike previously characterized CX50 mutants that exhibit impaired trafficking and/or lack of function, CX50G46V traffics properly to the plasma membrane and forms functional hemichannels and gap junction channels; however, it causes cell death even when expressed at minute levels. The biochemical results indirectly suggest a potential novel mechanism by which connexin mutants could lead to cataracts: cytotoxicity due to enhanced hemichannel function. PMID:19684000

  1. Genetic Stability of Streptomyces Lividans pIJ702 in Response to Spaceflight

    NASA Astrophysics Data System (ADS)

    Lim, K. S.; Goins, T. L.; Voeikova, T. A.; Pyle, B. H.

    2008-06-01

    Streptomyces lividans carrying plasmid pIJ702 encoding genes for thiostrepton resistance (tsr-) and melanin production (mel+) was plated on agar and flown on the Russian satellite Foton-M3 for 16 days. The percentage loss of plasmid expression in flight samples was lower than that in ground samples when both samples were grown in enriched (ISP) media. Differences in media content also affect plasmid expression rate; ISP media have a higher loss of plasmid expression than samples in minimum media when both were grown on ground conditions. Results suggest that stress resulted in the increased expression of plasmid pIJ702 by S. lividans. Screening of thiostrepton resistant white (tsr+ mel-) mutants showed similar proportions of variants in ground samples and flight samples. To determine if there are mutations in the mel gene, DNA extracted from flight and control white mutants was amplified and gel electrophoresis of amplified products show no major mutation in the products. Sequencing of amplified products is required to identify mutations resulting in loss of pigmentation.

  2. phoP, SPI1, SPI2 and aroA mutants of Salmonella Enteritidis induce a different immune response in chickens.

    PubMed

    Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan

    2015-09-17

    Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.

  3. Abnormal N-Glycosylation of a Novel Missense Creatine Transporter Mutant, G561R, Associated with Cerebral Creatine Deficiency Syndromes Alters Transporter Activity and Localization.

    PubMed

    Uemura, Tatsuki; Ito, Shingo; Ohta, Yusuke; Tachikawa, Masanori; Wada, Takahito; Terasaki, Tetsuya; Ohtsuki, Sumio

    2017-01-01

    Cerebral creatine deficiency syndromes (CCDSs) are caused by loss-of-function mutations in creatine transporter (CRT, SLC6A8), which transports creatine at the blood-brain barrier and into neurons of the central nervous system (CNS). This results in low cerebral creatine levels, and patients exhibit mental retardation, poor language skills and epilepsy. We identified a novel human CRT gene missense mutation (c.1681 G>C, G561R) in Japanese CCDSs patients. The purpose of the present study was to evaluate the reduction of creatine transport in G561R-mutant CRT-expressing 293 cells, and to clarify the mechanism of its functional attenuation. G561R-mutant CRT exhibited greatly reduced creatine transport activity compared to wild-type CRT (WT-CRT) when expressed in 293 cells. Also, the mutant protein is localized mainly in intracellular membrane fraction, while WT-CRT is localized in plasma membrane. Western blot analysis revealed a 68 kDa band of WT-CRT protein in plasma membrane fraction, while G561R-mutant CRT protein predominantly showed bands at 55, 110 and 165 kDa in crude membrane fraction. The bands of both WT-CRT and G561R-mutant CRT were shifted to 50 kDa by N-glycosidase treatment. Our results suggest that the functional impairment of G561R-mutant CRT was probably caused by incomplete N-linked glycosylation due to misfolding during protein maturation, leading to oligomer formation and changes of cellular localization.

  4. A loss-of-function mutation in the nucleoporin AtNUP160 indicates that normal auxin signalling is required for a proper ethylene response in Arabidopsis

    PubMed Central

    Robles, Linda M.; Deslauriers, Stephen D.; Alvarez, Ashley A.; Larsen, Paul B.

    2012-01-01

    As part of a continuing effort to elucidate mechanisms that regulate the magnitude of ethylene signalling, an Arabidopsis mutant with an enhanced ethylene response was identified. Subsequent characterization of this loss-of-function mutant revealed severe hypocotyl shortening in the presence of saturating ethylene along with increased expression in leaves of a subset of ethylene-responsive genes. It was subsequently determined by map-based cloning that the mutant (sar1-7) represents a loss-of-function mutation in the previously described nucleoporin AtNUP160 (At1g33410, SAR1). In support of previously reported results, the sar1-7 mutant partially restored auxin responsiveness to roots of an rce1 loss-of-function mutant, indicating that AtNUP160/SAR1 is required for proper expression of factors responsible for the repression of auxin signalling. Analysis of arf7-1/sar1-7 and arf19-1/sar1-7 double mutants revealed that mutations affecting either ARF7 or ARF19 function almost fully blocked manifestation of the sar1-7-dependent ethylene hypersensitivity phenotype, suggesting that ARF7- and ARF19-mediated auxin signalling is responsible for regulating the magnitude of and/or competence for the ethylene response in Arabidopsis etiolated hypocotyls. Consistent with this, addition of auxin to ethylene-treated seedlings resulted in severe hypocotyl shortening, reminiscent of that seen for other eer (enhanced ethylene response) mutants, suggesting that auxin functions in part synergistically with ethylene to control hypocotyl elongation and other ethylene-dependent phenomena. PMID:22238449

  5. MtPAR MYB transcription factor acts as an on switch for proanthocyanidin biosynthesis in Medicago truncatula

    PubMed Central

    Verdier, Jerome; Zhao, Jian; Torres-Jerez, Ivone; Ge, Shujun; Liu, Chenggang; He, Xianzhi; Mysore, Kirankumar S.; Dixon, Richard A.; Udvardi, Michael K.

    2012-01-01

    MtPAR (Medicago truncatula proanthocyanidin regulator) is an MYB family transcription factor that functions as a key regulator of proanthocyanidin (PA) biosynthesis in the model legume Medicago truncatula. MtPAR expression is confined to the seed coat, the site of PA accumulation. Loss-of-function par mutants contained substantially less PA in the seed coat than the wild type, whereas levels of anthocyanin and other specialized metabolites were normal in the mutants. In contrast, massive accumulation of PAs occurred when MtPAR was expressed ectopically in transformed hairy roots of Medicago. Transcriptome analysis of par mutants and MtPAR-expressing hairy roots, coupled with yeast one-hybrid analysis, revealed that MtPAR positively regulates genes encoding enzymes of the flavonoid–PA pathway via a probable activation of WD40-1. Expression of MtPAR in the forage legume alfalfa (Medicago sativa) resulted in detectable levels of PA in shoots, highlighting the potential of this gene for biotechnological strategies to increase PAs in forage legumes for reduction of pasture bloat in ruminant animals. PMID:22307644

  6. Differential regulation of insulin-like growth factor-I receptor gene expression by wild type and mutant androgen receptor in prostate cancer cells.

    PubMed

    Schayek, Hagit; Seti, Hila; Greenberg, Norman M; Sun, Shihua; Werner, Haim; Plymate, Stephen R

    2010-07-29

    The progression of prostate cancer from an organ-confined, androgen-sensitive disease to a metastatic one is associated with dysregulation of androgen receptor (AR)-regulated target genes and with a decrease in insulin-like growth factor-I receptor (IGF-IR) expression. To investigate the differential effects of wild type (wt) and mutant AR on IGF-IR levels we employed a series of isogenic prostate-derived cell lines and human xenografts. We show that basal and phosphorylated IGF-IR levels progressively decreased as prostate cancer cells became more tumorigenic and metastatic. In addition, we show that wt, but not mutant, AR along with dihydrotestosterone treatment increased IGF-IR promoter activity and endogenous IGF-IR levels. ChIP analysis show enhanced AR binding to the IGF-IR promoter in AR-overexpressing cells. Finally, wt AR-overexpressing cells display an enhanced proliferation rate. In summary, we provide evidence that activated wt AR enhances IGF-IR transcription in prostate cancer cells via a mechanism that involves AR binding to the IGF-IR promoter. AR mutations alter the ability of the mutated protein to regulate IGF-IR expression. Our results suggest that prostate cancer progression is associated with a decrease in IGF-IR expression that could be the result of impaired ability of AR to stimulate IGF-IR gene expression. 2010 Elsevier Ireland Ltd. All rights reserved.

  7. Differential regulation of insulin-like growth factor-I receptor gene expression by wild type and mutant androgen receptor in prostate cancer cells

    PubMed Central

    Schayek, Hagit; Seti, Hila; Greenberg, Norman M.; Sun, Shihua; Werner, Haim; Plymate, Stephen R.

    2010-01-01

    The progression of prostate cancer from an organ-confined, androgen-sensitive disease to a metastatic one is associated with dysregulation of androgen receptor (AR)-regulated target genes and with a decrease in insulin-like growth factor-I receptor (IGF-IR) expression. To investigate the differential effects of wild type (wt) and mutant AR on IGF-IR levels we employed a series of isogenic prostate-derived cell lines and human xenografts. We show that basal and phosphorylated IGF-IR levels progressively decreased as prostate cancer cells became more tumorigenic and metastatic. In addition, we show that wt, but not mutant, AR along with dihydrotestosterone treatment increased IGF-IR promoter activity and endogenous IGF-IR levels. ChIP analysis show enhanced AR binding to the IGF-IR promoter in AR-overexpressing cells. Finally, wt AR-overexpressing cells display an enhanced proliferation rate. In summary, we provide evidence that activated wt AR enhances IGF-IR transcription in prostate cancer cells via a mechanism that involves AR binding to the IGF-IR promoter. AR mutations alter the ability of the mutated protein to regulate IGF-IR expression. Our results suggest that prostate cancer progression is associated with a decrease in IGF-IR expression that could be the result of impaired ability of AR to stimulate IGF-IR gene expression. PMID:20417685

  8. Identification and Characterization of Diacylglycerol Acyltransferase from Oleaginous Fungus Mucor circinelloides.

    PubMed

    Zhang, Luning; Zhang, Huaiyuan; Song, Yuanda

    2018-01-24

    Acyl-CoA:diacylglycerol acyltransferase (DGAT) is a pivotal regulator of triacylglycerol (TAG) synthesis. The oleaginous fungus Mucor circinelloides has four putative DGATs: McDGAT1A, McDGAT1B, McDGAT2A, and McDGAT2B, classified into the DGAT1 and DGAT2 subfamilies, respectively. To identify and characterize DGATs in M. circinelloides, these four genes were expressed in Saccharomyces cerevisiae H1246 (TAG-deficient quadruple mutant), individually. TAG biosynthesis was restored only by the expression of McDGAT2B, and TAG content was significantly higher in the mutants with McDGAT2B expression than in a S. cerevisiae mutant with endogenous DGA1 expression. McDGAT2B prefers saturated fatty acids to monounsaturated fatty acids and has an obvious preference for C18:3 (ω-6) according to the results of substrate preference experiments. Furthermore, only the mRNA expression pattern of McDGAT2B correlated with TAG biosynthesis during a fermentation process. Our experiments strongly indicate that McDGAT2B is crucial for TAG accumulation, suggesting that it may be an essential target for metabolic engineering aimed at increasing lipid content of M. circinelloides.

  9. Influence of Gene Expression on Hardness in Wheat.

    PubMed

    Nirmal, Ravi C; Furtado, Agnelo; Wrigley, Colin; Henry, Robert J

    2016-01-01

    Puroindoline (Pina and Pinb) genes control grain texture or hardness in wheat. Wild-type/soft alleles lead to softer grain while a mutation in one or both of these genes results in a hard grain. Variation in hardness in genotypes with identical Pin alleles (wild-type or mutant) is known but the molecular basis of this is not known. We now report the identification of wheat genotypes with hard grain texture and wild-type/soft Pin alleles indicating that hardness in wheat may be controlled by factors other than mutations in the coding region of the Pin genes. RNA-Seq analysis was used to determine the variation in the transcriptome of developing grains of thirty three diverse wheat genotypes including hard (mutant Pin) and soft (wild type) and those that were hard without having Pin mutations. This defined the role of pin gene expression and identified other candidate genes associated with hardness. Pina was not expressed in hard wheat with a mutation in the Pina gene. The ratio of Pina to Pinb expression was generally lower in the hard non mutant genotypes. Hardness may be associated with differences in Pin expression and other factors and is not simply associated with mutations in the PIN protein coding sequences.

  10. The Loss of Vacuolar Protein Sorting 11 (vps11) Causes Retinal Pathogenesis in a Vertebrate Model of Syndromic Albinism

    PubMed Central

    Thomas, Jennifer L.; Vihtelic, Thomas S.; denDekker, Aaron D.; Willer, Gregory; Luo, Xixia; Murphy, Taylor R.; Gregg, Ronald G.; Hyde, David R.

    2011-01-01

    Purpose. To establish the zebrafish platinum mutant as a model for studying vision defects caused by syndromic albinism diseases such as Chediak-Higashi syndrome, Griscelli syndrome, and Hermansky-Pudlak syndrome (HPS). Methods. Bulked segregant analysis and candidate gene sequencing revealed that the zebrafish platinum mutation is a single-nucleotide insertion in the vps11 (vacuolar protein sorting 11) gene. Expression of vps11 was determined by RT-PCR and in situ hybridization. Mutants were analyzed for pigmentation defects and retinal disease by histology, immunohistochemistry, and transmission electron microscopy. Results. Phenocopy and rescue experiments determined that a loss of Vps11 results in the platinum phenotype. Expression of vps11 appeared ubiquitous during zebrafish development, with stronger expression in the developing retina and retinal pigmented epithelium (RPE). Zebrafish platinum mutants exhibited reduced pigmentation in the body and RPE; however, melanophore development, migration, and dispersion occurred normally. RPE, photoreceptors, and inner retinal neurons formed normally in zebrafish platinum mutants. However, a gradual loss of RPE, an absence of mature melanosomes, and the subsequent degradation of RPE/photoreceptor interdigitation was observed. Conclusions. These data show that Vps11 is not necessary for normal retinal development or initiation of melanin biosynthesis, but is essential for melanosome maturation and healthy maintenance of the RPE and photoreceptors. PMID:21330665

  11. Identification of Novel Glycosyltransferases Required for Assembly of the Pasteurella multocida A:1 Lipopolysaccharide and Their Involvement in Virulence▿ †

    PubMed Central

    Boyce, John D.; Harper, Marina; St. Michael, Frank; John, Marietta; Aubry, Annie; Parnas, Henrietta; Logan, Susan M.; Wilkie, Ian W.; Ford, Mark; Cox, Andrew D.; Adler, Ben

    2009-01-01

    We previously determined the structure of the Pasteurella multocida Heddleston type 1 lipopolysaccharide (LPS) molecule and characterized some of the transferases essential for LPS biosynthesis. We also showed that P. multocida strains expressing truncated LPS display reduced virulence. Here, we have identified all of the remaining glycosyltransferases required for synthesis of the oligosaccharide extension of the P. multocida Heddleston type 1 LPS, including a novel α-1,6 glucosyltransferase, a β-1,4 glucosyltransferase, a putative bifunctional galactosyltransferase, and two heptosyltransferases. In addition, we identified a novel oligosaccharide extension expressed only in a heptosyltransferase (hptE) mutant background. All of the analyzed mutants expressing LPS with a truncated main oligosaccharide extension displayed reduced virulence, but those expressing LPS with an intact heptose side chain were able to persist for long periods in muscle tissue. The hptC mutant, which expressed LPS with the shortest oligosaccharide extension and no heptose side chain, was unable to persist on the muscle or cause any disease. Furthermore, all of the mutants displayed increased sensitivity to the chicken antimicrobial peptide fowlicidin 1, with mutants expressing highly truncated LPS being the most sensitive. PMID:19168738

  12. Efficient production of infectious viruses requires enzymatic activity of Epstein-Barr virus protein kinase.

    PubMed

    Murata, Takayuki; Isomura, Hiroki; Yamashita, Yoriko; Toyama, Shigenori; Sato, Yoshitaka; Nakayama, Sanae; Kudoh, Ayumi; Iwahori, Satoko; Kanda, Teru; Tsurumi, Tatsuya

    2009-06-20

    The Epstein-Barr virus (EBV) BGLF4 gene product is the only protein kinase encoded by the virus genome. In order to elucidate its physiological roles in viral productive replication, we here established a BGLF4-knockout mutant and a revertant virus. While the levels of viral DNA replication of the deficient mutant were equivalent to those of the wild-type and the revertant, virus production was significantly impaired. Expression of the BGLF4 protein in trans fully complemented the low yield of the mutant virus, while expression of a kinase-dead (K102I) form of the protein failed to restore the virus titer. These results demonstrate that BGLF4 plays a significant role in production of infectious viruses and that the kinase activity is crucial.

  13. Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ-ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation.

    PubMed

    Jobe, Timothy O; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A; Mendoza-Cózatl, David G; Schroeder, Julian I

    2012-06-01

    Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M(2) seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  14. Genetic evidence suggests that GIS functions downstream of TCL1 to regulate trichome formation in Arabidopsis.

    PubMed

    Zhang, Na; Yang, Li; Luo, Sha; Wang, Xutong; Wang, Wei; Cheng, Yuxin; Tian, Hainan; Zheng, Kaijie; Cai, Ling; Wang, Shucai

    2018-04-13

    Trichome formation in Arabidopsis is regulated by a MBW complex formed by MYB, bHLH and WD40 transcriptional factors, which can activate GLABRA2 (GL2) and the R3 MYB transcription factor genes. GL2 promotes trichome formation, whereas R3 MYBs are able to block the formation of the MBW complex. It has been reported that the C2H2 transcription factor GIS (GLABROUS INFLORESCENCE STEMS) functions upstream of the MBW activator complex to regulate trichome formation, and that the expression of TCL1 is not regulated by the MBW complex. However, gis and the R3 MYB gene mutant tcl1 (trichomeless 1) have opposite inflorescence trichome phenotypes, but their relationship in regulating trichome formation remained unknown. By generating and characterization of the gis tcl1 double mutant, we found that trichome formation in the gis tcl1double and the tcl1 single mutants were largely indistinguishable, but the trichome formation in the 35S:TCL1/gis transgenic plant was similar to that in the gis mutant. By using quantitative RT-PCR analysis, we showed that expression level of GIS was increased in the triple mutant tcl1 try cpc, but the expression level of TCL1 was not affected in the gis mutant. On the other hand, trichome morphology in both gis tcl1 and 35S:TCL1/gis plants was similar to that in the gis mutant. In summary, our results indicate that GIS may work downstream of TCL1 to regulate trichome formation, and GIS has a dominant role in controlling trichome morphology.

  15. Augmented Expression of Polysaccharide Intercellular Adhesin in a Defined Staphylococcus epidermidis Mutant with the Small-Colony-Variant Phenotype▿

    PubMed Central

    Al Laham, Nahed; Rohde, Holger; Sander, Gunnar; Fischer, Andreas; Hussain, Muzaffar; Heilmann, Christine; Mack, Dietrich; Proctor, Richard; Peters, Georg; Becker, Karsten; von Eiff, Christof

    2007-01-01

    While coagulase-negative staphylococci (CoNS), with their ability to form a thick, multilayered biofilm on foreign bodies, have been identified as the major cause of implant-associated infections, no data are available about biofilm formation by staphylococcal small-colony variants (SCVs). In the past years, a number of device-associated infections due to staphylococcal SCVs were described, among them, several pacemaker infections due to SCVs of CoNS auxotrophic to hemin. To test the characteristics of SCVs of CoNS, in particular, to study the ability of SCVs to form a biofilm on foreign bodies, we generated a stable mutant in electron transport by interrupting one of the hemin biosynthetic genes, hemB, in Staphylococcus epidermidis. In fact, this mutant displayed a stable SCV phenotype with tiny colonies showing strong adhesion to the agar surface. When the incubation time was extended to 48 h or a higher inoculum concentration was used, the mutant produced biofilm amounts on polystyrene similar to those produced by the parent strain. When grown under planktonic conditions, the mutant formed markedly larger cell clusters than the parental strain which were completely disintegrated by the specific β-1,6-hexosaminidase dispersin B but were resistant to trypsin treatment. In a dot blot assay, the mutant expressed larger amounts of polysaccharide intercellular adhesin (PIA) than the parent strain. In conclusion, interrupting a hemin biosynthetic gene in S. epidermidis resulted in an SCV phenotype. Markedly larger cell clusters and the ability of the hemB mutant to form a biofilm are related to the augmented expression of PIA. PMID:17449620

  16. MIB-1 Is Required for Spermatogenesis and Facilitates LIN-12 and GLP-1 Activity in Caenorhabditis elegans.

    PubMed

    Ratliff, Miriam; Hill-Harfe, Katherine L; Gleason, Elizabeth J; Ling, Huiping; Kroft, Tim L; L'Hernault, Steven W

    2018-05-01

    Covalent attachment of ubiquitin to substrate proteins changes their function or marks them for proteolysis, and the specificity of ubiquitin attachment is mediated by the numerous E3 ligases encoded by animals. Mind Bomb is an essential E3 ligase during Notch pathway signaling in insects and vertebrates. While Caenorhabditis elegans encodes a Mind Bomb homolog ( mib-1 ), it has never been recovered in the extensive Notch suppressor/enhancer screens that have identified numerous pathway components. Here, we show that C. elegans mib-1 null mutants have a spermatogenesis-defective phenotype that results in a heterogeneous mixture of arrested spermatocytes, defective spermatids, and motility-impaired spermatozoa. mib-1 mutants also have chromosome segregation defects during meiosis, molecular null mutants are intrinsically temperature-sensitive, and many mib-1 spermatids contain large amounts of tubulin. These phenotypic features are similar to the endogenous RNA intereference (RNAi) mutants, but mib-1 mutants do not affect RNAi. MIB-1 protein is expressed throughout the germ line with peak expression in spermatocytes followed by segregation into the residual body during spermatid formation. C. elegans mib-1 expression, while upregulated during spermatogenesis, also occurs somatically, including in vulva precursor cells. Here, we show that mib-1 mutants suppress both lin-12 and glp-1 ( C. elegans Notch) gain-of-function mutants, restoring anchor cell formation and a functional vulva to the former and partly restoring oocyte production to the latter. However, suppressed hermaphrodites are only observed when grown at 25°, and they are self-sterile. This probably explains why mib-1 was not previously recovered as a Notch pathway component in suppressor/enhancer selection experiments. Copyright © 2018 by the Genetics Society of America.

  17. Inactivation of JAK2/STAT3 Signaling Axis and Downregulation of M1 mAChR Cause Cognitive Impairment in klotho Mutant Mice, a Genetic Model of Aging

    PubMed Central

    Park, Seok-Joo; Shin, Eun-Joo; Min, Sun Seek; An, Jihua; Li, Zhengyi; Hee Chung, Yoon; Hoon Jeong, Ji; Bach, Jae-Hyung; Nah, Seung-Yeol; Kim, Won-Ki; Jang, Choon-Gon; Kim, Yong-Sun; Nabeshima, Yo-ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

    2013-01-01

    We previously reported cognitive dysfunction in klotho mutant mice. In the present study, we further examined novel mechanisms involved in cognitive impairment in these mice. Significantly decreased janus kinase 2 (JAK2) and signal transducer and activator of transcription3 (STAT3) phosphorylation were observed in the hippocampus of klotho mutant mice. A selective decrease in protein expression and binding density of the M1 muscarinic cholinergic receptor (M1 mAChR) was observed in these mice. Cholinergic parameters (ie, acetylcholine (ACh), choline acetyltransferase (ChAT), and acetylcholinesterase (AChE)) and NMDAR-dependent long-term potentiation (LTP) were significantly impaired in klotho mutant mice. McN-A-343 (McN), an M1 mAChR agonist, significantly attenuated these impairments. AG490 (AG), a JAK2 inhibitor, counteracted the attenuating effects of McN, although AG did not significantly alter the McN-induced effect on AChE. Furthermore, AG significantly inhibited the attenuating effects of McN on decreased NMDAR-dependent LTP, protein kinase C βII, p-ERK, p-CREB, BDNF, and p-JAK2/p-STAT3-expression in klotho mutant mice. In addition, k252a, a BDNF receptor tyrosine kinase B (TrkB) inhibitor, significantly counteracted McN effects on decreased ChAT, ACh, and M1 mAChR and p-JAK2/p-STAT3 expression. McN-induced effects on cognitive impairment in klotho mutant mice were consistently counteracted by either AG or k252a. Our results suggest that inactivation of the JAK2/STAT3 signaling axis and M1 mAChR downregulation play a critical role in cognitive impairment observed in klotho mutant mice. PMID:23389690

  18. Gravity persistent signal 1 reveals a novel cytochrome P450 involved in gravitropic signal transduction

    NASA Astrophysics Data System (ADS)

    Wyatt, Sarah

    Understanding gene expression that occurs during gravitopism is important for studying the processes that link the perception of gravity to the growth response. Arabidopsis plants with a mutation in the GRAVITY PERSISTENT SIGNAL (GPS)1 locus show a "no response" phenotype during gravistimulation experiments. Basepital auxin transport in gps1 mutant was unaffected by the mutation, but auxin was not laterally redistributed after gravistimulation. GPS1 encodes CYP705A22, a cytochrome P450 protein (P450) of unknown function. The wild type CYP705A22 gene was transformed into the gps1 mutant background and successfully rescued the mutant phenotype. Data mining of microarray data collected from gravistimulated root tips of Arabidopsis indicated that although CYP705A22 was not expressed in roots, a family member CYP705A5 was up-regulated within 3 minutes after gravistimulation. Expression profiling of CYP705A5, using real-time quantitative PCR, showed that CYP705A5 was up-regulated nearly five fold within minutes of gravity stimulation. And reporter gene fusions that link the CYP705A5 gene to the green fluorescent protein showed that CYP705A5 was expressed in the root zones of elongation and maturation. Computer modeling of the catalytic domain of CYP705A22 and CYP705A5 and in silico substrate docking simulations generated a list of 130 compounds that are potential substrates of the P450s. Many of the compounds are phenylpropanoid derivatives. Heterologous expression of CYP705A5 in baculovirus and Type 1 binding studies indicate the substrate of the P450 may be quercitin or myricetin. A mutation affecting CYP705A5 expression resulted in a delayed gravity response in roots. The mutant phenotype could be chemically complemented, and DPBA staining in the CYP705A5 mutant indicated a 1.5 fold accumulation of quercetin in mutant roots as compared to WT. These data, taken together, may indicate that we have identified a flavonoid pathway that regulates auxin distribution and thus is involved in gravitropic signal transduction. (Partially support by NSF: 0618506 to SEW)

  19. Induction of expression and co-localization of heat shock polypeptides with the polyalanine expansion mutant of poly(A)-binding protein N1 after chemical stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Qishan; Bag, Jnanankur

    Formation of nuclear inclusions consisting of aggregates of a polyalanine expansion mutant of nuclear poly(A)-binding protein (PABPN1) is the hallmark of oculopharyngeal muscular dystrophy (OPMD). OPMD is a late onset autosomal dominant disease. Patients with this disorder exhibit progressive swallowing difficulty and drooping of their eye lids, which starts around the age of 50. Previously we have shown that treatment of cells expressing the mutant PABPN1 with a number of chemicals such as ibuprofen, indomethacin, ZnSO{sub 4}, and 8-hydroxy-quinoline induces HSP70 expression and reduces PABPN1 aggregation. In these studies we have shown that expression of additional HSPs including HSP27, HSP40,more » and HSP105 were induced in mutant PABPN1 expressing cells following exposure to the chemicals mentioned above. Furthermore, all three additional HSPs were translocated to the nucleus and probably helped to properly fold the mutant PABPN1 by co-localizing with this protein.« less

  20. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib

    PubMed Central

    Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Kirkwood, John; Avogadri-Connors, Francesca; Cutler Jr, Richard E.; Lalani, Alshad S.; Dent, Paul

    2018-01-01

    ABSTRACT The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins. PMID:29219657

  1. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib.

    PubMed

    Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul

    2018-02-01

    The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins.

  2. Functional Heterologous Protein Expression by Genetically Engineered Probiotic Yeast Saccharomyces boulardii

    PubMed Central

    Hudson, Lauren E.; Fasken, Milo B.; McDermott, Courtney D.; McBride, Shonna M.; Kuiper, Emily G.; Guiliano, David B.; Corbett, Anita H.; Lamb, Tracey J.

    2014-01-01

    Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders. PMID:25391025

  3. Functional heterologous protein expression by genetically engineered probiotic yeast Saccharomyces boulardii.

    PubMed

    Hudson, Lauren E; Fasken, Milo B; McDermott, Courtney D; McBride, Shonna M; Kuiper, Emily G; Guiliano, David B; Corbett, Anita H; Lamb, Tracey J

    2014-01-01

    Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders.

  4. Regulation of Hemolysin Expression and Virulence of Staphylococcus aureus by a Serine/Threonine Kinase and Phosphatase

    PubMed Central

    Burnside, Kellie; Lembo, Annalisa; de los Reyes, Melissa; Iliuk, Anton; BinhTran, Nguyen-Thao; Connelly, James E.; Lin, Wan-Jung; Schmidt, Byron Z.; Richardson, Anthony R.; Fang, Ferric C.; Tao, Weiguo Andy; Rajagopal, Lakshmi

    2010-01-01

    Exotoxins, including the hemolysins known as the alpha (α) and beta (β) toxins, play an important role in the pathogenesis of Staphylococcus aureus infections. A random transposon library was screened for S. aureus mutants exhibiting altered hemolysin expression compared to wild type. Transposon insertions in 72 genes resulting in increased or decreased hemolysin expression were identified. Mutations inactivating a putative cyclic di-GMP synthetase and a serine/threonine phosphatase (Stp1) were found to reduce hemolysin expression, and mutations in genes encoding a two component regulator PhoR, LysR family transcriptional regulator, purine biosynthetic enzymes and a serine/threonine kinase (Stk1) increased expression. Transcription of the hla gene encoding α toxin was decreased in a Δstp1 mutant strain and increased in a Δstk1 strain. Microarray analysis of a Δstk1 mutant revealed increased transcription of additional exotoxins. A Δstp1 strain is severely attenuated for virulence in mice and elicits less inflammation and IL-6 production than the Δstk1 strain. In vivo phosphopeptide enrichment and mass spectrometric analysis revealed that threonine phosphorylated peptides corresponding to Stk1, DNA binding histone like protein (HU), serine-aspartate rich fibrinogen/bone sialoprotein binding protein (SdrE) and a hypothetical protein (NWMN_1123) were present in the wild type and not in the Δstk1 mutant. Collectively, these studies suggest that Stk1 mediated phosphorylation of HU, SrdE and NWMN_1123 affects S. aureus gene expression and virulence. PMID:20552019

  5. Study the Expression of ompf Gene in Esherichia coli Mutants.

    PubMed

    Jaktaji, R Pourahmad; Heidari, F

    2013-09-01

    The outer membrane porin proteins are the major factors in controlling the permeability of cell membrane. OmpF is an example of porin proteins in Esherichia coli. In normal growth condition a large amount of this protein is synthesised, but under stress condition, such as the presence of antibiotics in environment its expression is decreased inhibiting the entrance of antibiotics into cell. The expression of ompF is inhibited by antisense RNA transcribed from micF. In normal condition the expression of micF is low, but in the presence of antibiotics its expression is increased and causes multiple resistances to irrelevant antibiotics. The aims of this research were to study first, the intactness of micF and then quantify the expression of ompF in ciprofloxacin and tetracycline resistant mutants of E. coli. For this purpose the 5' end of micF was amplified and then sequenced. None of these mutants except one and its clone has a mutation in this gene. Then the relative expression of ompF in these mutants was quantified by real time PCR. There was no significant difference between ompF transcription of mutants and wild type strain. Based on this study and previous study it is concluded that low to intermediate levels of resistance to ciprofloxacin and tetracycline does not decrease ompF transcription.

  6. Ectopic expression of a polyalanine expansion mutant of poly(A)-binding protein N1 in muscle cells in culture inhibits myogenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Qishan; Bag, Jnanankur

    2006-02-17

    Oculopharyngeal muscular dystrophy (OPMD) is an adult-onset dominant genetic disease caused by the expansion of a GCG trinucleotide repeat that encodes the polyalanine tract at the N-terminus of the nuclear poly(A)-binding protein (PABPN1). Presence of intranuclear inclusions (INIs) containing PABPN1 aggregates in the skeletal muscles is the hallmark of OPMD. Here, we show that ectopic expression of the mutant PABPN1 produced INIs in a muscle cell culture model and reduced expression of several muscle-specific proteins including {alpha}-actin, slow troponin C, muscle creatine kinase, and two myogenic transcription factors, myogenin and MyoD. However, the levels of two upstream regulators of themore » MyoD gene, the Myf-5 and Pax3/7, were not affected, but both proteins co-localized with the PABPN1 aggregates in the mutant PABPN1 overexpressing cells. In these cells, although myogenin and MyoD levels were reduced, these two transcription factors did not co-localize with the mutant PABPN1 aggregates. Therefore, sequestration of Myf5 and Pax3/7 by the mutant PABPN1 aggregates was a specific effect on these factors. Our results suggest that trapping of these two important myogenic determinants may interfere with an early step in myogenesis.« less

  7. Arabidopsis WRKY6 Transcription Factor Acts as a Positive Regulator of Abscisic Acid Signaling during Seed Germination and Early Seedling Development

    PubMed Central

    Wu, Wei-Hua; Chen, Yi-Fang

    2016-01-01

    The phytohormone abscisic acid (ABA) plays important roles during seed germination and early seedling development. Here, we characterized the function of the Arabidopsis WRKY6 transcription factor in ABA signaling. The transcript of WRKY6 was repressed during seed germination and early seedling development, and induced by exogenous ABA. The wrky6-1 and wrky6-2 mutants were ABA insensitive, whereas WRKY6-overexpressing lines showed ABA-hypersensitive phenotypes during seed germination and early seedling development. The expression of RAV1 was suppressed in the WRKY6-overexpressing lines and elevated in the wrky6 mutants, and the expression of ABI3, ABI4, and ABI5, which was directly down-regulated by RAV1, was enhanced in the WRKY6-overexpressing lines and repressed in the wrky6 mutants. Electrophoretic mobility shift and chromatin immunoprecipitation assays showed that WRKY6 could bind to the RAV1 promoter in vitro and in vivo. Overexpression of RAV1 in WRKY6-overexpressing lines abolished their ABA-hypersensitive phenotypes, and the rav1 wrky6-2 double mutant showed an ABA-hypersensitive phenotype, similar to rav1 mutant. Together, the results demonstrated that the Arabidopsis WRKY6 transcription factor played important roles in ABA signaling by directly down-regulating RAV1 expression. PMID:26829043

  8. Epithelial-to-Mesenchymal Transition Antagonizes Response to Targeted Therapies in Lung Cancer by Suppressing BIM.

    PubMed

    Song, Kyung-A; Niederst, Matthew J; Lochmann, Timothy L; Hata, Aaron N; Kitai, Hidenori; Ham, Jungoh; Floros, Konstantinos V; Hicks, Mark A; Hu, Haichuan; Mulvey, Hillary E; Drier, Yotam; Heisey, Daniel A R; Hughes, Mark T; Patel, Neha U; Lockerman, Elizabeth L; Garcia, Angel; Gillepsie, Shawn; Archibald, Hannah L; Gomez-Caraballo, Maria; Nulton, Tara J; Windle, Brad E; Piotrowska, Zofia; Sahingur, Sinem E; Taylor, Shirley M; Dozmorov, Mikhail; Sequist, Lecia V; Bernstein, Bradley; Ebi, Hiromichi; Engelman, Jeffrey A; Faber, Anthony C

    2018-01-01

    Purpose: Epithelial-to-mesenchymal transition (EMT) confers resistance to a number of targeted therapies and chemotherapies. However, it has been unclear why EMT promotes resistance, thereby impairing progress to overcome it. Experimental Design: We have developed several models of EMT-mediated resistance to EGFR inhibitors (EGFRi) in EGFR -mutant lung cancers to evaluate a novel mechanism of EMT-mediated resistance. Results: We observed that mesenchymal EGFR -mutant lung cancers are resistant to EGFRi-induced apoptosis via insufficient expression of BIM, preventing cell death despite potent suppression of oncogenic signaling following EGFRi treatment. Mechanistically, we observed that the EMT transcription factor ZEB1 inhibits BIM expression by binding directly to the BIM promoter and repressing transcription. Derepression of BIM expression by depletion of ZEB1 or treatment with the BH3 mimetic ABT-263 to enhance "free" cellular BIM levels both led to resensitization of mesenchymal EGFR -mutant cancers to EGFRi. This relationship between EMT and loss of BIM is not restricted to EGFR -mutant lung cancers, as it was also observed in KRAS -mutant lung cancers and large datasets, including different cancer subtypes. Conclusions: Altogether, these data reveal a novel mechanistic link between EMT and resistance to lung cancer targeted therapies. Clin Cancer Res; 24(1); 197-208. ©2017 AACR . ©2017 American Association for Cancer Research.

  9. Overexpression of mutant ataxin-3 in mouse cerebellum induces ataxia and cerebellar neuropathology.

    PubMed

    Nóbrega, Clévio; Nascimento-Ferreira, Isabel; Onofre, Isabel; Albuquerque, David; Conceição, Mariana; Déglon, Nicole; de Almeida, Luís Pereira

    2013-08-01

    Machado-Joseph disease (MJD), also known as spinocerebellar ataxia type 3 (SCA3), is a fatal, dominant neurodegenerative disorder caused by the polyglutamine-expanded protein ataxin-3. Clinical manifestations include cerebellar ataxia and pyramidal signs culminating in severe neuronal degeneration. Currently, there is no therapy able to modify disease progression. In the present study, we aimed at investigating one of the most severely affected brain regions in the disorder--the cerebellum--and the behavioral defects associated with the neuropathology in this region. For this purpose, we injected lentiviral vectors encoding full-length human mutant ataxin-3 in the mouse cerebellum of 3-week-old C57/BL6 mice. We show that circumscribed expression of human mutant ataxin-3 in the cerebellum mediates within a short time frame--6 weeks, the development of a behavioral phenotype including reduced motor coordination, wide-based ataxic gait, and hyperactivity. Furthermore, the expression of mutant ataxin-3 resulted in the accumulation of intranuclear inclusions, neuropathological abnormalities, and neuronal death. These data show that lentiviral-based expression of mutant ataxin-3 in the mouse cerebellum induces localized neuropathology, which is sufficient to generate a behavioral ataxic phenotype. Moreover, this approach provides a physiologically relevant, cost-effective and time-effective animal model to gain further insights into the pathogenesis of MJD and for the evaluation of experimental therapeutics of MJD.

  10. Polygalacturonase Gene Expression in Rutgers, rin, nor, and Nr Tomato Fruits 1

    PubMed Central

    DellaPenna, Dean; Kates, David S.; Bennett, Alan B.

    1987-01-01

    Polygalacturonase (PG) gene expression was studied in normally ripening tomato fruit (Lycopersicon esculentum Mill, cv Rutgers) and in three ripening-impaired mutants, rin, nor, and Nr. Normal and mutant fruit of identical chronological age were analyzed at 41, 49, and 62 days after pollination. These stages corresponded to mature-green, ripe, and overripe, respectively, for Rutgers. The amount of PG mRNA in Rutgers was highest at 49 days and accounted for 2.3% of the total mRNA mass but at 62 days had decreased to 0.004% of the total mRNA mass. In Nr, the amount of PG mRNA steadily increased between 41 and 62 days after pollination, reaching a maximum level of 0.5% of the total mRNA mass. The mutant nor exhibited barely detectable levels of PG mRNA at all stages tested. Surprisingly, PG mRNA, comprising approximately 0.06% of the mRNA mass, was detected in 49 day rin fruit. This mRNA accumulation occurred in the absence of elevated ethylene production by the fruit and resulted in the synthesis of enzymically active PG I. The different patterns of PG mRNA accumulation in the three mutants suggests that distinct molecular mechanisms contribute to reduced PG expression in each ripening-impaired mutant. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 PMID:16665727

  11. Understanding the role of argininosuccinate lyase transcript variants in the clinical and biochemical variability of the urea cycle disorder argininosuccinic aciduria.

    PubMed

    Hu, Liyan; Pandey, Amit V; Eggimann, Sandra; Rüfenacht, Véronique; Möslinger, Dorothea; Nuoffer, Jean-Marc; Häberle, Johannes

    2013-11-29

    Argininosuccinic aciduria (ASA) is an autosomal recessive urea cycle disorder caused by deficiency of argininosuccinate lyase (ASL) with a wide clinical spectrum from asymptomatic to severe hyperammonemic neonatal onset life-threatening courses. We investigated the role of ASL transcript variants in the clinical and biochemical variability of ASA. Recombinant proteins for ASL wild type, mutant p.E189G, and the frequently occurring transcript variants with exon 2 or 7 deletions were (co-)expressed in human embryonic kidney 293T cells. We found that exon 2-deleted ASL forms a stable truncated protein with no relevant activity but a dose-dependent dominant negative effect on enzymatic activity after co-expression with wild type or mutant ASL, whereas exon 7-deleted ASL is unstable but seems to have, nevertheless, a dominant negative effect on mutant ASL. These findings were supported by structural modeling predictions for ASL heterotetramer/homotetramer formation. Illustrating the physiological relevance, the predominant occurrence of exon 7-deleted ASL was found in two patients who were both heterozygous for the ASL mutant p.E189G. Our results suggest that ASL transcripts can contribute to the highly variable phenotype in ASA patients if expressed at high levels. Especially, the exon 2-deleted ASL variant may form a heterotetramer with wild type or mutant ASL, causing markedly reduced ASL activity.

  12. Hox11 paralogous genes are essential for metanephric kidney induction

    PubMed Central

    Wellik, Deneen M.; Hawkes, Patrick J.; Capecchi, Mario R.

    2002-01-01

    The mammalian Hox complex is divided into four linkage groups containing 13 sets of paralogous genes. These paralogous genes have retained functional redundancy during evolution. For this reason, loss of only one or two Hox genes within a paralogous group often results in incompletely penetrant phenotypes which are difficult to interpret by molecular analysis. For example, mice individually mutant for Hoxa11 or Hoxd11 show no discernible kidney abnormalities. Hoxa11/Hoxd11 double mutants, however, demonstrate hypoplasia of the kidneys. As described in this study, removal of the last Hox11 paralogous member, Hoxc11, results in the complete loss of metanephric kidney induction. In these triple mutants, the metanephric blastema condenses, and expression of early patterning genes, Pax2 and Wt1, is unperturbed. Eya1 expression is also intact. Six2 expression, however, is absent, as is expression of the inducing growth factor, Gdnf. In the absence of Gdnf, ureteric bud formation is not initiated. Molecular analysis of this phenotype demonstrates that Hox11 control of early metanephric induction is accomplished by the interaction of Hox11 genes with the pax-eya-six regulatory cascade, a pathway that may be used by Hox genes more generally for the induction of multiple structures along the anteroposterior axis. PMID:12050119

  13. The transcription factor SKN7 regulates conidiation, thermotolerance, apoptotic-like cell death and parasitism in the nematode endoparasitic fungus Hirsutella minnesotensis

    PubMed Central

    Hussain, Muzammil; Hamid, M. Imran; Wang, Niuniu; Bin, Lin; Xiang, Meichun; Liu, Xingzhong

    2016-01-01

    The transcription factor SKN7 is a highly conserved protein among fungi and was initially recognized as a response regulator that protects cells from oxidative stress and maintains cell wall integrity in yeast. Orthologs of SKN7 are extensively present in biocontrol agents of plant pathogens, but they had not been functionally characterized. Here, we identified and characterized the transcription factor SKN7 in the nematode endoparasitic fungus Hirsutella minnesotensis. Null mutant lacking HIM-SKN7 (HIM_03620), which was generated by a gene disruption strategy, demonstrated reduced conidiation, increased sensitivity to high temperature, hydrogen peroxide, mannitol and ethanol, and reduced fungal resistance to farnesol. However, over-expression mutant showed increased conidial production, thermotolerance and resistance to farnesol, suggesting that HIM-SKN7 regulates antiapoptotic-like cell death in H. minnesotensis. Moreover, the results showed that in null mutant, H. minnesotensis had decreased endoparasitic ability as compared to wild type and over-expression strain. During the infection process, the relative expression of the HIM-SKN7 gene was significantly induced in the wild type and over-expression strain. The results of the present study advance our understanding of the functions of the SKN7 gene in biocontrol agents, in particular, nematode endoparasitic fungi. PMID:27436205

  14. Hox11 paralogous genes are essential for metanephric kidney induction.

    PubMed

    Wellik, Deneen M; Hawkes, Patrick J; Capecchi, Mario R

    2002-06-01

    The mammalian Hox complex is divided into four linkage groups containing 13 sets of paralogous genes. These paralogous genes have retained functional redundancy during evolution. For this reason, loss of only one or two Hox genes within a paralogous group often results in incompletely penetrant phenotypes which are difficult to interpret by molecular analysis. For example, mice individually mutant for Hoxa11 or Hoxd11 show no discernible kidney abnormalities. Hoxa11/Hoxd11 double mutants, however, demonstrate hypoplasia of the kidneys. As described in this study, removal of the last Hox11 paralogous member, Hoxc11, results in the complete loss of metanephric kidney induction. In these triple mutants, the metanephric blastema condenses, and expression of early patterning genes, Pax2 and Wt1, is unperturbed. Eya1 expression is also intact. Six2 expression, however, is absent, as is expression of the inducing growth factor, Gdnf. In the absence of Gdnf, ureteric bud formation is not initiated. Molecular analysis of this phenotype demonstrates that Hox11 control of early metanephric induction is accomplished by the interaction of Hox11 genes with the pax-eya-six regulatory cascade, a pathway that may be used by Hox genes more generally for the induction of multiple structures along the anteroposterior axis.

  15. Stress Marker Signatures in Lesion Mimic Single and Double Mutants Identify a Crucial Leaf Age-Dependent Salicylic Acid Related Defense Signal.

    PubMed

    Kaurilind, Eve; Brosché, Mikael

    2017-01-01

    Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.

  16. A link among DNA replication, recombination, and gene expression revealed by genetic and genomic analysis of TEBICHI gene of Arabidopsis thaliana.

    PubMed

    Inagaki, Soichi; Nakamura, Kenzo; Morikami, Atsushi

    2009-08-01

    Spatio-temporal regulation of gene expression during development depends on many factors. Mutations in Arabidopsis thaliana TEBICHI (TEB) gene encoding putative helicase and DNA polymerase domains-containing protein result in defects in meristem maintenance and correct organ formation, as well as constitutive DNA damage response and a defect in cell cycle progression; but the molecular link between these phenotypes of teb mutants is unknown. Here, we show that mutations in the DNA replication checkpoint pathway gene, ATR, but not in ATM gene, enhance developmental phenotypes of teb mutants, although atr suppresses cell cycle defect of teb mutants. Developmental phenotypes of teb mutants are also enhanced by mutations in RAD51D and XRCC2 gene, which are involved in homologous recombination. teb and teb atr double mutants exhibit defects in adaxial-abaxial polarity of leaves, which is caused in part by the upregulation of ETTIN (ETT)/AUXIN RESPONSIVE FACTOR 3 (ARF3) and ARF4 genes. The Helitron transposon in the upstream of ETT/ARF3 gene is likely to be involved in the upregulation of ETT/ARF3 in teb. Microarray analysis indicated that teb and teb atr causes preferential upregulation of genes nearby the Helitron transposons. Furthermore, interestingly, duplicated genes, especially tandemly arrayed homologous genes, are highly upregulated in teb or teb atr. We conclude that TEB is required for normal progression of DNA replication and for correct expression of genes during development. Interplay between these two functions and possible mechanism leading to altered expression of specific genes will be discussed.

  17. Enhanced MET Translation and Signaling Sustains K-Ras-Driven Proliferation under Anchorage-Independent Growth Conditions.

    PubMed

    Fujita-Sato, Saori; Galeas, Jacqueline; Truitt, Morgan; Pitt, Cameron; Urisman, Anatoly; Bandyopadhyay, Sourav; Ruggero, Davide; McCormick, Frank

    2015-07-15

    Oncogenic K-Ras mutation occurs frequently in several types of cancers, including pancreatic and lung cancers. Tumors with K-Ras mutation are resistant to chemotherapeutic drugs as well as molecular targeting agents. Although numerous approaches are ongoing to find effective ways to treat these tumors, there are still no effective therapies for K-Ras mutant cancer patients. Here we report that K-Ras mutant cancers are more dependent on K-Ras in anchorage-independent culture conditions than in monolayer culture conditions. In seeking to determine mechanisms that contribute to the K-Ras dependency in anchorage-independent culture conditions, we discovered the involvement of Met in K-Ras-dependent, anchorage-independent cell growth. The Met signaling pathway is enhanced and plays an indispensable role in anchorage-independent growth even in cells in which Met is not amplified. Indeed, Met expression is elevated under anchorage-independent growth conditions and is regulated by K-Ras in a MAPK/ERK kinase (MEK)-dependent manner. Remarkably, in spite of a global downregulation of mRNA translation during anchorage-independent growth, we find that Met mRNA translation is specifically enhanced under these conditions. Importantly, ectopic expression of an active Met mutant rescues K-Ras ablation-derived growth suppression, indicating that K-Ras-mediated Met expression drives "K-Ras addiction" in anchorage-independent conditions. Our results indicate that enhanced Met expression and signaling is essential for anchorage-independent growth of K-Ras mutant cancer cells and suggests that pharmacological inhibitors of Met could be effective for K-Ras mutant tumor patients. ©2015 American Association for Cancer Research.

  18. Enhanced MET translation and signaling sustains K-Ras driven proliferation under anchorage-independent growth conditions

    PubMed Central

    Fujita-Sato, Saori; Galeas, Jacqueline; Truitt, Morgan; Pitt, Cameron; Urisman, Anatoly; Bandyopadhyay, Sourav; Ruggero, Davide; McCormick, Frank

    2015-01-01

    Oncogenic K-Ras mutation occurs frequently in several types of cancers including pancreatic and lung cancers. Tumors with K-Ras mutation are resistant to chemotherapeutic drugs as well as molecular targeting agents. Although numerous approaches are ongoing to find effective ways to treat these tumors, there are still no effective therapies for K-Ras mutant cancer patients. Here we report that K-Ras mutant cancers are more dependent on K-Ras in anchorage independent culture conditions than in monolayer culture conditions. In seeking to determine mechanisms that contribute to the K-Ras dependency in anchorage independent culture conditions, we discovered the involvement of Met in K-Ras-dependent, anchorage independent cell growth. The Met signaling pathway is enhanced and plays an indispensable role in anchorage independent growth even in cells in which Met is not amplified. Indeed, Met expression is elevated under anchorage-independent growth conditions and is regulated by K-Ras in a MAPK/ERK kinase (MEK)-dependent manner. Remarkably, in spite of a global down-regulation of mRNA translation during anchorage independent growth, we find that Met mRNA translation is specifically enhanced under these conditions. Importantly, ectopic expression of an active Met mutant rescues K-Ras ablation-derived growth suppression, indicating that K-Ras mediated Met expression drives “K-Ras addiction” in anchorage independent conditions. Our results indicate that enhanced Met expression and signaling is essential for anchorage independent growth of K-Ras mutant cancer cells and suggests that pharmacological inhibitors of Met could be effective for K-Ras mutant tumor patients. PMID:25977330

  19. Mechanism for generation of left isomerism in Ccdc40 mutant embryos

    PubMed Central

    Sugrue, Kelsey F.

    2017-01-01

    Leftward fluid flow in the mouse node is generated by cilia and is critical for initiating asymmetry of the left-right axis. Coiled-coil domain containing-40 (Ccdc40) plays an evolutionarily conserved role in the assembly of motile cilia and establishment of the left-right axis. Approximately one-third of Ccdc40lnks mutant embryos display situs defects and here we investigate the underlying mechanism. Ccdc40lnks mutants show delayed induction of markers of the left-lateral plate mesoderm (L-LPM) including Lefty1, Lefty2 and Nodal. Consistent with defective cilia motility compromising fluid flow across the node, initiation of asymmetric perinodal Cerberus like-2 (Cerl2) expression is delayed and then randomized. This is followed by delayed and then randomized asymmetric Nodal expression around the node. We propose a model to explain how left isomerism arises in a proportion of Ccdc40lnks mutants. We postulate that with defective motile cilia, Cerl2 expression remains symmetric and Nodal is antagonized equally on both sides of the node. This effectively reduces Nodal activation bilaterally, leading to reduced and delayed activation of Nodal and its antagonists in the LPM. This model is further supported by the failure to establish Nodal expression in the left-LPM with reduced Nodal gene dosage in Ccdc40lnks/lnks;NodalLacZ/+ mutants causing a predominance of right not left isomerism. Together these results suggest a model where cilia generated fluid flow in the node functions to ensure robust Nodal activation and a timely left-sided developmental program in the LPM. PMID:28182636

  20. A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

    PubMed

    Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

    2002-08-22

    A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

  1. A herpes simplex virus 2 glycoprotein D mutant generated by bacterial artificial chromosome mutagenesis is severely impaired for infecting neuronal cells and infects only Vero cells expressing exogenous HVEM.

    PubMed

    Wang, Kening; Kappel, Justin D; Canders, Caleb; Davila, Wilmer F; Sayre, Dean; Chavez, Mayra; Pesnicak, Lesley; Cohen, Jeffrey I

    2012-12-01

    We constructed a herpes simplex virus 2 (HSV-2) bacterial artificial chromosome (BAC) clone, bHSV2-BAC38, which contains full-length HSV-2 inserted into a BAC vector. Unlike previously reported HSV-2 BAC clones, the virus genome inserted into this BAC clone has no known gene disruptions. Virus derived from the BAC clone had a wild-type phenotype for growth in vitro and for acute infection, latency, and reactivation in mice. HVEM, expressed on epithelial cells and lymphocytes, and nectin-1, expressed on neurons and epithelial cells, are the two principal receptors used by HSV to enter cells. We used the HSV-2 BAC clone to construct an HSV-2 glycoprotein D mutant (HSV2-gD27) with point mutations in amino acids 215, 222, and 223, which are critical for the interaction of gD with nectin-1. HSV2-gD27 infected cells expressing HVEM, including a human epithelial cell line. However, the virus lost the ability to infect cells expressing only nectin-1, including neuronal cell lines, and did not infect ganglia in mice. Surprisingly, we found that HSV2-gD27 could not infect Vero cells unless we transduced the cells with a retrovirus expressing HVEM. High-level expression of HVEM in Vero cells also resulted in increased syncytia and enhanced cell-to-cell spread in cells infected with wild-type HSV-2. The inability of the HSV2-gD27 mutant to infect neuronal cells in vitro or sensory ganglia in mice after intramuscular inoculation suggests that this HSV-2 mutant might be an attractive candidate for a live attenuated HSV-2 vaccine.

  2. A Herpes Simplex Virus 2 Glycoprotein D Mutant Generated by Bacterial Artificial Chromosome Mutagenesis Is Severely Impaired for Infecting Neuronal Cells and Infects Only Vero Cells Expressing Exogenous HVEM

    PubMed Central

    Kappel, Justin D.; Canders, Caleb; Davila, Wilmer F.; Sayre, Dean; Chavez, Mayra; Pesnicak, Lesley; Cohen, Jeffrey I.

    2012-01-01

    We constructed a herpes simplex virus 2 (HSV-2) bacterial artificial chromosome (BAC) clone, bHSV2-BAC38, which contains full-length HSV-2 inserted into a BAC vector. Unlike previously reported HSV-2 BAC clones, the virus genome inserted into this BAC clone has no known gene disruptions. Virus derived from the BAC clone had a wild-type phenotype for growth in vitro and for acute infection, latency, and reactivation in mice. HVEM, expressed on epithelial cells and lymphocytes, and nectin-1, expressed on neurons and epithelial cells, are the two principal receptors used by HSV to enter cells. We used the HSV-2 BAC clone to construct an HSV-2 glycoprotein D mutant (HSV2-gD27) with point mutations in amino acids 215, 222, and 223, which are critical for the interaction of gD with nectin-1. HSV2-gD27 infected cells expressing HVEM, including a human epithelial cell line. However, the virus lost the ability to infect cells expressing only nectin-1, including neuronal cell lines, and did not infect ganglia in mice. Surprisingly, we found that HSV2-gD27 could not infect Vero cells unless we transduced the cells with a retrovirus expressing HVEM. High-level expression of HVEM in Vero cells also resulted in increased syncytia and enhanced cell-to-cell spread in cells infected with wild-type HSV-2. The inability of the HSV2-gD27 mutant to infect neuronal cells in vitro or sensory ganglia in mice after intramuscular inoculation suggests that this HSV-2 mutant might be an attractive candidate for a live attenuated HSV-2 vaccine. PMID:22993162

  3. Expression and regulation of the penicillin G acylase gene from Proteus rettgeri cloned in Escherichia coli.

    PubMed

    Daumy, G O; Williams, J A; McColl, A S; Zuzel, T J; Danley, D

    1986-10-01

    The penicillin G acylase genes from the Proteus rettgeri wild type and from a hyperproducing mutant which is resistant to succinate repression were cloned in Escherichia coli K-12. Expression of both wild-type and mutant P. rettgeri acylase genes in E. coli K-12 was independent of orientation in the cloning vehicle and apparently resulted from recognition in E. coli of the P. rettgeri promoter sequences. The P. rettgeri acylase was secreted into the E. coli periplasmic space and was composed of subunits electrophoretically identical to those made in P. rettgeri. Expression of these genes in E. coli K-12 was not repressed by succinate as it is in P. rettgeri. Instead, expression of the enzymes was regulated by glucose catabolite repression.

  4. Forced Expression of Heat Shock Protein 27 (Hsp27) Reverses P-Glycoprotein (ABCB1)-mediated Drug Efflux and MDR1 Gene Expression in Adriamycin-resistant Human Breast Cancer Cells*

    PubMed Central

    Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy

    2011-01-01

    Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846

  5. Forced expression of heat shock protein 27 (Hsp27) reverses P-glycoprotein (ABCB1)-mediated drug efflux and MDR1 gene expression in Adriamycin-resistant human breast cancer cells.

    PubMed

    Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy

    2011-09-23

    Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.

  6. Development of a High-Throughput Flow Cytometry Assay to Monitor Defective Trafficking and Rescue of Long QT2 Mutant hERG Channels

    PubMed Central

    Kanner, Scott A.; Jain, Ananya; Colecraft, Henry M.

    2018-01-01

    Long QT Syndrome (LQTS) is an acquired or inherited disorder characterized by prolonged QT interval, exertion-triggered arrhythmias, and sudden cardiac death. One of the most prevalent hereditary LQTS subtypes, LQT2, results from loss-of-function mutations in the hERG channel, which conducts IKr, the rapid component of the delayed rectifier K+ current, critical for cardiac repolarization. The majority of LQT2 mutations result in Class 2 deficits characterized by impaired maturation and trafficking of hERG channels. Here, we have developed a high-throughput flow cytometric assay to analyze the surface and total expression of wild-type (WT) and mutant hERG channels with single-cell resolution. To test our method, we focused on 16 LQT2 mutations in the hERG Per-Arnt-Sim (PAS) domain that were previously studied via a widely used biochemical approach that compares levels of 135-kDa immature and 155-kDa fully glycosylated hERG protein to infer surface expression. We confirmed that LQT2 mutants expressed in HEK293 cells displayed a decreased surface density compared to WT hERG, and were differentially rescued by low temperature. However, we also uncovered some notable differences from the findings obtained via the biochemical approach. In particular, three mutations (N33T, R56Q, and A57P) with apparent WT-like hERG glycosylation patterns displayed up to 50% decreased surface expression. Furthermore, despite WT-like levels of complex glycosylation, these mutants have impaired forward trafficking, and exhibit varying half-lives at the cell surface. The results highlight utility of the surface labeling/flow cytometry approach to quantitatively assess trafficking deficiencies associated with LQT2 mutations, to discern underlying mechanisms, and to report on interventions that rescue deficits in hERG surface expression. PMID:29725305

  7. A Cold-Inducible DEAD-Box RNA Helicase from Arabidopsis thaliana Regulates Plant Growth and Development under Low Temperature.

    PubMed

    Liu, Yuelin; Tabata, Daisuke; Imai, Ryozo

    2016-01-01

    DEAD-box RNA helicases comprise a large family and are involved in a range of RNA processing events. Here, we identified one of the Arabidopsis thaliana DEAD-box RNA helicases, AtRH7, as an interactor of Arabidopsis COLD SHOCK DOMAIN PROTEIN 3 (AtCSP3), which is an RNA chaperone involved in cold adaptation. Promoter:GUS transgenic plants revealed that AtRH7 is expressed ubiquitously and that its levels of the expression are higher in rapidly growing tissues. Knockout mutant lines displayed several morphological alterations such as disturbed vein pattern, pointed first true leaves, and short roots, which resemble ribosome-related mutants of Arabidopsis. In addition, aberrant floral development was also observed in rh7 mutants. When the mutants were germinated at low temperature (12°C), both radicle and first leaf emergence were severely delayed; after exposure of seedlings to a long period of cold, the mutants developed aberrant, fewer, and smaller leaves. RNA blots and circular RT-PCR revealed that 35S and 18S rRNA precursors accumulated to higher levels in the mutants than in WT under both normal and cold conditions, suggesting the mutants are partially impaired in pre-rRNA processing. Taken together, the results suggest that AtRH7 affects rRNA biogenesis and plays an important role in plant growth under cold.

  8. Chemokine guided angiogenesis directs coronary vasculature formation in zebrafish

    PubMed Central

    Harrison, Michael R.M.; Bussmann, Jeroen; Huang, Ying; Zhao, Long; Osorio, Arthela; Burns, C. Geoffrey; Burns, Caroline E.; Sucov, Henry M.; Siekmann, Arndt F.; Lien, Ching-Ling

    2015-01-01

    SUMMARY Interruption of coronary blood supply severely impairs heart function with often-fatal consequences for heart disease patients. However the formation and maturation of these coronary vessels is not fully understood. Here we provide a detailed analysis of coronary vessel development in zebrafish. We observe that coronary vessels form in zebrafish by angiogenic sprouting of arterial cells derived from the endocardium at the atrioventricular canal. Endothelial cells express the CXC-motif chemokine receptor Cxcr4a and migrate to vascularize the ventricle under the guidance of the myocardium-expressed ligand Cxcl12b. cxcr4a mutant zebrafish fail to form a vascular network, whereas ectopic expression of Cxcl12b ligand induces coronary vessel formation. Importantly, cxcr4a mutant zebrafish fail to undergo heart regeneration following injury. Our results suggest that chemokine-signaling has an essential role in coronary vessel formation by directing migration of endocardium-derived endothelial cells. Poorly developed vasculature in cxcr4a mutants likely underlies decreased regenerative potential in adults. PMID:26017769

  9. A 4-Nitroquinoleneoxide-Induced Pleurotus eryngii Mutant Variety Increases Pin1 Expression in Rat Brain.

    PubMed

    Jeong, Yoonhwa; Jung, Mina; Kim, Myeung Ju; Hwang, Cheol Ho

    2017-01-01

    To develop Pleurotus eryngii varieties with improved medicinal qualities, protoplasts of P. eryngii were mutagenized using 4-nitroquinoleneoxide. The effects of the resulting variant mushrooms on a human cell were evaluated by applying their aqueous extracts to the human hepatoma cell line, HepG2, in vitro and examining any alteration in the proteomes of the treated HepG2. The P. eryngii mutant, NQ2A-12, was selected for its effects on increasing the expression level of Pin1 in HepG2. Pin1 is one of the peptidyl-prolyl cis-trans isomerases known to play an important role in repressing Alzheimer's disease pathogenesis. Validity of NQ2A-12 related to Alzheimer's disease was shown with an enhanced expression of Pin1 in a mouse brain tissue by injecting the NQ2A-12 extract. The mutant mushroom, NQ2A-12, could be developed as a new variety of P. eryngii with potential to protect against Alzheimer's disease.

  10. Altered striatal function in a mutant mouse lacking D1A dopamine receptors.

    PubMed Central

    Drago, J; Gerfen, C R; Lachowicz, J E; Steiner, H; Hollon, T R; Love, P E; Ooi, G T; Grinberg, A; Lee, E J; Huang, S P

    1994-01-01

    Of the five known dopamine receptors, D1A and D2 represent the major subtypes expressed in the striatum of the adult brain. Within the striatum, these two subtypes are differentially distributed in the two main neuronal populations that provide direct and indirect pathways between the striatum and the output nuclei of the basal ganglia. Movement disorders, including Parkinson disease and various dystonias, are thought to result from imbalanced activity in these pathways. Dopamine regulates movement through its differential effects on D1A receptors expressed by direct output neurons and D2 receptors expressed by indirect output neurons. To further examine the interaction of D1A and D2 neuronal pathways in the striatum, we used homologous recombination to generate mutant mice lacking functional D1A receptors (D1A-/-). D1A-/- mutants are growth retarded and die shortly after weaning age unless their diet is supplemented with hydrated food. With such treatment the mice gain weight and survive to adulthood. Neurologically, D1A-/- mice exhibit normal coordination and locomotion, although they display a significant decrease in rearing behavior. Examination of the striatum revealed changes associated with the altered phenotype of these mutants. D1A receptor binding was absent in striatal sections from D1A-/- mice. Striatal neurons normally expressing functional D1A receptors are formed and persist in adult homozygous mutants. Moreover, substance P mRNA, which is colocalized specifically in striatal neurons with D1A receptors, is expressed at a reduced level. In contrast, levels of enkephalin mRNA, which is expressed in striatal neurons with D2 receptors, are unaffected. These findings show that D1A-/- mice exhibit selective functional alterations in the striatal neurons giving rise to the direct striatal output pathway. Images Fig. 2 Fig. 4 PMID:7809078

  11. In Vitro Selection of ramR and soxR Mutants Overexpressing Efflux Systems by Fluoroquinolones as Well as Cefoxitin in Klebsiella pneumoniae▿

    PubMed Central

    Bialek-Davenet, Suzanne; Marcon, Estelle; Leflon-Guibout, Véronique; Lavigne, Jean-Philippe; Bert, Frédéric; Moreau, Richard; Nicolas-Chanoine, Marie-Hélène

    2011-01-01

    The relationship between efflux system overexpression and cross-resistance to cefoxitin, quinolones, and chloramphenicol has recently been reported in Klebsiella pneumoniae. In 3 previously published clinical isolates and 17 in vitro mutants selected with cefoxitin or fluoroquinolones, mutations in the potential regulator genes of the AcrAB efflux pump (acrR, ramR, ramA, marR, marA, soxR, soxS, and rob) were searched, and their impacts on efflux-related antibiotic cross-resistance were assessed. All mutants but 1, and 2 clinical isolates, overexpressed acrB. No mutation was detected in the regulator genes studied among the clinical isolates and 8 of the mutants. For the 9 remaining mutants, a mutation was found in the ramR gene in 8 of them and in the soxR gene in the last one, resulting in overexpression of ramA and soxS, respectively. Transformation of the ramR mutants and the soxR mutant with the wild-type ramR and soxR genes, respectively, abolished overexpression of acrB and ramA in the ramR mutants and of soxS in the soxR mutant, as well as antibiotic cross-resistance. Resistance due to efflux system overexpression was demonstrated for 4 new antibiotics: cefuroxime, cefotaxime, ceftazidime, and ertapenem. This study shows that the ramR and soxR genes control the expression of efflux systems in K. pneumoniae and suggests the existence of efflux pumps other than AcrAB and of other loci involved in the regulation of AcrAB expression. PMID:21464248

  12. Methylammonium-resistant mutants of Nicotiana plumbaginifolia are affected in nitrate transport.

    PubMed

    Godon, C; Krapp, A; Leydecker, M T; Daniel-Vedele, F; Caboche, M

    1996-02-25

    This work reports the isolation and preliminary characterization of Nicotiana plumbaginifolia mutants resistant to methylammonium. Nicotiana plumbaginifolia plants cannot grow on low levels of nitrate in the presence of methylammonium. Methylammonium is not used as a nitrogen source, although it can be efficiently taken up by Nicotiana plumbaginifolia cells and converted into methylglutamine, an analog of glutamine. Glutamine is known to repress the expression of the enzymes that mediate the first two steps in the nitrate assimilatory pathway, nitrate reductase (NR) and nitrite reductase (NiR). Methylammonium has therefore been used, in combination with low concentrations of nitrate, as a selective agent in order to screen for mutants in which the nitrate pathway is de-repressed. Eleven semi-dominant mutants, all belonging to the same complementation group, were identified. The mutant showing the highest resistance to methylammonium was not affected either in the utilization of ammonium, accumulation of methylammonium or in glutamine synthase activity. A series of experiments showed that utilization of nitrite by the wild-type and the mutant was comparable, in the presence or the absence of methylammonium, thus suggesting that the mutation specifically affected nitrate transport or reduction. Although NR mRNA levels were less repressed by methylammonium treatment of the wild-type than the mutant, NR activities of the mutant remained comparable with or without methylammonium, leading to the hypothesis that modified expression of NR is probably not responsible for resistance to methylammonium. Methylammonium inhibited nitrate uptake in the wild-type but had only a limited effect in the mutant. The implications of these results are discussed.

  13. SpxA1 and SpxA2 Act Coordinately To Fine-Tune Stress Responses and Virulence in Streptococcus pyogenes.

    PubMed

    Port, Gary C; Cusumano, Zachary T; Tumminello, Paul R; Caparon, Michael G

    2017-03-28

    SpxA is a unique transcriptional regulator highly conserved among members of the phylum Firmicutes that binds RNA polymerase and can act as an antiactivator. Why some Firmicutes members have two highly similar SpxA paralogs is not understood. Here, we show that the SpxA paralogs of the pathogen Streptococcus pyogenes , SpxA1 and SpxA2, act coordinately to regulate virulence by fine-tuning toxin expression and stress resistance. Construction and analysis of mutants revealed that SpxA1 - mutants were defective for growth under aerobic conditions, while SpxA2 - mutants had severely attenuated responses to multiple stresses, including thermal and oxidative stresses. SpxA1 - mutants had enhanced resistance to the cationic antimicrobial molecule polymyxin B, while SpxA2 - mutants were more sensitive. In a murine model of soft tissue infection, a SpxA1 - mutant was highly attenuated. In contrast, the highly stress-sensitive SpxA2 - mutant was hypervirulent, exhibiting more extensive tissue damage and a greater bacterial burden than the wild-type strain. SpxA1 - attenuation was associated with reduced expression of several toxins, including the SpeB cysteine protease. In contrast, SpxA2 - hypervirulence correlated with toxin overexpression and could be suppressed to wild-type levels by deletion of speB These data show that SpxA1 and SpxA2 have opposing roles in virulence and stress resistance, suggesting that they act coordinately to fine-tune toxin expression in response to stress. SpxA2 - hypervirulence also shows that stress resistance is not always essential for S. pyogenes pathogenesis in soft tissue. IMPORTANCE For many pathogens, it is generally assumed that stress resistance is essential for pathogenesis. For Streptococcus pyogenes , environmental stress is also used as a signal to alter toxin expression. The amount of stress likely informs the bacterium of the strength of the host's defense response, allowing it to adjust its toxin expression to produce the ideal amount of tissue damage, balancing between too little damage, which will result in its elimination, and too much damage, which will debilitate the host. Here we identify components of a genetic circuit involved in stress resistance and toxin expression that has a fine-tuning function in tissue damage. The circuit consists of two versions of the protein SpxA that regulate transcription and are highly similar but have opposing effects on the severity of soft tissue damage. These results will help us understand how virulence is fine-tuned in other pathogens that have two SpxA proteins. Copyright © 2017 Port et al.

  14. Epidermal jasmonate perception is sufficient for all aspects of jasmonate-mediated male fertility in Arabidopsis.

    PubMed

    Jewell, Jeremy B; Browse, John

    2016-03-01

    Jasmonate (JA) signaling is essential for several environmental responses and reproductive development in many plant species. In Arabidopsis thaliana, the most obvious phenotype of JA biosynthetic and perception mutants is profound sporophytic male sterility characterized by failure of stamen filament elongation, severe delay of anther dehiscence and pollen inviability. The site of action of JA in the context of reproductive development has been discussed, but the ideas have not been tested experimentally. To this end we used targeted expression of a COI1-YFP transgene in the coi1-1 mutant background. As COI1 is an essential component of the JA co-receptor complex, the null coi1-1 mutant is male sterile due to lack of JA perception. We show that expression of COI1-YFP in the epidermis of the stamen filament and anther in coi1 mutant plants is sufficient to rescue filament elongation, anther dehiscence and pollen viability. In contrast, filament expression alone or expression in the tapetum do not restore dehiscence and pollen viability. These results demonstrate that epidermal JA perception is sufficient for anther function and pollen viability, and suggest the presence of a JA-dependent non-autonomous signal produced in the anther epidermis to synchronize both anther dehiscence and pollen maturation. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  15. Regulation of the Salmonella enterica std fimbrial operon by DNA adenine methylation, SeqA, and HdfR.

    PubMed

    Jakomin, Marcello; Chessa, Daniela; Bäumler, Andreas J; Casadesús, Josep

    2008-11-01

    DNA adenine methylase (dam) mutants of Salmonella enterica serovar Typhimurium grown under laboratory conditions express the std fimbrial operon, which is tightly repressed in the wild type. Here, we show that uncontrolled production of Std fimbriae in S. enterica serovar Typhimurium dam mutants contributes to attenuation in mice, as indicated by the observation that an stdA dam strain is more competitive than a dam strain upon oral infection. Dam methylation appears to regulate std transcription, rather than std mRNA stability or turnover. A genetic screen for std regulators showed that the GATC-binding protein SeqA directly or indirectly represses std expression, while the poorly characterized yifA gene product serves as an std activator. YifA encodes a putative LysR-like protein and has been renamed HdfR, like its Escherichia coli homolog. Activation of std expression by HdfR is observed only in dam and seqA backgrounds. These data suggest that HdfR directly or indirectly activates std transcription. Since SeqA is unable to bind nonmethylated DNA, it is possible that std operon derepression in dam and seqA mutants may result from unconstrained HdfR-mediated activation of std transcription. Derepression of std in dam and seqA mutants of S. enterica occurs in only a fraction of the bacterial population, suggesting the occurrence of either bistable expression or phase variation.

  16. Oncogene cooperation in tumor maintenance and tumor recurrence in mouse mammary tumors induced by Myc and mutant Kras.

    PubMed

    Podsypanina, Katrina; Politi, Katerina; Beverly, Levi J; Varmus, Harold E

    2008-04-01

    Most, if not all, cancers are composed of cells in which more than one gene has a cancer-promoting mutation. Although recent evidence has shown the benefits of therapies targeting a single mutant protein, little attention has been given to situations in which experimental tumors are induced by multiple cooperating oncogenes. Using combinations of doxycycline-inducible and constitutive Myc and mutant Kras transgenes expressed in mouse mammary glands, we show that tumors induced by the cooperative actions of two oncogenes remain dependent on the activity of a single oncogene. Deinduction of either oncogene individually, or both oncogenes simultaneously, led to partial or complete tumor regression. Prolonged remission followed deinduction of Kras(G12D) in the context of continued Myc expression, deinduction of a MYC transgene with continued expression of mutant Kras produced modest effects on life extension, whereas simultaneous deinduction of both MYC and Kras(G12D) transgenes further improved survival. Disease relapse after deinduction of both oncogenes was associated with reactivation of both oncogenic transgenes in all recurrent tumors, often in conjunction with secondary somatic mutations in the tetracycline transactivator transgene, MMTV-rtTA, rendering gene expression doxycycline-independent. These results demonstrate that tumor viability is maintained by each gene in a combination of oncogenes and that targeted approaches will also benefit from combination therapies.

  17. A eukaryotic-type signalling system of Pseudomonas aeruginosa contributes to oxidative stress resistance, intracellular survival and virulence.

    PubMed

    Goldová, Jana; Ulrych, Aleš; Hercík, Kamil; Branny, Pavel

    2011-08-31

    The genome of Pseudomonas aeruginosa contains at least three genes encoding eukaryotic-type Ser/Thr protein kinases, one of which, ppkA, has been implicated in P. aeruginosa virulence. Together with the adjacent pppA phosphatase gene, they belong to the type VI secretion system (H1-T6SS) locus, which is important for bacterial pathogenesis. To determine the biological function of this protein pair, we prepared a pppA-ppkA double mutant and characterised its phenotype and transcriptomic profiles. Phenotypic studies revealed that the mutant grew slower than the wild-type strain in minimal media and exhibited reduced secretion of pyoverdine. In addition, the mutant had altered sensitivity to oxidative and hyperosmotic stress conditions. Consequently, mutant cells had an impaired ability to survive in murine macrophages and an attenuated virulence in the plant model of infection. Whole-genome transcriptome analysis revealed that pppA-ppkA deletion affects the expression of oxidative stress-responsive genes, stationary phase σ-factor RpoS-regulated genes, and quorum-sensing regulons. The transcriptome of the pppA-ppkA mutant was also analysed under conditions of oxidative stress and showed an impaired response to the stress, manifested by a weaker induction of stress adaptation genes as well as the genes of the SOS regulon. In addition, expression of either RpoS-regulated genes or quorum-sensing-dependent genes was also affected. Complementation analysis confirmed that the transcription levels of the differentially expressed genes were specifically restored when the pppA and ppkA genes were expressed ectopically. Our results suggest that in addition to its crucial role in controlling the activity of P. aeruginosa H1-T6SS at the post-translational level, the PppA-PpkA pair also affects the transcription of stress-responsive genes. Based on these data, it is likely that the reduced virulence of the mutant strain results from an impaired ability to survive in the host due to the limited response to stress conditions.

  18. Metabolic pathway profiling of mitochondrial respiratory chain mutants in C. elegans

    PubMed Central

    MJ, Falk; Z, Zhang; Rosenjack; Nissim; E, Daikhin; Nissim; MM, Sedensky; M, Yudkoff; PG, Morgan

    2008-01-01

    C. elegans affords a model of primary mitochondrial dysfunction that provides insight into cellular adaptations which accompany mutations in nuclear gene that encode mitochondrial proteins. To this end, we characterized genome-wide expression profiles of C. elegans strains with mutations in nuclear-encoded subunits of respiratory chain complexes. Our goal was to detect concordant changes among clusters of genes that comprise defined metabolic pathways. Results indicate that respiratory chain mutants significantly upregulate a variety of basic cellular metabolic pathways involved in carbohydrate, amino acid, and fatty acid metabolism, as well as cellular defense pathways such as the metabolism of P450 and glutathione. To further confirm and extend expression analysis findings, quantitation of whole worm free amino acid levels was performed in C. elegans mitochondrial mutants for subunits of complexes I, II, and III. Significant differences were seen for 13 of 16 amino acid levels in complex I mutants compared with controls, as well as overarching similarities among profiles of complex I, II, and III mutants compared with controls. The specific pattern of amino acid alterations observed provides novel evidence to suggest that an increase in glutamate-linked transamination reactions caused by the failure of NAD+ dependent oxidation of ketoacids occurs in primary mitochondrial respiratory chain mutants. Recognition of consistent alterations among patterns of nuclear gene expression for multiple biochemical pathways and in quantitative amino acid profiles in a translational genetic model of mitochondrial dysfunction allows insight into the complex pathogenesis underlying primary mitochondrial disease. Such knowledge may enable the development of a metabolomic profiling diagnostic tool applicable to human mitochondrial disease. PMID:18178500

  19. Impaired trafficking of human kidney anion exchanger (kAE1) caused by hetero-oligomer formation with a truncated mutant associated with distal renal tubular acidosis.

    PubMed

    Quilty, Janne A; Cordat, Emmanuelle; Reithmeier, Reinhart A F

    2002-12-15

    Autosomal dominant distal renal tubular acidosis (dRTA) has been associated with several mutations in the anion exchanger AE1 gene. The effect of an 11-amino-acid C-terminal dRTA truncation mutation (901 stop) on the expression of kidney AE1 (kAE1) and erythroid AE1 was examined in transiently transfected HEK-293 cells. Unlike the wild-type proteins, kAE1 901 stop and AE1 901 stop mutants exhibited impaired trafficking from the endoplasmic reticulum to the plasma membrane as determined by immunolocalization, cell-surface biotinylation, oligosaccharide processing and pulse-chase experiments. The 901 stop mutants were able to bind to an inhibitor affinity resin, suggesting that these mutant membrane proteins were not grossly misfolded. Co-expression of wild-type and mutant kAE1 or AE1 resulted in intracellular retention of the wild-type proteins in a pre-medial Golgi compartment. This dominant negative effect was due to hetero-oligomer formation of the mutant and wild-type proteins. Intracellular retention of kAE1 in the alpha-intercalated cells of the kidney would account for the impaired acid secretion into the urine characteristic of dRTA.

  20. Mutant TDP-43 within motor neurons drives disease onset but not progression in amyotrophic lateral sclerosis.

    PubMed

    Ditsworth, Dara; Maldonado, Marcus; McAlonis-Downes, Melissa; Sun, Shuying; Seelman, Amanda; Drenner, Kevin; Arnold, Eveline; Ling, Shuo-Chien; Pizzo, Donald; Ravits, John; Cleveland, Don W; Da Cruz, Sandrine

    2017-06-01

    Mutations in TDP-43 cause amyotrophic lateral sclerosis (ALS), a fatal paralytic disease characterized by degeneration and premature death of motor neurons. The contribution of mutant TDP-43-mediated damage within motor neurons was evaluated using mice expressing a conditional allele of an ALS-causing TDP-43 mutant (Q331K) whose broad expression throughout the central nervous system mimics endogenous TDP-43. TDP-43 Q331K mice develop age- and mutant-dependent motor deficits from degeneration and death of motor neurons. Cre-recombinase-mediated excision of the TDP-43 Q331K gene from motor neurons is shown to delay onset of motor symptoms and appearance of TDP-43-mediated aberrant nuclear morphology, and abrogate subsequent death of motor neurons. However, reduction of mutant TDP-43 selectively in motor neurons did not prevent age-dependent degeneration of axons and neuromuscular junction loss, nor did it attenuate astrogliosis or microgliosis. Thus, disease mechanism is non-cell autonomous with mutant TDP-43 expressed in motor neurons determining disease onset but progression defined by mutant acting within other cell types.

  1. Zebrafish aussicht mutant embryos exhibit widespread overexpression of ace (fgf8) and coincident defects in CNS development.

    PubMed

    Heisenberg, C P; Brennan, C; Wilson, S W

    1999-05-01

    During the development of the zebrafish nervous system both noi, a zebrafish pax2 homolog, and ace, a zebrafish fgf8 homolog, are required for development of the midbrain and cerebellum. Here we describe a dominant mutation, aussicht (aus), in which the expression of noi and ace is upregulated. In aus mutant embryos, ace is upregulated at many sites in the embryo, while noi expression is only upregulated in regions of the forebrain and midbrain which also express ace. Subsequent to the alterations in noi and ace expression, aus mutants exhibit defects in the differentiation of the forebrain, midbrain and eyes. Within the forebrain, the formation of the anterior and postoptic commissures is delayed and the expression of markers within the pretectal area is reduced. Within the midbrain, En and wnt1 expression is expanded. In heterozygous aus embryos, there is ectopic outgrowth of neural retina in the temporal half of the eyes, whereas in putative homozygous aus embryos, the ventral retina is reduced and the pigmented retinal epithelium is expanded towards the midline. The observation that aus mutant embryos exhibit widespread upregulation of ace raised the possibility that aus might represent an allele of the ace gene itself. However, by crossing carriers for both aus and ace, we were able to generate homozygous ace mutant embryos that also exhibited the aus phenotype. This indicated that aus is not tightly linked to ace and is unlikely to be a mutation directly affecting the ace locus. However, increased Ace activity may underly many aspects of the aus phenotype and we show that the upregulation of noi in the forebrain of aus mutants is partially dependent upon functional Ace activity. Conversely, increased ace expression in the forebrain of aus mutants is not dependent upon functional Noi activity. We conclude that aus represents a mutation involving a locus normally required for the regulation of ace expression during embryogenesis.

  2. Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

    PubMed

    Takala, T M; Saris, P E J; Tynkkynen, S S H

    2003-01-01

    A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

  3. Mig6 Puts the Brakes on Mutant EGFR-Driven Lung Cancer | Center for Cancer Research

    Cancer.gov

    Lung cancer is the most common cause of cancer-related death worldwide. These cancers are often induced by mutations in the epidermal growth factor receptor (EGFR), resulting in constitutive activation of the protein’s tyrosine kinase domain. Lung cancers expressing these EGFR mutants are initially sensitive to tyrosine kinase inhibitors (TKIs), such as erlotinib, but often

  4. Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

    PubMed

    Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

    2014-10-01

    This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

  5. Maintenance of basal levels of autophagy in Huntington's disease mouse models displaying metabolic dysfunction.

    PubMed

    Baldo, Barbara; Soylu, Rana; Petersén, Asa

    2013-01-01

    Huntington's disease (HD) is a fatal neurodegenerative disorder caused by an expanded polyglutamine repeat in the huntingtin protein. Neuropathology in the basal ganglia and in the cerebral cortex has been linked to the motor and cognitive symptoms whereas recent work has suggested that the hypothalamus might be involved in the metabolic dysfunction. Several mouse models of HD that display metabolic dysfunction have hypothalamic pathology, and expression of mutant huntingtin in the hypothalamus has been causally linked to the development of metabolic dysfunction in mice. Although the pathogenic mechanisms by which mutant huntingtin exerts its toxic functions in the HD brain are not fully known, several studies have implicated a role for the lysososomal degradation pathway of autophagy. Interestingly, changes in autophagy in the hypothalamus have been associated with the development of metabolic dysfunction in wild-type mice. We hypothesized that expression of mutant huntingtin might lead to changes in the autophagy pathway in the hypothalamus in mice with metabolic dysfunction. We therefore investigated whether there were changes in basal levels of autophagy in a mouse model expressing a fragment of 853 amino acids of mutant huntingtin selectively in the hypothalamus using a recombinant adeno-associate viral vector approach as well as in the transgenic BACHD mice. We performed qRT-PCR and Western blot to investigate the mRNA and protein expression levels of selected autophagy markers. Our results show that basal levels of autophagy are maintained in the hypothalamus despite the presence of metabolic dysfunction in both mouse models. Furthermore, although there were no major changes in autophagy in the striatum and cortex of BACHD mice, we detected modest, but significant differences in levels of some markers in mice at 12 months of age. Taken together, our results indicate that overexpression of mutant huntingtin in mice do not significantly perturb basal levels of autophagy.

  6. Integration of multiple stimuli-sensing systems to regulate HrpS and type III secretion system in Erwinia amylovora.

    PubMed

    Lee, Jae Hoon; Zhao, Youfu

    2018-02-01

    The bacterial enhancer binding protein (bEBP) HrpS is essential for Erwinia amylovora virulence by activating the type III secretion system (T3SS). However, how the hrpS gene is regulated remains poorly understood in E. amylovora. In this study, 5' rapid amplification of cDNA ends and promoter deletion analyses showed that the hrpS gene contains two promoters driven by HrpX/HrpY and the Rcs phosphorelay system, respectively. Electrophoretic mobility shift and gene expression assays demonstrated that integration host factor IHF positively regulates hrpS expression through directly binding the hrpX promoter and positively regulating hrpX/hrpY expression. Moreover, hrpX expression was down-regulated in the relA/spoT ((p)ppGpp-deficient) mutant and the dksA mutant, but up-regulated when the wild-type strain was treated with serine hydroxamate, which induced (p)ppGpp-mediated stringent response. Furthermore, the csrA mutant showed significantly reduced transcripts of major hrpS activators, including the hrpX/hrpY, rcsA and rcsB genes, indicating that CsrA is required for full hrpS expression. On the other hand, the csrB mutant exhibited up-regulation of the rcsA and rcsB genes, and hrpS expression was largely diminished in the csrB/rcsB mutant, indicating that the Rcs system is mainly responsible for the increased hrpS expression in the csrB mutant. These findings suggest that E. amylovora recruits multiple stimuli-sensing systems, including HrpX/HrpY, the Rcs phosphorelay system and the Gac-Csr system, to regulate hrpS and T3SS gene expression.

  7. Mutant p53-Expressing Cells Undergo Necroptosis via Cell Competition with the Neighboring Normal Epithelial Cells.

    PubMed

    Watanabe, Hirotaka; Ishibashi, Kojiro; Mano, Hiroki; Kitamoto, Sho; Sato, Nanami; Hoshiba, Kazuya; Kato, Mugihiko; Matsuzawa, Fumihiko; Takeuchi, Yasuto; Shirai, Takanobu; Ishikawa, Susumu; Morioka, Yuka; Imagawa, Toshiaki; Sakaguchi, Kazuyasu; Yonezawa, Suguru; Kon, Shunsuke; Fujita, Yasuyuki

    2018-06-26

    p53 is a tumor suppressor protein, and its missense mutations are frequently found in human cancers. During the multi-step progression of cancer, p53 mutations generally accumulate at the mid or late stage, but not in the early stage, and the underlying mechanism is still unclear. In this study, using mammalian cell culture and mouse ex vivo systems, we demonstrate that when p53R273H- or p53R175H-expressing cells are surrounded by normal epithelial cells, mutant p53 cells undergo necroptosis and are basally extruded from the epithelial monolayer. When mutant p53 cells alone are present, cell death does not occur, indicating that necroptosis results from cell competition with the surrounding normal cells. Furthermore, when p53R273H mutation occurs within RasV12-transformed epithelia, cell death is strongly suppressed and most of the p53R273H-expressing cells remain intact. These results suggest that the order of oncogenic mutations in cancer development could be dictated by cell competition. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Histone acetyltransferase Enok regulates oocyte polarization by promoting expression of the actin nucleation factor spire.

    PubMed

    Huang, Fu; Paulson, Ariel; Dutta, Arnob; Venkatesh, Swaminathan; Smolle, Michaela; Abmayr, Susan M; Workman, Jerry L

    2014-12-15

    KAT6 histone acetyltransferases (HATs) are highly conserved in eukaryotes and have been shown to play important roles in transcriptional regulation. Here, we demonstrate that the Drosophila KAT6 Enok acetylates histone H3 Lys 23 (H3K23) in vitro and in vivo. Mutants lacking functional Enok exhibited defects in the localization of Oskar (Osk) to the posterior end of the oocyte, resulting in loss of germline formation and abdominal segments in the embryo. RNA sequencing (RNA-seq) analysis revealed that spire (spir) and maelstrom (mael), both required for the posterior localization of Osk in the oocyte, were down-regulated in enok mutants. Chromatin immunoprecipitation showed that Enok is localized to and acetylates H3K23 at the spir and mael genes. Furthermore, Gal4-driven expression of spir in the germline can largely rescue the defective Osk localization in enok mutant ovaries. Our results suggest that the Enok-mediated H3K23 acetylation (H3K23Ac) promotes the expression of spir, providing a specific mechanism linking oocyte polarization to histone modification. © 2014 Huang et al.; Published by Cold Spring Harbor Laboratory Press.

  9. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatinmore » immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.« less

  10. Ablation of TrkB expression in RGS9-2 cells leads to hyperphagic obesity★

    PubMed Central

    Liao, Guey-Ying; Li, Yuqing; Xu, Baoji

    2013-01-01

    Brain-derived neurotrophic factor (BDNF) and its cognate receptor, TrkB (tropomyosin receptor kinase B), are widely expressed in the brain where they regulate a wide variety of biological processes, including energy homeostasis. However, the specific population(s) of TrkB-expressing neurons through which BDNF governs energy homeostasis remain(s) to be determined. Using the Cre-loxP recombination system, we deleted the mouse TrkB gene in RGS9-2-expressing cells. In this mouse mutant, TrkB expression was abolished in several hypothalamic nuclei, including arcuate nucleus, dorsomedial hypothalamus, and lateral hypothalamus. TrkB expression was also abolished in a small number of cells in other brain regions, including the cerebral cortex and striatum. The mutant animals developed hyperphagic obesity with normal energy expenditure. Despite hyperglycemia under fed conditions, these animals exhibited normal fasting blood glucose levels and normal glucose tolerance. These results suggest that BDNF regulates energy homeostasis in part through TrkB-expressing neurons in the hypothalamus. PMID:24327964

  11. Unravelling the molecular basis for light modulated cellulase gene expression - the role of photoreceptors in Neurospora crassa

    PubMed Central

    2012-01-01

    Background Light represents an important environmental cue, which exerts considerable influence on the metabolism of fungi. Studies with the biotechnological fungal workhorse Trichoderma reesei (Hypocrea jecorina) have revealed an interconnection between transcriptional regulation of cellulolytic enzymes and the light response. Neurospora crassa has been used as a model organism to study light and circadian rhythm biology. We therefore investigated whether light also regulates transcriptional regulation of cellulolytic enzymes in N. crassa. Results We show that the N. crassa photoreceptor genes wc-1, wc-2 and vvd are involved in regulation of cellulase gene expression, indicating that this phenomenon is conserved among filamentous fungi. The negative effect of VVD on production of cellulolytic enzymes is thereby accomplished by its role in photoadaptation and hence its function in White collar complex (WCC) formation. In contrast, the induction of vvd expression by the WCC does not seem to be crucial in this process. Additionally, we found that WC-1 and WC-2 not only act as a complex, but also have individual functions upon growth on cellulose. Conclusions Genome wide transcriptome analysis of photoreceptor mutants and evaluation of results by analysis of mutant strains identified several candidate genes likely to play a role in light modulated cellulase gene expression. Genes with functions in amino acid metabolism, glycogen metabolism, energy supply and protein folding are enriched among genes with decreased expression levels in the wc-1 and wc-2 mutants. The ability to properly respond to amino acid starvation, i. e. up-regulation of the cross pathway control protein cpc-1, was found to be beneficial for cellulase gene expression. Our results further suggest a contribution of oxidative depolymerization of cellulose to plant cell wall degradation in N. crassa. PMID:22462823

  12. A Novel FC116/BC10 Mutation Distinctively Causes Alteration in the Expression of the Genes for Cell Wall Polymer Synthesis in Rice

    PubMed Central

    Zhang, Mingliang; Wei, Feng; Guo, Kai; Hu, Zhen; Li, Yuyang; Xie, Guosheng; Wang, Yanting; Cai, Xiwen; Peng, Liangcai; Wang, Lingqiang

    2016-01-01

    We report isolation and characterization of a fragile culm mutant fc116 that displays reduced mechanical strength caused by decreased cellulose content and altered cell wall structure in rice. Map-based cloning revealed that fc116 was a base substitution mutant (G to A) in a putative beta-1,6-N-acetylglucosaminyltransferase (C2GnT) gene (LOC_Os05g07790, allelic to BC10). This mutation resulted in one amino acid missing within a newly-identified protein motif “R, RXG, RA.” The FC116/BC10 gene was lowly but ubiquitously expressed in the all tissues examined across the whole life cycle of rice, and slightly down-regulated during secondary growth. This mutant also exhibited a significant increase in the content of hemicelluloses and lignins, as well as the content of pentoses (xylose and arabinose). But the content of hexoses (glucose, mannose, and galactose) was decreased in both cellulosic and non-cellulosic (pectins and hemicelluloses) fractions of the mutant. Transcriptomic analysis indicated that the typical genes in the fc116 mutant were up-regulated corresponding to xylan biosynthesis, as well as lignin biosynthesis including p-hydroxyphenyl (H), syringyl (S), and guaiacyl (G). Our results indicate that FC116 has universal function in regulation of the cell wall polymers in rice. PMID:27708650

  13. OsCNGC13 promotes seed-setting rate by facilitating pollen tube growth in stylar tissues.

    PubMed

    Xu, Yang; Yang, Jie; Wang, Yihua; Wang, Jiachang; Yu, Yang; Long, Yu; Wang, Yunlong; Zhang, Huan; Ren, Yulong; Chen, Jun; Wang, Ying; Zhang, Xin; Guo, Xiuping; Wu, Fuqing; Zhu, Shanshan; Lin, Qibing; Jiang, Ling; Wu, Chuanyin; Wang, Haiyang; Wan, Jianmin

    2017-07-01

    Seed-setting rate is a critical determinant of grain yield in rice (Oryza sativa L.). Rapid and healthy pollen tube growth in the style is required for high seed-setting rate. The molecular mechanisms governing this process remain largely unknown. In this study, we isolate a dominant low seed-setting rate rice mutant, sss1-D. Cellular examination results show that pollen tube growth is blocked in about half of the mutant styles. Molecular cloning and functional assays reveals that SSS1-D encodes OsCNGC13, a member of the cyclic nucleotide-gated channel family. OsCNGC13 is preferentially expressed in the pistils and its expression is dramatically reduced in the heterozygous plant, suggesting a haploinsufficiency nature for the dominant mutant phenotype. We show that OsCNGC13 is permeable to Ca2+. Consistent with this, accumulation of cytoplasmic calcium concentration ([Ca2+]cyt) is defective in the sss1-D mutant style after pollination. Further, the sss1-D mutant has altered extracellular matrix (ECM) components and delayed cell death in the style transmission tract (STT). Based on these results, we propose that OsCNGC13 acts as a novel maternal sporophytic factor required for stylar [Ca2+]cyt accumulation, ECM components modification and STT cell death, thus facilitating the penetration of pollen tube in the style for successful double fertilization and seed-setting in rice.

  14. Partial complementation of the UV sensitivity of E. coli and yeast excision repair mutants by the cloned denV gene of bacteriophage T4.

    PubMed

    Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C

    1986-04-01

    The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.

  15. Analysis of Lactobacillus sakei Mutants Selected after Adaptation to the Gastrointestinal Tracts of Axenic Mice▿ †

    PubMed Central

    Chiaramonte, Fabrizio; Anglade, Patricia; Baraige, Fabienne; Gratadoux, Jean-Jacques; Langella, Philippe; Champomier-Vergès, Marie-Christine; Zagorec, Monique

    2010-01-01

    We recently showed that Lactobacillus sakei, a natural meat-borne lactic acid bacterium, can colonize the gastrointestinal tracts (GIT) of axenic mice but that this colonization in the intestinal environment selects L. sakei mutants showing modified colony morphology (small and rough) and cell shape, most probably resulting from the accumulation of various mutations that confer a selective advantage for persistence in the GIT. In the present study, we analyzed such clones, issued from three different L. sakei strains, in order to determine which functions were modified in the mutants. In the elongated filamentous cells of the rough clones, transmission electron microscopy (TEM) analysis showed a septation defect and dotted and slanted black bands, suggesting the presence of a helical structure around the cells. Comparison of the cytoplasmic and cell wall/membrane proteomes of the meat isolate L. sakei 23K and of one of its rough derivatives revealed a modified expression for 38 spots. The expression of six oxidoreductases, several stress proteins, and four ABC transporters was strongly reduced in the GIT-adapted strain, while the actin-like MreB protein responsible for cell shaping was upregulated. In addition, the expression of several enzymes involved in carbohydrate metabolism was modified, which may correlate with the observation of modified growth of mutants on various carbon sources. These results suggest that the modifications leading to a better adaptation to the GIT are pleiotropic and are characterized in a rough mutant by a different stress status, a cell wall modification, and modified use of energy sources, leading to an improved fitness for the colonization of the GIT. PMID:20208026

  16. Gene mapping and functional analysis of the novel leaf color gene SiYGL1 in foxtail millet [Setaria italica (L.) P. Beauv].

    PubMed

    Li, Wen; Tang, Sha; Zhang, Shuo; Shan, Jianguo; Tang, Chanjuan; Chen, Qiannan; Jia, Guanqing; Han, Yuanhuai; Zhi, Hui; Diao, Xianmin

    2016-05-01

    Setaria italica and its wild ancestor Setaria viridis are emerging as model systems for genetics and functional genomics research. However, few systematic gene mapping or functional analyses have been reported in these promising C4 models. We herein isolated the yellow-green leaf mutant (siygl1) in S. italica using forward genetics approaches. Map-based cloning revealed that SiYGL1, which is a recessive nuclear gene encoding a magnesium-chelatase D subunit (CHLD), is responsible for the mutant phenotype. A single Phe to Leu amino acid change occurring near the ATPase-conserved domain resulted in decreased chlorophyll (Chl) accumulation and modified chloroplast ultrastructure. However, the mutation enhanced the light-use efficiency of the siygl1 mutant, suggesting that the mutated CHLD protein does not completely lose its original activity, but instead, gains novel features. A transcriptional analysis of Chl a oxygenase revealed that there is a strong negative feedback control of Chl b biosynthesis in S. italica. The SiYGL1 mRNA was expressed in all examined tissues, with higher expression observed in the leaves. Comparison of gene expression profiles in wild-type and siygl1 mutant plants indicated that SiYGL1 regulates a subset of genes involved in photosynthesis (rbcL and LHCB1), thylakoid development (DEG2) and chloroplast signaling (SRP54CP). These results provide information regarding the mutant phenotype at the transcriptional level. This study demonstrated that the genetic material of a Setaria species could be ideal for gene discovery investigations using forward genetics approaches and may help to explain the molecular mechanisms associated with leaf color variation. © 2015 Scandinavian Plant Physiology Society.

  17. Molecular Determinants of Mutant Phenotypes, Inferred from Saturation Mutagenesis Data.

    PubMed

    Tripathi, Arti; Gupta, Kritika; Khare, Shruti; Jain, Pankaj C; Patel, Siddharth; Kumar, Prasanth; Pulianmackal, Ajai J; Aghera, Nilesh; Varadarajan, Raghavan

    2016-11-01

    Understanding how mutations affect protein activity and organismal fitness is a major challenge. We used saturation mutagenesis combined with deep sequencing to determine mutational sensitivity scores for 1,664 single-site mutants of the 101 residue Escherichia coli cytotoxin, CcdB at seven different expression levels. Active-site residues could be distinguished from buried ones, based on their differential tolerance to aliphatic and charged amino acid substitutions. At nonactive-site positions, the average mutational tolerance correlated better with depth from the protein surface than with accessibility. Remarkably, similar results were observed for two other small proteins, PDZ domain (PSD95 pdz3 ) and IgG-binding domain of protein G (GB1). Mutational sensitivity data obtained with CcdB were used to derive a procedure for predicting functional effects of mutations. Results compared favorably with those of two widely used computational predictors. In vitro characterization of 80 single, nonactive-site mutants of CcdB showed that activity in vivo correlates moderately with thermal stability and solubility. The inability to refold reversibly, as well as a decreased folding rate in vitro, is associated with decreased activity in vivo. Upon probing the effect of modulating expression of various proteases and chaperones on mutant phenotypes, most deleterious mutants showed an increased in vivo activity and solubility only upon over-expression of either Trigger factor or SecB ATP-independent chaperones. Collectively, these data suggest that folding kinetics rather than protein stability is the primary determinant of activity in vivo This study enhances our understanding of how mutations affect phenotype, as well as the ability to predict fitness effects of point mutations. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Role of N-linked oligosaccharides in processing and intracellular transport of E2 glycoprotein of rubella virus.

    PubMed Central

    Qiu, Z; Hobman, T C; McDonald, H L; Seto, N O; Gillam, S

    1992-01-01

    The role of N-linked glycosylation in processing and intracellular transport of rubella virus glycoprotein E2 has been studied by expressing glycosylation mutants of E2 in COS cells. A panel of E2 glycosylation mutants were generated by oligonucleotide-directed mutagenesis. Each of the three potential N-linked glycosylation sites was eliminated separately as well as in combination with the other two sites. Expression of the E2 mutant proteins in COS cells indicated that in rubella virus M33 strain, all three sites are used for the addition of N-linked oligosaccharides. Removal of any of the glycosylation sites resulted in slower glycan processing, lower stability, and aberrant disulfide bonding of the mutant proteins, with the severity of defect depending on the number of deleted carbohydrate sites. The mutant proteins were transported to the endoplasmic reticulum and Golgi complex but were not detected on the cell surface. However, the secretion of the anchor-free form of E2 into the medium was not completely blocked by the removal of any one of its glycosylation sites. This effect was dependent on the position of the deleted glycosylation site. Images PMID:1583721

  19. Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes

    PubMed Central

    Place, Elsie S.; Smith, James C.

    2017-01-01

    Tmem88a is a transmembrane protein that is thought to be a negative regulator of the Wnt signalling pathway. Several groups have used antisense morpholino oligonucleotides in an effort to characterise the role of tmem88a in zebrafish cardiovascular development, but they have not obtained consistent results. Here, we generate an 8 bp deletion in the coding region of the tmem88a locus using TALENs, and we have gone on to establish a viable homozygous tmem88aΔ8 mutant line. Although tmem88aΔ8 mutants have reduced expression of some key haematopoietic genes, differentiation of erythrocytes and neutrophils is unaffected, contradicting our previous study using antisense morpholino oligonucleotides. We find that expression of the tmem88a paralogue tmem88b is not significantly changed in tmem88aΔ8 mutants and injection of the tmem88a splice-blocking morpholino oligonucleotide into tmem88aΔ8 mutants recapitulates the reduction of erythrocytes observed in morphants using o-Dianisidine. This suggests that there is a partial, but inessential, requirement for tmem88a during haematopoiesis and that morpholino injection exacerbates this phenotype in tmem88a morpholino knockdown embryos. PMID:28192479

  20. PHB Biosynthesis Counteracts Redox Stress in Herbaspirillum seropedicae.

    PubMed

    Batista, Marcelo B; Teixeira, Cícero S; Sfeir, Michelle Z T; Alves, Luis P S; Valdameri, Glaucio; Pedrosa, Fabio de Oliveira; Sassaki, Guilherme L; Steffens, Maria B R; de Souza, Emanuel M; Dixon, Ray; Müller-Santos, Marcelo

    2018-01-01

    The ability of bacteria to produce polyhydroxyalkanoates such as poly(3-hydroxybutyrate) (PHB) enables provision of a carbon storage molecule that can be mobilized under demanding physiological conditions. However, the precise function of PHB in cellular metabolism has not been clearly defined. In order to determine the impact of PHB production on global physiology, we have characterized the properties of a Δ phaC1 mutant strain of the diazotrophic bacterium Herbaspirillum seropedicae . The absence of PHB in the mutant strain not only perturbs redox balance and increases oxidative stress, but also influences the activity of the redox-sensing Fnr transcription regulators, resulting in significant changes in expression of the cytochrome c -branch of the electron transport chain. The synthesis of PHB is itself dependent on the Fnr1 and Fnr3 proteins resulting in a cyclic dependency that couples synthesis of PHB with redox regulation. Transcriptional profiling of the Δ phaC1 mutant reveals that the loss of PHB synthesis affects the expression of many genes, including approximately 30% of the Fnr regulon.

  1. Study the Expression of ompf Gene in Esherichia coli Mutants

    PubMed Central

    Jaktaji, R. Pourahmad; Heidari, F.

    2013-01-01

    The outer membrane porin proteins are the major factors in controlling the permeability of cell membrane. OmpF is an example of porin proteins in Esherichia coli. In normal growth condition a large amount of this protein is synthesised, but under stress condition, such as the presence of antibiotics in environment its expression is decreased inhibiting the entrance of antibiotics into cell. The expression of ompF is inhibited by antisense RNA transcribed from micF. In normal condition the expression of micF is low, but in the presence of antibiotics its expression is increased and causes multiple resistances to irrelevant antibiotics. The aims of this research were to study first, the intactness of micF and then quantify the expression of ompF in ciprofloxacin and tetracycline resistant mutants of E. coli. For this purpose the 5’ end of micF was amplified and then sequenced. None of these mutants except one and its clone has a mutation in this gene. Then the relative expression of ompF in these mutants was quantified by real time PCR. There was no significant difference between ompF transcription of mutants and wild type strain. Based on this study and previous study it is concluded that low to intermediate levels of resistance to ciprofloxacin and tetracycline does not decrease ompF transcription. PMID:24403654

  2. Identification and comparative profiling of miRNAs in an early flowering mutant of trifoliate orange and its wild type by genome-wide deep sequencing.

    PubMed

    Sun, Lei-Ming; Ai, Xiao-Yan; Li, Wen-Yang; Guo, Wen-Wu; Deng, Xiu-Xin; Hu, Chun-Gen; Zhang, Jin-Zhi

    2012-01-01

    MicroRNAs (miRNAs) are a new class of small, endogenous RNAs that play a regulatory role in various biological and metabolic processes by negatively affecting gene expression at the post-transcriptional level. While the number of known Arabidopsis and rice miRNAs is continuously increasing, information regarding miRNAs from woody plants such as citrus remains limited. Solexa sequencing was performed at different developmental stages on both an early flowering mutant of trifoliate orange (precocious trifoliate orange, Poncirus trifoliata L. Raf.) and its wild-type in this study, resulting in the obtainment of 141 known miRNAs belonging to 99 families and 75 novel miRNAs in four libraries. A total of 317 potential target genes were predicted based on the 51 novel miRNAs families, GO and KEGG annotation revealed that high ranked miRNA-target genes are those implicated in diverse cellular processes in plants, including development, transcription, protein degradation and cross adaptation. To characterize those miRNAs expressed at the juvenile and adult development stages of the mutant and its wild-type, further analysis on the expression profiles of several miRNAs through real-time PCR was performed. The results revealed that most miRNAs were down-regulated at adult stage compared with juvenile stage for both the mutant and its wild-type. These results indicate that both conserved and novel miRNAs may play important roles in citrus growth and development, stress responses and other physiological processes.

  3. Overexpression of IRM1 Enhances Resistance to Aphids in Arabidopsis thaliana

    PubMed Central

    Chen, Xi; Zhang, Zhao; Visser, Richard G. F.; Broekgaarden, Colette; Vosman, Ben

    2013-01-01

    Aphids are insects that cause direct damage to crops by the removal of phloem sap, but more importantly they spread devastating viruses. Aphids use their sophisticated mouthpart (i.e. stylet) to feed from the phloem sieve elements of the host plant. To identify genes that affect host plant resistance to aphids, we previously screened an Arabidopsis thaliana activation tag mutant collection. In such mutants, tagged genes are overexpressed by a strong 35S enhancer adjacent to the natural promoter, resulting in a dominant gain-of-function phenotype. We previously identified several of these mutants on which the aphid Myzus persicae showed a reduced population development compared with wild type. In the present study we show that the gene responsible for the phenotype of one of the mutants is At5g65040 and named this gene Increased Resistance to Myzus persicae 1 (IRM1). Overexpression of the cloned IRM1 gene conferred a phenotype identical to that of the original mutant. Conversely, an IRM1 knockout mutant promoted aphid population development compared to the wild type. We performed Electrical Penetration Graph analysis to investigate how probing and feeding behaviour of aphids was affected on plants that either overexpressed IRM1 or contained a knockout mutation in this gene. The EPG results indicated that the aphids encounter resistance factors while reaching for the phloem on the overexpressing line. This resistance mechanism also affected other aphid species and is suggested to be of mechanical nature. Interestingly, genetic variation for IRM1 expression in response to aphid attack was observed. Upon aphid attack the expression of IRM1 was initially (after 6 hours) induced in ecotype Wassilewskija followed by suppression. In Columbia-0, IRM1 expression was already suppressed six hours after the start of the infestation. The resistance conferred by the overexpression of IRM1 in A. thaliana trades off with plant growth. PMID:23951039

  4. Dental and Cranial Pathologies in Mice Lacking the Cl−/H+-Exchanger ClC-7

    PubMed Central

    WEN, Xin; LACRUZ, Rodrigo S.; PAINE, Michael L.

    2015-01-01

    ClC-7 is a 2Cl−/1H+-exchanger expressed at late endosomes and lysosomes, as well as the ruffled border of osteoclasts. ClC-7 deficiencies in mice and humans lead to impaired osteoclast function and therefore osteopetrosis. Failure of tooth eruption is also apparent in ClC-7 mutant animals, and this has been attributed to the osteoclast dysfunction and the subsequent defect in alveolar bone resorptive activity surrounding tooth roots. Ameloblasts also express ClC-7, and this study aims to determine the significance of ClC-7 in enamel formation by examining the dentitions of ClC-7 mutant mice. Micro-CT analysis revealed that the molar teeth of 3-week old ClC-7 mutant mice had no roots, and the incisors were smaller than their age-matched controls. Despite these notable developmental differences, the enamel and dentin densities of the mutant mice were comparable to those of the wild type littermates. Scanning electron microscopy (SEM) showed normal enamel crystallite and prismatic organization in the ClC-7 mutant mice, although the enamel was thinner (hypoplastic) than in controls. These results suggested that ClC-7 was not critical to enamel and dentin formation, and the observed tooth defects may be related more to a resulting alveolar bone phenotype. Micro-CT analysis also revealed abnormal features in the calvarial bones of the mutant mice. The cranial sutures in ClC-7 mutant mice remained open compared to the closed sutures seen in the control mice at 3 weeks. These data demonstrate that ClC-7 deficiency impacts the development of the dentition and calvaria, but does not significantly disrupt amelogenesis. PMID:25663454

  5. Zebrafish mab21l2 is specifically expressed in the presumptive eye and tectum from early somitogenesis onwards.

    PubMed

    Kudoh, T; Dawid, I B

    2001-11-01

    Random screening for tissue specific genes in zebrafish by in situ hybridization led us to isolate a gene which showed highly restricted expression in the developing eyes and midbrain at somitogenesis stages. This gene was very similar to mouse and human mab21l2. The characteristic expression pattern of mab21l2 facilitates a detailed description of the morphogenesis of the eyes and midbrain in the zebrafish. In the eye field, mab21l2 expression illustrates the transformation of the eye field to form two separate eyes in the anterior neural plate. Mab21l2 staining in the cyclopic mutants, cyc and oep, exhibited incomplete splitting of the eye primodium. In the midbrain, mab21l2 is expressed in the tectum, and its expression follows the expansion of the tectal region. In mutants affecting the mid-hindbrain boundary (MHB), mab21l2 expression is affected differentially. In the noi/pax2.1 mutant, mab21l2 is down-regulated and the size of the tectum remains small, whereas in the ace/fgf8 mutant, mab21l2 expression persists although the shape of the tectum is altered.

  6. Establishment of a tissue-specific RNAi system in C. elegans.

    PubMed

    Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo

    2007-10-01

    In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.

  7. Establishment of a tissue-specific RNAi system in C. elegans

    PubMed Central

    Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo

    2011-01-01

    In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718

  8. Genetic interactions of the unfinished flower development (ufd) mutant support a significant role of the tomato UFD gene in regulating floral organogenesis.

    PubMed

    Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Bretones, Sandra; Yuste-Lisbona, Fernando J; Lozano, Rafael

    2016-09-01

    Genetic interactions of UFD gene support its specific function during reproductive development of tomato; in this process, UFD could play a pivotal role between inflorescence architecture and flower initiation genes. Tomato (Solanum lycopersicum L.) is a major vegetable crop that also constitutes a model species for the study of plant developmental processes. To gain insight into the control of flowering and floral development, a novel tomato mutant, unfinished flower development (ufd), whose inflorescence and flowers were unable to complete their normal development was characterized using double mutant and gene expression analyses. Genetic interactions of ufd with mutations affecting inflorescence fate (uniflora, jointless and single flower truss) were additive and resulted in double mutants displaying the inflorescence structure of the non-ufd parental mutant and the flower phenotype of the ufd mutant. In addition, ufd mutation promotes an earlier inflorescence meristem termination. Taken together, both results indicated that UFD is not involved in the maintenance of inflorescence meristem identity, although it could participate in the regulatory system that modulates the rate of meristem maturation. Regarding the floral meristem identity, the falsiflora mutation was epistatic to the ufd mutation even though FALSIFLORA was upregulated in ufd inflorescences. In terms of floral organ identity, the ufd mutation was epistatic to macrocalyx, and MACROCALYX expression was differently regulated depending on the inflorescence developmental stage. These results suggest that the UFD gene may play a pivotal role between the genes required for flowering initiation and inflorescence development (such as UNIFLORA, FALSIFLORA, JOINTLESS and SINGLE FLOWER TRUSS) and those required for further floral organ development such as the floral organ identity genes.

  9. Over-Expression of Porcine Myostatin Missense Mutant Leads to A Gender Difference in Skeletal Muscle Growth between Transgenic Male and Female Mice.

    PubMed

    Ma, Dezun; Gao, Pengfei; Qian, Lili; Wang, Qingqing; Cai, Chunbo; Jiang, Shengwang; Xiao, Gaojun; Cui, Wentao

    2015-08-24

    Myostatin, a transforming growth factor-β family member, is a negative regulator of skeletal muscle development and growth. Piedmontese cattle breeds have a missense mutation, which results in a cysteine to tyrosine substitution in the mature myostatin protein (C313Y). This loss-of-function mutation in myostatin results in a double-muscled phenotype in cattle. Myostatin propeptide is an inhibitor of myostatin activity and is considered a potential agent to stimulate muscle growth in livestock. In this study, we generated transgenic mice overexpressing porcine myostatin missense mutant (pmMS), C313Y, and wild-type porcine myostatin propeptide (ppMS), respectively, to examine their effects on muscle growth in mice. Enhanced muscle growth was observed in both pmMS and ppMS transgenic female mice and also in ppMS transgenic male mice. However, there was no enhanced muscle growth observed in pmMS transgenic male mice. To explore why there is such a big difference in muscle growth between pmMS and ppMS transgenic male mice, the expression level of androgen receptor (AR) mutant AR45 was measured by Western blot. Results indicated that AR45 expression significantly increased in pmMS transgenic male mice while it decreased dramatically in ppMS transgenic male mice. Our data demonstrate that both pmMS and ppMS act as myostatin inhibitors in the regulation of muscle growth, but the effect of pmMS in male mice is reversed by an increased AR45 expression. These results provide useful insight and basic theory to future studies on improving pork quality by genetically manipulating myostatin expression or by regulating myostatin activity.

  10. The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

    PubMed

    Ren, Jun; Prescott, John F

    2004-11-15

    An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

  11. Maize Opaque Endosperm Mutations Create Extensive Changes in Patterns of Gene ExpressionW⃞

    PubMed Central

    Hunter, Brenda G.; Beatty, Mary K.; Singletary, George W.; Hamaker, Bruce R.; Dilkes, Brian P.; Larkins, Brian A.; Jung, Rudolf

    2002-01-01

    Maize starchy endosperm mutants have kernel phenotypes that include a brittle texture, susceptibility to insect pests, and inferior functional characteristics of products made from their flour. At least 18 such mutants have been identified, but only in the cases of opaque2 (o2) and floury2 (fl2), which affect different aspects of storage protein synthesis, is the molecular basis of the mutation known. To better understand the relationship between the phenotypes of these mutants and their biochemical bases, we characterized the protein and amino acid composition, as well as the mRNA transcript profiles, of nearly isogenic inbred lines of W64A o1, o2, o5, o9, o11, Mucuronate (Mc), Defective endosperm B30 (DeB30), and fl2. The largest reductions in zein protein synthesis occur in the W64A o2, DeB30, and fl2 mutants, which have ∼35 to 55% of the wild-type level of storage proteins. Zeins in W64A o5, o9, o11, and Mc are within 80 to 90% of the amount found in the wild type. Only in the cases of o5 and Mc were significant qualitative changes in zein synthesis observed. The pattern of gene expression in normal and mutant genotypes was assayed by profiling endosperm mRNA transcripts at 18 days after pollination with an Affymetrix GeneChip containing >1400 selected maize gene sequences. Compared with W64A sugary1, a mutant defective in starch synthesis, alterations in the gene expression patterns of the opaque mutants are very pleiotropic. Increased expression of genes associated with physiological stress, and the unfolded protein response, are common features of the opaque mutants. Based on global patterns of gene expression, these mutants were categorized in four phenotypic groups as follows: W64A+ and o1; o2; o5/o9/o11; and Mc and fl2. PMID:12368507

  12. Capsule expression in Streptococcus mitis modulates interaction with oral keratinocytes and alters susceptibility to human antimicrobial peptides.

    PubMed

    Rukke, H V; Engen, S A; Schenck, K; Petersen, F C

    2016-08-01

    Streptococcus mitis is a colonizer of the oral cavity and the nasopharynx, and is closely related to Streptococcus pneumoniae. Both species occur in encapsulated and unencapsulated forms, but in S. mitis the role of the capsule in host interactions is mostly unknown. Therefore, the aim of this study was to examine how capsule expression in S. mitis can modulate interactions with the host with relevance for colonization. The S. mitis type strain, as well as two mutants of the type strain, an isogenic capsule deletion mutant, and a capsule switch mutant expressing the serotype 4 capsule of S. pneumoniae TIGR4, were used. Wild-type and capsule deletion strains of S. pneumoniae TIGR4 were included for comparison. We found that capsule production in S. mitis reduced adhesion to oral and lung epithelial cells. Further, exposure of oral epithelial cells to encapsulated S. mitis resulted in higher interleukin-6 and CXCL-8 transcription levels relative to the unencapsulated mutant. Capsule expression in S. mitis increased the sensitivity to human neutrophil peptide 1-3 but reduced the sensitivity to human β-defensin-3 and cathelicidin. This was in contrast with S. pneumoniae in which capsule expression has been generally associated with increased sensitivity to human antimicrobial peptides (AMPs). Collectively, these findings indicate that capsule expression in S. mitis is important in modulating interactions with epithelial cells, and is associated with increased or reduced susceptibility to AMPs depending on the nature of the AMP. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Sonic hedgehog: restricted expression and limb dysmorphologies

    PubMed Central

    Hill, Robert E; Heaney, Simon JH; Lettice, Laura A

    2003-01-01

    Sonic hedgehog, SHH, is required for patterning the limb. The array of skeletal elements that compose the hands and feet, and the ordered arrangement of these bones to form the pattern of fingers and toes are dependent on SHH. The mechanism of action of SHH in the limb is not fully understood; however, an aspect that appears to be important is the localized, asymmetric expression of Shh. Shh is expressed in the posterior margin of the limb bud in a region defined as the zone of polarizing activity (ZPA). Analysis of mouse mutants which have polydactyly (extra toes) shows that asymmetric expression of Shh is lost due to the appearance of an ectopic domain of expression in the anterior limb margin. One such polydactylous mouse mutant, sasquatch (Ssq), maps to the corresponding chromosomal region of the human condition pre-axial polydactyly (PPD) and thus represents a model for this condition. The mutation responsible for Ssq is located 1 Mb away from the Shh gene; however, the mutation disrupts a long-range cis-acting regulator of Shh expression. By inference, human pre-axial polydactyly results from a similar disruption of Shh expression. Other human congenital abnormalities also map near the pre-axial polydactyly locus, suggesting a major chromosomal region for limb dysmorphologies. The distinct phenotypes range from loss of all bones of the hands and feet to syndactyly of the soft tissue and fusion of the digits. We discuss the role played by Shh expression in mouse mutant phenotypes and the human limb dysmorphologies. PMID:12587915

  14. Reversal of a full-length mutant huntingtin neuronal cell phenotype by chemical inhibitors of polyglutamine-mediated aggregation

    PubMed Central

    Wang, Jin; Gines, Silvia; MacDonald, Marcy E; Gusella, James F

    2005-01-01

    Background Huntington's disease (HD) is an inherited neurodegenerative disorder triggered by an expanded polyglutamine tract in huntingtin that is thought to confer a new conformational property on this large protein. The propensity of small amino-terminal fragments with mutant, but not wild-type, glutamine tracts to self-aggregate is consistent with an altered conformation but such fragments occur relatively late in the disease process in human patients and mouse models expressing full-length mutant protein. This suggests that the altered conformational property may act within the full-length mutant huntingtin to initially trigger pathogenesis. Indeed, genotype-phenotype studies in HD have defined genetic criteria for the disease initiating mechanism, and these are all fulfilled by phenotypes associated with expression of full-length mutant huntingtin, but not amino-terminal fragment, in mouse models. As the in vitro aggregation of amino-terminal mutant huntingtin fragment offers a ready assay to identify small compounds that interfere with the conformation of the polyglutamine tract, we have identified a number of aggregation inhibitors, and tested whether these are also capable of reversing a phenotype caused by endogenous expression of mutant huntingtin in a striatal cell line from the HdhQ111/Q111 knock-in mouse. Results We screened the NINDS Custom Collection of 1,040 FDA approved drugs and bioactive compounds for their ability to prevent in vitro aggregation of Q58-htn 1–171 amino terminal fragment. Ten compounds were identified that inhibited aggregation with IC50 < 15 μM, including gossypol, gambogic acid, juglone, celastrol, sanguinarine and anthralin. Of these, both juglone and celastrol were effective in reversing the abnormal cellular localization of full-length mutant huntingtin observed in mutant HdhQ111/Q111 striatal cells. Conclusions At least some compounds identified as aggregation inhibitors also prevent a neuronal cellular phenotype caused by full-length mutant huntingtin, suggesting that in vitro fragment aggregation can act as a proxy for monitoring the disease-producing conformational property in HD. Thus, identification and testing of compounds that alter in vitro aggregation is a viable approach for defining potential therapeutic compounds that may act on the deleterious conformational property of full-length mutant huntingtin. PMID:15649316

  15. The effect of dys-1 mutation on miRNA expression profile in Caenorhabditis elegans during Shenzhou-8 mission

    NASA Astrophysics Data System (ADS)

    Xu, Dan; Sun, Yeqing; Gao, Ying; Xing, Yanfang

    microRNAs (miRNAs) is reported to be sensitive to radiation exposure and altered gravity, involved in a variety of biological processes through negative regulation of gene expression. Dystrophin-like dys-1 gene is expressed and required in muscle tissue, which plays a vital role in mechanical transduction when gravity varies. In the present study, we investigated the effect of dys-1 mutation on miRNA expression profile in Caenorhabditis elegans (C. elegans) under space radiation associated with microgravity (R+M) and radiation alone (R) environment during Shenzhou-8 mission. We performed miRNA microarray analysis in dys-1 mutant and wide-type (WT) of dauer larvae and found that 27 miRNAs changed in abundance after spaceflight. Compared with WT, there was different miRNA expression pattern in different treatments in dys-1 mutant. Cel-miR-796 and miR-124 were reversely expressed under R+M and R environment in WT and dys-1 mutant, respectively, indicating they might be affected by microgravity. Mutation of dys-1 remarkably reduced the number of altered miRNAs under space environment, resulting in the decrease of genes in biological categories of “body morphogenesis”, “behavior”, “cell adhesion” and so on. Particularly, we found that those genes controlling regulation of locomotion in WT were lost in dys-1 mutant, while genes in positive regulation of developmental process only existed in dys-1 mutant. miR-796 was predicted to target genes ace-1 and dyc-1 that are functionally linked to dys-1. Integration analysis of miRNA and mRNA expression profile revealed that miR-56 and miR-124 were involved in behavior and locomotion by regulating different target genes under space environment, among which nep-11, deb-1, C07H4.1 and F11H8.2 might be associated with neuromuscular system. Our findings suggest that dys-1 could cause alteration of miRNAs and target genes, involved in regulating the response of C. elegans to space microgravity in neuromuscular system. This research will provide new insight for better understanding of the mechanism in microgravity-induced muscular dystrophy.

  16. The AAE14 gene encodes the Arabidopsis o-succinylbenzoyl-CoA ligase that is essential for phylloquinone synthesis and photosystem-I function.

    PubMed

    Kim, Hyun Uk; van Oostende, Chloë; Basset, Gilles J C; Browse, John

    2008-04-01

    Phylloquinone is the one-electron carrier at the A(1) site of photosystem I, and is essential for photosynthesis. Arabidopsis mutants deficient in early steps of phylloquinone synthesis do not become autotrophic and are seedling lethals, even when grown on sucrose-supplemented media. Here, we identify acyl-activating enzyme 14 (AAE14, At1g30520) as the o-succinylbenzoyl-coenzyme A (OSB-CoA) ligase acting in phylloquinone synthesis. Three aae14 mutant alleles, identified by reverse genetics, were found to be seedling lethal, to contain no detectable phylloquinone (< 0.1 pmol mg(-1) fresh weight) compared with 10 pmol mg(-1) fresh weight in wild-type leaves, and to accumulate OSB. AAE14 was able to restore menaquinone biosynthesis when expressed in an Escherichia coli mutant disrupted in the menE gene that encodes the bacterial OSB-CoA ligase. Weak expression of an AAE14 transgene in mutant plants (controlled by the uninduced XVE promoter) resulted in chlorotic, slow-growing plants that accumulated an average of 4.7 pmol mg(-1) fresh weight of phylloquinone. Inducing the XVE promoter in these plants, or expressing an AAE14 transgene under the control of the CaMV 35S promoter, led to full complementation of the mutant phenotype. aae14-mutant plants were also able to synthesize phylloquinone when provided with 1,4-dihydroxy-2-naphthoate, an intermediate in phylloquinone synthesis downstream of the OSB-CoA ligase reaction. Expression of an AAE14:GFP reporter construct indicated that the protein accumulated in discrete foci within the chloroplasts. This and other evidence suggests that the enzymes of phylloquinone synthesis from isochorismate may form a complex in the chloroplast stroma to facilitate the efficient channeling of intermediates through the pathway.

  17. Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish

    PubMed Central

    Yang, Yan-Jing; Wang, Yang; Li, Zhi; Zhou, Li; Gui, Jian-Fang

    2017-01-01

    Foxl2 is essential for mammalian ovary maintenance. Although sexually dimorphic expression of foxl2 was observed in many teleosts, its role and regulative mechanism in fish remained largely unclear. In this study, we first identified two transcript variants of foxl2a and its homologous gene foxl2b in zebrafish, and revealed their specific expression in follicular layer cells in a sequential and divergent fashion during ovary differentiation, maturation, and maintenance. Then, homozygous foxl2a mutants (foxl2a−/−) and foxl2b mutants (foxl2b−/−) were constructed and detailed comparisons, such as sex ratio, gonadal histological structure, transcriptome profiling, and dynamic expression of gonadal development-related genes, were carried out. Initial ovarian differentiation and oocyte development occur normally both in foxl2a−/− and foxl2b−/− mutants, but foxl2a and foxl2b disruptions result in premature ovarian failure and partial sex reversal, respectively, in adult females. In foxl2a−/− female mutants, sox9a-amh/cyp19a1a signaling was upregulated at 150 days postfertilization (dpf) and subsequently oocyte apoptosis was triggered after 180 dpf. In contrast, dmrt1 expression was greater at 105 dpf and increased several 100-fold in foxl2b−/− mutated ovaries at 270 dpf, along with other testis-related genes. Finally, homozygous foxl2a−/−/foxl2b−/− double mutants were constructed in which complete sex reversal occurs early and testis-differentiation genes robustly increase at 60 dpf. Given mutual compensation between foxl2a and foxl2b in foxl2b−/− and foxl2a−/− mutants, we proposed a model in which foxl2a and foxl2b cooperate to regulate zebrafish ovary development and maintenance, with foxl2b potentially having a dominant role in preventing the ovary from differentiating as testis, as compared to foxl2a. PMID:28193729

  18. Inactivation of NMB0419, Encoding a Sel1-Like Repeat (SLR) Protein, in Neisseria meningitidis Is Associated with Differential Expression of Genes Belonging to the Fur Regulon and Reduced Intraepithelial Replication

    PubMed Central

    Li, Ming-Shi

    2017-01-01

    ABSTRACT Neisseria meningitidis is a commensal microbe that colonizes the human nasopharynx but occasionally invades the bloodstream to cause life-threatening infection. N. meningitidis MC58 NMB0419 encodes a Sel1-like repeat (SLR)-containing protein, previously implicated in invasion of epithelial cells. A gene-regulatory function was revealed in Escherichia coli expressing plasmid-borne NMB0419 and showing significantly increased epithelial adherence compared to the wild type, due to increased expression of mannose-sensitive type 1 pili. While a meningococcal NMB0419 mutant did not have altered epithelial adherence, in a transcriptome-wide comparison of the wild type and an NMB0419 mutant, a large proportion of genes differentially regulated in the mutant were involved in iron acquisition and metabolism. Fifty-one percent and 38% of genes, respectively, up- and downregulated in the NMB0419 mutant had previously been identified as being induced and repressed by meningococcal Fur. An in vitro growth defect of the NMB0419 mutant under iron restriction was consistent with the downregulation of tbpAB and hmbR, while an intraepithelial replication defect was consistent with the downregulation of tonB, exbB, and exbD, based on a known phenotype of a meningococcal tonB mutant. Disruption of the N-terminal NMB0419 signal peptide, predicted to export the protein beyond the cytoplasmic membrane, resulted in loss of functional traits in N. meningitidis and E. coli. Our study indicates that the expression of NMB0419 is associated with transcriptional changes counterbalancing the regulatory function of Fur, offering a new perspective on regulatory mechanisms involved in meningococcal interaction with epithelial cells, and suggests new insights into the roles of SLR-containing genes in other bacteria. PMID:28264906

  19. Loss of DDB1 Leads to Transcriptional p53 Pathway Activation in Proliferating Cells, Cell Cycle Deregulation, and Apoptosis in Zebrafish Embryos.

    PubMed

    Hu, Zhilian; Holzschuh, Jochen; Driever, Wolfgang

    2015-01-01

    DNA damage-binding protein 1 (DDB1) is a large subunit of the heterodimeric DDB complex that recognizes DNA lesions and initiates the nucleotide excision repair process. DDB1 is also a component of the CUL4 E3 ligase complex involved in a broad spectrum of cellular processes by targeted ubiquitination of key regulators. Functions of DDB1 in development have been addressed in several model organisms, however, are not fully understood so far. Here we report an ENU induced mutant ddb1 allele (ddb1m863) identified in zebrafish (Danio rerio), and analyze its effects on development. Zebrafish ddb1 is expressed broadly, both maternally and zygotically, with enhanced expression in proliferation zones. The (ddb1m863 mutant allele affects the splice acceptor site of exon 20, causing a splicing defect that results in truncation of the 1140 amino acid protein after residue 800, lacking part of the β-propeller domain BPC and the C-terminal helical domain CTD. ddb1m863 zygotic mutant embryos have a pleiotropic phenotype, including smaller and abnormally shaped brain, head skeleton, eyes, jaw, and branchial arches, as well as reduced dopaminergic neuron groups. However, early forming tissues develop normally in zygotic ddb1m863 mutant embryos, which may be due to maternal rescue. In ddb1m863 mutant embryos, pcna-expressing proliferating cell populations were reduced, concurrent with increased apoptosis. We also observed a concomitant strong up-regulation of transcripts of the tumor suppressor p53 (tp53) and the cell cycle inhibitor cdkn1a (p21a/bCIP1/WAF1) in proliferating tissues. In addition, transcription of cyclin genes ccna2 and ccnd1 was deregulated in ddb1m863 mutants. Reduction of p53 activity by anti-sense morpholinos alleviated the apoptotic phenotype in ddb1m863 mutants. These results imply that Ddb1 may be involved in maintaining proper cell cycle progression and viability of dividing cells during development through transcriptional mechanisms regulating genes involved in cell cycle control and cell survival.

  20. Correlating levels of type III secretion and secreted proteins with fecal shedding of Escherichia coli O157:H7 in cattle.

    PubMed

    Sharma, V K; Sacco, R E; Kunkle, R A; Bearson, S M D; Palmquist, D E

    2012-04-01

    The locus of enterocyte effacement (LEE) of Escherichia coli O157:H7 (O157) encodes a type III secretion system (T3SS) for secreting LEE-encoded and non-LEE-encoded virulence proteins that promote the adherence of O157 to intestinal epithelial cells and the persistence of this food-borne human pathogen in bovine intestines. In this study, we compared hha sepB and hha mutants of O157 for LEE transcription, T3SS activity, adherence to HEp-2 cells, persistence in bovine intestines, and the ability to induce changes in the expression of proinflammatory cytokines. LEE transcription was upregulated in the hha sepB and hha mutant strains compared to that in the wild-type strain, but the secretion of virulence proteins in the hha sepB mutant was severely compromised. This reduced secretion resulted in reduced adherence of the hha sepB mutant to Hep-2 cells, correlating with a significantly shorter duration and lower magnitude of fecal shedding in feces of weaned (n = 4 per group) calves inoculated with this mutant strain. The levels of LEE transcription, T3SS activity, and adherence to HEp-2 cells were much lower in the wild-type strain than in the hha mutant, but no significant differences were observed in the duration or the magnitude of fecal shedding in calves inoculated with these strains. Examination of the rectoanal junction (RAJ) tissues from three groups of calves showed no adherent O157 bacteria and similar proinflammatory cytokine gene expression, irrespective of the inoculated strain, with the exception that interleukin-1β was upregulated in calves inoculated with the hha sepB mutant. These results indicate that the T3SS is essential for intestinal colonization and prolonged shedding, but increased secretion of virulence proteins did not enhance the duration and magnitude of fecal shedding of O157 in cattle or have any significant impact on the cytokine gene expression in RAJ tissue compared with that in small intestinal tissue from the same calves.

  1. Cellular Prion Protein Combined with Galectin-3 and -6 Affects the Infectivity Titer of an Endogenous Retrovirus Assayed in Hippocampal Neuronal Cells

    PubMed Central

    Shin, Hae-Young; Goto, Joy J.; Carp, Richard I.; Choi, Eun-Kyoung; Kim, Yong-Sun

    2016-01-01

    Prion diseases are infectious and fatal neurodegenerative diseases which require the cellular prion protein, PrPC, for development of diseases. The current study shows that the PrPC augments infectivity and plaque formation of a mouse endogenous retrovirus, MuLV. We have established four neuronal cell lines expressing mouse PrPC, PrP+/+; two express wild type PrPC (MoPrPwild) and the other two express mutant PrPC (MoPrPmut). Infection of neuronal cells from various PrP+/+ and PrP-/- (MoPrPKO) lines with MuLV yielded at least three times as many plaques in PrP+/+ than in PrP-/-. Furthermore, among the four PrP+/+ lines, one mutant line, P101L, had at least 2.5 times as many plaques as the other three PrP+/+ lines. Plaques in P101L were four times larger than those in other PrP+/+ lines. Colocalization of PrP and CAgag was seen in MuLV-infected PrP+/+ cells. In the PrP-MuLV interaction, the involvement of galectin-3 and -6 was observed by immunoprecipitation with antibody to PrPC. These results suggest that PrPC combined with galectin-3 and -6 can act as a receptor for MuLV. P101L, the disease form of mutant PrPC results suggest the genetic mutant form of PrPC may be more susceptible to viral infection. PMID:27936017

  2. Maternal topoisomerase II alpha, not topoisomerase II beta, enables embryonic development of zebrafish top2a-/- mutants

    PubMed Central

    2011-01-01

    Background Genetic alterations in human topoisomerase II alpha (TOP2A) are linked to cancer susceptibility. TOP2A decatenates chromosomes and thus is necessary for multiple aspects of cell division including DNA replication, chromosome condensation and segregation. Topoisomerase II alpha is also required for embryonic development in mammals, as mouse Top2a knockouts result in embryonic lethality as early as the 4-8 cell stage. The purpose of this study was to determine whether the extended developmental capability of zebrafish top2a mutants arises from maternal expression of top2a or compensation from its top2b paralogue. Results Here, we describe bloody minded (blm), a novel mutant of zebrafish top2a. In contrast to mouse Top2a nulls, zebrafish top2a mutants survive to larval stages (4-5 day post fertilization). Developmental analyses demonstrate abundant expression of maternal top2a but not top2b. Inhibition or poisoning of maternal topoisomerase II delays embryonic development by extending the cell cycle M-phase. Zygotic top2a and top2b are co-expressed in the zebrafish CNS, but endogenous or ectopic top2b RNA appear unable to prevent the blm phenotype. Conclusions We conclude that maternal top2a enables zebrafish development before the mid-zygotic transition (MZT) and that zebrafish top2a and top2b are not functionally redundant during development after activation of the zygotic genome. PMID:22111588

  3. Molecular Genetic Analysis of an Endotoxin Nonresponder Mutant Cell Line

    PubMed Central

    Schromm, Andra B.; Lien, Egil; Henneke, Philipp; Chow, Jesse C.; Yoshimura, Atsutoshi; Heine, Holger; Latz, Eicke; Monks, Brian G.; Schwartz, David A.; Miyake, Kensuke; Golenbock, Douglas T.

    2001-01-01

    Somatic cell mutagenesis is a powerful tool for characterizing receptor systems. We reported previously two complementation groups of mutant cell lines derived from CD14-transfected Chinese hamster ovary–K1 fibroblasts defective in responses to bacterial endotoxin. Both classes of mutants expressed a normal gene product for Toll-like receptor (TLR)4, and fully responded to stimulation by tumor necrosis factor (TNF)-α or interleukin (IL)-1β. We identified the lesion in one of the complementation groups in the gene for MD-2, a putative TLR4 coreceptor. The nonresponder phenotype of this mutant was reversed by transfection with MD-2. Cloning of MD-2 from the nonresponder cell line revealed a point mutation in a highly conserved region resulting in a C95Y amino acid exchange. Both forms of MD-2 colocalized with TLR4 on the cell surface after transfection, but only the wild-type cDNA reverted the lipopolysaccharide (LPS) nonresponder phenotype. Furthermore, soluble MD-2, but not soluble MD-2C95Y, functioned to enable LPS responses in cells that expressed TLR4. Thus, MD-2 is a required component of the LPS signaling complex and can function as a soluble receptor for cells that do not otherwise express it. We hypothesize that MD-2 conformationally affects the extracellular domain of TLR4, perhaps resulting in a change in affinity for LPS or functioning as a portion of the true ligand for TLR4. PMID:11435474

  4. Lack of tau proteins rescues neuronal cell death and decreases amyloidogenic processing of APP in APP/PS1 mice.

    PubMed

    Leroy, Karelle; Ando, Kunie; Laporte, Vincent; Dedecker, Robert; Suain, Valérie; Authelet, Michèle; Héraud, Céline; Pierrot, Nathalie; Yilmaz, Zehra; Octave, Jean-Noël; Brion, Jean-Pierre

    2012-12-01

    Lack of tau expression has been reported to protect against excitotoxicity and to prevent memory deficits in mice expressing mutant amyloid precursor protein (APP) identified in familial Alzheimer disease. In APP mice, mutant presenilin 1 (PS1) enhances generation of Aβ42 and inhibits cell survival pathways. It is unknown whether the deficient phenotype induced by concomitant expression of mutant PS1 is rescued by absence of tau. In this study, we have analyzed the effect of tau deletion in mice expressing mutant APP and PS1. Although APP/PS1/tau(+/+) mice had a reduced survival, developed spatial memory deficits at 6 months and motor impairments at 12 months, these deficits were rescued in APP/PS1/tau(-/-) mice. Neuronal loss and synaptic loss in APP/PS1/tau(+/+) mice were rescued in the APP/PS1/tau(-/-) mice. The amyloid plaque burden was decreased by roughly 50% in the cortex and the spinal cord of the APP/PS1/tau(-/-) mice. The levels of soluble and insoluble Aβ40 and Aβ42, and the Aβ42/Aβ40 ratio were reduced in APP/PS1/tau(-/-) mice. Levels of phosphorylated APP, of β-C-terminal fragments (CTFs), and of β-secretase 1 (BACE1) were also reduced, suggesting that β-secretase cleavage of APP was reduced in APP/PS1/tau(-/-) mice. Our results indicate that tau deletion had a protective effect against amyloid induced toxicity even in the presence of mutant PS1 and reduced the production of Aβ. Copyright © 2012 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  5. Mutant Transcriptome Sequencing Provides Insights into Pod Development in Peanut (Arachis hypogaea L.)

    PubMed Central

    Wan, Liyun; Li, Bei; Lei, Yong; Yan, Liying; Ren, Xiaoping; Chen, Yuning; Dai, Xiaofeng; Jiang, Huifang; Zhang, Juncheng; Guo, Wei; Chen, Ao; Liao, Boshou

    2017-01-01

    Pod size is the major yield component and a key target trait that is selected for in peanut breeding. However, although numerous quantitative trait loci (QTLs) for peanut pod size have been described, the molecular mechanisms underlying the development of this characteristic remain elusive. A peanut mutant with a narrower pod was developed in this study using ethyl methanesulfonate (EMS) mutagenesis and designated as the “pod width” mutant line (pw). The fresh pod weight of pw was only about 40% of that seen in the wild-type (WT) Zhonghua16, while the hull and seed filling of the mutant both also developed at earlier stages. Pods from both pw and WT lines were sampled 20, 40, and 60 days after flowering (DAF) and used for RNA-Seq analysis; the results revealed highly differentially expressed lignin metabolic pathway genes at all three stages, but especially at DAF 20 and DAF 40. At the same time, expression of genes related to auxin signal transduction was found to be significantly repressed during the pw early pod developmental stage. A genome-wide comparative analysis of expression profiles revealed 260 differentially expressed genes (DEGs) across all three stages, and two candidate genes, c26901_g1 (CAD) and c37339_g1 (ACS), responsible for pod width were identified by integrating expression patterns and function annotation of the common DEGs within the three stages. Taken together, the information provided in this study illuminates the processes underlying peanut pod development, and will facilitate further identification of causal genes and the development of improved peanut varieties with higher yields. PMID:29170673

  6. Mutations of NOTCH3 in childhood pulmonary arterial hypertension

    PubMed Central

    Chida, Ayako; Shintani, Masaki; Matsushita, Yoshihisa; Sato, Hiroki; Eitoku, Takahiro; Nakayama, Tomotaka; Furutani, Yoshiyuki; Hayama, Emiko; Kawamura, Yoichi; Inai, Kei; Ohtsuki, Shinichi; Saji, Tsutomu; Nonoyama, Shigeaki; Nakanishi, Toshio

    2014-01-01

    Mutations of BMPR2 and other TGF-β superfamily genes have been reported in pulmonary arterial hypertension (PAH). However, 60–90% of idiopathic PAH cases have no mutations in these genes. Recently, the expression of NOTCH3 was shown to be increased in the pulmonary artery smooth muscle cells of PAH patients. We sought to investigate NOTCH3 and its target genes in PAH patients and clarify the role of NOTCH3 signaling. We screened for mutations in NOTCH3, HES1, and HES5 in 41 PAH patients who had no mutations in BMPR2, ALK1, endoglin, SMAD1/4/8, BMPR1B, or Caveolin-1. Two novel missense mutations (c.2519 G>A p.G840E, c.2698 A>C p.T900P) in NOTCH3 were identified in two PAH patients. We performed functional analysis using stable cell lines expressing either wild-type or mutant NOTCH3. The protein-folding chaperone GRP78/BiP was colocalized with wild-type NOTCH3 in the endoplasmic reticulum, whereas the majority of GRP78/BiP was translocated into the nuclei of cells expressing mutant NOTCH3. Cell proliferation and viability were higher for cells expressing mutant NOTCH3 than for those expressing wild-type NOTCH3. We identified novel NOTCH3 mutations in PAH patients and revealed that these mutations were involved in cell proliferation and viability. NOTCH3 mutants induced an impairment in NOTCH3-HES5 signaling. The results may contribute to the elucidation of PAH pathogenesis. PMID:24936512

  7. Switch-like reprogramming of gene expression after fusion of multinucleate plasmodial cells of two Physarum polycephalum sporulation mutants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta

    2013-05-24

    Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states.more » The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level.« less

  8. [Correlation of chromosome 1p and 19q status and expression of R132H mutant IDH1 protein in oligodendroglial tumors].

    PubMed

    Yao, Kun; Duan, Zejun; Hu, Zeliang; Bian, Yu; Qi, Xueling

    2014-10-01

    To correlate the presence of chromosome 1p/19q deletion with the expression of R132H mutant IDH1 status in oligodendroglial tumors, and to explore molecular markers for predicting chemosensitivity of oligodendroglial tumors. The study included 75 oligodendroglial tumors (38 oligodendrogliomas and 37 oligoastrocytomas). Immunohistochemistry was used to detect the expression of R132H mutant IDH1 protein, and fluorescence in situ hybridization (FISH) was employed to detect 1p/19q deletion. Deletion of chromosome 1p and/or 19q was detected in 37 cases (37/75, 49.3%), among which co-deletion of 1p and 19q was seen in 34 cases (closely correlated, P < 0.01). Oligodendrogliomas WHOIIhad a slightly higher deletion rate than oligodendrogliomas WHO III, although without statistical significance. Oligodendrogliomas WHO IIand WHO III had a significantly higher deletion rate of chromosome 1p/19q than oligoastrocytomas WHO II and WHO III (P < 0.05). While combined loss of 1p/19q was always detected in oligodendrogliomas when FISH was positive, isolated 1p or 19q deletion was only found in oligoastrocytomas. The expression of R132H mutant IDH1 was detected in 51 of 75 cases (68.0%), in which oligodendrogliomas had a higher positive rate than oligoastrocytomas. Statistical analysis demonstrated a significant correlation between the expression of R132H mutant IDH1 protein and the presence of combined 1p/19q deletion in oligodendrogliomas (P < 0.05). A significant correlation was observed between the expression of R132H mutant protein and 1p/19q LOH.Expression of 132H mutant IDH1 protein is the potential biomarker for predicating the presence of 1p/19q deletion in oligodendrogliomas.

  9. A C2H2-type zinc finger protein, SGR5, is involved in early events of gravitropism in Arabidopsis inflorescence stems.

    PubMed

    Morita, Miyo T; Sakaguchi, Keitaro; Kiyose, Shin-Ichiro; Taira, Kensuke; Kato, Takehide; Nakamura, Moritaka; Tasaka, Masao

    2006-08-01

    Plants can sense the direction of gravity and change the growth orientation of their organs. To elucidate the molecular mechanisms of gravity perception and the signal transduction of gravitropism, we have characterized a number of shoot gravitropism (sgr) mutants of Arabidopsis. The sgr5-1 mutant shows reduced gravitropism in the inflorescence stem but its root and hypocotyl have normal gravitropism. SGR5 encodes a zinc finger protein with a coiled-coil motif. The SGR5-GFP fusion protein is localized in the nucleus of Arabidopsis protoplasts, suggesting that SGR5 may act as a transcription factor. Analysis of GUS expression under the control of the SGR5 promoter revealed that SGR5 is mainly expressed in the endodermis, the gravity-sensing tissue in inflorescence stems. Furthermore, the observation that endodermis-specific expression of SGR5 using the SCR promoter in the sgr5-1 mutant restores shoot gravitropism indicates that it could function in the gravity-sensing endodermal cell layer. In contrast to other sgr mutants reported previously, almost all amyloplasts in the endodermal cells of the sgr5-1 mutant sedimented in the direction of gravity. Taken together, our results suggest that SGR5 may be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells.

  10. The distribution and functional properties of Pelizaeus-Merzbacher-like disease-linked Cx47 mutations on Cx47/Cx47 homotypic and Cx47/Cx43 heterotypic gap junctions.

    PubMed

    Kim, Mi Seong; Gloor, Gregory B; Bai, Donglin

    2013-06-01

    GJs (gap junctions) allow direct intercellular communication, and consist of Cxs (connexins). In the mammalian central nervous system, oligodendrocytes express Cx47, Cx32 and Cx29, whereas astrocytes express Cx43, Cx30 and Cx26. Homotypic Cx47/Cx47 GJs couple oligodendrocytes, and heterotypic Cx47/Cx43 channels are the primary GJs at oligodendrocyte/astrocyte junctions. Interestingly, autosomal recessive mutations in the gene GJC2 encoding Cx47 have been linked to a central hypomyelinating disease termed PMLD (Pelizaeus-Merzbacher-like disease). The aim of the present study was to determine the cellular distribution and functional properties of PMLD-associated Cx47 mutants (I46M, G149S, G236R, G236S, M286T and T398I). Expressing GFP (green fluorescent protein)-tagged mutant versions of Cx47 in gap-junction-deficient model cells revealed that these mutants were detected at the cell-cell interface similar to that observed for wild-type Cx47. Furthermore, four of the six mutants showed no electrical coupling in both Cx47/Cx47 and Cx47/Cx43 GJ channels. These results suggest that most of the PMLD-linked Cx47 mutants disrupt Cx47/Cx47 and Cx47/Cx43 GJ function in the glial network, which may play a role in leading to PMLD symptoms.

  11. Influence of Gene Expression on Hardness in Wheat

    PubMed Central

    Nirmal, Ravi C.; Wrigley, Colin

    2016-01-01

    Puroindoline (Pina and Pinb) genes control grain texture or hardness in wheat. Wild-type/soft alleles lead to softer grain while a mutation in one or both of these genes results in a hard grain. Variation in hardness in genotypes with identical Pin alleles (wild-type or mutant) is known but the molecular basis of this is not known. We now report the identification of wheat genotypes with hard grain texture and wild-type/soft Pin alleles indicating that hardness in wheat may be controlled by factors other than mutations in the coding region of the Pin genes. RNA-Seq analysis was used to determine the variation in the transcriptome of developing grains of thirty three diverse wheat genotypes including hard (mutant Pin) and soft (wild type) and those that were hard without having Pin mutations. This defined the role of pin gene expression and identified other candidate genes associated with hardness. Pina was not expressed in hard wheat with a mutation in the Pina gene. The ratio of Pina to Pinb expression was generally lower in the hard non mutant genotypes. Hardness may be associated with differences in Pin expression and other factors and is not simply associated with mutations in the PIN protein coding sequences. PMID:27741295

  12. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    PubMed

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  13. Enhanced Cell-Specific Ablation in Zebrafish Using a Triple Mutant of Escherichia Coli Nitroreductase

    PubMed Central

    Mathias, Jonathan R.; Zhang, Zhanying; Saxena, Meera T.

    2014-01-01

    Abstract Transgenic expression of bacterial nitroreductase (NTR) facilitates chemically-inducible targeted cell ablation. In zebrafish, the NTR system enables studies of cell function and cellular regeneration. Metronidazole (MTZ) has become the most commonly used prodrug substrate for eliciting cell loss in NTR-expressing transgenic zebrafish due to the cell-specific nature of its cytotoxic derivatives. Unfortunately, MTZ treatments required for effective cell ablation border toxic effects, and, thus, likely incur undesirable nonspecific effects. Here, we tested whether a triple mutant variant of NTR, previously shown to display improved activity in bacterial assays, can solve this issue by promoting cell ablation in zebrafish using reduced prodrug treatment regimens. We generated several complementary transgenic zebrafish lines expressing either wild-type or mutant NTR (mutNTR) in specific neural cell types, and assayed prodrug-induced cell ablation kinetics using confocal time series imaging and plate reader-based quantification of fluorescent reporters expressed in targeted cell types. The results show that cell ablation can be achieved in mutNTR expressing transgenic lines with markedly shortened prodrug exposure times and/or at lower prodrug concentrations. The mutNTR variant characterized here can circumvent problematic nonspecific/toxic effects arising from low prodrug conversion efficiency, thus increasing the effectiveness and versatility of this selective cell ablation methodology. PMID:24428354

  14. Enhanced cell-specific ablation in zebrafish using a triple mutant of Escherichia coli nitroreductase.

    PubMed

    Mathias, Jonathan R; Zhang, Zhanying; Saxena, Meera T; Mumm, Jeff S

    2014-04-01

    Transgenic expression of bacterial nitroreductase (NTR) facilitates chemically-inducible targeted cell ablation. In zebrafish, the NTR system enables studies of cell function and cellular regeneration. Metronidazole (MTZ) has become the most commonly used prodrug substrate for eliciting cell loss in NTR-expressing transgenic zebrafish due to the cell-specific nature of its cytotoxic derivatives. Unfortunately, MTZ treatments required for effective cell ablation border toxic effects, and, thus, likely incur undesirable nonspecific effects. Here, we tested whether a triple mutant variant of NTR, previously shown to display improved activity in bacterial assays, can solve this issue by promoting cell ablation in zebrafish using reduced prodrug treatment regimens. We generated several complementary transgenic zebrafish lines expressing either wild-type or mutant NTR (mutNTR) in specific neural cell types, and assayed prodrug-induced cell ablation kinetics using confocal time series imaging and plate reader-based quantification of fluorescent reporters expressed in targeted cell types. The results show that cell ablation can be achieved in mutNTR expressing transgenic lines with markedly shortened prodrug exposure times and/or at lower prodrug concentrations. The mutNTR variant characterized here can circumvent problematic nonspecific/toxic effects arising from low prodrug conversion efficiency, thus increasing the effectiveness and versatility of this selective cell ablation methodology.

  15. Ectopic expression of a Catalpa bungei (Bignoniaceae) PISTILLATA homologue rescues the petal and stamen identities in Arabidopsis pi-1 mutant.

    PubMed

    Jing, Danlong; Xia, Yan; Chen, Faju; Wang, Zhi; Zhang, Shougong; Wang, Junhui

    2015-02-01

    PISTILLATA (PI) plays crucial roles in Arabidopsis flower development by specifying petal and stamen identities. To investigate the molecular mechanisms underlying organ development of woody angiosperm in Catalpa, we isolated and identified a PI homologue, referred to as CabuPI (C. bungei PISTILLATA), from two genetically cognate C. bungei (Bignoniaceae) bearing single and double flowers. Sequence and phylogenetic analyses revealed that the gene is closest related to the eudicot PI homologues. Moreover, a highly conserved PI-motif is found in the C-terminal regions of CabuPI. Semi-quantitative and quantitative real time PCR analyses showed that the expression of CabuPI was restricted to petals and stamens. However, CabuPI expression in the petals and stamens persisted throughout all floral development stages, but the expression levels were different. In 35S::CabuPI transgenic homozygous pi-1 mutant Arabidopsis, the second and the third whorl floral organs produced normal petals and a different number of stamens, respectively. Furthermore, ectopic expression of the CabuPI in transgenic wild-type or heterozygote pi-1 mutant Arabidopsis caused the first whorl sepal partially converted into a petal-like structure. These results clearly reveal the functional conservation of PI homologues between C. bungei and Arabidopsis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. The Armadillo Repeat Gene ZAK IXIK Promotes Arabidopsis Early Embryo and Endosperm Development through a Distinctive Gametophytic Maternal Effect[C][W][OA

    PubMed Central

    Ngo, Quy A.; Baroux, Celia; Guthörl, Daniela; Mozerov, Peter; Collinge, Margaret A.; Sundaresan, Venkatesan; Grossniklaus, Ueli

    2012-01-01

    The proper balance of parental genomic contributions to the fertilized embryo and endosperm is essential for their normal growth and development. The characterization of many gametophytic maternal effect (GME) mutants affecting seed development indicates that there are certain classes of genes with a predominant maternal contribution. We present a detailed analysis of the GME mutant zak ixik (zix), which displays delayed and arrested growth at the earliest stages of embryo and endosperm development. ZIX encodes an Armadillo repeat (Arm) protein highly conserved across eukaryotes. Expression studies revealed that ZIX manifests a GME through preferential maternal expression in the early embryo and endosperm. This parent-of-origin–dependent expression is regulated by neither the histone and DNA methylation nor the DNA demethylation pathways known to regulate some other GME mutants. The ZIX protein is localized in the cytoplasm and nucleus of cells in reproductive tissues and actively dividing root zones. The maternal ZIX allele is required for the maternal expression of MINISEED3. Collectively, our results reveal a reproductive function of plant Arm proteins in promoting early seed growth, which is achieved through a distinct GME of ZIX that involves mechanisms for maternal allele-specific expression that are independent of the well-established pathways. PMID:23064319

  17. Comparative analysis of the integument transcriptomes of the black dilute mutant and the wild-type silkworm Bombyx mori

    PubMed Central

    Wu, Songyuan; Tong, Xiaoling; Peng, Chenxing; Xiong, Gao; Lu, Kunpeng; hu, Hai; Tan, Duan; Li, Chunlin; Han, Minjin; Lu, Cheng; Dai, Fangyin

    2016-01-01

    The insect cuticle is a critical protective shell that is composed predominantly of chitin and various cuticular proteins and pigments. Indeed, insects often change their surface pigment patterns in response to selective pressures, such as threats from predators, sexual selection and environmental changes. However, the molecular mechanisms underlying the construction of the epidermis and its pigmentation patterns are not fully understood. Among Lepidoptera, the silkworm is a favorable model for color pattern research. The black dilute (bd) mutant of silkworm is the result of a spontaneous mutation; the larval body color is notably melanized. We performed integument transcriptome sequencing of the wild-type strain Dazao and the mutant strains +/bd and bd/bd. In these experiments, during an early stage of the fourth molt, a stage at which approximately 51% of genes were expressed genome wide (RPKM ≥1) in each strain. A total of 254 novel transcripts were characterized using Cuffcompare and BLAST analyses. Comparison of the transcriptome data revealed 28 differentially expressed genes (DEGs) that may contribute to bd larval melanism, including 15 cuticular protein genes that were remarkably highly expressed in the bd/bd mutant. We suggest that these significantly up-regulated cuticular proteins may promote melanism in silkworm larvae. PMID:27193628

  18. Intracellularly Induced Cyclophilins Play an Important Role in Stress Adaptation and Virulence of Brucella abortus

    PubMed Central

    García Fernández, Lucía; DelVecchio, Vito G.; Briones, Gabriel

    2013-01-01

    Brucella is an intracellular bacterial pathogen that causes the worldwide zoonotic disease brucellosis. Brucella virulence relies on its ability to transition to an intracellular lifestyle within host cells. Thus, this pathogen must sense its intracellular localization and then reprogram gene expression for survival within the host cell. A comparative proteomic investigation was performed to identify differentially expressed proteins potentially relevant for Brucella intracellular adaptation. Two proteins identified as cyclophilins (CypA and CypB) were overexpressed in the intracellular environment of the host cell in comparison to laboratory-grown Brucella. To define the potential role of cyclophilins in Brucella virulence, a double-deletion mutant was constructed and its resulting phenotype was characterized. The Brucella abortus ΔcypAB mutant displayed increased sensitivity to environmental stressors, such as oxidative stress, pH, and detergents. In addition, the B. abortus ΔcypAB mutant strain had a reduced growth rate at lower temperature, a phenotype associated with defective expression of cyclophilins in other microorganisms. The B. abortus ΔcypAB mutant also displays reduced virulence in BALB/c mice and defective intracellular survival in HeLa cells. These findings suggest that cyclophilins are important for Brucella virulence and survival in the host cells. PMID:23230297

  19. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

    PubMed Central

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

    2018-01-01

    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  20. Six post-implantation lethal knockouts of genes for lipophilic MAPK pathway proteins are expressed in preimplantation mouse embryos and trophoblast stem cells.

    PubMed

    Xie, Yufen; Wang, Yingchun; Sun, Tong; Wang, Fangfei; Trostinskaia, Anna; Puscheck, Elizabeth; Rappolee, Daniel A

    2005-05-01

    Mitogen-activated protein kinase (MAPK) signaling pathways play an important role in controlling embryonic proliferation and differentiation. It has been demonstrated that sequential lipophilic signal transduction mediators that participate in the MAPK pathway are null post-implantation lethal. It is not clear why the lethality of these null mutants arises after implantation and not before. One hypothesis is that the gene product of these post-implantation lethal null mutants are not present before implantation in normal embryos and do not have function until after implantation. To test this hypothesis, we selected a set of lipophilic genes mediating MAPK signal transduction pathways whose null mutants result in early peri-implantation or placental lethality. These included FRS2alpha, GAB1, GRB2, SOS1, Raf-B, and Raf1. Products of these selected genes were detected and their locations and functions indicated by indirect immunocytochemistry and Western blotting for proteins and RT-polymerase chain reaction (PCR) for mRNA transcription. We report here that all six signal mediators are detected at the protein level in preimplantation mouse embryo, placental trophoblasts, and in cultured trophoblast stem cells (TSC). Proteins are all detected in E3.5 embryos at a time when the first known mitogenic intercellular communication has been documented. mRNA transcripts of two post-implantation null mutant genes are expressed in mouse preimplantation embryos and unfertilized eggs. These mRNA transcripts were detected as maternal mRNA in unfertilized eggs that could delay the lethality of null mutants. All of the proteins were detected in the cytoplasm or in the cell membrane. This study of spatial and temporal expression revealed that all of these six null mutants post-implantation genes in MAPK pathway are expressed and, where tested, phosphorylated/activated proteins are detected in the blastocyst. Studies on RNA expression using RT-PCR suggest that maternal RNA could play an important role in delaying the presence of the lethal phenotype of null mutations. Copyright (c) 2005 Wiley-Liss, Inc.

  1. The rice GERMINATION DEFECTIVE 1, encoding a B3 domain transcriptional repressor, regulates seed germination and seedling development by integrating GA and carbohydrate metabolism

    PubMed Central

    Guo, Xiaoli; Hou, Xiaomei; Fang, Jun; Wei, Piwei; Xu, Bo; Chen, Mingluan; Feng, Yuqi; Chu, Chengcai

    2013-01-01

    It has been shown that seed development is regulated by a network of transcription factors in Arabidopsis including LEC1 (LEAFY COTYLEDON1), L1L (LEC1-like) and the B3 domain factors LEC2, FUS3 (FUSCA3) and ABI3 (ABA-INSENSITIVE3); however, molecular and genetic regulation of seed development in cereals is poorly understood. To understand seed development and seed germination in cereals, a large-scale screen was performed using our T–DNA mutant population, and a mutant germination-defective1 (gd1) was identified. In addition to the severe germination defect, the gd1 mutant also shows a dwarf phenotype and abnormal flower development. Molecular and biochemical analyses revealed that GD1 encodes a B3 domain-containing transcription factor with repression activity. Consistent with the dwarf phenotype of gd1, expression of the gibberelic acid (GA) inactivation gene OsGA2ox3 is increased dramatically, accompanied by reduced expression of GA biosynthetic genes including OsGA20ox1, OsGA20ox2 and OsGA3ox2 in gd1, resulting in a decreased endogenous GA4 level. Exogenous application of GA not only induced GD1 expression, but also partially rescued the dwarf phenotype of gd1. Furthermore, GD1 binds to the promoter of OsLFL1, a LEC2/FUS3-like gene of rice, via an RY element, leading to significant up-regulation of OsLFL1 and a large subset of seed maturation genes in the gd1 mutant. Plants over-expressing OsLFL1 partly mimic the gd1 mutant. In addition, expression of GD1 was induced under sugar treatment, and the contents of starch and soluble sugar are altered in the gd1 mutant. These data indicate that GD1 participates directly or indirectly in regulating GA and carbohydrate homeostasis, and further regulates rice seed germination and seedling development. PMID:23581288

  2. The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses.

    PubMed

    Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G

    2002-07-01

    Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants.

  3. Whole-exome sequencing in a single proband reveals a mutation in the CHST8 gene in autosomal recessive peeling skin syndrome

    PubMed Central

    Cabral, Rita M.; Kurban, Mazen; Wajid, Muhammad; Shimomura, Yutaka; Petukhova, Lynn; Christiano, Angela M.

    2015-01-01

    Generalized peeling skin syndrome (PSS) is an autosomal recessive genodermatosis characterized by lifelong, continuous shedding of the upper epidermis. Using whole-genome homozygozity mapping and whole-exome sequencing, we identified a novel homozygous missense mutation (c.229C>T, R77W) within the CHST8 gene, in a large consanguineous family with non-inflammatory PSS type A. CHST8 encodes a Golgi transmembrane N-acetylgalactosamine-4-O-sulfotransferase (GalNAc4-ST1), which we show by immunofluorescence staining to be expressed throughout normal epidermis. A colorimetric assay for total sulfated glycosaminoglycan (GAG) quantification, comparing human keratinocytes (CCD1106 KERTr) expressing wild type and mutant recombinant GalNAc4-ST1, revealed decreased levels of total sulfated GAGs in cells expressing mutant GalNAc4-ST1, suggesting loss of function. Western blotting revealed lower expression levels of mutant recombinant GalNAc4-ST1 compared to wild type, suggesting that accelerated degradation may result in loss of function, leading to PSS type A. This is the first report describing a mutation as the cause of PSS type A. PMID:22289416

  4. Whole-exome sequencing in a single proband reveals a mutation in the CHST8 gene in autosomal recessive peeling skin syndrome.

    PubMed

    Cabral, Rita M; Kurban, Mazen; Wajid, Muhammad; Shimomura, Yutaka; Petukhova, Lynn; Christiano, Angela M

    2012-04-01

    Generalized peeling skin syndrome (PSS) is an autosomal recessive genodermatosis characterized by lifelong, continuous shedding of the upper epidermis. Using whole-genome homozygozity mapping and whole-exome sequencing, we identified a novel homozygous missense mutation (c.229C>T, R77W) within the CHST8 gene, in a large consanguineous family with non-inflammatory PSS type A. CHST8 encodes a Golgi transmembrane N-acetylgalactosamine-4-O-sulfotransferase (GalNAc4-ST1), which we show by immunofluorescence staining to be expressed throughout normal epidermis. A colorimetric assay for total sulfated glycosaminoglycan (GAG) quantification, comparing human keratinocytes (CCD1106 KERTr) expressing wild type and mutant recombinant GalNAc4-ST1, revealed decreased levels of total sulfated GAGs in cells expressing mutant GalNAc4-ST1, suggesting loss of function. Western blotting revealed lower expression levels of mutant recombinant GalNAc4-ST1 compared to wild type, suggesting that accelerated degradation may result in loss of function, leading to PSS type A. This is the first report describing a mutation as the cause of PSS type A. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. miR-1298 inhibits mutant KRAS-driven tumor growth by repressing FAK and LAMB3

    PubMed Central

    Zhou, Ying; Dang, Jason; Chang, Kung-Yen; Yau, Edwin; Aza-Blanc, Pedro; Moscat, Jorge; Rana, Tariq M.

    2016-01-01

    Global microRNA functional screens can offer a strategy to identify synthetic lethal interactions in cancer cells that might be exploited therapeutically. In this study, we applied this strategy to identify novel gene interactions in KRAS mutant cancer cells. In this manner, we discovered miR-1298, a novel miRNA that inhibited the growth of KRAS-driven cells both in vitro and in vivo. Using miR-TRAP affinity purification technology, we identified the tyrosine kinase FAK and the laminin subunit LAMB3 as functional targets of miR-1298. Silencing of FAK or LAMB3 recapitulated the synthetic lethal effects of miR-1298 expression in KRAS-driven cancer cells, whereas co-expression of both proteins was critical to rescue miR-1298-induced cell death. Expression of LAMB3 but not FAK was upregulated by mutant KRAS. In clinical specimens, elevated LAMB3 expression correlated with poorer survival in lung cancer patients with an oncogenic KRAS gene signature, suggesting a novel candidate biomarker in this disease setting. Our results define a novel regulatory pathway in KRAS-driven cancers which offers a potential therapeutic target for their eradication PMID:27698189

  6. Adaptation of Arabidopsis to nitrogen limitation involves induction of anthocyanin synthesis which is controlled by the NLA gene

    PubMed Central

    Peng, Mingsheng; Hudson, Darryl; Schofield, Andrew; Tsao, Rong; Yang, Raymond; Gu, Honglan; Bi, Yong-Mei; Rothstein, Steven. J.

    2008-01-01

    Plants can survive a limiting nitrogen (N) supply by developing a set of N limitation adaptive responses. However, the Arabidopsis nla (nitrogen limitation adaptation) mutant fails to produce such responses, and cannot adapt to N limitation. In this study, the nla mutant was utilized to understand further the effect of NLA on Arabidopsis adaptation to N limitation. Grown with limiting N, the nla mutant could not accumulate anthocyanins and instead produced an N limitation-induced early senescence phenotype. In contrast, when supplied with limiting N and limiting phosphorus (Pi), the nla mutants accumulated abundant anthocyanins and did not show the N limitation-induced early senescence phenotype. These results support the hypothesis that Arabidopsis has a specific pathway to control N limitation-induced anthocyanin synthesis, and the nla mutation disrupts this pathway. However, the nla mutation does not affect the Pi limitation-induced anthocyanin synthesis pathway. Therefore, Pi limitation induced the nla mutant to accumulate anthocyanins under N limitation and allowed this mutant to adapt to N limitation. Under N limitation, the nla mutant had a significantly down-regulated expression of many genes functioning in anthocyanin synthesis, and an enhanced expression of genes involved in lignin production. Correspondingly, the nla mutant grown with limiting N showed a significantly lower production of anthocyanins (particularly cyanidins) and an increase in lignin contents compared with wild-type plants. These data suggest that NLA controls Arabidopsis adaptability to N limitation by channelling the phenylpropanoid metabolic flux to the induced anthocyanin synthesis, which is important for Arabidopsis to adapt to N limitation. PMID:18552353

  7. Susceptibility of Glucokinase-MODY Mutants to Inactivation by Oxidative Stress in Pancreatic β-Cells

    PubMed Central

    Cullen, Kirsty S.; Matschinsky, Franz M.; Agius, Loranne; Arden, Catherine

    2011-01-01

    OBJECTIVE The posttranslational regulation of glucokinase (GK) differs in hepatocytes and pancreatic β-cells. We tested the hypothesis that GK mutants that cause maturity-onset diabetes of the young (GK-MODY) show compromised activity and posttranslational regulation in β-cells. RESEARCH DESIGN AND METHODS Activity and protein expression of GK-MODY and persistent hyperinsulinemic hypoglycemia of infancy (PHHI) mutants were studied in β-cell (MIN6) and non–β-cell (H4IIE) models. Binding of GK to phosphofructo-2-kinase, fructose-2,6-bisphosphatase (PFK2/FBPase2) was studied by bimolecular fluorescence complementation in cell-based models. RESULTS Nine of 11 GK-MODY mutants that have minimal effect on enzyme kinetics in vitro showed decreased specific activity relative to wild type when expressed in β-cells. A subset of these were stable in non–β-cells but showed increased inactivation in conditions of oxidative stress and partial reversal of inactivation by dithiothreitol. Unlike the GK-MODY mutants, four of five GK-PHHI mutants had similar specific activity to wild type and Y214C had higher activity than wild type. The GK-binding protein PFK2/FBPase2 protected wild-type GK from oxidative inactivation and the decreased stability of GK-MODY mutants correlated with decreased interaction with PFK2/FBPase2. CONCLUSIONS Several GK-MODY mutants show posttranslational defects in β-cells characterized by increased susceptibility to oxidative stress and/or protein instability. Regulation of GK activity through modulation of thiol status may be a physiological regulatory mechanism for the control of GK activity in β-cells. PMID:22028181

  8. Mutant p53 proteins counteract autophagic mechanism sensitizing cancer cells to mTOR inhibition.

    PubMed

    Cordani, Marco; Oppici, Elisa; Dando, Ilaria; Butturini, Elena; Dalla Pozza, Elisa; Nadal-Serrano, Mercedes; Oliver, Jordi; Roca, Pilar; Mariotto, Sofia; Cellini, Barbara; Blandino, Giovanni; Palmieri, Marta; Di Agostino, Silvia; Donadelli, Massimo

    2016-08-01

    Mutations in TP53 gene play a pivotal role in tumorigenesis and cancer development. Here, we report that gain-of-function mutant p53 proteins inhibit the autophagic pathway favoring antiapoptotic effects as well as proliferation of pancreas and breast cancer cells. We found that mutant p53 significantly counteracts the formation of autophagic vesicles and their fusion with lysosomes throughout the repression of some key autophagy-related proteins and enzymes as BECN1 (and P-BECN1), DRAM1, ATG12, SESN1/2 and P-AMPK with the concomitant stimulation of mTOR signaling. As a paradigm of this mechanism, we show that atg12 gene repression was mediated by the recruitment of the p50 NF-κB/mutant p53 protein complex onto the atg12 promoter. Either mutant p53 or p50 NF-κB depletion downregulates atg12 gene expression. We further correlated the low expression levels of autophagic genes (atg12, becn1, sesn1, and dram1) with a reduced relapse free survival (RFS) and distant metastasis free survival (DMFS) of breast cancer patients carrying TP53 gene mutations conferring a prognostic value to this mutant p53-and autophagy-related signature. Interestingly, the mutant p53-driven mTOR stimulation sensitized cancer cells to the treatment with the mTOR inhibitor everolimus. All these results reveal a novel mechanism through which mutant p53 proteins promote cancer cell proliferation with the concomitant inhibition of autophagy. Copyright © 2016 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  9. A Novel fry1 Allele Reveals the Existence of a Mutant Phenotype Unrelated to 5′->3′ Exoribonuclease (XRN) Activities in Arabidopsis thaliana Roots

    PubMed Central

    Hirsch, Judith; Estavillo, Gonzalo M.; Javot, Hélène; Chiarenza, Serge; Mallory, Allison C.; Maizel, Alexis; Declerck, Marie; Pogson, Barry J.; Vaucheret, Hervé; Crespi, Martin; Desnos, Thierry; Thibaud, Marie-Christine; Nussaume, Laurent; Marin, Elena

    2011-01-01

    Background Mutations in the FRY1/SAL1 Arabidopsis locus are highly pleiotropic, affecting drought tolerance, leaf shape and root growth. FRY1 encodes a nucleotide phosphatase that in vitro has inositol polyphosphate 1-phosphatase and 3′,(2′),5′-bisphosphate nucleotide phosphatase activities. It is not clear which activity mediates each of the diverse biological functions of FRY1 in planta. Principal Findings A fry1 mutant was identified in a genetic screen for Arabidopsis mutants deregulated in the expression of Pi High affinity Transporter 1;4 (PHT1;4). Histological analysis revealed that, in roots, FRY1 expression was restricted to the stele and meristems. The fry1 mutant displayed an altered root architecture phenotype and an increased drought tolerance. All of the phenotypes analyzed were complemented with the AHL gene encoding a protein that converts 3′-polyadenosine 5′-phosphate (PAP) into AMP and Pi. PAP is known to inhibit exoribonucleases (XRN) in vitro. Accordingly, an xrn triple mutant with mutations in all three XRNs shared the fry1 drought tolerance and root architecture phenotypes. Interestingly these two traits were also complemented by grafting, revealing that drought tolerance was primarily conferred by the rosette and that the root architecture can be complemented by long-distance regulation derived from leaves. By contrast, PHT1 expression was not altered in xrn mutants or in grafting experiments. Thus, PHT1 up-regulation probably resulted from a local depletion of Pi in the fry1 stele. This hypothesis is supported by the identification of other genes modulated by Pi deficiency in the stele, which are found induced in a fry1 background. Conclusions/Significance Our results indicate that the 3′,(2′),5′-bisphosphate nucleotide phosphatase activity of FRY1 is involved in long-distance as well as local regulatory activities in roots. The local up-regulation of PHT1 genes transcription in roots likely results from local depletion of Pi and is independent of the XRNs. PMID:21304819

  10. Csf3r mutations in mice confer a strong clonal HSC advantage via activation of Stat5

    PubMed Central

    Liu, Fulu; Kunter, Ghada; Krem, Maxwell M.; Eades, William C.; Cain, Jennifer A.; Tomasson, Michael H.; Hennighausen, Lothar; Link, Daniel C.

    2008-01-01

    A fundamental property of leukemic stem cells is clonal dominance of the bone marrow microenvironment. Truncation mutations of CSF3R, which encodes the G-CSF receptor (G-CSFR), are implicated in leukemic progression in patients with severe congenital neutropenia. Here we show that expression of a truncated mutant Csf3r in mice confers a strong clonal advantage at the HSC level that is dependent upon exogenous G-CSF. G-CSF–induced proliferation, phosphorylation of Stat5, and transcription of Stat5 target genes were increased in HSCs isolated from mice expressing the mutant Csf3r. Conversely, the proliferative advantage conferred by the mutant Csf3r was abrogated in myeloid progenitors lacking both Stat5A and Stat5B, and HSC function was reduced in mice expressing a truncated mutant Csf3r engineered to have impaired Stat5 activation. These data indicate that in mice, inappropriate Stat5 activation plays a key role in establishing clonal dominance by stem cells expressing mutant Csf3r. PMID:18292815

  11. Comprehensive Gene Expression Analysis of Rice Aleurone Cells: Probing the Existence of an Alternative Gibberellin Receptor1

    PubMed Central

    Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

    2015-01-01

    Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. PMID:25511432

  12. Comparative analysis of gene expression level by quantitative real-time PCR has limited application in objects with different morphology.

    PubMed

    Demidenko, Natalia V; Penin, Aleksey A

    2012-01-01

    qRT-PCR is a generally acknowledged method for gene expression analysis due to its precision and reproducibility. However, it is well known that the accuracy of qRT-PCR data varies greatly depending on the experimental design and data analysis. Recently, a set of guidelines has been proposed that aims to improve the reliability of qRT-PCR. However, there are additional factors that have not been taken into consideration in these guidelines that can seriously affect the data obtained using this method. In this study, we report the influence that object morphology can have on qRT-PCR data. We have used a number of Arabidopsis thaliana mutants with altered floral morphology as models for this study. These mutants have been well characterised (including in terms of gene expression levels and patterns) by other techniques. This allows us to compare the results from the qRT-PCR with the results inferred from other methods. We demonstrate that the comparison of gene expression levels in objects that differ greatly in their morphology can lead to erroneous results.

  13. Arabidopsis serotonin N-acetyltransferase knockout mutant plants exhibit decreased melatonin and salicylic acid levels resulting in susceptibility to an avirulent pathogen.

    PubMed

    Lee, Hyoung Yool; Byeon, Yeong; Tan, Dun-Xian; Reiter, Russel J; Back, Kyoungwhan

    2015-04-01

    Serotonin N-acetyltransferase (SNAT) is the penultimate enzyme in the melatonin biosynthesis pathway in plants. We examined the effects of SNAT gene inactivation in two Arabidopsis T-DNA insertion mutant lines. After inoculation with the avirulent pathogen Pseudomonas syringe pv. tomato DC3000 harboring the elicitor avrRpt2 (Pst-avrRpt2), melatonin levels in the snat knockout mutant lines were 50% less than in wild-type Arabidopsis Col-0 plants. The snat knockout mutant lines exhibited susceptibility to pathogen infection that coincided with decreased induction of defense genes including PR1, ICS1, and PDF1.2. Because melatonin acts upstream of salicylic acid (SA) synthesis, the reduced melatonin levels in the snat mutant lines led to decreased SA levels compared to wild-type, suggesting that the increased pathogen susceptibility of the snat mutant lines could be attributed to decreased SA levels and subsequent attenuation of defense gene induction. Exogenous melatonin treatment failed to induce defense gene expression in nahG Arabidopsis plants, but restored the induction of defense gene expression in the snat mutant lines. In addition, melatonin caused translocation of NPR1 (nonexpressor of PR1) protein from the cytoplasm into the nucleus indicating that melatonin-elicited pathogen resistance in response to avirulent pathogen attack is SA-dependent in Arabidopsis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Light-Induced Acclimation of the Arabidopsis chlorina1 Mutant to Singlet Oxygen[C][W

    PubMed Central

    Ramel, Fanny; Ksas, Brigitte; Akkari, Elsy; Mialoundama, Alexis S.; Monnet, Fabien; Krieger-Liszkay, Anja; Ravanat, Jean-Luc; Mueller, Martin J.; Bouvier, Florence; Havaux, Michel

    2013-01-01

    Singlet oxygen (1O2) is a reactive oxygen species that can function as a stress signal in plant leaves leading to programmed cell death. In microalgae, 1O2-induced transcriptomic changes result in acclimation to 1O2. Here, using a chlorophyll b–less Arabidopsis thaliana mutant (chlorina1 [ch1]), we show that this phenomenon can also occur in vascular plants. The ch1 mutant is highly photosensitive due to a selective increase in the release of 1O2 by photosystem II. Under photooxidative stress conditions, the gene expression profile of ch1 mutant leaves very much resembled the gene responses to 1O2 reported in the Arabidopsis mutant flu. Preexposure of ch1 plants to moderately elevated light intensities eliminated photooxidative damage without suppressing 1O2 formation, indicating acclimation to 1O2. Substantial differences in gene expression were observed between acclimation and high-light stress: A number of transcription factors were selectively induced by acclimation, and contrasting effects were observed for the jasmonate pathway. Jasmonate biosynthesis was strongly induced in ch1 mutant plants under high-light stress and was noticeably repressed under acclimation conditions, suggesting the involvement of this hormone in 1O2-induced cell death. This was confirmed by the decreased tolerance to photooxidative damage of jasmonate-treated ch1 plants and by the increased tolerance of the jasmonate-deficient mutant delayed-dehiscence2. PMID:23590883

  15. Analysis of crystal structure of Arabidopsis MPK6 and generation of its mutants with higher activity

    PubMed Central

    Wang, Bo; Qin, Xinghua; Wu, Juan; Deng, Hongying; Li, Yuan; Yang, Hailian; Chen, Zhongzhou; Liu, Guoqin; Ren, Dongtao

    2016-01-01

    Mitogen-activated protein kinase (MAPK) cascades, which are the highly conserved signalling modules in eukaryotic organisms, have been shown to play important roles in regulating growth, development, and stress responses. The structures of various MAPKs from yeast and animal have been solved, and structure-based mutants were generated for their function analyses, however, the structures of plant MAPKs remain unsolved. Here, we report the crystal structure of Arabidopsis MPK6 at a 3.0 Å resolution. Although MPK6 is topologically similar to ERK2 and p38, the structures of the glycine-rich loop, MAPK insert, substrate binding sites, and L16 loop in MPK6 show notable differences from those of ERK2 and p38. Based on the structural comparison, we constructed MPK6 mutants and analyzed their kinase activity both in vitro and in planta. MPK6F364L and MPK6F368L mutants, in which Phe364 and Phe368 in the L16 loop were changed to Leu, respectively, acquired higher intrinsic kinase activity and retained the normal MAPKK activation property. The expression of MPK6 mutants with basal activity is sufficient to induce camalexin biosynthesis; however, to induce ethylene and leaf senescence, the expression of MPK6 mutants with higher activity is required. The results suggest that these mutants can be used to analyze the specific biological functions of MPK6. PMID:27160427

  16. Misfolded rhodopsin mutants display variable aggregation properties.

    PubMed

    Gragg, Megan; Park, Paul S-H

    2018-06-08

    The largest class of rhodopsin mutations causing autosomal dominant retinitis pigmentosa (adRP) is mutations that lead to misfolding and aggregation of the receptor. The misfolding mutants have been characterized biochemically, and categorized as either partial or complete misfolding mutants. This classification is incomplete and does not provide sufficient information to fully understand the disease pathogenesis and evaluate therapeutic strategies. A Förster resonance energy transfer (FRET) method was utilized to directly assess the aggregation properties of misfolding rhodopsin mutants within the cell. Partial (P23H and P267L) and complete (G188R, H211P, and P267R) misfolding mutants were characterized to reveal variability in aggregation properties. The complete misfolding mutants all behaved similarly, forming aggregates when expressed alone, minimally interacting with the wild-type receptor when coexpressed, and were unresponsive to treatment with the pharmacological chaperone 9-cis retinal. In contrast, variability was observed between the partial misfolding mutants. In the opsin form, the P23H mutant behaved similarly as the complete misfolding mutants. In contrast, the opsin form of the P267L mutant existed as both aggregates and oligomers when expressed alone and formed mostly oligomers with the wild-type receptor when coexpressed. The partial misfolding mutants both reacted similarly to the pharmacological chaperone 9-cis retinal, displaying improved folding and oligomerization when expressed alone but aggregating with wild-type receptor when coexpressed. The observed differences in aggregation properties and effect of 9-cis retinal predict different outcomes in disease pathophysiology and suggest that retinoid-based chaperones will be ineffective or even detrimental. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Selective targeting of KRAS-Mutant cells by miR-126 through repression of multiple genes essential for the survival of KRAS-Mutant cells

    PubMed Central

    Hara, Toshifumi; Jones, Matthew F.; Subramanian, Murugan; Li, Xiao Ling; Ou, Oliver; Zhu, Yuelin; Yang, Yuan; Wakefield, Lalage M.; Hussain, S. Perwez; Gaedcke, Jochen; Ried, Thomas; Luo, Ji; Caplen, Natasha J.; Lal, Ashish

    2014-01-01

    MicroRNAs (miRNAs) regulate the expression of hundreds of genes. However, identifying the critical targets within a miRNA-regulated gene network is challenging. One approach is to identify miRNAs that exert a context-dependent effect, followed by expression profiling to determine how specific targets contribute to this selective effect. In this study, we performed miRNA mimic screens in isogenic KRAS-Wild-type (WT) and KRAS-Mutant colorectal cancer (CRC) cell lines to identify miRNAs selectively targeting KRAS-Mutant cells. One of the miRNAs we identified as a selective inhibitor of the survival of multiple KRAS-Mutant CRC lines was miR-126. In KRAS-Mutant cells, miR-126 over-expression increased the G1 compartment, inhibited clonogenicity and tumorigenicity, while exerting no effect on KRAS-WT cells. Unexpectedly, the miR-126-regulated transcriptome of KRAS-WT and KRAS-Mutant cells showed no significant differences. However, by analyzing the overlap between miR-126 targets with the synthetic lethal genes identified by RNAi in KRAS-Mutant cells, we identified and validated a subset of miR-126-regulated genes selectively required for the survival and clonogenicity of KRAS-Mutant cells. Our strategy therefore identified critical target genes within the miR-126-regulated gene network. We propose that the selective effect of miR-126 on KRAS-Mutant cells could be utilized for the development of targeted therapy for KRAS mutant tumors. PMID:25245095

  18. FGF8 is essential for formation of the ductal system in the male reproductive tract

    PubMed Central

    Kitagaki, Jirouta; Ueda, Yutaka; Chi, Xuan; Sharma, Nirmala; Elder, Cynthia M.; Truffer, Erika; Costantini, Frank; Lewandoski, Mark; Perantoni, Alan O.

    2011-01-01

    During development of the urogenital tract, fibroblast growth factor 8 (Fgf8) is expressed in mesonephric tubules, but its role in this tissue remains undefined. An evaluation of previously generated T-Cre-mediated Fgf8-deficient mice (T-Cre; Fgf8flox/Δ2,3 mice), which lack Fgf8 expression in the mesoderm, revealed that the cranial region of the Wolffian duct degenerated prematurely and the cranial mesonephric tubules were missing. As a result, the epididymis, vas deferens and efferent ductules were largely absent in mutant mice. Rarb2-Cre was used to eliminate FGF8 from the mesonephric tubules but to allow expression in the adjacent somites. These mutants retained the cranial end of the Wolffian duct and formed the epididymis and vas deferens, but failed to elaborate the efferent ductules, indicating that Fgf8 expression by the mesonephric tubules is required specifically for the formation of the ductules. Ret knockout mice do not form the ureteric bud, a caudal outgrowth of the Wolffian duct and progenitor for the collecting duct network in the kidney, but they do develop the cranial end normally. This indicates that Fgf8, but not Ret, expression is essential to the outgrowth of the cranial mesonephric tubules from the Wolffian duct and to the development of major portions of the sex accessory tissues in the male reproductive tract. Mechanistically, FGF8 functions upstream of Lhx1 expression in forming the nephron, and analysis of Fgf8 mutants similarly shows deficient Lhx1 expression in the mesonephric tubules. These results demonstrate a multifocal requirement for FGF8 in establishing the male reproductive tract ducts and implicate Lhx1 signaling in tubule elongation. PMID:22110055

  19. Wild-Type U2AF1 Antagonizes the Splicing Program Characteristic of U2AF1-Mutant Tumors and Is Required for Cell Survival

    PubMed Central

    Fei, Dennis Liang; Motowski, Hayley; Chatrikhi, Rakesh; Gao, Shaojian; Kielkopf, Clara L.; Varmus, Harold

    2016-01-01

    We have asked how the common S34F mutation in the splicing factor U2AF1 regulates alternative splicing in lung cancer, and why wild-type U2AF1 is retained in cancers with this mutation. A human lung epithelial cell line was genetically modified so that U2AF1S34F is expressed from one of the two endogenous U2AF1 loci. By altering levels of mutant or wild-type U2AF1 in this cell line and by analyzing published data on human lung adenocarcinomas, we show that S34F-associated changes in alternative splicing are proportional to the ratio of S34F:wild-type gene products and not to absolute levels of either the mutant or wild-type factor. Preferential recognition of specific 3′ splice sites in S34F-expressing cells is largely explained by differential in vitro RNA-binding affinities of mutant versus wild-type U2AF1 for those same 3′ splice sites. Finally, we show that lung adenocarcinoma cell lines bearing U2AF1 mutations do not require the mutant protein for growth in vitro or in vivo. In contrast, wild-type U2AF1 is required for survival, regardless of whether cells carry the U2AF1S34F allele. Our results provide mechanistic explanations of the magnitude of splicing changes observed in U2AF1-mutant cells and why tumors harboring U2AF1 mutations always retain an expressed copy of the wild-type allele. PMID:27776121

  20. Fine Mapping and Candidate Gene Analysis of the Leaf-Color Gene ygl-1 in Maize

    PubMed Central

    Guan, Haiying; Xu, Xiangbo; He, Chunmei; Liu, Chunxiao; Liu, Qiang; Dong, Rui; Liu, Tieshan; Wang, Liming

    2016-01-01

    A novel yellow-green leaf mutant yellow-green leaf-1 (ygl-1) was isolated in self-pollinated progenies from the cross of maize inbred lines Ye478 and Yuanwu02. The mutant spontaneously showed yellow-green character throughout the lifespan. Meanwhile, the mutant reduced contents of chlorophyll and Car, arrested chloroplast development and lowered the capacity of photosynthesis compared with the wild-type Lx7226. Genetic analysis revealed that the mutant phenotype was controlled by a recessive nuclear gene. The ygl-1 locus was initially mapped to an interval of about 0.86 Mb in bin 1.01 on the short arm of chromosome 1 using 231 yellow-green leaf individuals of an F2 segregating population from ygl-1/Lx7226. Utilizing four new polymorphic SSR markers, the ygl-1 locus was narrowed down to a region of about 48 kb using 2930 and 2247 individuals of F2 and F3 mapping populations, respectively. Among the three predicted genes annotated within this 48 kb region, GRMZM2G007441, which was predicted to encode a cpSRP43 protein, had a 1-bp nucleotide deletion in the coding region of ygl-1 resulting in a frame shift mutation. Semi-quantitative RT-PCR analysis revealed that YGL-1 was constitutively expressed in all tested tissues and its expression level was not significantly affected in the ygl-1 mutant from early to mature stages, while light intensity regulated its expression both in the ygl-1 mutant and wild type seedlings. Furthermore, the mRNA levels of some genes involved in chloroplast development were affected in the six-week old ygl-1 plants. These findings suggested that YGL-1 plays an important role in chloroplast development of maize. PMID:27100184

  1. The bZIP Transcription Factor Fgap1 Mediates Oxidative Stress Response and Trichothecene Biosynthesis But Not Virulence in Fusarium graminearum

    PubMed Central

    Montibus, Mathilde; Ducos, Christine; Bonnin-Verdal, Marie-Noelle; Bormann, Jorg; Ponts, Nadia; Richard-Forget, Florence; Barreau, Christian

    2013-01-01

    Redox sensing is of primary importance for fungi to cope with oxidant compounds found in their environment. Plant pathogens are particularly subject to the oxidative burst during the primary steps of infection. In the budding yeast Saccharomyces cerevisiae, it is the transcription factor Yap1 that mediates the response to oxidative stress via activation of genes coding for detoxification enzymes. In the cereal pathogen Fusarium graminearum, Fgap1 a homologue of Yap1 was identified and its role was investigated. During infection, this pathogen produces mycotoxins belonging to the trichothecenes family that accumulate in the grains. The global regulation of toxin biosynthesis is not completely understood. However, it is now clearly established that an oxidative stress activates the production of toxins by F. graminearum. The involvement of Fgap1 in this activation was investigated. A deleted mutant and a strain expressing a truncated constitutive form of Fgap1 were constructed. None of the mutants was affected in pathogenicity. The deleted mutant showed higher level of trichothecenes production associated with overexpression of Tri genes. Moreover activation of toxin accumulation in response to oxidative stress was no longer observed. Regarding the mutant with the truncated constitutive form of Fgap1, toxin production was strongly reduced. Expression of oxidative stress response genes was not activated in the deleted mutant and expression of the gene encoding the mitochondrial superoxide dismutase MnSOD1 was up-regulated in the mutant with the truncated constitutive form of Fgap1. Our results demonstrate that Fgap1 plays a key role in the link between oxidative stress response and F. graminearum secondary metabolism. PMID:24349499

  2. Functional analysis of potassium channels in Kv7.2 G271V mutant causing early onset familial epilepsy.

    PubMed

    Wang, Juanjuan; Li, Yuan; Hui, Zhiyan; Cao, Min; Shi, Ruiming; Zhang, Wei; Geng, Limeng; Zhou, Xihui

    2015-08-07

    Kv7 (KCNQ) channels underlying a class of voltage-gated K+ current are best known for regulating neuronal excitability. The first glycine (G) residue in the pore helix of Kv7.2 (KCNQ2) subunit is highly conserved among different classes of Kv7 channel family. A missense mutation causing the replacement of the corresponding G residues with a valine (p.G271V) in Kv7.2 was found in a large, four-generation pedigree. Here, we set out to examine the molecular pathomechanism of G271V mutants using patch clamp technology combined with biochemical and immunocytochemical techniques in transiently transfected human embryonic kidney (HEK) 293 cells. The expression of Kv7.2 protein had the same intensity for both wild type (WT) and G271V. In transfected HEK cells, G271V mutants induced large depolarizing shifts of the conductance-voltage relationships and marked slowing of current activation kinetics compared to WT. In addition, G271V mutants abolished currents in homomeric channels, and resulted in about 50% reduction of current in Kv7.2/G271V/Kv7.3 heteromultimeric condition, indicating a more severe functional defect. To test for G271V mutant channel expression in surface membrane, we performed fluorescence confocal microscopy imaging, which revealed no differences between the mutant and WT, suggesting that G271V channels fail to open in response to depolarization even though they are present in the membrane. Furthermore, pharmacologic intervention experiments revealed that upon specific incubation of transfected HEK 293 cells expressing G271V heteromultimeric channels in presence of Kv7 channel enhancer retigabine (ezogabine), the potassium currents increased significantly, suggesting the potential of retigabine as gene-specific therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. tortuga refines Notch pathway gene expression in the zebrafish presomitic mesoderm at the post-transcriptional level.

    PubMed

    Dill, Kariena K; Amacher, Sharon L

    2005-11-15

    We have identified the zebrafish tortuga (tor) gene by an ENU-induced mutation that disrupts the presomitic mesoderm (PSM) expression of Notch pathway genes. In tor mutants, Notch pathway gene expression persists in regions of the PSM where expression is normally off in wild type embryos. The expression of hairy/Enhancer of split-related 1 (her1) is affected first, followed by the delta genes deltaC and deltaD, and finally, by another hairy/Enhancer of split-related gene, her7. In situ hybridization with intron-specific probes for her1 and deltaC indicates that transcriptional bursts of expression are normal in tor mutants, suggesting that tor normally functions to refine her1 and deltaC message levels downstream of transcription. Despite the striking defects in Notch pathway gene expression, somite boundaries form normally in tor mutant embryos, although somitic mesoderm defects are apparent later, when cells mature to form muscle fibers. Thus, while the function of Notch pathway genes is required for proper somite formation, the tor mutant phenotype suggests that precise oscillations of Notch pathway transcripts are not essential for establishing segmental pattern in the presomitic mesoderm.

  4. Reduced Heme Levels Underlie the Exponential Growth Defect of the Shewanella oneidensis hfq Mutant

    PubMed Central

    Mezoian, Taylor; Hunt, Taylor M.; Keane, Meaghan L.; Leonard, Jessica N.; Scola, Shelby E.; Beer, Emma N.; Perdue, Sarah; Pellock, Brett J.

    2014-01-01

    The RNA chaperone Hfq fulfills important roles in small regulatory RNA (sRNA) function in many bacteria. Loss of Hfq in the dissimilatory metal reducing bacterium Shewanella oneidensis strain MR-1 results in slow exponential phase growth and a reduced terminal cell density at stationary phase. We have found that the exponential phase growth defect of the hfq mutant in LB is the result of reduced heme levels. Both heme levels and exponential phase growth of the hfq mutant can be completely restored by supplementing LB medium with 5-aminolevulinic acid (5-ALA), the first committed intermediate synthesized during heme synthesis. Increasing expression of gtrA, which encodes the enzyme that catalyzes the first step in heme biosynthesis, also restores heme levels and exponential phase growth of the hfq mutant. Taken together, our data indicate that reduced heme levels are responsible for the exponential growth defect of the S. oneidensis hfq mutant in LB medium and suggest that the S. oneidensis hfq mutant is deficient in heme production at the 5-ALA synthesis step. PMID:25356668

  5. Analysis of the Fluoroquinolone Antibiotic Resistance Mechanism of Salmonella enterica Isolates.

    PubMed

    Kim, Soo-Young; Lee, Si-Kyung; Park, Myeong-Soo; Na, Hun-Taek

    2016-09-28

    Quinolone-resistant Salmonella strains were isolated from patient samples, and several quinolone-sensitive strains were used to analyze mutations in the quinolone resistance-determining region (QRDR) of gyrA, gyrB, parC, and parE and to screen for plasmid-mediated quinolone resistance. Among the 21 strains that showed resistance to nalidixic acid and ciprofloxacin (MIC 0.125-2.0 μg/ml), 17 strains had a mutation in QRDR codon 87 of gyrA, and 3 strains had a single mutation (Ser83 → Phe). Another cause of resistance, efflux pump regulation, was studied by examining the expression of acrB, ramA, marA, and soxS. Five strains, including Sal-KH1 and Sal-KH2, showed no increase in relative expression in an analysis using the qRT-PCR method (p < 0.05). In order to determine the genes involved in the resistance, the Sal-9 isolate that showed decreased susceptibility and did not contain a mutation in the gyrA QRDR was used to make the STM (MIC 8 μg/ml) and STH (MIC 16 μg/ml) ciprofloxacin-resistant mutants. The gyrA QRDR Asp87 → Gly mutation was identified in both the STM and STH mutants by mutation analysis. qRT-PCR analysis of the efflux transporter acrB of the AcrAB-TolC efflux system showed increased expression levels in both the STM (1.79-fold) and STH (2.0-fold) mutants. In addition, the expression of the transcriptional regulator marA was increased in both the STM (6.35-fold) and STH (21.73-fold) mutants. Moreover, the expression of soxS was increased in the STM (3.41-fold) and STH (10.05-fold) mutants (p < 0.05). Therefore, these results indicate that AcrAB-TolC efflux pump activity and the target site mutation in gyrA are involved in quinolone resistance.

  6. [The preparation of recombinant adenovirus Ad-Rad50-GFP and detection of the optimal multiplicity of infection in CNE1 transfected hv Ad-Rad50-GFP].

    PubMed

    Yan, Ruicheng; Huang, Jiancong; Zhu, Ling; Chang, Lihong; Li, Jingjia; Wu, Xifu; Ye, Jin; Zhang, Gehua

    2015-12-01

    The optimal multiplicity of infection (MOI) of the recombinant adenovirus Ad-Rad50-GFP carrying a mutant Rad50 gene expression region on the cell growth of nasopharyngeal carcinoma and the viral amplification efficiency of CNE1 cell infected by this adenovirus were studied. The biological titer of Ad-Rad50-GFP was measured by end point dilution method. The impact of recombinant adenoviral vector transfection on the growth of CNE1 cells was observed by cell growth curve. Transfection efficacy of recombinant adenoviral vector was observed and calculated through fluorescence microscope. The expression f mutant Rad50 in the Ad-Rad50-GFP transfected CNE1 cells with optimal MOI was detected by Western Blot after transfection. The biological titer of Ad-Rad50-GFP was 1.26 x 10¹¹ pfu/ml. CNE1 cell growth was not influenced significantly as they were transfected by recombinant adenoviral vector with MOI less than 50. Transfection efficacy of recombinant adenoviral vector was most salient at 24 hours after transfection, with the high expression of mutant Rad50, and the efficiency still remained about 70% after 72 hours. Recombinant adenoviral vector Ad-Rad50-GFP could transfect CNE1 cells as well as result in the expression of mutant Rad50 in CNE1 cells effectively. MOI = 50 was the optimal multiplicity of infection of CNE1 cells transfected by recombinant adenoviral vector Ad-Rad50-GFP.

  7. Polymorphic Variation in Susceptibility and Metabolism of Triclosan-Resistant Mutants of Escherichia coli and Klebsiella pneumoniae Clinical Strains Obtained after Exposure to Biocides and Antibiotics

    PubMed Central

    Curiao, Tânia; Marchi, Emmanuela; Viti, Carlo; Oggioni, Marco R.; Baquero, Fernando; Martinez, José Luis

    2015-01-01

    Exposure to biocides may result in cross-resistance to other antimicrobials. Changes in biocide and antibiotic susceptibilities, metabolism, and fitness costs were studied here in biocide-selected Escherichia coli and Klebsiella pneumoniae mutants. E. coli and K. pneumoniae mutants with various degrees of triclosan susceptibility were obtained after exposure to triclosan (TRI), benzalkonium chloride (BKC), chlorhexidine (CHX) or sodium hypochlorite (SHC), and ampicillin or ciprofloxacin. Alterations in antimicrobial susceptibility and metabolism in mutants were tested using Phenotype MicroArrays. The expression of AcrAB pump and global regulators (SoxR, MarA, and RamA) was measured by quantitative reverse transcription-PCR (qRT-PCR), and the central part of the fabI gene was sequenced. The fitness costs of resistance were assessed by a comparison of relative growth rates. Triclosan-resistant (TRIr) and triclosan-hypersusceptible (TRIhs) mutants of E. coli and K. pneumoniae were obtained after selection with biocides and/or antibiotics. E. coli TRIr mutants, including those with mutations in the fabI gene or in the expression of acrB, acrF, and marA, exhibited changes in susceptibility to TRI, CHX, and antibiotics. TRIr mutants for which the TRI MIC was high presented improved metabolism of carboxylic acids, amino acids, and carbohydrates. In TRIr mutants, resistance to one antimicrobial provoked hypersusceptibility to another one(s). TRIr mutants had fitness costs, particularly marA-overexpressing (E. coli) or ramA-overexpressing (K. pneumoniae) mutants. TRI, BKC, and CIP exposure frequently yielded TRIr mutants exhibiting alterations in AraC-like global regulators (MarA, SoxR, and RamA), AcrAB-TolC, and/or FabI, and influencing antimicrobial susceptibility, fitness, and metabolism. These various phenotypes suggest a trade-off of different selective processes shaping the evolution toward antibiotic/biocide resistance and influencing other adaptive traits. PMID:25824225

  8. Polymorphic variation in susceptibility and metabolism of triclosan-resistant mutants of Escherichia coli and Klebsiella pneumoniae clinical strains obtained after exposure to biocides and antibiotics.

    PubMed

    Curiao, Tânia; Marchi, Emmanuela; Viti, Carlo; Oggioni, Marco R; Baquero, Fernando; Martinez, José Luis; Coque, Teresa M

    2015-01-01

    Exposure to biocides may result in cross-resistance to other antimicrobials. Changes in biocide and antibiotic susceptibilities, metabolism, and fitness costs were studied here in biocide-selected Escherichia coli and Klebsiella pneumoniae mutants. E. coli and K. pneumoniae mutants with various degrees of triclosan susceptibility were obtained after exposure to triclosan (TRI), benzalkonium chloride (BKC), chlorhexidine (CHX) or sodium hypochlorite (SHC), and ampicillin or ciprofloxacin. Alterations in antimicrobial susceptibility and metabolism in mutants were tested using Phenotype MicroArrays. The expression of AcrAB pump and global regulators (SoxR, MarA, and RamA) was measured by quantitative reverse transcription-PCR (qRT-PCR), and the central part of the fabI gene was sequenced. The fitness costs of resistance were assessed by a comparison of relative growth rates. Triclosan-resistant (TRI(r)) and triclosan-hypersusceptible (TRI(hs)) mutants of E. coli and K. pneumoniae were obtained after selection with biocides and/or antibiotics. E. coli TRI(r) mutants, including those with mutations in the fabI gene or in the expression of acrB, acrF, and marA, exhibited changes in susceptibility to TRI, CHX, and antibiotics. TRI(r) mutants for which the TRI MIC was high presented improved metabolism of carboxylic acids, amino acids, and carbohydrates. In TRI(r) mutants, resistance to one antimicrobial provoked hypersusceptibility to another one(s). TRI(r) mutants had fitness costs, particularly marA-overexpressing (E. coli) or ramA-overexpressing (K. pneumoniae) mutants. TRI, BKC, and CIP exposure frequently yielded TRI(r) mutants exhibiting alterations in AraC-like global regulators (MarA, SoxR, and RamA), AcrAB-TolC, and/or FabI, and influencing antimicrobial susceptibility, fitness, and metabolism. These various phenotypes suggest a trade-off of different selective processes shaping the evolution toward antibiotic/biocide resistance and influencing other adaptive traits. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Involvement of NADPH oxidase isoforms in the production of O2− manipulated by ABA in the senescing leaves of early-senescence-leaf (esl) mutant rice (Oryza sativa)

    PubMed Central

    Wang, Fubiao; Zhao, Qian; Liu, Jianchao; Cheng, Fangmin

    2018-01-01

    In this study, the differences in reactive oxygen species (ROS) generation and abscisic acid (ABA) accumulation in senescing leaves were investigated by early-senescence-leaf (esl) mutant and its wild type, to clarify the relationship among ABA levels, ROS generation, and NADPH oxidase (Nox) in senescing leaves of rice (Oryza sativa). The temporal expression levels of OsNox isoforms in senescing leaves and their expression patterns in response to ABA treatment were determined through quantitative real-time reverse transcription PCR (qRT-PCR). Results showed that the flag leaf of the esl mutant generated more O2- concentrations and accumulated higher ABA levels than the wild-type cultivar did in the grain-filling stage. Exogenous ABA treatment induced O2- generation; however, it was depressed by diphenyleneiodonium chloride (DPI) pretreatment in the detached leaf segments. This finding suggested the involvement of NADPH oxidase in ABA-induced O2- generation. The esl mutant exhibited significantly higher expression of OsNox2, OsNox5, OsNox6, and OsNox7 in the initial of grain-filling stage, followed by sharply decrease. The transcriptional levels of OsNox1, OsNox3, and OsFR07 in the flag leaf of the esl mutant were significantly lower than those in the wild-type cultivar. The expression levels of OsNox2, OsNox5, OsNox6, and OsNox7 were significantly enhanced by exogenous ABA treatments. The enhanced expression levels of OsNox2 and OsNox6 were dependent on the duration of ABA treatment. The inducible expression levels of OsNox5 and OsNox7 were dependent on ABA concentrations. By contrast, exogenous ABA treatment severely repressed the transcripts of OsNox1, OsNox3, and OsFR07 in the detached leaf segments. Therefore, OsNox2, OsNox5, OsNox6, and OsNox7 were probably involved in the ABA-induced O2- generation in the initial stage of leaf senescence. Subsequently, other oxidases activated in deteriorating cells were associated with ROS generation and accumulation in the senescing leaves of the esl mutant. Conversely, OsNox1, OsNox3, and OsFR07 were not associated with ABA-induced O2- generation during leaf senescence. PMID:29309410

  10. Involvement of NADPH oxidase isoforms in the production of O2- manipulated by ABA in the senescing leaves of early-senescence-leaf (esl) mutant rice (Oryza sativa).

    PubMed

    Li, Zhaowei; Wang, Fubiao; Zhao, Qian; Liu, Jianchao; Cheng, Fangmin

    2018-01-01

    In this study, the differences in reactive oxygen species (ROS) generation and abscisic acid (ABA) accumulation in senescing leaves were investigated by early-senescence-leaf (esl) mutant and its wild type, to clarify the relationship among ABA levels, ROS generation, and NADPH oxidase (Nox) in senescing leaves of rice (Oryza sativa). The temporal expression levels of OsNox isoforms in senescing leaves and their expression patterns in response to ABA treatment were determined through quantitative real-time reverse transcription PCR (qRT-PCR). Results showed that the flag leaf of the esl mutant generated more O2- concentrations and accumulated higher ABA levels than the wild-type cultivar did in the grain-filling stage. Exogenous ABA treatment induced O2- generation; however, it was depressed by diphenyleneiodonium chloride (DPI) pretreatment in the detached leaf segments. This finding suggested the involvement of NADPH oxidase in ABA-induced O2- generation. The esl mutant exhibited significantly higher expression of OsNox2, OsNox5, OsNox6, and OsNox7 in the initial of grain-filling stage, followed by sharply decrease. The transcriptional levels of OsNox1, OsNox3, and OsFR07 in the flag leaf of the esl mutant were significantly lower than those in the wild-type cultivar. The expression levels of OsNox2, OsNox5, OsNox6, and OsNox7 were significantly enhanced by exogenous ABA treatments. The enhanced expression levels of OsNox2 and OsNox6 were dependent on the duration of ABA treatment. The inducible expression levels of OsNox5 and OsNox7 were dependent on ABA concentrations. By contrast, exogenous ABA treatment severely repressed the transcripts of OsNox1, OsNox3, and OsFR07 in the detached leaf segments. Therefore, OsNox2, OsNox5, OsNox6, and OsNox7 were probably involved in the ABA-induced O2- generation in the initial stage of leaf senescence. Subsequently, other oxidases activated in deteriorating cells were associated with ROS generation and accumulation in the senescing leaves of the esl mutant. Conversely, OsNox1, OsNox3, and OsFR07 were not associated with ABA-induced O2- generation during leaf senescence.

  11. Lack of genetic interaction between Tbx20 and Tbx3 in early mouse heart development.

    PubMed

    Gavrilov, Svetlana; Harvey, Richard P; Papaioannou, Virginia E

    2013-01-01

    Members of the T-box family of transcription factors are important regulators orchestrating the complex regionalization of the developing mammalian heart. Individual mutations in Tbx20 and Tbx3 cause distinct congenital heart abnormalities in the mouse: Tbx20 mutations result in failure of heart looping, developmental arrest and lack of chamber differentiation, while hearts of Tbx3 mutants progress further, loop normally but show atrioventricular convergence and outflow tract defects. The two genes have overlapping areas of expression in the atrioventricular canal and outflow tract of the heart but their potential genetic interaction has not been previously investigated. In this study we produced compound mutants to investigate potential genetic interactions at the earliest stages of heart development. We find that Tbx20; Tbx3 double heterozygous mice are viable and fertile with no apparent abnormalities, while double homozygous mutants are embryonic lethal by midgestation. Double homozygous mutant embryos display abnormal cardiac morphogenesis, lack of heart looping, expression patterns of cardiac genes and time of death that are indistinguishable from Tbx20 homozygous mutants. Prior to death, the double homozygotes show an overall developmental delay similar to Tbx3 homozygous mutants. Thus the effects of Tbx20 are epistatic to Tbx3 in the heart but Tbx3 is epistatic to Tbx20 with respect to developmental delay.

  12. Absence of cell surface expression of human ACE leads to perinatal death

    PubMed Central

    Michaud, Annie; Acharya, K. Ravi; Masuyer, Geoffrey; Quenech'du, Nicole; Gribouval, Olivier; Morinière, Vincent; Gubler, Marie-Claire; Corvol, Pierre

    2014-01-01

    Renal tubular dysgenesis (RTD) is a recessive autosomal disease characterized most often by perinatal death. It is due to the inactivation of any of the major genes of the renin-angiotensin system (RAS), one of which is the angiotensin I-converting enzyme (ACE). ACE is present as a tissue-bound enzyme and circulates in plasma after its solubilization. In this report, we present the effect of different ACE mutations associated with RTD on ACE intracellular trafficking, secretion and enzymatic activity. One truncated mutant, R762X, responsible for neonatal death was found to be an enzymatically active, secreted form, not inserted in the plasma membrane. In contrast, another mutant, R1180P, was compatible with life after transient neonatal renal insufficiency. This mutant was located at the plasma membrane and rapidly secreted. These results highlight the importance of tissue-bound ACE versus circulating ACE and show that the total absence of cell surface expression of ACE is incompatible with life. In addition, two missense mutants (W594R and R828H) and two truncated mutants (Q1136X and G1145AX) were also studied. These mutants were neither inserted in the plasma membrane nor secreted. Finally, the structural implications of these ACE mutations were examined by molecular modelling, which suggested some important structural alterations such as disruption of intra-molecular non-covalent interactions (e.g. salt bridges). PMID:24163131

  13. Use of bioluminescence mutant screening for identification of Edwardsiella ictaluri genes involved in channel catfish (Ictalurus punctatus) skin colonization.

    PubMed

    Menanteau-Ledouble, Simon; Lawrence, Mark L

    2013-03-23

    Initial invasion of the host is the first and vital part of any infection process. We have demonstrated that Edwardsiella ictaluri is capable of colonizing and penetrating catfish skin. Therefore, a mutant library was constructed by random insertion of the Mar2xT7 transposon into the chromosome of E. ictaluri harboring the bioluminescence plasmid pAKgfplux1. This library was then screened through a series of three consecutive challenges for mutants showing a decreased ability to colonize the catfish epithelium. Eighteen mutants were identified that have decreased adhesion and virulence. Mutated genes encoded one sensor protein, two transport proteins, five enzymes, two regulatory proteins, and five hypothetical proteins. Among the mutated genes, the first one identified was a gene encoding for RstA/B, which is known to play a role in regulating the expression of invasion genes in Salmonella enterica Typhimurium. Another mutant was lacking a putative ribonuclease similar to a Shigella protein that regulates the expression of adhesin. A third mutant was defective in a protein similar to a Brucella protein that was initially identified as a transporter, but actually is a member of a newly discovered adhesin family. Results from this study could enable development of a new strategy for blocking E. ictaluri invasion at the initial adherence stage. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Regulation of the Candida albicans Cell Wall Damage Response by Transcription Factor Sko1 and PAS Kinase Psk1

    PubMed Central

    Rauceo, Jason M.; Blankenship, Jill R.; Fanning, Saranna; Hamaker, Jessica J.; Deneault, Jean-Sebastien; Smith, Frank J.; Nantel, Andre

    2008-01-01

    The environmental niche of each fungus places distinct functional demands on the cell wall. Hence cell wall regulatory pathways may be highly divergent. We have pursued this hypothesis through analysis of Candida albicans transcription factor mutants that are hypersensitive to caspofungin, an inhibitor of beta-1,3-glucan synthase. We report here that mutations in SKO1 cause this phenotype. C. albicans Sko1 undergoes Hog1-dependent phosphorylation after osmotic stress, like its Saccharomyces cerevisiae orthologues, thus arguing that this Hog1-Sko1 relationship is conserved. However, Sko1 has a distinct role in the response to cell wall inhibition because 1) sko1 mutants are much more sensitive to caspofungin than hog1 mutants; 2) Sko1 does not undergo detectable phosphorylation in response to caspofungin; 3) SKO1 transcript levels are induced by caspofungin in both wild-type and hog1 mutant strains; and 4) sko1 mutants are defective in expression of caspofungin-inducible genes that are not induced by osmotic stress. Upstream Sko1 regulators were identified from a panel of caspofungin-hypersensitive protein kinase–defective mutants. Our results show that protein kinase Psk1 is required for expression of SKO1 and of Sko1-dependent genes in response to caspofungin. Thus Psk1 and Sko1 lie in a newly described signal transduction pathway. PMID:18434592

  15. [6]-Gingerol Induces Cell Cycle Arrest and Cell Death of Mutant p53-expressing Pancreatic Cancer Cells

    PubMed Central

    Park, Yon Jung; Wen, Jing; Bang, Seungmin; Park, Seung Woo

    2006-01-01

    [6]-Gingerol, a major phenolic compound derived from ginger, has anti-bacterial, anti-inflammatory and anti-tumor activities. While several molecular mechanisms have been described to underlie its effects on cells in vitro and in vivo, the underlying mechanisms by which [6]-gingerol exerts anti-tumorigenic effects are largely unknown. The purpose of this study was to investigate the action of [6]-gingerol on two human pancreatic cancer cell lines, HPAC expressing wild-type (wt) p53 and BxPC-3 expressing mutated p53. We found that [6]-gingerol inhibited the cell growth through cell cycle arrest at G1 phase in both cell lines. Western blot analyses indicated that [6]-gingerol decreased both Cyclin A and Cyclin-dependent kinase (Cdk) expression. These events led to reduction in Rb phosphorylation followed by blocking of S phase entry. p53 expression was decreased by [6]-gingerol treatment in both cell lines suggesting that the induction of Cyclin-dependent kinase inhibitor, p21cip1, was p53-independent. [6]-Gingerol induced mostly apoptotic death in the mutant p53-expressing cells, while no signs of early apoptosis were detected in wild type p53-expressing cells and this was related to the increased phosphorylation of AKT. These results suggest that [6]-gingerol can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing apoptotic cell death while it exerts cytostatic effect on wild type p53-expressing cells by inducing temporal growth arrest. PMID:17066513

  16. Hoxb3 negatively regulates Hoxb1 expression in mouse hindbrain patterning.

    PubMed

    Wong, Elaine Y M; Wang, Xing An; Mak, Siu Shan; Sae-Pang, Jearn Jang; Ling, Kam Wing; Fritzsch, Bernd; Sham, Mai Har

    2011-04-15

    The spatial regulation of combinatorial expression of Hox genes is critical for determining hindbrain rhombomere (r) identities. To address the cross-regulatory relationship between Hox genes in hindbrain neuronal specification, we have generated a gain-of-function transgenic mouse mutant Hoxb3(Tg) using the Hoxb2 r4-specific enhancer element. Interestingly, in r4 of the Hoxb3(Tg) mutant where Hoxb3 was ectopically expressed, the expression of Hoxb1 was specifically abolished. The hindbrain neuronal defects of the Hoxb3(Tg) mutant mice were similar to those of Hoxb1(-/-) mutants. Therefore, we hypothesized that Hoxb3 could directly suppress Hoxb1 expression. We first identified a novel Hoxb3 binding site S3 on the Hoxb1 locus and confirmed protein binding to this site by EMSA, and by in vivo ChIP analysis using P19 cells and hindbrain tissues from the Hoxb3(Tg) mutant. We further showed that Hoxb3 could suppress Hoxb1 transcriptional activity by chick in ovo luciferase reporter assay. Moreover, in E10.5 wildtype caudal hindbrain, where Hoxb1 is not expressed, we showed by in vivo ChIP that Hoxb3 was consistently bound to the S3 site on the Hoxb1 gene. This study reveals a novel negative regulatory mechanism by which Hoxb3 as a posterior gene serves to restrict Hoxb1 expression in r4 by direct transcriptional repression to maintain the rhombomere identity. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

    PubMed Central

    Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

    1999-01-01

    In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

  18. The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation.

    PubMed

    Liao, W; Bisgrove, B W; Sawyer, H; Hug, B; Bell, B; Peters, K; Grunwald, D J; Stainier, D Y

    1997-01-01

    The zebrafish cloche mutation affects both the endothelial and hematopoietic lineages at a very early stage (Stainier, D. Y. R., Weinstein, B. M., Detrich, H. W., Zon, L. I. and Fishman, M. C. (1995). Development 121, 3141-3150). The most striking vascular phenotype is the absence of endocardial cells from the heart. Microscopic examination of mutant embryos reveals the presence of endothelial-like cells in the lower trunk and tail regions while head vessels appear to be missing, indicating a molecular diversification of the endothelial lineage. Cell transplantation experiments show that cloche acts cell-autonomously within the endothelial lineage. To analyze further the role of cloche in regulating endothelial cell differentiation, we have examined the expression of flk-1 and tie, two receptor tyrosine kinase genes expressed early and sequentially in the endothelial lineage. In wild-type fish, flk-1-positive cells are found throughout the embryo and differentiate to form the nascent vasculature. In cloche mutants, flk-1-positive cells are found only in the lower trunk and tail regions, and this expression is delayed as compared to wild-type. Unlike the flk-1-positive cells in wild-type embryos, those in cloche mutants do not go on to express tie, suggesting that their differentiation is halted at an early stage. We also find that the cloche mutation is not linked to flk-1. These data indicate that cloche affects the differentiation of all endothelial cells and that it acts at a very early stage, either by directly regulating flk-1 expression or by controlling the differentiation of cells that normally develop to express flk-1. cloche mutants also have a blood deficit and their hematopoietic tissues show no expression of the hematopoietic transcription factor genes GATA-1 or GATA-2 at early stages. Because the appearance of distinct levels of flk-1 expression is delayed in cloche mutants, we examined GATA-1 expression at late embryonic stages and found some blood cell differentiation that appears to be limited to the region lined by the flk-1-expressing cells. The spatial restriction of blood in the ventroposterior-most region of cloche mutant embryos may be indicative of a ventral source of signal(s) controlling hematopoietic differentiation. In addition, the restricted colocalization of blood and endothelium in cloche mutants suggests that important interactions occur between these two lineages during normal development.

  19. Drosophila GPCR Han is a receptor for the circadian clock neuropeptide PDF.

    PubMed

    Hyun, Seogang; Lee, Youngseok; Hong, Sung-Tae; Bang, Sunhoe; Paik, Donggi; Kang, Jongkyun; Shin, Jinwhan; Lee, Jaejung; Jeon, Keunhye; Hwang, Seungyoon; Bae, Eunkyung; Kim, Jaeseob

    2005-10-20

    The pigment-dispersing factor (PDF) is a neuropeptide controlling circadian behavioral rhythms in Drosophila, but its receptor is not yet known. From a large-scale temperature preference behavior screen in Drosophila, we isolated a P insertion mutant that preferred different temperatures during the day and night. This mutation, which we named han, reduced the transcript level of CG13758. We found that Han was expressed specifically in 13 pairs of circadian clock neurons in the adult brain. han null flies showed arrhythmic circadian behavior in constant darkness. The behavioral characteristics of han null mutants were similar to those of pdf null mutants. We also found that PDF binds specifically to S2 cells expressing Han, which results in the elevation of cAMP synthesis. Therefore, we herein propose that Han is a PDF receptor regulating circadian behavioral rhythm through coordination of activities of clock neurons.

  20. Alteration in cellular acetylcholine influences dauer formation in Caenorhabditis elegans.

    PubMed

    Lee, Jeeyong; Kim, Kwang-Youl; Paik, Young-Ki

    2014-02-01

    Altered acetylcholine (Ach) homeostasis is associated with loss of viability in flies, developmental defects in mice, and cognitive deficits in human. Here, we assessed the importance of Ach in Caenorhabditis elegans development, focusing on the role of Ach during dauer formation. We found that dauer formation was disturbed in choline acetyltransferase (cha-1) and acetylcholinesterase (ace) mutants defective in Ach biosynthesis and degradation, respectively. When examined the potential role of G-proteins in dauer formation, goa-1 and egl-30 mutant worms, expressing mutated versions of mammalian G(o) and G(q) homolog, respectively, showed some abnormalities in dauer formation. Using quantitative mass spectrometry, we also found that dauer larvae had lower Ach content than did reproductively grown larvae. In addition, a proteomic analysis of acetylcholinesterase mutant worms, which have excessive levels of Ach, showed differential expression of metabolic genes. Collectively, these results indicate that alterations in Ach release may influence dauer formation in C. elegans.

  1. Wing Defects in Drosophila xenicid Mutant Clones Are Caused by C-Terminal Deletion of Additional Sex Combs (Asx)

    PubMed Central

    Bischoff, Kara; Ballew, Anna C.; Simon, Michael A.; O'Reilly, Alana M.

    2009-01-01

    Background The coordinated action of genes that control patterning, cell fate determination, cell size, and cell adhesion is required for proper wing formation in Drosophila. Defects in any of these basic processes can lead to wing aberrations, including blisters. The xenicid mutation was originally identified in a screen designed to uncover regulators of adhesion between wing surfaces [1]. Principal Findings Here, we demonstrate that expression of the βPS integrin or the patterning protein Engrailed are not affected in developing wing imaginal discs in xenicid mutants. Instead, expression of the homeotic protein Ultrabithorax (Ubx) is strongly increased in xenicid mutant cells. Conclusion Our results suggest that upregulation of Ubx transforms cells from a wing blade fate to a haltere fate, and that the presence of haltere cells within the wing blade is the primary defect leading to the adult wing phenotypes observed. PMID:19956620

  2. A soma-to-germline transformation in long-lived C. elegans mutants

    PubMed Central

    Curran, Sean P.; Wu, Xiaoyun; Riedel, Christian G.; Ruvkun, Gary

    2009-01-01

    Unlike the soma which ages during the lifespan of multicellular organisms, the germline traces an essentially immortal lineage. Genomic instability in somatic cells increases with age, and this decline in somatic maintenance might be regulated to facilitate resource reallocation toward reproduction at the expense of cellular senescence. We report here that C. elegans mutants with increased longevity exhibit a soma-to-germline transformation of gene expression programs normally limited to the germline. Decreased insulin-like signaling causes the somatic misexpression of germline-limited pie-1 and pgl family of genes in intestinal and ectodermal tissues. DAF-16/FoxO, the major transcriptional effector of insulin-like signaling, regulates pie-1 expression by directly binding to the pie-1 promoter. The somatic tissues of insulin-like mutants are more germline-like and protected from genotoxic stress. Gene inactivation of components of the cytosolic chaperonin complex that induce increased longevity also cause somatic misexpression of PGL-1. These results suggest that the acquisition of germline characteristics by the somatic cells of C. elegans mutants with increased longevity contributes to their increased health and survival. PMID:19506556

  3. Reversed polarized delivery of an aquaporin-2 mutant causes dominant nephrogenic diabetes insipidus

    PubMed Central

    Kamsteeg, Erik-Jan; Bichet, Daniel G.; Konings, Irene B.M.; Nivet, Hubert; Lonergan, Michelle; Arthus, Marie-Françoise; van Os, Carel H.; Deen, Peter M.T.

    2003-01-01

    Vasopressin regulates body water conservation by redistributing aquaporin-2 (AQP2) water channels from intracellular vesicles to the apical surface of renal collecting ducts, resulting in water reabsorption from urine. Mutations in AQP2 cause autosomal nephrogenic diabetes insipidus (NDI), a disease characterized by the inability to concentrate urine. Here, we report a frame-shift mutation in AQP2 causing dominant NDI. This AQP2 mutant is a functional water channel when expressed in Xenopus oocytes. However, expressed in polarized renal cells, it is misrouted to the basolateral instead of apical plasma membrane. Additionally, this mutant forms heterotetramers with wild-type AQP2 and redirects this complex to the basolateral surface. The frame shift induces a change in the COOH terminus of AQP2, creating both a leucine- and a tyrosine-based motif, which cause the reversed sorting of AQP2. Our data reveal a novel cellular phenotype in dominant NDI and show that dominance of basolateral sorting motifs in a mutant subunit can be the molecular basis for disease. PMID:14662748

  4. Characterization of a spontaneous avirulent mutant of Legionella pneumophila Serogroup 6: evidence of DotA and flagellin involvement in the loss of virulence.

    PubMed

    Scaturro, Maria; Meschini, Stefania; Arancia, Giuseppe; Stefano, Fontana; Ricci, Maria Luisa

    2009-12-01

    The pathogenesis of Legionella pneumophila mainly resides in its ability to inhibit the phagosome-lysosome fusion, which normally prevents the killing of the host cells. In order to characterize the molecular alterations that occurred in a spontaneous avirulent mutant of Legionella pneumophila serogroup 6, named Vir-, we investigated the ability of the mutant to adhere to and multiply in the WI26VA4 alveolar epithelial cell line and in human macrophages, when compared to its parental strain, Vir+. We also determined the colocalization of bacteria with LAMP-1 to gain an insight into the phagosome-lysosome fusion process. Additionally, we determined the flagellin expression and dotA nucleotide sequencing. We observed a lack of expression of flagellin and an in-frame mutation in the dotA. gene. The data obtained strongly suggest the loss of virulence of the mutant could probably be due to the absence of flagellin and the dysfunctional type IV secretion System, resulting from the DotA protein being severely compromised.

  5. Zebrafish Dmrta2 regulates neurogenesis in the telencephalon.

    PubMed

    Yoshizawa, Akio; Nakahara, Yoshinari; Izawa, Toshiaki; Ishitani, Tohru; Tsutsumi, Makiko; Kuroiwa, Atsushi; Itoh, Motoyuki; Kikuchi, Yutaka

    2011-11-01

    Although recent findings showed that some Drosophila doublesex and Caenorhabditis elegans mab-3 related genes are expressed in neural tissues during development, their functions have not been fully elucidated. Here, we isolated a zebrafish mutant, ha2, that shows defects in telencephalic neurogenesis and found that ha2 encodes Doublesex and MAB-3 related transcription factor like family A2 (Dmrta2). dmrta2 expression is restricted to the telencephalon, diencephalon and olfactory placode during somitogenesis. We found that the expression of the proneural gene, neurogenin1, in the posterior and dorsal region of telencephalon (posterior-dorsal telencephalon) is markedly reduced in this mutant at the 14-somite stage without any defects in cell proliferation or cell death. In contrast, the telencephalic expression of her6, a Hes-related gene that is known to encode a negative regulator of neurogenin1, expands dramatically in the ha2 mutant. Based on over-expression experiments and epistatic analyses, we propose that zebrafish Dmrta2 controls neurogenin1 expression by repressing her6 in the posterior-dorsal telencephalon. Furthermore, the expression domains of the telencephalic marker genes, foxg1 and emx3, and the neuronal differentiation gene, neurod, are downregulated in the ha2 posterior-dorsal telencephalon during somitogenesis. These results suggest that Dmrta2 plays important roles in the specification of the posterior-dorsal telencephalic cell fate during somitogenesis. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  6. Effect of mutant variants of the KRAS gene on PD-L1 expression and on the immune microenvironment and association with clinical outcome in lung adenocarcinoma patients.

    PubMed

    Falk, Alexander T; Yazbeck, Nathalie; Guibert, Nicolas; Chamorey, Emmanuel; Paquet, Agnès; Ribeyre, Lydia; Bence, Coraline; Zahaf, Katia; Leroy, Sylvie; Marquette, Charles-Hugo; Cohen, Charlotte; Mograbi, Baharia; Mazières, Julien; Hofman, Véronique; Brest, Patrick; Hofman, Paul; Ilié, Marius

    2018-07-01

    The effect of anti-PD-1/PD-L1 inhibitors on lung adenocarcinomas (LADCs) with KRAS mutations is debatable. We examined the association between specific mutant KRAS proteins and the immune infiltrates with the outcome of patients with LADCs. In 219 LADCs harboring either wild-type (WT) or mutated KRAS gene, we quantified the density of several immune markers by immunohistochemistry followed by automated digital image analysis. Data were correlated to clinicopathological parameters and outcome of patients. Tumors harboring mutant KRAS-G12 V had a significantly higher PD-L1 expression compared to other tumors (p = 0.044), while mutant KRAS-G12D tumors showed an increase in the density of CD66b+ cells (p = 0.001). High PD-L1 expression in tumor cells was associated to improved overall survival (OS) in KRAS mutant patients (p = 0.012), but not in the WT population (p = 0.385), whereas increased PD-L1 expression in immune cells correlated to poor OS of KRAS-WT patients (p = 0.025), with no difference in patients with KRAS mutations. KRAS mutational status can affect the immune microenvironment and survival of LADC patients in a heterogeneous way, implying that specific mutant KRAS variants expressed by the tumor should be considered when stratifying patients for immunotherapy. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Systematic strain construction and process development: Xylitol production by Saccharomyces cerevisiae expressing Candida tenuis xylose reductase in wild-type or mutant form.

    PubMed

    Pratter, S M; Eixelsberger, T; Nidetzky, B

    2015-12-01

    A novel Saccharomyces cerevisiae whole-cell biocatalyst for xylitol production based on Candida tenuis xylose reductase (CtXR) is presented. Six recombinant strains expressing wild-type CtXR or an NADH-specific mutant were constructed and evaluated regarding effects of expression mode, promoter strength, biocatalyst concentration and medium composition. Intracellular XR activities ranged from 0.09 U mgProt(-1) to 1.05 U mgProt(-1) but did not correlate with the strains' xylitol productivities, indicating that other factors limited xylose conversion in the high-activity strains. The CtXR mutant decreased the biocatalyst's performance, suggesting use of the NADPH-preferring wild-type enzyme when (semi-)aerobic conditions are applied. In a bioreactor process, the best-performing strain converted 40 g L(-1) xylose with an initial productivity of 1.16 g L(-1)h(-1) and a xylitol yield of 100%. The obtained results underline the potential of CtXR wild-type for xylose reduction and point out parameters to improve "green" xylitol production. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Epithelial heparan sulfate regulates Sonic Hedgehog signaling in lung development.

    PubMed

    He, Hua; Huang, Meina; Sun, Shenfei; Wu, Yihui; Lin, Xinhua

    2017-08-01

    The tree-like structure of the mammalian lung is generated from branching morphogenesis, a reiterative process that is precisely regulated by numerous factors. How the cell surface and extra cellular matrix (ECM) molecules regulate this process is still poorly understood. Herein, we show that epithelial deletion of Heparan Sulfate (HS) synthetase Ext1 resulted in expanded branching tips and reduced branching number, associated with several mesenchymal developmental defects. We further demonstrate an expanded Fgf10 expression and increased FGF signaling activity in Ext1 mutant lungs, suggesting a cell non-autonomous mechanism. Consistent with this, we observed reduced levels of SHH signaling which is responsible for suppressing Fgf10 expression. Moreover, reactivating SHH signaling in mutant lungs rescued the tip dilation phenotype and attenuated FGF signaling. Importantly, the reduced SHH signaling activity did not appear to be caused by decreased Shh expression or protein stability; instead, biologically active form of SHH proteins were reduced in both the Ext1 mutant epithelium and surrounding wild type mesenchymal cells. Together, our study highlights the epithelial HS as a key player for dictating SHH signaling critical for lung morphogenesis.

  9. Mig6 Puts the Brakes on Mutant EGFR-Driven Lung Cancer | Center for Cancer Research

    Cancer.gov

    Lung cancer is the most common cause of cancer-related death worldwide. These cancers are often induced by mutations in the epidermal growth factor receptor (EGFR), resulting in constitutive activation of the protein’s tyrosine kinase domain. Lung cancers expressing these EGFR mutants are initially sensitive to tyrosine kinase inhibitors (TKIs), such as erlotinib, but often become resistant by developing compensatory mutations in EGFR or other growth-promoting pathways. To better understand how mutant EGFR initiates and maintains tumor growth in the hopes of identifying novel targets for drug development, Udayan Guha, M.D., Ph.D., of CCR’s Thoracic and Gastrointestinal Oncology Branch, and his colleagues examined the landscape of proteins phosphorylated in EGFR wild type and mutant cells. One protein hyper-phosphorylated in mutant EGFR cells was Mig6, a putative tumor suppressor.

  10. Examining the specific contributions of individual Arabidopsis metallothioneins to copper distribution and metal tolerance.

    PubMed

    Guo, Woei-Jiun; Meetam, Metha; Goldsbrough, Peter B

    2008-04-01

    Metallothioneins (MTs) are small cysteine-rich proteins found in various eukaryotes. Plant MTs are classified into four types based on the arrangement of cysteine residues. To determine whether all four types of plant MTs function as metal chelators, six Arabidopsis (Arabidopsis thaliana) MTs (MT1a, MT2a, MT2b, MT3, MT4a, and MT4b) were expressed in the copper (Cu)- and zinc (Zn)-sensitive yeast mutants, Deltacup1 and Deltazrc1 Deltacot1, respectively. All four types of Arabidopsis MTs provided similar levels of Cu tolerance and accumulation to the Deltacup1 mutant. The type-4 MTs (MT4a and MT4b) conferred greater Zn tolerance and higher accumulation of Zn than other MTs to the Deltazrc1 Deltacot1 mutant. To examine the functions of MTs in plants, we studied Arabidopsis plants that lack MT1a and MT2b, two MTs that are expressed in phloem. The lack of MT1a, but not MT2b, led to a 30% decrease in Cu accumulation in roots of plants exposed to 30 mum CuSO(4). Ectopic expression of MT1a RNA in the mt1a-2 mt2b-1 mutant restored Cu accumulation in roots. The mt1a-2 mt2b-1 mutant had normal metal tolerance. However, when MT deficiency was combined with phytochelatin deficiency, growth of the mt1a-2 mt2b-1 cad1-3 triple mutant was more sensitive to Cu and cadmium compared to the cad1-3 mutant. Together these results provide direct evidence for functional contributions of MTs to plant metal homeostasis. MT1a, in particular, plays a role in Cu homeostasis in the roots under elevated Cu. Moreover, MTs and phytochelatins function cooperatively to protect plants from Cu and cadmium toxicity.

  11. ChR2 mutants at L132 and T159 with improved operational light sensitivity for vision restoration.

    PubMed

    Pan, Zhuo-Hua; Ganjawala, Tushar H; Lu, Qi; Ivanova, Elena; Zhang, Zhifei

    2014-01-01

    The ectopic expression of microbial opsin-based optogenetic sensors, such as channelrhodopsin-2 (ChR2) in surviving inner retinal neurons, is a promising approach to restoring vision after retinal degeneration. However, a major limitation in using native ChR2 as a light sensor for vision restoration is the low light sensitivity of its expressing cells. Recently, two ChR2 mutations, T159C and L132C, were reported to produce higher photocurrents or have ultra light sensitivity. In this study, we created additional ChR2 mutants at these two sites to search for more light responsive ChR2 forms and evaluate their suitability for vision restoration by examining their light responsive properties in HEK cells and mouse retinal ganglion cells. We found additional ChR2 mutants at these two sites that showed a further increase in current amplitude at low light levels in the cells expressing these mutants, or operational light sensitivity. However, the increase in the operational light sensitivity was correlated with a decrease in temporal kinetics. Therefore, there is a trade-off between operational light sensitivity and temporal resolution for these more light responsive ChR2 mutants. Our results showed that for the two most light responsive mutants, L132C/T159C and L132C/T159S, the required light intensities for generating the threshold spiking activity in retinal ganglion cells were 1.5 and nearly 2 log units lower than wild-type ChR2 (wt-ChR2), respectively. Additionally, their ChR2-mediated spiking activities could follow flicker frequencies up to 20 and 10 Hz, respectively, at light intensities up to 1.5 log units above their threshold levels. Thus, the use of these more light responsive ChR2 mutants could make the optogenetic approach to restoring vision more feasible.

  12. Superoxide-Dismutase Deficient Mutants in Common Beans (Phaseolus vulgaris L.): Genetic Control, Differential Expressions of Isozymes, and Sensitivity to Arsenic

    PubMed Central

    Talukdar, Dibyendu; Talukdar, Tulika

    2013-01-01

    Two common bean (Phaseolus vulgaris L.) mutants, sodPv 1 and sodPv 2, exhibiting foliar superoxide dismutase (SOD) activity of only 25% and 40% of their mother control (MC) cv. VL 63 were isolated in EMS-mutagenized (0.15%, 8 h) M2 progeny. Native-PAGE analysis revealed occurrence of Mn SOD, Fe SOD, Cu/Zn SOD I and Cu/Zn SOD II isozymes in MC, while Fe SOD, and Mn SOD were not formed in sodPv 1 and sodPv 2 leaves, respectively. In-gel activity of individual isozymes differed significantly among the parents. SOD deficiency is inherited as recessive mutations, controlled by two different nonallelic loci. Gene expressions using qRT PCR confirmed higher expressions of Cu/Zn SOD transcripts in both mutants and the absence of Fe SOD in sodPv 1 and Mn SOD in sodPv 2. In 50 μM arsenic, Cu/Zn SODs genes were further upregulated but other isoforms downregulated in the two mutants, maintaining SOD activity in its control level. In an F2 double mutants of sodPv 1 × sodPv 2, no Fe SOD, and Mn SOD expressions were detectable, while both Cu/Zn SODs are down-regulated and arsenic-induced leaf necrosis appeared. In contrast to both mutants, ROS-imaging study revealed overaccumulation of both superoxides and H2O2 in leaves of double mutant. PMID:24078924

  13. Genetic Dissection of Midbrain Dopamine Neuron Development in vivo

    PubMed Central

    Ellisor, Debra; Rieser, Caroline; Voelcker, Bettina; Machan, Jason T.; Zervas, Mark

    2012-01-01

    Midbrain dopamine (MbDA) neurons are partitioned into medial and lateral cohorts that control complex functions. However, the genetic underpinnings of MbDA neuron heterogeneity are unclear. While it is known that Wnt1-expressing progenitors contribute to MbDA neurons, the role of Wnt1 in MbDA neuron development in vivo is unresolved. We show that mice with a spontaneous point mutation in Wnt1 have a unique phenotype characterized by the loss of medial MbDA neurons concomitant with a severe depletion of Wnt1-expressing progenitors and diminished LMX1a-expressing progenitors. Wnt1 mutant embryos also have alterations in a hierarchical gene regulatory loop suggesting multiple gene involvement in the Wnt1 mutant MbDA neuron phenotype. To investigate this possibility, we conditionally deleted Gbx2, Fgf8, and En1/2 after their early role in patterning and asked whether these genetic manipulations phenocopied the depletion of MbDA neurons in Wnt1 mutants. The conditional deletion of Gbx2 did not result in re-positioning or distribution of MbDA neurons. The temporal deletion of Fgf8 did not result in the loss of either LMX1a-expressing progenitors nor the initial population of differentiated MbDA neurons, but did result in a complete loss of MbDA neurons at later stages. The temporal deletion and species specific manipulation of En1/2 demonstrated a continued and species specific role of Engrailed genes in MbDA neuron development. Notably, our conditional deletion experiments revealed phenotypes dissimilar to Wnt1 mutants indicating the unique role of Wnt1 in MbDA neuron development. By placing Wnt1, Fgf8, and En1/2 in the context of their temporal requirement for MbDA neuron development, we further deciphered the developmental program underpinning MbDA neuron progenitors. PMID:23041116

  14. Functional Inactivation of Putative Photosynthetic Electron Acceptor Ferredoxin C2 (FdC2) Induces Delayed Heading Date and Decreased Photosynthetic Rate in Rice

    PubMed Central

    Ruan, Banpu; Kang, Shujing; He, Lei; Zhang, Sen; Dong, Guojun; Hu, Jiang; Zeng, Dali; Zhang, Guangheng; Gao, Zhenyu; Ren, Deyong; Hu, Xingming; Chen, Guang; Guo, Longbiao; Qian, Qian; Zhu, Li

    2015-01-01

    Ferredoxin (Fd) protein as unique electron acceptor, involved in a variety of fundamental metabolic and signaling processes, which is indispensable for plant growth. The molecular mechanisms of Fd such as regulation of electron partitioning, impact of photosynthetic rate and involvement in the carbon fixing remain elusive in rice. Here we reported a heading date delay and yellowish leaf 1 (hdy1) mutant derived from Japonica rice cultivar “Nipponbare” subjected to EMS treatment. In the paddy field, the hdy1 mutant appeared at a significantly late heading date and had yellow-green leaves during the whole growth stage. Further investigation indicated that the abnormal phenotype of hdy1 was connected with depressed pigment content and photosynthetic rate. Genetic analysis results showed that the hdy1 mutant phenotype was caused by a single recessive nuclear gene mutation. Map-based cloning revealed that OsHDY1 is located on chromosome 3 and encodes an ortholog of the AtFdC2 gene. Complementation and overexpression, transgenic plants exhibited the mutant phenotype including head date, leaf color and the transcription levels of the FdC2 were completely rescued by transformation with OsHDY1. Real-time PCR revealed that the expression product of OsHDY1 was detected in almost all of the organs except root, whereas highest expression levels were observed in seeding new leaves. The lower expression levels of HDY1 and content of iron were detected in hdy1 than WT’s. The FdC2::GFP was detected in the chloroplasts of rice. Real-time PCR results showed that the expression of many photosynthetic electron transfer related genes in hdy1 were higher than WT. Our results suggest that OsFdC2 plays an important role in photosynthetic rate and development of heading date by regulating electron transfer and chlorophyll content in rice. PMID:26598971

  15. Zebrafish pit1 mutants lack three pituitary cell types and develop severe dwarfism.

    PubMed

    Nica, Gabriela; Herzog, Wiebke; Sonntag, Carmen; Hammerschmidt, Matthias

    2004-05-01

    The Pou domain transcription factor Pit-1 is required for lineage determination and cellular commitment processes during mammalian adenohypophysis development. Here we report the cloning and mutational analysis of a pit1 homolog from zebrafish. Compared with mouse, zebrafish pit1 starts to be expressed at a much earlier stage of adenohypophysis development. However, as in the mouse, expression is restricted to a subset of pituitary cell types, excluding proopiomelanocortin (pomc)-expressing cells (corticotropes, melanotropes) and possibly gonadotropes. We could identify two N-ethyl-N-nitrosourea-induced zebrafish pit1 null mutants. Most mutants die during larval stages, whereas survivors develop severe dwarfism. Mutant larvae lack lactotropes, somatotropes, and thyrotropes, although the adenohypophysis is of normal size, without any sign of increased apoptosis rates. Instead, mutant embryos initiate ectopic expression of pomc in pit1-positive cells, leading to an expansion of the Pomc lineage. Similarly, the number of gonadotropes seems increased, as indicated by the expression of gsualpha, a marker for thyrotropes and gonadotropes. In pit1 mutants, the total number of gsualpha-positive cells is normal despite the loss of gsualpha and tshbeta coexpressing cells. Together, these data suggest a transfating of the Pit1 lineage to the Pomc and possibly the gonadotroph lineages in the mutant, and a pomc- and gonadotropin-repressive role of Pit1 during normal zebrafish development. This is different from mouse, for which a repressive role of Pit-1 has only been reported for the gonadotropin Lhbeta, but not for Pomc. In sum, our data point to both conserved and class-specific aspects of Pit1 function during pituitary development in different vertebrate species.

  16. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals

    PubMed Central

    Fagard, Mathilde; Boutet, Stéphanie; Morel, Jean-Benoit; Bellini, Catherine; Vaucheret, Hervé

    2000-01-01

    Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants. PMID:11016954

  17. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals.

    PubMed

    Fagard, M; Boutet, S; Morel, J B; Bellini, C; Vaucheret, H

    2000-10-10

    Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants.

  18. Lgl1 Is Required for Olfaction and Development of Olfactory Bulb in Mice.

    PubMed

    Li, Zhenzu; Zhang, Tingting; Lin, Zhuchun; Hou, Congzhe; Zhang, Jian; Men, Yuqin; Li, Huashun; Gao, Jiangang

    2016-01-01

    Lethal giant larvae 1 (Lgl1) was initially identified as a tumor suppressor in Drosophila and functioned as a key regulator of epithelial polarity and asymmetric cell division. In this study, we generated Lgl1 conditional knockout mice mediated by Pax2-Cre, which is expressed in olfactory bulb (OB). Next, we examined the effects of Lgl1 loss in the OB. First, we determined the expression patterns of Lgl1 in the neurogenic regions of the embryonic dorsal region of the LGE (dLGE) and postnatal OB. Furthermore, the Lgl1 conditional mutants exhibited abnormal morphological characteristics of the OB. Our behavioral analysis exhibited greatly impaired olfaction in Lgl1 mutant mice. To elucidate the possible mechanisms of impaired olfaction in Lgl1 mutant mice, we investigated the development of the OB. Interestingly, reduced thickness of the MCL and decreased density of mitral cells (MCs) were observed in Lgl1 mutant mice. Additionally, we observed a dramatic loss in SP8+ interneurons (e.g. calretinin and GABAergic/non-dopaminergic interneurons) in the GL of the OB. Our results demonstrate that Lgl1 is required for the development of the OB and the deletion of Lgl1 results in impaired olfaction in mice.

  19. Lgl1 Is Required for Olfaction and Development of Olfactory Bulb in Mice

    PubMed Central

    Li, Zhenzu; Zhang, Tingting; Lin, Zhuchun; Hou, Congzhe; Zhang, Jian; Men, Yuqin; Li, Huashun

    2016-01-01

    Lethal giant larvae 1 (Lgl1) was initially identified as a tumor suppressor in Drosophila and functioned as a key regulator of epithelial polarity and asymmetric cell division. In this study, we generated Lgl1 conditional knockout mice mediated by Pax2-Cre, which is expressed in olfactory bulb (OB). Next, we examined the effects of Lgl1 loss in the OB. First, we determined the expression patterns of Lgl1 in the neurogenic regions of the embryonic dorsal region of the LGE (dLGE) and postnatal OB. Furthermore, the Lgl1 conditional mutants exhibited abnormal morphological characteristics of the OB. Our behavioral analysis exhibited greatly impaired olfaction in Lgl1 mutant mice. To elucidate the possible mechanisms of impaired olfaction in Lgl1 mutant mice, we investigated the development of the OB. Interestingly, reduced thickness of the MCL and decreased density of mitral cells (MCs) were observed in Lgl1 mutant mice. Additionally, we observed a dramatic loss in SP8+ interneurons (e.g. calretinin and GABAergic/non-dopaminergic interneurons) in the GL of the OB. Our results demonstrate that Lgl1 is required for the development of the OB and the deletion of Lgl1 results in impaired olfaction in mice. PMID:27603780

  20. Reduced expression of the global regulator protein CsrA in Legionella pneumophila affects virulence-associated regulators and growth in Acanthamoeba castellanii.

    PubMed

    Forsbach-Birk, Vera; McNealy, Tamara; Shi, Chunwei; Lynch, Damien; Marre, Reinhard

    2004-07-01

    Legionella bacteria have a developmental cycle in which they go from existing in the aquatic environment to replicating inside eukaryotic host cells. The adaptation to the new environment requires an efficient regulatory system. Overexpression of CsrA, a global regulatory protein found in a variety of gram-negative bacteria has been shown to suppress virulence-associated traits in Legionella pneumophila. Since evidence resulting only from overproduction may not be sufficient to validate the role of a regulatory protein, a csrA mutant strain, CsrA(-), with a drastically reduced production of CsrA, was created. Using RNA slot blots and Western blotting it was shown that fliA and flaA, genes which contribute to flagellation, were expressed early in the mutant. Additionally, in CsrA(-) the levels of the stationary-phase sigma factor, RpoS, and a recently described regulator of virulence traits, LetE, were increased. Growth curves of CsrA(-) bacteria were delayed with pigment production occurring at the same OD578 but at reduced levels in the mutant. Replication ability of the CsrA(-) mutant in amoebae was also affected. Based on these results, we could show that CsrA is involved in the regulation of the bacterial switch from the replicative to the transmissible form.

  1. ClpC regulates the fate of a sporulation initiation sigma factor, sigmaH protein, in Bacillus subtilis at elevated temperatures.

    PubMed

    Nanamiya, H; Ohashi, Y; Asai, K; Moriya, S; Ogasawara, N; Fujita, M; Sadaie, Y; Kawamura, F

    1998-07-01

    Using a strain carrying a clpC-bgaB transcriptional fusion at the amyE locus, we found that the expression of a clpC operon was induced at the end of exponential growth in a sigmaB-independent manner and ceased around T3.5 in the wild type but not in a spo0H mutant. This suggests that some gene product(s) whose expression is dependent on sigmaH function is required for the turn-off of clpC transcription during an early stage of sporulation. A clpC deletion mutant showed a temperature-sensitive sporulation phenotype and exhibited an abnormally large accumulation of sigmaH in the cell at 45 degrees C after T2, at which time the sigmaH level in the wild type had begun to decrease. These results, together with the fact that spo0H transcription in the clpC deletion mutant was similar to that of the wild type, suggested that ClpC may be responsible for the degradation of sigmaH after the accomplishment of its role in sporulation. Moreover, as expected from these results, overproduction of Spo0A was also observed after the initiation of sporulation in the clpC deletion mutant at 45 degrees C.

  2. Functional characterization of type-B response regulators in the Arabidopsis cytokinin response.

    PubMed

    Hill, Kristine; Mathews, Dennis E; Kim, Hyo Jung; Street, Ian H; Wildes, Sarah L; Chiang, Yi-Hsuan; Mason, Michael G; Alonso, Jose M; Ecker, Joseph R; Kieber, Joseph J; Schaller, G Eric

    2013-05-01

    Cytokinins play critical roles in plant growth and development, with the transcriptional response to cytokinin being mediated by the type-B response regulators. In Arabidopsis (Arabidopsis thaliana), type-B response regulators (ARABIDOPSIS RESPONSE REGULATORS [ARRs]) form three subfamilies based on phylogenic analysis, with subfamily 1 having seven members and subfamilies 2 and 3 each having two members. Cytokinin responses are predominantly mediated by subfamily 1 members, with cytokinin-mediated effects on root growth and root meristem size correlating with type-B ARR expression levels. To determine which type-B ARRs can functionally substitute for the subfamily 1 members ARR1 or ARR12, we expressed different type-B ARRs from the ARR1 promoter and assayed their ability to rescue arr1 arr12 double mutant phenotypes. ARR1, as well as a subset of other subfamily 1 type-B ARRs, restore the cytokinin sensitivity to arr1 arr12. Expression of ARR10 from the ARR1 promoter results in cytokinin hypersensitivity and enhances shoot regeneration from callus tissue, correlating with enhanced stability of the ARR10 protein compared with the ARR1 protein. Examination of transfer DNA insertion mutants in subfamilies 2 and 3 revealed little effect on several well-characterized cytokinin responses. However, a member of subfamily 2, ARR21, restores cytokinin sensitivity to arr1 arr12 roots when expressed from the ARR1 promoter, indicating functional conservation of this divergent family member. Our results indicate that the type-B ARRs have diverged in function, such that some, but not all, can complement the arr1 arr12 mutant. In addition, our results indicate that type-B ARR expression profiles in the plant, along with posttranscriptional regulation, play significant roles in modulating their contribution to cytokinin signaling.

  3. Characterization and Complementation of a Chlorophyll-Less Dominant Mutant GL1 in Lagerstroemia indica.

    PubMed

    Wang, Shu'an; Wang, Peng; Gao, Lulu; Yang, Rutong; Li, Linfang; Zhang, Enliang; Wang, Qing; Li, Ya; Yin, Zengfang

    2017-05-01

    Crape myrtle (Lagerstroemia indica) is a woody ornamental plant popularly grown because of its long-lasting, midsummer blooms and beautiful colors. The GL1 dominant mutant is the first chlorophyll-less mutant identified in crape myrtle. It was obtained from a natural yellow leaf bud mutation. We previously revealed that leaf color of the GL1 mutant is affected by light intensity. However, the mechanism of the GL1 mutant on light response remained unclear. The acclimation response of mutant and wild-type (WT) plants was assessed in a time series after transferring from low light (LL) to high light (HL) by analyzing chlorophyll synthesis precursor content, photosynthetic performance, and gene expression. In LL conditions, coproporphyrinogen III (Coprogen III) content had the greatest amount of accumulation in the mutant compared with WT, increasing by 100%. This suggested that the yellow leaf phenotype of the GL1 dominant mutant might be caused by disruption of coproporphyrinogen III oxidase (CPO) biosynthesis. Furthermore, the candidate gene, oxygen-independent CPO (HEMN), might only affect expression of upstream genes involved in chlorophyll metabolism in the mutant. Moreover, two genes, photosystem II (PSII) 10 kDa protein (psbR) and chlorophyll a/b binding protein gene (CAB1), had decreased mRNA levels in the GL1 mutant within the first 96 h following LL/HL transfer compared with the WT. Hierarchical clustering revealed that these two genes shared a similar expression trend as the oxygen-dependent CPO (HEMF). These findings provide evidence that GL1 is highly coordinated with PSII stability and chloroplast biogenesis.

  4. A Transformation-Defective Polyomavirus Middle T Antigen with a Novel Defect in PI3 Kinase Signaling.

    PubMed

    Denis, Deborah; Rouleau, Cecile; Schaffhausen, Brian S

    2017-01-15

    Middle T antigen (MT), the principal oncoprotein of murine polyomavirus, transforms by association with cellular proteins. Protein phosphatase 2A (PP2A), YAP, Src family tyrosine kinases, Shc, phosphatidylinositol 3-kinase (PI3K), and phospholipase C-γ1 (PLCγ1) have all been implicated in MT transformation. Mutant dl1015, with deletion of residues 338 to 347 in the C-terminal region, has been an enigma, because the basis for its transformation defect has not been apparent. This work probes the dl1015 region of MT. Because the region is proline rich, the hypothesis that it targets Src homology domain 3 (SH3) domains was tested, but mutation of the putative SH3 binding motif did not affect transformation. During this work, two point mutants, W348R and E349K, were identified as transformation defective. Extensive analysis of the E349K mutant is described here. Similar to wild-type MT, the E349K mutant associates with PP2A, YAP, tyrosine kinases, Shc, PI3 kinase, and PLCγ1. The E349K mutant was examined to determine the mechanism for its transformation defect. Assays of cell localization and membrane targeting showed no obvious difference in localization. Src association was normal as assayed by in vitro kinase and MT phosphopeptide mapping. Shc activation was confirmed by its tyrosine phosphorylation. Association of type 1 PI3K with MT was demonstrated by coimmunoprecipitation, showing both PI3K subunits and in vitro activity. Nonetheless, expression of the mutants failed to lead to the activation of two known downstream targets of PI3K, Akt and Rac-1. Strikingly, despite normal association of the E349K mutant with PI3K, cells expressing the mutant failed to elevate phosphatidylinositol (3,4,5)-trisphosphate (PIP3) in mutant-expressing cells. These results indicate a novel unsuspected aspect to PI3K control. The gene coding for middle T antigen (MT) is the murine polyomavirus oncogene most responsible for tumor formation. Its study has a history of uncovering novel aspects of mammalian cell regulation. The importance of PI3K activity and tyrosine phosphorylation are two examples of insights coming from MT. This study describes new mutants unable to transform like the wild type that point to novel regulation of PI3K signaling. Previous mutants were defective in PI3K because they failed to bind the enzyme and bring the activity to the membrane. These mutants recruit PI3K activity like the wild type, but fail to elevate the cellular level of PIP3, the product used to signal downstream of PI3K. As a result, they fail to activate either Akt or Rac1, explaining the transformation defect. Copyright © 2017 American Society for Microbiology.

  5. Improved α-amylase production by Aspergillus oryzae after a double deletion of genes involved in carbon catabolite repression.

    PubMed

    Ichinose, Sakurako; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

    2014-01-01

    In filamentous fungi, the expression of secretory glycoside hydrolase encoding genes, such as those for amylases, cellulases, and xylanases, is generally repressed in the presence of glucose. CreA and CreB have been observed to be regulating factors for carbon catabolite repression. In this study, we generated single and double deletion creA and/or creB mutants in Aspergillus oryzae. The α-amylase activities of each strain were compared under various culture conditions. For the wild-type strain, mRNA levels of α-amylase were markedly decreased in the later stage of submerged culture under inducing conditions, whereas this reduced expression was not observed for single creA and double creA/creB deletion mutants. In addition, α-amylase activity of the wild-type strain was reduced in submerged culture containing high concentrations of inducing sugars, whereas all constructed mutants showed higher α-amylase activities. In particular, the α-amylase activity of the double deletion mutant in a medium containing 5% starch was >10-fold higher than that of the wild-type strain under the same culture conditions. In solid-state cultures using wheat bran as a substrate, the α-amylase activities of single creA and double deletion mutants were >2-fold higher than that of the wild-type strain. These results suggested that deleting both creA and creB resulted in dramatic improvements in the production of secretory glycoside hydrolases in filamentous fungi.

  6. A De Novo Floral Transcriptome Reveals Clues into Phalaenopsis Orchid Flower Development

    PubMed Central

    Huang, Jian-Zhi; Lin, Chih-Peng; Cheng, Ting-Chi; Chang, Bill Chia-Han; Cheng, Shu-Yu; Chen, Yi-Wen; Lee, Chen-Yu; Chin, Shih-Wen; Chen, Fure-Chyi

    2015-01-01

    Phalaenopsis has a zygomorphic floral structure, including three outer tepals, two lateral inner tepals and a highly modified inner median tepal called labellum or lip; however, the regulation of its organ development remains unelucidated. We generated RNA-seq reads with the Illumina platform for floral organs of the Phalaenopsis wild-type and peloric mutant with a lip-like petal. A total of 43,552 contigs were obtained after de novo assembly. We used differentially expressed gene profiling to compare the transcriptional changes in floral organs for both the wild-type and peloric mutant. Pair-wise comparison of sepals, petals and labellum between peloric mutant and its wild-type revealed 1,838, 758 and 1,147 contigs, respectively, with significant differential expression. PhAGL6a (CUFF.17763), PhAGL6b (CUFF.17763.1), PhMADS1 (CUFF.36625.1), PhMADS4 (CUFF.25909) and PhMADS5 (CUFF.39479.1) were significantly upregulated in the lip-like petal of the peloric mutant. We used real-time PCR analysis of lip-like petals, lip-like sepals and the big lip of peloric mutants to confirm the five genes’ expression patterns. PhAGL6a, PhAGL6b and PhMADS4 were strongly expressed in the labellum and significantly upregulated in lip-like petals and lip-like sepals of peloric-mutant flowers. In addition, PhAGL6b was significantly downregulated in the labellum of the big lip mutant, with no change in expression of PhAGL6a. We provide a comprehensive transcript profile and functional analysis of Phalaenopsis floral organs. PhAGL6a PhAGL6b, and PhMADS4 might play crucial roles in the development of the labellum in Phalaenopsis. Our study provides new insights into how the orchid labellum differs and why the petal or sepal converts to a labellum in Phalaenopsis floral mutants. PMID:25970572

  7. Functions of transmembrane domain 3 of human melanocortin-4 receptor.

    PubMed

    Mo, Xiu-Lei; Yang, Rui; Tao, Ya-Xiong

    2012-12-01

    The melanocortin-4 receptor (MC4R) is a G protein-coupled receptor critical for maintaining energy homeostasis. Transmembrane domain 3 (TM3) of MC4R contains residues that were suggested to be essential in ligand binding and signaling. Several MC4R mutations in TM3 are associated with human obesity. To gain a better understanding of the functions of TM3, we analyzed the functions of 26 residues in TM3 using alanine-scanning mutagenesis. We showed that all mutants had normal cell-surface expression. Four mutants were defective in ligand binding and signaling and six mutants had normal ligand binding but impaired cAMP production. L140A had increased basal cAMP level. To further characterize the function of L140, we generated 17 additional L140 mutants. Fifteen L140 mutants had significantly decreased cell-surface expression, with L140R and L140V expressed normally. Ten L140 mutants had increased basal cAMP activities. Four L140 mutants were defective in ligand-stimulated cAMP generation. Interestingly, with the ERK1/2 pathway, we showed that nine constitutively active mutants had similar levels of basal pERK1/2 as that of WT, and two signaling defective mutants had similar levels of pERK1/2 as that of WT upon agonist stimulation, different from their cAMP signaling properties, suggesting biased signaling in these mutant receptors. In summary, we identified 13 residues in TM3 that were essential for ligand binding and/or signaling. Moreover, L140 was critical for locking MC4R in inactive conformation and several mutants showed biased signaling in cAMP and ERK1/2 signaling pathways.

  8. Lack of promoter IV-driven BDNF transcription results in depression-like behavior.

    PubMed

    Sakata, K; Jin, L; Jha, S

    2010-10-01

    Transcription of Bdnf is controlled by multiple promoters, in which promoter IV contributes significantly to activity-dependent Bdnf transcription. We have generated promoter IV mutant mice [brain-derived neurotrophic factor (BDNF)-KIV] in which promoter IV-driven expression of BDNF is selectively disrupted by inserting a green fluorescent protein (GFP)-STOP cassette within the Bdnf exon IV locus. BDNF-KIV animals exhibited depression-like behavior as shown by the tail suspension test (TST), sucrose preference test (SPT) and learned helplessness test (LHT). In addition, BDNF-KIV mice showed reduced activity in the open field test (OFT) and reduced food intake in the novelty-suppressed feeding test (NSFT). The mutant mice did not display anxiety-like behavior in the light and dark box test and elevated plus maze tests. Interestingly, the mutant mice showed defective response inhibition in the passive avoidance test (PAT) even though their learning ability was intact when measured with the active avoidance test (AAT). These results suggest that promoter IV-dependent BDNF expression plays a critical role in the control of mood-related behaviors. This is the first study that directly addressed the effects of endogenous promoter-driven expression of BDNF in depression-like behavior. © 2010 The Authors. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

  9. Restoration of mutant bestrophin-1 expression, localisation and function in a polarised epithelial cell model

    PubMed Central

    Briant, Kit; Streit, Anne-Kathrin; Thomson, Steven; Koay, Yee Hui

    2016-01-01

    ABSTRACT Autosomal recessive bestrophinopathy (ARB) is a retinopathy caused by mutations in the bestrophin-1 protein, which is thought to function as a Ca2+-gated Cl− channel in the basolateral surface of the retinal pigment epithelium (RPE). Using a stably transfected polarised epithelial cell model, we show that four ARB mutant bestrophin-1 proteins were mislocalised and subjected to proteasomal degradation. In contrast to the wild-type bestrophin-1, each of the four mutant proteins also failed to conduct Cl− ions in transiently transfected cells as determined by whole-cell patch clamp. We demonstrate that a combination of two clinically approved drugs, bortezomib and 4-phenylbutyrate (4PBA), successfully restored the expression and localisation of all four ARB mutant bestrophin-1 proteins. Importantly, the Cl− conductance function of each of the mutant bestrophin-1 proteins was fully restored to that of wild-type bestrophin-1 by treatment of cells with 4PBA alone. The functional rescue achieved with 4PBA is significant because it suggests that this drug, which is already approved for long-term use in infants and adults, might represent a promising therapy for the treatment of ARB and other bestrophinopathies resulting from missense mutations in BEST1. PMID:27519691

  10. Restoration of mutant bestrophin-1 expression, localisation and function in a polarised epithelial cell model.

    PubMed

    Uggenti, Carolina; Briant, Kit; Streit, Anne-Kathrin; Thomson, Steven; Koay, Yee Hui; Baines, Richard A; Swanton, Eileithyia; Manson, Forbes D

    2016-11-01

    Autosomal recessive bestrophinopathy (ARB) is a retinopathy caused by mutations in the bestrophin-1 protein, which is thought to function as a Ca 2+ -gated Cl - channel in the basolateral surface of the retinal pigment epithelium (RPE). Using a stably transfected polarised epithelial cell model, we show that four ARB mutant bestrophin-1 proteins were mislocalised and subjected to proteasomal degradation. In contrast to the wild-type bestrophin-1, each of the four mutant proteins also failed to conduct Cl - ions in transiently transfected cells as determined by whole-cell patch clamp. We demonstrate that a combination of two clinically approved drugs, bortezomib and 4-phenylbutyrate (4PBA), successfully restored the expression and localisation of all four ARB mutant bestrophin-1 proteins. Importantly, the Cl - conductance function of each of the mutant bestrophin-1 proteins was fully restored to that of wild-type bestrophin-1 by treatment of cells with 4PBA alone. The functional rescue achieved with 4PBA is significant because it suggests that this drug, which is already approved for long-term use in infants and adults, might represent a promising therapy for the treatment of ARB and other bestrophinopathies resulting from missense mutations in BEST1. © 2016. Published by The Company of Biologists Ltd.

  11. Involvement of Penicillium digitatum PdSUT1 in fungicide sensitivity and virulence during citrus fruit infection.

    PubMed

    Ramón-Carbonell, Marta de; Sánchez-Torres, Paloma

    2017-10-01

    A putative sucrose transporter PdSUT1 included in the same clade that Sut1p from Schizosaccharomyces pombe was identified in Penicillium digitatum, the major citrus postharvest pathogen. PdSUT1 gene was characterized using target gene disruption and gene overexpression. The ΔPdSUT1 mutants generated by gene elimination showed reduction in fungal virulence during citrus fruit infection assayed in mature fruit at 20°C. However, the overexpression mutants did not increased disease severity neither in the mutants coming from a high virulent nor from a low virulent P. digitatum progenitor strains. Moreover, fungicide sensitivity was affected in the deletant mutants but not in the overexpression transformants. The expression analysis of several genes involved in fungicide resistance showed an intensification of MFS transporters and a decrease of sterol demethylases transcriptional abundance in the ΔPdSUT1 mutants compare to the parental wild type strain. PdSUT1 appear not to be directly involved in fungicide resistance although can affect the gene expression of fungicide related genes. These results indicate that PdSUT1 contribute to P. digitatum fungal virulence and influence fungicide sensitivity through carbohydrate uptake and MFS transporters gene activation. Copyright © 2017 Elsevier GmbH. All rights reserved.

  12. Enhanced cellulase producing mutants developed from heterokaryotic Aspergillus strain.

    PubMed

    Kaur, Baljit; Oberoi, H S; Chadha, B S

    2014-03-01

    A heterokaryon 28, derived through protoplast fusion between Aspergillus nidulans and Aspergillus tubingensis (Dal8), was subjected cyclic mutagenesis followed by selection on increasing levels of 2-deoxy glucose (2-DG) as selection marker. The derived deregulated cellulase hyper producing mutant '64', when compared to fusant 28, produced 9.83, 7.8, 3.2, 4.2 and 19.74 folds higher endoglucanase, β-glucosidase, cellobiohydrolase, FPase and xylanase, respectively, under shake cultures. The sequence analysis of PCR amplified β-glucosidase gene from wild and mutant showed nucleotide deletion/substitution. The mutants showed highly catalytic efficient β-glucosidase as evident from low Km and high Vmax values. The expression profiling through zymogram analysis also indicated towards over-expression of cellulases. The up/down regulated expressed proteins observed through SDS-PAGE were identified by Peptide mass fingerprinting The cellulase produced by mutants in conjunction with cellulase free xylanase derived from Thermomyces lanuginosus was used for efficient utilization of alkali treated rice straw for obtaining xylo-oligosaccharides and ethanol. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Partial trypsin digestion as an indicator of mis-folding of mutant alanine:glyoxylate aminotransferase and chaperone effects of specific ligands. Study of a spectrum of missense mutants.

    PubMed

    Coulter-Mackie, M B; Lian, Q

    2008-07-01

    Alanine:glyoxylate aminotransferase (AGT) is a liver peroxisomal enzyme whose deficiency results in primary hyperoxaluria type 1 (PH1). More than 75 PH1 mutations are now documented in the AGT gene (AGXT), of which about 50% are missense. We have previously demonstrated that many such mutants expressed by transcription/translation are subject to generalized degradation by the proteasome and a specific limited trimming by an endogenous ATP-independent protease activity. Here, we report the results of partial digestion using trypsin as a mimic for the endogenous non-proteasomal protease and the use of N-terminal protein sequencing to determine the sensitive site. Partial trypsin digestion also provided an indicator of proper folding of the mutant enzyme. For selected mutations the sensitivity to trypsin could be ameliorated by addition of pyridoxal phosphate or aminooxy acetic acid as specific pharmacological chaperones.

  14. [Isolation and function of genes regulating aphB expression in Vibrio cholerae].

    PubMed

    Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

    2012-02-04

    We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

  15. Evidence for transceptor function of cellodextrin transporters in Neurospora crassa.

    PubMed

    Znameroski, Elizabeth A; Li, Xin; Tsai, Jordan C; Galazka, Jonathan M; Glass, N Louise; Cate, Jamie H D

    2014-01-31

    Neurospora crassa colonizes burnt grasslands and metabolizes both cellulose and hemicellulose from plant cell walls. When switched from a favored carbon source to cellulose, N. crassa dramatically up-regulates expression and secretion of genes encoding lignocellulolytic enzymes. However, the means by which N. crassa and other filamentous fungi sense the presence of cellulose in the environment remains unclear. Previously, we have shown that a N. crassa mutant carrying deletions of three β-glucosidase enzymes (Δ3βG) lacks β-glucosidase activity, but efficiently induces cellulase gene expression and cellulolytic activity in the presence of cellobiose as the sole carbon source. These observations indicate that cellobiose, or a modified version of cellobiose, functions as an inducer of lignocellulolytic gene expression and activity in N. crassa. Here, we show that in N. crassa, two cellodextrin transporters, CDT-1 and CDT-2, contribute to cellulose sensing. A N. crassa mutant carrying deletions for both transporters is unable to induce cellulase gene expression in response to crystalline cellulose. Furthermore, a mutant lacking genes encoding both the β-glucosidase enzymes and cellodextrin transporters (Δ3βGΔ2T) does not induce cellulase gene expression in response to cellobiose. Point mutations that severely reduce cellobiose transport by either CDT-1 or CDT-2 when expressed individually do not greatly impact cellobiose induction of cellulase gene expression. These data suggest that the N. crassa cellodextrin transporters act as "transceptors" with dual functions - cellodextrin transport and receptor signaling that results in downstream activation of cellulolytic gene expression. Similar mechanisms of transceptor activity likely occur in related ascomycetes used for industrial cellulase production.

  16. Phylogenetic distribution and expression of a penicillin-binding protein homologue, Ear and its significance in virulence of Staphylococcus aureus.

    PubMed

    Singh, Vineet K; Ring, Robert P; Aswani, Vijay; Stemper, Mary E; Kislow, Jennifer; Ye, Zhan; Shukla, Sanjay K

    2017-12-01

    Staphylococcus aureus is an opportunistic human pathogen that can cause serious infections in humans. A plethora of known and putative virulence factors are produced by staphylococci that collectively orchestrate pathogenesis. Ear protein (Escherichia coli ampicillin resistance) in S. aureus is an exoprotein in COL strain, predicted to be a superantigen, and speculated to play roles in antibiotic resistance and virulence. The goal of this study was to determine if expression of ear is modulated by single nucleotide polymorphisms in its promoter and coding sequences and whether this gene plays roles in antibiotic resistance and virulence. Promoter, coding sequences and expression of the ear gene in clinical and carriage S. aureus strains with distinct genetic backgrounds were analysed. The JE2 strain and its isogenic ear mutant were used in a systemic infection mouse model to determine the competiveness of the ear mutant.Results/Key findings. The ear gene showed a variable expression, with USA300FPR3757 showing a high-level expression compared to many of the other strains tested including some showing negligible expression. Higher expression was associated with agr type 1 but not correlated with phylogenetic relatedness of the ear gene based upon single nucleotide polymorphisms in the promoter or coding regions suggesting a complex regulation. An isogenic JE2 (USA300 background) ear mutant showed no significant difference in its growth, antibiotic susceptibility or virulence in a mouse model. Our data suggests that despite being highly expressed in a USA300 genetic background, Ear is not a significant contributor to virulence in that strain.

  17. Functional assessment of the Medicago truncatula NIP/LATD protein demonstrates that it is a high-affinity nitrate transporter.

    PubMed

    Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D Janine; Dickstein, Rebecca

    2012-10-01

    The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function.

  18. Functional Assessment of the Medicago truncatula NIP/LATD Protein Demonstrates That It Is a High-Affinity Nitrate Transporter1[W][OA

    PubMed Central

    Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O. Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D. Janine; Dickstein, Rebecca

    2012-01-01

    The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function. PMID:22858636

  19. KRAS-mutation status dependent effect of zoledronic acid in human non-small cell cancer preclinical models

    PubMed Central

    Kenessey, István; Kói, Krisztina; Horváth, Orsolya; Cserepes, Mihály; Molnár, Dávid; Izsák, Vera; Dobos, Judit; Hegedűs, Balázs

    2016-01-01

    Background In non-small cell lung cancer (NSCLC) KRAS-mutant status is a negative prognostic and predictive factor. Nitrogen-containing bisphosphonates inhibit prenylation of small G-proteins (e.g. Ras, Rac, Rho) and thus may affect proliferation and migration. In our preclinical work, we investigated the effect of an aminobisphosphonate compound (zoledronic acid) on mutant and wild type KRAS-expressing human NSCLC cell lines. Results We confirmed that zoledronic acid was unable to inhibit the prenylation of mutant K-Ras unlike in the case of wild type K-Ras. In case of in vitro proliferation, the KRAS-mutant human NSCLC cell lines showed resistance to zoledronic acid wild-type KRAS-cells proved to be sensitive. Combinatory application of zoledronic acid enhanced the cytostatic effect of cisplatin. Zoledronic acid did not induce significant apoptosis. In xenograft model, zoledronic acid significantly reduced the weight of wild type KRAS-EGFR-expressing xenograft tumor by decreasing the proliferative capacity. Futhermore, zoledronic acid induced VEGF expression and improved in vivo tumor vascularization. Materials and methods Membrane association of K-Ras was examined by Western-blot. In vitro cell viability, apoptotic cell death and migration were measured in NSCLC lines with different molecular background. The in vivo effect of zoledronic acid was investigated in a SCID mouse subcutaneous xenograft model. Conclusions The in vitro and in vivo inhibitory effect of zoledronic acid was based on the blockade of cell cycle in wild type KRAS-expressing human NSCLC cells. The zoledronic acid induced vascularization supported in vivo cytostatic effect. Our preclinical investigation suggests that patients with wild type KRAS-expressing NSCLC could potentially benefit from aminobisphosphonate therapy. PMID:27780929

  20. Two closely related members of Arabidopsis 13-lipoxygenases (13-LOXs), LOX3 and LOX4, reveal distinct functions in response to plant-parasitic nematode infection.

    PubMed

    Ozalvo, Rachel; Cabrera, Javier; Escobar, Carolina; Christensen, Shawn A; Borrego, Eli J; Kolomiets, Michael V; Castresana, Carmen; Iberkleid, Ionit; Brown Horowitz, Sigal

    2014-05-01

    The responses of two closely related members of Arabidopsis 13-lipoxygenases (13-LOXs), LOX3 and LOX4, to infection by the sedentary nematodes root-knot nematode (Meloidogyne javanica) and cyst nematode (Heterodera schachtii) were analysed in transgenic Arabidopsis seedlings. The tissue localization of LOX3 and LOX4 gene expression using β-glucuronidase (GUS) reporter gene constructs showed local induction of LOX3 expression when second-stage juveniles reached the vascular bundle and during the early stages of plant-nematode interaction through gall and syncytia formation. Thin sections of nematode-infested knots indicated LOX3 expression in mature giant cells, and high expression in neighbouring cells and those surrounding the female body. LOX4 promoter was also activated by nematode infection, although the GUS signal weakened as infection and disease progressed. Homozygous insertion mutants lacking LOX3 were less susceptible than wild-type plants to root-knot nematode infection, as reflected by a decrease in female counts. Conversely, deficiency in LOX4 function led to a marked increase in females and egg mass number and in the female to male ratio of M. javanica and H. schachtii, respectively. The susceptibility of lox4 mutants was accompanied by increased expression of allene oxide synthase, allene oxide cyclase and ethylene-responsive transcription factor 4, and the accumulation of jasmonic acid, measured in the roots of lox4 mutants. This response was not found in lox3 mutants. Taken together, our results reveal that LOX4 and LOX3 interfere differentially with distinct metabolic and signalling pathways, and that LOX4 plays a major role in controlling plant defence against nematode infection. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  1. Multiple Genes Repress Motility in Uropathogenic Escherichia coli Constitutively Expressing Type 1 Fimbriae▿ †

    PubMed Central

    Simms, Amy N.; Mobley, Harry L. T.

    2008-01-01

    Two surface organelles of uropathogenic Escherichia coli (UPEC), flagella and type 1 fimbriae, are critical for colonization of the urinary tract but mediate opposite actions. Flagella propel bacteria through urine and along mucus layers, while type 1 fimbriae allow bacteria to adhere to specific receptors present on uroepithelial cells. Constitutive expression of type 1 fimbriae leads to repression of motility and chemotaxis in UPEC strain CFT073, suggesting that UPEC may coordinately regulate motility and adherence. To identify genes involved in this regulation of motility by type 1 fimbriae, transposon mutagenesis was performed on a phase-locked type 1 fimbrial ON variant of strain CFT073 (CFT073 fim L-ON), followed by a screen for restoration of motility in soft agar. Functions of the genes identified included attachment, metabolism, transport, DNA mismatch repair, and transcriptional regulation, and a number of genes had hypothetical function. Isogenic deletion mutants of these genes were also constructed in CFT073 fim L-ON. Motility was partially restored in six of these mutants, including complementable mutations in four genes encoding known transcriptional regulators, lrhA, lrp, slyA, and papX; a mismatch repair gene, mutS; and one hypothetical gene, ydiV. Type 1 fimbrial expression in these mutants was unaltered, and the majority of these mutants expressed larger amounts of flagellin than the fim L-ON parental strain. Our results indicate that repression of motility in CFT073 fim L-ON is not solely due to the constitutive expression of type 1 fimbriae on the surfaces of the bacteria and that multiple genes may contribute to this repression. PMID:18359812

  2. Parvoviral Left-End Hairpin Ears Are Essential during Infection for Establishing a Functional Intranuclear Transcription Template and for Efficient Progeny Genome Encapsidation

    PubMed Central

    Li, Lei; Cotmore, Susan F.

    2013-01-01

    The 121-nucleotide left-end telomere of Minute Virus of Mice (MVM) can be folded into a Y-shaped hairpin with short axial ears that are highly conserved within genus Parvovirus. To explore their potential role(s) during infection, we constructed infectious plasmid clones that lacked one or other ear. Although these were nonviable when transfected into A9 cells, excision of the viral genome and DNA amplification appeared normal, and viral transcripts and proteins were expressed, but progeny virion production was minimal, supporting the idea of a potential role for the ears in genome packaging. To circumvent the absence of progeny that confounded further analysis of these mutants, plasmids were transfected into 293T cells both with and without an adenovirus helper construct, generating single bursts of progeny. These virions bound to A9 cells and were internalized but failed to initiate viral transcription, protein expression, or DNA replication. No defects in mutant virion stability or function could be detected in vitro. Significantly, mutant capsid gene expression and DNA replication could be rescued by coinfection with wild-type virions carrying a replication-competent, capsid-gene-replacement vector. To pinpoint where such complementation occurred, prior transfection of plasmids expressing only MVM nonstructural proteins was explored. NS1 alone, but not NS2, rescued transcription and protein expression from both P4 and P38 promoters, whereas NS1 molecules deleted for their C-terminal transactivation domain did not. These results suggest that the mutant virions reach the nucleus, uncoat, and are converted to duplex DNA but require an intact left-end hairpin structure to form the initiating transcription complex. PMID:23903839

  3. Differential roles for the C-terminal hexapeptide domains of NS2 splice variants during MVM infection of murine cells.

    PubMed

    Ruiz, Zandra; D'Abramo, Anthony; Tattersall, Peter

    2006-06-05

    The MVM NS2 proteins are required for viral replication in cells of its normal murine host, but are dispensable in transformed human 324K cells. Alternate splicing at the minor intron controls synthesis of three forms of this protein, which differ in their C-terminal hexapeptides and in their relative abundance, with NS2P and NS2Y, the predominant isoforms, being expressed at a 5:1 ratio. Mutant genomes were constructed with premature termination codons in the C-terminal exons of either NS2P or NS2Y, which resulted in their failure to accumulate in vivo. To modulate their expression levels, we also introduced a mutation at the putative splice branch point of the large intron, dubbed NS2(lo), that reduced total NS2 expression in murine A9 cells such that NS2P accumulated to approximately half the level normally seen for NS2Y. All mutants replicated productively in human 324K cells. In A9 cells, NS2Y(-) mutants replicated like wildtype, and the NS2(lo) mutants expressed NS1 and replicated duplex viral DNA like wildtype, although their progeny single-strand DNA synthesis was reduced. However, while NS2P(-) and NS2-null viruses initiated infection efficiently in A9 cells, they gave diminished NS1 levels, and viral macromolecular synthesis appeared to become paralyzed shortly after the onset of viral duplex DNA amplification, such that no progeny single-strand DNA could be detected. Thus, the NS2P isoform, even when expressed at a level lower than that of NS2Y, performs a critical role in infection of A9 cells that cannot be accomplished by the NS2Y isoform alone.

  4. Importance of the residue Asp 290 on chain length selectivity and catalytic efficiency of recombinant Staphylococcus simulans lipase expressed in E. coli.

    PubMed

    Sayari, Adel; Mosbah, Habib; Gargouri, Youssef

    2007-05-01

    In addition to their physiological importance, microbial lipases, like staphylococcal ones, are of considerable commercial interest for biotechnological applications such as detergents, food production, and pharmaceuticals and industrial synthesis of fine chemicals. The gene encoding the extracellular lipase of Staphylococcus simulans (SSL) was subcloned in the pET-14b expression vector and expressed in Esherichia coli BL21 (DE3). The wild-type SSL was expressed as amino terminal His6-tagged recombinant protein. One-step purification of the recombinant lipase was achieved with nickel metal affinity column. The purified His-tagged SSL (His6-SSL) is able to hydrolyse triacylglycerols without chain length selectivity. The major differences among lipases are reflected in their chemical specificity in the hydrolysis of peculiar ester bonds, and their respective capacity to hydrolyse substrates having different physico-chemical properties. It has been proposed, using homology alignment, that the region around the residue 290 of Staphylococcus hyicus lipase could be involved in the selection of the substrate. To evaluate the importance of this environment, the residue Asp290 of Staphylococcus simulans lipase was mutated to Ala using site-directed mutagenesis. The mutant expression plasmid was also overexpressed in Esherichia coli and purified with a nickel metal affinity column. The substitution of Asp290 by Ala was accompanied by a significant shift of the acyl-chain length specificity of the mutant towards short chain fatty acid esters. Kinetic studies of wild-type SSL and its mutant D290A were carried out, and show essentially that the catalytic efficiency (k cat /K M ) of the mutant was affected. Our results confirmed that Asp290 is important for the chain length selectivity and catalytic efficiency of Staphylococcus simulans lipase.

  5. Zic deficiency in the cortical marginal zone and meninges results in cortical lamination defects resembling those in type II lissencephaly.

    PubMed

    Inoue, Takashi; Ogawa, Masaharu; Mikoshiba, Katsuhiko; Aruga, Jun

    2008-04-30

    The formation of the highly organized cortical structure depends on the production and correct placement of the appropriate number and types of neurons. The Zic family of zinc-finger transcription factors plays essential roles in regulating the proliferation and differentiation of neuronal progenitors in the medial forebrain and the cerebellum. Examination of the expression of Zic genes demonstrated that Zic1, Zic2, and Zic3 were expressed by the progenitor cells in the septum and cortical hem, the sites of generation of the Cajal-Retzius (CR) cells. Immunohistochemical studies have revealed that Zic proteins were abundantly expressed in the meningeal cells and that the majority of the CR cells distributed in the medial and dorsal cortex also expressed Zic proteins in the mid-late embryonic and postnatal cortical marginal zones. During embryonic cortical development, Zic1/Zic3 double-mutant and hypomorphic Zic2 mutant mice showed a reduction in the number of CR cells in the rostral cortex, whereas the cell number remained unaffected in the caudal cortex. These mutants also showed mislocalization of the CR cells and cortical lamination defects, resembling the changes noted in type II (cobblestone) lissencephaly, throughout the brain. In the Zic1/3 mutant, reduced proliferation of the meningeal cells was observed before the thinner and disrupted organization of the pial basement membrane (BM) with reduced expression of the BM components and the meningeal cell-derived secretory factor. These defects correlated with the changes in the end feet morphology of the radial glial cells. These findings indicate that the Zic genes play critical roles in cortical development through regulating the proliferation of meningeal cells and the pial BM assembly.

  6. Inhibition of Excessive Monoamine Oxidase A/B Activity Protects Against Stress-induced Neuronal Death in Huntington Disease.

    PubMed

    Ooi, Jolene; Hayden, Michael R; Pouladi, Mahmoud A

    2015-12-01

    Monoamine oxidases (MAO) are important components of the homeostatic machinery that maintains the levels of monoamine neurotransmitters, including dopamine, in balance. Given the imbalance in dopamine levels observed in Huntington disease (HD), the aim of this study was to examine MAO activity in a mouse striatal cell model of HD and in human neural cells differentiated from control and HD patient-derived induced pluripotent stem cell (hiPSC) lines. We show that mouse striatal neural cells expressing mutant huntingtin (HTT) exhibit increased MAO expression and activity. We demonstrate using luciferase promoter assays that the increased MAO expression reflects enhanced epigenetic activation in striatal neural cells expressing mutant HTT. Using cellular stress paradigms, we further demonstrate that the increase in MAO activity in mutant striatal neural cells is accompanied by enhanced susceptibility to oxidative stress and impaired viability. Treatment of mutant striatal neural cells with MAO inhibitors ameliorated oxidative stress and improved cellular viability. Finally, we demonstrate that human HD neural cells exhibit increased MAO-A and MAO-B expression and activity. Altogether, this study demonstrates abnormal MAO expression and activity and suggests a potential use for MAO inhibitors in HD.

  7. The ventralizing activity of Radar, a maternally expressed bone morphogenetic protein, reveals complex bone morphogenetic protein interactions controlling dorso-ventral patterning in zebrafish.

    PubMed

    Goutel, C; Kishimoto, Y; Schulte-Merker, S; Rosa, F

    2000-12-01

    In Xenopus and zebrafish, BMP2, 4 and 7 have been implicated, after the onset of zygotic expression, in inducing and maintaining ventro-lateral cell fate during early development. We provide evidence here that a maternally expressed bone morphogenetic protein (BMP), Radar, may control early ventral specification in zebrafish. We show that Radar ventralizes zebrafish embryos and induces the early expression of bmp2b and bmp4. The analysis of Radar overexpression in both swirl/bmp2b mutants and embryos expressing truncated BMP receptors shows that Radar-induced ventralization is dependent on functional BMP2/4 pathways, and may initially rely on an Alk6-related signaling pathway. Finally, we show that while radar-injected swirl embryos still exhibit a strongly dorsalized phenotype, the overexpression of Radar into swirl/bmp2b mutant embryos restores ventral marker expression, including bmp4 expression. Our results suggest that a complex regulation of different BMP pathways controls dorso-ventral (DV) patterning from early cleavage stages until somitogenesis.

  8. Novel CLCNKB mutations causing Bartter syndrome affect channel surface expression.

    PubMed

    Keck, Mathilde; Andrini, Olga; Lahuna, Olivier; Burgos, Johanna; Cid, L Pablo; Sepúlveda, Francisco V; L'hoste, Sébastien; Blanchard, Anne; Vargas-Poussou, Rosa; Lourdel, Stéphane; Teulon, Jacques

    2013-09-01

    Mutations in the CLCNKB gene encoding the ClC-Kb Cl(-) channel cause Bartter syndrome, which is a salt-losing renal tubulopathy. Here, we investigate the functional consequences of seven mutations. When expressed in Xenopus laevis oocytes, four mutants carried no current (c.736G>C, p.Gly246Arg; c.1271G>A, p.Gly424Glu; c.1313G>A, p.Arg438His; c.1316T>C, p.Leu439Pro), whereas others displayed a 30%-60% reduction in conductance as compared with wild-type ClC-Kb (c.242T>C, p.Leu81Pro; c.274C>T, p.Arg92Trp; c.1052G>C, p.Arg351Pro). Anion selectivity and sensitivity to external Ca(2+) and H(+), typical of the ClC-Kb channel, were not modified in the partially active mutants. In oocytes, we found that all the mutations reduced surface expression with a profile similar to that observed for currents. In HEK293 cells, the currents in the mutants had similar profiles to those obtained in oocytes, except for p.Leu81Pro, which produced no current. Furthermore, p.Arg92Trp and p.Arg351Pro mutations did not modify the unit-conductance of closely related ClC-K1. Western blot analysis in HEK293 cells showed that ClC-Kb protein abundance was lower for the nonconducting mutants but similar to wild-type for other mutants. Overall, two classes of mutants can be distinguished: nonconducting mutants associated with low total protein expression, and partially conducting mutants with unaltered channel properties and ClC-Kb protein abundance. © 2013 WILEY PERIODICALS, INC.

  9. Functional Rescue of Trafficking-Impaired ABCB4 Mutants by Chemical Chaperones

    PubMed Central

    Gordo-Gilart, Raquel; Andueza, Sara; Hierro, Loreto; Jara, Paloma; Alvarez, Luis

    2016-01-01

    Multidrug resistance protein 3 (MDR3, ABCB4) is a hepatocellular membrane protein that mediates biliary secretion of phosphatidylcholine. Null mutations in ABCB4 gene give rise to severe early-onset cholestatic liver disease. We have previously shown that the disease-associated mutations p.G68R, p.G228R, p.D459H, and p.A934T resulted in retention of ABCB4 in the endoplasmic reticulum, thus failing to target the plasma membrane. In the present study, we tested the ability of two compounds with chaperone-like activity, 4-phenylbutyrate and curcumin, to rescue these ABCB4 mutants by assessing their effects on subcellular localization, protein maturation, and phospholipid efflux capability. Incubation of transfected cells at a reduced temperature (30°C) or exposure to pharmacological doses of either 4-PBA or curcumin restored cell surface expression of mutants G228R and A934T. The delivery of these mutants to the plasma membrane was accompanied by a switch in the ratio of mature to inmature protein forms, leading to a predominant expression of the mature protein. This effect was due to an improvement in the maturation rate and not to the stabilization of the mature forms. Both mutants were also functionally rescued, displaying bile salt-dependent phospholipid efflux activity after addition of 4-PBA or curcumin. Drug-induced rescue was mutant specific, given neither 4-PBA nor curcumin had an effect on the ABCB4 mutants G68R and A934T. Collectively, these data indicate that the functionality of selected trafficking-defective ABCB4 mutants can be recovered by chemical chaperones through restoration of membrane localization, suggesting a potential treatment for patients carrying such mutations. PMID:26900700

  10. Genetic and Genomic Insights into the Role of Benzoate-Catabolic Pathway Redundancy in Burkholderia xenovorans LB400†

    PubMed Central

    Denef, V. J.; Klappenbach, J. A.; Patrauchan, M. A.; Florizone, C.; Rodrigues, J. L. M.; Tsoi, T. V.; Verstraete, W.; Eltis, L. D.; Tiedje, J. M.

    2006-01-01

    Transcriptomic and proteomic analyses of Burkholderia xenovorans LB400, a potent polychlorinated biphenyl (PCB) degrader, have implicated growth substrate- and phase-dependent expression of three benzoate-catabolizing pathways: a catechol ortho cleavage (ben-cat) pathway and two benzoyl-coenzyme A pathways, encoded by gene clusters on the large chromosome (boxC) and the megaplasmid (boxM). To elucidate the significance of this apparent redundancy, we constructed mutants with deletions of the ben-cat pathway (the ΔbenABCD::kan mutant), the boxC pathway (the ΔboxABC::kan mutant), and both pathways (the ΔbenABCDΔ boxABC::kan mutant). All three mutants oxidized benzoate in resting-cell assays. However, the ΔbenABCD::kan and ΔbenABCD ΔboxABC::kan mutants grew at reduced rates on benzoate and displayed increased lag phases. By contrast, growth on succinate, on 4-hydroxybenzoate, and on biphenyl was unaffected. Microarray and proteomic analyses revealed that cells of the ΔbenABCD::kan mutant growing on benzoate expressed both box pathways. Overall, these results indicate that all three pathways catabolize benzoate. Deletion of benABCD abolished the ability of LB400 to grow using 3-chlorobenzoate. None of the benzoate pathways could degrade 2- or 4-chlorobenzoate, indicating that the pathway redundancy does not directly contribute to LB400's PCB-degrading capacities. Finally, an extensive sigmaE-regulated oxidative stress response not present in wild-type LB400 grown on benzoate was detected in these deletion mutants, supporting our earlier suggestion that the box pathways are preferentially active under reduced oxygen tension. Our data further substantiate the expansive network of tightly interconnected and complexly regulated aromatic degradation pathways in LB400. PMID:16391095

  11. Regulation of virulence by a two-component system in group B streptococcus.

    PubMed

    Jiang, Sheng-Mei; Cieslewicz, Michael J; Kasper, Dennis L; Wessels, Michael R

    2005-02-01

    Group B Streptococcus (GBS) is frequently carried in the gastrointestinal or genitourinary tract as a commensal organism, yet it has the potential to cause life-threatening infection in newborn infants, pregnant women, and individuals with chronic illness. Regulation of virulence factor expression may affect whether GBS behaves as an asymptomatic colonizer or an invasive pathogen, but little is known about how such factors are controlled in GBS. We now report the characterization of a GBS locus that encodes a two-component regulatory system similar to CsrRS (or CovRS) in Streptococcus pyogenes. Inactivation of csrR, encoding the putative response regulator, in two unrelated wild-type strains of GBS resulted in a marked increase in production of beta-hemolysin/cytolysin and a striking decrease in production of CAMP factor, an unrelated cytolytic toxin. Quantitative RNA hybridization experiments revealed that these two phenotypes were associated with a marked increase and decrease in expression of the corresponding genes, cylE and cfb, respectively. The CsrR mutant strains also displayed increased expression of scpB encoding C5a peptidase. Similar, but less marked, changes in gene expression were observed in CsrS (putative sensor component) mutants, evidence that CsrR and CsrS constitute a functional two-component system. Experimental infection studies in mice demonstrated reduced virulence of both CsrR and CsrS mutant strains relative to the wild type. Together, these results indicate that CsrRS regulates expression of multiple GBS virulence determinants and is likely to play an important role in GBS pathogenesis.

  12. Isobutanol production as an alternative metabolic sink to rescue the growth deficiency of the glycogen mutant of Synechococcus elongatus PCC 7942

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, XQ; Shen, CR; Liao, JC

    2014-03-04

    Glycogen synthesis initiated by glucose-1-phosphate adenylyltransferase (glgC) represents a major carbon storage route in cyanobacteria which could divert a significant portion of assimilated carbon. Significant growth retardation in cyanobacteria with glgC knocked out (Delta glgC) has been reported in high light conditions. Here, we knocked out the glgC gene and analyzed its effects on carbon distribution in an isobutanol-producing strain of Synechococcus elongatus PCC7942 and its parental wild-type strain. We showed that isobutanol production was able to partially rescue the growth of Delta glgC mutant where the growth rescue effect positively correlated with the rate of isobutanol production. Using (NaHCO3)-C-14more » incorporation analysis, we observed a 28 % loss of total carbon fixation rate in the Delta glgC mutant compared to the wild-type. Upon expression of the isobutanol production pathway in Delta glgC mutant, the total carbon fixation rate was restored to the wild-type level. Furthermore, we showed that 52 % of the total carbon fixed was redirected into isobutanol biosynthesis in the Delta glgC mutant expressing enzymes for isobutanol production, which is 2.5 times higher than that of the wild-type expressing the same enzymes. These results suggest that biosynthesis of non-native product such as isobutanol can serve as a metabolic sink for replacing glycogen to rescue growth and restore carbon fixation rate. The rescue effect may further serve as a platform for cyanobacteria energy and carbon metabolism study.« less

  13. Factors Supporting Cysteine Tolerance and Sulfite Production in Candida albicans

    PubMed Central

    Hennicke, Florian; Grumbt, Maria; Lermann, Ulrich; Ueberschaar, Nico; Palige, Katja; Böttcher, Bettina; Jacobsen, Ilse D.; Staib, Claudia; Morschhäuser, Joachim; Monod, Michel; Hube, Bernhard; Hertweck, Christian

    2013-01-01

    The amino acid cysteine has long been known to be toxic at elevated levels for bacteria, fungi, and humans. However, mechanisms of cysteine tolerance in microbes remain largely obscure. Here we show that the human pathogenic yeast Candida albicans excretes sulfite when confronted with increasing cysteine concentrations. Mutant construction and phenotypic analysis revealed that sulfite formation from cysteine in C. albicans relies on cysteine dioxygenase Cdg1, an enzyme with similar functions in humans. Environmental cysteine induced not only the expression of the CDG1 gene in C. albicans, but also the expression of SSU1, encoding a putative sulfite efflux pump. Accordingly, the deletion of SSU1 resulted in enhanced sensitivity of the fungal cells to both cysteine and sulfite. To study the regulation of sulfite/cysteine tolerance in more detail, we screened a C. albicans library of transcription factor mutants in the presence of sulfite. This approach and subsequent independent mutant analysis identified the zinc cluster transcription factor Zcf2 to govern sulfite/cysteine tolerance, as well as cysteine-inducible SSU1 and CDG1 gene expression. cdg1Δ and ssu1Δ mutants displayed reduced hypha formation in the presence of cysteine, indicating a possible role of the newly proposed mechanisms of cysteine tolerance and sulfite secretion in the pathogenicity of C. albicans. Moreover, cdg1Δ mutants induced delayed mortality in a mouse model of disseminated infection. Since sulfite is toxic and a potent reducing agent, its production by C. albicans suggests diverse roles during host adaptation and pathogenicity. PMID:23417561

  14. MYB10 and MYB72 are required for growth under iron-limiting conditions.

    PubMed

    Palmer, Christine M; Hindt, Maria N; Schmidt, Holger; Clemens, Stephan; Guerinot, Mary Lou

    2013-11-01

    Iron is essential for photosynthesis and is often a limiting nutrient for plant productivity. Plants respond to conditions of iron deficiency by increasing transcript abundance of key genes involved in iron homeostasis, but only a few regulators of these genes have been identified. Using genome-wide expression analysis, we searched for transcription factors that are induced within 24 hours after transferring plants to iron-deficient growth conditions. Out of nearly 100 transcription factors shown to be up-regulated, we identified MYB10 and MYB72 as the most highly induced transcription factors. Here, we show that MYB10 and MYB72 are functionally redundant and are required for plant survival in alkaline soil where iron availability is greatly restricted. myb10myb72 double mutants fail to induce transcript accumulation of the nicotianamine synthase gene NAS4. Both myb10myb72 mutants and nas4-1 mutants have reduced iron concentrations, chlorophyll levels, and shoot mass under iron-limiting conditions, indicating that these genes are essential for proper plant growth. The double myb10myb72 mutant also showed nickel and zinc sensitivity, similar to the nas4 mutant. Ectopic expression of NAS4 rescues myb10myb72 plants, suggesting that loss of NAS4 is the primary defect in these plants and emphasizes the importance of nicotianamine, an iron chelator, in iron homeostasis. Overall, our results provide evidence that MYB10 and MYB72 act early in the iron-deficiency regulatory cascade to drive gene expression of NAS4 and are essential for plant survival under iron deficiency.

  15. GPNMB ameliorates mutant TDP-43-induced motor neuron cell death.

    PubMed

    Nagahara, Yuki; Shimazawa, Masamitsu; Ohuchi, Kazuki; Ito, Junko; Takahashi, Hitoshi; Tsuruma, Kazuhiro; Kakita, Akiyoshi; Hara, Hideaki

    2017-08-01

    Glycoprotein nonmetastatic melanoma protein B (GPNMB) aggregates are observed in the spinal cord of amyotrophic lateral sclerosis (ALS) patients, but the detailed localization is still unclear. Mutations of transactive response DNA binding protein 43kDa (TDP-43) are associated with neurodegenerative diseases including ALS. In this study, we evaluated the localization of GPNMB aggregates in the spinal cord of ALS patients and the effect of GPNMB against mutant TDP-43 induced motor neuron cell death. GPNMB aggregates were not localized in the glial fibrillary acidic protein (GFAP)-positive astrocyte and ionized calcium binding adaptor molecule-1 (Iba1)-positive microglia. GPNMB aggregates were localized in the microtubule-associated protein 2 (MAP-2)-positive neuron and neurofilament H non-phosphorylated (SMI-32)-positive neuron, and these were co-localized with TDP-43 aggregates in the spinal cord of ALS patients. Mock or TDP-43 (WT, M337V, and A315T) plasmids were transfected into mouse motor neuron cells (NSC34). The expression level of GPNMB was increased by transfection of mutant TDP-43 plasmids. Recombinant GPNMB ameliorated motor neuron cell death induced by transfection of mutant TDP-43 plasmids and serum-free stress. Furthermore, the expression of phosphorylated ERK1/2 and phosphorylated Akt were decreased by this stress, and these expressions were increased by recombinant GPNMB. These results indicate that GPNMB has protective effects against mutant TDP-43 stress via activating the ERK1/2 and Akt pathways, and GPNMB may be a therapeutic target for TDP-43 proteinopathy in familial and sporadic ALS. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Functionomics of NCC mutations in Gitelman syndrome using a novel mammalian cell-based activity assay.

    PubMed

    Valdez-Flores, Marco A; Vargas-Poussou, Rosa; Verkaart, Sjoerd; Tutakhel, Omar A Z; Valdez-Ortiz, Angel; Blanchard, Anne; Treard, Cyrielle; Hoenderop, Joost G J; Bindels, René J M; Jeleń, Sabina

    2016-12-01

    Gitelman syndrome (GS) is an autosomal recessive salt-wasting tubular disorder resulting from loss-of-function mutations in the thiazide-sensitive NaCl cotransporter (NCC). Functional analysis of these mutations has been limited to the use of Xenopus laevis oocytes. The aim of the present study was, therefore, to analyze the functional consequences of NCC mutations in a mammalian cell-based assay, followed by analysis of mutated NCC protein expression as well as glycosylation and phosphorylation profiles using human embryonic kidney (HEK) 293 cells. NCC activity was assessed with a novel assay based on thiazide-sensitive iodide uptake in HEK293 cells expressing wild-type or mutant NCC (N59I, R83W, I360T, C421Y, G463R, G731R, L859P, or R861C). All mutations caused a significantly lower NCC activity. Immunoblot analysis of the HEK293 cells revealed that 1) all NCC mutants have decreased NCC protein expression; 2) mutant N59I, R83W, I360T, C421Y, G463R, and L859P have decreased NCC abundance at the plasma membrane; 3) mutants C421Y and L859P display impaired NCC glycosylation; and 4) mutants N59I, R83W, C421Y, C731R, and L859P show affected NCC phosphorylation. In conclusion, we developed a mammalian cell-based assay in which NCC activity assessment together with a profiling of mutated protein processing aid our understanding of the pathogenic mechanism of the NCC mutations. Copyright © 2016 the American Physiological Society.

  17. Transcriptomic and molecular genetic analysis of the cell wall salvage response of Aspergillus niger to the absence of galactofuranose synthesis.

    PubMed

    Park, Joohae; Hulsman, Mark; Arentshorst, Mark; Breeman, Matthijs; Alazi, Ebru; Lagendijk, Ellen L; Rocha, Marina C; Malavazi, Iran; Nitsche, Benjamin M; van den Hondel, Cees A M J J; Meyer, Vera; Ram, Arthur F J

    2016-09-01

    The biosynthesis of cell surface-located galactofuranose (Galf)-containing glycostructures such as galactomannan, N-glycans and O-glycans in filamentous fungi is important to secure the integrity of the cell wall. UgmA encodes an UDP-galactopyranose mutase, which is essential for the formation of Galf. Consequently, the ΔugmA mutant lacks Galf-containing molecules. Our previous work in Aspergillus niger work suggested that loss of function of ugmA results in activation of the cell wall integrity (CWI) pathway which is characterized by increased expression of the agsA gene, encoding an α-glucan synthase. In this study, the transcriptional response of the ΔugmA mutant was further linked to the CWI pathway by showing the induced and constitutive phosphorylation of the CWI-MAP kinase in the ΔugmA mutant. To identify genes involved in cell wall remodelling in response to the absence of galactofuranose biosynthesis, a genome-wide expression analysis was performed using RNAseq. Over 400 genes were higher expressed in the ΔugmA mutant compared to the wild-type. These include genes that encode enzymes involved in chitin (gfaB, gnsA, chsA) and α-glucan synthesis (agsA), and in β-glucan remodelling (bgxA, gelF and dfgC), and also include several glycosylphosphatidylinositol (GPI)-anchored cell wall protein-encoding genes. In silico analysis of the 1-kb promoter regions of the up-regulated genes in the ΔugmA mutant indicated overrepresentation of genes with RlmA, MsnA, PacC and SteA-binding sites. The importance of these transcription factors for survival of the ΔugmA mutant was analysed by constructing the respective double mutants. The ΔugmA/ΔrlmA and ΔugmA/ΔmsnA double mutants showed strong synthetic growth defects, indicating the importance of these transcription factors to maintain cell wall integrity in the absence of Galf biosynthesis. © 2016 The Authors Cellular Microbiology Published by John Wiley & Sons Ltd.

  18. LMOf2365_0442 Encoding for a Fructose Specific PTS Permease IIA May Be Required for Virulence in L. monocytogenes Strain F2365

    PubMed Central

    Liu, Yanhong; Yoo, Brian B.; Hwang, Cheng-An; Suo, Yujuan; Sheen, Shiowshuh; Khosravi, Parvaneh; Huang, Lihan

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that causes listeriosis, which is a major public health concern due to the high fatality rate. LMOf2365_0442, 0443, and 0444 encode for fructose-specific EIIABC components of phosphotransferase transport system (PTS) permease that is responsible for sugar transport. In previous studies, in-frame deletion mutants of a putative fructose-specific PTS permease (LMOf2365_0442, 0443, and 0444) were constructed and analyzed. However, the virulence potential of these deletion mutants has not been studied. In this study, two in vitro methods were used to analyze the virulence potential of these L. monocytogenes deletion mutants. First, invasion assays were used to measure the invasion efficiencies to host cells using the human HT-29 cell line. Second, plaque forming assays were used to measure cell-to-cell spread in host cells. Our results showed that the deletion mutant ΔLMOf2365_0442 had reduced invasion and cell-to-cell spread efficiencies in human cell line compared to the parental strain LMOf2365, indicating that LMOf2365_0442 encoding for a fructose specific PTS permease IIA may be required for virulence in L. monocytogenes strain F2365. In addition, the gene expression levels of 15 virulence and stress-related genes were analyzed in the stationary phase cells of the deletion mutants using RT-PCR assays. Virulence-related gene expression levels were elevated in the deletion mutants ΔLMOf2365_0442-0444 compared to the wild type parental strain LMOf2365, indicating the down-regulation of virulence genes by this PTS permease in L. monocytogenes. Finally, stress-related gene clpC expression levels were also increased in all of the deletion mutants, suggesting the involvement of this PTS permease in stress response. Furthermore, these deletion mutants displayed the same pressure tolerance and the same capacity for biofilm formation compared to the wild-type parental strain LMOf2365. In summary, our findings suggest that the LMOf2365_0442 gene can be used as a potential target to develop inhibitors for new therapeutic and pathogen control strategies for public health. PMID:28900418

  19. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

    PubMed

    Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

    2014-05-01

    During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

  20. Cytoplasmically Retargeted HSV1-tk/GFP Reporter Gene Mutants for Optimization of Noninvasive Molecular-Genetic Imaging

    PubMed Central

    Ponomarev, Vladimir; Doubrovin, Michael; Serganova, Inna; Beresten, Tatiana; Vider, Jelena; Shavrin, Aleksander; Ageyeva, Ludmila; Balatoni, Julius; Blasberg, Ronald; Tjuvajev, Juri Gelovani

    2003-01-01

    Abstract To optimize the sensitivity of imaging HSV1-tk/GFP reporter gene expression, a series of HSV1-tk/GFP mutants was developed with altered nuclear localization and better cellular enzymatic activity, compared to that of the native HSV1-tk/GFP fusion protein (HSV1-tk/GFP). Several modifications of HSV1-tk/GFP reporter gene were performed, including targeted inactivating mutations in the nuclear localization signal (NLS), the addition of a nuclear export signal (NES), a combination of both mutation types, and a truncation of the first 135 bp of the native hsv1-tk coding sequence containing a “cryptic” testicular promoter and the NLS. A recombinant HSV1-tk/GFP protein and a highly sensitive sandwich enzyme-linked immunosorbent assay for HSV1-tk/GFP were developed to quantitate the amount of reporter gene product in different assays to allow normalization of the data. These different mutations resulted in various degrees of nuclear clearance, predominant cytoplasmic distribution, and increased total cellular enzymatic activity of the HSV1-tk/GFP mutants, compared to native HSV1-tk/GFP when expressed at the same levels. This appears to be the result of improvedmetabolic bioavailability of cytoplasmically retargeted mutant HSV1-tk/GFP enzymes for reaction with the radiolabeled probe (e.g., FIAU). The analysis of enzymatic properties of different HSV1-tk/GFP mutants using FIAU as a substrate revealed no significant differences from that of the native HSV1-tk/GFP. Improved total cellular enzymatic activity of cytoplasmically retargeted HSV1-tk/GFP mutants observed in vitro was confirmed by noninvasive imaging of transduced subcutaneous tumor xenografts bearing these reporters using [131I]FIAU and a γ-camera. PMID:12869307

  1. Role of cyclic di-GMP in Xylella fastidiosa biofilm formation, plant virulence, and insect transmission.

    PubMed

    Chatterjee, Subhadeep; Killiny, Nabil; Almeida, Rodrigo P P; Lindow, Steven E

    2010-10-01

    Xylella fastidiosa must coordinately regulate a variety of traits contributing to biofilm formation, host plant and vector colonization, and transmission between plants. Traits such as production of extracellular polysaccharides (EPS), adhesins, extracellular enzymes, and pili are expressed in a cell-density-dependent fashion mediated by a cell-to-cell signaling system involving a fatty acid diffusible signaling factor (DSF). The expression of gene PD0279 (which has a GGDEF domain) is downregulated in the presence of DSF and may be involved in intracellular signaling by modulating the levels of cyclic di-GMP. PD0279, designated cyclic di-GMP synthase A (cgsA), is required for biofilm formation, plant virulence, and vector transmission. cgsA mutants exhibited a hyperadhesive phenotype in vitro and overexpressed gumJ, hxfA, hxfB, xadA, and fimA, which promote attachment of cells to surfaces and, hence, biofilm formation. The mutants were greatly reduced in virulence to grape albeit still transmissible by insect vectors, although at a reduced level compared with transmission rates of the wild-type strain, despite the fact that similar numbers of cells of the cgsA mutant were acquired by the insects from infected plants. High levels of EPS were measured in cgsA mutants compared with wild-type strains, and scanning electron microscopy analysis also revealed a thicker amorphous layer surrounding the mutants. Overexpression of cgsA in a cgsA-complemented mutant conferred the opposite phenotypes in vitro. These results suggest that decreases of cyclic di-GMP result from the accumulation of DSF as cell density increases, leading to a phenotypic transition from a planktonic state capable of colonizing host plants to an adhesive state that is insect transmissible.

  2. BvrR/BvrS-Controlled Outer Membrane Proteins Omp3a and Omp3b Are Not Essential for Brucella abortus Virulence▿

    PubMed Central

    Manterola, Lorea; Guzmán-Verri, Caterina; Chaves-Olarte, Esteban; Barquero-Calvo, Elías; de Miguel, María-Jesús; Moriyón, Ignacio; Grilló, María-Jesús; López-Goñi, Ignacio; Moreno, Edgardo

    2007-01-01

    The Brucella abortus two-component regulatory system BvrR/BvrS controls the expression of outer membrane proteins (Omp) Omp3a (Omp25) and Omp3b (Omp22). Disruption of bvrS or bvrR generates avirulent mutants with altered cell permeability, higher sensitivity to microbicidal peptides, and complement. Consequently, the role of Omp3a and Omp3b in virulence was examined. Similar to bvrS or bvrR mutants, omp3a and omp3b mutants displayed increased attachment to cells, indicating surface alterations. However, they showed unaltered permeability; normal expression of Omp10, Omp16, Omp19, Omp2b, and Omp1; native hapten polysaccharide; and lipopolysaccharide and were resistant to complement and polymyxin B at ranges similar to those of the wild-type (WT) counterpart. Likewise, omp3a and omp3b mutants were able to replicate in murine macrophages and in HeLa cells, were resistant to the killing action of human neutrophils, and persisted in mice, like the WT strain. Murine macrophages infected with the omp3a mutant generated slightly higher levels of tumor necrosis factor alpha than the WT, whereas the bvrS mutant induced lower levels of this cytokine. Since the absence of Omp3a or Omp3b does not result in attenuation, it can be concluded that BvrR/BvrS influences additional Brucella properties involved in virulence. Our results are discussed in the light of previous works suggesting that disruption of omp3a generates attenuated Brucella strains, and we speculate on the role of group 3 Omps. PMID:17664262

  3. Theoretical Analysis of Allosteric and Operator Binding for Cyclic-AMP Receptor Protein Mutants

    NASA Astrophysics Data System (ADS)

    Einav, Tal; Duque, Julia; Phillips, Rob

    2018-02-01

    Allosteric transcription factors undergo binding events both at their inducer binding sites as well as at distinct DNA binding domains, and it is often difficult to disentangle the structural and functional consequences of these two classes of interactions. In this work, we compare the ability of two statistical mechanical models - the Monod-Wyman-Changeux (MWC) and the Koshland-N\\'emethy-Filmer (KNF) models of protein conformational change - to characterize the multi-step activation mechanism of the broadly acting cyclic-AMP receptor protein (CRP). We first consider the allosteric transition resulting from cyclic-AMP binding to CRP, then analyze how CRP binds to its operator, and finally investigate the ability of CRP to activate gene expression. In light of these models, we examine data from a beautiful recent experiment that created a single-chain version of the CRP homodimer, thereby enabling each subunit to be mutated separately. Using this construct, six mutants were created using all possible combinations of the wild type subunit, a D53H mutant subunit, and an S62F mutant subunit. We demonstrate that both the MWC and KNF models can explain the behavior of all six mutants using a small, self-consistent set of parameters. In comparing the results, we find that the MWC model slightly outperforms the KNF model in the quality of its fits, but more importantly the parameters inferred by the MWC model are more in line with structural knowledge of CRP. In addition, we discuss how the conceptual framework developed here for CRP enables us to not merely analyze data retrospectively, but has the predictive power to determine how combinations of mutations will interact, how double mutants will behave, and how each construct would regulate gene expression.

  4. Mutation of a vitelline membrane protein, BmEP80, is responsible for the silkworm "Ming" lethal egg mutant.

    PubMed

    Chen, Anli; Gao, Peng; Zhao, Qiaoling; Tang, Shunming; Shen, Xingjia; Zhang, Guozheng; Qiu, Zhiyong; Xia, Dingguo; Huang, Yongping; Xu, Yunmin; He, Ningjia

    2013-02-25

    The egg stage is an important stage in the silkworm (Bombyx mori) life cycle. Normal silkworm eggs are usually short, elliptical, and laterally flattened, with a sometimes hollowed surface on the lateral side. However, the eggs laid by homozygous recessive "Ming" lethal egg mutants (l-e(m)) lose water and become concaved around 1h, ultimately exhibiting a triangular shape on the egg surfaces. We performed positional cloning, and narrowed down the region containing the gene responsible for the l-e(m) mutant to 360 kb on chromosome 10 using 2287 F(2) individuals. Using expression analysis and RNA interference, the best l-e(m) candidate gene was shown to be BmEP80. The results of the inverse polymerase chain reaction showed that an ~1.9 kb region from the 3' untranslated region of BmVMP23 to the forepart of BmEP80 was replaced by a >100 kb DNA fragment in the l-e(m) mutant. Several eggs laid by the normal moths injected with BmEP80 small interfering RNAs were evidently depressed and exhibited a triangular shape on the surface. The phenotype exhibited was consistent with the eggs laid by the l-e(m) mutant. Moreover, two-dimensional gel electrophoresis showed that the BmEP80 protein was expressed in the ovary from the 9th day of the pupa stage to eclosion in the wild-type silkworm, but was absent in the l-e(m) mutant. These results indicate that BmEP80 is responsible for the l-e(m) mutation. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. The Arabidopsis Mutant cev1 Links Cell Wall Signaling to Jasmonate and Ethylene Responses

    PubMed Central

    Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G.

    2002-01-01

    Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants. PMID:12119374

  6. Mutant p53-associated myosin-X upregulation promotes breast cancer invasion and metastasis.

    PubMed

    Arjonen, Antti; Kaukonen, Riina; Mattila, Elina; Rouhi, Pegah; Högnäs, Gunilla; Sihto, Harri; Miller, Bryan W; Morton, Jennifer P; Bucher, Elmar; Taimen, Pekka; Virtakoivu, Reetta; Cao, Yihai; Sansom, Owen J; Joensuu, Heikki; Ivaska, Johanna

    2014-03-01

    Mutations of the tumor suppressor TP53 are present in many forms of human cancer and are associated with increased tumor cell invasion and metastasis. Several mechanisms have been identified for promoting dissemination of cancer cells with TP53 mutations, including increased targeting of integrins to the plasma membrane. Here, we demonstrate a role for the filopodia-inducing motor protein Myosin-X (Myo10) in mutant p53-driven cancer invasion. Analysis of gene expression profiles from 2 breast cancer data sets revealed that MYO10 was highly expressed in aggressive cancer subtypes. Myo10 was required for breast cancer cell invasion and dissemination in multiple cancer cell lines and murine models of cancer metastasis. Evaluation of a Myo10 mutant without the integrin-binding domain revealed that the ability of Myo10 to transport β₁ integrins to the filopodia tip is required for invasion. Introduction of mutant p53 promoted Myo10 expression in cancer cells and pancreatic ductal adenocarcinoma in mice, whereas suppression of endogenous mutant p53 attenuated Myo10 levels and cell invasion. In clinical breast carcinomas, Myo10 was predominantly expressed at the invasive edges and correlated with the presence of TP53 mutations and poor prognosis. These data indicate that Myo10 upregulation in mutant p53-driven cancers is necessary for invasion and that plasma-membrane protrusions, such as filopodia, may serve as specialized metastatic engines.

  7. Neuronal defects in the hindbrain of Hoxa1, Hoxb1 and Hoxb2 mutants reflect regulatory interactions among these Hox genes.

    PubMed

    Gavalas, Anthony; Ruhrberg, Christiana; Livet, Jean; Henderson, Christopher E; Krumlauf, Robb

    2003-12-01

    Hox genes are instrumental in assigning segmental identity in the developing hindbrain. Auto-, cross- and para-regulatory interactions help establish and maintain their expression. To understand to what extent such regulatory interactions shape neuronal patterning in the hindbrain, we analysed neurogenesis, neuronal differentiation and motoneuron migration in Hoxa1, Hoxb1 and Hoxb2 mutant mice. This comparison revealed that neurogenesis and differentiation of specific neuronal subpopulations in r4 was impaired in a similar fashion in all three mutants, but with different degrees of severity. In the Hoxb1 mutants, neurons derived from the presumptive r4 territory were re-specified towards an r2-like identity. Motoneurons derived from that territory resembled trigeminal motoneurons in both their migration patterns and the expression of molecular markers. Both migrating motoneurons and the resident territory underwent changes consistent with a switch from an r4 to r2 identity. Abnormally migrating motoneurons initially formed ectopic nuclei that were subsequently cleared. Their survival could be prolonged through the introduction of a block in the apoptotic pathway. The Hoxa1 mutant phenotype is consistent with a partial misspecification of the presumptive r4 territory that results from partial Hoxb1 activation. The Hoxb2 mutant phenotype is a hypomorph of the Hoxb1 mutant phenotype, consistent with the overlapping roles of these genes in facial motoneuron specification. Therefore, we have delineated the functional requirements in hindbrain neuronal patterning that follow the establishment of the genetic regulatory hierarchy between Hoxa1, Hoxb1 and Hoxb2.

  8. Transcriptomic and proteomic analyses of a pale-green durum wheat mutant shows variations in photosystem components and metabolic deficiencies under drought stress

    PubMed Central

    2014-01-01

    Background Leaf pigment content is an important trait involved in environmental interactions. In order to determine its impact on drought tolerance in wheat, we characterized a pale-green durum wheat mutant (Triticum turgidum L. var. durum) under contrasting water availability conditions. Results The pale-green mutant was investigated by comparing pigment content and gene/protein expression profiles to wild-type plants at anthesis. Under well-watered (control) conditions the mutant had lower levels of chlorophylls and carotenoids, but higher levels of xanthophyll de-epoxidation compared to wild-type. Transcriptomic analysis under control conditions showed that defense genes (encoding e.g. pathogenesis-related proteins, peroxidases and chitinases) were upregulated in the mutant, suggesting the presence of mild oxidative stress that was compensated without altering the net rate of photosynthesis. Transcriptomic analysis under terminal water stress conditions, revealed the modulation of antioxidant enzymes, photosystem components, and enzymes representing carbohydrate metabolism and the tricarboxylic acid cycle, indicating that the mutant was exposed to greater oxidative stress than the wild-type plants, but had a limited capacity to respond. We also compared the two genotypes under irrigated and rain-fed field conditions over three years, finding that the greater oxidative stress and corresponding molecular changes in the pale-green mutant were associated to a yield reduction. Conclusions This study provides insight on the effect of pigment content in the molecular response to drought. Identified genes differentially expressed under terminal water stress may be valuable for further studies addressing drought resistance in wheat. PMID:24521234

  9. Mutational analysis of the gag-pol junction of Moloney murine leukemia virus: requirements for expression of the gag-pol fusion protein.

    PubMed Central

    Felsenstein, K M; Goff, S P

    1992-01-01

    The gag-pol polyprotein of the murine and feline leukemia viruses is expressed by translational readthrough of a UAG terminator codon at the 3' end of the gag gene. To explore the cis-acting sequence requirements for the readthrough event in vivo, we generated a library of mutants of the Moloney murine leukemia virus with point mutations near the terminator codon and tested the mutant viral DNAs for the ability to direct synthesis of the gag-pol fusion protein and formation of infectious virus. The analysis showed that sequences 3' to the terminator are necessary and sufficient for the process. The results do not support a role for one proposed stem-loop structure that includes the terminator but are consistent with the involvement of another stem-loop 3' to the terminator. One mutant, containing two compensatory changes in this stem structure, was temperature sensitive for replication and for formation of the gag-pol protein. The results suggest that RNA sequence and structure are critical determinants of translational readthrough in vivo. Images PMID:1404606

  10. SAS-6 engineering reveals interdependence between cartwheel and microtubules in determining centriole architecture.

    PubMed

    Hilbert, Manuel; Noga, Akira; Frey, Daniel; Hamel, Virginie; Guichard, Paul; Kraatz, Sebastian H W; Pfreundschuh, Moritz; Hosner, Sarah; Flückiger, Isabelle; Jaussi, Rolf; Wieser, Mara M; Thieltges, Katherine M; Deupi, Xavier; Müller, Daniel J; Kammerer, Richard A; Gönczy, Pierre; Hirono, Masafumi; Steinmetz, Michel O

    2016-04-01

    Centrioles are critical for the formation of centrosomes, cilia and flagella in eukaryotes. They are thought to assemble around a nine-fold symmetric cartwheel structure established by SAS-6 proteins. Here, we have engineered Chlamydomonas reinhardtii SAS-6-based oligomers with symmetries ranging from five- to ten-fold. Expression of a SAS-6 mutant that forms six-fold symmetric cartwheel structures in vitro resulted in cartwheels and centrioles with eight- or nine-fold symmetries in vivo. In combination with Bld10 mutants that weaken cartwheel-microtubule interactions, this SAS-6 mutant produced six- to eight-fold symmetric cartwheels. Concurrently, the microtubule wall maintained eight- and nine-fold symmetries. Expressing SAS-6 with analogous mutations in human cells resulted in nine-fold symmetric centrioles that exhibited impaired length and organization. Together, our data suggest that the self-assembly properties of SAS-6 instruct cartwheel symmetry, and lead us to propose a model in which the cartwheel and the microtubule wall assemble in an interdependent manner to establish the native architecture of centrioles.

  11. PHB Biosynthesis Counteracts Redox Stress in Herbaspirillum seropedicae

    PubMed Central

    Batista, Marcelo B.; Teixeira, Cícero S.; Sfeir, Michelle Z. T.; Alves, Luis P. S.; Valdameri, Glaucio; Pedrosa, Fabio de Oliveira; Sassaki, Guilherme L.; Steffens, Maria B. R.; de Souza, Emanuel M.; Dixon, Ray; Müller-Santos, Marcelo

    2018-01-01

    The ability of bacteria to produce polyhydroxyalkanoates such as poly(3-hydroxybutyrate) (PHB) enables provision of a carbon storage molecule that can be mobilized under demanding physiological conditions. However, the precise function of PHB in cellular metabolism has not been clearly defined. In order to determine the impact of PHB production on global physiology, we have characterized the properties of a ΔphaC1 mutant strain of the diazotrophic bacterium Herbaspirillum seropedicae. The absence of PHB in the mutant strain not only perturbs redox balance and increases oxidative stress, but also influences the activity of the redox-sensing Fnr transcription regulators, resulting in significant changes in expression of the cytochrome c-branch of the electron transport chain. The synthesis of PHB is itself dependent on the Fnr1 and Fnr3 proteins resulting in a cyclic dependency that couples synthesis of PHB with redox regulation. Transcriptional profiling of the ΔphaC1 mutant reveals that the loss of PHB synthesis affects the expression of many genes, including approximately 30% of the Fnr regulon. PMID:29599762

  12. Mutants of Neurospora crassa that alter gene expression and conidia development.

    PubMed Central

    Madi, L; Ebbole, D J; White, B T; Yanofsky, C

    1994-01-01

    Several genes have been identified that are highly expressed during conidiation. Inactivation of these genes has no observable phenotypic effect. Transcripts of two such genes, con-6 and con-10, are normally absent from vegetative mycelia. To identify regulatory genes that affect con-6 and/or con-10 expression, strains were prepared in which the regulatory regions for these genes were fused to a gene conferring hygromycin resistance. Mutants were then selected that were resistant to the drug during mycelial growth. Mutations in several of the isolates had trans effects; they activated transcription of the corresponding intact gene and, in most isolates, one or more of the other con genes. Most interestingly, resistant mutants were obtained that were defective at different stages of conidiation. One mutant conidiated under conditions that do not permit conidiation in wild type. Images PMID:8016143

  13. Pharmacogenetic Features of Inhibitors to Cathepsin B that Improve Memory Deficit and Reduce Beta-Amyloid Related to Alzheimer’s Disease

    PubMed Central

    Hook, Vivian; Hook, Gregory; Kindy, Mark

    2015-01-01

    Beta-amyloid (Aβ) in brain is a major factor involved in Alzheimer’s disease (AD) that results in severe memory deficit. Our recent studies demonstrate pharmacogenetic differences in the effects of inhibitors of cathepsin B to improve memory and reduce Aβ in different mouse models of AD. The inhibitors improve memory and reduce brain Aβ in mice expressing the wild-type (WT) β-secretase site of human APP, expressed in most AD patients. However, these inhibitors have no effect in mice expressing the rare Swedish (Swe) mutant APP. Knockout of the cathepsin B decreased brain Aβ in mice expressing WT APP, validating cathepsin B as the target. The specificity of cathepsin B to cleave the WT β-secretase site, but not the Swe mutant site, of APP for Aβ production explains the distinct inhibitor responses in the different AD mouse models. In contrast to cathepsin B, the BACE1 β-secretase prefers to cleave the Swe mutant site. Discussion of BACE1 data in the field indicate that they do not preclude cathepsin B as also being a β-secretase. Cathepsin B and BACE1 may participate jointly as β-secretases. Significantly, the majority of AD patients express WT APP and, therefore, inhibitors of cathepsin B represent candidate drugs for AD. PMID:20536395

  14. G Protein–Coupled Receptor-Type G Proteins Are Required for Light-Dependent Seedling Growth and Fertility in Arabidopsis[W

    PubMed Central

    Jaffé, Felix W.; Freschet, Gian-Enrico C.; Valdes, Billy M.; Runions, John; Terry, Matthew J.; Williams, Lorraine E.

    2012-01-01

    G protein–coupled receptor-type G proteins (GTGs) are highly conserved membrane proteins in plants, animals, and fungi that have eight to nine predicted transmembrane domains. They have been classified as G protein–coupled receptor-type G proteins that function as abscisic acid (ABA) receptors in Arabidopsis thaliana. We cloned Arabidopsis GTG1 and GTG2 and isolated new T-DNA insertion alleles of GTG1 and GTG2 in both Wassilewskija and Columbia backgrounds. These gtg1 gtg2 double mutants show defects in fertility, hypocotyl and root growth, and responses to light and sugars. Histological studies of shoot tissue reveal cellular distortions that are particularly evident in the epidermal layer. Stable expression of GTG1pro:GTG1-GFP (for green fluorescent protein) in Arabidopsis and transient expression in tobacco (Nicotiana tabacum) indicate that GTG1 is localized primarily to Golgi bodies and to the endoplasmic reticulum. Microarray analysis comparing gene expression profiles in the wild type and double mutant revealed differences in expression of genes important for cell wall function, hormone response, and amino acid metabolism. The double mutants isolated here respond normally to ABA in seed germination assays, root growth inhibition, and gene expression analysis. These results are inconsistent with their proposed role as ABA receptors but demonstrate that GTGs are fundamentally important for plant growth and development. PMID:23001037

  15. Lack of hormone binding in COS-7 cells expressing a mutated growth hormone receptor found in Laron dwarfism.

    PubMed Central

    Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A

    1993-01-01

    A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064

  16. The RNA-binding protein CsrA plays a central role in positively regulating virulence factors in Erwinia amylovora

    PubMed Central

    Ancona, Veronica; Lee, Jae Hoon; Zhao, Youfu

    2016-01-01

    The GacS/GacA two-component system (also called GrrS/GrrA) is a global regulatory system which is highly conserved among gamma-proteobacteria. This system positively regulates non-coding small regulatory RNA csrB, which in turn binds to the RNA-binding protein CsrA. However, how GacS/GacA-Csr system regulates virulence traits in E. amylovora remains unknown. Results from mutant characterization showed that the csrB mutant was hypermotile, produced higher amount of exopolysaccharide amylovoran, and had increased expression of type III secretion (T3SS) genes in vitro. In contrast, the csrA mutant exhibited complete opposite phenotypes, including non-motile, reduced amylovoran production and expression of T3SS genes. Furthermore, the csrA mutant did not induce hypersensitive response on tobacco or cause disease on immature pear fruits, indicating that CsrA is a positive regulator of virulence factors. These findings demonstrated that CsrA plays a critical role in E. amylovora virulence and suggested that negative regulation of virulence by GacS/GacA acts through csrB sRNA, which binds to CsrA and neutralizes its positive effect on T3SS gene expression, flagellar formation and amylovoran production. Future research will be focused on determining the molecular mechanism underlying the positive regulation of virulence traits by CsrA. PMID:27845410

  17. The RNA-binding protein CsrA plays a central role in positively regulating virulence factors in Erwinia amylovora.

    PubMed

    Ancona, Veronica; Lee, Jae Hoon; Zhao, Youfu

    2016-11-15

    The GacS/GacA two-component system (also called GrrS/GrrA) is a global regulatory system which is highly conserved among gamma-proteobacteria. This system positively regulates non-coding small regulatory RNA csrB, which in turn binds to the RNA-binding protein CsrA. However, how GacS/GacA-Csr system regulates virulence traits in E. amylovora remains unknown. Results from mutant characterization showed that the csrB mutant was hypermotile, produced higher amount of exopolysaccharide amylovoran, and had increased expression of type III secretion (T3SS) genes in vitro. In contrast, the csrA mutant exhibited complete opposite phenotypes, including non-motile, reduced amylovoran production and expression of T3SS genes. Furthermore, the csrA mutant did not induce hypersensitive response on tobacco or cause disease on immature pear fruits, indicating that CsrA is a positive regulator of virulence factors. These findings demonstrated that CsrA plays a critical role in E. amylovora virulence and suggested that negative regulation of virulence by GacS/GacA acts through csrB sRNA, which binds to CsrA and neutralizes its positive effect on T3SS gene expression, flagellar formation and amylovoran production. Future research will be focused on determining the molecular mechanism underlying the positive regulation of virulence traits by CsrA.

  18. Serotonin hyperinnervation and upregulated 5-HT2A receptor expression and motor-stimulating function in nigrostriatal dopamine-deficient Pitx3 mutant mice.

    PubMed

    Li, Li; Qiu, Guozhen; Ding, Shengyuan; Zhou, Fu-Ming

    2013-01-23

    The striatum receives serotonin (5-hydroxytryptamine, 5-HT) innervation and expresses 5-HT2A receptors (5-HT2ARs) and other 5-HT receptors, raising the possibility that the striatal 5-HT system may undergo adaptive changes after chronic severe dopamine (DA) loss and contribute to the function and dysfunction of the striatum. Here we show that in transcription factor Pitx3 gene mutant mice with a selective, severe DA loss in the dorsal striatum mimicking the DA denervation in late Parkinson's disease (PD), both the 5-HT innervation and the 5-HT2AR mRNA expression were increased in the dorsal striatum. Functionally, while having no detectable motor effect in wild type mice, the 5-HT2R agonist 2,5-dimethoxy-4-iodoamphetamine increased both the baseline and l-dopa-induced normal ambulatory and dyskinetic movements in Pitx3 mutant mice, whereas the selective 5-HT2AR blocker volinanserin had the opposite effects. These results demonstrate that Pitx3 mutant mice are a convenient and valid mouse model to study the compensatory 5-HT upregulation following the loss of the nigrostriatal DA projection and that the upregulated 5-HT2AR function in the DA deficient dorsal striatum may enhance both normal and dyskinetic movements. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Protein kinase D2 controls cardiac valve formation in zebrafish by regulating histone deacetylase 5 activity.

    PubMed

    Just, Steffen; Berger, Ina M; Meder, Benjamin; Backs, Johannes; Keller, Andreas; Marquart, Sabine; Frese, Karen; Patzel, Eva; Rauch, Gerd-Jörg; Katus, Hugo A; Rottbauer, Wolfgang

    2011-07-19

    The molecular mechanisms that guide heart valve formation are not well understood. However, elucidation of the genetic basis of congenital heart disease is one of the prerequisites for the development of tissue-engineered heart valves. We isolated here a mutation in zebrafish, bungee (bng(jh177)), which selectively perturbs valve formation in the embryonic heart by abrogating endocardial Notch signaling in cardiac cushions. We found by positional cloning that the bng phenotype is caused by a missense mutation (Y849N) in zebrafish protein kinase D2 (pkd2). The bng mutation selectively impairs PKD2 kinase activity and hence Histone deacetylase 5 phosphorylation, nuclear export, and inactivation. As a result, the expression of Histone deacetylase 5 target genes Krüppel-like factor 2a and 4a, transcription factors known to be pivotal for heart valve formation and to act upstream of Notch signaling, is severely downregulated in bungee (bng) mutant embryos. Accordingly, the expression of Notch target genes, such as Hey1, Hey2, and HeyL, is severely decreased in bng mutant embryos. Remarkably, downregulation of Histone deacetylase 5 activity in homozygous bng mutant embryos can rescue the mutant phenotype and reconstitutes notch1b expression in atrioventricular endocardial cells. We demonstrate for the first time that proper heart valve formation critically depends on Protein kinase D2-Histone deacetylase 5-Krüppel-like factor signaling.

  20. MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

    PubMed

    Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

    2010-03-01

    Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

  1. The mouse homeobox gene Noto regulates node morphogenesis, notochordal ciliogenesis, and left–right patterning

    PubMed Central

    Beckers, Anja; Alten, Leonie; Viebahn, Christoph; Andre, Philipp; Gossler, Achim

    2007-01-01

    The mouse homeobox gene Noto represents the homologue of zebrafish floating head (flh) and is expressed in the organizer node and in the nascent notochord. Previous analyses suggested that Noto is required exclusively for the formation of the caudal part of the notochord. Here, we show that Noto is also essential for node morphogenesis, controlling ciliogenesis in the posterior notochord, and the establishment of laterality, whereas organizer functions in anterior–posterior patterning are apparently not compromised. In mutant embryos, left–right asymmetry of internal organs and expression of laterality markers was randomized. Mutant posterior notochord regions were variable in size and shape, cilia were shortened with highly irregular axonemal microtubuli, and basal bodies were, in part, located abnormally deep in the cytoplasm. The transcription factor Foxj1, which regulates the dynein gene Dnahc11 and is required for the correct anchoring of basal bodies in lung epithelial cells, was down-regulated in mutant nodes. Likewise, the transcription factor Rfx3, which regulates cilia growth, was not expressed in Noto mutants, and various other genes important for cilia function or assembly such as Dnahc5 and Nphp3 were down-regulated. Our results establish Noto as an essential regulator of node morphogenesis and ciliogenesis in the posterior notochord, and suggest Noto acts upstream of Foxj1 and Rfx3. PMID:17884984

  2. Pathogenesis of listeria-infected Drosophila wntD mutants is associated with elevated levels of the novel immunity gene edin.

    PubMed

    Gordon, Michael D; Ayres, Janelle S; Schneider, David S; Nusse, Roel

    2008-07-25

    Drosophila melanogaster mount an effective innate immune response against invading microorganisms, but can eventually succumb to persistent pathogenic infections. Understanding of this pathogenesis is limited, but it appears that host factors, induced by microbes, can have a direct cost to the host organism. Mutations in wntD cause susceptibility to Listeria monocytogenes infection, apparently through the derepression of Toll-Dorsal target genes, some of which are deleterious to survival. Here, we use gene expression profiling to identify genes that may mediate the observed susceptibility of wntD mutants to lethal infection. These genes include the TNF family member eiger and the novel immunity gene edin (elevated during infection; synonym CG32185), both of which are more strongly induced by infection of wntD mutants compared to controls. edin is also expressed more highly during infection of wild-type flies with wild-type Salmonella typhimurium than with a less pathogenic mutant strain, and its expression is regulated in part by the Imd pathway. Furthermore, overexpression of edin can induce age-dependent lethality, while loss of function in edin renders flies more susceptible to Listeria infection. These results are consistent with a model in which the regulation of host factors, including edin, must be tightly controlled to avoid the detrimental consequences of having too much or too little activity.

  3. spiel ohne grenzen/pou2 is required during establishment of the zebrafish midbrain-hindbrain boundary organizer.

    PubMed

    Belting, H G; Hauptmann, G; Meyer, D; Abdelilah-Seyfried, S; Chitnis, A; Eschbach, C; Söll, I; Thisse, C; Thisse, B; Artinger, K B; Lunde, K; Driever, W

    2001-11-01

    The vertebrate midbrain-hindbrain boundary (MHB) organizes patterning and neuronal differentiation in the midbrain and anterior hindbrain. Formation of this organizing center involves multiple steps, including positioning of the MHB within the neural plate, establishment of the organizer and maintenance of its regional identity and signaling activities. Juxtaposition of the Otx2 and Gbx2 expression domains positions the MHB. How the positional information is translated into activation of Pax2, Wnt1 and Fgf8 expression during MHB establishment remains unclear. In zebrafish spiel ohne grenzen (spg) mutants, the MHB is not established, neither isthmus nor cerebellum form, the midbrain is reduced in size and patterning abnormalities develop within the hindbrain. In spg mutants, despite apparently normal expression of otx2, gbx1 and fgf8 during late gastrula stages, the initial expression of pax2.1, wnt1 and eng2, as well as later expression of fgf8 in the MHB primordium are reduced. We show that spg mutants have lesions in pou2, which encodes a POU-domain transcription factor. Maternal pou2 transcripts are distributed evenly in the blastula, and zygotic expression domains include the midbrain and hindbrain primordia during late gastrulation. Microinjection of pou2 mRNA can rescue pax2.1 and wnt1 expression in the MHB of spg/pou2 mutants without inducing ectopic expression. This indicates an essential but permissive role for pou2 during MHB establishment. pou2 is expressed normally in noi/pax2.1 and ace/fgf8 zebrafish mutants, which also form no MHB. Thus, expression of pou2 does not depend on fgf8 and pax2.1. Our data suggest that pou2 is required for the establishment of the normal expression domains of wnt1 and pax2.1 in the MHB primordium.

  4. Systems Approaches to Predict the Functions of Glycoside Hydrolases during the Life Cycle of Aspergillus niger Using Developmental Mutants ∆brlA and ∆flbA

    PubMed Central

    van Munster, Jolanda M.; Nitsche, Benjamin M.; Akeroyd, Michiel; Dijkhuizen, Lubbert; van der Maarel, Marc J. E. C.; Ram, Arthur F. J.

    2015-01-01

    Background The filamentous fungus Aspergillus niger encounters carbon starvation in nature as well as during industrial fermentations. In response, regulatory networks initiate and control autolysis and sporulation. Carbohydrate-active enzymes play an important role in these processes, for example by modifying cell walls during spore cell wall biogenesis or in cell wall degradation connected to autolysis. Results In this study, we used developmental mutants (ΔflbA and ΔbrlA) which are characterized by an aconidial phenotype when grown on a plate, but also in bioreactor-controlled submerged cultivations during carbon starvation. By comparing the transcriptomes, proteomes, enzyme activities and the fungal cell wall compositions of a wild type A. niger strain and these developmental mutants during carbon starvation, a global overview of the function of carbohydrate-active enzymes is provided. Seven genes encoding carbohydrate-active enzymes, including cfcA, were expressed during starvation in all strains; they may encode enzymes involved in cell wall recycling. Genes expressed in the wild-type during starvation, but not in the developmental mutants are likely involved in conidiogenesis. Eighteen of such genes were identified, including characterized sporulation-specific chitinases and An15g02350, member of the recently identified carbohydrate-active enzyme family AA11. Eight of the eighteen genes were also expressed, independent of FlbA or BrlA, in vegetative mycelium, indicating that they also have a role during vegetative growth. The ΔflbA strain had a reduced specific growth rate, an increased chitin content of the cell wall and specific expression of genes that are induced in response to cell wall stress, indicating that integrity of the cell wall of strain ΔflbA is reduced. Conclusion The combination of the developmental mutants ΔflbA and ΔbrlA resulted in the identification of enzymes involved in cell wall recycling and sporulation-specific cell wall modification, which contributes to understanding cell wall remodeling mechanisms during development. PMID:25629352

  5. Role of Pseudomonas aeruginosa low-molecular-mass penicillin-binding proteins in AmpC expression, β-lactam resistance, and peptidoglycan structure.

    PubMed

    Ropy, Alaa; Cabot, Gabriel; Sánchez-Diener, Irina; Aguilera, Cristian; Moya, Bartolome; Ayala, Juan A; Oliver, Antonio

    2015-07-01

    This study aimed to characterize the role of Pseudomonas aeruginosa low-molecular-mass penicillin-binding proteins (LMM PBPs), namely, PBP4 (DacB), PBP5 (DacC), and PBP7 (PbpG), in peptidoglycan composition, β-lactam resistance, and ampC regulation. For this purpose, we constructed all single and multiple mutants of dacB, dacC, pbpG, and ampC from the wild-type P. aeruginosa PAO1 strain. Peptidoglycan composition was determined by high-performance liquid chromatography (HPLC), ampC expression by reverse transcription-PCR (RT-PCR), PBP patterns by a Bocillin FL-binding test, and antimicrobial susceptibility by MIC testing for a panel of β-lactams. Microscopy and growth rate analyses revealed no apparent major morphological changes for any of the mutants compared to the wild-type PAO1 strain. Of the single mutants, only dacC mutation led to significantly increased pentapeptide levels, showing that PBP5 is the major dd-carboxypeptidase in P. aeruginosa. Moreover, our results indicate that PBP4 and PBP7 play a significant role as dd-carboxypeptidase only if PBP5 is absent, and their dd-endopeptidase activity is also inferred. As expected, the inactivation of PBP4 led to a significant increase in ampC expression (around 50-fold), but, remarkably, the sequential inactivation of the three LMM PBPs produced a much greater increase (1,000-fold), which correlated with peptidoglycan pentapeptide levels. Finally, the β-lactam susceptibility profiles of the LMM PBP mutants correlated well with the ampC expression data. However, the inactivation of ampC in these mutants also evidenced a role of LMM PBPs, especially PBP5, in intrinsic β-lactam resistance. In summary, in addition to assessing the effect of P. aeruginosa LMM PBPs on peptidoglycan structure for the first time, we obtained results that represent a step forward in understanding the impact of these PBPs on β-lactam resistance, apparently driven by the interplay between their roles in AmpC induction, β-lactam trapping, and dd-carboxypeptidase/β-lactamase activity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish

    PubMed Central

    Kim, Seok-Hyung; Kowalski, Marie L.; Carson, Robert P.; Bridges, L. Richard; Ess, Kevin C.

    2013-01-01

    SUMMARY Tuberous sclerosis complex (TSC) is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1) kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors. PMID:23580196

  7. Airways in smooth muscle α-actin null mice experience a compensatory mechanism that modulates their contractile response.

    PubMed

    Shardonofsky, Felix R; Moore, Joan; Schwartz, Robert J; Boriek, Aladin M

    2012-03-01

    We hypothesized that ablation of smooth muscle α-actin (SM α-A), a contractile-cytoskeletal protein expressed in airway smooth muscle (ASM) cells, abolishes ASM shortening capacity and decreases lung stiffness. In both SM α-A knockout and wild-type (WT) mice, airway resistance (Raw) determined by the forced oscillation technique rose in response to intravenous methacholine (Mch). However, the slope of Raw (cmH(2)O·ml(-1)·s) vs. log(2) Mch dose (μg·kg(-1)·min(-1)) was lower (P = 0.007) in mutant (0.54 ± 0.14) than in WT mice (1.23 ± 0.19). RT-PCR analysis performed on lung tissues confirmed that mutant mice lacked SM α-A mRNA and showed that these mice had robust expressions of both SM γ-A mRNA and skeletal muscle (SKM) α-A mRNA, which were not expressed in WT mice, and an enhanced SM22 mRNA expression relative to that in WT mice. Compared with corresponding spontaneously breathing mice, mechanical ventilation-induced lung mechanical strain increased the expression of SM α-A mRNA in WT lungs; in mutant mice, it augmented the expressions of SM γ-A mRNA and SM22 mRNA and did not alter that of SKM α-A mRNA. In mutant mice, the expression of SM γ-A mRNA in the lung during spontaneous breathing and its enhanced expression following mechanical ventilation are consistent with the likely possibility that in the absence of SM α-A, SM γ-A underwent polymerization and interacted with smooth muscle myosin to produce ASM shortening during cholinergic stimulation. Thus our data are consistent with ASM in mutant mice experiencing compensatory mechanisms that modulated its contractile muscle capacity.

  8. Differential transcriptional activation by human T-cell leukemia virus type 1 Tax mutants is mediated by distinct interactions with CREB binding protein and p300.

    PubMed

    Bex, F; Yin, M J; Burny, A; Gaynor, R B

    1998-04-01

    The human T-cell leukemia virus type 1 Tax protein transforms human T lymphocytes, which can lead to the development of adult T-cell leukemia. Tax transformation is related to its ability to activate gene expression via the ATF/CREB and the NF-kappaB pathways. Transcriptional activation of these pathways is mediated by the actions of the related coactivators CREB binding protein (CBP) and p300. In this study, immunocytochemistry and confocal microscopy were used to localize CBP and p300 in cells expressing wild-type Tax or Tax mutants that are able to selectively activate gene expression from either the NF-kappaB or ATF/CREB pathway. Wild-type Tax colocalized with both CBP and p300 in nuclear bodies which also contained ATF-1 and the RelA subunit of NF-kappaB. However, a Tax mutant that selectively activates gene expression from only the ATF/CREB pathway colocalized with CBP but not p300, while a Tax mutant that selectively activates gene expression from only the NF-kappaB pathway colocalized with p300 but not CBP. In vitro and in vivo protein interaction studies indicated that the integrity of two independent domains of Tax delineated by these mutants was involved in the direct interaction of Tax with either CBP or p300. These studies are consistent with a model in which activation of either the NF-kappaB or the ATF/CREB pathway by specific Tax mutants is mediated by distinct interactions with related coactivator proteins.

  9. Distinct functions of capsid protein in assembly and movement of tobacco etch potyvirus in plants.

    PubMed Central

    Dolja, V V; Haldeman, R; Robertson, N L; Dougherty, W G; Carrington, J C

    1994-01-01

    Tobacco etch potyvirus engineered to express the reporter protein beta-glucuronidase (TEV-GUS) was used for direct observation and quantitation of virus translocation in plants. Four TEV-GUS mutants were generated containing capsid proteins (CPs) with single amino acid substitutions (R154D and D198R), a double substitution (DR), or a deletion of part of the N-terminal domain (delta N). Each modified virus replicated as well as the parental virus in protoplasts, but was defective in cell-to-cell movement through inoculated leaves. The R154D, D198R and DR mutants were restricted essentially to single, initially infected cells. The delta N variant exhibited slow cell-to-cell movement in inoculated leaves, but was unable to move systemically due to a lack of entry into or replication in vascular-associated cells. Both cell-to-cell and systemic movement defects of each mutant were rescued in transgenic plants expressing wild-type TEV CP. Cell-to-cell movement, but not systemic movement, of the DR mutant was rescued partially in transgenic plants expressing TEV CP lacking the C-terminal domain, and in plants expressing CP from the heterologous potyvirus, potato virus Y. Despite comparable levels of accumulation of parental virus and each mutant in symptomatic tissue of TEV CP-expressing transgenic plants, virions were detected only in parental virus- and delta N mutant-infected plants, as revealed using three independent assays. These data suggest that the potyvirus CP possesses distinct, separable activities required for virion assembly, cell-to-cell movement and long-distance transport. Images PMID:7511101

  10. Mutations in CIC and IDH1 cooperatively regulate 2-hydroxyglutarate levels and cell clonogenicity

    PubMed Central

    Chittaranjan, Suganthi; Chan, Susanna; Yang, Cindy; Yang, Kevin C.; Chen, Vincent; Moradian, Annie; Firme, Marlo; Song, Jungeun; Go, Nancy E.; Blough, Michael D.; Chan, Jennifer A.; Cairncross, J. Gregory; Gorski, Sharon M.; Morin, Gregg B.; Yip, Stephen; Marra, Marco A.

    2014-01-01

    The majority of oligodendrogliomas (ODGs) exhibit combined losses of chromosomes 1p and 19q and mutations of isocitrate dehydrogenase (IDH1-R132H or IDH2-R172K). Approximately 70% of ODGs with 1p19q co-deletions harbor somatic mutations in the Capicua Transcriptional Repressor (CIC) gene on chromosome 19q13.2. Here we show that endogenous long (CIC-L) and short (CIC-S) CIC proteins are predominantly localized to the nucleus or cytoplasm, respectively. Cytoplasmic CIC-S is found in close proximity to the mitochondria. To study wild type and mutant CIC function and motivated by the paucity of 1p19q co-deleted ODG lines, we created HEK293 and HOG stable cell lines ectopically co-expressing CIC and IDH1. Non-mutant lines displayed increased clonogenicity, but cells co-expressing the mutant IDH1-R132H with either CIC-S-R201W or -R1515H showed reduced clonogenicity in an additive manner, demonstrating cooperative effects in our assays. Expression of mutant CIC-R1515H increased cellular 2-Hydroxyglutarate (2HG) levels compared to wild type CIC in IDH1-R132H background. Levels of phosphorylated ATP-citrate Lyase (ACLY) were lower in cell lines expressing mutant CIC-S proteins compared to cells expressing wild type CIC-S, supporting a cytosolic citrate metabolism-related mechanism of reduced clonogenicity in our in vitro model systems. ACLY or phospho-ACLY were similarly reduced in CIC-mutant 1p19q co-deleted oligodendroglioma patient samples. PMID:25277207

  11. Reciprocal expression of integration host factor and HU in the developmental cycle and infectivity of Legionella pneumophila.

    PubMed

    Morash, Michael G; Brassinga, Ann Karen C; Warthan, Michelle; Gourabathini, Poornima; Garduño, Rafael A; Goodman, Steven D; Hoffman, Paul S

    2009-04-01

    Legionella pneumophila is an intracellular parasite of protozoa that differentiates late in infection into metabolically dormant cysts that are highly infectious. Regulation of this process is poorly understood. Here we report that the small DNA binding regulatory proteins integration host factor (IHF) and HU are reciprocally expressed over the developmental cycle, with HU expressed during exponential phase and IHF expressed postexponentially. To assess the role of these regulatory proteins in development, chromosomal deletions were constructed. Single (ihfA or ihfB) and double deletion (Deltaihf) IHF mutants failed to grow in Acanthamoeba castellanii unless complemented in trans when expressed temporally from the ihfA promoter but not under P(tac) (isopropyl-beta-d-thiogalactopyranoside). In contrast, IHF mutants were infectious for HeLa cells, though electron microscopic examination revealed defects in late-stage cyst morphogenesis (thickened cell wall, intracytoplasmic membranes, and inclusions of poly-beta-hydroxybutyrate), and were depressed for the developmental marker MagA. Green fluorescent protein promoter fusion assays indicated that IHF and the stationary-phase sigma factor RpoS were required for full postexponential expression of magA. Finally, defects in cyst morphogenesis noted for Deltaihf mutants in HeLa cells correlated with a loss of both detergent resistance and hyperinfectivity compared with results for wild-type cysts. These studies establish IHF and HU as markers of developmental stages and show that IHF function is required for both differentiation and full virulence of L. pneumophila in natural amoebic hosts.

  12. The expression of the genes involved in leucine catabolism of Pseudomonas aeruginosa is controlled by the transcriptional regulator LiuR and by the CbrAB/Crc system.

    PubMed

    Díaz-Pérez, Alma Laura; Núñez, Cinthia; Meza Carmen, Victor; Campos-García, Jesús

    2018-05-19

    Pseudomonas aeruginosa metabolizes leucine through the leucine/isovalerate utilization pathway, whose enzymes are encoded in the liuRABCDE gene cluster (liu). In this study, we investigated the role of the LiuR protein in the liu cluster regulation. Our results indicated that liu expression is regulated at the transcriptional level by LiuR. Mobility shift assays using purified recombinant His-tagged LiuR showed that it was able to bind at the promoter region of liuR, in a dose-dependent manner. Results revealed that expression of the liu operon is subjected to carbon catabolite repression control (CCR); protein LiuD was strongly expressed in the presence of leucine, but it was repressed in the presence of glucose or succinate. Furthermore, this CCR control was dependent on LiuR as in the liuR - mutant the LiuD protein was strongly expressed in all the carbon sources tested. In agreement with this result, in the absence of the Crc protein, LiuD was expressed independently of the carbon source used, whereas in a cbrB - mutant its expression was severely impaired. The results indicated that the liu cluster is subjected to a coordinated transcriptional and translational regulation by the LiuR repressor and by the CbrAB/Crc system, respectively, in response to the available carbon source. Copyright © 2018 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  13. AUXIN RESPONSE FACTOR17 Is Essential for Pollen Wall Pattern Formation in Arabidopsis1[C][W][OA

    PubMed Central

    Yang, Jun; Tian, Lei; Sun, Ming-Xi; Huang, Xue-Yong; Zhu, Jun; Guan, Yue-Feng; Jia, Qi-Shi; Yang, Zhong-Nan

    2013-01-01

    In angiosperms, pollen wall pattern formation is determined by primexine deposition on the microspores. Here, we show that AUXIN RESPONSE FACTOR17 (ARF17) is essential for primexine formation and pollen development in Arabidopsis (Arabidopsis thaliana). The arf17 mutant exhibited a male-sterile phenotype with normal vegetative growth. ARF17 was expressed in microsporocytes and microgametophytes from meiosis to the bicellular microspore stage. Transmission electron microscopy analysis showed that primexine was absent in the arf17 mutant, which leads to pollen wall-patterning defects and pollen degradation. Callose deposition was also significantly reduced in the arf17 mutant, and the expression of CALLOSE SYNTHASE5 (CalS5), the major gene for callose biosynthesis, was approximately 10% that of the wild type. Chromatin immunoprecipitation and electrophoretic mobility shift assays showed that ARF17 can directly bind to the CalS5 promoter. As indicated by the expression of DR5-driven green fluorescent protein, which is an synthetic auxin response reporter, auxin signaling appeared to be specifically impaired in arf17 anthers. Taken together, our results suggest that ARF17 is essential for pollen wall patterning in Arabidopsis by modulating primexine formation at least partially through direct regulation of CalS5 gene expression. PMID:23580594

  14. FLOOZY of petunia is a flavin mono-oxygenase-like protein required for the specification of leaf and flower architecture

    PubMed Central

    Tobeña-Santamaria, Rafael; Bliek, Mattijs; Ljung, Karin; Sandberg, Göran; Mol, Joseph N.M.; Souer, Erik; Koes, Ronald

    2002-01-01

    The mechanisms that determine the relative positions of floral organs, and thereby their numbers, is a poorly understood aspect of flower development. We isolated a petunia mutant, floozy (fzy), in which the formation of floral organ primordia in the outermost three floral whorls and one of the two bracts at the base of the flower is blocked at an early stage. In addition, fzy mutants fail to generate secondary veins in leaves and bracts and display a decreased apical dominance in the inflorescence. FZY encodes an enzyme with homology to flavin mono-oxygenases and appears to be the ortholog of YUCCA genes of Arabidopsis. FZY is expressed in young leafs and bracts and in developing flowers. In young floral meristems FZY is expressed in the center of the meristem dome and, later, expression becomes localized on the flanks of the initiating petal and stamen primordia and at several sites in maturing anthers and carpels. These findings indicate that FZY is involved in synthesizing a signaling compound that is required for floral organ initiation and specification of the vascularization pattern in leaves. Although fzy mutants contain normal auxin levels, ectopic expression of FZY results in excessive auxin accumulation, suggesting that the signaling compound is auxin. PMID:11914280

  15. cIAPs promote the proteasomal degradation of mutant SOD1 linked to familial amyotrophic lateral sclerosis.

    PubMed

    Choi, Jin Sun; Kim, Kidae; Lee, Do Hee; Cho, Sayeon; Ha, Jae Du; Park, Byoung Chul; Kim, Sunhong; Park, Sung Goo; Kim, Jeong-Hoon

    2016-11-18

    Although the ubiquitin-proteasome system is believed to play an important role in the pathogenesis of familial amyotrophic lateral sclerosis (FALS), caused by mutations in Cu/Zn-superoxide dismutase 1 (SOD1), the mechanism of how mutant SOD1 protein is regulated in cells is still poorly understood. Here we have demonstrated that cellular inhibitor of apoptosis proteins (cIAPs) are specifically associated with FALS-linked mutant SOD1 (mSOD1) and that this interaction promotes the ubiquitin-dependent proteasomal degradation of mutant SOD1. By utilizing cumate inducible SOD1 cells, we also showed that knock-down or pharmacologic depletion of cIAPs leads to H 2 O 2 induced cytotoxicity in mSOD1 expressing cells. Altogether, our results reveal a novel role of cIAPs in FALS-associated mutant SOD1 regulation. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Retinoic acid from the meninges regulates cortical neuron generation.

    PubMed

    Siegenthaler, Julie A; Ashique, Amir M; Zarbalis, Konstantinos; Patterson, Katelin P; Hecht, Jonathan H; Kane, Maureen A; Folias, Alexandra E; Choe, Youngshik; May, Scott R; Kume, Tsutomu; Napoli, Joseph L; Peterson, Andrew S; Pleasure, Samuel J

    2009-10-30

    Extrinsic signals controlling generation of neocortical neurons during embryonic life have been difficult to identify. In this study we demonstrate that the dorsal forebrain meninges communicate with the adjacent radial glial endfeet and influence cortical development. We took advantage of Foxc1 mutant mice with defects in forebrain meningeal formation. Foxc1 dosage and loss of meninges correlated with a dramatic reduction in both neuron and intermediate progenitor production and elongation of the neuroepithelium. Several types of experiments demonstrate that retinoic acid (RA) is the key component of this secreted activity. In addition, Rdh10- and Raldh2-expressing cells in the dorsal meninges were either reduced or absent in the Foxc1 mutants, and Rdh10 mutants had a cortical phenotype similar to the Foxc1 null mutants. Lastly, in utero RA treatment rescued the cortical phenotype in Foxc1 mutants. These results establish RA as a potent, meningeal-derived cue required for successful corticogenesis.

  17. Altered sexual and social behaviors in trp2 mutant mice

    PubMed Central

    Leypold, Bradley G.; Yu, C. Ron; Leinders-Zufall, Trese; Kim, Michelle M.; Zufall, Frank; Axel, Richard

    2002-01-01

    We have used gene targeting to generate mice with a homozygous deficiency in trp2, a cation channel expressed in the vomeronasal organ (VNO). Trp2 mutant animals reveal a striking reduction in the electrophysiological response to pheromones in the VNO, suggesting that trp2 plays a central role in mediating the pheromone response. These mutants therefore afford the opportunity to examine the role of the VNO in the generation of innate sexual and social behaviors in mice. Trp2 mutant males and nursing females are docile and fail to initiate aggressive attacks on intruder males. Male–female sexual behavior appears normal, but trp2 mutant males also vigorously mount other males. These results suggest that the cation channel trp2 is required in the VNO to detect male-specific pheromones that elicit aggressive behaviors and dictate the choice of sexual partners. PMID:11972034

  18. Quaternary ammonium salt N-(dodecyloxycarboxymethyl)-N,N,N-trimethyl ammonium chloride induced alterations in Saccharomyces cerevisiae physiology.

    PubMed

    Oblak, Ewa; Piecuch, Agata; Maciaszczyk-Dziubinska, Ewa; Wawrzycka, Donata

    2016-12-01

    We investigated the influence of the quaternary ammonium salt (QAS) called IM (N-(dodecyloxycarboxymethyl)- N,N,N-trimethyl ammonium chloride) on yeast cells of the parental strain and the IM-resistant mutant (EO25 IMR) growth. The phenotype of this mutant was pleiotropic. The IMR mutant exhibited resistance to ethanol, osmotic shock and oxidative stress, as well as increased sensitivity to UV. Moreover, it was noted that mutant EO25 appears to have an increased resistance to clotrimazole, ketoconazole, fluconazole, nystatin and cycloheximide. It also tolerated growth in the presence of crystal violet, DTT and metals (selenium, tin, arsenic). It was shown that the presence of IM decreased ergosterol level in mutant plasma membrane and increased its unsaturation. These results indicate changes in the cell lipid composition. Western blot analysis showed the induction of Pma1 level by IM. RT-PCR revealed an increased PMA1 expression after IM treatment.

  19. Novel Escherichia coli umuD′ Mutants: Structure-Function Insights into SOS Mutagenesis

    PubMed Central

    McLenigan, Mary; Peat, Thomas S.; Frank, Ekaterina G.; McDonald, John P.; Gonzalez, Martín; Levine, Arthur S.; Hendrickson, Wayne A.; Woodgate, Roger

    1998-01-01

    Although it has been 10 years since the discovery that the Escherichia coli UmuD protein undergoes a RecA-mediated cleavage reaction to generate mutagenically active UmuD′, the function of UmuD′ has yet to be determined. In an attempt to elucidate the role of UmuD′ in SOS mutagenesis, we have utilized a colorimetric papillation assay to screen for mutants of a hydroxylamine-treated, low-copy-number umuD′ plasmid that are unable to promote SOS-dependent spontaneous mutagenesis. Using such an approach, we have identified 14 independent umuD′ mutants. Analysis of these mutants revealed that two resulted from promoter changes which reduced the expression of wild-type UmuD′, three were nonsense mutations that resulted in a truncated UmuD′ protein, and the remaining nine were missense alterations. In addition to the hydroxylamine-generated mutants, we have subcloned the mutations found in three chromosomal umuD1, umuD44, and umuD77 alleles into umuD′. All 17 umuD′ mutants resulted in lower levels of SOS-dependent spontaneous mutagenesis but varied in the extent to which they promoted methyl methanesulfonate-induced mutagenesis. We have attempted to correlate these phenotypes with the potential effect of each mutation on the recently described structure of UmuD′. PMID:9721309

  20. The transcriptional response to the inactivation of the PaMpk1 and PaMpk2 MAP kinase pathways in Podospora anserina.

    PubMed

    Bidard, Frédérique; Coppin, Evelyne; Silar, Philippe

    2012-08-01

    Transcription pattern during mycelium growth of Podospora anserina was assayed by microarray analysis in wild type and in mutants affected in the MAP kinase genes PaMpk1 and PaMpk2 and in the NADPH oxidase gene PaNox1. 15% of the genes have their expression modified by a factor two or more as growth proceeds in wild type. The genes whose expression is modified during growth in P. anserina are either not conserved or differently regulated in Neurospora crassa and Aspergillus niger, two fungi for which transcriptome data during growth are available. The P. anserina mutants display a similar alteration of their transcriptome profile, with nearly 1000 genes affected similarly in the three mutants, accounting for their similar growth phenotypes. Yet, each mutant has its specific set of modified transcripts, in line with particular phenotypes exhibited by each mutant. Again, there is limited conservation during evolution of the genes regulated at the transcription level by MAP kinases, as indicated by the comparison the P. anserina data, with those of Aspergillus fumigatus and N. crassa, two fungi for which gene expression data are available for mutants of the MAPK pathways. Among the genes regulated in wild type and affected in the mutants, those involved in carbohydrate and secondary metabolisms appear prominent. The vast majority of the genes differentially expressed are of unknown function. Availability of their transcription profile at various stages of development should help to decipher their role in fungal physiology and development. Copyright © 2012 Elsevier Inc. All rights reserved.

Top