Isolation and Characterization of Mutants of Common Ice Plant Deficient in Crassulacean Acid Metabolism1[W][OA

PubMed Central

Cushman, John C.; Agarie, Sakae; Albion, Rebecca L.; Elliot, Stewart M.; Taybi, Tahar; Borland, Anne M.

2008-01-01

Crassulacean acid metabolism (CAM) is a specialized mode of photosynthesis that improves water use efficiency by shifting part or all of net atmospheric CO2 uptake to the night. Genetic dissection of regulatory and metabolic attributes of CAM has been limited by the difficulty of identifying a reliable phenotype for mutant screening. We developed a novel and simple colorimetric assay to measure leaf pH to screen fast neutron-mutagenized populations of common ice plant (Mesembryanthemum crystallinum), a facultative CAM species, to detect CAM-deficient mutants with limited nocturnal acidification. The isolated CAM-deficient mutants showed negligible net dark CO2 uptake compared with wild-type plants following the imposition of salinity stress. The mutants and wild-type plants accumulated nearly comparable levels of sodium in leaves, but the mutants grew more slowly than the wild-type plants. The mutants also had substantially reduced seed set and seed weight relative to wild type under salinity stress. Carbon-isotope ratios of seed collected from 4-month-old plants indicated that C3 photosynthesis made a greater contribution to seed production in mutants compared to wild type. The CAM-deficient mutants were deficient in leaf starch and lacked plastidic phosphoglucomutase, an enzyme critical for gluconeogenesis and starch formation, resulting in substrate limitation of nocturnal C4 acid formation. The restoration of nocturnal acidification by feeding detached leaves of salt-stressed mutants with glucose or sucrose supported this defect and served to illustrate the flexibility of CAM. The CAM-deficient mutants described here constitute important models for exploring regulatory features and metabolic consequences of CAM. PMID:18326789

Temporal dissection of K-ras(G12D) mutant in vitro and in vivo using a regulatable K-ras(G12D) mouse allele.

PubMed

Wang, Zuoyun; Feng, Yan; Bardeesy, Nabeel; Bardessy, Nabeel; Wong, Kwok-Kin; Liu, Xin-Yuan; Ji, Hongbin

2012-01-01

Animal models which allow the temporal regulation of gene activities are valuable for dissecting gene function in tumorigenesis. Here we have constructed a conditional inducible estrogen receptor-K-ras(G12D) (ER-K-ras(G12D)) knock-in mice allele that allows us to temporally switch on or off the activity of K-ras oncogenic mutant through tamoxifen administration. In vitro studies using mice embryonic fibroblast (MEF) showed that a dose of tamoxifen at 0.05 µM works optimally for activation of ER-K-ras(G12D) independent of the gender status. Furthermore, tamoxifen-inducible activation of K-ras(G12D) promotes cell proliferation, anchor-independent growth, transformation as well as invasion, potentially via activation of downstream MAPK pathway and cell cycle progression. Continuous activation of K-ras(G12D) in vivo by tamoxifen treatment is sufficient to drive the neoplastic transformation of normal lung epithelial cells in mice. Tamoxifen withdrawal after the tumor formation results in apoptosis and tumor regression in mouse lungs. Taken together, these data have convincingly demonstrated that K-ras mutant is essential for neoplastic transformation and this animal model may provide an ideal platform for further detailed characterization of the role of K-ras oncogenic mutant during different stages of lung tumorigenesis.

Dissecting the Role of CHITINASE-LIKE1 in Nitrate-Dependent Changes in Root Architecture1[C][W

PubMed Central

Hermans, Christian; Porco, Silvana; Vandenbussche, Filip; Gille, Sascha; De Pessemier, Jérôme; Van Der Straeten, Dominique; Verbruggen, Nathalie; Bush, Daniel R.

2011-01-01

The root phenotype of an Arabidopsis (Arabidopsis thaliana) mutant of CHITINASE-LIKE1 (CTL1), called arm (for anion-related root morphology), was previously shown to be conditional on growth on high nitrate, chloride, or sucrose. Mutants grown under restrictive conditions displayed inhibition of primary root growth, radial swelling, proliferation of lateral roots, and increased root hair density. We found here that the spatial pattern of CTL1 expression was mainly in the root and root tips during seedling development and that the protein localized to the cell wall. Fourier-transform infrared microspectroscopy of mutant root tissues indicated differences in spectra assigned to linkages in cellulose and pectin. Indeed, root cell wall polymer composition analysis revealed that the arm mutant contained less crystalline cellulose and reduced methylesterification of pectins. We also explored the implication of growth regulators on the phenotype of the mutant response to the nitrate supply. Exogenous abscisic acid application inhibited more drastically primary root growth in the arm mutant but failed to repress lateral branching compared with the wild type. Cytokinin levels were higher in the arm root, but there were no changes in mitotic activity, suggesting that cytokinin is not directly involved in the mutant phenotype. Ethylene production was higher in arm but inversely proportional to the nitrate concentration in the medium. Interestingly, eto2 and eto3 ethylene overproduction mutants mimicked some of the conditional root characteristics of the arm mutant on high nitrate. Our data suggest that ethylene may be involved in the arm mutant phenotype, albeit indirectly, rather than functioning as a primary signal. PMID:21949212

Probing transcription-specific outputs of β-catenin in vivo

PubMed Central

Valenta, Tomas; Gay, Max; Steiner, Sarah; Draganova, Kalina; Zemke, Martina; Hoffmans, Raymond; Cinelli, Paolo; Aguet, Michel; Sommer, Lukas; Basler, Konrad

2011-01-01

β-Catenin, apart from playing a cell-adhesive role, is a key nuclear effector of Wnt signaling. Based on activity assays in Drosophila, we generated mouse strains where the endogenous β-catenin protein is replaced by mutant forms, which retain the cell adhesion function but lack either or both of the N- and the C-terminal transcriptional outputs. The C-terminal activity is essential for mesoderm formation and proper gastrulation, whereas N-terminal outputs are required later during embryonic development. By combining the double-mutant β-catenin with a conditional null allele and a Wnt1-Cre driver, we probed the role of Wnt/β-catenin signaling in dorsal neural tube development. While loss of β-catenin protein in the neural tube results in severe cell adhesion defects, the morphology of cells and tissues expressing the double-mutant form is normal. Surprisingly, Wnt/β-catenin signaling activity only moderately regulates cell proliferation, but is crucial for maintaining neural progenitor identity and for neuronal differentiation in the dorsal spinal cord. Our model animals thus allow dissecting signaling and structural functions of β-catenin in vivo and provide the first genetic tool to generate cells and tissues that entirely and exclusively lack canonical Wnt pathway activity. PMID:22190459

Separating genetic and hemodynamic defects in neuropilin 1 knockout embryos.

PubMed

Jones, Elizabeth A V; Yuan, Li; Breant, Christine; Watts, Ryan J; Eichmann, Anne

2008-08-01

Targeted inactivation of genes involved in murine cardiovascular development frequently leads to abnormalities in blood flow. As blood fluid dynamics play a crucial role in shaping vessel morphology, the presence of flow defects generally prohibits the precise assignment of the role of the mutated gene product in the vasculature. In this study, we show how to distinguish between genetic defects caused by targeted inactivation of the neuropilin 1 (Nrp1) receptor and hemodynamic defects occurring in homozygous knockout embryos. Our analysis of a Nrp1 null allele bred onto a C57BL/6 background shows that vessel remodeling defects occur concomitantly with the onset of blood flow and cause death of homozygous mutants at E10.5. Using mouse embryo culture, we establish that hemodynamic defects are already present at E8.5 and continuous circulation is never established in homozygous mutants. The geometry of yolk sac blood vessels is altered and remodeling into yolk sac arteries and veins does not occur. To separate flow-induced deficiencies from those caused by the Nrp1 mutation, we arrested blood flow in cultured wild-type and mutant embryos and followed their vascular development. We find that loss of Nrp1 function rather than flow induces the altered geometry of the capillary plexus. Endothelial cell migration, but not replication, is altered in Nrp1 mutants. Gene expression analysis of endothelial cells isolated from freshly dissected wild-type and mutants and after culture in no-flow conditions showed down-regulation of the arterial marker genes connexin 40 and ephrin B2 related to the loss of Nrp1 function. This method allows genetic defects caused by loss-of-function of a gene important for cardiovascular development to be isolated even in the presence of hemodynamic defects.

Cancer-Associated Mutants of RNA Helicase DDX3X Are Defective in RNA-Stimulated ATP Hydrolysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Epling, Leslie B.; Grace, Christy R.; Lowe, Brandon R.

The DEAD-box RNA helicase DDX3X is frequently mutated in pediatric medulloblastoma. We dissect how these mutants affect DDX3X function with structural, biochemical, and genetic experiments. We identify an N-terminal extension (“ATP-binding loop”, ABL) that is critical for the stimulation of ATP hydrolysis by RNA. We present crystal structures suggesting that the ABL interacts dynamically with ATP and confirming that the interaction occurs in solution by NMR chemical shift perturbation and isothermal titration calorimetry. DEAD-box helicases require interaction between two conserved RecA-like helicase domains, D1 and D2 for function. We use NMR chemical shift perturbation to show that DDX3X interacts specificallymore » with double-stranded RNA through its D1 domain, with contact mediated by residues G302 and G325. Mutants of these residues, G302V and G325E, are associated with pediatric medulloblastoma. These mutants are defective in RNA-stimulated ATP hydrolysis. We show that DDX3X complements the growth defect in a ded1 temperature-sensitive strain of Schizosaccharomyces pombe, but the cancer-associated mutants G302V and G325E do not complement and exhibit protein expression defects. In conclusion, taken together, our results suggest that impaired translation of important mRNA targets by mutant DDX3X represents a key step in the development of medulloblastoma.« less

Cancer-Associated Mutants of RNA Helicase DDX3X Are Defective in RNA-Stimulated ATP Hydrolysis

DOE PAGES

Epling, Leslie B.; Grace, Christy R.; Lowe, Brandon R.; ...

2015-02-25

The DEAD-box RNA helicase DDX3X is frequently mutated in pediatric medulloblastoma. We dissect how these mutants affect DDX3X function with structural, biochemical, and genetic experiments. We identify an N-terminal extension (“ATP-binding loop”, ABL) that is critical for the stimulation of ATP hydrolysis by RNA. We present crystal structures suggesting that the ABL interacts dynamically with ATP and confirming that the interaction occurs in solution by NMR chemical shift perturbation and isothermal titration calorimetry. DEAD-box helicases require interaction between two conserved RecA-like helicase domains, D1 and D2 for function. We use NMR chemical shift perturbation to show that DDX3X interacts specificallymore » with double-stranded RNA through its D1 domain, with contact mediated by residues G302 and G325. Mutants of these residues, G302V and G325E, are associated with pediatric medulloblastoma. These mutants are defective in RNA-stimulated ATP hydrolysis. We show that DDX3X complements the growth defect in a ded1 temperature-sensitive strain of Schizosaccharomyces pombe, but the cancer-associated mutants G302V and G325E do not complement and exhibit protein expression defects. In conclusion, taken together, our results suggest that impaired translation of important mRNA targets by mutant DDX3X represents a key step in the development of medulloblastoma.« less

Effects of Spaceflight on Drosophila Neural Development

NASA Technical Reports Server (NTRS)

Keshishian, Haig S.

1997-01-01

The major goal from the animal side, however, has been achieved, namely to develop Drosophila lines where we can assay individual neuromuscular endings directly without dissection. This was achieved by means of using the GAL4-UAS system, where we have succeeded in establishing stocks of flies where the key neuromuscular connections can be assayed directly in undissected larvae by means of the expression of endogenously fluorescent reporters in the specific motor endings. The green fluorescent protein (GFP) as a reporter allows scoring of neural anatomy en-masse in whole mount using fluorescent microscopy without the need for either dissection or specific labeling. Two stocks have been developed. The first, which we developed first, uses the S65T mutant form, which has a dramatically brighter expression than the native protein. This animal will use GAL4 drivers with expression under the control of the elav gene, and which will ensure expression in all neurons of the embryo and larva. The second transgenic animal we have developed is of a novel kind, and makes use of dicistronic design, so that two copies of the protein will be expressed per insert. We have also developed a tricistronic form, but this has not yet been transformed into flies, and we do not imagine that this third line will be ready in time for the flight.

Constraints on somatosensory map development: mutants lead the way.

PubMed

Gaspar, Patricia; Renier, Nicolas

2018-05-09

In the rodent somatosensory system, the disproportionally large whisker representation and their specialization into barrel-shaped units in the different sensory relays has offered experimentalists with an ideal tool to identify mechanisms involved in brain map formation. These combine three intertwined constraints: Firstly, fasciculation of the incoming axons; secondly, early neural activity; finally, molecular patterning. Sophisticated genetic manipulations in mice have now allowed dissecting these mechanisms with greater accuracy. Here we discuss some recent papers that provided novel insights into how these different mapping rules and constraints interact to shape the barrel map. Copyright © 2018 Elsevier Ltd. All rights reserved.

Lung Squamous Cell Carcinoma Stem Cells as Immunotherapy Targets

DTIC Science & Technology

2017-08-01

will examine the importance of candidate genes in CSC activity using blocking antibodies, knockdown or CRISPR strategies coupled with transplantation...Aim 1. Engineer isogenic human and murine BRG1 mutant cell lines using CRISPR -Cas9 to dissect the mechanisms behind the sensitivity to combined EZH2

Popeye domain containing proteins are essential for stress-mediated modulation of cardiac pacemaking in mice

PubMed Central

Froese, Alexander; Breher, Stephanie S.; Waldeyer, Christoph; Schindler, Roland F.R.; Nikolaev, Viacheslav O.; Rinné, Susanne; Wischmeyer, Erhard; Schlueter, Jan; Becher, Jan; Simrick, Subreena; Vauti, Franz; Kuhtz, Juliane; Meister, Patrick; Kreissl, Sonja; Torlopp, Angela; Liebig, Sonja K.; Laakmann, Sandra; Müller, Thomas D.; Neumann, Joachim; Stieber, Juliane; Ludwig, Andreas; Maier, Sebastian K.; Decher, Niels; Arnold, Hans-Henning; Kirchhof, Paulus; Fabritz, Larissa; Brand, Thomas

2012-01-01

Cardiac pacemaker cells create rhythmic pulses that control heart rate; pacemaker dysfunction is a prevalent disorder in the elderly, but little is known about the underlying molecular causes. Popeye domain containing (Popdc) genes encode membrane proteins with high expression levels in cardiac myocytes and specifically in the cardiac pacemaking and conduction system. Here, we report the phenotypic analysis of mice deficient in Popdc1 or Popdc2. ECG analysis revealed severe sinus node dysfunction when freely roaming mutant animals were subjected to physical or mental stress. In both mutants, bradyarrhythmia developed in an age-dependent manner. Furthermore, we found that the conserved Popeye domain functioned as a high-affinity cAMP-binding site. Popdc proteins interacted with the potassium channel TREK-1, which led to increased cell surface expression and enhanced current density, both of which were negatively modulated by cAMP. These data indicate that Popdc proteins have an important regulatory function in heart rate dynamics that is mediated, at least in part, through cAMP binding. Mice with mutant Popdc1 and Popdc2 alleles are therefore useful models for the dissection of the mechanisms causing pacemaker dysfunction and could aid in the development of strategies for therapeutic intervention. PMID:22354168

Probing transcription-specific outputs of β-catenin in vivo.

PubMed

Valenta, Tomas; Gay, Max; Steiner, Sarah; Draganova, Kalina; Zemke, Martina; Hoffmans, Raymond; Cinelli, Paolo; Aguet, Michel; Sommer, Lukas; Basler, Konrad

2011-12-15

β-Catenin, apart from playing a cell-adhesive role, is a key nuclear effector of Wnt signaling. Based on activity assays in Drosophila, we generated mouse strains where the endogenous β-catenin protein is replaced by mutant forms, which retain the cell adhesion function but lack either or both of the N- and the C-terminal transcriptional outputs. The C-terminal activity is essential for mesoderm formation and proper gastrulation, whereas N-terminal outputs are required later during embryonic development. By combining the double-mutant β-catenin with a conditional null allele and a Wnt1-Cre driver, we probed the role of Wnt/β-catenin signaling in dorsal neural tube development. While loss of β-catenin protein in the neural tube results in severe cell adhesion defects, the morphology of cells and tissues expressing the double-mutant form is normal. Surprisingly, Wnt/β-catenin signaling activity only moderately regulates cell proliferation, but is crucial for maintaining neural progenitor identity and for neuronal differentiation in the dorsal spinal cord. Our model animals thus allow dissecting signaling and structural functions of β-catenin in vivo and provide the first genetic tool to generate cells and tissues that entirely and exclusively lack canonical Wnt pathway activity. © 2011 by Cold Spring Harbor Laboratory Press

The role of Candida albicans AP-1 protein against host derived ROS in in vivo models of infection.

PubMed

Jain, Charu; Pastor, Kelly; Gonzalez, Arely Y; Lorenz, Michael C; Rao, Reeta P

2013-01-01

Candida albicans is a major fungal pathogen of humans, causing mucosal infections that are difficult to eliminate and systemic infections that are often lethal primarily due to defects in the host's innate status. Here we demonstrate the utility of Caenorhabditis elegans, a model host to study innate immunity, by exploring the role of reactive oxygen species (ROS) as a critical innate response against C. albicans infections. Much like a human host, the nematode's innate immune response is activated to produce ROS in response to fungal infection. We use the C. albicans cap1 mutant, which is susceptible to ROS, as a tool to dissect this physiological innate immune response and show that cap1 mutants fail to cause disease and death, except in bli-3 mutant worms that are unable to produce ROS because of a defective NADPH oxidase. We further validate the ROS-mediated host defense mechanism in mammalian phagocytes by demonstrating that chemical inhibition of the NADPH oxidase in cultured macrophages enables the otherwise susceptible cap1 mutant to resists ROS-mediated phagolysis. Loss of CAP1 confers minimal attenuation of virulence in a disseminated mouse model, suggesting that CAP1-independent mechanisms contribute to pathogen survival in vivo. Our findings underscore a central theme in the process of infection-the intricate balance between the virulence strategies employed by C. albicans and the host's innate immune system and validates C. elegans as a simple model host to dissect this balance at the molecular level.

Cold-sensitive mutants G680V and G691C of Dictyostelium myosin II confer dramatically different biochemical defects.

PubMed

Patterson, B; Ruppel, K M; Wu, Y; Spudich, J A

1997-10-31

Cold-sensitive myosin mutants represent powerful tools for dissecting discrete deficiencies in myosin function. Biochemical characterization of two such mutants, G680V and G691C, has allowed us to identify separate facets of myosin motor function perturbed by each alteration. Compared with wild type, the G680V myosin exhibits a substantially enhanced affinity for several nucleotides, decreased ATPase activity, and overoccupancy or creation of a novel strongly actin-binding state. The properties of the novel strong binding state are consistent with a partial arrest or pausing at the onset of the mechanical stroke. The G691C mutant, on the other hand, exhibits an elevated basal ATPase indicative of premature phosphate release. By releasing phosphate without a requirement for actin binding, the G691C can bypass the part of the cycle involving the mechanical stroke. The two mutants, despite having alterations in glycine residues separated by only 11 residues, have dramatically different consequences on the mechanochemical cycle.

MIP-MAP: High-Throughput Mapping of Caenorhabditis elegans Temperature-Sensitive Mutants via Molecular Inversion Probes.

PubMed

Mok, Calvin A; Au, Vinci; Thompson, Owen A; Edgley, Mark L; Gevirtzman, Louis; Yochem, John; Lowry, Joshua; Memar, Nadin; Wallenfang, Matthew R; Rasoloson, Dominique; Bowerman, Bruce; Schnabel, Ralf; Seydoux, Geraldine; Moerman, Donald G; Waterston, Robert H

2017-10-01

Mutants remain a powerful means for dissecting gene function in model organisms such as Caenorhabditis elegans Massively parallel sequencing has simplified the detection of variants after mutagenesis but determining precisely which change is responsible for phenotypic perturbation remains a key step. Genetic mapping paradigms in C . elegans rely on bulk segregant populations produced by crosses with the problematic Hawaiian wild isolate and an excess of redundant information from whole-genome sequencing (WGS). To increase the repertoire of available mutants and to simplify identification of the causal change, we performed WGS on 173 temperature-sensitive (TS) lethal mutants and devised a novel mapping method. The mapping method uses molecular inversion probes (MIP-MAP) in a targeted sequencing approach to genetic mapping, and replaces the Hawaiian strain with a Million Mutation Project strain with high genomic and phenotypic similarity to the laboratory wild-type strain N2 We validated MIP-MAP on a subset of the TS mutants using a competitive selection approach to produce TS candidate mapping intervals with a mean size < 3 Mb. MIP-MAP successfully uses a non-Hawaiian mapping strain and multiplexed libraries are sequenced at a fraction of the cost of WGS mapping approaches. Our mapping results suggest that the collection of TS mutants contains a diverse library of TS alleles for genes essential to development and reproduction. MIP-MAP is a robust method to genetically map mutations in both viable and essential genes and should be adaptable to other organisms. It may also simplify tracking of individual genotypes within population mixtures. Copyright © 2017 by the Genetics Society of America.

MIP-MAP: High-Throughput Mapping of Caenorhabditis elegans Temperature-Sensitive Mutants via Molecular Inversion Probes

PubMed Central

Mok, Calvin A.; Au, Vinci; Thompson, Owen A.; Edgley, Mark L.; Gevirtzman, Louis; Yochem, John; Lowry, Joshua; Memar, Nadin; Wallenfang, Matthew R.; Rasoloson, Dominique; Bowerman, Bruce; Schnabel, Ralf; Seydoux, Geraldine; Moerman, Donald G.; Waterston, Robert H.

2017-01-01

Mutants remain a powerful means for dissecting gene function in model organisms such as Caenorhabditis elegans. Massively parallel sequencing has simplified the detection of variants after mutagenesis but determining precisely which change is responsible for phenotypic perturbation remains a key step. Genetic mapping paradigms in C. elegans rely on bulk segregant populations produced by crosses with the problematic Hawaiian wild isolate and an excess of redundant information from whole-genome sequencing (WGS). To increase the repertoire of available mutants and to simplify identification of the causal change, we performed WGS on 173 temperature-sensitive (TS) lethal mutants and devised a novel mapping method. The mapping method uses molecular inversion probes (MIP-MAP) in a targeted sequencing approach to genetic mapping, and replaces the Hawaiian strain with a Million Mutation Project strain with high genomic and phenotypic similarity to the laboratory wild-type strain N2. We validated MIP-MAP on a subset of the TS mutants using a competitive selection approach to produce TS candidate mapping intervals with a mean size < 3 Mb. MIP-MAP successfully uses a non-Hawaiian mapping strain and multiplexed libraries are sequenced at a fraction of the cost of WGS mapping approaches. Our mapping results suggest that the collection of TS mutants contains a diverse library of TS alleles for genes essential to development and reproduction. MIP-MAP is a robust method to genetically map mutations in both viable and essential genes and should be adaptable to other organisms. It may also simplify tracking of individual genotypes within population mixtures. PMID:28827289

Dissecting a complex chemical stress: chemogenomic profiling of plant hydrolysates

PubMed Central

Skerker, Jeffrey M; Leon, Dacia; Price, Morgan N; Mar, Jordan S; Tarjan, Daniel R; Wetmore, Kelly M; Deutschbauer, Adam M; Baumohl, Jason K; Bauer, Stefan; Ibáñez, Ana B; Mitchell, Valerie D; Wu, Cindy H; Hu, Ping; Hazen, Terry; Arkin, Adam P

2013-01-01

The efficient production of biofuels from cellulosic feedstocks will require the efficient fermentation of the sugars in hydrolyzed plant material. Unfortunately, plant hydrolysates also contain many compounds that inhibit microbial growth and fermentation. We used DNA-barcoded mutant libraries to identify genes that are important for hydrolysate tolerance in both Zymomonas mobilis (44 genes) and Saccharomyces cerevisiae (99 genes). Overexpression of a Z. mobilis tolerance gene of unknown function (ZMO1875) improved its specific ethanol productivity 2.4-fold in the presence of miscanthus hydrolysate. However, a mixture of 37 hydrolysate-derived inhibitors was not sufficient to explain the fitness profile of plant hydrolysate. To deconstruct the fitness profile of hydrolysate, we profiled the 37 inhibitors against a library of Z. mobilis mutants and we modeled fitness in hydrolysate as a mixture of fitness in its components. By examining outliers in this model, we identified methylglyoxal as a previously unknown component of hydrolysate. Our work provides a general strategy to dissect how microbes respond to a complex chemical stress and should enable further engineering of hydrolysate tolerance. PMID:23774757

Defects in middle ear cavitation cause conductive hearing loss in the Tcof1 mutant mouse.

PubMed

Richter, Carol A; Amin, Susan; Linden, Jennifer; Dixon, Jill; Dixon, Michael J; Tucker, Abigail S

2010-04-15

Conductive hearing loss (CHL) is one of the most common forms of human deafness. Despite this observation, a surprising gap in our understanding of the mechanisms underlying CHL remains, particularly with respect to the molecular mechanisms underlying middle ear development and disease. Treacher Collins syndrome (TCS) is an autosomal dominant disorder of facial development that results from mutations in the gene TCOF1. CHL is a common feature of TCS but the causes of the hearing defect have not been studied. In this study, we have utilized Tcof1 mutant mice to dissect the developmental mechanisms underlying CHL. Our results demonstrate that effective cavitation of the middle ear is intimately linked to growth of the auditory bulla, the neural crest cell-derived structure that encapsulates all middle ear components, and that defects in these processes have a profoundly detrimental effect on hearing. This research provides important insights into a poorly characterized cause of human deafness, and provides the first mouse model for the study of middle ear cavity defects, while also being of direct relevance to a human genetic disorder.

Three-dimensional microCT imaging of murine embryonic development from immediate post-implantation to organogenesis: application for phenotyping analysis of early embryonic lethality in mutant animals.

PubMed

Ermakova, Olga; Orsini, Tiziana; Gambadoro, Alessia; Chiani, Francesco; Tocchini-Valentini, Glauco P

2018-04-01

In this work, we applied three-dimensional microCT imaging to study murine embryogenesis in the range from immediate post-implantation period (embryonic day 5.5) to mid-gestation (embryonic day 12.5) with the resolution up to 1.4 µm/voxel. Also, we introduce an imaging procedure for non-invasive volumetric estimation of an entire litter of embryos within the maternal uterine structures. This method allows for an accurate, detailed and systematic morphometric analysis of both embryonic and extra-embryonic components during embryogenesis. Three-dimensional imaging of unperturbed embryos was performed to visualize the egg cylinder, primitive streak, gastrulation and early organogenesis stages of murine development in the C57Bl6/N mouse reference strain. Further, we applied our microCT imaging protocol to determine the earliest point when embryonic development is arrested in a mouse line with knockout for tRNA splicing endonuclease subunit Tsen54 gene. Our analysis determined that the embryonic development in Tsen54 null embryos does not proceed beyond implantation. We demonstrated that application of microCT imaging to entire litter of non-perturbed embryos greatly facilitate studies to unravel gene function during early embryogenesis and to determine the precise point at which embryonic development is arrested in mutant animals. The described method is inexpensive, does not require lengthy embryos dissection and can be applicable for detailed analysis of mutant mice at laboratory scale as well as for high-throughput projects.

Sultr4;1 mutant seeds of Arabidopsis have an enhanced sulphate content and modified proteome suggesting metabolic adaptations to altered sulphate compartmentalization

PubMed Central

2010-01-01

Background Sulphur is an essential macronutrient needed for the synthesis of many cellular components. Sulphur containing amino acids and stress response-related compounds, such as glutathione, are derived from reduction of root-absorbed sulphate. Sulphate distribution in cell compartments necessitates specific transport systems. The low-affinity sulphate transporters SULTR4;1 and SULTR4;2 have been localized to the vacuolar membrane, where they may facilitate sulphate efflux from the vacuole. Results In the present study, we demonstrated that the Sultr4;1 gene is expressed in developing Arabidopsis seeds to a level over 10-fold higher than the Sultr4;2 gene. A characterization of dry mature seeds from a Sultr4;1 T-DNA mutant revealed a higher sulphate content, implying a function for this transporter in developing seeds. A fine dissection of the Sultr4;1 seed proteome identified 29 spots whose abundance varied compared to wild-type. Specific metabolic features characteristic of an adaptive response were revealed, such as an up-accumulation of various proteins involved in sugar metabolism and in detoxification processes. Conclusions This study revealed a role for SULTR4;1 in determining sulphate content of mature Arabidopsis seeds. Moreover, the adaptive response of sultr4;1 mutant seeds as revealed by proteomics suggests a function of SULTR4;1 in redox homeostasis, a mechanism that has to be tightly controlled during development of orthodox seeds. PMID:20426829

Genetic Dissection of Midbrain Dopamine Neuron Development in vivo

PubMed Central

Ellisor, Debra; Rieser, Caroline; Voelcker, Bettina; Machan, Jason T.; Zervas, Mark

2012-01-01

Midbrain dopamine (MbDA) neurons are partitioned into medial and lateral cohorts that control complex functions. However, the genetic underpinnings of MbDA neuron heterogeneity are unclear. While it is known that Wnt1-expressing progenitors contribute to MbDA neurons, the role of Wnt1 in MbDA neuron development in vivo is unresolved. We show that mice with a spontaneous point mutation in Wnt1 have a unique phenotype characterized by the loss of medial MbDA neurons concomitant with a severe depletion of Wnt1-expressing progenitors and diminished LMX1a-expressing progenitors. Wnt1 mutant embryos also have alterations in a hierarchical gene regulatory loop suggesting multiple gene involvement in the Wnt1 mutant MbDA neuron phenotype. To investigate this possibility, we conditionally deleted Gbx2, Fgf8, and En1/2 after their early role in patterning and asked whether these genetic manipulations phenocopied the depletion of MbDA neurons in Wnt1 mutants. The conditional deletion of Gbx2 did not result in re-positioning or distribution of MbDA neurons. The temporal deletion of Fgf8 did not result in the loss of either LMX1a-expressing progenitors nor the initial population of differentiated MbDA neurons, but did result in a complete loss of MbDA neurons at later stages. The temporal deletion and species specific manipulation of En1/2 demonstrated a continued and species specific role of Engrailed genes in MbDA neuron development. Notably, our conditional deletion experiments revealed phenotypes dissimilar to Wnt1 mutants indicating the unique role of Wnt1 in MbDA neuron development. By placing Wnt1, Fgf8, and En1/2 in the context of their temporal requirement for MbDA neuron development, we further deciphered the developmental program underpinning MbDA neuron progenitors. PMID:23041116

A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

PubMed

Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

2002-08-22

A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

Plants, plant pathogens, and microgravity--a deadly trio.

PubMed

Leach, J E; Ryba-White, M; Sun, Q; Wu, C J; Hilaire, E; Gartner, C; Nedukha, O; Kordyum, E; Keck, M; Leung, H; Guikema, J A

2001-06-01

Plants grown in spaceflight conditions are more susceptible to colonization by plant pathogens. The underlying causes for this enhanced susceptibility are not known. Possibly the formation of structural barriers and the activation of plant defense response components are impaired in spaceflight conditions. Either condition would result from altered gene expression of the plant. Because of the tools available, past studies focused on a few physiological responses or biochemical pathways. With recent advances in genomics research, new tools, including microarray technologies, are available to examine the global impact of growth in the spacecraft on the plant's gene expression profile. In ground-based studies, we have developed cDNA subtraction libraries of rice that are enriched for genes induced during pathogen infection and the defense response. Arrays of these genes are being used to dissect plant defense response pathways in a model system involving wild-type rice plants and lesion mimic mutants. The lesion mimic mutants are ideal experimental tools because they erratically develop defense response-like lesions in the absence of pathogens. The gene expression profiles from these ground-based studies will provide the molecular basis for understanding the biochemical and physiological impacts of spaceflight on plant growth, development and disease defense responses. This, in turn, will allow the development of strategies to manage plant disease for life in the space environment.

Plants, plant pathogens, and microgravity--a deadly trio

NASA Technical Reports Server (NTRS)

Leach, J. E.; Ryba-White, M.; Sun, Q.; Wu, C. J.; Hilaire, E.; Gartner, C.; Nedukha, O.; Kordyum, E.; Keck, M.; Leung, H.;

Isolation and characterization of Arabidopsis mutants defective in the induction of ethylene biosynthesis by cytokinin

NASA Technical Reports Server (NTRS)

Vogel, J. P.; Schuerman, P.; Woeste, K.; Brandstatter, I.; Kieber, J. J.; Evans, M. L. (Principal Investigator)

1998-01-01

Cytokinins elevate ethylene biosynthesis in etiolated Arabidopsis seedlings via a post-transcriptional modification of one isoform of the key biosynthetic enzyme ACC synthase. In order to begin to dissect the signaling events leading from cytokinin perception to this modification, we have isolated a series of mutants that lack the ethylene-mediated triple response in the presence of cytokinin due to their failure to increase ethylene biosynthesis. Analysis of genetic complementation and mapping revealed that these Cin mutants (cytokinin-insensitive) represent four distinct complementation groups, one of which, cin4, is allelic to the constitutive photomorphogenic mutant fus9/cop10. The Cin mutants have subtle effects on the morphology of adult plants. We further characterized the Cin mutants by analyzing ethylene biosynthesis in response to various other inducers and in adult tissues, as well as by assaying additional cytokinin responses. The cin3 mutant did not disrupt ethylene biosynthesis under any other conditions, nor did it disrupt any other cytokinin responses. Only cin2 disrupted ethylene biosynthesis in multiple circumstances. cin1 and cin2 made less anthocyanin in response to cytokinin. cin1 also displayed reduced shoot initiation in tissue culture in response to cytokinin, suggesting that it affects a cytokinin signaling element.

Dissecting the Mechanisms of Drug Resistance in BRCA1/2-Mutant Breast Cancers

DTIC Science & Technology

2017-10-01

LPS (25 mg/ml), IL-4(5 ng/ml) and RP105 (0.5 mg/ml). PAR levels in stimulated B cells were analyzed on day 3 by ELISA . *pɘ.05. 4...cells reproducibly by ELISA (Figure 1). PARPs are NAD+-dependent enzymes and thus require a source of NAD+ in all cellular compartments in which

A novel computational approach for simultaneous tracking and feature extraction of C. elegans populations in fluid environments.

PubMed

Tsechpenakis, Gabriel; Bianchi, Laura; Metaxas, Dimitris; Driscoll, Monica

2008-05-01

The nematode Caenorhabditis elegans (C. elegans) is a genetic model widely used to dissect conserved basic biological mechanisms of development and nervous system function. C. elegans locomotion is under complex neuronal regulation and is impacted by genetic and environmental factors; thus, its analysis is expected to shed light on how genetic, environmental, and pathophysiological processes control behavior. To date, computer-based approaches have been used for analysis of C. elegans locomotion; however, none of these is both high resolution and high throughput. We used computer vision methods to develop a novel automated approach for analyzing the C. elegans locomotion. Our method provides information on the position, trajectory, and body shape during locomotion and is designed to efficiently track multiple animals (C. elegans) in cluttered images and under lighting variations. We used this method to describe in detail C. elegans movement in liquid for the first time and to analyze six unc-8, one mec-4, and one odr-1 mutants. We report features of nematode swimming not previously noted and show that our method detects differences in the swimming profile of mutants that appear at first glance similar.

Functional dissection of the paired domain of Pax6 reveals molecular mechanisms of coordinating neurogenesis and proliferation

PubMed Central

Walcher, Tessa; Xie, Qing; Sun, Jian; Irmler, Martin; Beckers, Johannes; Öztürk, Timucin; Niessing, Dierk; Stoykova, Anastassia; Cvekl, Ales; Ninkovic, Jovica; Götz, Magdalena

2013-01-01

To achieve adequate organ development and size, cell proliferation and differentiation have to be tightly regulated and coordinated. The transcription factor Pax6 regulates patterning, neurogenesis and proliferation in forebrain development. The molecular basis of this regulation is not well understood. As the bipartite DNA-binding paired domain of Pax6 regulates forebrain development, we examined mice with point mutations in its individual DNA-binding subdomains PAI (Pax6Leca4, N50K) and RED (Pax6Leca2, R128C). This revealed distinct roles in regulating proliferation in the developing cerebral cortex, with the PAI and RED subdomain mutations reducing and increasing, respectively, the number of mitoses. Conversely, neurogenesis was affected only by the PAI subdomain mutation, phenocopying the neurogenic defects observed in full Pax6 mutants. Genome-wide expression profiling identified molecularly discrete signatures of Pax6Leca4 and Pax6Leca2 mutations. Comparison to Pax6 targets identified by chromatin immunoprecipitation led to the identification and functional characterization of distinct DNA motifs in the promoters of target genes dysregulated in the Pax6Leca2 or Pax6Leca4 mutants, further supporting the distinct regulatory functions of the DNA-binding subdomains. Thus, Pax6 achieves its key roles in the developing forebrain by utilizing particular subdomains to coordinate patterning, neurogenesis and proliferation simultaneously. PMID:23404109

Immunostaining of dissected zebrafish embryonic heart.

PubMed

Yang, Jingchun; Xu, Xiaolei

2012-01-10

Zebrafish embryo becomes a popular in vivo vertebrate model for studying cardiac development and human heart diseases due to its advantageous embryology and genetics. About 100-200 embryos are readily available every week from a single pair of adult fish. The transparent embryos that develop ex utero make them ideal for assessing cardiac defects. The expression of any gene can be manipulated via morpholino technology or RNA injection. Moreover, forward genetic screens have already generated a list of mutants that affect different perspectives of cardiogenesis. Whole mount immunostaining is an important technique in this animal model to reveal the expression pattern of the targeted protein to a particular tissue. However, high resolution images that can reveal cellular or subcellular structures have been difficult, mainly due to the physical location of the heart and the poor penetration of the antibodies. Here, we present a method to address these bottlenecks by dissecting heart first and then conducting the staining process on the surface of a microscope slide. To prevent the loss of small heart samples and to facilitate solution handling, we restricted the heart samples within a circle on the surface of the microscope slides drawn by an immEdge pen. After the staining, the fluorescence signals can be directly observed by a compound microscope. Our new method significantly improves the penetration for antibodies, since a heart from an embryonic fish only consists of few cell layers. High quality images from intact hearts can be obtained within a much reduced procession time for zebrafish embryos aged from day 2 to day 6. Our method can be potentially extended to stain other organs dissected from either zebrafish or other small animals. Copyright © 2012 Journal of Visualized Experiments

Proteomic profiling of maize opaque endosperm mutants reveals selective accumulation of lysine-enriched proteins

PubMed Central

Morton, Kyla J.; Jia, Shangang; Zhang, Chi; Holding, David R.

2016-01-01

Reduced prolamin (zein) accumulation and defective endoplasmic reticulum (ER) body formation occurs in maize opaque endosperm mutants opaque2 (o2), floury2 (fl2), defective endosperm*B30 (DeB30), and Mucronate (Mc), whereas other opaque mutants such as opaque1 (o1) and floury1 (fl1) are normal in these regards. This suggests that other factors contribute to kernel texture. A liquid chromatography approach coupled with tandem mass spectrometry (LC-MS/MS) proteomics was used to compare non-zein proteins of nearly isogenic opaque endosperm mutants. In total, 2762 proteins were identified that were enriched for biological processes such as protein transport and folding, amino acid biosynthesis, and proteolysis. Principal component analysis and pathway enrichment suggested that the mutants partitioned into three groups: (i) Mc, DeB30, fl2 and o2; (ii) o1; and (iii) fl1. Indicator species analysis revealed mutant-specific proteins, and highlighted ER secretory pathway components that were enriched in selected groups of mutants. The most significantly changed proteins were related to stress or defense and zein partitioning into the soluble fraction for Mc, DeB30, o1, and fl1 specifically. In silico dissection of the most significantly changed proteins revealed novel qualitative changes in lysine abundance contributing to the overall lysine increase and the nutritional rebalancing of the o2 and fl2 endosperm. PMID:26712829

Loose Panicle1 encoding a novel WRKY transcription factor, regulates panicle development, stem elongation, and seed size in foxtail millet [Setaria italica (L.) P. Beauv.].

PubMed

Xiang, Jishan; Tang, Sha; Zhi, Hui; Jia, Guanqing; Wang, Huajun; Diao, Xianmin

2017-01-01

Panicle development is an important agronomic trait that aids in determining crop productivity. Foxtail millet and its wild ancestor green foxtail have recently been used as model systems to dissect gene functions. Here, we characterized a recessive mutant of foxtail millet, loose-panicle 1 (lp1), which showed pleiotropic phenotypes, such as a lax primary branching pattern, aberrant branch morphology, semi-dwarfism, and enlarged seed size. The loose panicle phenotype was attributed to increased panicle lengths and decreased primary branch numbers. Map-based cloning, combined with high-throughput sequencing, revealed that LP1, which encodes a novel WRKY transcription factor, is responsible for the mutant phenotype. A phylogenetic analysis revealed that LP1 belongs to the Group I WRKY subfamily, which possesses two WRKY domains (WRKY I and II). A single G-to-A transition in the fifth intron of LP1 resulted in three disorganized splicing events in mutant plants. For each of these aberrant splice variants, the normal C2H2 motif in the WRKY II domain was completely disrupted, resulting in a loss-of-function mutation. LP1 mRNA was expressed in all of the tissues examined, with higher expression levels observed in inflorescences, roots, and seeds at the grain-filling stage. A subcellular localization analysis showed that LP1 predominantly accumulated in the nucleus, which confirmed its role as a transcriptional regulator. This study provides novel insights into the roles of WRKY proteins in regulating reproductive organ development in plants and may help to develop molecular markers associated with crop yields.

Dissecting hematopoietic and renal cell heterogeneity in adult zebrafish at single-cell resolution using RNA sequencing.

PubMed

Tang, Qin; Iyer, Sowmya; Lobbardi, Riadh; Moore, John C; Chen, Huidong; Lareau, Caleb; Hebert, Christine; Shaw, McKenzie L; Neftel, Cyril; Suva, Mario L; Ceol, Craig J; Bernards, Andre; Aryee, Martin; Pinello, Luca; Drummond, Iain A; Langenau, David M

2017-10-02

Recent advances in single-cell, transcriptomic profiling have provided unprecedented access to investigate cell heterogeneity during tissue and organ development. In this study, we used massively parallel, single-cell RNA sequencing to define cell heterogeneity within the zebrafish kidney marrow, constructing a comprehensive molecular atlas of definitive hematopoiesis and functionally distinct renal cells found in adult zebrafish. Because our method analyzed blood and kidney cells in an unbiased manner, our approach was useful in characterizing immune-cell deficiencies within DNA-protein kinase catalytic subunit ( prkdc ), interleukin-2 receptor γ a ( il2rga ), and double-homozygous-mutant fish, identifying blood cell losses in T, B, and natural killer cells within specific genetic mutants. Our analysis also uncovered novel cell types, including two classes of natural killer immune cells, classically defined and erythroid-primed hematopoietic stem and progenitor cells, mucin-secreting kidney cells, and kidney stem/progenitor cells. In total, our work provides the first, comprehensive, single-cell, transcriptomic analysis of kidney and marrow cells in the adult zebrafish. © 2017 Tang et al.

Dissecting hematopoietic and renal cell heterogeneity in adult zebrafish at single-cell resolution using RNA sequencing

PubMed Central

Iyer, Sowmya; Lobbardi, Riadh; Chen, Huidong; Hebert, Christine; Shaw, McKenzie L.; Neftel, Cyril; Suva, Mario L.; Bernards, Andre; Aryee, Martin; Drummond, Iain A.

2017-01-01

Recent advances in single-cell, transcriptomic profiling have provided unprecedented access to investigate cell heterogeneity during tissue and organ development. In this study, we used massively parallel, single-cell RNA sequencing to define cell heterogeneity within the zebrafish kidney marrow, constructing a comprehensive molecular atlas of definitive hematopoiesis and functionally distinct renal cells found in adult zebrafish. Because our method analyzed blood and kidney cells in an unbiased manner, our approach was useful in characterizing immune-cell deficiencies within DNA–protein kinase catalytic subunit (prkdc), interleukin-2 receptor γ a (il2rga), and double-homozygous–mutant fish, identifying blood cell losses in T, B, and natural killer cells within specific genetic mutants. Our analysis also uncovered novel cell types, including two classes of natural killer immune cells, classically defined and erythroid-primed hematopoietic stem and progenitor cells, mucin-secreting kidney cells, and kidney stem/progenitor cells. In total, our work provides the first, comprehensive, single-cell, transcriptomic analysis of kidney and marrow cells in the adult zebrafish. PMID:28878000

Natural variation of potato allene oxide synthase 2 causes differential levels of jasmonates and pathogen resistance in Arabidopsis

PubMed Central

Pajerowska-Mukhtar, Karolina M.; Mukhtar, M. Shahid; Guex, Nicolas; Halim, Vincentius A.; Rosahl, Sabine; Somssich, Imre E.

2008-01-01

Natural variation of plant pathogen resistance is often quantitative. This type of resistance can be genetically dissected in quantitative resistance loci (QRL). To unravel the molecular basis of QRL in potato (Solanum tuberosum), we employed the model plant Arabidopsis thaliana for functional analysis of natural variants of potato allene oxide synthase 2 (StAOS2). StAOS2 is a candidate gene for QRL on potato chromosome XI against the oömycete Phytophthora infestans causing late blight, and the bacterium Erwinia carotovora ssp. atroseptica causing stem black leg and tuber soft rot, both devastating diseases in potato cultivation. StAOS2 encodes a cytochrome P450 enzyme that is essential for biosynthesis of the defense signaling molecule jasmonic acid. Allele non-specific dsRNAi-mediated silencing of StAOS2 in potato drastically reduced jasmonic acid production and compromised quantitative late blight resistance. Five natural StAOS2 alleles were expressed in the null Arabidopsis aos mutant under control of the Arabidopsis AOS promoter and tested for differential complementation phenotypes. The aos mutant phenotypes evaluated were lack of jasmonates, male sterility and susceptibility to Erwinia carotovora ssp. carotovora. StAOS2 alleles that were associated with increased disease resistance in potato complemented all aos mutant phenotypes better than StAOS2 alleles associated with increased susceptibility. First structure models of ‘quantitative resistant’ versus ‘quantitative susceptible’ StAOS2 alleles suggested potential mechanisms for their differential activity. Our results demonstrate how a candidate gene approach in combination with using the homologous Arabidopsis mutant as functional reporter can help to dissect the molecular basis of complex traits in non model crop plants. Electronic supplementary material The online version of this article (doi:10.1007/s00425-008-0737-x) contains supplementary material, which is available to authorized users. PMID:18431595

A Toxoplasma MORN1 Null Mutant Undergoes Repeated Divisions but Is Defective in Basal Assembly, Apicoplast Division and Cytokinesis

PubMed Central

Lorestani, Alexander; Sheiner, Lilach; Yang, Kevin; Robertson, Seth D.; Sahoo, Nivedita; Brooks, Carrie F.; Ferguson, David J. P.; Striepen, Boris; Gubbels, Marc-Jan

2010-01-01

The membrane occupation and recognition nexus protein 1 (MORN1) is highly conserved among apicomplexan parasites and is associated with several structures that have a role in cell division. Here we dissected the role of MORN1 using the relatively simple budding process of Toxoplasma gondii as a model. Ablation of MORN1 in a conditional null mutant resulted in pronounced defects suggesting a central role for MORN1 in apicoplast segregation and in daughter cell budding. Lack of MORN1 resulted in double-headed parasites. These Janus-headed parasites form two complete apical complexes but fail to assemble a basal complex. Moreover, these parasites were capable of undergoing several more budding rounds resulting in the formation of up to 16-headed parasites conjoined at the basal end. Despite this segregation defect, the mother's cytoskeleton was completely disassembled in every budding round. Overall this argues that successful completion of the budding is not required for cell cycle progression. None of the known basal complex components, including a set of recently identified inner membrane complex (IMC) proteins, localized correctly in these multi-headed parasites. These data suggest that MORN1 is essential for assembly of the basal complex, and that lack of the basal complex abolishes the contractile capacity assigned to the basal complex late in daughter formation. Consistent with this hypothesis we observe that MORN1 mutants fail to efficiently constrict and divide the apicoplast. We used the null background provided by the mutant to dissect the function of subdomains of the MORN1 protein. This demonstrated that deletion of a single MORN domain already prevented the function of MORN1 whereas a critical role for the short linker between MORN domains 6 and 7 was identified. In conclusion, MORN1 is required for basal complex assembly and loss of MORN1 results in defects in apicoplast division and daughter segregation. PMID:20808817

Four Genes of Medicago truncatula Controlling Components of a Nod Factor Transduction Pathway

PubMed Central

Catoira, Romy; Galera, Christine; de Billy, Francoise; Penmetsa, R. Varma; Journet, Etienne-Pascal; Maillet, Fabienne; Rosenberg, Charles; Cook, Douglas; Gough, Clare; Dénarié, Jean

2000-01-01

Rhizobium nodulation (Nod) factors are lipo-chitooligosaccharides that act as symbiotic signals, eliciting several key developmental responses in the roots of legume hosts. Using nodulation-defective mutants of Medicago truncatula, we have started to dissect the genetic control of Nod factor transduction. Mutants in four genes (DMI1, DMI2, DMI3, and NSP) were pleiotropically affected in Nod factor responses, indicating that these genes are required for a Nod factor–activated signal transduction pathway that leads to symbiotic responses such as root hair deformations, expressions of nodulin genes, and cortical cell divisions. Mutant analysis also provides evidence that Nod factors have a dual effect on the growth of root hair: inhibition of endogenous (plant) tip growth, and elicitation of a novel tip growth dependent on (bacterial) Nod factors. dmi1, dmi2, and dmi3 mutants are also unable to establish a symbiotic association with endomycorrhizal fungi, indicating that there are at least three common steps to nodulation and endomycorrhization in M. truncatula and providing further evidence for a common signaling pathway between nodulation and mycorrhization. PMID:11006338

Seipin performs dissectible functions in promoting lipid droplet biogenesis and regulating droplet morphology

PubMed Central

Cartwright, Bethany R.; Binns, Derk D.; Hilton, Christopher L.; Han, Sungwon; Gao, Qiang; Goodman, Joel M.

2015-01-01

Seipin is necessary for both adipogenesis and lipid droplet (LD) organization in nonadipose tissues; however, its molecular function is incompletely understood. Phenotypes in the seipin-null mutant of Saccharomyces cerevisiae include aberrant droplet morphology (endoplasmic reticulum–droplet clusters and size heterogeneity) and sensitivity of droplet size to changes in phospholipid synthesis. It has not been clear, however, whether seipin acts in initiation of droplet synthesis or at a later step. Here we utilize a system of de novo droplet formation to show that the absence of seipin results in a delay in droplet appearance with concomitant accumulation of neutral lipid in membranes. We also demonstrate that seipin is required for vectorial budding of droplets toward the cytoplasm. Furthermore, we find that the normal rate of droplet initiation depends on 14 amino acids at the amino terminus of seipin, deletion of which results in fewer, larger droplets that are consistent with a delay in initiation but are otherwise normal in morphology. Importantly, other functions of seipin, namely vectorial budding and resistance to inositol, are retained in this mutant. We conclude that seipin has dissectible roles in both promoting early LD initiation and in regulating LD morphology, supporting its importance in LD biogenesis. PMID:25540432

Estimating HIV-1 Fitness Characteristics from Cross-Sectional Genotype Data

PubMed Central

Gopalakrishnan, Sathej; Montazeri, Hesam; Menz, Stephan; Beerenwinkel, Niko; Huisinga, Wilhelm

2014-01-01

Despite the success of highly active antiretroviral therapy (HAART) in the management of human immunodeficiency virus (HIV)-1 infection, virological failure due to drug resistance development remains a major challenge. Resistant mutants display reduced drug susceptibilities, but in the absence of drug, they generally have a lower fitness than the wild type, owing to a mutation-incurred cost. The interaction between these fitness costs and drug resistance dictates the appearance of mutants and influences viral suppression and therapeutic success. Assessing in vivo viral fitness is a challenging task and yet one that has significant clinical relevance. Here, we present a new computational modelling approach for estimating viral fitness that relies on common sparse cross-sectional clinical data by combining statistical approaches to learn drug-specific mutational pathways and resistance factors with viral dynamics models to represent the host-virus interaction and actions of drug mechanistically. We estimate in vivo fitness characteristics of mutant genotypes for two antiretroviral drugs, the reverse transcriptase inhibitor zidovudine (ZDV) and the protease inhibitor indinavir (IDV). Well-known features of HIV-1 fitness landscapes are recovered, both in the absence and presence of drugs. We quantify the complex interplay between fitness costs and resistance by computing selective advantages for different mutants. Our approach extends naturally to multiple drugs and we illustrate this by simulating a dual therapy with ZDV and IDV to assess therapy failure. The combined statistical and dynamical modelling approach may help in dissecting the effects of fitness costs and resistance with the ultimate aim of assisting the choice of salvage therapies after treatment failure. PMID:25375675

Hot-spot analysis to dissect the functional protein-protein interface of a tRNA-modifying enzyme.

PubMed

Jakobi, Stephan; Nguyen, Tran Xuan Phong; Debaene, François; Metz, Alexander; Sanglier-Cianférani, Sarah; Reuter, Klaus; Klebe, Gerhard

2014-10-01

Interference with protein-protein interactions of interfaces larger than 1500 Ų by small drug-like molecules is notoriously difficult, particularly if targeting homodimers. The tRNA modifying enzyme Tgt is only functionally active as a homodimer. Thus, blocking Tgt dimerization is a promising strategy for drug therapy as this protein is key to the development of Shigellosis. Our goal was to identify hot-spot residues which, upon mutation, result in a predominantly monomeric state of Tgt. The detailed understanding of the spatial location and stability contribution of the individual interaction hot-spot residues and the plasticity of motifs involved in the interface formation is a crucial prerequisite for the rational identification of drug-like inhibitors addressing the respective dimerization interface. Using computational analyses, we identified hot-spot residues that contribute particularly to dimer stability: a cluster of hydrophobic and aromatic residues as well as several salt bridges. This in silico prediction led to the identification of a promising double mutant, which was validated experimentally. Native nano-ESI mass spectrometry showed that the dimerization of the suggested mutant is largely prevented resulting in a predominantly monomeric state. Crystal structure analysis and enzyme kinetics of the mutant variant further support the evidence for enhanced monomerization and provide first insights into the structural consequences of the dimer destabilization. © 2014 Wiley Periodicals, Inc.

Direct engagement of the PI3K pathway by mutant KIT dominates oncogenic signaling in gastrointestinal stromal tumor.

PubMed

Bosbach, Benedikt; Rossi, Ferdinand; Yozgat, Yasemin; Loo, Jennifer; Zhang, Jennifer Q; Berrozpe, Georgina; Warpinski, Katherine; Ehlers, Imke; Veach, Darren; Kwok, Andrew; Manova, Katia; Antonescu, Cristina R; DeMatteo, Ronald P; Besmer, Peter

2017-10-03

Gastrointestinal stromal tumors (GISTs) predominantly harbor activating mutations in the receptor tyrosine kinase KIT. To genetically dissect in vivo the requirement of different signal transduction pathways emanating from KIT for tumorigenesis, the oncogenic Kit V558Δ mutation was combined with point mutations abrogating specific phosphorylation sites on KIT. Compared with single-mutant Kit V558Δ/+ mice, double-mutant Kit V558Δ;Y567F/Y567F knock-in mice lacking the SRC family kinase-binding site on KIT (pY567) exhibited attenuated MAPK signaling and tumor growth. Surprisingly, abrogation of the PI3K-binding site (pY719) in Kit V558Δ;Y719F/Y719F mice prevented GIST development, although the interstitial cells of Cajal (ICC), the cells of origin of GIST, were normal. Pharmacologic inhibition of the PI3K pathway in tumor-bearing Kit V558Δ/+ mice with the dual PI3K/mTOR inhibitor voxtalisib, the pan-PI3K inhibitor pilaralisib, and the PI3K-alpha-restricted inhibitor alpelisib each diminished tumor proliferation. The addition of the MEK inhibitor PD-325901 or binimetinib further decreased downstream KIT signaling. Moreover, combining PI3K and MEK inhibition was effective against imatinib-resistant Kit V558Δ;T669I/+ tumors.

Direct engagement of the PI3K pathway by mutant KIT dominates oncogenic signaling in gastrointestinal stromal tumor

PubMed Central

Bosbach, Benedikt; Rossi, Ferdinand; Yozgat, Yasemin; Loo, Jennifer; Zhang, Jennifer Q.; Berrozpe, Georgina; Warpinski, Katherine; Ehlers, Imke; Kwok, Andrew; Manova, Katia; Antonescu, Cristina R.; DeMatteo, Ronald P.; Besmer, Peter

2017-01-01

Gastrointestinal stromal tumors (GISTs) predominantly harbor activating mutations in the receptor tyrosine kinase KIT. To genetically dissect in vivo the requirement of different signal transduction pathways emanating from KIT for tumorigenesis, the oncogenic KitV558Δ mutation was combined with point mutations abrogating specific phosphorylation sites on KIT. Compared with single-mutant KitV558Δ/+ mice, double-mutant KitV558Δ;Y567F/Y567F knock-in mice lacking the SRC family kinase-binding site on KIT (pY567) exhibited attenuated MAPK signaling and tumor growth. Surprisingly, abrogation of the PI3K-binding site (pY719) in KitV558Δ;Y719F/Y719F mice prevented GIST development, although the interstitial cells of Cajal (ICC), the cells of origin of GIST, were normal. Pharmacologic inhibition of the PI3K pathway in tumor-bearing KitV558Δ/+ mice with the dual PI3K/mTOR inhibitor voxtalisib, the pan-PI3K inhibitor pilaralisib, and the PI3K-alpha–restricted inhibitor alpelisib each diminished tumor proliferation. The addition of the MEK inhibitor PD-325901 or binimetinib further decreased downstream KIT signaling. Moreover, combining PI3K and MEK inhibition was effective against imatinib-resistant KitV558Δ;T669I/+ tumors. PMID:28923937

Dynein-mediated trafficking negatively regulates LET-23 EGFR signaling

PubMed Central

Skorobogata, Olga; Meng, Jassy; Gauthier, Kimberley; Rocheleau, Christian E.

2016-01-01

Epidermal growth factor receptor (EGFR) signaling is essential for animal development, and increased signaling underlies many human cancers. Identifying the genes and cellular processes that regulate EGFR signaling in vivo will help to elucidate how this pathway can become inappropriately activated. Caenorhabditis elegans vulva development provides an in vivo model to genetically dissect EGFR signaling. Here we identified a mutation in dhc-1, the heavy chain of the cytoplasmic dynein minus end–directed microtubule motor, in a genetic screen for regulators of EGFR signaling. Despite the many cellular functions of dynein, DHC-1 is a strong negative regulator of EGFR signaling during vulva induction. DHC-1 is required in the signal-receiving cell and genetically functions upstream or in parallel to LET-23 EGFR. LET-23 EGFR accumulates in cytoplasmic foci in dhc-1 mutants, consistent with mammalian cell studies in which dynein is shown to regulate late endosome trafficking of EGFR with the Rab7 GTPase. However, we found different distributions of LET-23 EGFR foci in rab-7 versus dhc-1 mutants, suggesting that dynein functions at an earlier step of LET-23 EGFR trafficking to the lysosome than RAB-7. Our results demonstrate an in vivo role for dynein in limiting LET-23 EGFR signaling via endosomal trafficking. PMID:27654944

Mutations and polymorphisms in FSH receptor: functional implications in human reproduction.

PubMed

Desai, Swapna S; Roy, Binita Sur; Mahale, Smita D

2013-12-01

FSH brings about its physiological actions by activating a specific receptor located on target cells. Normal functioning of the FSH receptor (FSHR) is crucial for follicular development and estradiol production in females and for the regulation of Sertoli cell function and spermatogenesis in males. In the last two decades, the number of inactivating and activating mutations, single nucleotide polymorphisms, and spliced variants of FSHR gene has been identified in selected infertile cases. Information on genotype-phenotype correlation and in vitro functional characterization of the mutants has helped in understanding the possible genetic cause for female infertility in affected individuals. The information is also being used to dissect various extracellular and intracellular events involved in hormone-receptor interaction by studying the differences in the properties of the mutant receptor when compared with WT receptor. Studies on polymorphisms in the FSHR gene have shown variability in clinical outcome among women treated with FSH. These observations are being explored to develop molecular markers to predict the optimum dose of FSH required for controlled ovarian hyperstimulation. Pharmacogenetics is an emerging field in this area that aims at designing individual treatment protocols for reproductive abnormalities based on FSHR gene polymorphisms. The present review discusses the current knowledge of various genetic alterations in FSHR and their impact on receptor function in the female reproductive system.

A Conserved, Mg2+-Dependent Exonuclease Degrades Organelle DNA during Arabidopsis Pollen Development[C][W

PubMed Central

Matsushima, Ryo; Tang, Lay Yin; Zhang, Lingang; Yamada, Hiroshi; Twell, David; Sakamoto, Wataru

2011-01-01

In plant cells, mitochondria and plastids contain their own genomes derived from the ancestral bacteria endosymbiont. Despite their limited genetic capacity, these multicopy organelle genomes account for a substantial fraction of total cellular DNA, raising the question of whether organelle DNA quantity is controlled spatially or temporally. In this study, we genetically dissected the organelle DNA decrease in pollen, a phenomenon that appears to be common in most angiosperm species. By staining mature pollen grains with fluorescent DNA dye, we screened Arabidopsis thaliana for mutants in which extrachromosomal DNAs had accumulated. Such a recessive mutant, termed defective in pollen organelle DNA degradation1 (dpd1), showing elevated levels of DNAs in both plastids and mitochondria, was isolated and characterized. DPD1 encodes a protein belonging to the exonuclease family, whose homologs appear to be found in angiosperms. Indeed, DPD1 has Mg2+-dependent exonuclease activity when expressed as a fusion protein and when assayed in vitro and is highly active in developing pollen. Consistent with the dpd phenotype, DPD1 is dual-targeted to plastids and mitochondria. Therefore, we provide evidence of active organelle DNA degradation in the angiosperm male gametophyte, primarily independent of maternal inheritance; the biological function of organellar DNA degradation in pollen is currently unclear. PMID:21521697

Dissecting the Mechanisms of Drug Resistance in BRCA1/2-Mutant Breast Cancers

DTIC Science & Technology

2017-10-01

approval from the Institutional Animal Care and Use Committee (IACUC) (protocol # 08-036) for performing Figure 6. NMNAT-1 deficiency rescues...sorted on day 3, and chromosomal aberrations were analyzed by metaphase spreads. 7 all of the proposed animal experiments at site 2, DFCI. The...ACURO documents/forms have been submitted to DOD for approval. The USAMRMC Animal Care and Use Review Office (ACURO) has received the appropriate forms

Autophagy drives epidermal deterioration in a Drosophila model of tissue aging.

PubMed

Scherfer, Christoph; Han, Violet C; Wang, Yan; Anderson, Aimee E; Galko, Michael J

2013-04-01

Organismal lifespan has been the primary readout in aging research. However, how longevity genes control tissue-specific aging remains an open question. To examine the crosstalk between longevity programs and specific tissues during aging, biomarkers of organ-specific aging are urgently needed. Since the earliest signs of aging occur in the skin, we sought to examine skin aging in a genetically tractable model. Here we introduce a Drosophila model of skin aging. The epidermis undergoes a dramatic morphological deterioration with age that includes membrane and nuclear loss. These changes were decelerated in a long-lived mutant and accelerated in a short-lived mutant. An increase in autophagy markers correlated with epidermal aging. Finally, the epidermis of Atg7 mutants retained younger characteristics, suggesting that autophagy is a critical driver of epidermal aging. This is surprising given that autophagy is generally viewed as protective during aging. Since Atg7 mutants are short-lived, the deceleration of epidermal aging in this mutant suggests that in the epidermis healthspan can be uncoupled from longevity. Because the aging readout we introduce here has an early onset and is easily visualized, genetic dissection using our model should identify other novel mechanisms by which lifespan genes feed into tissue-specific aging.

Proteomic analysis of middle and late stages of bread wheat (Triticum aestivum L.) grain development

PubMed Central

Zhang, Ning; Chen, Feng; Huo, Wang; Cui, Dangqun

2015-01-01

Proteomic approaches were applied in four grain developmental stages of the Chinese bread wheat Yunong 201 and its ethyl methanesulfonate (EMS) mutant line Yunong 3114. 2-DE and tandem MALDI-TOF/TOF-MS analyzed proteome characteristics during middle and late grain development of the Chinese bread wheat Yunong 201 and its EMS mutant line Yunong 3114 with larger grain sizes. We identified 130 differentially accumulated protein spots representing 88 unique proteins, and four main expression patterns displayed a dynamic description of middle and late grain formation. Those identified protein species participated in eight biochemical processes: stress/defense, carbohydrate metabolism, protein synthesis/assembly/degradation, storage proteins, energy production and transportation, photosynthesis, transcription/translation, signal transduction. Comparative proteomic characterization demonstrated 12 protein spots that co-accumulated in the two wheat cultivars with different expression patterns, and six cultivar-specific protein spots including serpin, small heat shock protein, β-amylase, α-amylase inhibitor, dimeric α-amylase inhibitor precursor, and cold regulated protein. These cultivar-specific protein spots possibly resulted in differential yield-related traits of the two wheat cultivars. Our results provide valuable information for dissection of molecular and genetics basis of yield-related traits in bread wheat and the proteomic characterization in this study could also provide insights in the biology of middle and late grain development. PMID:26442048

A homozygous recA mutant of Synechocystis PCC6803: construction strategy and characteristics eliciting a novel RecA independent UVC resistance in dark.

PubMed

Minda, Renu; Ramchandani, Jyoti; Joshi, Vasudha P; Bhattacharjee, Swapan Kumar

2005-12-01

We report here the construction of a homozygous recA460::cam insertion mutant of Synechocystis sp. PCC 6803 that may be useful for plant molecular genetics by providing a plant like host free of interference from homologous recombination. The homozygous recA460::cam mutant is highly sensitive to UVC under both photoreactivating and non-photoreactivating conditions compared to the wild type (WT). The liquid culture of the mutant growing in approximately 800 lx accumulates nonviable cells to the tune of 86% as estimated by colony counts on plates incubated at the same temperature and light intensity. The generation time of recA mutant in standard light intensity (2,500 lx) increases to 50 h compared to 28 h in lower light intensity (approximately 800 lx) that was used for selection, thus explaining the earlier failures to obtain a homozygous recA mutant. The WT, in contrast, grows at faster rate (23 h generation time) in standard light intensity compared to that at approximately 800 lx (26 h). The Synechocystis RecA protein supports homologous recombination during conjugation in recA (-) mutant of Escherichia coli, but not the SOS response as measured by UV sensitivity. It is suggested that using this homozygous recA460::cam mutant, investigations can now be extended to dissect the network of DNA repair pathways involved in housekeeping activities that may be more active in cyanobacteria than in heterotrophs. Using this mutant for the first time we provide a genetic evidence of a mechanism independent of RecA that causes enhanced UVC resistance on light to dark transition.

Discovery of a highly selective KIT kinase primary V559D mutant inhibitor for gastrointestinal stromal tumors (GISTs).

PubMed

Yu, Kailin; Liu, Xuesong; Jiang, Zongru; Hu, Chen; Zou, Fengming; Chen, Cheng; Ge, Juan; Wu, Jiaxin; Liu, Xiaochuan; Wang, Aoli; Wang, Wenliang; Wang, Wenchao; Qi, Ziping; Wang, Beilei; Wang, Li; Yan, Hezhong; Wang, Jiaoxue; Ren, Tao; Tang, Jun; Liu, Qingsong; Liu, Jing

2017-12-19

KIT kinase V559D mutation is the most prevalent primary gain-of-function mutation in Gastrointestinal Stromal Tumors (GISTs). Here we reported a highly selective KIT V559D inhibitor CHMFL-KIT-031, which displayed about 10-20 fold selectivity over KIT wt in the biochemical assay (IC 50 : 28 nM over 168 nM; Kd: 266 nM versus 6640 nM) and in cell (EC 50 : 176 nM versus 2000 nM for pY703) examination. It also displayed 15∼400-fold selectivity over other primary mutants such as L576P and secondary mutants including T670I, V654A (ATP binding pocket) as well as N822K and D816V (activation loop). In addition, it exhibited a selectivity S score (1) of 0.01 among 468 kinases/mutants in the KINOMEScan ™ assay. CHMFL-KIT-031 showed potent inhibitory efficacy for KIT V559D mediated signaling pathways in cell and anti-tumor activity in vivo (Tumor Growth Inhibition: 68.5%). Its superior selectivity would make it a good pharmacological tool for further dissection of KIT V559D mediated pathology in the GISTs.

Discovery of a highly selective KIT kinase primary V559D mutant inhibitor for gastrointestinal stromal tumors (GISTs)

PubMed Central

Yu, Kailin; Liu, Xuesong; Jiang, Zongru; Hu, Chen; Zou, Fengming; Chen, Cheng; Ge, Juan; Wu, Jiaxin; Liu, Xiaochuan; Wang, Aoli; Wang, Wenliang; Wang, Wenchao; Qi, Ziping; Wang, Beilei; Wang, Li; Yan, Hezhong; Wang, Jiaoxue; Ren, Tao; Tang, Jun; Liu, Qingsong; Liu, Jing

2017-01-01

KIT kinase V559D mutation is the most prevalent primary gain-of-function mutation in Gastrointestinal Stromal Tumors (GISTs). Here we reported a highly selective KIT V559D inhibitor CHMFL-KIT-031, which displayed about 10-20 fold selectivity over KIT wt in the biochemical assay (IC50: 28 nM over 168 nM; Kd: 266 nM versus 6640 nM) and in cell (EC50: 176 nM versus 2000 nM for pY703) examination. It also displayed 15∼400-fold selectivity over other primary mutants such as L576P and secondary mutants including T670I, V654A (ATP binding pocket) as well as N822K and D816V (activation loop). In addition, it exhibited a selectivity S score (1) of 0.01 among 468 kinases/mutants in the KINOMEScan™ assay. CHMFL-KIT-031 showed potent inhibitory efficacy for KIT V559D mediated signaling pathways in cell and anti-tumor activity in vivo (Tumor Growth Inhibition: 68.5%). Its superior selectivity would make it a good pharmacological tool for further dissection of KIT V559D mediated pathology in the GISTs. PMID:29340041

The use of ene adducts to study and engineer enoyl-thioester reductases.

PubMed

Rosenthal, Raoul G; Vögeli, Bastian; Quade, Nick; Capitani, Guido; Kiefer, Patrick; Vorholt, Julia A; Ebert, Marc-Olivier; Erb, Tobias J

2015-06-01

An improved understanding of enzymes' catalytic proficiency and stereoselectivity would further enable applications in chemistry, biocatalysis and industrial biotechnology. We use a chemical probe to dissect individual catalytic steps of enoyl-thioester reductases (Etrs), validating an active site tyrosine as the cryptic proton donor and explaining how it had eluded definitive identification. This information enabled the rational redesign of Etr, yielding mutants that create products with inverted stereochemistry at wild type-like turnover frequency.

White collar 2, a partner in blue-light signal transduction, controlling expression of light-regulated genes in Neurospora crassa.

PubMed Central

Linden, H; Macino, G

1997-01-01

A saturating genetic dissection of 'blind' mutants in Neurospora crassa has identified a total of two non-redundant loci (wc-1 and wc-2) each of which is required for blue-light perception/signal transduction. Previously, we demonstrated that WC1 is a putative zinc finger transcription factor able to bind specifically to a light-regulated promoter. Here, we present the cloning and characterization of the wc-2 gene. We demonstrate using mutation analysis and in vitro DNA-binding assays that WC2, the second partner of this light signal transduction system, encodes a functional zinc finger DNA-binding protein with putative PAS dimerization and transcription activation domains. This molecular genetic dissection of the second of two components of this light signal transduction system has enabled us to devise a model whereby WC1 and WC2 are proposed to interact via homologous PAS domains, bind to promoters of light-regulated genes and activate transcription. As such, this study provides the first insight into two co-operating partners in blue-light signal transduction in any organism and describes the molecular tools with which to dissect this enigmatic process. PMID:9009271

Positional cloning in mice and its use for molecular dissection of inflammatory arthritis.

PubMed

Abe, Koichiro; Yu, Philipp

2009-02-01

One of the upcoming next quests in the field of genetics might be molecular dissection of the genetic and environmental components of human complex diseases. In humans, however, there are certain experimental limitations for identification of a single component of the complex interactions by genetic analyses. Experimental animals offer simplified models for genetic and environmental interactions in human complex diseases. In particular, mice are the best mammalian models because of a long history and ample experience for genetic analyses. Forward genetics, which includes genetic screen and subsequent positional cloning of the causative genes, is a powerful strategy to dissect a complex phenomenon without preliminarily molecular knowledge of the process. In this review, first, we describe a general scheme of positional cloning in mice. Next, recent accomplishments on the patho-mechanisms of inflammatory arthritis by forward genetics approaches are introduced; Positional cloning effort for skg, Ali5, Ali18, cmo, and lupo mutants are provided as examples for the application to human complex diseases. As seen in the examples, the identification of genetic factors by positional cloning in the mouse have potential in solving molecular complexity of gene-environment interactions in human complex diseases.

Dissection of Arabidopsis NCED9 promoter regulatory regions reveals a role for ABA synthesized in embryos in the regulation of GA-dependent seed germination.

PubMed

Seo, Mitsunori; Kanno, Yuri; Frey, Anne; North, Helen M; Marion-Poll, Annie

2016-05-01

Nine-cis-epoxycarotenoid dioxygenase (NCED) catalyzes the key step of abscisic acid (ABA) biosynthesis. There are five genes encoding NCED in Arabidopsis, which differentially regulate ABA biosynthesis in a spatiotemporal manner in response to endogenous and environmental stimuli. Previous studies have shown that NCED9 is expressed in testa and embryos during seed development. In the present study, we have identified promoter regions required for the expression of NCED9 in testa and embryos, respectively. Electrophoretic mobility shift assays (EMSA) and yeast one-hybrid (Y1H) assays showed that several homeodomain-leucine zipper (HD-Zip) proteins, namely ATHBs, bound to the sequence required for expression of NCED9 in testa, suggesting that they redundantly regulate NCED9 expression. By expressing the NCED9 gene under the control of a deleted NCED9 promoter in an nced9 mutant expression was limited to embryos. Transformants were complemented for the paclobutrazol resistant germination phenotype of the mutant, suggesting that the ABA synthesis mediated by NCED9 in embryos plays an important role in the regulation of gibberellin (GA)-dependent seed germination. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Epigenetic Regulation of Learning and Memory by Drosophila EHMT/G9a

PubMed Central

Kramer, Jamie M.; Kochinke, Korinna; Oortveld, Merel A. W.; Marks, Hendrik; Kramer, Daniela; de Jong, Eiko K.; Asztalos, Zoltan; Westwood, J. Timothy; Stunnenberg, Hendrik G.; Sokolowski, Marla B.; Keleman, Krystyna; Zhou, Huiqing; van Bokhoven, Hans; Schenck, Annette

2011-01-01

The epigenetic modification of chromatin structure and its effect on complex neuronal processes like learning and memory is an emerging field in neuroscience. However, little is known about the “writers” of the neuronal epigenome and how they lay down the basis for proper cognition. Here, we have dissected the neuronal function of the Drosophila euchromatin histone methyltransferase (EHMT), a member of a conserved protein family that methylates histone 3 at lysine 9 (H3K9). EHMT is widely expressed in the nervous system and other tissues, yet EHMT mutant flies are viable. Neurodevelopmental and behavioral analyses identified EHMT as a regulator of peripheral dendrite development, larval locomotor behavior, non-associative learning, and courtship memory. The requirement for EHMT in memory was mapped to 7B-Gal4 positive cells, which are, in adult brains, predominantly mushroom body neurons. Moreover, memory was restored by EHMT re-expression during adulthood, indicating that cognitive defects are reversible in EHMT mutants. To uncover the underlying molecular mechanisms, we generated genome-wide H3K9 dimethylation profiles by ChIP-seq. Loss of H3K9 dimethylation in EHMT mutants occurs at 5% of the euchromatic genome and is enriched at the 5′ and 3′ ends of distinct classes of genes that control neuronal and behavioral processes that are corrupted in EHMT mutants. Our study identifies Drosophila EHMT as a key regulator of cognition that orchestrates an epigenetic program featuring classic learning and memory genes. Our findings are relevant to the pathophysiological mechanisms underlying Kleefstra Syndrome, a severe form of intellectual disability caused by mutations in human EHMT1, and have potential therapeutic implications. Our work thus provides novel insights into the epigenetic control of cognition in health and disease. PMID:21245904

Swimming Behaviour and Otolith Characteristics of wildtype and mutant Zebrafish (AIE) under diminished Gravity Conditions

NASA Astrophysics Data System (ADS)

Weigele, J.; Anken, R.; Hilbig, R.

During microgravity humans often suffer from sensorimotor disorders e g motion sickness a kinetosis Using fish as vertebrate model systems we could previously provide ample evidence that the individually different susceptibility to such disorders is based on an individually differently pronounced asymmetric mineralisation calcification of inner ear stones otoliths In the course of a preliminary study we subjected mutant zebrafish Danio rerio due to malformation of the inner ear - see below - this mutant was termed Asymmetric Inner Ear AIE to diminished gravity conditions during parabolic aircraft flight PF As compared to wildtype WT animals the mutants showed a pronounced kinetotic behaviour The gross-morphology of the inner ears of AIE and WT animals strikingly differed In WT specimens the saccular otoliths were located at the periphery of the inner ear whereas the utricular stones were positioned mediad as it is usually the case in teleosts in most AIE animals dissected however the respective otoliths were positioned in an opposite arrangement Moreover the mutants sported transparent otoliths whereas the otoliths of WT specimens had an opaque appearance This finding clearly indicates that mutant otoliths differed from wildtype ones in their lattice structure i e the calcium carbonate polymorph and thus the compostion of the proteinacious matrix which is a template for calcium carbonate deposition In the course of the present study the PF experiment is scheduled to be carried out in March 2006 we intend to statistically verify

The filamentous fungus Sordaria macrospora as a genetic model to study fruiting body development.

PubMed

Teichert, Ines; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

2014-01-01

Filamentous fungi are excellent experimental systems due to their short life cycles as well as easy and safe manipulation in the laboratory. They form three-dimensional structures with numerous different cell types and have a long tradition as genetic model organisms used to unravel basic mechanisms underlying eukaryotic cell differentiation. The filamentous ascomycete Sordaria macrospora is a model system for sexual fruiting body (perithecia) formation. S. macrospora is homothallic, i.e., self-fertile, easily genetically tractable, and well suited for large-scale genomics, transcriptomics, and proteomics studies. Specific features of its life cycle and the availability of a developmental mutant library make it an excellent system for studying cellular differentiation at the molecular level. In this review, we focus on recent developments in identifying gene and protein regulatory networks governing perithecia formation. A number of tools have been developed to genetically analyze developmental mutants and dissect transcriptional profiles at different developmental stages. Protein interaction studies allowed us to identify a highly conserved eukaryotic multisubunit protein complex, the striatin-interacting phosphatase and kinase complex and its role in sexual development. We have further identified a number of proteins involved in chromatin remodeling and transcriptional regulation of fruiting body development. Furthermore, we review the involvement of metabolic processes from both primary and secondary metabolism, and the role of nutrient recycling by autophagy in perithecia formation. Our research has uncovered numerous players regulating multicellular development in S. macrospora. Future research will focus on mechanistically understanding how these players are orchestrated in this fungal model system. Copyright © 2014 Elsevier Inc. All rights reserved.

A host beetle pheromone regulates development and behavior in the nematode Pristionchus pacificus.

PubMed

Cinkornpumin, Jessica K; Wisidagama, Dona R; Rapoport, Veronika; Go, James L; Dieterich, Christoph; Wang, Xiaoyue; Sommer, Ralf J; Hong, Ray L

2014-10-15

Nematodes and insects are the two most speciose animal phyla and nematode-insect associations encompass widespread biological interactions. To dissect the chemical signals and the genes mediating this association, we investigated the effect of an oriental beetle sex pheromone on the development and behavior of the nematode Pristionchus pacificus. We found that while the beetle pheromone is attractive to P. pacificus adults, the pheromone arrests embryo development, paralyzes J2 larva, and inhibits exit of dauer larvae. To uncover the mechanism that regulates insect pheromone sensitivity, a newly identified mutant, Ppa-obi-1, is used to reveal the molecular links between altered attraction towards the beetle pheromone, as well as hypersensitivity to its paralyzing effects. Ppa-obi-1 encodes lipid-binding domains and reaches its highest expression in various cell types, including the amphid neuron sheath and excretory cells. Our data suggest that the beetle host pheromone may be a species-specific volatile synomone that co-evolved with necromeny.

Inflorescence Development and the Role of LsFT in Regulating Bolting in Lettuce (Lactuca sativa L.).

PubMed

Chen, Zijing; Han, Yingyan; Ning, Kang; Ding, Yunyu; Zhao, Wensheng; Yan, Shuangshuang; Luo, Chen; Jiang, Xiaotang; Ge, Danfeng; Liu, Renyi; Wang, Qian; Zhang, Xiaolan

2017-01-01

Lettuce ( Lactuca sativa L.) is one of the most important leafy vegetable that is consumed during its vegetative growth. The transition from vegetative to reproductive growth is induced by high temperature, which has significant economic effect on lettuce production. However, the progression of floral transition and the molecular regulation of bolting are largely unknown. Here we morphologically characterized the inflorescence development and functionally analyzed the FLOWERING LOCUS T (LsFT) gene during bolting regulation in lettuce. We described the eight developmental stages during floral transition process. The expression of LsFT was negatively correlated with bolting in different lettuce varieties, and was promoted by heat treatment. Overexpression of LsFT could recover the late-flowering phenotype of ft-2 mutant. Knockdown of LsFT by RNA interference dramatically delayed bolting in lettuce, and failed to respond to high temperature. Therefore, this study dissects the process of inflorescence development and characterizes the role of LsFT in bolting regulation in lettuce.

Inflorescence Development and the Role of LsFT in Regulating Bolting in Lettuce (Lactuca sativa L.)

PubMed Central

Chen, Zijing; Han, Yingyan; Ning, Kang; Ding, Yunyu; Zhao, Wensheng; Yan, Shuangshuang; Luo, Chen; Jiang, Xiaotang; Ge, Danfeng; Liu, Renyi; Wang, Qian; Zhang, Xiaolan

2018-01-01

Lettuce (Lactuca sativa L.) is one of the most important leafy vegetable that is consumed during its vegetative growth. The transition from vegetative to reproductive growth is induced by high temperature, which has significant economic effect on lettuce production. However, the progression of floral transition and the molecular regulation of bolting are largely unknown. Here we morphologically characterized the inflorescence development and functionally analyzed the FLOWERING LOCUS T (LsFT) gene during bolting regulation in lettuce. We described the eight developmental stages during floral transition process. The expression of LsFT was negatively correlated with bolting in different lettuce varieties, and was promoted by heat treatment. Overexpression of LsFT could recover the late-flowering phenotype of ft-2 mutant. Knockdown of LsFT by RNA interference dramatically delayed bolting in lettuce, and failed to respond to high temperature. Therefore, this study dissects the process of inflorescence development and characterizes the role of LsFT in bolting regulation in lettuce. PMID:29403510

Gibberellins regulate the stem elongation rate without affecting the mature plant height of a quick development mutant of winter wheat (Triticum aestivum L.).

PubMed

Zhang, Ning; Xie, Yong-Dun; Guo, Hui-Jun; Zhao, Lin-Shu; Xiong, Hong-Chun; Gu, Jia-Yu; Li, Jun-Hui; Kong, Fu-Quan; Sui, Li; Zhao, Zi-Wei; Zhao, Shi-Rong; Liu, Lu-Xiang

2016-10-01

Gibberellin (GA) is essential for determining plant height. Alteration of GA content or GA signaling results in a dwarf or slender phenotype. Here, we characterized a novel wheat mutant, quick development (qd), in which GA regulates stem elongation but does not affect mature plant height. qd and wild-type plants did not exhibit phenotypic differences at the seedling stage. From jointing to heading stage, qd plants were taller than wild-type plants due to elongated cells. However, wild-type and qd plants were the same height at heading. Unlike wild-type plants, qd plants were sensitive to exogenous GA due to mutation of Rht-B1. With continuous GA stimulation, qd seedlings and adult plants were taller than wild-type. Thus, the GA content of qd plants might differ from that of wild-type during the growth process. Analysis of GA biosynthetic gene expression verified this hypothesis and showed that TaKAO, which is involved in catalyzing the early steps of GA biosynthesis, was differentially expressed in qd plants compared with wild-type. The bioactive GA associated gene TaGA20ox was downregulated in qd plants during the late growth stages. Measurements of endogenous GA content were consistent with the gene-expression analysis results. Consistent with the GA content variation, the first three basal internodes were longer and the last two internodes were shorter in qd than in wild-type plants. The qd mutant might be useful in dissecting the mechanism by which GA regulates stem-growing process, and it may be serve as a GA responsive semi-dwarf germplasm in breeding programs. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Mutational landscape, clonal evolution patterns, and role of RAS mutations in relapsed acute lymphoblastic leukemia

PubMed Central

Oshima, Koichi; Khiabanian, Hossein; da Silva-Almeida, Ana C.; Tzoneva, Gannie; Abate, Francesco; Ambesi-Impiombato, Alberto; Sanchez-Martin, Marta; Carpenter, Zachary; Penson, Alex; Perez-Garcia, Arianne; Eckert, Cornelia; Nicolas, Concepción; Balbin, Milagros; Sulis, Maria Luisa; Kato, Motohiro; Koh, Katsuyoshi; Paganin, Maddalena; Basso, Giuseppe; Gastier-Foster, Julie M.; Devidas, Meenakshi; Loh, Mignon L.; Kirschner-Schwabe, Renate; Palomero, Teresa; Rabadan, Raul; Ferrando, Adolfo A.

2016-01-01

Although multiagent combination chemotherapy is curative in a significant fraction of childhood acute lymphoblastic leukemia (ALL) patients, 20% of cases relapse and most die because of chemorefractory disease. Here we used whole-exome and whole-genome sequencing to analyze the mutational landscape at relapse in pediatric ALL cases. These analyses identified numerous relapse-associated mutated genes intertwined in chemotherapy resistance-related protein complexes. In this context, RAS-MAPK pathway-activating mutations in the neuroblastoma RAS viral oncogene homolog (NRAS), kirsten rat sarcoma viral oncogene homolog (KRAS), and protein tyrosine phosphatase, nonreceptor type 11 (PTPN11) genes were present in 24 of 55 (44%) cases in our series. Interestingly, some leukemias showed retention or emergence of RAS mutant clones at relapse, whereas in others RAS mutant clones present at diagnosis were replaced by RAS wild-type populations, supporting a role for both positive and negative selection evolutionary pressures in clonal evolution of RAS-mutant leukemia. Consistently, functional dissection of mouse and human wild-type and mutant RAS isogenic leukemia cells demonstrated induction of methotrexate resistance but also improved the response to vincristine in mutant RAS-expressing lymphoblasts. These results highlight the central role of chemotherapy-driven selection as a central mechanism of leukemia clonal evolution in relapsed ALL, and demonstrate a previously unrecognized dual role of RAS mutations as drivers of both sensitivity and resistance to chemotherapy. PMID:27655895

Evaluation of Educator & Student Use of & Attitudes toward Dissection & Dissection Alternatives

ERIC Educational Resources Information Center

Osenkowski, Pamela; Green, Che; Tjaden, Anne; Cunniff, Peggy

2015-01-01

Animal dissection has been routinely practiced in American biology classrooms for decades. With technological advancements, more states adopting student choice measures, and increased awareness about ethical concerns surrounding dissection, many useful dissection alternatives have been developed. To understand the current use of animal dissection…

Preferential Ascus Discharge during Cross Maturation in SORDARIA BREVICOLLIS

PubMed Central

MacDonald, D. J.; Bond, D. J.

1974-01-01

Crosses involving spore color mutants of Sordaria brevicollis all showed a decline in the frequency of second division asymmetric asci (2:2:2:2's) as the cross matured. This decline was due to the preferential maturation and/or discharge of these asci. The proportion of spindle overlap and recombinational asci within the group did not change as shown by ascus dissection. The preferential discharge was also found to occur in two-point crosses where the asci did not contain wild-type spores. PMID:4822469

Preferential ascus discharge during cross maturation in Sordaria brevicollis.

PubMed

MacDonald, D J; Bond, D J

1974-02-01

Crosses involving spore color mutants of Sordaria brevicollis all showed a decline in the frequency of second division asymmetric asci (2:2:2:2's) as the cross matured. This decline was due to the preferential maturation and/or discharge of these asci. The proportion of spindle overlap and recombinational asci within the group did not change as shown by ascus dissection. The preferential discharge was also found to occur in two-point crosses where the asci did not contain wild-type spores.

The role of primary myogenic regulatory factors in the developing diaphragmatic muscle in the nitrofen-induced diaphragmatic hernia.

PubMed

Dingemann, Jens; Doi, Takashi; Ruttenstock, Elke; Puri, Prem

2011-06-01

The nitrofen model of congenital diaphragmatic hernia (CDH) is widely used to investigate the pathogenesis of CDH. However, the exact pathomechanism of the diaphragmatic defect is still unclear. Diaphragmatic muscularization represents the last stage of diaphragmatic development. Myogenic differentiation 1 (MyoD) and myogenic factor 5 (Myf5) play a crucial role in muscularization. MyoD(-/-) : Myf5(+/-) mutant mice show reduced diaphragmatic size, whereas MyoD(+/-) : Myf5(-/-) mutants have normal diaphragms. We designed this study to investigate diaphragmatic gene expression of MyoD and Myf5 in the nitrofen CDH model. Pregnant rats received nitrofen or vehicle on day 9 of gestation (D9), followed by cesarean section on D18 and D21. Fetal diaphragms (n = 40) were micro-dissected and divided into CDH group and controls. MyoD and Myf5 mRNA-expression were determined using Real-time PCR. Immunohistochemistry was performed to evaluate protein expression of MyoD and Myf5. Relative diaphragmatic mRNA expression levels and immunoreactivity of MyoD were decreased in the CDH group on D18 and D21. Myf 5 mRNA and protein expression were not altered in the CDH group. This is the first study showing that MyoD expression is selectively decreased in the diaphragm muscle in the nitrofen model of CDH.

A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8.

PubMed

Bouhy, Delphine; Juneja, Manisha; Katona, Istvan; Holmgren, Anne; Asselbergh, Bob; De Winter, Vicky; Hochepied, Tino; Goossens, Steven; Haigh, Jody J; Libert, Claude; Ceuterick-de Groote, Chantal; Irobi, Joy; Weis, Joachim; Timmerman, Vincent

2018-01-01

Mutations in the small heat shock protein B8 gene (HSPB8/HSP22) have been associated with distal hereditary motor neuropathy, Charcot-Marie-Tooth disease, and recently distal myopathy. It is so far not clear how mutant HSPB8 induces the neuronal and muscular phenotypes and if a common pathogenesis lies behind these diseases. Growing evidence points towards a role of HSPB8 in chaperone-associated autophagy, which has been shown to be a determinant for the clearance of poly-glutamine aggregates in neurodegenerative diseases but also for the maintenance of skeletal muscle myofibrils. To test this hypothesis and better dissect the pathomechanism of mutant HSPB8, we generated a new transgenic mouse model leading to the expression of the mutant protein (knock-in lines) or the loss-of-function (functional knock-out lines) of the endogenous protein Hspb8. While the homozygous knock-in mice developed motor deficits associated with degeneration of peripheral nerves and severe muscle atrophy corroborating patient data, homozygous knock-out mice had locomotor performances equivalent to those of wild-type animals. The distal skeletal muscles of the post-symptomatic homozygous knock-in displayed Z-disk disorganisation, granulofilamentous material accumulation along with Hspb8, αB-crystallin (HSPB5/CRYAB), and desmin aggregates. The presence of the aggregates correlated with reduced markers of effective autophagy. The sciatic nerve of the homozygous knock-in mice was characterized by low autophagy potential in pre-symptomatic and Hspb8 aggregates in post-symptomatic animals. On the other hand, the sciatic nerve of the homozygous knock-out mice presented a normal morphology and their distal muscle displayed accumulation of abnormal mitochondria but intact myofiber and Z-line organisation. Our data, therefore, suggest that toxic gain-of-function of mutant Hspb8 aggregates is a major contributor to the peripheral neuropathy and the myopathy. In addition, mutant Hspb8 induces impairments in autophagy that may aggravate the phenotype.

Research highlights: microfluidics meets big data.

PubMed

Tseng, Peter; Weaver, Westbrook M; Masaeli, Mahdokht; Owsley, Keegan; Di Carlo, Dino

2014-03-07

In this issue we highlight a collection of recent work in which microfluidic parallelization and automation have been employed to address the increasing need for large amounts of quantitative data concerning cellular function--from correlating microRNA levels to protein expression, increasing the throughput and reducing the noise when studying protein dynamics in single-cells, and understanding how signal dynamics encodes information. The painstaking dissection of cellular pathways one protein at a time appears to be coming to an end, leading to more rapid discoveries which will inevitably translate to better cellular control--in producing useful gene products and treating disease at the individual cell level. From these studies it is also clear that development of large scale mutant or fusion libraries, automation of microscopy, image analysis, and data extraction will be key components as microfluidics contributes its strengths to aid systems biology moving forward.

Forward Genetic Dissection of Biofilm Development by Fusobacterium nucleatum: Novel Functions of Cell Division Proteins FtsX and EnvC.

PubMed

Wu, Chenggang; Al Mamun, Abu Amar Mohamed; Luong, Truc Thanh; Hu, Bo; Gu, Jianhua; Lee, Ju Huck; D'Amore, Melissa; Das, Asis; Ton-That, Hung

2018-04-24

Fusobacterium nucleatum is a key member of the human oral biofilm. It is also implicated in preterm birth and colorectal cancer. To facilitate basic studies of fusobacterial virulence, we describe here a versatile transposon mutagenesis procedure and a pilot screen for mutants defective in biofilm formation. Out of 10 independent biofilm-defective mutants isolated, the affected genes included the homologs of the Escherichia coli cell division proteins FtsX and EnvC, the electron transport protein RnfA, and four proteins with unknown functions. Next, a facile new gene deletion method demonstrated that nonpolar, in-frame deletion of ftsX or envC produces viable bacteria that are highly filamentous due to defective cell division. Transmission electron and cryo-electron microscopy revealed that the Δ ftsX and Δ envC mutant cells remain joined with apparent constriction, and scanning electron microscopy (EM) uncovered a smooth cell surface without the microfolds present in wild-type cells. FtsX and EnvC proteins interact with each other as well as a common set of interacting partners, many with unknown function. Last, biofilm development is altered when cell division is blocked by MinC overproduction; however, unlike the phenotypes of Δ ftsX and Δ envC mutants, a weakly adherent biofilm is formed, and the wild-type rugged cell surface is maintained. Therefore, FtsX and EnvC may perform novel functions in Fusobacterium cell biology. This is the first report of an unbiased approach to uncover genetic determinants of fusobacterial biofilm development. It points to an intriguing link among cytokinesis, cell surface dynamics, and biofilm formation, whose molecular underpinnings remain to be elucidated. IMPORTANCE Little is known about the virulence mechanisms and associated factors in F. nucleatum , due mainly to the lack of convenient genetic tools for this organism. We employed two efficient genetic strategies to identify F. nucleatum biofilm-defective mutants, revealing FtsX and EnvC among seven biofilm-associated factors. Electron microscopy established cell division defects of the Δ ftsX and Δ envC mutants, accompanied with a smooth cell surface, unlike the microfold, rugged appearance of wild-type bacteria. Proteomic studies demonstrated that FtsX and EnvC interact with each other as well as a set of common and unique interacting proteins, many with unknown functions. Importantly, blocking cell division by MinC overproduction led to formation of a weakly adherent biofilm, without alteration of the wild-type cell surface. Thus, this work links cell division and surface dynamics to biofilm development and lays a foundation for future genetic and biochemical investigations of basic cellular processes in this clinically significant pathogen. Copyright © 2018 Wu et al.

DELLA genes restrict inflorescence meristem function independently of plant height.

PubMed

Serrano-Mislata, Antonio; Bencivenga, Stefano; Bush, Max; Schiessl, Katharina; Boden, Scott; Sablowski, Robert

2017-09-01

DELLA proteins associate with transcription factors to control plant growth in response to gibberellin 1 . Semi-dwarf DELLA mutants with improved harvest index and decreased lodging greatly improved global food security during the 'green revolution' in the 1960-1970s 2 . However, DELLA mutants are pleiotropic and the developmental basis for their effects on plant architecture remains poorly understood. Here, we show that DELLA proteins have genetically separable roles in controlling stem growth and the size of the inflorescence meristem, where flowers initiate. Quantitative three-dimensional image analysis, combined with a genome-wide screen for DELLA-bound loci in the inflorescence tip, revealed that DELLAs limit meristem size in Arabidopsis by directly upregulating the cell-cycle inhibitor KRP2 in the underlying rib meristem, without affecting the canonical WUSCHEL-CLAVATA meristem size regulators 3 . Mutation of KRP2 in a DELLA semi-dwarf background restored meristem size, but not stem growth, and accelerated flower production. In barley, secondary mutations in the DELLA gain-of-function mutant Sln1d 4 also uncoupled meristem and inflorescence size from plant height. Our work reveals an unexpected and conserved role for DELLA genes in controlling shoot meristem function and suggests how dissection of pleiotropic DELLA functions could unlock further yield gains in semi-dwarf mutants.

DELLA genes restrict inflorescence meristem function independently of plant height

PubMed Central

Serrano-Mislata, Antonio; Bencivenga, Stefano; Bush, Max; Schiessl, Katharina; Boden, Scott; Sablowski, Robert

2017-01-01

Summary DELLA proteins associate with transcription factors to control plant growth in response to gibberellin 1. Semi-dwarf DELLA mutants with improved harvest index and decreased lodging greatly improved global food security during the “green revolution” in the 1960-70s 2. However, DELLA mutants are pleiotropic and the developmental basis for their effects on plant architecture remains poorly understood. Here, we show that DELLA proteins have genetically separable roles in controlling stem growth and the size of the inflorescence meristem, where flowers initiate. Quantitative 3D image analysis, combined with a genome-wide screen for DELLA-bound loci in the inflorescence tip, revealed that DELLAs limit meristem size in Arabidopsis by directly up-regulating the cell cycle inhibitor KRP2 in the underlying rib meristem, without affecting the canonical WUSCHEL-CLAVATA meristem size regulators3. Mutation of KRP2 in a DELLA semi-dwarf background restored meristem size, but not stem growth, and accelerated flower production. In barley, secondary mutations in the DELLA gain of function mutant Sln1d 4 also uncoupled meristem and inflorescence size from plant height. Our work reveals an unexpected and conserved role for DELLA genes in controlling shoot meristem function and suggests how dissection of pleiotropic DELLA functions could unlock further yield gains in semi-dwarf mutants. PMID:28827519

A Computational Approach to Estimating Nondisjunction Frequency in Saccharomyces cerevisiae

PubMed Central

Chu, Daniel B.; Burgess, Sean M.

2016-01-01

Errors segregating homologous chromosomes during meiosis result in aneuploid gametes and are the largest contributing factor to birth defects and spontaneous abortions in humans. Saccharomyces cerevisiae has long served as a model organism for studying the gene network supporting normal chromosome segregation. Measuring homolog nondisjunction frequencies is laborious, and involves dissecting thousands of tetrads to detect missegregation of individually marked chromosomes. Here we describe a computational method (TetFit) to estimate the relative contributions of meiosis I nondisjunction and random-spore death to spore inviability in wild type and mutant strains. These values are based on finding the best-fit distribution of 4, 3, 2, 1, and 0 viable-spore tetrads to an observed distribution. Using TetFit, we found that meiosis I nondisjunction is an intrinsic component of spore inviability in wild-type strains. We show proof-of-principle that the calculated average meiosis I nondisjunction frequency determined by TetFit closely matches empirically determined values in mutant strains. Using these published data sets, TetFit uncovered two classes of mutants: Class A mutants skew toward increased nondisjunction death, and include those with known defects in establishing pairing, recombination, and/or synapsis of homologous chromosomes. Class B mutants skew toward random spore death, and include those with defects in sister-chromatid cohesion and centromere function. Epistasis analysis using TetFit is facilitated by the low numbers of tetrads (as few as 200) required to compare the contributions to spore death in different mutant backgrounds. TetFit analysis does not require any special strain construction, and can be applied to previously observed tetrad distributions. PMID:26747203

Plastid Ontogeny during Petal Development in Arabidopsis1

PubMed Central

Pyke, Kevin A.; Page, Anton M.

1998-01-01

Imaging of chlorophyll autofluorescence by confocal microscopy in intact whole petals of Arabidopsis thaliana has been used to analyze chloroplast development and redifferentiation during petal development. Young petals dissected from unopened buds contained green chloroplasts throughout their structure, but as the upper part of the petal lamina developed and expanded, plastids lost their chlorophyll and redifferentiated into leukoplasts, resulting in a white petal blade. Normal green chloroplasts remained in the stalk of the mature petal. In epidermal cells the chloroplasts were normal and green, in stark contrast with leaf epidermal cell plastids. In addition, the majority of these chloroplasts had dumbbell shapes, typical of dividing chloroplasts, and we suggest that the rapid expansion of petal epidermal cells may be a trigger for the initiation of chloroplast division. In petals of the Arabidopsis plastid division mutant arc6, the conversion of chloroplasts into leukoplasts was unaffected in spite of the greatly enlarged size and reduced number of arc6 chloroplasts in cells in the petal base, resulting in few enlarged leukoplasts in cells from the white lamina of arc6 petals. PMID:9489024

The Problems of Dissection.

ERIC Educational Resources Information Center

Davis, Pat

1997-01-01

Describes some problems of classroom dissection including the cruelty that animals destined for the laboratory suffer. Discusses the multilevel approach that the National Anti-Vivisection Society (NAVS) has developed to address the problems of animal dissection such as offering a dissection hotline, exhibiting at science teacher conferences, and…

Neurofibromin Loss of Function Drives Excessive Grooming in Drosophila

PubMed Central

King, Lanikea B.; Koch, Marta; Murphy, Keith R.; Velazquez, Yoheilly; Ja, William W.; Tomchik, Seth M.

2016-01-01

Neurofibromatosis I is a common genetic disorder that results in tumor formation, and predisposes individuals to a range of cognitive/behavioral symptoms, including deficits in attention, visuospatial skills, learning, language development, and sleep, and autism spectrum disorder-like traits. The nf1-encoded neurofibromin protein (Nf1) exhibits high conservation, from the common fruit fly, Drosophila melanogaster, to humans. Drosophila provides a powerful platform to investigate the signaling cascades upstream and downstream of Nf1, and the fly model exhibits similar behavioral phenotypes to mammalian models. In order to understand how loss of Nf1 affects motor behavior in flies, we combined traditional activity monitoring with video analysis of grooming behavior. In nf1 mutants, spontaneous grooming was increased up to 7x. This increase in activity was distinct from previously described dopamine-dependent hyperactivity, as dopamine transporter mutants exhibited slightly decreased grooming. Finally, we found that relative grooming frequencies can be compared in standard activity monitors that measure infrared beam breaks, enabling the use of activity monitors as an automated method to screen for grooming phenotypes. Overall, these data suggest that loss of nf1 produces excessive activity that is manifested as increased grooming, providing a platform to dissect the molecular genetics of neurofibromin signaling across neuronal circuits. PMID:26896440

Neurofibromin Loss of Function Drives Excessive Grooming in Drosophila.

PubMed

King, Lanikea B; Koch, Marta; Murphy, Keith R; Velazquez, Yoheilly; Ja, William W; Tomchik, Seth M

2016-04-07

Neurofibromatosis I is a common genetic disorder that results in tumor formation, and predisposes individuals to a range of cognitive/behavioral symptoms, including deficits in attention, visuospatial skills, learning, language development, and sleep, and autism spectrum disorder-like traits. The nf1-encoded neurofibromin protein (Nf1) exhibits high conservation, from the common fruit fly, Drosophila melanogaster, to humans. Drosophila provides a powerful platform to investigate the signaling cascades upstream and downstream of Nf1, and the fly model exhibits similar behavioral phenotypes to mammalian models. In order to understand how loss of Nf1 affects motor behavior in flies, we combined traditional activity monitoring with video analysis of grooming behavior. In nf1 mutants, spontaneous grooming was increased up to 7x. This increase in activity was distinct from previously described dopamine-dependent hyperactivity, as dopamine transporter mutants exhibited slightly decreased grooming. Finally, we found that relative grooming frequencies can be compared in standard activity monitors that measure infrared beam breaks, enabling the use of activity monitors as an automated method to screen for grooming phenotypes. Overall, these data suggest that loss of nf1 produces excessive activity that is manifested as increased grooming, providing a platform to dissect the molecular genetics of neurofibromin signaling across neuronal circuits. Copyright © 2016 King et al.

A neurotransmitter transporter encoded by the Drosophila inebriated gene

PubMed Central

Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

1996-01-01

Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

Homocysteine regulates fatty acid and lipid metabolism in yeast

PubMed Central

Visram, Myriam; Radulovic, Maja; Steiner, Sabine; Malanovic, Nermina; Eichmann, Thomas O.; Wolinski, Heimo; Rechberger, Gerald N.; Tehlivets, Oksana

2018-01-01

S-Adenosyl-l-homocysteine hydrolase (AdoHcy hydrolase; Sah1 in yeast/AHCY in mammals) degrades AdoHcy, a by-product and strong product inhibitor of S-adenosyl-l-methionine (AdoMet)-dependent methylation reactions, to adenosine and homocysteine (Hcy). This reaction is reversible, so any elevation of Hcy levels, such as in hyperhomocysteinemia (HHcy), drives the formation of AdoHcy, with detrimental consequences for cellular methylation reactions. HHcy, a pathological condition linked to cardiovascular and neurological disorders, as well as fatty liver among others, is associated with a deregulation of lipid metabolism. Here, we developed a yeast model of HHcy to identify mechanisms that dysregulate lipid metabolism. Hcy supplementation to wildtype cells up-regulated cellular fatty acid and triacylglycerol content and induced a shift in fatty acid composition, similar to changes observed in mutants lacking Sah1. Expression of the irreversible bacterial pathway for AdoHcy degradation in yeast allowed us to dissect the impact of AdoHcy accumulation on lipid metabolism from the impact of elevated Hcy. Expression of this pathway fully suppressed the growth deficit of sah1 mutants as well as the deregulation of lipid metabolism in both the sah1 mutant and Hcy-exposed wildtype, showing that AdoHcy accumulation mediates the deregulation of lipid metabolism in response to elevated Hcy in yeast. Furthermore, Hcy supplementation in yeast led to increased resistance to cerulenin, an inhibitor of fatty acid synthase, as well as to a concomitant decline of condensing enzymes involved in very long-chain fatty acid synthesis, in line with the observed shift in fatty acid content and composition. PMID:29414770

Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function.

PubMed

Drummond, I A; Majumdar, A; Hentschel, H; Elger, M; Solnica-Krezel, L; Schier, A F; Neuhauss, S C; Stemple, D L; Zwartkruis, F; Rangini, Z; Driever, W; Fishman, M C

1998-12-01

The zebrafish pronephric kidney provides a simplified model of nephron development and epithelial cell differentiation which is amenable to genetic analysis. The pronephros consists of two nephrons with fused glomeruli and paired pronephric tubules and ducts. Nephron formation occurs after the differentiation of the pronephric duct with both the glomeruli and tubules being derived from a nephron primordium. Fluorescent dextran injection experiments demonstrate that vascularization of the zebrafish pronephros and the onset of glomerular filtration occurs between 40 and 48 hpf. We isolated fifteen recessive mutations that affect development of the pronephros. All have visible cysts in place of the pronephric tubule at 2-2.5 days of development. Mutants were grouped in three classes: (1) a group of twelve mutants with defects in body axis curvature and manifesting the most rapid and severe cyst formation involving the glomerulus, tubule and duct, (2) the fleer mutation with distended glomerular capillary loops and cystic tubules, and (3) the mutation pao pao tang with a normal glomerulus and cysts limited to the pronephric tubules. double bubble was analyzed as a representative of mutations that perturb the entire length of the pronephros and body axis curvature. Cyst formation begins in the glomerulus at 40 hpf at the time when glomerular filtration is established suggesting a defect associated with the onset of pronephric function. Basolateral membrane protein targeting in the pronephric duct epithelial cells is also severely affected, suggesting a failure in terminal epithelial cell differentiation and alterations in electrolyte transport. These studies reveal the similarity of normal pronephric development to kidney organogenesis in all vertebrates and allow for a genetic dissection of genes needed to establish the earliest renal function.

Development and validation of the neck dissection impairment index: a quality of life measure.

PubMed

Taylor, Rodney J; Chepeha, Judith C; Teknos, Theodoros N; Bradford, Carol R; Sharma, Pramod K; Terrell, Jeffrey E; Hogikyan, Norman D; Wolf, Gregory T; Chepeha, Douglas B

2002-01-01

To validate a health-related quality-of-life (QOL) instrument for patients following neck dissection and to identify the factors that affect QOL following neck dissection. Cross-sectional validation study. The outpatient clinic of a tertiary care cancer center. Convenience sample of 54 patients previously treated for head and neck cancer who underwent a selective neck dissection or modified radical neck dissection (64 total neck dissections). Patients had a minimum postoperative convalescence of 11 months. Thirty-two underwent accessory nerve-sparing modified radical neck dissection, and 32 underwent selective neck dissection. A 10-item, self-report instrument, the Neck Dissection Impairment Index (NDII), was developed and validated. Reliability was evaluated with test-retest correlation and internal consistency using the Cronbach alpha coefficient. Convergent validity was assessed using the 36-Item Short-Form Health Survey (SF-36) and the Constant Shoulder Scale, a shoulder function test. Multiple variable regression was used to determine variables that most affected QOL following neck dissection The 10-item NDII test-retest correlation was 0.91 (P<.001) with an internal consistency Cronbach alpha coefficient of.95. The NDII correlated with the Constant Shoulder Scale (r = 0.85, P<.001) and with the SF-36 physical functioning (r = 0.50, P<.001) and role-physical functioning (r = 0.60, P<.001) domains. Using multiple variable regression, the variables that contributed most to QOL score were patient's age and weight, radiation treatment, and neck dissection type. The NDII is a valid, reliable instrument for assessing neck dissection impairment. Patient's age, weight, radiation treatment, and neck dissection type were important factors that affect QOL following neck dissection.

Novel Insights into the Development and Function of Cilia Using the Advantages of the Paramecium Cell and Its Many Cilia

PubMed Central

Yano, Junji; Valentine, Megan S.; Van Houten, Judith L.

2015-01-01

Paramecium species, especially P. tetraurelia and caudatum, are model organisms for modern research into the form and function of cilia. In this review, we focus on the ciliary ion channels and other transmembrane proteins that control the beat frequency and wave form of the cilium by controlling the signaling within the cilium. We put these discussions in the context of the advantages that Paramecium brings to the understanding of ciliary motility: mutants for genetic dissections of swimming behavior, electrophysiology, structural analysis, abundant cilia for biochemistry and modern proteomics, genomics and molecular biology. We review the connection between behavior and physiology, which allows the cells to broadcast the function of their ciliary channels in real time. We build a case for the important insights and advantages that this model organism continues to bring to the study of cilia. PMID:26230712

Novel Insights into the Development and Function of Cilia Using the Advantages of the Paramecium Cell and Its Many Cilia.

PubMed

Yano, Junji; Valentine, Megan S; Van Houten, Judith L

2015-07-29

Paramecium species, especially P. tetraurelia and caudatum, are model organisms for modern research into the form and function of cilia. In this review, we focus on the ciliary ion channels and other transmembrane proteins that control the beat frequency and wave form of the cilium by controlling the signaling within the cilium. We put these discussions in the context of the advantages that Paramecium brings to the understanding of ciliary motility: mutants for genetic dissections of swimming behavior, electrophysiology, structural analysis, abundant cilia for biochemistry and modern proteomics, genomics and molecular biology. We review the connection between behavior and physiology, which allows the cells to broadcast the function of their ciliary channels in real time. We build a case for the important insights and advantages that this model organism continues to bring to the study of cilia.

Network inference reveals novel connections in pathways regulating growth and defense in the yeast salt response.

PubMed

MacGilvray, Matthew E; Shishkova, Evgenia; Chasman, Deborah; Place, Michael; Gitter, Anthony; Coon, Joshua J; Gasch, Audrey P

2018-05-01

Cells respond to stressful conditions by coordinating a complex, multi-faceted response that spans many levels of physiology. Much of the response is coordinated by changes in protein phosphorylation. Although the regulators of transcriptome changes during stress are well characterized in Saccharomyces cerevisiae, the upstream regulatory network controlling protein phosphorylation is less well dissected. Here, we developed a computational approach to infer the signaling network that regulates phosphorylation changes in response to salt stress. We developed an approach to link predicted regulators to groups of likely co-regulated phospho-peptides responding to stress, thereby creating new edges in a background protein interaction network. We then use integer linear programming (ILP) to integrate wild type and mutant phospho-proteomic data and predict the network controlling stress-activated phospho-proteomic changes. The network we inferred predicted new regulatory connections between stress-activated and growth-regulating pathways and suggested mechanisms coordinating metabolism, cell-cycle progression, and growth during stress. We confirmed several network predictions with co-immunoprecipitations coupled with mass-spectrometry protein identification and mutant phospho-proteomic analysis. Results show that the cAMP-phosphodiesterase Pde2 physically interacts with many stress-regulated transcription factors targeted by PKA, and that reduced phosphorylation of those factors during stress requires the Rck2 kinase that we show physically interacts with Pde2. Together, our work shows how a high-quality computational network model can facilitate discovery of new pathway interactions during osmotic stress.

Three Fusarium oxysporum mitogen-activated protein kinases (MAPKs) have distinct and complementary roles in stress adaptation and cross-kingdom pathogenicity.

PubMed

Segorbe, David; Di Pietro, Antonio; Pérez-Nadales, Elena; Turrà, David

2017-09-01

Mitogen-activated protein kinase (MAPK) cascades mediate cellular responses to environmental signals. Previous studies in the fungal pathogen Fusarium oxysporum have revealed a crucial role of Fmk1, the MAPK orthologous to Saccharomyces cerevisiae Fus3/Kss1, in vegetative hyphal fusion and plant infection. Here, we genetically dissected the individual and combined contributions of the three MAPKs Fmk1, Mpk1 and Hog1 in the regulation of development, stress response and virulence of F. oxysporum on plant and animal hosts. Mutants lacking Fmk1 or Mpk1 were affected in reactive oxygen species (ROS) homeostasis and impaired in hyphal fusion and aggregation. Loss of Mpk1 also led to increased sensitivity to cell wall and heat stress, which was exacerbated by simultaneous inactivation of Fmk1, suggesting that both MAPKs contribute to cellular adaptation to high temperature, a prerequisite for mammalian pathogens. Deletion of Hog1 caused increased sensitivity to hyperosmotic stress and resulted in partial rescue of the restricted colony growth phenotype of the mpk1Δ mutant. Infection assays on tomato plants and the invertebrate animal host Galleria mellonella revealed distinct and additive contributions of the different MAPKs to virulence. Our results indicate that positive and negative cross-talk between the three MAPK pathways regulates stress adaptation, development and virulence in the cross-kingdom pathogen F. oxysporum. © 2016 BSPP AND JOHN WILEY & SONS LTD.

A novel protein RLS1 with NB-ARM domains is involved in chloroplast degradation during leaf senescence in rice.

PubMed

Jiao, Bin-Bin; Wang, Jian-Jun; Zhu, Xu-Dong; Zeng, Long-Jun; Li, Qun; He, Zu-Hua

2012-01-01

Leaf senescence, a type of programmed cell death (PCD) characterized by chlorophyll degradation, is important to plant growth and crop productivity. It emerges that autophagy is involved in chloroplast degradation during leaf senescence. However, the molecular mechanism(s) involved in the process is not well understood. In this study, the genetic and physiological characteristics of the rice rls1 (rapid leaf senescence 1) mutant were identified. The rls1 mutant developed small, yellow-brown lesions resembling disease scattered over the whole surfaces of leaves that displayed earlier senescence than those of wild-type plants. The rapid loss of chlorophyll content during senescence was the main cause of accelerated leaf senescence in rls1. Microscopic observation indicated that PCD was misregulated, probably resulting in the accelerated degradation of chloroplasts in rls1 leaves. Map-based cloning of the RLS1 gene revealed that it encodes a previously uncharacterized NB (nucleotide-binding site)-containing protein with an ARM (armadillo) domain at the carboxyl terminus. Consistent with its involvement in leaf senescence, RLS1 was up-regulated during dark-induced leaf senescence and down-regulated by cytokinin. Intriguingly, constitutive expression of RLS1 also slightly accelerated leaf senescence with decreased chlorophyll content in transgenic rice plants. Our study identified a previously uncharacterized NB-ARM protein involved in PCD during plant growth and development, providing a unique tool for dissecting possible autophagy-mediated PCD during senescence in plants.

Stress Marker Signatures in Lesion Mimic Single and Double Mutants Identify a Crucial Leaf Age-Dependent Salicylic Acid Related Defense Signal.

PubMed

Kaurilind, Eve; Brosché, Mikael

2017-01-01

Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.

Mycoviruses as Triggers and Targets of RNA Silencing in White Mold Fungus Sclerotinia sclerotiorum.

PubMed

Mochama, Pauline; Jadhav, Prajakta; Neupane, Achal; Lee Marzano, Shin-Yi

2018-04-22

This study aimed to demonstrate the existence of antiviral RNA silencing mechanisms in Sclerotinia sclerotiorum by infecting wild-type and RNA-silencing-deficient strains of the fungus with an RNA virus and a DNA virus. Key silencing-related genes were disrupted to dissect the RNA silencing pathway. Specifically, dicer genes ( dcl-1, dcl-2 , and both dcl-1 / dcl-2 ) were displaced by selective marker(s). Disruption mutants were then compared for changes in phenotype, virulence, and susceptibility to virus infections. Wild-type and mutant strains were transfected with a single-stranded RNA virus, SsHV2-L, and copies of a single-stranded DNA mycovirus, SsHADV-1, as a synthetic virus constructed in this study. Disruption of dcl-1 or dcl-2 resulted in no changes in phenotype compared to wild-type S. sclerotiorum ; however, the double dicer mutant strain exhibited significantly slower growth. Furthermore, the Δdcl-1/dcl-2 double mutant, which was slow growing without virus infection, exhibited much more severe debilitation following virus infections including phenotypic changes such as slower growth, reduced pigmentation, and delayed sclerotial formation. These phenotypic changes were absent in the single mutants, Δdcl-1 and Δdcl-2 . Complementation of a single dicer in the double disruption mutant reversed viral susceptibility to the wild-type state. Virus-derived small RNAs were accumulated from virus-infected wild-type strains with strand bias towards the negative sense. The findings of these studies indicate that S. sclerotiorum has robust RNA silencing mechanisms that process both DNA and RNA mycoviruses and that, when both dicers are silenced, invasive nucleic acids can greatly debilitate the virulence of this fungus.

Microevolution of Group A Streptococci In Vivo: Capturing Regulatory Networks Engaged in Sociomicrobiology, Niche Adaptation, and Hypervirulence

PubMed Central

Aziz, Ramy K.; Kansal, Rita; Aronow, Bruce J.; Taylor, William L.; Rowe, Sarah L.; Kubal, Michael; Chhatwal, Gursharan S.; Walker, Mark J.; Kotb, Malak

2010-01-01

The onset of infection and the switch from primary to secondary niches are dramatic environmental changes that not only alter bacterial transcriptional programs, but also perturb their sociomicrobiology, often driving minor subpopulations with mutant phenotypes to prevail in specific niches. Having previously reported that M1T1 Streptococcus pyogenes become hypervirulent in mice due to selection of mutants in the covRS regulatory genes, we set out to dissect the impact of these mutations in vitro and in vivo from the impact of other adaptive events. Using a murine subcutaneous chamber model to sample the bacteria prior to selection or expansion of mutants, we compared gene expression dynamics of wild type (WT) and previously isolated animal-passaged (AP) covS mutant bacteria both in vitro and in vivo, and we found extensive transcriptional alterations of pathoadaptive and metabolic gene sets associated with invasion, immune evasion, tissue-dissemination, and metabolic reprogramming. In contrast to the virulence-associated differences between WT and AP bacteria, Phenotype Microarray analysis showed minor in vitro phenotypic differences between the two isogenic variants. Additionally, our results reflect that WT bacteria's rapid host-adaptive transcriptional reprogramming was not sufficient for their survival, and they were outnumbered by hypervirulent covS mutants with SpeB−/Sdahigh phenotype, which survived up to 14 days in mice chambers. Our findings demonstrate the engagement of unique regulatory modules in niche adaptation, implicate a critical role for bacterial genetic heterogeneity that surpasses transcriptional in vivo adaptation, and portray the dynamics underlying the selection of hypervirulent covS mutants over their parental WT cells. PMID:20418946

The dead center of the dental curriculum: changing attitudes of dental students during dissection.

PubMed

Redwood, Christopher J; Townsend, Grant C

2011-10-01

The purpose of this study was to investigate changes in dental students' perceptions of professionalism, knowledge, and emotion over the period of dissection in a human anatomy course. Whether human dissection needs to be a part of the modern dental curriculum is often called into question, particularly with the plethora of electronic and other aids available to support the learning of anatomy. The influence of the dissection process on development of professional attitudes and emotional maturity has been studied in medical students, but how dental students react to this part of their education is less well known. To investigate this question, a survey was administered before and after the dissection course to two sequential year groups of dental students. It was found that these students had high levels of understanding of professional values before commencing dissection and continued to value the role of teamwork in aiding their learning over the survey period. The majority of students coped well with the assimilation of knowledge and developed coping mechanisms to handle the emotional aspects of dissection. The students remained excited by and interested in dissection, and the majority valued it as the most positive aspect of their anatomy course. The students increasingly valued the use of prosected specimens as an aid to learning. This study confirmed that significant changes occur in dental students' attitudes during the period of dissection, which we believe contribute to the development of more empathetic and caring practitioners.

Shade avoidance components and pathways in adult plants revealed by phenotypic profiling.

PubMed

Nozue, Kazunari; Tat, An V; Kumar Devisetty, Upendra; Robinson, Matthew; Mumbach, Maxwell R; Ichihashi, Yasunori; Lekkala, Saradadevi; Maloof, Julin N

2015-04-01

Shade from neighboring plants limits light for photosynthesis; as a consequence, plants have a variety of strategies to avoid canopy shade and compete with their neighbors for light. Collectively the response to foliar shade is called the shade avoidance syndrome (SAS). The SAS includes elongation of a variety of organs, acceleration of flowering time, and additional physiological responses, which are seen throughout the plant life cycle. However, current mechanistic knowledge is mainly limited to shade-induced elongation of seedlings. Here we use phenotypic profiling of seedling, leaf, and flowering time traits to untangle complex SAS networks. We used over-representation analysis (ORA) of shade-responsive genes, combined with previous annotation, to logically select 59 known and candidate novel mutants for phenotyping. Our analysis reveals shared and separate pathways for each shade avoidance response. In particular, auxin pathway components were required for shade avoidance responses in hypocotyl, petiole, and flowering time, whereas jasmonic acid pathway components were only required for petiole and flowering time responses. Our phenotypic profiling allowed discovery of seventeen novel shade avoidance mutants. Our results demonstrate that logical selection of mutants increased success of phenotypic profiling to dissect complex traits and discover novel components.

Asymmetric configurations in a reengineered homodimer reveal multiple subunit communication pathways in protein allostery

PubMed Central

Lanfranco, Maria Fe; Gárate, Fernanda; Engdahl, Ashton J.; Maillard, Rodrigo A.

2017-01-01

Many allosteric proteins form homo-oligomeric complexes to regulate a biological function. In homo-oligomers, subunits establish communication pathways that are modulated by external stimuli like ligand binding. A challenge for dissecting the communication mechanisms in homo-oligomers is identifying intermediate liganded states, which are typically transiently populated. However, their identities provide the most mechanistic information on how ligand-induced signals propagate from bound to empty subunits. Here, we dissected the directionality and magnitude of subunit communication in a reengineered single-chain version of the homodimeric transcription factor cAMP receptor protein. By combining wild-type and mutant subunits in various asymmetric configurations, we revealed a linear relationship between the magnitude of cooperative effects and the number of mutant subunits. We found that a single mutation is sufficient to change the global allosteric behavior of the dimer even when one subunit was wild type. Dimers harboring two mutations with opposite cooperative effects had different allosteric properties depending on the arrangement of the mutations. When the two mutations were placed in the same subunit, the resulting cooperativity was neutral. In contrast, when placed in different subunits, the observed cooperativity was dominated by the mutation with strongest effects over cAMP affinity relative to wild type. These results highlight the distinct roles of intrasubunit interactions and intersubunit communication in allostery. Finally, dimers bound to either one or two cAMP molecules had similar DNA affinities, indicating that both asymmetric and symmetric liganded states activate DNA interactions. These studies have revealed the multiple communication pathways that homo-oligomers employ to transduce signals. PMID:28188293

Target of Rapamycin Regulates Development and Ribosomal RNA Expression through Kinase Domain in Arabidopsis1[W][OA

PubMed Central

Ren, Maozhi; Qiu, Shuqing; Venglat, Prakash; Xiang, Daoquan; Feng, Li; Selvaraj, Gopalan; Datla, Raju

2011-01-01

Target of rapamycin (TOR) is a central regulator of cell growth, cell death, nutrition, starvation, hormone, and stress responses in diverse eukaryotes. However, very little is known about TOR signaling and the associated functional domains in plants. We have taken a genetic approach to dissect TOR functions in Arabidopsis (Arabidopsis thaliana) and report here that the kinase domain is essential for the role of TOR in embryogenesis and 45S rRNA expression. Twelve new T-DNA insertion mutants, spanning 14.2 kb of TOR-encoding genomic region, have been characterized. Nine of these share expression of defective kinase domain and embryo arrest at 16 to 32 cell stage. However, three T-DNA insertion lines affecting FATC domain displayed normal embryo development, indicating that FATC domain was dispensable in Arabidopsis. Genetic complementation showed that the TOR kinase domain alone in tor-10/tor-10 mutant background can rescue early embryo lethality and restore normal development. Overexpression of full-length TOR or kinase domain in Arabidopsis displayed developmental abnormalities in meristem, leaf, root, stem, flowering time, and senescence. We further show that TOR, especially the kinase domain, plays a role in ribosome biogenesis by activating 45S rRNA production. Of the six putative nuclear localization sequences in the kinase domain, nuclear localization sequence 6 was identified to confer TOR nuclear targeting in transient expression assays. Chromatin immunoprecipitation studies revealed that the HEAT repeat domain binds to 45S rRNA promoter and the 5′ external transcribed spacer elements motif. Together, these results show that TOR controls the embryogenesis, postembryonic development, and 45S rRNA production through its kinase domain in Arabidopsis. PMID:21266656

Retrograde Ascending Aortic Dissection after Stent Grafting for Stanford Type B Aortic Dissection with Severe Limb Ischemia.

PubMed

Higuchi, Yoshiro; Tochii, Masato; Takami, Yoshiyuki; Kobayashi, Akihiro; Yanagisawa, Tsutomu; Amano, Kentaro; Sakurai, Yusuke; Ishida, Michiko; Ishikawa, Hiroshi; Hattori, Koji; Takagi, Yasushi

2017-03-24

We report a rare case of retrograde Stanford type A aortic dissection after endovascular repair for complicated Stanford type B aortic dissection. A 45-year-old man presented with a sudden onset of back pain and was transferred to our hospital. Computed tomography demonstrated acute Stanford type B aortic dissection with lower limb ischemia. Emergency endovascular surgery was planned for repair of the Stanford type B aortic dissection. The patient suddenly developed recurrent chest pain 10 days after the initial procedure. Computed tomography revealed retrograde Stanford type A aortic dissection involving the ascending aorta and aortic arch. The patient underwent a successful emergency total aortic arch replacement.

HMBPP-deficient Listeria mutant immunization alters pulmonary/systemic responses, effector functions, and memory polarization of Vγ2Vδ2 T cells

PubMed Central

Frencher, James T.; Shen, Hongbo; Yan, Lin; Wilson, Jessica O.; Freitag, Nancy E.; Rizzo, Alicia N.; Chen, Crystal Y.; Chen, Zheng W.

2014-01-01

Whereas infection or immunization of humans/primates with microbes coproducing HMBPP/IPP can remarkably activate Vγ2Vδ2 T cells, in vivo studies have not been done to dissect HMBPP- and IPP-driven expansion, pulmonary trafficking, effector functions, and memory polarization of Vγ2Vδ2 T cells. We define these phosphoantigen-host interplays by comparative immunizations of macaques with the HMBPP/IPP-coproducing Listeria ΔactA prfA* and HMBPP-deficient Listeria ΔactAΔgcpE prfA* mutant. The HMBPP-deficient ΔgcpE mutant shows lower ability to expand Vγ2Vδ2 T cells in vitro than the parental HMBPP-producing strain but displays comparably attenuated infectivity or immunogenicity. Respiratory immunization of macaques with the HMBPP-deficient mutant elicits lower pulmonary and systemic responses of Vγ2Vδ2 T cells compared with the HMBPP-producing vaccine strain. Interestingly, HMBPP-deficient mutant reimmunization or boosting elicits enhanced responses of Vγ2Vδ2 T cells, but the magnitude is lower than that by HMBPP-producing listeria. HMBPP-deficient listeria differentiated fewer Vγ2Vδ2 T effector cells capable of coproducing IFN-γ and TNF-α and inhibiting intracellular listeria than HMBPP-producing listeria. Furthermore, HMBPP deficiency in listerial immunization influences memory polarization of Vγ2Vδ2 T cells. Thus, both HMBPP and IPP production in listerial immunization or infection elicit systemic/pulmonary responses and differentiation of Vγ2Vδ2 T cells, but a role for HMBPP is more dominant. Findings may help devise immune intervention. PMID:25114162

Dissecting the Genetic Basis for Seed Coat Mucilage Heteroxylan Biosynthesis in Plantago ovata Using Gamma Irradiation and Infrared Spectroscopy

PubMed Central

Tucker, Matthew R.; Ma, Chao; Phan, Jana; Neumann, Kylie; Shirley, Neil J.; Hahn, Michael G.; Cozzolino, Daniel; Burton, Rachel A.

2017-01-01

Seeds from the myxospermous species Plantago ovata release a polysaccharide-rich mucilage upon contact with water. This seed coat derived mucilage is composed predominantly of heteroxylan (HX) and is utilized as a gluten-free dietary fiber supplement to promote human colorectal health. In this study, a gamma-irradiated P. ovata population was generated and screened using histological stains and Fourier Transform Mid Infrared (FTMIR) spectroscopy to identify putative mutants showing defects in seed coat mucilage HX composition and/or structure. FTMIR analysis of dry seed revealed variation in regions of the IR spectra previously linked to xylan structure in Secale cereale (rye). Subsequent absorbance ratio and PCA multivariate analysis identified 22 putative mutant families with differences in the HX IR fingerprint region. Many of these showed distinct changes in the amount and subtle changes in structure of HX after mucilage extrusion, while 20% of the putative HX mutants identified by FTMIR showed no difference in staining patterns of extruded mucilage compared to wild-type. Transcriptional screening analysis of two putative reduced xylan in mucilage (rxm) mutants, rxm1 and rxm3, revealed that changes in HX levels in rxm1 correlate with reduced transcription of known and novel genes associated with xylan synthesis, possibly indicative of specific co-regulatory units within the xylan biosynthetic pathway. These results confirm that FTMIR is a suitable method for identifying putative mutants with altered mucilage HX composition in P. ovata, and therefore forms a resource to identify novel genes involved in xylan biosynthesis. PMID:28377777

A simple, cheap, one-minute method to mount insect pins for use as sharp-tipped probes in plant dissection.

PubMed

Frohlich, Michael W

2005-08-01

A new method is presented for twist mounting insect pins onto standard dissecting (teasing) needles. Insect pins, with their sharp points, are ideal for fine dissection of plants, especially of shoot tips and early developing flower buds. Twist mounting makes them convenient and effective dissecting tools to prepare specimens for SEM.

The Identification of Zebrafish Mutants Showing Alterations in Senescence-Associated Biomarkers

PubMed Central

Uchiyama, Junzo; Koshimizu, Eriko; Qi, Jie; Nanjappa, Purushothama; Imamura, Shintaro; Islam, Asiful; Neuberg, Donna; Amsterdam, Adam; Roberts, Thomas M.

2008-01-01

There is an interesting overlap of function in a wide range of organisms between genes that modulate the stress responses and those that regulate aging phenotypes and, in some cases, lifespan. We have therefore screened mutagenized zebrafish embryos for the altered expression of a stress biomarker, senescence-associated β-galactosidase (SA-β-gal) in our current study. We validated the use of embryonic SA-β-gal production as a screening tool by analyzing a collection of retrovirus-insertional mutants. From a pool of 306 such mutants, we identified 11 candidates that showed higher embryonic SA-β-gal activity, two of which were selected for further study. One of these mutants is null for a homologue of Drosophila spinster, a gene known to regulate lifespan in flies, whereas the other harbors a mutation in a homologue of the human telomeric repeat binding factor 2 (terf2) gene, which plays roles in telomere protection and telomere-length regulation. Although the homozygous spinster and terf2 mutants are embryonic lethal, heterozygous adult fish are viable and show an accelerated appearance of aging symptoms including lipofuscin accumulation, which is another biomarker, and shorter lifespan. We next used the same SA-β-gal assay to screen chemically mutagenized zebrafish, each of which was heterozygous for lesions in multiple genes, under the sensitizing conditions of oxidative stress. We obtained eight additional mutants from this screen that, when bred to homozygosity, showed enhanced SA-β-gal activity even in the absence of stress, and further displayed embryonic neural and muscular degenerative phenotypes. Adult fish that are heterozygous for these mutations also showed the premature expression of aging biomarkers and the accelerated onset of aging phenotypes. Our current strategy of mutant screening for a senescence-associated biomarker in zebrafish embryos may thus prove to be a useful new tool for the genetic dissection of vertebrate stress response and senescence mechanisms. PMID:18704191

Homocysteine regulates fatty acid and lipid metabolism in yeast.

PubMed

Visram, Myriam; Radulovic, Maja; Steiner, Sabine; Malanovic, Nermina; Eichmann, Thomas O; Wolinski, Heimo; Rechberger, Gerald N; Tehlivets, Oksana

2018-04-13

S -Adenosyl-l-homocysteine hydrolase (AdoHcy hydrolase; Sah1 in yeast/AHCY in mammals) degrades AdoHcy, a by-product and strong product inhibitor of S -adenosyl-l-methionine (AdoMet)-dependent methylation reactions, to adenosine and homocysteine (Hcy). This reaction is reversible, so any elevation of Hcy levels, such as in hyperhomocysteinemia (HHcy), drives the formation of AdoHcy, with detrimental consequences for cellular methylation reactions. HHcy, a pathological condition linked to cardiovascular and neurological disorders, as well as fatty liver among others, is associated with a deregulation of lipid metabolism. Here, we developed a yeast model of HHcy to identify mechanisms that dysregulate lipid metabolism. Hcy supplementation to wildtype cells up-regulated cellular fatty acid and triacylglycerol content and induced a shift in fatty acid composition, similar to changes observed in mutants lacking Sah1. Expression of the irreversible bacterial pathway for AdoHcy degradation in yeast allowed us to dissect the impact of AdoHcy accumulation on lipid metabolism from the impact of elevated Hcy. Expression of this pathway fully suppressed the growth deficit of sah1 mutants as well as the deregulation of lipid metabolism in both the sah1 mutant and Hcy-exposed wildtype, showing that AdoHcy accumulation mediates the deregulation of lipid metabolism in response to elevated Hcy in yeast. Furthermore, Hcy supplementation in yeast led to increased resistance to cerulenin, an inhibitor of fatty acid synthase, as well as to a concomitant decline of condensing enzymes involved in very long-chain fatty acid synthesis, in line with the observed shift in fatty acid content and composition. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

FANCB is essential in the male germline and regulates H3K9 methylation on the sex chromosomes during meiosis

PubMed Central

Kato, Yasuko; Alavattam, Kris G.; Sin, Ho-Su; Meetei, Amom Ruhikanta; Pang, Qishen; Andreassen, Paul R.; Namekawa, Satoshi H.

2015-01-01

Fanconi anemia (FA) is a recessive X-linked and autosomal genetic disease associated with bone marrow failure and increased cancer, as well as severe germline defects such as hypogonadism and germ cell depletion. Although deficiencies in FA factors are commonly associated with germ cell defects, it remains unknown whether the FA pathway is involved in unique epigenetic events in germ cells. In this study, we generated Fancb mutant mice, the first mouse model of X-linked FA, and identified a novel function of the FA pathway in epigenetic regulation during mammalian gametogenesis. Fancb mutant mice were infertile and exhibited primordial germ cell (PGC) defects during embryogenesis. Further, Fancb mutation resulted in the reduction of undifferentiated spermatogonia in spermatogenesis, suggesting that FANCB regulates the maintenance of undifferentiated spermatogonia. Additionally, based on functional studies, we dissected the pathway in which FANCB functions during meiosis. The localization of FANCB on sex chromosomes is dependent on MDC1, a binding partner of H2AX phosphorylated at serine 139 (γH2AX), which initiates chromosome-wide silencing. Also, FANCB is required for FANCD2 localization during meiosis, suggesting that the role of FANCB in the activation of the FA pathway is common to both meiosis and somatic DNA damage responses. H3K9me2, a silent epigenetic mark, was decreased on sex chromosomes, whereas H3K9me3 was increased on sex chromosomes in Fancb mutant spermatocytes. Taken together, these results indicate that FANCB functions at critical stages of germ cell development and reveal a novel function of the FA pathway in the regulation of H3K9 methylation in the germline. PMID:26123487

Rapamycin and Glucose-Target of Rapamycin (TOR) Protein Signaling in Plants*

PubMed Central

Xiong, Yan; Sheen, Jen

2012-01-01

Target of rapamycin (TOR) kinase is an evolutionarily conserved master regulator that integrates energy, nutrients, growth factors, and stress signals to promote survival and growth in all eukaryotes. The reported land plant resistance to rapamycin and the embryo lethality of the Arabidopsis tor mutants have hindered functional dissection of TOR signaling in plants. We developed sensitive cellular and seedling assays to monitor endogenous Arabidopsis TOR activity based on its conserved S6 kinase (S6K) phosphorylation. Surprisingly, rapamycin effectively inhibits Arabidopsis TOR-S6K1 signaling and retards glucose-mediated root and leaf growth, mimicking estradiol-inducible tor mutants. Rapamycin inhibition is relieved in transgenic plants deficient in Arabidopsis FK506-binding protein 12 (FKP12), whereas FKP12 overexpression dramatically enhances rapamycin sensitivity. The role of Arabidopsis FKP12 is highly specific as overexpression of seven closely related FKP proteins fails to increase rapamycin sensitivity. Rapamycin exerts TOR inhibition by inducing direct interaction between the TOR-FRB (FKP-rapamycin binding) domain and FKP12 in plant cells. We suggest that variable endogenous FKP12 protein levels may underlie the molecular explanation for longstanding enigmatic observations on inconsistent rapamycin resistance in plants and in various mammalian cell lines or diverse animal cell types. Integrative analyses with rapamycin and conditional tor and fkp12 mutants also reveal a central role of glucose-TOR signaling in root hair formation. Our studies demonstrate the power of chemical genetic approaches in the discovery of previously unknown and pivotal functions of glucose-TOR signaling in governing the growth of cotyledons, true leaves, petioles, and primary and secondary roots and root hairs. PMID:22134914

A Case of Acute Ischemic Duodenal Ulcer Associated with Superior Mesenteric Artery Dissection After Transarterial Chemoembolization for Hepatocellular Carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jang, Eun Sun; Jeong, Sook-Hyang, E-mail: jsh@snubh.org; Kim, Jin Wook

We report a case of transarterial chemoembolization (TACE)-related acute ischemic duodenal ulcer that developed in association with dissection of the superior mesenteric artery. We conclude that the acute duodenal ulcer was developed by ischemia related to superior mesenteric artery dissection during TACE. TACE should be conducted carefully with continuous observation of abdominal arteries.

Assessing mouse behaviour throughout the light/dark cycle using automated in-cage analysis tools.

PubMed

Bains, Rasneer S; Wells, Sara; Sillito, Rowland R; Armstrong, J Douglas; Cater, Heather L; Banks, Gareth; Nolan, Patrick M

2018-04-15

An important factor in reducing variability in mouse test outcomes has been to develop assays that can be used for continuous automated home cage assessment. Our experience has shown that this has been most evidenced in long-term assessment of wheel-running activity in mice. Historically, wheel-running in mice and other rodents have been used as a robust assay to determine, with precision, the inherent period of circadian rhythms in mice. Furthermore, this assay has been instrumental in dissecting the molecular genetic basis of mammalian circadian rhythms. In teasing out the elements of this test that have determined its robustness - automated assessment of an unforced behaviour in the home cage over long time intervals - we and others have been investigating whether similar test apparatus could be used to accurately discriminate differences in distinct behavioural parameters in mice. Firstly, using these systems, we explored behaviours in a number of mouse inbred strains to determine whether we could extract biologically meaningful differences. Secondly, we tested a number of relevant mutant lines to determine how discriminative these parameters were. Our findings show that, when compared to conventional out-of-cage phenotyping, a far deeper understanding of mouse mutant phenotype can be established by monitoring behaviour in the home cage over one or more light:dark cycles. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

NemaFlex: a microfluidics-based technology for standardized measurement of muscular strength of C. elegans.

PubMed

Rahman, Mizanur; Hewitt, Jennifer E; Van-Bussel, Frank; Edwards, Hunter; Blawzdziewicz, Jerzy; Szewczyk, Nathaniel J; Driscoll, Monica; Vanapalli, Siva A

2018-06-12

Muscle strength is a functional measure of quality of life in humans. Declines in muscle strength are manifested in diseases as well as during inactivity, aging, and space travel. With conserved muscle biology, the simple genetic model C. elegans is a high throughput platform in which to identify molecular mechanisms causing muscle strength loss and to develop interventions based on diet, exercise, and drugs. In the clinic, standardized strength measures are essential to quantitate changes in patients; however, analogous standards have not been recapitulated in the C. elegans model since force generation fluctuates based on animal behavior and locomotion. Here, we report a microfluidics-based system for strength measurement that we call 'NemaFlex', based on pillar deflection as the nematode crawls through a forest of pillars. We have optimized the micropillar forest design and identified robust measurement conditions that yield a measure of strength that is independent of behavior and gait. Validation studies using a muscle contracting agent and mutants confirm that NemaFlex can reliably score muscular strength in C. elegans. Additionally, we report a scaling factor to account for animal size that is consistent with a biomechanics model and enables comparative strength studies of mutants. Taken together, our findings anchor NemaFlex for applications in genetic and drug screens, for defining molecular and cellular circuits of neuromuscular function, and for dissection of degenerative processes in disuse, aging, and disease.

Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans.

PubMed

Vieira, Neide; Bessa, Carlos; Rodrigues, Ana J; Marques, Paulo; Chan, Fung-Yi; de Carvalho, Ana Xavier; Correia-Neves, Margarida; Sousa, Nuno

2018-06-01

The sorting nexins family of proteins (SNXs) plays pleiotropic functions in protein trafficking and intracellular signaling and has been associated with several disorders, namely Alzheimer's disease and Down's syndrome. Despite the growing association of SNXs with neurodegeneration, not much is known about their function in the nervous system. The aim of this work was to use the nematode Caenorhabditis elegans that encodes in its genome eight SNXs orthologs, to dissect the role of distinct SNXs, particularly in the nervous system. By screening the C. elegans SNXs deletion mutants for morphological, developmental and behavioral alterations, we show here that snx-3 gene mutation leads to an array of developmental defects, such as delayed hatching, decreased brood size and life span and reduced body length. Additionally, ∆snx-3 worms present increased susceptibility to osmotic, thermo and oxidative stress and distinct behavioral deficits, namely, a chemotaxis defect which is independent of the described snx-3 role in Wnt secretion. ∆snx-3 animals also display abnormal GABAergic neuronal architecture and wiring and altered AIY interneuron structure. Pan-neuronal expression of C. elegans snx-3 cDNA in the ∆snx-3 mutant is able to rescue its locomotion defects, as well as its chemotaxis toward isoamyl alcohol. Altogether, the present work provides the first in vivo evidence of the SNX-3 role in the nervous system.

The risk for type B aortic dissection in Marfan syndrome.

PubMed

den Hartog, Alexander W; Franken, Romy; Zwinderman, Aeilko H; Timmermans, Janneke; Scholte, Arthur J; van den Berg, Maarten P; de Waard, Vivian; Pals, Gerard; Mulder, Barbara J M; Groenink, Maarten

2015-01-27

Aortic dissections involving the descending aorta are a major clinical problem in patients with Marfan syndrome. The purpose of this study was to identify clinical parameters associated with type B aortic dissection and to develop a risk model to predict type B aortic dissection in patients with Marfan syndrome. Patients with the diagnosis of Marfan syndrome and magnetic resonance imaging or computed tomographic imaging of the aorta were followed for a median of 6 years for the occurrence of type B dissection or the combined end point of type B aortic dissection, distal aortic surgery, and death. A model using various clinical parameters as well as genotyping was developed to predict the risk for type B dissection in patients with Marfan syndrome. Between 1998 and 2013, 54 type B aortic dissections occurred in 600 patients with Marfan syndrome (mean age 36 ± 14 years, 52% male). Independent variables associated with type B aortic dissection were prior prophylactic aortic surgery (hazard ratio: 2.1; 95% confidence interval: 1.2 to 3.8; p = 0.010) and a proximal descending aorta diameter ≥27 mm (hazard ratio: 2.2; 95% confidence interval: 1.1 to 4.3; p = 0.020). In the risk model, the 10-year occurrence of type B aortic dissection in low-, moderate-, and high-risk patients was 6%, 19%, and 34%, respectively. Angiotensin II receptor blocker therapy was associated with fewer type B aortic dissections (hazard ratio: 0.3; 95% confidence interval: 0.1 to 0.9; p = 0.030). Patients with Marfan syndrome with prior prophylactic aortic surgery are at substantial risk for type B aortic dissection, even when the descending aorta is only slightly dilated. Angiotensin II receptor blocker therapy may be protective in the prevention of type B aortic dissections. Copyright © 2015 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Using whole mount in situ hybridization to link molecular and organismal biology.

PubMed

Jacobs, Nicole L; Albertson, R Craig; Wiles, Jason R

2011-03-31

Whole mount in situ hybridization (WISH) is a common technique in molecular biology laboratories used to study gene expression through the localization of specific mRNA transcripts within whole mount specimen. This technique (adapted from Albertson and Yelick, 2005) was used in an upper level undergraduate Comparative Vertebrate Biology laboratory classroom at Syracuse University. The first two thirds of the Comparative Vertebrate Biology lab course gave students the opportunity to study the embryology and gross anatomy of several organisms representing various chordate taxa primarily via traditional dissections and the use of models. The final portion of the course involved an innovative approach to teaching anatomy through observation of vertebrate development employing molecular techniques in which WISH was performed on zebrafish embryos. A heterozygous fibroblast growth factor 8 a (fgf8a) mutant line, ace, was used. Due to Mendelian inheritance, ace intercrosses produced wild type, heterozygous, and homozygous ace/fgf8a mutants in a 1:2:1 ratio. RNA probes with known expression patterns in the midline and in developing anatomical structures such as the heart, somites, tailbud, myotome, and brain were used. WISH was performed using zebrafish at the 13 somite and prim-6 stages, with students performing the staining reaction in class. The study of zebrafish embryos at different stages of development gave students the ability to observe how these anatomical structures changed over ontogeny. In addition, some ace/fgf8a mutants displayed improper heart looping, and defects in somite and brain development. The students in this lab observed the normal development of various organ systems using both external anatomy as well as gene expression patterns. They also identified and described embryos displaying improper anatomical development and gene expression (i.e., putative mutants). For instructors at institutions that do not already own the necessary equipment or where funds for lab and curricular innovation are limited, the financial cost of the reagents and apparatus may be a factor to consider, as will the time and effort required on the part of the instructor regardless of the setting. Nevertheless, we contend that the use of WISH in this type of classroom laboratory setting can provide an important link between developmental genetics and anatomy. As technology advances and the ability to study organismal development at the molecular level becomes easier, cheaper, and increasingly popular, many evolutionary biologists, ecologists, and physiologists are turning to research strategies in the field of molecular biology. Using WISH in a Comparative Vertebrate Biology laboratory classroom is one example of how molecules and anatomy can converge within a single course. This gives upper level college students the opportunity to practice modern biological research techniques, leading to a more diversified education and the promotion of future interdisciplinary scientific research.

Hippo vs. Crab: tissue-specific functions of the mammalian Hippo pathway.

PubMed

Nishio, Miki; Maehama, Tomohiko; Goto, Hiroki; Nakatani, Keisuke; Kato, Wakako; Omori, Hirofumi; Miyachi, Yosuke; Togashi, Hideru; Shimono, Yohei; Suzuki, Akira

2017-01-01

The Hippo signaling pathway is a vital suppressor of tumorigenesis that is often inactivated in human cancers. In normal cells, the Hippo pathway is triggered by external forces such as cell crowding, or changes to the extracellular matrix or cell polarity. Once activated, Hippo signaling down-regulates transcription supported by the paralogous cofactors YAP1 and TAZ. The Hippo pathway's functions in normal and cancer biology have been dissected by studies of mutant mice with null or conditional tissue-specific mutations of Hippo signaling elements. In this review, we attempt to systematically summarize results that have been gleaned from detailed in vivo characterizations of these mutants. Our goal is to describe the physiological roles of Hippo signaling in several normal organ systems, as well as to emphasize how disruption of the Hippo pathway, and particularly hyperactivation of YAP1/TAZ, can be oncogenic. © 2017 The Authors Genes to Cells published by Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Identification of a Novel GJA8 (Cx50) Point Mutation Causes Human Dominant Congenital Cataracts

NASA Astrophysics Data System (ADS)

Ge, Xiang-Lian; Zhang, Yilan; Wu, Yaming; Lv, Jineng; Zhang, Wei; Jin, Zi-Bing; Qu, Jia; Gu, Feng

2014-02-01

Hereditary cataracts are clinically and genetically heterogeneous lens diseases that cause a significant proportion of visual impairment and blindness in children. Human cataracts have been linked with mutations in two genes, GJA3 and GJA8, respectively. To identify the causative mutation in a family with hereditary cataracts, family members were screened for mutations by PCR for both genes. Sequencing the coding regions of GJA8, coding for connexin 50, revealed a C > A transversion at nucleotide 264, which caused p.P88T mutation. To dissect the molecular consequences of this mutation, plasmids carrying wild-type and mutant mouse ORFs of Gja8 were generated and ectopically expressed in HEK293 cells and human lens epithelial cells, respectively. The recombinant proteins were assessed by confocal microscopy and Western blotting. The results demonstrate that the molecular consequences of the p.P88T mutation in GJA8 include changes in connexin 50 protein localization patterns, accumulation of mutant protein, and increased cell growth.

The roles of specific xanthophylls in photoprotection

PubMed Central

Niyogi, Krishna K.; Björkman, Olle; Grossman, Arthur R.

1997-01-01

Xanthophyll pigments have critical structural and functional roles in the photosynthetic light-harvesting complexes of algae and vascular plants. Genetic dissection of xanthophyll metabolism in the green alga Chlamydomonas reinhardtii revealed functions for specific xanthophylls in the nonradiative dissipation of excess absorbed light energy, measured as nonphotochemical quenching of chlorophyll fluorescence. Mutants with a defect in either the α- or β-branch of carotenoid biosynthesis exhibited less nonphotochemical quenching but were still able to tolerate high light. In contrast, a double mutant that was defective in the synthesis of lutein, loroxanthin (α-carotene branch), zeaxanthin, and antheraxanthin (β-carotene branch) had almost no nonphotochemical quenching and was extremely sensitive to high light. These results strongly suggest that in addition to the xanthophyll cycle pigments (zeaxanthin and antheraxanthin), α-carotene-derived xanthophylls such as lutein, which are structural components of the subunits of the light-harvesting complexes, contribute to the dissipation of excess absorbed light energy and the protection of plants from photo-oxidative damage. PMID:9391170

Functional dissection of protein domains involved in the immunomodulatory properties of PE_PGRS33 of Mycobacterium tuberculosis.

PubMed

Zumbo, Antonella; Palucci, Ivana; Cascioferro, Alessandro; Sali, Michela; Ventura, Marcello; D'Alfonso, Pamela; Iantomasi, Raffaella; Di Sante, Gabriele; Ria, Francesco; Sanguinetti, Maurizio; Fadda, Giovanni; Manganelli, Riccardo; Delogu, Giovanni

2013-12-01

PE_PGRSs are a large family of proteins identified in Mycobacterium tuberculosis complex and in few other pathogenic mycobacteria. The PE domain of PE_PGRS33 mediates localization of the protein on the mycobacterial cell surface, where the PGRS domain is available to interact with host components. In this study, PE_PGRS33 and its functional deletion mutants were expressed in M. smegmatis, and in vitro and in vivo assays were used to dissect the protein domains involved in the immunomodulatory properties of the protein. We demonstrate that PE_PGRS33-mediated secretion of TNF-α by macrophages occurs by extracellular interaction with TLR2. Our results also show that while the PGRS domain of the protein is required for triggering TNF-α secretion, mutation in the PE domain affects the pro-inflammatory properties of the protein. These results indicate that PE_PGRS33 is a protein with immunomodulatory activity and that protein stability and localization on the mycobacterial surface can affect these properties. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Dissection of structural and functional requirements that underlie the interaction of ERdj3 protein with substrates in the endoplasmic reticulum.

PubMed

Otero, Joel H; Lizák, Beata; Feige, Matthias J; Hendershot, Linda M

2014-10-03

ERdj3, a mammalian endoplasmic reticulum (ER) Hsp40/DnaJ family member, binds unfolded proteins, transfers them to BiP, and concomitantly stimulates BiP ATPase activity. However, the requirements for ERdj3 binding to and release from substrates in cells are not well understood. We found that ERdj3 homodimers that cannot stimulate the ATPase activity of BiP (QPD mutants) bound to unfolded ER proteins under steady state conditions in much greater amounts than wild-type ERdj3. This was due to reduced release from these substrates as opposed to enhanced binding, although in both cases dimerization was strictly required for substrate binding. Conversely, heterodimers consisting of one wild-type and one mutant ERdj3 subunit bound substrates at levels comparable with wild-type ERdj3 homodimers, demonstrating that release requires only one protomer to be functional in stimulating BiP ATPase activity. Co-expressing wild-type ERdj3 and a QPD mutant, which each exclusively formed homodimers, revealed that the release rate of wild-type ERdj3 varied according to the relative half-lives of substrates, suggesting that ERdj3 release is an important step in degradation of unfolded client proteins in the ER. Furthermore, pulse-chase experiments revealed that the binding of QPD mutant homodimers remained constant as opposed to increasing, suggesting that ERdj3 does not normally undergo reiterative binding cycles with substrates. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Dissection of Structural and Functional Requirements That Underlie the Interaction of ERdj3 Protein with Substrates in the Endoplasmic Reticulum*

PubMed Central

Otero, Joel H.; Lizák, Beata; Feige, Matthias J.; Hendershot, Linda M.

2014-01-01

ERdj3, a mammalian endoplasmic reticulum (ER) Hsp40/DnaJ family member, binds unfolded proteins, transfers them to BiP, and concomitantly stimulates BiP ATPase activity. However, the requirements for ERdj3 binding to and release from substrates in cells are not well understood. We found that ERdj3 homodimers that cannot stimulate the ATPase activity of BiP (QPD mutants) bound to unfolded ER proteins under steady state conditions in much greater amounts than wild-type ERdj3. This was due to reduced release from these substrates as opposed to enhanced binding, although in both cases dimerization was strictly required for substrate binding. Conversely, heterodimers consisting of one wild-type and one mutant ERdj3 subunit bound substrates at levels comparable with wild-type ERdj3 homodimers, demonstrating that release requires only one protomer to be functional in stimulating BiP ATPase activity. Co-expressing wild-type ERdj3 and a QPD mutant, which each exclusively formed homodimers, revealed that the release rate of wild-type ERdj3 varied according to the relative half-lives of substrates, suggesting that ERdj3 release is an important step in degradation of unfolded client proteins in the ER. Furthermore, pulse-chase experiments revealed that the binding of QPD mutant homodimers remained constant as opposed to increasing, suggesting that ERdj3 does not normally undergo reiterative binding cycles with substrates. PMID:25143379

Cadaveric dissection as an educational tool for anatomical sciences in the 21st century.

PubMed

Ghosh, Sanjib Kumar

2017-06-01

Anatomical education has been undergoing reforms in line with the demands of medical profession. The aim of the present study is to assess the impact of a traditional method like cadaveric dissection in teaching/learning anatomy at present times when medical schools are inclining towards student-centered, integrated, clinical application models. The article undertakes a review of literature and analyzes the observations made therein reflecting on the relevance of cadaveric dissection in anatomical education of 21st century. Despite the advent of modern technology and evolved teaching methods, dissection continues to remain a cornerstone of anatomy curriculum. Medical professionals of all levels believe that dissection enables learning anatomy with relevant clinical correlates. Moreover dissection helps to build discipline independent skills which are essential requirements of modern health care setup. It has been supplemented by other teaching/learning methods due to limited availability of cadavers in some countries. However, in the developing world due to good access to cadavers, dissection based teaching is central to anatomy education till date. Its utility is also reflected in the perception of students who are of the opinion that dissection provides them with a foundation critical to development of clinical skills. Researchers have even suggested that time has come to reinstate dissection as the core method of teaching gross anatomy to ensure safe medical practice. Nevertheless, as dissection alone cannot provide uniform learning experience hence needs to be complemented with other innovative learning methods in the future education model of anatomy. Anat Sci Educ 10: 286-299. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

Electron microscopy of Drosophila garland cell nephrocytes: Optimal preparation, immunostaining and STEM tomography.

PubMed

Hochapfel, Florian; Denk, Lucia; Maaßen, Christine; Zaytseva, Yulia; Rachel, Reinhard; Witzgall, Ralph; Krahn, Michael P

2018-01-29

Due to its structural and molecular similarities to mammalian podocytes, the Drosophila nephrocyte emerged as a model system to study podocyte development and associated diseases. Similar to podocytes, nephrocytes establish a slit diaphragm between foot process-like structures in order to filter the hemolymph. One major obstacle in nephrocyte research is the distinct visualization of this subcellular structure to assess its integrity. Therefore, we developed a specialized dissection and fixation protocol, including high pressure freezing and freeze substitution techniques, to improve the preservation of the intricate ultrastructural details necessary for electron microscopic assessment. By means of scanning transmission electron microscopy (STEM) tomography, a three-dimensional dataset was generated to further understand the complex architecture of the nephrocyte channel system. Moreover, a staining protocol for immunolabeling of ultrathin sections of Epon-embedded nephrocytes is discussed, which allows the reliable detection of GFP-tagged fusion proteins combined with superior sample preservation. Due to the growing number of available GFP-trap fly lines, this approach is widely applicable for high resolution localization studies in wild type and mutant nephrocytes. © 2018 Wiley Periodicals, Inc.

Cell Biology of the Caenorhabditis elegans Nucleus

PubMed Central

Cohen-Fix, Orna; Askjaer, Peter

2017-01-01

Studies on the Caenorhabditis elegans nucleus have provided fascinating insight to the organization and activities of eukaryotic cells. Being the organelle that holds the genetic blueprint of the cell, the nucleus is critical for basically every aspect of cell biology. The stereotypical development of C. elegans from a one cell-stage embryo to a fertile hermaphrodite with 959 somatic nuclei has allowed the identification of mutants with specific alterations in gene expression programs, nuclear morphology, or nuclear positioning. Moreover, the early C. elegans embryo is an excellent model to dissect the mitotic processes of nuclear disassembly and reformation with high spatiotemporal resolution. We review here several features of the C. elegans nucleus, including its composition, structure, and dynamics. We also discuss the spatial organization of chromatin and regulation of gene expression and how this depends on tight control of nucleocytoplasmic transport. Finally, the extensive connections of the nucleus with the cytoskeleton and their implications during development are described. Most processes of the C. elegans nucleus are evolutionarily conserved, highlighting the relevance of this powerful and versatile model organism to human biology. PMID:28049702

Temporal Requirements of the Fragile X Mental Retardation Protein in Modulating Circadian Clock Circuit Synaptic Architecture

PubMed Central

Gatto, Cheryl L.; Broadie, Kendal

2009-01-01

Loss of fragile X mental retardation 1 (FMR1) gene function is the most common cause of inherited mental retardation and autism spectrum disorders, characterized by attention disorder, hyperactivity and disruption of circadian activity cycles. Pursuit of effective intervention strategies requires determining when the FMR1 product (FMRP) is required in the regulation of neuronal circuitry controlling these behaviors. In the well-characterized Drosophila disease model, loss of the highly conserved dFMRP causes circadian arrhythmicity and conspicuous abnormalities in the circadian clock circuitry. Here, a novel Sholl Analysis was used to quantify over-elaborated synaptic architecture in dfmr1-null small ventrolateral neurons (sLNvs), a key subset of clock neurons. The transgenic Gene-Switch system was employed to drive conditional neuronal dFMRP expression in the dfmr1-null mutant background in order to dissect temporal requirements within the clock circuit. Introduction of dFMRP during early brain development, including the stages of neurogenesis, neuronal fate specification and early pathfinding, provided no rescue of dfmr1 mutant phenotypes. Similarly, restoring normal dFMRP expression in the adult failed to restore circadian circuit architecture. In sharp contrast, supplying dFMRP during a transient window of very late brain development, wherein synaptogenesis and substantial subsequent synaptic reorganization (e.g. use-dependent pruning) occur, provided strong morphological rescue to reestablish normal sLNvs synaptic arbors. We conclude that dFMRP plays a developmentally restricted role in sculpting synaptic architecture in these neurons that cannot be compensated for by later reintroduction of the protein at maturity. PMID:19738924

Investigation of hemodynamics in the development of dissecting aneurysm within patient-specific dissecting aneurismal aortas using computational fluid dynamics (CFD) simulations.

PubMed

Tse, Kwong Ming; Chiu, Peixuan; Lee, Heow Pueh; Ho, Pei

2011-03-15

Aortic dissecting aneurysm is one of the most catastrophic cardiovascular emergencies that carries high mortality. It was pointed out from clinical observations that the aneurysm development is likely to be related to the hemodynamics condition of the dissected aorta. In order to gain more insight on the formation and progression of dissecting aneurysm, hemodynamic parameters including flow pattern, velocity distribution, aortic wall pressure and shear stress, which are difficult to measure in vivo, are evaluated using numerical simulations. Pulsatile blood flow in patient-specific dissecting aneurismal aortas before and after the formation of lumenal aneurysm (pre-aneurysm and post-aneurysm) is investigated by computational fluid dynamics (CFD) simulations. Realistic time-dependent boundary conditions are prescribed at various arteries of the complete aorta models. This study suggests the helical development of false lumen around true lumen may be related to the helical nature of hemodynamic flow in aorta. Narrowing of the aorta is responsible for the massive recirculation in the poststenosis region in the lumenal aneurysm development. High pressure difference of 0.21 kPa between true and false lumens in the pre-aneurismal aorta infers the possible lumenal aneurysm site in the descending aorta. It is also found that relatively high time-averaged wall shear stress (in the range of 4-8 kPa) may be associated with tear initiation and propagation. CFD modeling assists in medical planning by providing blood flow patterns, wall pressure and wall shear stress. This helps to understand various phenomena in the development of dissecting aneurysm. Copyright © 2011 Elsevier Ltd. All rights reserved.

Protein Phosphorylation Profiling Using an In Situ Proximity Ligation Assay: Phosphorylation of AURKA-Elicited EGFR-Thr654 and EGFR-Ser1046 in Lung Cancer Cells

PubMed Central

Chen, Tzu-Chi; Liu, Yu-Wen; Huang, Yei-Hsuan; Yeh, Yi-Chen; Chou, Teh-Ying; Wu, Yu-Chung; Wu, Chun-Chi; Chen, Yi-Rong; Cheng, Hui-Chuan; Lu, Pei-Jung; Lai, Jin-Mei; Huang, Chi-Ying F.

2013-01-01

The epidermal growth factor receptor (EGFR), which is up-regulated in lung cancer, involves the activation of mitogenic signals and triggers multiple signaling cascades. To dissect these EGFR cascades, we used 14 different phospho-EGFR antibodies to quantify protein phosphorylation using an in situ proximity ligation assay (in situ PLA). Phosphorylation at EGFR-Thr654 and -Ser1046 was EGF-dependent in the wild-type (WT) receptor but EGF-independent in a cell line carrying the EGFR-L858R mutation. Using a ProtoAarray™ containing ∼5000 recombinant proteins on the protein chip, we found that AURKA interacted with the EGFR-L861Q mutant. Moreover, overexpression of EGFR could form a complex with AURKA, and the inhibitors of AURKA and EGFR decreased EGFR-Thr654 and -Ser1046 phosphorylation. Immunohistochemical staining of stage I lung adenocarcinoma tissues demonstrated a positive correlation between AURKA expression and phosphorylation of EGFR at Thr654 and Ser1046 in EGFR-mutant specimens, but not in EGFR-WT specimens. The interplay between EGFR and AURKA provides an explanation for the difference in EGF dependency between EGFR-WT and EGFR-mutant cells and may provide a new therapeutic strategy for lung cancer patients carrying EGFR mutations. PMID:23520446

Using Microarrays to Facilitate Positional Cloning: Identification of Tomosyn as an Inhibitor of Neurosecretion

PubMed Central

Dybbs, Michael; Ngai, John; Kaplan, Joshua M

2005-01-01

Forward genetic screens have been used as a powerful strategy to dissect complex biological pathways in many model systems. A significant limitation of this approach has been the time-consuming and costly process of positional cloning and molecular characterization of the mutations isolated in these screens. Here, the authors describe a strategy using microarray hybridizations to facilitate positional cloning. This method relies on the fact that premature stop codons (i.e., nonsense mutations) constitute a frequent class of mutations isolated in screens and that nonsense mutant messenger RNAs are efficiently degraded by the conserved nonsense-mediated decay pathway. They validate this strategy by identifying two previously uncharacterized mutations: (1) tom-1, a mutation found in a forward genetic screen for enhanced acetylcholine secretion in Caenorhabditis elegans, and (2) an apparently spontaneous mutation in the hif-1 transcription factor gene. They further demonstrate the broad applicability of this strategy using other known mutants in C. elegans, Arabidopsis, and mouse. Characterization of tom-1 mutants suggests that TOM-1, the C. elegans ortholog of mammalian tomosyn, functions as an endogenous inhibitor of neurotransmitter secretion. These results also suggest that microarray hybridizations have the potential to significantly reduce the time and effort required for positional cloning. PMID:16103915

[Progress and challenge of Stanford type A aortic dissection in China].

PubMed

Sun, L Z; Li, J R

2017-04-01

In recent 20 years, the rapid development of acute Stanford type A aortic dissection in China has been mainly due to three aspects: (1) the refined classification of aortic dissection based on Stanford classification, (2) right axillary artery canal and selective cerebral perfusion technology become basic cardiopulmonary bypass strategy for Stanford type A aortic dissection, and (3) total aortic arch replacement and descending aortic stent graft surgery (Sun's surgery) become the standard treatment of Stanford type A aortic dissection. However, there are still many problems in the diagnosis and treatment of aortic dissection in China, such as: (1) unstandardized, lack of comprehensive guidelines of aortic dissection, (2) immature, perioperative organ protection and intraoperative blood protection technology remains a big flaw, and (3) it takes a long time to get patient prepared for surgery. In conclusion, as to the issue of the management of acute Stanford type A aortic dissection, there will be a long way for Chinese doctors to go. Peers should pay more attention to this problem and take more efforts, so that the outcome of acute Stanford type A aortic dissection surgical patients can be improved.

Animal Organ Dissections in High Schools: Is There More than Just Cutting?

ERIC Educational Resources Information Center

Kavai, Portia; de Villiers, Rian; Fraser, William; Sommerville, Jaqui; Strydom, Nina

2015-01-01

In Life Sciences education internationally, including South Africa, the study of animal and organ morphology has traditionally involved dissections since the early nineteenth century. The major purpose of this study was to investigate how the engagement of learners with animal organ dissections may influence the development of problem-solving…

Studying tumor growth in Drosophila using the tissue allograft method.

PubMed

Rossi, Fabrizio; Gonzalez, Cayetano

2015-10-01

This protocol describes a method to allograft Drosophila larval tissue into adult fly hosts that can be used to assay the tumorigenic potential of mutant tissues. The tissue of interest is dissected, loaded into a fine glass needle and implanted into a host. Upon implantation, nontransformed tissues do not overgrow beyond their normal size, but malignant tumors grow without limit, are invasive and kill the host. By using this method, Drosophila malignant tumors can be transplanted repeatedly, for years, and therefore they can be aged beyond the short life span of flies. Because several hosts can be implanted using different pieces from a single tumor, the method also allows the tumor mass to be increased to facilitate further studies that may require large amounts of tissue (i.e., genomics, proteomics and so on). This method also provides an operational definition of hyperplastic, benign and malignant growth. The injection procedure itself requires only ∼1 d. Tumor development can then be monitored until the death of the implanted hosts.

Single Molecule Cluster Analysis Identifies Signature Dynamic Conformations along the Splicing Pathway

PubMed Central

Blanco, Mario R.; Martin, Joshua S.; Kahlscheuer, Matthew L.; Krishnan, Ramya; Abelson, John; Laederach, Alain; Walter, Nils G.

2016-01-01

The spliceosome is the dynamic RNA-protein machine responsible for faithfully splicing introns from precursor messenger RNAs (pre-mRNAs). Many of the dynamic processes required for the proper assembly, catalytic activation, and disassembly of the spliceosome as it acts on its pre-mRNA substrate remain poorly understood, a challenge that persists for many biomolecular machines. Here, we developed a fluorescence-based Single Molecule Cluster Analysis (SiMCAn) tool to dissect the manifold conformational dynamics of a pre-mRNA through the splicing cycle. By clustering common dynamic behaviors derived from selectively blocked splicing reactions, SiMCAn was able to identify signature conformations and dynamic behaviors of multiple ATP-dependent intermediates. In addition, it identified a conformation adopted late in splicing by a 3′ splice site mutant, invoking a mechanism for substrate proofreading. SiMCAn presents a novel framework for interpreting complex single molecule behaviors that should prove widely useful for the comprehensive analysis of a plethora of dynamic cellular machines. PMID:26414013

Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis.

PubMed

Sedykh, Irina; Yoon, Baul; Roberson, Laura; Moskvin, Oleg; Dewey, Colin N; Grinblat, Yevgenya

2017-09-01

The vertebrate retina develops in close proximity to the forebrain and neural crest-derived cartilages of the face and jaw. Coloboma, a congenital eye malformation, is associated with aberrant forebrain development (holoprosencephaly) and with craniofacial defects (frontonasal dysplasia) in humans, suggesting a critical role for cross-lineage interactions during retinal morphogenesis. ZIC2, a zinc-finger transcription factor, is linked to human holoprosencephaly. We have previously used morpholino assays to show zebrafish zic2 functions in the developing forebrain, retina and craniofacial cartilage. We now report that zebrafish with genetic lesions in zebrafish zic2 orthologs, zic2a and zic2b, develop with retinal coloboma and craniofacial anomalies. We demonstrate a requirement for zic2 in restricting pax2a expression and show evidence that zic2 function limits Hh signaling. RNA-seq transcriptome analysis identified an early requirement for zic2 in periocular neural crest as an activator of alx1, a transcription factor with essential roles in craniofacial and ocular morphogenesis in human and zebrafish. Collectively, these data establish zic2 mutant zebrafish as a powerful new genetic model for in-depth dissection of cell interactions and genetic controls during craniofacial complex development. Copyright © 2017 Elsevier Inc. All rights reserved.

Online Dissection Audio-Visual Resources for Human Anatomy: Undergraduate Medical Students' Usage and Learning Outcomes

ERIC Educational Resources Information Center

Choi-Lundberg, Derek L.; Cuellar, William A.; Williams, Anne-Marie M.

2016-01-01

In an attempt to improve undergraduate medical student preparation for and learning from dissection sessions, dissection audio-visual resources (DAVR) were developed. Data from e-learning management systems indicated DAVR were accessed by 28% ± 10 (mean ± SD for nine DAVR across three years) of students prior to the corresponding dissection…

Visualizing Science Dissections in 3D: Contextualizing Student Responses to Multidimensional Learning Materials in Science Dissections

NASA Astrophysics Data System (ADS)

Walker, Robin Annette

A series of dissection tasks was developed in this mixed-methods study of student self-explanations of their learning using actual and virtual multidimensional science dissections and visuo-spatial instruction. Thirty-five seventh-grade students from a science classroom (N = 20 Female/15 Male, Age =13 years) were assigned to three dissection environments instructing them to: (a) construct static paper designs of frogs, (b) perform active dissections with formaldehyde specimens, and (c) engage with interactive 3D frog visualizations and virtual simulations. This multi-methods analysis of student engagement with anchored dissection materials found learning gains on labeling exercises and lab assessments among most students. Data revealed that students who correctly utilized multimedia text and diagrams, individually and collaboratively, manipulated 3D tools more effectively and were better able to self-explain and complete their dissection work. Student questionnaire responses corroborated that they preferred learning how to dissect a frog using 3D multimedia instruction. The data were used to discuss the impact of 3D technologies, programs, and activities on student learning, spatial reasoning, and their interest in science. Implications were drawn regarding how to best integrate 3D visualizations into science curricula as innovative learning options for students, as instructional alternatives for teachers, and as mandated dissection choices for those who object to physical dissections in schools.

Using Genomics to Dissect Seed Development (JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment Meeting)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldberg, Robert

2012-03-21

Robert Goldberg of UCLA presents "Using Genomics to Dissect Seed Development" at the JGI 7th Annual Users Meeting: Genomics of Energy & Environment Meeting on March 22, 2012 in Walnut Creek, California.

Using Genomics to Dissect Seed Development (JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment Meeting)

ScienceCinema

Goldberg, Robert

2018-04-27

Robert Goldberg of UCLA presents "Using Genomics to Dissect Seed Development" at the JGI 7th Annual Users Meeting: Genomics of Energy & Environment Meeting on March 22, 2012 in Walnut Creek, California.

Total extraperitoneal (TEP) mesh repair of inguinal hernia in the developing world: comparison of low-cost indigenous balloon dissection versus direct telescopic dissection: a prospective randomized controlled study.

PubMed

Misra, Mahesh C; Kumar, Sareesh; Bansal, Virinder K

2008-09-01

Creation of extraperitoneal space during TEP repair requires an expensive commercially available balloon. Fifty-six patients suffering from uncomplicated primary unilateral or bilateral groin hernia were randomized into two groups; group 1--indigenous balloon dissection and group 2--direct telescopic dissection. There were 55 males and 1 female, with an average age of 49 years; 50% of the inguinal hernias were bilateral. Creation of extraperitoneal space was considered as satisfactory in majority of patients (94.6%) with satisfactory anatomical delineation. Peritoneal breach was noticed during dissection in 36 (64.3%) patients. There was one (3.8%) conversion of TEP to TAPP in group 2. Distance between pubic symphysis to umbilicus was an important factor, which affected the easiness of dissection. In patients with this distance

Deciphering structural and functional roles of individual disulfide bonds of the mitochondrial sulfhydryl oxidase Erv1p.

PubMed

Ang, Swee Kim; Lu, Hui

2009-10-16

Erv1p is a FAD-dependent sulfhydryl oxidase of the mitochondrial intermembrane space. It contains three conserved disulfide bonds arranged in two CXXC motifs and one CX(16)C motif. Experimental evidence for the specific roles of the individual disulfide bonds is lacking. In this study, structural and functional roles of the disulfides were dissected systematically using a wide range of biochemical and biophysical methods. Three double cysteine mutants with each pair of cysteines mutated to serines were generated. All of the mutants were purified with the normal FAD binding properties as the wild type Erv1p, showing that none of the three disulfides are essential for FAD binding. Thermal denaturation and trypsin digestion studies showed that the CX(16)C disulfide plays an important role in stabilizing the folding of Erv1p. To understand the functional role of each disulfide, small molecules and the physiological substrate protein Mia40 were used as electron donors in oxygen consumption assays. We show that both CXXC disulfides are required for Erv1 oxidase activity. The active site disulfide is well protected thus requires the shuttle disulfide for its function. Although both mutants of the CXXC motifs were individually inactive, Erv1p activity was partially recovered by mixing these two mutants together, and the recovery was rapid. Thus, we provided the first experimental evidence of electron transfer between the shuttle and active site disulfides of Erv1p, and we propose that both intersubunit and intermolecular electron transfer can occur.

Deciphering Structural and Functional Roles of Individual Disulfide Bonds of the Mitochondrial Sulfhydryl Oxidase Erv1p*

PubMed Central

Ang, Swee Kim; Lu, Hui

2009-01-01

Erv1p is a FAD-dependent sulfhydryl oxidase of the mitochondrial intermembrane space. It contains three conserved disulfide bonds arranged in two CXXC motifs and one CX16C motif. Experimental evidence for the specific roles of the individual disulfide bonds is lacking. In this study, structural and functional roles of the disulfides were dissected systematically using a wide range of biochemical and biophysical methods. Three double cysteine mutants with each pair of cysteines mutated to serines were generated. All of the mutants were purified with the normal FAD binding properties as the wild type Erv1p, showing that none of the three disulfides are essential for FAD binding. Thermal denaturation and trypsin digestion studies showed that the CX16C disulfide plays an important role in stabilizing the folding of Erv1p. To understand the functional role of each disulfide, small molecules and the physiological substrate protein Mia40 were used as electron donors in oxygen consumption assays. We show that both CXXC disulfides are required for Erv1 oxidase activity. The active site disulfide is well protected thus requires the shuttle disulfide for its function. Although both mutants of the CXXC motifs were individually inactive, Erv1p activity was partially recovered by mixing these two mutants together, and the recovery was rapid. Thus, we provided the first experimental evidence of electron transfer between the shuttle and active site disulfides of Erv1p, and we propose that both intersubunit and intermolecular electron transfer can occur. PMID:19679655

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

The Caenorhabditis elegans choline transporter CHO-1 sustains acetylcholine synthesis and motor function in an activity-dependent manner.

PubMed

Matthies, Dawn Signor; Fleming, Paul A; Wilkes, Don M; Blakely, Randy D

2006-06-07

Cholinergic neurotransmission supports motor, autonomic, and cognitive function and is compromised in myasthenias, cardiovascular diseases, and neurodegenerative disorders. Presynaptic uptake of choline via the sodium-dependent, hemicholinium-3-sensitive choline transporter (CHT) is believed to sustain acetylcholine (ACh) synthesis and release. Analysis of this hypothesis in vivo is limited in mammals because of the toxicity of CHT antagonists and the early postnatal lethality of CHT-/- mice (Ferguson et al., 2004). In Caenorhabditis elegans, in which cholinergic signaling supports motor activity and mutant alleles impacting ACh secretion and response can be propagated, we investigated the contribution of CHT (CHO-1) to facets of cholinergic neurobiology. Using the cho-1 promoter to drive expression of a translational, green fluorescent protein-CHO-1 fusion (CHO-1:GFP) in wild-type and kinesin (unc-104) mutant backgrounds, we establish in the living nematode that the transporter localizes to cholinergic synapses, and likely traffics on synaptic vesicles. Using embryonic primary cultures, we demonstrate that CHO-1 mediates hemicholinium-3-sensitive, high-affinity choline uptake that can be enhanced with depolarization in a Ca(2+)-dependent manner supporting ACh synthesis. Although homozygous cho-1 null mutants are viable, they possess 40% less ACh than wild-type animals and display stress-dependent defects in motor activity. In a choline-free liquid environment, cho-1 mutants demonstrate premature paralysis relative to wild-type animals. Our findings establish a requirement for presynaptic choline transport activity in vivo in a model amenable to a genetic dissection of CHO-1 regulation.

Identification of essential genes of Pseudomonas aeruginosa for its growth in airway mucus.

PubMed

Alrahman, Mohammed Abd; Yoon, Sang Sun

2017-01-01

Pseudomonas aeruginosa has been identified as an important causative agent of airway infection, mainly in cystic fibrosis. This disease is characterized by defective mucociliary clearance induced in part by mucus hyper-production. Mucin is a major component of airway mucus and is heavily O-glycosylated, with a protein backbone. Airway infection is known to be established with bacterial adhesion to mucin. However, the genes involved in mucin degradation or utilization remain elusive. In this study, we sought to provide a genetic basis of P. aeruginosa airway growth by identifying those genes. First, using RNASeq analyses, we compared genome-wide expression profiles of PAO1, a prototype P. aeruginosa laboratory strain, grown in M9-mucin (M9M) and M9-glucose (M9G) media. Additionally, a PAO1 transposon (Tn) insertion mutants library was screened for mutants defective in growth in M9M medium. One mutant with a Tn insertion in the xcpU gene (PA3100) was determined to exhibit faulty growth in M9M medium. This gene contributes to the type II secretion system, suggesting that P. aeruginosa uses this secretion system to produce a number of proteins to break down and assimilate the mucin molecule. Furthermore, we screened the PAO1 genome for genes with protease activity. Of 13 mutants, one with mutation in PA3247 gene exhibited defective growth in M9M, suggesting that the PA3247-encoded protease plays a role in mucin utilization. Further mechanistic dissection of this particular process will reveal new drug targets, the inhibition of which could control recalcitrant P. aeruginosa infections.

Viral evolution in response to the broad-based retroviral protease inhibitor TL-3.

PubMed

Bühler, B; Lin, Y C; Morris, G; Olson, A J; Wong, C H; Richman, D D; Elder, J H; Torbett, B E

2001-10-01

TL-3 is a protease inhibitor developed using the feline immunodeficiency virus protease as a model. It has been shown to efficiently inhibit replication of human, simian, and feline immunodeficiency viruses and therefore has broad-based activity. We now demonstrate that TL-3 efficiently inhibits the replication of 6 of 12 isolates with confirmed resistance mutations to known protease inhibitors. To dissect the spectrum of molecular changes in protease and viral properties associated with resistance to TL-3, a panel of chronological in vitro escape variants was generated. We have virologically and biochemically characterized mutants with one (V82A), three (M46I/F53L/V82A), or six (L24I/M46I/F53L/L63P/V77I/V82A) changes in the protease and structurally modeled the protease mutant containing six changes. Virus containing six changes was found to be 17-fold more resistant to TL-3 in cell culture than was wild-type virus but maintained similar in vitro replication kinetics compared to the wild-type virus. Analyses of enzyme activity of protease variants with one, three, and six changes indicated that these enzymes, compared to wild-type protease, retained 40, 47, and 61% activity, respectively. These results suggest that deficient protease enzymatic activity is sufficient for function, and the observed protease restoration might imply a selective advantage, at least in vitro, for increased protease activity.

Viral Evolution in Response to the Broad-Based Retroviral Protease Inhibitor TL-3†

PubMed Central

Bühler, Bernd; Lin, Ying-Chuan; Morris, Garrett; Olson, Arthur J.; Wong, Chi-Huey; Richman, Douglas D.; Elder, John H.; Torbett, Bruce E.

2001-01-01

TL-3 is a protease inhibitor developed using the feline immunodeficiency virus protease as a model. It has been shown to efficiently inhibit replication of human, simian, and feline immunodeficiency viruses and therefore has broad-based activity. We now demonstrate that TL-3 efficiently inhibits the replication of 6 of 12 isolates with confirmed resistance mutations to known protease inhibitors. To dissect the spectrum of molecular changes in protease and viral properties associated with resistance to TL-3, a panel of chronological in vitro escape variants was generated. We have virologically and biochemically characterized mutants with one (V82A), three (M46I/F53L/V82A), or six (L24I/M46I/F53L/L63P/V77I/V82A) changes in the protease and structurally modeled the protease mutant containing six changes. Virus containing six changes was found to be 17-fold more resistant to TL-3 in cell culture than was wild-type virus but maintained similar in vitro replication kinetics compared to the wild-type virus. Analyses of enzyme activity of protease variants with one, three, and six changes indicated that these enzymes, compared to wild-type protease, retained 40, 47, and 61% activity, respectively. These results suggest that deficient protease enzymatic activity is sufficient for function, and the observed protease restoration might imply a selective advantage, at least in vitro, for increased protease activity. PMID:11533212

Nanometer-Scale Dissection of Chromosomes by Atomic Force Microscopy Combined with Heat-Denaturing Treatment

NASA Astrophysics Data System (ADS)

Tsukamoto, Kazumi; Kuwazaki, Seigo; Yamamoto, Kimiko; Shichiri, Motoharu; Yoshino, Tomoyuki; Ohtani, Toshio; Sugiyama, Shigeru

2006-03-01

We have developed a method for dissecting chromosome fragments with a size of a few hundred nanometers by atomic force microscopy (AFM). By using this method, we demonstrated reproducible dissections of silkworm chromosomes in the pachytene phase. The dissected fragments were successfully recovered on the cantilever tips, as confirmed by fluorescent microscopy using fluorescent stained chromosomes. To recover dissected chromosome fragments from a larger chromosome, such as the human metaphase chromosome of a somatic cell, heat denaturation was found to be effective. Further improvements in this method may lead to a novel tool for isolating valuable genes and/or investigating local genome structures in the near future.

Reduction of Mental Distress in the Dissection Course by Introducing the Body Donor Experience through Anatomical Demonstrations of Organ Systems

ERIC Educational Resources Information Center

Bockers, Anja; Baader, Christoph; Fassnacht, Ulrich Kai; Ochsner, Wolfgang; Bockers, Tobias Maria

2012-01-01

The practice of dissection teaches students not only the foundations of anatomical knowledge but also encourages the development of professional competencies. Yet, the dissection of cadavers in the gross anatomy course can be a stress factor for medical students. There are a minor proportion of students who demonstrate strong emotional reactions…

A Presynaptic Function of Shank Protein in Drosophila.

PubMed

Wu, Song; Gan, Guangming; Zhang, Zhiping; Sun, Jie; Wang, Qifu; Gao, Zhongbao; Li, Meixiang; Jin, Shan; Huang, Juan; Thomas, Ulrich; Jiang, Yong-Hui; Li, Yan; Tian, Rui; Zhang, Yong Q

2017-11-29

Human genetic studies support that loss-of-function mutations in the SH 3 domain and ank yrin repeat containing family proteins (SHANK1-3), the large synaptic scaffolding proteins enriched at the postsynaptic density of excitatory synapses, are causative for autism spectrum disorder and other neuropsychiatric disorders in humans. To better understand the in vivo functions of Shank and facilitate dissection of neuropathology associated with SHANK mutations in human, we generated multiple mutations in the Shank gene, the only member of the SHANK family in Drosophila melanogaster Both male and female Shank null mutants were fully viable and fertile with no apparent morphological or developmental defects. Expression analysis revealed apparent enrichment of Shank in the neuropils of the CNS. Specifically, Shank coexpressed with another PSD scaffold protein, Homer, in the calyx of mushroom bodies in the brain. Consistent with high expression in mushroom body calyces, Shank mutants show an abnormal calyx structure and reduced olfactory acuity. These morphological and functional phenotypes were fully rescued by pan-neuronal reexpression of Shank, and only partially rescued by presynaptic but no rescue by postsynaptic reexpression of Shank. Our findings thus establish a previously unappreciated presynaptic function of Shank. SIGNIFICANCE STATEMENT Mutations in SHANK family genes are causative for idiopathic autism spectrum disorder. To understand the neural function of Shank, a large scaffolding protein enriched at the postsynaptic densities, we examined the role of Drosophila Shank in synapse development at the peripheral neuromuscular junctions and the central mushroom body calyx. Our results demonstrate that, in addition to its conventional postsynaptic function, Shank also acts presynaptically in synapse development in the brain. This study offers novel insights into the synaptic role of Shank. Copyright © 2017 the authors 0270-6474/17/3711592-13$15.00/0.

Virtual, on-line, frog dissection vs. conventional laboratory dissection: A comparison of student achievement and teacher perceptions among honors, general ability, and foundations-level high school biology classes

NASA Astrophysics Data System (ADS)

Kopec, Ronald H.

2002-09-01

Dissecting animal specimens has long been a tradition in biology classes. Objections by students, based on religious or ethical grounds, have been raised regarding the dissections of animals in classroom laboratories. A number of states now have legal proceedings or statewide policies requiring that alternatives to the actual dissection of laboratory animal specimens be permitted in their school districts. Alternatives to actual dissections have been developed in recent years. For a variety of reasons, performing an actual or conventional animal dissection may not be a desirable option. The purpose of this study was to investigate how a virtual On-line frog dissection compares with an actual laboratory dissection. What were the perceptions of the teacher's using it? How does student achievement compare among three the different ability levels on a pre and posttest regarding basic frog anatomy? Is a virtual On-line dissection a suitable alternative for students who, for whatever reason, do not participate in the actual laboratory experience? The subjects consisted of 218 biology students among three different ability levels, in a Northeastern suburban high school. Approximately half of the student groups participated in a virtual On-line dissection, the other half in an actual laboratory dissection. A pretest of basic frog anatomy was administered to the students two days before and the posttest one day after their dissection experience. Data were analyzed using matched pairs t-Tests, Analysis of Variance, Tukey HSD, and Squared Curvilinear Coefficients. Survey questionnaires were administered to the teachers after the dissection experiences were completed. There were no significant differences found in achievement between the virtual and conventional dissection groups. There were significant differences found in achievement score means among the three ability levels. There was no significant interaction between gender and achievement. Perceptions of the teacher's facilitating the two instructional methods varied. The main area of agreement among them was that a virtual On-line frog dissection was a viable alternative for students who objected to doing a conventional dissection.

Expression of connective tissue growth factor (CTGF/CCN2) in breast cancer cells is associated with increased migration and angiogenesis.

PubMed

Chien, Wenwen; O'Kelly, James; Lu, Daning; Leiter, Amanda; Sohn, Julia; Yin, Dong; Karlan, Beth; Vadgama, Jay; Lyons, Karen M; Koeffler, H Phillip

2011-06-01

Connective tissue growth factor (CTGF/CCN2) belongs to the CCN family of matricellular proteins, comprising Cyr61, CTGF, NovH and WISP1-3. The CCN proteins contain an N-terminal signal peptide followed by four conserved domains sharing sequence similarities with the insulin-like growth factor binding proteins, von Willebrand factor type C repeat, thrombospondin type 1 repeat, and a C-terminal growth factor cysteine knot domain. To investigate the role of CCN2 in breast cancer, we transfected MCF-7 cells with full-length CCN2, and with four mutant constructs in which one of the domains had been deleted. MCF-7 cells stably expressing full-length CCN2 demonstrated reduced cell proliferation, increased migration in Boyden chamber assays and promoted angiogenesis in chorioallantoic membrane assays compared to control cells. Deletion of the C-terminal cysteine knot domain, but not of any other domain-deleted mutants, abolished activities mediated by full-length CCN2. We have dissected the role of CCN2 in breast tumorigenesis on a structural basis.

Integrating high-throughput genetic interaction mapping and high-content screening to explore yeast spindle morphogenesis

PubMed Central

Vizeacoumar, Franco J.; van Dyk, Nydia; S.Vizeacoumar, Frederick; Cheung, Vincent; Li, Jingjing; Sydorskyy, Yaroslav; Case, Nicolle; Li, Zhijian; Datti, Alessandro; Nislow, Corey; Raught, Brian; Zhang, Zhaolei; Frey, Brendan; Bloom, Kerry

2010-01-01

We describe the application of a novel screening approach that combines automated yeast genetics, synthetic genetic array (SGA) analysis, and a high-content screening (HCS) system to examine mitotic spindle morphogenesis. We measured numerous spindle and cellular morphological parameters in thousands of single mutants and corresponding sensitized double mutants lacking genes known to be involved in spindle function. We focused on a subset of genes that appear to define a highly conserved mitotic spindle disassembly pathway, which is known to involve Ipl1p, the yeast aurora B kinase, as well as the cell cycle regulatory networks mitotic exit network (MEN) and fourteen early anaphase release (FEAR). We also dissected the function of the kinetochore protein Mcm21p, showing that sumoylation of Mcm21p regulates the enrichment of Ipl1p and other chromosomal passenger proteins to the spindle midzone to mediate spindle disassembly. Although we focused on spindle disassembly in a proof-of-principle study, our integrated HCS-SGA method can be applied to virtually any pathway, making it a powerful means for identifying specific cellular functions. PMID:20065090

Decreased expression of fibulin-4 in aortic wall of aortic dissection.

PubMed

Huawei, P; Qian, C; Chuan, T; Lei, L; Laing, W; Wenlong, X; Wenzhi, L

2014-02-01

In this research, we will examine the expression of Fibulin-4 in aortic wall to find out its role in aortic dissection development. The samples of aortic wall were obtained from 10 patients operated for acute ascending aortic dissection and five patients for chronic ascending aortic dissection. Another 15 pieces of samples from patients who had coronary artery bypass were as controls. The aortic samples were stained with aldehyde magenta dyeing to evaluate the arrangement of elastic fibers. The Fibulin-4 protein and mRNA expression were both determined by Western blot and realtime quantitative polymerase chain reaction. Compared with the control group, both in acute and chronic ascending aortic dissection, elastic fiber fragments increased and the expression of fibulin-4 protein significantly decreased (P= 0.045 < 0.05). The level of fibulin-4 mRNA decreased in acute ascending aortic dissection (P= 0.034 < 0.05), while it increased in chronic ascending aortic dissection (P=0.004 < 0.05). The increased amounts of elastic fiber fragments were negatively correlated with the expression of fibulin-4 mRNA in acute ascending aortic dissection. In conclusion, in aortic wall of ascending aortic dissection, the expression of fibulin-4 protein decreased and the expression of fibulin-4 mRNA was abnormal. Fibulin-4 may play an important role in the pathogenesis of aortic dissection.

Combinatorial Wnt control of zebrafish midbrain-hindbrain boundary formation.

PubMed

Buckles, Gerri R; Thorpe, Christopher J; Ramel, Marie-Christine; Lekven, Arne C

2004-05-01

Wnt signaling is known to be required for the normal development of the vertebrate midbrain and hindbrain, but genetic loss of function analyses in the mouse and zebrafish yield differing results regarding the relative importance of specific Wnt loci. In the zebrafish, Wnt1 and Wnt10b functionally overlap in their control of gene expression in the ventral midbrain-hindbrain boundary (MHB), but they are not required for the formation of the MHB constriction. Whether other wnt loci are involved in zebrafish MHB development is unclear, although the expression of at least two wnts, wnt3a and wnt8b, is maintained in wnt1/wnt10b mutants. In order to address the role of wnt3a in zebrafish, we have isolated a full length cDNA and examined its expression and function via knockdown by morpholino antisense oligonucleotide (MO)-mediated knockdown. The expression pattern of wnt3a appears to be evolutionarily conserved between zebrafish and mouse, and MO knockdown shows that Wnt3a, while not uniquely required for MHB development, is required in the absence of Wnt1 and Wnt10b for the formation of the MHB constriction. In zebrafish embryos lacking Wnt3a, Wnt1 and Wnt10b, the expression of engrailed orthologs, pax2a and fgf8 is not maintained after mid-somitogenesis. In contrast to acerebellar and no isthmus mutants, in which midbrain and hindbrain cells acquire new fates but cell number is not significantly affected until late in embryogenesis, zebrafish embryos lacking Wnt3a, Wnt1 and Wnt10b undergo extensive apoptosis in the midbrain and cerebellum anlagen beginning in mid-somitogenesis, which results in the absence of a significant portion of the midbrain and cerebellum. Thus, the requirement for Wnt signaling in forming the MHB constriction is evolutionarily conserved in vertebrates and it is possible in zebrafish to dissect the relative impact of multiple Wnt loci in midbrain and hindbrain development.

Ultrasonic dissection versus electrocautery in mastectomy for breast cancer - a meta-analysis.

PubMed

Currie, A; Chong, K; Davies, G L; Cummins, R S

2012-10-01

Electrocautery has advanced the practice of mastectomy but significant morbidity, such as seroma and blood loss, remains a concern. This has led to newer forms of dissection being introduced including the ultrasonic dissection devices, which are thought to reduce tissue damage. The aim of this systematic review was to compare the outcomes after mastectomy using novel ultrasonic dissection or standard electrocautery in published trials. Medline, Embase, trial registries, conference proceedings and reference lists were searched for comparative trials of ultrasonic dissection versus electrocautery for mastectomy. The primary outcomes were total postoperative drainage, seroma development and intra-operative blood loss. Secondary outcomes were operative time and wound complications. Odds ratios were calculated for categorical outcomes and standardised mean differences for continuous outcomes. Six trials were included in the analysis of 287 mastectomies. There was no effect in total postoperative drainage (pooled analysis weight mean difference: -0.21 (95% CI: -0.70-0.29); p = 0.41) or seroma development (pooled analysis odds ratio: 0.77 (95% CIs 0.43-1.37); p = 0.37). Intra-operative blood was slightly less for ultrasonic dissection compared to standard electrocautery (pooled analysis weight mean difference: -1.04 (95% CI: -2.00 to -0.08); p = 0.03). Ultrasonic dissection and standard electrocautery had similar outcomes with regard to operative time and wound complications. Ultrasonic dissection and standard electrocautery appear to deliver similar results in the mastectomy setting. Further cost-effectiveness analysis may guide surgeon selection in the use of new technologies for mastectomy. Copyright © 2012 Elsevier Ltd. All rights reserved.

Positive family history of aortic dissection dramatically increases dissection risk in family members.

PubMed

Ma, Wei-Guo; Chou, Alan S; Mok, Salvior C M; Ziganshin, Bulat A; Charilaou, Paris; Zafar, Mohammad A; Sieller, Richard S; Tranquilli, Maryann; Rizzo, John A; Elefteriades, John A

2017-08-01

Although family members of patients with aortic dissection (AoD) are believed to be at higher risk of AoD, the prognostic value of family history (FH) of aortic dissection (FHAD) in family members of patients with AoD has not been studied rigorously. We seek examine how much a positive FHAD increases the risk of developing new aortic dissection (AoD) among first-degree relatives. Patients with AoD at our institution were analyzed for information of FHAD. Positive FHAD referred to that AoD occurred in index patient and one or more first-degree relatives. Negative FHAD was defined as the condition in which only one case of AoD (the index patient) occurred in the family. The age at AoD, exposure years in adulthood before AoD, and annual probability of AoD among first-degree relatives were compared between patients with negative and positive FHADs. FHAD was positive in 32 and negative in 68 among the 100 AoD patients with detailed family history information. Mean age at dissection was 59.9±14.7years. Compared to negative FHAD, patients with positive FHAD dissected at significantly younger age (54.7±16.8 vs 62.4±13.0years, p=0.013), had more AoD events in first-degree relatives (2.3±0.6 vs 1.0±0.0, p<0.001), and shorter exposure years per AoD event (18.3±6.7 vs 43.1±8.5, p<0.001). Annual probability of AoD per first-degree relative was 2.77 times higher in patients with positive than negative FHADs (0.0100±0.0057 vs 0.0036±0.0014, p<0.001). A positive FHAD confers a significantly increased risk of developing aortic dissection on family members, with a higher annual probability of aortic dissection, a shorter duration of "exposure time" before dissection occurs and a lower mean age at time of dissection. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Analysis of the state of posttranslational calmodulin methylation in developing pea plants. [Pisum sativum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oh, Sukheung; Roberts, D.M.

1990-07-01

A specific calmodulin-N-methyltransferase was used in a radiometric assay to analyze the degree of methylation of lysine-115 in pea (Pisum sativum) plants. Calmodulin was isolated from dissected segments of developing roots of young etiolated and green pea plants and was tested for its ability to be methylated by incubation with the calmodulin methyltransferase in the presence of ({sup 3}H)methyl-S-adenosylmethionine. By this approach, the presence of unmethylated calmodulins were demonstrated in pea tissues, and the levels of methylation varied depending on the developmental state of the tissue tested. Calmodulin methylation levels were lower in apical root segments of both etiolated andmore » green plants, and in the young lateral roots compared with the mature, differentiated root tissues. The incorporation of methyl groups into these calmodulin samples appears to be specific for position 115 since site-directed mutants of calmodulin with substitutions at this position competitively inhibited methyl group incorporation. The present findings, combined with previous data showing differences in the ability of methylated and unmethylated calmodulins to activate pea NAD kinase raise the possibility that posttranslational methylation of calmodulin could be another mechanism for regulating calmodulin activity.« less

[Historical outline on the nomenclature of neck lymph nodes as a basis of neck dissection classification].

PubMed

Werner, J A

2001-07-01

The neck dissection classification is based considerably on the organization of the lymph nodes of the neck. Terminology and anatomical allocation of nearly 300 cervicofacial lymph nodes repeatedly changed since the beginning of the 20th century. Analysis of the literature on neck lymph node organization with reference to the development of the neck dissection classification. The first fundamental nomenclature of the neck lymph nodes is founded on the work of Rouviére (1932). Suárez (1963) described the functional neck dissection on the basis of the fascial compartmentalization of the neck. Lindberg (1972) left the predominantly anatomically correlated grouping of the cervical lymph nodes as described by Rouviére and divided the lymphatic system of the neck on basis of pathophysiological mechanisms. The attention regarding the location of occult metastases led to the description of the selective neck dissection. Since the fundamental work of Shah et al. (1981) there was a multiplicity of more or less slight changes of the neck node regions. These changes were again basis for new neck dissection terminologies. A new classification was introduced in the year 2000 as the revised version of the American Head and Neck Society. The revised version of the neck dissection classification can reduce former controversies, particularly regarding an optimized intraoperative allocation of the lymph nodes and a simplified terminology of the selective neck dissection. With the goal of a standardization of the neck dissection forms it remains to be seen if the proponents of the functional neck dissection after Suárez consider the extent of the neck dissection in patients with N0 neck in favor of the selective neck dissection.

A multiscale computational approach to dissect early events in the Erb family receptor mediated activation, differential signaling, and relevance to oncogenic transformations.

PubMed

Liu, Yingting; Purvis, Jeremy; Shih, Andrew; Weinstein, Joshua; Agrawal, Neeraj; Radhakrishnan, Ravi

2007-06-01

We describe a hierarchical multiscale computational approach based on molecular dynamics simulations, free energy-based molecular docking simulations, deterministic network-based kinetic modeling, and hybrid discrete/continuum stochastic dynamics protocols to study the dimer-mediated receptor activation characteristics of the Erb family receptors, specifically the epidermal growth factor receptor (EGFR). Through these modeling approaches, we are able to extend the prior modeling of EGF-mediated signal transduction by considering specific EGFR tyrosine kinase (EGFRTK) docking interactions mediated by differential binding and phosphorylation of different C-terminal peptide tyrosines on the RTK tail. By modeling signal flows through branching pathways of the EGFRTK resolved on a molecular basis, we are able to transcribe the effects of molecular alterations in the receptor (e.g., mutant forms of the receptor) to differing kinetic behavior and downstream signaling response. Our molecular dynamics simulations show that the drug sensitizing mutation (L834R) of EGFR stabilizes the active conformation to make the system constitutively active. Docking simulations show preferential characteristics (for wildtype vs. mutant receptors) in inhibitor binding as well as preferential enhancement of phosphorylation of particular substrate tyrosines over others. We find that in comparison to the wildtype system, the L834R mutant RTK preferentially binds the inhibitor erlotinib, as well as preferentially phosphorylates the substrate tyrosine Y1068 but not Y1173. We predict that these molecular level changes result in preferential activation of the Akt signaling pathway in comparison to the Erk signaling pathway for cells with normal EGFR expression. For cells with EGFR over expression, the mutant over activates both Erk and Akt pathways, in comparison to wildtype. These results are consistent with qualitative experimental measurements reported in the literature. We discuss these consequences in light of how the network topology and signaling characteristics of altered (mutant) cell lines are shaped differently in relationship to native cell lines.

Insertional inactivation of Eap in Staphylococcus aureus strain Newman confers reduced staphylococcal binding to fibroblasts.

PubMed

Hussain, Muzaffar; Haggar, Axana; Heilmann, Christine; Peters, Georg; Flock, Jan-Ingmar; Herrmann, Mathias

2002-06-01

To initiate invasive infection, Staphylococcus aureus must adhere to host substrates, such as the extracellular matrix or eukaryotic cells, by virtue of different surface proteins (adhesins). Recently, we identified a 60-kDa cell-secreted extracellular adherence protein (Eap) of S. aureus strain Newman with broad-spectrum binding characteristics (M. Palma, A. Haggar, and J. I. Flock, J. Bacteriol. 181:2840-2845, 1999), and we have molecularly confirmed Eap to be an analogue of the previously identified major histocompatibility complex class II analog protein (Map) (M. Hussain, K. Becker, C. von Eiff, G. Peter, and M. Herrmann, Clin. Diagn. Lab. Immunol. 8:1281-1286, 2001). Previous analyses of the Eap/Map function performed with purified protein did not allow dissection of its precise role in the complex situation of the staphylococcal whole cell presenting several secreted and wall-bound adhesins. Therefore, the role of Eap was investigated by constructing a stable eap::ermB deletion in strain Newman and by complementation of the mutant. Patterns of extracted cell surface proteins analyzed both by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and by Western ligand assays with various adhesive matrix molecules clearly confirmed the absence of Eap in the mutant. However, binding and adhesion tests using whole staphylococcal cells demonstrated that both the parent and mutant strains bound equally well to fibronectin- and fibrinogen-coated surfaces, possibly due to their recognition by other staphylococcal adhesins. Furthermore, Eap mediated staphylococcal agglutination of both wild-type and mutant cells. In contrast, the mutant adhered to a significantly lesser extent to cultured fibroblasts (P < 0.001) than did the wild type, while adherence was restorable upon complementation. Furthermore, adherence to both epithelial cells (P < 0.05) and fibroblasts (not significant) could be blocked with antibodies against Eap, whereas preimmune serum was not active. In conclusion, Eap may contribute to pathogenicity by promoting adhesion of whole staphylococcal cells to complex eukaryotic substrates.

Improved dissection efficiency in the human gross anatomy laboratory by the integration of computers and modern technology.

PubMed

Reeves, Rustin E; Aschenbrenner, John E; Wordinger, Robert J; Roque, Rouel S; Sheedlo, Harold J

2004-05-01

The need to increase the efficiency of dissection in the gross anatomy laboratory has been the driving force behind the technologic changes we have recently implemented. With the introduction of an integrated systems-based medical curriculum and a reduction in laboratory teaching hours, anatomy faculty at the University of North Texas Health Science Center (UNTHSC) developed a computer-based dissection manual to adjust to these curricular changes and time constraints. At each cadaver workstation, Apple iMac computers were added and a new dissection manual, running in a browser-based format, was installed. Within the text of the manual, anatomical structures required for dissection were linked to digital images from prosected materials; in addition, for each body system, the dissection manual included images from cross sections, radiographs, CT scans, and histology. Although we have placed a high priority on computerization of the anatomy laboratory, we remain strong advocates of the importance of cadaver dissection. It is our belief that the utilization of computers for dissection is a natural evolution of technology and fosters creative teaching strategies adapted for anatomy laboratories in the 21st century. Our strategy has significantly enhanced the independence and proficiency of our students, the efficiency of their dissection time, and the quality of laboratory instruction by the faculty. Copyright 2004 Wiley-Liss, Inc.

Mitochondrial and Cytoplasmic ROS Have Opposing Effects on Lifespan

PubMed Central

Schaar, Claire E.; Dues, Dylan J.; Spielbauer, Katie K.; Machiela, Emily; Cooper, Jason F.; Senchuk, Megan; Hekimi, Siegfried; Van Raamsdonk, Jeremy M.

2015-01-01

Reactive oxygen species (ROS) are highly reactive, oxygen-containing molecules that can cause molecular damage within the cell. While the accumulation of ROS-mediated damage is widely believed to be one of the main causes of aging, ROS also act in signaling pathways. Recent work has demonstrated that increasing levels of superoxide, one form of ROS, through treatment with paraquat, results in increased lifespan. Interestingly, treatment with paraquat robustly increases the already long lifespan of the clk-1 mitochondrial mutant, but not other long-lived mitochondrial mutants such as isp-1 or nuo-6. To genetically dissect the subcellular compartment in which elevated ROS act to increase lifespan, we deleted individual superoxide dismutase (sod) genes in clk-1 mutants, which are sensitized to ROS. We find that only deletion of the primary mitochondrial sod gene, sod-2 results in increased lifespan in clk-1 worms. In contrast, deletion of either of the two cytoplasmic sod genes, sod-1 or sod-5, significantly decreases the lifespan of clk-1 worms. Further, we show that increasing mitochondrial superoxide levels through deletion of sod-2 or treatment with paraquat can still increase lifespan in clk-1;sod-1 double mutants, which live shorter than clk-1 worms. The fact that mitochondrial superoxide can increase lifespan in worms with a detrimental level of cytoplasmic superoxide demonstrates that ROS have a compartment specific effect on lifespan – elevated ROS in the mitochondria acts to increase lifespan, while elevated ROS in the cytoplasm decreases lifespan. This work also suggests that both ROS-dependent and ROS-independent mechanisms contribute to the longevity of clk-1 worms. PMID:25671321

Targeted Deletion of Sox10 by Wnt1-cre Defects Neuronal Migration and Projection in the Mouse Inner Ear

PubMed Central

Mao, YanYan; Reiprich, Simone; Wegner, Michael; Fritzsch, Bernd

2014-01-01

Sensory nerves of the brainstem are mostly composed of placode-derived neurons, neural crest-derived neurons and neural crest-derived Schwann cells. This mixed origin of cells has made it difficult to dissect interdependence for fiber guidance. Inner ear-derived neurons are known to connect to the brain after delayed loss of Schwann cells in ErbB2 mutants. However, the ErbB2 mutant related alterations in the ear and the brain compound interpretation of the data. We present here a new model to evaluate exclusively the effect of Schwann cell loss on inner ear innervation. Conditional deletion of the neural crest specific transcription factor, Sox10, using the rhombic lip/neural crest specific Wnt1-cre driver spares Sox10 expression in the ear. We confirm that neural crest-derived cells provide a stop signal for migrating spiral ganglion neurons. In the absence of Schwann cells, spiral ganglion neurons migrate into the center of the cochlea and even out of the ear toward the brain. Spiral ganglion neuron afferent processes reach the organ of Corti, but many afferent fibers bypass the organ of Corti to enter the lateral wall of the cochlea. In contrast to this peripheral disorganization, the central projection to cochlear nuclei is normal. Compared to ErbB2 mutants, conditional Sox10 mutants have limited cell death in spiral ganglion neurons, indicating that the absence of Schwann cells alone contributes little to the embryonic survival of neurons. These data suggest that neural crest-derived cells are dispensable for all central and some peripheral targeting of inner ear neurons. However, Schwann cells provide a stop signal for migratory spiral ganglion neurons and facilitate proper targeting of the organ of Corti by spiral ganglion afferents. PMID:24718611

Experimentally Dissecting the Origins of Peroxiredoxin Catalysis.

PubMed

Nelson, Kimberly J; Perkins, Arden; Van Swearingen, Amanda E D; Hartman, Steven; Brereton, Andrew E; Parsonage, Derek; Salsbury, Freddie R; Karplus, P Andrew; Poole, Leslie B

2018-03-01

Peroxiredoxins (Prxs) are ubiquitous cysteine-based peroxidases involved in oxidant defense and signal transduction. Despite much study, the precise roles of conserved residues remain poorly defined. In this study, we carried out extensive functional and structural characterization of 10 variants of such residues in a model decameric bacterial Prx. Three active site proximal mutations of Salmonella typhimurium AhpC, T43V, R119A, and E49Q, lowered catalytic efficiency with hydrogen peroxide by 4-5 orders of magnitude, but did not affect reactivity toward their reductant, AhpF. pK a values of the peroxidatic cysteine were also shifted up by 1-1.3 pH units for these and a decamer disruption mutant, T77I. Except for the decamer-stabilizing T77V, all mutations destabilized decamers in the reduced form. In the oxidized form, three mutants-T77V, T43A, and T43S-exhibited stabilized decamers and were more efficiently reduced by AhpF than wild-type AhpC. Crystal structures of most mutants were solved and many showed alterations in stability of the fully folded active site loop. This is the first study of Prx mutants to comprehensively assess the effects of mutations on catalytic activities, the active site cysteine pK a , and the protein structure and oligomeric status. The Arg119 side chain must be properly situated for efficient catalysis, but for other debilitating variants, the functional defects could be explained by structural perturbations and/or associated decamer destabilization rather than direct effects. This underscores the importance of our comprehensive approach. A remarkable new finding was the preference of the reductant for decamers. Antioxid. Redox Signal. 28, 521-536.

Increased photosystem II stability promotes H2 production in sulfur-deprived Chlamydomonas reinhardtii

PubMed Central

Volgusheva, Alena; Styring, Stenbjörn; Mamedov, Fikret

2013-01-01

Photobiological H2 production is an attractive option for renewable solar fuels. Sulfur-deprived cells of Chlamydomonas reinhardtii have been shown to produce hydrogen with the highest efficiency among photobiological systems. We have investigated the photosynthetic reactions during sulfur deprivation and H2 production in the wild-type and state transition mutant 6 (Stm6) mutant of Chlamydomonas reinhardtii. The incubation period (130 h) was dissected into different phases, and changes in the amount and functional status of photosystem II (PSII) were investigated in vivo by electron paramagnetic resonance spectroscopy and variable fluorescence measurements. In the wild type it was found that the amount of PSII is decreased to 25% of the original level; the electron transport from PSII was completely blocked during the anaerobic phase preceding H2 formation. This block was released during the H2 production phase, indicating that the hydrogenase withdraws electrons from the plastoquinone pool. This partly removes the block in PSII electron transport, thereby permitting electron flow from water oxidation to hydrogenase. In the Stm6 mutant, which has higher respiration and H2 evolution than the wild type, PSII was analogously but much less affected. The addition of the PSII inhibitor 3-(3,4-dichlorophenyl)-1,1-dimethylurea revealed that ∼80% of the H2 production was inhibited in both strains. We conclude that (i) at least in the earlier stages, most of the electrons delivered to the hydrogenase originate from water oxidation by PSII, (ii) a faster onset of anaerobiosis preserves PSII from irreversible photoinhibition, and (iii) mutants with enhanced respiratory activity should be considered for better photobiological H2 production. PMID:23589846

Femtosecond laser dissection in C. elegans neural circuits

NASA Astrophysics Data System (ADS)

Samuel, Aravinthan D. T.; Chung, Samuel H.; Clark, Damon A.; Gabel, Christopher V.; Chang, Chieh; Murthy, Venkatesh; Mazur, Eric

2006-02-01

The nematode C. elegans, a millimeter-long roundworm, is a well-established model organism for studies of neural development and behavior, however physiological methods to manipulate and monitor the activity of its neural network have lagged behind the development of powerful methods in genetics and molecular biology. The small size and transparency of C. elegans make the worm an ideal test-bed for the development of physiological methods derived from optics and microscopy. We present the development and application of a new physiological tool: femtosecond laser dissection, which allows us to selectively ablate segments of individual neural fibers within live C. elegans. Femtosecond laser dissection provides a scalpel with submicrometer resolution, and we discuss its application in studies of neural growth, regenerative growth, and the neural basis of behavior.

DISSECT: a new mnemonic-based approach to the categorization of aortic dissection.

PubMed

Dake, M D; Thompson, M; van Sambeek, M; Vermassen, F; Morales, J P

2013-08-01

Classification systems for aortic dissection provide important guides to clinical decision-making, but the relevance of traditional categorization schemes is being questioned in an era when endovascular techniques are assuming a growing role in the management of this frequently complex and catastrophic entity. In recognition of the expanding range of interventional therapies now used as alternatives to conventional treatment approaches, the Working Group on Aortic Diseases of the DEFINE Project developed a categorization system that features the specific anatomic and clinical manifestations of the disease process that are most relevant to contemporary decision-making. The DISSECT classification system is a mnemonic-based approach to the evaluation of aortic dissection. It guides clinicians through an assessment of six critical characteristics that facilitate optimal communication of the most salient details that currently influence the selection of a therapeutic option, including those findings that are key when considering an endovascular procedure, but are not taken into account by the DeBakey or Stanford categorization schemes. The six features of aortic dissection include: duration of disease; intimal tear location; size of the dissected aorta; segmental extent of aortic involvement; clinical complications of the dissection, and thrombus within the aortic false lumen. In current clinical practice, endovascular therapy is increasingly considered as an alternative to medical management or open surgical repair in select cases of type B aortic dissection. Currently, endovascular aortic repair is not used for patients with type A aortic dissection, but catheter-based techniques directed at peripheral branch vessel ischemia that may complicate type A dissection are considered valuable adjunctive interventions, when indicated. The use of a new system for categorization of aortic dissection, DISSECT, addresses the shortcomings of well-known established schemes devised more than 40 years ago, before the introduction of endovascular techniques. It will serve as a guide to support a critical analysis of contemporary therapeutic options and inform management decisions based on specific features of the disease process. Copyright © 2013 European Society for Vascular Surgery. All rights reserved.

Spontaneous Bilateral Vertebral Artery Dissection During a Basketball Game

PubMed Central

Mas Rodriguez, Manuel F.; Berrios, Rafael Arias; Ramos, Edwardo

2016-01-01

Spontaneous vertebral artery dissection accounts for 2% of all ischemic strokes and can occur as a consequence of sports events. We present an unusual case of spontaneous bilateral vertebral artery dissection in a 30-year-old male patient during a basketball game. He developed severe dysphagia, right hemiparesis, and balance dysfunction. We also present a review of the pathology, diagnosis, symptomatology, treatment, prognosis, and occurrence of this entity in sports. PMID:26733592

Isolated medial medullary infarction due to vertebral artery dissection.

PubMed

Wakita, M; Matsuoka, H; Hamada, R; Kasuya, J; Osame, M

2003-12-01

A 54-year-old man developed left hemiparesis and tactile and deep sensory disturbance following onset of rightside cervical pain. These symptoms resulted from an isolated infarct in the right medial area of the upper medulla oblongata and intracranial vertebral artery (VA) dissection. Atherosclerotic disease of the VA is the most common cause of medial medullary infarction. In past reports of isolated medial medullary infarction, only a few cases involved VA dissection.

Application of tissue mesodissection to molecular cancer diagnostics.

PubMed

Krizman, David; Adey, Nils; Parry, Robert

2015-02-01

To demonstrate clinical application of a mesodissection platform that was developed to combine advantages of laser-based instrumentation with the speed/ease of manual dissection for automated dissection of tissue off standard glass slides. Genomic analysis for KRAS gene mutation was performed on formalin fixed paraffin embedded (FFPE) cancer patient tissue that was dissected using the mesodissection platform. Selected reaction monitoring proteomic analysis for quantitative Her2 protein expression was performed on FFPE patient tumour tissue dissected by a laser-based instrument and the MilliSect instrument. Genomic analysis demonstrates highly confident detection of KRAS mutation specifically in lung cancer cells and not the surrounding benign, non-tumour tissue. Proteomic analysis demonstrates Her2 quantitative protein expression in breast cancer cells dissected manually, by laser-based instrumentation and by MilliSect instrumentation (mesodissection). Slide-mounted tissue dissection is commonly performed using laser-based instruments or manually scraping tissue by scalpel. Here we demonstrate that the mesodissection platform as performed by the MilliSect instrument for tissue dissection is cost-effective; it functions comparably to laser-based dissection and which can be adopted into a clinical diagnostic workflow. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Ethical views, attitudes and reactions of Romanian medical students to the dissecting room.

PubMed

Bob, M H; Popescu, Codruţa Alina; Armean, M S; Suciu, Soimita Mihaela; Buzoianu, Anca Dana

2014-01-01

Our objective was to evaluate the attitudes and views of first year medical students towards cadaver dissection in anatomy learning and discuss various findings in relation with ethical problems). The study was conducted at the "Iuliu Hat ieganu" University of Medicine and Pharmacy, during the academic year 2012-2013 at the end of the second semester. There were 121 first year medical students included. We developed a questionnaire to asses among other, the degree of fear, anxiety and stress in the dissection room, methods of coping, ethical aspects of dissection and hand it to the students. 34.7% of students experienced different levels of fear on exposure to the dissection room practical sessions. Many students experienced anxiety in reaction to dissection. In the first semester most students reported physical and behavioral reaction towards certain stimuli, with a decrease in the second semester. Recurring visual images of cadavers, reported by 57% of students in the first semester, dropped to 44.6% in the second semester. Students used most frequently the "rationalization and emotional detachment" as a coping method. Anatomists, most often the firsts who need to be aware of emotional and ethical issues, need to explain in detail the steps necessary for dissection and that dissection is performed with the respect of legislation, ethics and human rights.

Arterial elastic fiber structure. Function and potential roles in acute aortic dissection.

PubMed

Pratt, B; Curci, J

2010-10-01

The lethality of acute aortic dissection is well recognized. Successful treatment and prevention of aortic dissection is going to be dependent upon an improved understanding of the molecular and physiologic events which predispose to dissection development and propagation. In this review, we will focus on the elastic fiber, one of the critical elements of the aortic wall matrix. Mechanical or functional failure of the elastin in the wall of the aorta likely predisposes to dissection as well as the post-dissection aortic degeneration with aneurysm formation. Insight into the role of the elastin and the elastic fiber in aortic dissection has recently been accelerated by research into the molecular mechanisms associated with hereditary propensity for aortic dissection, such as Marfan syndrome. These studies have implicated both structural and metabolic contributions of alterations in the scaffolding proteins in matrix elastic fibers. In particular, increased transforming growth factor-β (TGF-β) activity may play a prominent role in predisposing the aortic wall to dissection. The events which predispose to post-dissection aortic degeneration are somewhat less well defined. However, the loss of the structural integrity of the remaining elastic fibers leaves the wall weaker and prone to dilatation and rupture. It appears likely that the upregulation of several potent proteases, particularly those of the matrix metalloproteinase (MMP) family such as MMP-9, are participating in the subsequent matrix damage. Novel medical treatments based on this pathologic data have been proposed and in some cases have made it to clinical trials. The ongoing study evaluating whether therapeutic inhibition of TGF-β may be useful in reducing the risk of aortic dissection in patients at high risk represents one promising new strategy in the treatment of this deadly disease.

Factors that predict the use or non-use of virtual dissection by high school biology teachers

NASA Astrophysics Data System (ADS)

Cockerham, William

2001-07-01

With the advent of computers into scholastic classrooms, virtual dissection has become a potential educational tool in high school biology lab settings. Utilizing non-experimental survey research methodology, this study attempted to identify factors that may influence high school biology teachers to use or not to use a virtual dissection. A 75-item research survey instrument consisting of both demographic background and Likert style questions was completed by 215 high school members of the National Association of Biology Teachers. The survey responses provided data to answer the research questions concerning the relationship between the likelihood of a high school biology teacher using a virtual dissection and a number of independent variables from the following three categories: (a) demographics, (b) attitude and experience, and (c) resources and support. These data also allowed for the determination of a demographic profile of the sample population. The demographic profile showed the sample population of high school biology teachers to be two-thirds female, mature, highly educated and very experienced. Analysis of variance and Pearson product moment correlational statistics were used to determine if there was a relationship between high school biology teachers' likelihood to use a virtual dissection and the independent variables. None of the demographic or resource and support independent variables demonstrated a strong relationship to the dependent variable of teachers' likelihood to use a virtual dissection. Three of the attitude and experience independent variables showed a statistically significant (p < .05) relationship to teachers' likelihood to use a virtual dissection: attitude toward virtual dissection, previous use of a virtual dissection and intention to use a real animal dissection. These findings may indicate that teachers are using virtual dissection as a supplement rather than a substitute. It appears that those concerned with promoting virtual dissection in high school biology classrooms will have to develop simulations that are more compelling to the teachers. Additionally, if science teacher organizations want to reduce the controversy surrounding dissection, they may need to re-visit their positions on the importance of real animal dissection.

Dissecting DNA damage response pathways by analyzing protein localization and abundance changes during DNA replication stress

PubMed Central

Tkach, Johnny M.; Yimit, Askar; Lee, Anna Y.; Riffle, Michael; Costanzo, Michael; Jaschob, Daniel; Hendry, Jason A.; Ou, Jiongwen; Moffat, Jason; Boone, Charles; Davis, Trisha N.; Nislow, Corey; Brown, Grant W.

2012-01-01

Re-localization of proteins is a hallmark of the DNA damage response. We use high-throughput microscopic screening of the yeast GFP fusion collection to develop a systems-level view of protein re-organization following drug-induced DNA replication stress. Changes in protein localization and abundance reveal drug-specific patterns of functional enrichments. Classification of proteins by sub-cellular destination allows the identification of pathways that respond to replication stress. We analyzed pairwise combinations of GFP fusions and gene deletion mutants to define and order two novel DNA damage responses. In the first, Cmr1 forms subnuclear foci that are regulated by the histone deacetylase Hos2 and are distinct from the typical Rad52 repair foci. In a second example, we find that the checkpoint kinases Mec1/Tel1 and the translation regulator Asc1 regulate P-body formation. This method identifies response pathways that were not detected in genetic and protein interaction screens, and can be readily applied to any form of chemical or genetic stress to reveal cellular response pathways. PMID:22842922

How to pattern a leaf.

PubMed

Bolduc, N; O'Connor, D; Moon, J; Lewis, M; Hake, S

2012-01-01

Leaf development presents a tremendous resource for tackling the question of patterning in biology. Leaves can be simple or highly dissected. They may have elaborated parts such as the tendrils of a pea leaf or the rolled blade of a carnivorous pitcher plant. Despite the variation in size, shape, and function, all leaves initiate in the same manner: from the flanks of a meristem. The maize leaf is useful for analysis of patterning due to the wealth of mutants and the distinct tissues along the proximal distal axis. The blade is distal, the sheath is proximal, and the ligule forms at the blade/sheath boundary. Establishment of this boundary involves the transcription factors LIGULELESS1 and LIGULELESS2 and the kinase LIGULELESS NARROW. The meristem-specific protein KNOTTED1 (KN1) binds and modulates the lg2 gene. Given the localization of KN1 at the proximal end of the leaf from the time of inception, we hypothesize that KN1 has a role in establishing the very proximal end of the leaf, whereas an auxin maximum guides the growing distal tip.

Sequential and coordinated action of phytochromes A and B during Arabidopsis stem growth revealed by kinetic analysis

NASA Technical Reports Server (NTRS)

Parks, B. M.; Spalding, E. P.; Evans, M. L. (Principal Investigator)

1999-01-01

Photoreceptor proteins of the phytochrome family mediate light-induced inhibition of stem (hypocotyl) elongation during the development of photoautotrophy in seedlings. Analyses of overt mutant phenotypes have established the importance of phytochromes A and B (phyA and phyB) in this developmental process, but kinetic information that would augment emerging molecular models of phytochrome signal transduction is absent. We have addressed this deficiency by genetically dissecting phytochrome-response kinetics, after having solved the technical issues that previously limited growth studies of small Arabidopsis seedlings. We show here, with resolution on the order of minutes, that phyA initiated hypocotyl growth inhibition upon the onset of continuous red light. This primary contribution of phyA began to decrease after 3 hr of irradiation, the same time at which immunochemically detectable phyA disappeared and an exclusively phyB-dependent phase of inhibition began. The sequential and coordinated actions of phyA and phyB in red light were not observed in far-red light, which inhibited growth persistently through an exclusively phyA-mediated pathway.

Spa47 is an oligomerization-activated type three secretion system (T3SS) ATPase from Shigella flexneri.

PubMed

Burgess, Jamie L; Jones, Heather B; Kumar, Prashant; Toth, Ronald T; Middaugh, C Russell; Antony, Edwin; Dickenson, Nicholas E

2016-05-01

Gram-negative pathogens often use conserved type three secretion systems (T3SS) for virulence. The Shigella type three secretion apparatus (T3SA) penetrates the host cell membrane and provides a unidirectional conduit for injection of effectors into host cells. The protein Spa47 localizes to the base of the apparatus and is speculated to be an ATPase that provides the energy for T3SA formation and secretion. Here, we developed an expression and purification protocol, producing active Spa47 and providing the first direct evidence that Spa47 is a bona fide ATPase. Additionally, size exclusion chromatography and analytical ultracentrifugation identified multiple oligomeric species of Spa47 with the largest greater than 8 fold more active for ATP hydrolysis than the monomer. An ATPase inactive Spa47 point mutant was then engineered by targeting a conserved Lysine within the predicted Walker A motif of Spa47. Interestingly, the mutant maintained a similar oligomerization pattern as active Spa47, but was unable to restore invasion phenotype when used to complement a spa47 null S. flexneri strain. Together, these results identify Spa47 as a Shigella T3SS ATPase and suggest that its activity is linked to oligomerization, perhaps as a regulatory mechanism as seen in some related pathogens. Additionally, Spa47 catalyzed ATP hydrolysis appears to be essential for host cell invasion, providing a strong platform for additional studies dissecting its role in virulence and providing an attractive target for anti-infective agents. © 2016 The Protein Society.

The transverse penile pedicled flap urethroplasty: description of a simplified technique for the dissection of the Fascio-cutaneous flap.

PubMed

Shittu, O B; Sotunmbi, P T

2015-06-01

Urethroplasty is often required for long urethral strictures or urethral strictures that have recurred after repeated urethral dilatations or urethrotomy. The transvers penile skin pedicled flap is very versatile for the reconstruction of long urethral stricture. However the meticulous sharp dissection required to develop it takes a long time to do and may be associated with button hole injuries to the vascular pedicle and the penile skin. We describe a simplified technique of raising the flap which does not require sharp dissection and is very quick to accomplish. Technique involves using a circumcising distal penile shaft skin incision to de-glove the penis by blunt dissection. The skin substitute, adequate to give appropriate urethra calibre is similarly dissected bluntly along with its vascular pedicle from the proximal penile skin. The techniques used to facilitate successful blunt dissection are described. In 9 adults with long, multiple urethral strictures, the average time to develop the flap was 15 minutes and complication have been limited to temporary urethro-cutaneous fistula at the ventral part of the circular skin closure. These fistulae closed on conservative treatment. No patient suffered button-hole injuries to either the vascular pedicle or the penile skin. This modification to the standard sharp dissection is very quick to accomplish. It also avoids the creation of button-hole injuries to either the vascular pedicle or the penile skin. It should make the use of this versatile flap more attractive in the reconstruction of long urethral strictures in those who may wish to use this option for reconstruction of long urethral strictures.

Future Development of Endoscopic Accessories for Endoscopic Submucosal Dissection

PubMed Central

Jang, Jae-Young

2017-01-01

Endoscopic submucosal dissection (ESD) has recently been accepted as a standard treatment for patients with early gastric cancer (EGC), without lymph node metastases. Given the rise in the number of ESDs being performed, new endoscopic accessories are being developed and existing accessories modified to facilitate the execution of ESD and reduce complication rates. This paper examines the history underlying the development of these new endoscopic accessories and indicates future directions for the development of these accessories. PMID:28609819

Hypertonicity-induced transmitter release at Drosophila neuromuscular junctions is partly mediated by integrins and cAMP/protein kinase A

NASA Technical Reports Server (NTRS)

Suzuki, Kazuhiro; Grinnell, Alan D.; Kidokoro, Yoshiaki

2002-01-01

The frequency of quantal transmitter release increases upon application of hypertonic solutions. This effect bypasses the Ca(2+) triggering step, but requires the presence of key molecules involved in vesicle fusion, and hence could be a useful tool for dissecting the molecular process of vesicle fusion. We have examined the hypertonicity response at neuromuscular junctions of Drosophila embryos in Ca(2+)-free saline. Relative to wild-type, the response induced by puff application of hypertonic solution was enhanced in a mutant, dunce, in which the cAMP level is elevated, or in wild-type embryos treated with forskolin, an activator of adenylyl cyclase, while protein kinase A (PKA) inhibitors decreased it. The response was also smaller in a mutant, DC0, which lacks the major subunit of PKA. Thus the cAMP/PKA cascade is involved in the hypertonicity response. Peptides containing the sequence Arg-Gly-Asp (RGD), which inhibit binding of integrins to natural ligands, reduced the response, whereas a peptide containing the non-binding sequence Arg-Gly-Glu (RGE) did not. A reduced response persisted in a mutant, myospheroid, which expresses no integrins, and the response in DC0 was unaffected by RGD peptides. These data indicate that there are at lease two components in the hypertonicity response: one that is integrin mediated and involves the cAMP/PKA cascade, and another that is not integrin mediated and does not involve the cAMP/PKA cascade.

Drosophila glypican Dally-like acts in FGF-receiving cells to modulate FGF signaling during tracheal morphogenesis

PubMed Central

Yan, Dong; Lin, Xinhua

2007-01-01

Summary Previous studies in Drosophila have shown that heparan sulfate proteoglycans (HSPGs) are involved in both breathless (btl)- and heartless (htl)-mediated FGF signaling during embryogenesis. However, the mechanism(s) by which HSPGs control Btl and Htl signaling is unknown. Here we show that dally-like (dlp, a Drosophila glypican) mutant embryos exhibit severe defects in tracheal morphogenesis and show a reduction in btl-mediated FGF signaling activity. However, htl-dependent mesodermal cell migration is not affected in dlp mutant embryos. Furthermore, expression of Dlp, but not other Drosophila HSPGs, can restore effectively the tracheal morphogenesis in dlp embryos. Rescue experiments in dlp embryos demonstrate that Dlp functions only in Bnl/FGF receiving cells in a cell-autonomous manner, but is not essential for Bnl/FGF expression cells. To further dissect the mechanism(s) of Dlp in Btl signaling, we analyzed the role of Dlp in Btl-mediated air sac tracheoblast formation in wing discs. Mosaic analysis experiments show that removal of HSPG activity in FGF-producing or other surrounding cells does not affect tracheoblasts migration, while HSPG mutant tracheoblast cells fail to receive FGF signaling. Together, our results argue strongly that HSPGs regulate Btl signaling exclusively in FGF-receiving cells as co-receptors, but are not essential for the secretion and distribution of the FGF ligand. This mechanism is distinct from HSPG functions in morphogen distribution, and is likely a general paradigm for HSPG functions in FGF signaling in Drosophila. PMID:17959166

Dissecting and modeling zeaxanthin- and lutein-dependent nonphotochemical quenching in Arabidopsis thaliana

PubMed Central

Leuenberger, Michelle; Morris, Jonathan M.; Chan, Arnold M.; Leonelli, Lauriebeth

2017-01-01

Photosynthetic organisms use various photoprotective mechanisms to dissipate excess photoexcitation as heat in a process called nonphotochemical quenching (NPQ). Regulation of NPQ allows for a rapid response to changes in light intensity and in vascular plants, is primarily triggered by a pH gradient across the thylakoid membrane (∆pH). The response is mediated by the PsbS protein and various xanthophylls. Time-correlated single-photon counting (TCSPC) measurements were performed on Arabidopsis thaliana to quantify the dependence of the response of NPQ to changes in light intensity on the presence and accumulation of zeaxanthin and lutein. Measurements were performed on WT and mutant plants deficient in one or both of the xanthophylls as well as a transgenic line that accumulates lutein via an engineered lutein epoxide cycle. Changes in the response of NPQ to light acclimation in WT and mutant plants were observed between two successive light acclimation cycles, suggesting that the character of the rapid and reversible response of NPQ in fully dark-acclimated plants is substantially different from in conditions plants are likely to experience caused by changes in light intensity during daylight. Mathematical models of the response of zeaxanthin- and lutein-dependent reversible NPQ were constructed that accurately describe the observed differences between the light acclimation periods. Finally, the WT response of NPQ was reconstructed from isolated components present in mutant plants with a single common scaling factor, which enabled deconvolution of the relative contributions of zeaxanthin- and lutein-dependent NPQ. PMID:28652334

Profilin-Dependent Nucleation and Assembly of Actin Filaments Controls Cell Elongation in Arabidopsis1[OPEN

PubMed Central

Cao, Lingyan; Blanchoin, Laurent; Staiger, Christopher J.

2016-01-01

Actin filaments in plant cells are incredibly dynamic; they undergo incessant remodeling and assembly or disassembly within seconds. These dynamic events are choreographed by a plethora of actin-binding proteins, but the exact mechanisms are poorly understood. Here, we dissect the contribution of Arabidopsis (Arabidopsis thaliana) PROFILIN1 (PRF1), a conserved actin monomer-binding protein, to actin organization and single filament dynamics during axial cell expansion of living epidermal cells. We found that reduced PRF1 levels enhanced cell and organ growth. Surprisingly, we observed that the overall frequency of nucleation events in prf1 mutants was dramatically decreased and that a subpopulation of actin filaments that assemble at high rates was reduced. To test whether profilin cooperates with plant formin proteins to execute actin nucleation and rapid filament elongation in cells, we used a pharmacological approach. Here, we used Small Molecule Inhibitor of Formin FH2 (SMIFH2), after validating its mode of action on a plant formin in vitro, and observed a reduced nucleation frequency of actin filaments in live cells. Treatment of wild-type epidermal cells with SMIFH2 mimicked the phenotype of prf1 mutants, and the nucleation frequency in prf1-2 mutant was completely insensitive to these treatments. Our data provide compelling evidence that PRF1 coordinates the stochastic dynamic properties of actin filaments by modulating formin-mediated actin nucleation and assembly during plant cell expansion. PMID:26574597

Practical guidelines for setting up neurosurgery skills training cadaver laboratory in India.

PubMed

Suri, Ashish; Roy, Tara Sankar; Lalwani, Sanjeev; Deo, Rama Chandra; Tripathi, Manjul; Dhingra, Renu; Bhardwaj, Daya Nand; Sharma, Bhawani Shankar

2014-01-01

Though the necessity of cadaver dissection is felt by the medical fraternity, and described as early as 600 BC, in India, there are no practical guidelines available in the world literature for setting up a basic cadaver dissection laboratory for neurosurgery skills training. Hands-on dissection practice on microscopic and endoscopic procedures is essential in technologically demanding modern neurosurgery training where ethical issues, cost constraints, medico-legal pitfalls, and resident duty time restrictions have resulted in lesser opportunities to learn. Collaboration of anatomy, forensic medicine, and neurosurgery is essential for development of a workflow of cadaver procurement, preservation, storage, dissection, and disposal along with setting up the guidelines for ethical and legal concerns.

Recent Development of Techniques and Devices in Colorectal Endoscopic Submucosal Dissection

PubMed Central

Mizutani, Hiroya; Ono, Satoshi; Ohki, Daisuke; Takeuchi, Chihiro; Yakabi, Seiichi; Kataoka, Yosuke; Saito, Itaru; Sakaguchi, Yoshiki; Minatsuki, Chihiro; Tsuji, Yosuke; Niimi, Keiko; Kodashima, Shinya; Yamamichi, Nobutake; Fujishiro, Mitsuhiro; Koike, Kazuhiko

2017-01-01

Colorectal endoscopic submucosal dissection (ESD) is now a well-established endoscopic treatment for early-stage colorectal neoplasms, especially in Asian countries, including Japan. Despite the spread of colorectal ESD, there are still situations in which achieving successful submucosal dissection is difficult. Various novel techniques and devices have been developed to overcome these difficulties, and past reports have shown that some of these strategies can be applied to colorectal ESD. We review several recent developments in the field. The techniques reviewed include the pocket creation method and traction methods and the devices reviewed include the overtube with balloon and electrosurgical knives with water-jet function. These improved techniques and devices can facilitate safer, more reliable ESDs and expand its applicability and acceptability all over the world. PMID:29207854

Stanford Type A Acute Aortic Dissection with Intimal Intussusception.

PubMed

Yanase, Yohsuke; Ohkawa, Akihito; Inoue, Satomi; Niida, Yukihiro

2018-03-17

In case of complete circumferential dissection of the ascending aorta, the dissected flap has the potential to fold backwards, causing several complications. We report two cases of Stanford type A acute aortic dissection (AAD) whose intimal flaps intussuscepted into the left ventricular outflow tract.Case 1: A 41-year-old man with AAD in whom transthoracic echocardiography (TTE) showed the dissected flap as folded back into the left ventricular outflow tract, causing severe aortic regurgitation (AR) with rapidly progressing acute pulmonary edema. Despite performing salvage surgery, the patient could not be rescued.Case 2: An 81-year-old man with annuloaortic ectasia developed Stanford type A AAD. TTE showed an extremely mobile intimal flap intussuscepting into the left ventricular outflow tract. However, AR was not severe as it was prevented by the flap itself. The patient was rescued by performance of the modified Bentall procedure.

Engineering of a Histone-Recognition Domain in Dnmt3a Alters the Epigenetic Landscape and Phenotypic Features of Mouse ESCs.

PubMed

Noh, Kyung-Min; Wang, Haibo; Kim, Hyunjae R; Wenderski, Wendy; Fang, Fang; Li, Charles H; Dewell, Scott; Hughes, Stephen H; Melnick, Ari M; Patel, Dinshaw J; Li, Haitao; Allis, C David

2015-07-02

Histone modification and DNA methylation are associated with varying epigenetic "landscapes," but detailed mechanistic and functional links between the two remain unclear. Using the ATRX-DNMT3-DNMT3L (ADD) domain of the DNA methyltransferase Dnmt3a as a paradigm, we apply protein engineering to dissect the molecular interactions underlying the recruitment of this enzyme to specific regions of chromatin in mouse embryonic stem cells (ESCs). By rendering the ADD domain insensitive to histone modification, specifically H3K4 methylation or H3T3 phosphorylation, we demonstrate the consequence of dysregulated Dnmt3a binding and activity. Targeting of a Dnmt3a mutant to H3K4me3 promoters decreases gene expression in a subset of developmental genes and alters ESC differentiation, whereas aberrant binding of another mutant to H3T3ph during mitosis promotes chromosome instability. Our studies support the general view that histone modification "reading" and DNA methylation are closely coupled in mammalian cells, and suggest an avenue for the functional assessment of chromatin-associated proteins. Copyright © 2015 Elsevier Inc. All rights reserved.

Skin stem cells orchestrate directional migration by regulating microtubule-ACF7 connections through GSK3β.

PubMed

Wu, Xiaoyang; Shen, Qing-Tao; Oristian, Daniel S; Lu, Catherine P; Zheng, Qinsi; Wang, Hong-Wei; Fuchs, Elaine

2011-02-04

Homeostasis and wound healing rely on stem cells (SCs) whose activity and directed migration are often governed by Wnt signaling. In dissecting how this pathway integrates with the necessary downstream cytoskeletal dynamics, we discovered that GSK3β, a kinase inhibited by Wnt signaling, directly phosphorylates ACF7, a > 500 kDa microtubule-actin crosslinking protein abundant in hair follicle stem cells (HF-SCs). We map ACF7's GSK3β sites to the microtubule-binding domain and show that phosphorylation uncouples ACF7 from microtubules. Phosphorylation-refractile ACF7 rescues overall microtubule architecture, but phosphorylation-constitutive mutants do not. Neither mutant rescues polarized movement, revealing that phospho-regulation must be dynamic. This circuitry is physiologically relevant and depends upon polarized GSK3β inhibition at the migrating front of SCs/progeny streaming from HFs during wound repair. Moreover, only ACF7 and not GSKβ-refractile-ACF7 restore polarized microtubule-growth and SC-migration to ACF7 null skin. Our findings provide insights into how this conserved spectraplakin integrates signaling, cytoskeletal dynamics, and polarized locomotion of somatic SCs. Copyright © 2011 Elsevier Inc. All rights reserved.

Assembly of streptolysin O pores assessed by quartz crystal microbalance and atomic force microscopy provides evidence for the formation of anchored but incomplete oligomers.

PubMed

Stewart, Sarah E; D'Angelo, Michael E; Paintavigna, Stefania; Tabor, Rico F; Martin, Lisandra L; Bird, Phillip I

2015-01-01

Streptolysin O (SLO) is a bacterial pore forming protein that is part of the cholesterol dependent cytolysin (CDC) family. We have used quartz crystal microbalance with dissipation monitoring (QCM-D) to examine SLO membrane binding and pore formation. In this system, SLO binds tightly to cholesterol-containing membranes, and assembles into partial and complete pores confirmed by atomic force microscopy. SLO binds to the lipid bilayer at a single rate consistent with the Langmuir isotherm model of adsorption. Changes in dissipation illustrate that SLO alters the viscoelastic properties of the bilayer during pore formation, but there is no loss of material from the bilayer as reported for small membrane-penetrating peptides. SLO mutants were used to further dissect the assembly and insertion processes by QCM-D. This shows the signature of SLO in QCM-D changes when pore formation is inhibited, and that bound and inserted SLO forms can be distinguished. Furthermore a pre-pore locked SLO mutant binds reversibly to lipid, suggesting that the partially complete wtSLO forms observed by AFM are anchored to the membrane. Copyright © 2014 Elsevier B.V. All rights reserved.

Reusable autoclavable silicone rubber dish for insect dissection

Treesearch

J.D. Podgwaite; R.D. Neely; R.T. Zerillo

1974-01-01

During a disease-diagnosis study which involved a large number of gypsy moth larvae, Porthetria dispar (L.),it became necessary to develop a dissecting dish that, while possessing the positive attributes of conventional wax and paraffin dishes, also could be sterilized and reused.

[Formaldehyde-reducing efficiency of a newly developed dissection-table-connected local ventilation system in the gross anatomy laboratory room].

PubMed

Shinoda, Koh; Oba, Jun

2010-03-01

In compliance with health and safety management guidelines against harmful formaldehyde (FA) levels in the gross anatomy laboratory, we newly developed a dissection-table-connected local ventilation system in 2006. The system was composed of (1) a simple plenum-chambered dissection table with low-cost filters, (2) a transparent vinyl flexible duct for easy mounting and removal, which connects the table and the exhaust pipe laid above the ceiling, and (3) an intake creating a downward-flow of air, which was installed on the ceiling just above each table. The dissection table was also designed as a separate-component system, of which the upper plate and marginal suction inlets can be taken apart for cleaning after dissection, and equipped with opening/closing side-windows for picking up materials dropped during dissection and a container underneath the table to receive exudate from the cadaver through a waste-fluid pipe. The local ventilation system dramatically reduced FA levels to 0.01-0.03 ppm in the gross anatomy laboratory room, resulting in no discomforting FA smell and irritating sensation while preserving the student's view of room and line of flow as well as solving the problems of high maintenance cost, sanitation issues inside the table, and working-inconvenience during dissection practice. Switching ventilation methods or power-modes, the current local ventilation system was demonstrated to be more than ten times efficient in FA reduction compared to the whole-room ventilation system and suggested that 11 m3/min/table in exhaust volume should decrease FA levels in both A- and B-measurements to less than 0.1 ppm in 1000 m3 space containing thirty-one 3.5%-FA-fixed cadavers.

Elephant trunk in a small-calibre true lumen for chronic aortic dissection: cause of haemolytic anaemia?

PubMed

Araki, Haruna; Kitamura, Tadashi; Horai, Tetsuya; Shibata, Ko; Miyaji, Kagami

2014-12-01

The elephant trunk technique for aortic dissection is useful for reducing false lumen pressure; however, a folded vascular prosthesis inside the aorta can cause haemolysis. The purpose of this study was to investigate whether an elephant trunk in a small-calibre lumen can cause haemolysis. Inpatient and outpatient records were retrospectively reviewed. Two cases of haemolytic anaemia after aortic surgery using the elephant trunk technique were identified from 2011 to 2013. A 64-year-old man, who underwent graft replacement of the ascending aorta for acute Stanford type A aortic dissection, presented with enlargement of the chronic dissection of the descending aorta and moderate aortic regurgitation. A two-stage surgery was scheduled. Total arch replacement with an elephant trunk in the true lumen and concomitant aortic valve replacement were performed. Postoperatively, he developed severe haemolytic anaemia because of the folded elephant trunk. The anaemia improved after the second surgery, including graft replacement of the descending aorta. Similarly, a 61-year-old man, who underwent total arch replacement for acute Stanford type A aortic dissection, presented with enlargement of the chronic dissection of the descending aorta. Graft replacement of the descending aorta with an elephant trunk inserted into the true lumen was performed. The patient postoperatively developed haemolytic anaemia because of the folded elephant trunk, which improved after additional stent grafting into the elephant trunk. A folded elephant trunk in a small-calibre lumen can cause haemolysis. Therefore, inserting an elephant trunk in a small-calibre true lumen during surgery for chronic aortic dissection should be avoided. © The Author 2014. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

Aortic dissection: a 250-year perspective.

PubMed

Criado, Frank J

2011-01-01

Two hundred fifty years have passed since Frank Nicholls' history-making, accurate observations on the anatomic findings and cause of death of King George II were published. Several decades later, the disease was named, using--for the first time--the terms dissection and dissecting attached to an aortic disease process. Another century went by before effective surgical treatment was developed. In sharp contrast, the evolution of the last 20 years has been nothing short of amazing. Our understanding of AD, while not yet complete, has improved dramatically. In addition, the introduction of nonsurgical endovascular therapy has had a profoundly transformative impact--and we are just at the beginning! It would not be unreasonable to predict that stent-graft repair will likely replace (or nearly replace) open surgery in the treatment of complicated type B dissection in the near future, especially as technologies continue to improve and indication-specific designs are developed and tested in the clinical setting. Moreover, it is predictable that endovascular solutions for some patients with type A aortic dissection will become available in the years to come as surgical results continue to be suboptimal. Finally, and amidst this plethora of “good news,” it is appropriate to reflect on the formidable challenge that endovascular therapies face as they gear to “compete” with optimal medical therapy in the management of patients with acute uncomplicated type B dissection, because it will obviously be difficult (if not impossible) to improve on the already-achieved 30-day mortality rate of less than 10%. Long-term gains may well become the winning card when and if the late results of TEVAR can be shown to improve on the rather compromised outlook of medically treated dissection patients. Stay tuned.

Squid Dissection: From Pen to Ink.

ERIC Educational Resources Information Center

Brown, Cindy; Kisiel, Jim

2003-01-01

Introduces students to dissection, which is an important part of scientific discovery. Students not only gain an understanding of the anatomy of a squid, but also develop a sense of responsibility and respect for the animal that they are using as a learning tool. (Author/SOE)

Using a Dissecting Microscope in Teaching Introductory Chemistry.

ERIC Educational Resources Information Center

Winokur, Robert; Monroe, Manus

1985-01-01

To have students develop observational skills and acquire an excitement about chemistry, stereoscopic dissecting microscopes are used to observe the physical characteristics and chemical reactions of various substances. Several of these reactions (including dissolving potassium permanganate in deionized water and reactions between copper metal and…

Percutaneous stenting of a dissected superior mesenteric artery in a patient with previous surgical repair of Stanford type A aortic dissection.

PubMed

Hatzidakis, A; Krokidis, M; Androulakakis, Z; Rossi, M

2015-01-01

We report a case of a 54-year-old male patient with background history of hypertension, which suffered a Stanford type A thoraco-abdominal aortic dissection with extension to the visceral arteries. The patient initially underwent surgical repair with replacement of the ascending aorta and of the hemiarch in the acute phase of the dissection. Postoperatively, he developed non-specific abdominal pain that was not related to meals but led to weight loss of 20 kg within the first five post-operative months. Follow-up computerized tomography scan revealed a chronic subphrenic aortic dissection extending to the celiac axis (with involvement of the left gastric and the splenic artery), the left renal artery and the superior mesenteric artery (SMA). The hepatic artery took origin from the SMA and received blood from the true lumen of the vessel, and the right renal artery was entirely supplied from the true aortic lumen. After exclusion of other causes of abdominal pain, the patient was treated with percutaneous stent placement in the dissected SMA with significant improvement of his symptoms. This case report emphasizes the role of visceral artery endovascular techniques in the management of patients with complicated chronic aortic dissection. Hippokratia 2015; 19 (3): 270-273.

Dissection of the atrial wall after mitral valve replacement.

PubMed Central

Lukács, L; Kassai, I; Lengyel, M

1996-01-01

We describe an unusual sequela of mitral valve replacement in a 50-year-old woman who had undergone a closed mitral commissurotomy in 1975. She was admitted to our hospital because of mitral restenosis in November 1993, at which time her mitral valve was replaced with a mechanical prosthesis. On the 8th postoperative day, the patient developed symptoms of heart failure; transesophageal echocardiography revealed dissection and rupture of the left atrial wall. At prompt reoperation, we found an interlayer dissection and rupture of the atrial wall into the left atrium. We repaired the ruptured atrial wall with a prosthetic patch. The postoperative course was uneventful, and postoperative transesophageal echocardiography showed normal prosthetic valve function and no dissection. Images PMID:8680278

Grain dissection as a grain size reducing mechanism during ice microdynamics

NASA Astrophysics Data System (ADS)

Steinbach, Florian; Kuiper, Ernst N.; Eichler, Jan; Bons, Paul D.; Drury, Martin R.; Griera, Albert; Pennock, Gill M.; Weikusat, Ilka

2017-04-01

Ice sheets are valuable paleo-climate archives, but can lose their integrity by ice flow. An understanding of the microdynamic mechanisms controlling the flow of ice is essential when assessing climatic and environmental developments related to ice sheets and glaciers. For instance, the development of a consistent mechanistic grain size law would support larger scale ice flow models. Recent research made significant progress in numerically modelling deformation and recrystallisation mechanisms in the polycrystalline ice and ice-air aggregate (Llorens et al., 2016a,b; Steinbach et al., 2016). The numerical setup assumed grain size reduction is achieved by the progressive transformation of subgrain boundaries into new high angle grain boundaries splitting an existing grain. This mechanism is usually termed polygonisation. Analogue experiments suggested, that strain induced grain boundary migration can cause bulges to migrate through the whole of a grain separating one region of the grain from another (Jessell, 1986; Urai, 1987). This mechanism of grain dissection could provide an alternative grain size reducing mechanism, but has not yet been observed during ice microdynamics. In this contribution, we present results using an updated numerical approach allowing for grain dissection. The approach is based on coupling the full field theory crystal visco-plasticity code (VPFFT) of Lebensohn (2001) to the multi-process modelling platform Elle (Bons et al., 2008). VPFFT predicts the mechanical fields resulting from short strain increments, dynamic recrystallisation process are implemented in Elle. The novel approach includes improvements to allow for grain dissection, which was topologically impossible during earlier simulations. The simulations are supported by microstructural observations from NEEM (North Greenland Eemian Ice Drilling) ice core. Mappings of c-axis orientations using the automatic fabric analyser and full crystallographic orientations using electron backscatter diffraction (EBSD) are presented. Numerical simulations predict and resolve the microstructural evolution over strain and time. The occurrence of processes such as grain dissection can only be proven using such time resolved movies of microstructure evolution. We will present movies that show grain dissection as a common process during the simulations. Microstructures obtained from NEEM ice core support the observations and we provide evidence for grain dissection in natural ice. Grain dissection is observed to be most efficient relative to polygonisation, when the microstructure approaches steady state grain sizes. This is consistent with analogue experiments observing grain dissection by Jessell (1986) and Urai (1987). Our research suggests a novel grain size reducing mechanisms in ice microdynamics that should be considered when developing a consistent grain size law.

Ooey, Gooey, Fish Guts

ERIC Educational Resources Information Center

Timmons, Maryellen

2004-01-01

Fish dissections are a great way to introduce the concepts of food webs, predator-prey relationships, and ecosystems, but these labs are expensive, messy, smelly, and require a lot of supervision because of the tools involved. The author has developed an inexpensive, safe, and clean alternative where students "dissect" simulated fish…

Digital report in an anatomy laboratory: a new method for team-based dissection, reporting, and evaluation.

PubMed

Oh, Chang-Seok; Kim, Kyong-Jee; Chung, Eilho; Choi, Hong-Joo

2015-04-01

Digital report (DR), a new method for students' dissection report, has been introduced to replace the traditional method in the anatomy laboratory. Laboratory tasks were assigned to groups of five students, and each group was asked to make a DR of their dissection tasks and upload it on the website for the anatomy course developed by the authors' institution. For creating the DR, students were instructed to take photographs of their findings with digital cameras, to mark the orientation and label the structures on the photograph. Students were assessed as a group by evaluating the DR. All the photographs of the DR were saved to construct a database that can be used by the students who will take the anatomy course in the following years. A questionnaire consisting of 14 questions was administered at the end of the anatomy course to evaluate the effectiveness of the DR. The results of the student survey showed that the DR was useful for making the students participate more actively in the teamwork for dissection, and for making dissection reports by referring to the DR made by the students from previous years. The DR was also more helpful for the anatomy teacher to assess student learning in the anatomy laboratory than conventional practical examinations and paper-based dissection reports. DR, a paperless report of team-based dissection, is concurrent with the 'digital' age and is in line with the need for a more systematic and objective evaluation of students' dissection.

Identification of the essential protein domains for Mib2 function during the development of the Drosophila larval musculature and adult flight muscles.

PubMed

Domsch, Katrin; Acs, Andreas; Obermeier, Claudia; Nguyen, Hanh T; Reim, Ingolf

2017-01-01

The proper differentiation and maintenance of myofibers is fundamental to a functional musculature. Disruption of numerous mostly structural factors leads to perturbations of these processes. Among the limited number of known regulatory factors for these processes is Mind bomb2 (Mib2), a muscle-associated E3 ubiquitin ligase, which was previously established to be required for maintaining the integrity of larval muscles. In this study, we have examined the mechanistic aspects of Mib2 function by performing a detailed functional dissection of the Mib2 protein. We show that the ankyrin repeats, in its entirety, and the hitherto uncharacterized Mib-specific domains (MIB), are important for the major function of Mib2 in skeletal and visceral muscles in the Drosophila embryo. Furthermore, we characterize novel mib2 alleles that have arisen from a forward genetic screen aimed at identifying regulators of myogenesis. Two of these alleles are viable, but flightless hypomorphic mib2 mutants, and harbor missense mutations in the MIB domain and RING finger, respectively. Functional analysis of these new alleles, including in vivo imaging, demonstrates that Mib2 plays an additional important role in the development of adult thorax muscles, particularly in maintaining the larval templates for the dorsal longitudinal indirect flight muscles during metamorphosis.

Yeast Reporter Assay to Identify Cellular Components of Ricin Toxin A Chain Trafficking.

PubMed

Becker, Björn; Schnöder, Tina; Schmitt, Manfred J

2016-12-06

RTA, the catalytic A-subunit of the ribosome inactivating A/B toxin ricin, inhibits eukaryotic protein biosynthesis by depurination of 28S rRNA. Although cell surface binding of ricin holotoxin is mainly mediated through its B-subunit (RTB), sole application of RTA is also toxic, albeit to a significantly lower extent, suggesting alternative pathways for toxin uptake and transport. Since ricin toxin trafficking in mammalian cells is still not fully understood, we developed a GFP-based reporter assay in yeast that allows rapid identification of cellular components required for RTA uptake and subsequent transport through a target cell. We hereby show that Ypt6p, Sft2p and GARP-complex components play an important role in RTA transport, while neither the retromer complex nor COPIB vesicles are part of the transport machinery. Analyses of yeast knock-out mutants with chromosomal deletion in genes whose products regulate ADP-ribosylation factor GTPases (Arf-GTPases) and/or retrograde Golgi-to-ER (endoplasmic reticulum) transport identified Sso1p, Snc1p, Rer1p, Sec22p, Erv46p, Gea1p and Glo3p as novel components in RTA transport, suggesting the developed reporter assay as a powerful tool to dissect the multistep processes of host cell intoxication in yeast.

[Influence of different surgeries on growth and development of alar cartilage in young-rabbit].

PubMed

Jiang, Lian; Dong, Xiqian; Song, Qinggao; Chen, Shang; Zou, Sihai

2011-01-01

The purpose of this study is to observe the affection of different clinical surgeries on alar nasal cartilages' growth and development. The experimental results can provide some theory basis for clinical surgeries. Twenty-eight New Zealand immature rabbits were used in this study, and divided into normal control group, hidden dissection group and cutting off alar nasal cartilages group randomly, which included 4,12 and 12 rabbits, separately. Arc incision were made on the mucous membrane of nasal cavity,and then dissect the alar nasal cartilages hidden or cut off the alar nasal cartilages, separately. The growth and development of the alar cartilage were observed at different stages after the surgery using histological and immuno-histochemical methods. Four weeks, eight weeks, twelve weeks and sixteen weeks after surgery, there were no significant differences in the indexes of chondrocytes between hidden dissection group and control group. In cutting off alar nasal cartilages group, fiber tissue were observed in the vacancy left after being cut off cartilages, and even mucous membrane tissue could be seen in some slices. There is no adverse influence on the growth and development of the alar cartilage after being hidden dissected. Contrarily, the restoring capability of transparent cartilage cannot counteract the injury resulted form the surgery after the alar nasal cartilages being cut off.

Maximizing Science Return from Future Rodent Experiments on the International Space Station (ISS): Tissue Preservation

NASA Technical Reports Server (NTRS)

Choi, S. Y.; Lai, S.; Klotz, R.; Popova, Y.; Chakravarty, K.; Beegle, J. E.; Wigley, C. L.; Globus, R. K.

2014-01-01

To better understand how mammals adapt to long duration habitation in space, a system for performing rodent experiments on the ISS is under development; Rodent Research-1 is the first flight and will include validation of both on-orbit animal support and tissue preservation. To evaluate plans for on-orbit sample dissection and preservation, we simulated conditions for euthanasia, tissue dissection, and prolonged sample storage on the ISS, and we also developed methods for post-flight dissection and recovery of high quality RNA from multiple tissues following prolonged storage in situ for future science. Mouse livers and spleens were harvested under conditions that simulated nominal, on-orbit euthanasia and dissection operations including storage at -80 C for 4 months. The RNA recovered was of high quality (RNA Integrity Number, RIN(is) greater than 8) and quantity, and the liver enzyme contents and activities (catalase, glutathione reductase, GAPDH) were similar to positive controls, which were collected under standard laboratory conditions. We also assessed the impact of possible delayed on-orbit dissection scenarios (off-nominal) by dissecting and preserving the spleen (RNAlater) and liver (fast-freezing) at various time points post-euthanasia (from 5 min up to 105 min). The RNA recovered was of high quality (spleen, RIN (is) greater than 8; liver, RIN (is) greater than 6) and liver enzyme activities were similar to positive controls at all time points, although an apparent decline in select enzyme activities was evident at the latest time (105 min). Additionally, various tissues were harvested from either intact or partially dissected, frozen carcasses after storage for approximately 2 months; most of the tissues (brain, heart, kidney, eye, adrenal glands and muscle) were of acceptable RNA quality for science return, whereas some tissues (small intestine, bone marrow and bones) were not. These data demonstrate: 1) The protocols developed for future flight experiments will support science return despite delayed preservation post-euthanasia or prolonged storage, and 2) Many additional tissues for gene expression analysis can be obtained by dissection following prolonged storage of the tissue in situ at -80 C. These findings have relevance both to high value, ground-based experiments when sample collection capability is severely constrained, and to all future spaceflight experiments that entail on-orbit sample recovery by the ISS crew.

Maximizing Science Return from Future Rodent Experiments on the International Space Station (ISS): Tissue Preservation

NASA Technical Reports Server (NTRS)

Choi, S. Y.; Lai, S.; Klotz, R.; Popova, Y.; Chakravarty, K.; Beegle, J. E.; Wigley, C. L.; Globus, R. K.

2014-01-01

To better understand how mammals adapt to long duration habitation in space, a system for performing rodent experiments on the ISS is under development. Rodent Research-1 is the first flight and will include validation of both on-orbit animal support and tissue preservation. To evaluate plans for on-orbit sample dissection and preservation, we simulated conditions for euthanasia, tissue dissection, and prolonged sample storage on the ISS, and we also developed methods for post-flight dissection and recovery of high quality RNA from multiple tissues following prolonged storage in situ for future science return. Livers and spleens from mice were harvested under conditions that simulated nominal, on-orbit euthanasia and dissection procedures including storage at minus 80 degrees Centigrade for 4 months. The RNA recovered was of high quality (RNA Integrity Number, RNA Integrity Number (RIN) greater than 8) and quantity, and the liver enzyme contents and activities (catalase, glutathione reductase, GAPDH) were similar to positive controls, which were collected under standard laboratory conditions. We also assessed the impact of possible delayed on-orbit dissection scenarios (off-nominal) by dissecting and preserving the spleen (RNA, later) and liver (fast-freezing) at various time points post-euthanasia (from 5 minutes up to 105 minutes). The RNA recovered was of high quality (spleen, RIN greater than 8; liver, RIN greater than 6) and liver enzyme activities were similar to positive controls at all time points, although an apparent decline in select enzyme activities was evident at 105 minutes. Additionally, various tissues were harvested from either intact or partially dissected, frozen carcasses after storage for approximately 2 months; most of the tissues (brain, heart, kidney, eye, adrenal glands and muscle) were of acceptable RNA quality for science return, whereas some tissues (small intestine, bone marrow and bones) were not. These data demonstrate: 1) The protocols developed for future flight experiments will support science return despite delayed preservation post-euthanasia or prolonged storage, and 2) High-quality RNA samples from many different tissues can be recovered by dissection following prolonged storage of the tissue in situ at minus 80 degrees Centigrade. These findings have relevance both to high-value, ground-based experiments when sample collection capability is severely constrained, and to future spaceflight experiments that entail on-orbit sample recovery by the ISS crew.

Dissection and Downstream Analysis of Zebra Finch Embryos at Early Stages of Development

PubMed Central

Murray, Jessica R.; Stanciauskas, Monika E.; Aralere, Tejas S.; Saha, Margaret S.

2014-01-01

The zebra finch (Taeniopygiaguttata) has become an increasingly important model organism in many areas of research including toxicology1,2, behavior3, and memory and learning4,5,6. As the only songbird with a sequenced genome, the zebra finch has great potential for use in developmental studies; however, the early stages of zebra finch development have not been well studied. Lack of research in zebra finch development can be attributed to the difficulty of dissecting the small egg and embryo. The following dissection method minimizes embryonic tissue damage, which allows for investigation of morphology and gene expression at all stages of embryonic development. This permits both bright field and fluorescence quality imaging of embryos, use in molecular procedures such as in situ hybridization (ISH), cell proliferation assays, and RNA extraction for quantitative assays such as quantitative real-time PCR (qtRT-PCR). This technique allows investigators to study early stages of development that were previously difficult to access. PMID:24999108

Development and Assessment of a Transoral Robotic Surgery Curriculum to Train Otolaryngology Residents.

PubMed

White, Joseph; Sharma, Arun

2018-05-30

(1) To develop a multifaceted didactic and hands-on curriculum to prepare otolaryngology residents to perform transoral robotic surgery (TORS) and safely transition to the operating room. (2) To assess the effectiveness of the TORS curriculum. Learning objectives were developed and a curriculum was formulated utilizing five unique modalities: focused didactic reading, online training modules, backpack console simulations, videos of TORS cases, and hands-on cadaveric dissections with the robotic surgical system in a simulated operating room. The trainees completed a nine-item self-assessment of their skill level using a Likert scale. Five senior otolaryngology residents completed the TORS curriculum. Before and after the cadaveric dissections, there was improvement in each of the nine items assessed. Composite scores were calculated and there was significant improvement from predissection (15.2 ± 2.2) to postdissection (31.4 ± 1.9) (p = 0.002). The current study demonstrates the feasibility of implementing a multifaceted TORS curriculum which incorporates robotic cadaveric dissection for otolaryngology residents. Residents demonstrate marked improvement in skills with the TORS curriculum. A TORS curriculum which includes robotic cadaveric dissection can improve surgical skills and serve as a key component of residency TORS education. © 2018 S. Karger AG, Basel.

Retrograde Ascending Dissection After Thoracic Endovascular Aortic Repair Combined With the Chimney Technique and Successful Open Repair Using the Frozen Elephant Trunk Technique.

PubMed

Hirano, Koji; Tokui, Toshiya; Nakamura, Bun; Inoue, Ryosai; Inagaki, Masahiro; Maze, Yasumi; Kato, Noriyuki

2018-01-01

The chimney technique can be combined with thoracic endovascular aortic repair (TEVAR) to both obtain an appropriate landing zone and maintain blood flow of the arch vessels. However, surgical repair becomes more complicated if retrograde type A aortic dissection occurs after TEVAR with the chimney technique. We herein report a case involving a 73-year-old woman who developed a retrograde ascending dissection 3 months after TEVAR for acute type B aortic dissection. To ensure an adequate proximal sealing distance, the proximal edge of the stent graft was located at the zone 2 level and an additional bare stent was placed at the left subclavian artery (the chimney technique) at the time of TEVAR. Enhanced computed tomography revealed an aortic dissection involving the ascending aorta and aortic arch. Surgical aortic repair using the frozen elephant trunk technique was urgently performed. The patient survived without stroke, paraplegia, renal failure, or other major complications. Retrograde ascending dissection can occur after TEVAR combined with the chimney technique. The frozen elephant trunk technique is useful for surgical repair in such complicated cases.

Measuring medical students' motivation to learning anatomy by cadaveric dissection.

PubMed

Abdel Meguid, Eiman M; Khalil, Mohammed K

2017-07-01

Motivation and learning are inter-related. It is well known that motivating learners is clearly a complex endeavor, which can be influenced by the educational program and the learning environment. Limited research has been conducted to examine students' motivation as a method to assess the effectiveness of dissection in medical education. This study aimed to assess and analyze students' motivation following their dissection experience. A 29-item survey was developed based on the Attention, Relevance, Confidence, and Satisfaction model of motivation. Descriptive statistics were undertaken to describe students' motivation to the dissection experience. T-test and ANOVA were used to compare differences in motivational scores between gender and educational characteristics of students. Dissection activities appear to promote students' motivation. Gender difference was statistically significant as males were more motivated by the dissection experience than females. Comparison between students with different knowledge of anatomy was also significantly different. The study is an important step in the motivational design to improve students' motivation to learn. The outcome of this study provides guidance to the selection of specific strategies to increase motivation by generating motivational strategies/tactics to facilitate learning. Anat Sci Educ 10: 363-371. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

The birth and evolution of neuroscience through cadaveric dissection.

PubMed

Moon, Karam; Filis, Andreas K; Cohen, Alan R

2010-09-01

Although interest in the art of dissection and vivisection has waxed and waned throughout the ages, the past century has seen it accepted as commonplace in medical schools across the country. No other practice in medicine has contributed more to the understanding of neuroanatomy and the neurosciences as dissection of the human cadaver, the origins of which are widely documented to have been in Alexandrian Greece. This article chronicles the fascinating and often controversial use of dissection and vivisection in these fields through the ages, beginning with Herophilus of Alexandria, among the first systematic dissectors in the history of Western medicine. The authors comment on its role in the development of modern neurosurgery and conclude with remarks about use of this educational tool today in the United States.

Abdominal Aortic Dissection and Cold-Intolerance After Whole-Body Cryotherapy: A Case Report.

PubMed

Cámara-Lemarroy, Carlos R; Azpiri-López, José R; Vázquez-Díaz, Luis A; Galarza-Delgado, Dionicio A

2017-09-01

Whole-body cryotherapy (WBC) involves short exposures to air temperatures below -100°C and is purported to enhance recovery after exercise and accelerate rehabilitation after injury. It is generally considered a procedure with few side effects, but there are no large studies that have established its safety profile. We present the case of a 56-year-old patient who developed an abdominal aortic dissection after receiving 15 sessions of WBC. The patient had no other strong risk factors for aortic dissection. Exposure to cold temperatures, including WBC, has multiple hemodynamic effects, including increases in blood pressure, heart rate, and an adrenergic response. We suggest that these changes could act as a trigger for the onset of aortic dissections. This could be the first reported cardiovascular complication associated with WBC.

Dissecting the total transition state stabilization provided by amino acid side chains at orotidine 5'-monophosphate decarboxylase: a two-part substrate approach.

PubMed

Barnett, Shonoi A; Amyes, Tina L; Wood, Bryant M; Gerlt, John A; Richard, John P

2008-07-29

Kinetic analysis of decarboxylation catalyzed by S154A, Q215A, and S154A/Q215A mutant yeast orotidine 5'-monophosphate decarboxylases with orotidine 5'-monophosphate (OMP) and with a truncated nucleoside substrate (EO) activated by phosphite dianion shows (1) the side chain of Ser-154 stabilizes the transition state through interactions with the pyrimidine rings of OMP or EO, (2) the side chain of Gln-215 interacts with the phosphodianion group of OMP or with phosphite dianion, and (3) the interloop hydrogen bond between the side chains of Ser-154 and Gln-215 orients the amide side chain of Gln-215 to interact with the phosphodianion group of OMP or with phosphite dianion.

Exon skipping of AGAMOUS homolog PrseAG in developing double flowers of Prunus lannesiana (Rosaceae).

PubMed

Liu, Zhixiong; Zhang, Dandan; Liu, Di; Li, Fenglan; Lu, Hai

2013-02-01

KEY MESSAGE : Two transcript isoforms of AGAMOUS homologs, from single and double flower Prunus lannesiana, respectively, showed different functions. The Arabidopsis floral homeotic C function gene AGAMOUS (AG) confers stamen and carpel identity. Loss of AG function results in homeotic conversions of stamens into petals and formation of double flowers. In order to present a molecular dissection of a double-flower cultivar in Prunus lannesiana (Rosaceae), we isolated and identified a single-copy gene, AG homolog from two genetically cognate P. lannesiana bearing single and double flowers, respectively. Sequence analysis revealed that the AG homolog, prseag-1, from double flowers showed a 170-bp exon skipping as compared to PrseAG (Prunus serrulata AGAMOUS) from the single flowers. Genomic DNA sequence revealed that abnormal splicing resulted in mutant prseag-1 protein with the C-terminal AG motifs I and II deletions. In addition, protein sequence alignment and phylogenetic analyses revealed that the PrseAG was grouped into the euAG lineage. A semi-quantitative PCR analysis showed that the expression of PrseAG was restricted to reproductive organs of stamens and carpels in single flowers of P. lannesiana 'speciosa', while the prseag-1 mRNA was highly transcribed throughout the petals, stamens, and carpels in double flowers from 'Albo-rosea'. The transgenic Arabidopsis containing 35S::PrseAG displayed extremely early flowering, bigger stamens and carpels and homeotic conversion of petals into staminoid organs, but ectopic expression of prseag-1 could not mimic the phenotypic ectopic expression of PrseAG in Arabidopsis. In general, this study provides evidences to show that double flower 'Albo-rosea' is a putative C functional ag mutant in P. lannesiana.

Receptor-mediated chitin perception in legume roots is functionally separable from Nod factor perception.

PubMed

Bozsoki, Zoltan; Cheng, Jeryl; Feng, Feng; Gysel, Kira; Vinther, Maria; Andersen, Kasper R; Oldroyd, Giles; Blaise, Mickael; Radutoiu, Simona; Stougaard, Jens

2017-09-19

The ability of root cells to distinguish mutualistic microbes from pathogens is crucial for plants that allow symbiotic microorganisms to infect and colonize their internal root tissues. Here we show that Lotus japonicus and Medicago truncatula possess very similar LysM pattern-recognition receptors, Lj LYS6/ Mt LYK9 and Mt LYR4, enabling root cells to separate the perception of chitin oligomeric microbe-associated molecular patterns from the perception of lipochitin oligosaccharide by the Lj NFR1/ Mt LYK3 and Lj NFR5/ Mt NFP receptors triggering symbiosis. Inactivation of chitin-receptor genes in Ljlys6 , Mtlyk9 , and Mtlyr4 mutants eliminates early reactive oxygen species responses and induction of defense-response genes in roots. Ljlys6 , Mtlyk9 , and Mtlyr4 mutants were also more susceptible to fungal and bacterial pathogens, while infection and colonization by rhizobia and arbuscular mycorrhizal fungi was maintained. Biochemical binding studies with purified Lj LYS6 ectodomains further showed that at least six GlcNAc moieties (CO6) are required for optimal binding efficiency. The 2.3-Å crystal structure of the Lj LYS6 ectodomain reveals three LysM βααβ motifs similar to other LysM proteins and a conserved chitin-binding site. These results show that distinct receptor sets in legume roots respond to chitin and lipochitin oligosaccharides found in the heterogeneous mixture of chitinaceous compounds originating from soil microbes. This establishes a foundation for genetic and biochemical dissection of the perception and the downstream responses separating defense from symbiosis in the roots of the 80-90% of land plants able to develop rhizobial and/or mycorrhizal endosymbiosis.

Genetic interaction networks: better understand to better predict

PubMed Central

Boucher, Benjamin; Jenna, Sarah

2013-01-01

A genetic interaction (GI) between two genes generally indicates that the phenotype of a double mutant differs from what is expected from each individual mutant. In the last decade, genome scale studies of quantitative GIs were completed using mainly synthetic genetic array technology and RNA interference in yeast and Caenorhabditis elegans. These studies raised questions regarding the functional interpretation of GIs, the relationship of genetic and molecular interaction networks, the usefulness of GI networks to infer gene function and co-functionality, the evolutionary conservation of GI, etc. While GIs have been used for decades to dissect signaling pathways in genetic models, their functional interpretations are still not trivial. The existence of a GI between two genes does not necessarily imply that these two genes code for interacting proteins or that the two genes are even expressed in the same cell. In fact, a GI only implies that the two genes share a functional relationship. These two genes may be involved in the same biological process or pathway; or they may also be involved in compensatory pathways with unrelated apparent function. Considering the powerful opportunity to better understand gene function, genetic relationship, robustness and evolution, provided by a genome-wide mapping of GIs, several in silico approaches have been employed to predict GIs in unicellular and multicellular organisms. Most of these methods used weighted data integration. In this article, we will review the later knowledge acquired on GI networks in metazoans by looking more closely into their relationship with pathways, biological processes and molecular complexes but also into their modularity and organization. We will also review the different in silico methods developed to predict GIs and will discuss how the knowledge acquired on GI networks can be used to design predictive tools with higher performances. PMID:24381582

Different mechanisms of Trichoderma virens-mediated resistance in tomato against Fusarium wilt involve the jasmonic and salicylic acid pathways.

PubMed

Jogaiah, Sudisha; Abdelrahman, Mostafa; Tran, Lam-Son Phan; Ito, Shin-Ichi

2018-04-01

In the present study, we investigated the role of Trichoderma virens (TriV_JSB100) spores or cell-free culture filtrate in the regulation of growth and activation of the defence responses of tomato (Solanum lycopersicum) plants against Fusarium oxysporum f. sp. lycopersici by the development of a biocontrol-plant-pathogen interaction system. Two-week-old tomato seedlings primed with TriV_JSB100 spores cultured on barley grains (BGS) or with cell-free culture filtrate (CF) were inoculated with Fusarium pathogen under glasshouse conditions; this resulted in significantly lower disease incidence in tomato Oogata-Fukuju plants treated with BGS than in those treated with CF. To dissect the pathways associated with this response, jasmonic acid (JA) and salicylic acid (SA) signalling in BGS- and CF-induced resistance was evaluated using JA- and SA-impaired tomato lines. We observed that JA-deficient mutant def1 plants were susceptible to Fusarium pathogen when they were treated with BGS. However, wild-type (WT) BGS-treated tomato plants showed a higher JA level and significantly lower disease incidence. SA-deficient mutant NahG plants treated with CF were also found to be susceptible to Fusarium pathogen and displayed low SA levels, whereas WT CF-treated tomato plants exhibited moderately lower disease levels and substantially higher SA levels. Expression of the JA-responsive defensin gene PDF1 was induced in WT tomato plants treated with BGS, whereas the SA-inducible pathogenesis-related protein 1 acidic (PR1a) gene was up-regulated in WT tomato plants treated with CF. These results suggest that TriV_JSB100 BGS and CF differentially induce JA and SA signalling cascades for the elicitation of Fusarium oxysporum resistance in tomato. © 2017 BSPP AND JOHN WILEY & SONS LTD.

Medical students' attitudes toward the anatomy dissection room in relation to personality.

PubMed

Plaisant, Odile; Courtois, Robert; Toussaint, Paule Joanne; Mendelsohn, Gerald A; John, Oliver P; Delmas, Vincent; Moxham, Bernard J

2011-01-01

Assessment of the personalities of medical students could enable medical educators to formulate strategies for the best development of academic and clinical competencies. In this article, we focus on the experience of students in the anatomy dissecting room. While there have been many attempts to evaluate the emotional responses of medical students to human cadaveric dissection, there has been no investigation into how different personality traits affect the responses. The main hypothesis tested was that there is a relationship between personality traits and attitudes toward the dissection room. For the present study, a group of French medical students (n = 403; mean age 21.3 ± 1.6; 65.3% female) completed a "Big Five" personality inventory and a questionnaire to assess their attitudes in regard to human dissection. The findings are consistent with our hypothesis, in that we found a relationship between reporting anxiety and four of the "Big Five" dimensions (all except openness). The rated level of anxiety was positively correlated with negative affectivity, more strongly at the beginning than at the end of the course. There were significant gender differences in attitudes toward dissection. The findings are discussed in relation to the possibility of preparing students for the dissecting room experience and also in relation to the students' understanding of mortality issues. Copyright © 2011 Wiley-Liss, Inc.

Dissecting protein function: an efficient protocol for identifying separation-of-function mutations that encode structurally stable proteins.

PubMed

Lubin, Johnathan W; Rao, Timsi; Mandell, Edward K; Wuttke, Deborah S; Lundblad, Victoria

2013-03-01

Mutations that confer the loss of a single biochemical property (separation-of-function mutations) can often uncover a previously unknown role for a protein in a particular biological process. However, most mutations are identified based on loss-of-function phenotypes, which cannot differentiate between separation-of-function alleles vs. mutations that encode unstable/unfolded proteins. An alternative approach is to use overexpression dominant-negative (ODN) phenotypes to identify mutant proteins that disrupt function in an otherwise wild-type strain when overexpressed. This is based on the assumption that such mutant proteins retain an overall structure that is comparable to that of the wild-type protein and are able to compete with the endogenous protein (Herskowitz 1987). To test this, the in vivo phenotypes of mutations in the Est3 telomerase subunit from Saccharomyces cerevisiae were compared with the in vitro secondary structure of these mutant proteins as analyzed by circular-dichroism spectroscopy, which demonstrates that ODN is a more sensitive assessment of protein stability than the commonly used method of monitoring protein levels from extracts. Reverse mutagenesis of EST3, which targeted different categories of amino acids, also showed that mutating highly conserved charged residues to the oppositely charged amino acid had an increased likelihood of generating a severely defective est3(-) mutation, which nevertheless encoded a structurally stable protein. These results suggest that charge-swap mutagenesis directed at a limited subset of highly conserved charged residues, combined with ODN screening to eliminate partially unfolded proteins, may provide a widely applicable and efficient strategy for generating separation-of-function mutations.

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase

PubMed Central

2013-01-01

Background The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. Results To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Conclusion Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo. PMID:24308601

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

PubMed

Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

2013-12-05

The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

Dissecting and modeling zeaxanthin- and lutein-dependent nonphotochemical quenching in Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leuenberger, Michelle; Morris, Jonathan M.; Chan, Arnold M.

It is known that photosynthetic organisms use various photoprotective mechanisms to dissipate excess photoexcitation as heat in a process called nonphotochemical quenching (NPQ). Regulation of NPQ allows for a rapid response to changes in light intensity and in vascular plants, is primarily triggered by a pH gradient across the thylakoid membrane (ΔpH). The response is mediated by the PsbS protein and various xanthophylls. Time-correlated single-photon counting (TCSPC) measurements were performed on Arabidopsis thaliana to quantify the dependence of the response of NPQ to changes in light intensity on the presence and accumulation of zeaxanthin and lutein. Measurements were performed onmore » WT and mutant plants deficient in one or both of the xanthophylls as well as a transgenic line that accumulates lutein via an engineered lutein epoxide cycle. Changes in the response of NPQ to light acclimation in WT and mutant plants were observed between two successive light acclimation cycles, suggesting that the character of the rapid and reversible response of NPQ in fully dark-acclimated plants is substantially different from in conditions plants are likely to experience caused by changes in light intensity during daylight. Mathematical models of the response of zeaxanthin- and lutein-dependent reversible NPQ were constructed that accurately describe the observed differences between the light acclimation periods. Finally, the WT response of NPQ was reconstructed from isolated components present in mutant plants with a single common scaling factor, which enabled deconvolution of the relative contributions of zeaxanthin- and lutein-dependent NPQ.« less

Dissecting and modeling zeaxanthin- and lutein-dependent nonphotochemical quenching in Arabidopsis thaliana

DOE PAGES

Leuenberger, Michelle; Morris, Jonathan M.; Chan, Arnold M.; ...

2017-06-26

It is known that photosynthetic organisms use various photoprotective mechanisms to dissipate excess photoexcitation as heat in a process called nonphotochemical quenching (NPQ). Regulation of NPQ allows for a rapid response to changes in light intensity and in vascular plants, is primarily triggered by a pH gradient across the thylakoid membrane (ΔpH). The response is mediated by the PsbS protein and various xanthophylls. Time-correlated single-photon counting (TCSPC) measurements were performed on Arabidopsis thaliana to quantify the dependence of the response of NPQ to changes in light intensity on the presence and accumulation of zeaxanthin and lutein. Measurements were performed onmore » WT and mutant plants deficient in one or both of the xanthophylls as well as a transgenic line that accumulates lutein via an engineered lutein epoxide cycle. Changes in the response of NPQ to light acclimation in WT and mutant plants were observed between two successive light acclimation cycles, suggesting that the character of the rapid and reversible response of NPQ in fully dark-acclimated plants is substantially different from in conditions plants are likely to experience caused by changes in light intensity during daylight. Mathematical models of the response of zeaxanthin- and lutein-dependent reversible NPQ were constructed that accurately describe the observed differences between the light acclimation periods. Finally, the WT response of NPQ was reconstructed from isolated components present in mutant plants with a single common scaling factor, which enabled deconvolution of the relative contributions of zeaxanthin- and lutein-dependent NPQ.« less

[Technical points of laparoscopic splenic hilar lymph node dissection--The original intention of CLASS-04 research design].

PubMed

Huang, Changming; Lin, Mi

2018-02-25

According to Japanese gastric cancer treatment guidelines, the standard operation for locally advanced upper third gastric cancer is the total gastrectomy with D2 lymphadenectomy, which includes the dissection of the splenic hilar lymph nodes. With the development of minimally invasive ideas and surgical techniques, laparoscopic spleen-preserving splenic hilar lymph node dissection is gradually accepted. It needs high technical requirements and should be carried out by surgeons with rich experience of open operation and skilled laparoscopic techniques. Based on being familiar with the anatomy of splenic hilum, we should choose a reasonable surgical approach and standardized operating procedure. A favorable left-sided approach is used to perform the laparoscopic spleen-preserving splenic hilar lymph node dissection in Department of Gastric Surgery, Fujian Medical University Union Hospital. This means that the membrane of the pancreas is separated at the superior border of the pancreatic tail in order to reach the posterior pancreatic space, revealing the end of the splenic vessels' trunk. The short gastric vessels are severed at their roots. This enables complete removal of the splenic hilar lymph nodes and stomach. At the same time, based on the rich clinical practice of laparoscopic gastric cancer surgery, we have summarized an effective operating procedure called Huang's three-step maneuver. The first step is the dissection of the lymph nodes in the inferior pole region of the spleen. The second step is the dissection of the lymph nodes in the trunk of splenic artery region. The third step is the dissection of the lymph nodes in the superior pole region of the spleen. It simplifies the procedure, reduces the difficulty of the operation, improves the efficiency of the operation, and ensures the safety of the operation. To further explore the safety of laparoscopic spleen-preserving splenic hilar lymph node dissection for locally advanced upper third gastric cancer, in 2016, we launched a multicenter phase II( trial of safety and feasibility of laparoscopic spleen-preserving No.10 lymph node dissection for locally advanced upper third gastric cancer (CLASS-04). Through the multicenter prospective study, we try to provide scientific theoretical basis and clinical experience for the promotion and application of the operation, and also to standardize and popularize the laparoscopic spleen-preserving splenic hilar lymph node dissection to promote its development. At present, the enrollment of the study has been completed, and the preliminary results also suggested that laparoscopic spleen-preserving No.10 lymph node dissection for locally advanced upper third gastric cancer was safe and feasible. We believe that with the improvement of standardized operation training system, the progress of laparoscopic technology and the promotion of Huang's three-step maneuver, laparoscopic spleen-preserving splenic hilar lymph node dissection will also become one of the standard treatments for locally advanced upper third gastric cancer.

Digital dissection system for medical school anatomy training

NASA Astrophysics Data System (ADS)

Augustine, Kurt E.; Pawlina, Wojciech; Carmichael, Stephen W.; Korinek, Mark J.; Schroeder, Kathryn K.; Segovis, Colin M.; Robb, Richard A.

2003-05-01

As technology advances, new and innovative ways of viewing and visualizing the human body are developed. Medicine has benefited greatly from imaging modalities that provide ways for us to visualize anatomy that cannot be seen without invasive procedures. As long as medical procedures include invasive operations, students of anatomy will benefit from the cadaveric dissection experience. Teaching proper technique for dissection of human cadavers is a challenging task for anatomy educators. Traditional methods, which have not changed significantly for centuries, include the use of textbooks and pictures to show students what a particular dissection specimen should look like. The ability to properly carry out such highly visual and interactive procedures is significantly constrained by these methods. The student receives a single view and has no idea how the procedure was carried out. The Department of Anatomy at Mayo Medical School recently built a new, state-of-the-art teaching laboratory, including data ports and power sources above each dissection table. This feature allows students to access the Mayo intranet from a computer mounted on each table. The vision of the Department of Anatomy is to replace all paper-based resources in the laboratory (dissection manuals, anatomic atlases, etc.) with a more dynamic medium that will direct students in dissection and in learning human anatomy. Part of that vision includes the use of interactive 3-D visualization technology. The Biomedical Imaging Resource (BIR) at Mayo Clinic has developed, in collaboration with the Department of Anatomy, a system for the control and capture of high resolution digital photographic sequences which can be used to create 3-D interactive visualizations of specimen dissections. The primary components of the system include a Kodak DC290 digital camera, a motorized controller rig from Kaidan, a PC, and custom software to synchronize and control the components. For each dissection procedure, the images are captured automatically, and then processed to generate a Quicktime VR sequence, which permits users to view an object from multiple angles by rotating it on the screen. This provides 3-D visualizations of anatomy for students without the need for special '3-D glasses' that would be impractical to use in a laboratory setting. In addition, a digital video camera may be mounted on the rig for capturing video recordings of selected dissection procedures being carried out by expert anatomists for playback by the students. Anatomists from the Department of Anatomy at Mayo have captured several sets of dissection sequences and processed them into Quicktime VR sequences. The students are able to look at these specimens from multiple angles using this VR technology. In addition, the student may zoom in to obtain high-resolution close-up views of the specimen. They may interactively view the specimen at varying stages of dissection, providing a way to quickly and intuitively navigate through the layers of tissue. Electronic media has begun to impact all areas of education, but a 3-D interactive visualization of specimen dissections in the laboratory environment is a unique and powerful means of teaching anatomy. When fully implemented, anatomy education will be enhanced significantly by comparison to traditional methods.

Prevalence, incidence, and risk factors for shoulder and neck dysfunction after neck dissection: A systematic review.

PubMed

Gane, E M; Michaleff, Z A; Cottrell, M A; McPhail, S M; Hatton, A L; Panizza, B J; O'Leary, S P

2017-07-01

Shoulder pain and dysfunction may occur following neck dissection among people being treated for head and neck cancer. This systematic review aims to examine the prevalence and incidence of shoulder and neck dysfunction after neck dissection and identify risk factors for these post-operative complications. Electronic databases (Pubmed, CINAHL, EMBASE, Cochrane) were searched for articles including adults undergoing neck dissection for head and neck cancer. Studies that reported prevalence, incidence or risk factors for an outcome of the shoulder or neck were eligible and assessed using the Critical Review Form - Quantitative Studies. Seventy-five articles were included in the final review. Prevalence rates for shoulder pain were slightly higher after RND (range, 10-100%) compared with MRND (range, 0-100%) and SND (range, 9-25%). The incidence of reduced shoulder active range of motion depended on surgery type (range, 5-20%). The prevalence of reduced neck active range of motion after neck dissection was 1-13%. Type of neck dissection was a risk factor for shoulder pain, reduced function and health-related quality of life. The prevalence and incidence of shoulder and neck dysfunction after neck dissection varies by type of surgery performed and measure of dysfunction used. Pre-operative education for patients undergoing neck dissection should acknowledge the potential for post-operative shoulder and neck problems to occur and inform patients that accessory nerve preservation lowers, but does not eliminate, the risk of developing musculoskeletal complications. Copyright © 2016 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

In vivo study of partial liver resection on pigs using a 1.9 μm thulium fiber laser

NASA Astrophysics Data System (ADS)

Theisen-Kunde, D.; Wolken, H.; Danicke, V.; Brinkmann, R.; Bruch, H.; Kleemann, M.

2011-07-01

Dissection of liver tissue can be performed by different techniques (ultrasound, mono and bipolar dissection, water jet dissection and by stapler). In this animal study the potential of a Thulium fiber laser system was investigated for open parenchyma dissection. Based on a cw Thulium fiber laser (IPG laser GmbH, Burbach, Germany), emitting a wavelength at 1.9 μm and a maximal power at 50 W, a surgical dissection device was developed at the Medical Laser Centre Luebeck. Cw laser radiation (40 Watt) was transmitted via a 365 μm fiber with a polished distal fiber tip. Procedure was performed in contact mode; irradiance at the distal fiber tip was 38.2 kW/cm2. After general anesthesia and a median laparotomy an atypical laser resection of the liver was performed in 3 pigs. Healing process was controlled after 2-3 weeks by histological analysis (H&E staining). The final evaluation data included total resection time, blood loss, bile leakage and mass of dissected tissue. All animals treated in this study were cared for in accordance to the European convention on animal care. In general the dissection with the 1.9 μm laser radiation was easily performed. Hemostasis was highly sufficient so blood loss and bile leakage was negligible. Total resection time including hemostasis of the remaining tissue was 26 +/- 12 min. Weight of resected tissue was 17 +/- 8 g. During survival period no complications (bleeding or inflammation) occurred. After 2 weeks histology showed ongoing scar formation about 1 - 2 mm in depth of the dissected area.

Medical Students' Attitudes toward the Anatomy Dissection Room in Relation to Personality

ERIC Educational Resources Information Center

Plaisant, Odile; Courtois, Robert; Toussaint, Paule Joanne; Mendelsohn, Gerald A.; John, Oliver P.; Delmas, Vincent; Moxham, Bernard J.

2011-01-01

Assessment of the personalities of medical students could enable medical educators to formulate strategies for the best development of academic and clinical competencies. In this article, we focus on the experience of students in the anatomy dissecting room. While there have been many attempts to evaluate the emotional responses of medical…

Nested association mapping for dissecting complex traits using Peanut 58K SNP array

USDA-ARS?s Scientific Manuscript database

Genome-wide association studies (GWAS) and linkage mapping have been the two most predominant strategies to dissect complex traits, but are limited by the occurrence of false positives reported for GWAS, and low resolution in the case of linkage analysis. This has led to the development of a joint a...

Genetic dissection of the role of cannabinoid type-1 receptors in the emotional consequences of repeated social stress in mice.

PubMed

Dubreucq, Sarah; Matias, Isabelle; Cardinal, Pierre; Häring, Martin; Lutz, Beat; Marsicano, Giovanni; Chaouloff, Francis

2012-07-01

The endocannabinoid system (ECS) tightly controls emotional responses to acute aversive stimuli. Repeated stress alters ECS activity but the role played by the ECS in the emotional consequences of repeated stress has not been investigated in detail. This study used social defeat stress, together with pharmacology and genetics to examine the role of cannabinoid type-1 (CB(1)) receptors on repeated stress-induced emotional alterations. Seven daily social defeat sessions increased water (but not food) intake, sucrose preference, anxiety, cued fear expression, and adrenal weight in C57BL/6N mice. The first and the last social stress sessions triggered immediate brain region-dependent changes in the concentrations of the principal endocannabinoids anandamide and 2-arachidonoylglycerol. Pretreatment before each of the seven stress sessions with the CB(1) receptor antagonist rimonabant prolonged freezing responses of stressed mice during cued fear recall tests. Repeated social stress abolished the increased fear expression displayed by constitutive CB(1) receptor-deficient mice. The use of mutant mice lacking CB(1) receptors from cortical glutamatergic neurons or from GABAergic neurons indicated that it is the absence of the former CB(1) receptor population that is responsible for the fear responses in socially stressed CB(1) mutant mice. In addition, stress-induced hypolocomotor reactivity was amplified by the absence of CB(1) receptors from GABAergic neurons. Mutant mice lacking CB(1) receptors from serotonergic neurons displayed a higher anxiety but decreased cued fear expression than their wild-type controls. These mutant mice failed to show social stress-elicited increased sucrose preference. This study shows that (i) release of endocannabinoids during stress exposure impedes stress-elicited amplification of cued fear behavior, (ii) social stress opposes the increased fear expression and delayed between-session extinction because of the absence of CB(1) receptors from cortical glutamatergic neurons, and (iii) CB(1) receptors on central serotonergic neurons are involved in the sweet consumption response to repeated stress.

Distinct roles of immunoreceptor tyrosine-based motifs in immunosuppressive indoleamine 2,3-dioxygenase 1.

PubMed

Albini, Elisa; Rosini, Verdiana; Gargaro, Marco; Mondanelli, Giada; Belladonna, Maria L; Pallotta, Maria Teresa; Volpi, Claudia; Fallarino, Francesca; Macchiarulo, Antonio; Antognelli, Cinzia; Bianchi, Roberta; Vacca, Carmine; Puccetti, Paolo; Grohmann, Ursula; Orabona, Ciriana

2017-01-01

The enzyme indoleamine 2,3-dioxygenase 1 (IDO1) catalyses the initial, rate-limiting step in tryptophan (Trp) degradation, resulting in tryptophan starvation and the production of immunoregulatory kynurenines. IDO1's catalytic function has long been considered as the one mechanism responsible for IDO1-dependent immune suppression by dendritic cells (DCs), which are master regulators of the balance between immunity and tolerance. However, IDO1 also harbours immunoreceptor tyrosine-based inhibitory motifs, (ITIM1 and ITIM2), that, once phosphorylated, bind protein tyrosine phosphatases, (SHP-1 and SHP-2), and thus trigger an immunoregulatory signalling in DCs. This mechanism leads to sustained IDO1 expression, in a feedforward loop, which is particularly important in restraining autoimmunity and chronic inflammation. Yet, under specific conditions requiring that early and protective inflammation be unrelieved, tyrosine-phosphorylated ITIMs will instead bind the suppressor of cytokine signalling 3 (SOCS3), which drives IDO1 proteasomal degradation and shortens the enzyme half-life. To dissect any differential roles of the two IDO1's ITIMs, we generated protein mutants by replacing one or both ITIM-associated tyrosines with phospho-mimicking glutamic acid residues. Although all mutants lost their enzymic activity, the ITIM1 - but not ITIM2 mutant - did bind SHPs and conferred immunosuppressive effects on DCs, making cells capable of restraining an antigen-specific response in vivo. Conversely, the ITIM2 mutant would preferentially bind SOCS3, and IDO1's degradation was accelerated. Thus, it is the selective phosphorylation of either ITIM that controls the duration of IDO1 expression and function, in that it dictates whether enhanced tolerogenic signalling or shutdown of IDO1-dependent events will occur in a local microenvironment. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Mechanistic Insight into the Host Transcription Inhibition Function of Rift Valley Fever Virus NSs and Its Importance in Virulence

PubMed Central

Terasaki, Kaori; Ramirez, Sydney I.; Makino, Shinji

2016-01-01

Rift Valley fever virus (RVFV), a member of the genus Phlebovirus within the family Bunyaviridae, causes periodic outbreaks in livestocks and humans in countries of the African continent and Middle East. RVFV NSs protein, a nonstructural protein, is a major virulence factor that exhibits several important biological properties. These include suppression of general transcription, inhibition of IFN-β promoter induction and degradation of double-stranded RNA-dependent protein kinase R. Although each of these biological functions of NSs are considered important for countering the antiviral response in the host, the individual contributions of these functions towards RVFV virulence remains unclear. To examine this, we generated two RVFV MP-12 strain-derived mutant viruses. Each carried mutations in NSs that specifically targeted its general transcription inhibition function without affecting its ability to degrade PKR and inhibit IFN-β promoter induction, through its interaction with Sin3-associated protein 30, a part of the repressor complex at the IFN-β promoter. Using these mutant viruses, we have dissected the transcription inhibition function of NSs and examined its importance in RVFV virulence. Both NSs mutant viruses exhibited a differentially impaired ability to inhibit host transcription when compared with MP-12. It has been reported that NSs suppresses general transcription by interfering with the formation of the transcription factor IIH complex, through the degradation of the p62 subunit and sequestration of the p44 subunit. Our study results lead us to suggest that the ability of NSs to induce p62 degradation is the major contributor to its general transcription inhibition property, whereas its interaction with p44 may not play a significant role in this function. Importantly, RVFV MP-12-NSs mutant viruses with an impaired general transcription inhibition function showed a reduced cytotoxicity in cell culture and attenuated virulence in young mice, compared with its parental virus MP-12, highlighting the contribution of NSs-mediated general transcription inhibition towards RVFV virulence. PMID:27711108

Mechanistic Insight into the Host Transcription Inhibition Function of Rift Valley Fever Virus NSs and Its Importance in Virulence.

PubMed

Terasaki, Kaori; Ramirez, Sydney I; Makino, Shinji

2016-10-01

Rift Valley fever virus (RVFV), a member of the genus Phlebovirus within the family Bunyaviridae, causes periodic outbreaks in livestocks and humans in countries of the African continent and Middle East. RVFV NSs protein, a nonstructural protein, is a major virulence factor that exhibits several important biological properties. These include suppression of general transcription, inhibition of IFN-β promoter induction and degradation of double-stranded RNA-dependent protein kinase R. Although each of these biological functions of NSs are considered important for countering the antiviral response in the host, the individual contributions of these functions towards RVFV virulence remains unclear. To examine this, we generated two RVFV MP-12 strain-derived mutant viruses. Each carried mutations in NSs that specifically targeted its general transcription inhibition function without affecting its ability to degrade PKR and inhibit IFN-β promoter induction, through its interaction with Sin3-associated protein 30, a part of the repressor complex at the IFN-β promoter. Using these mutant viruses, we have dissected the transcription inhibition function of NSs and examined its importance in RVFV virulence. Both NSs mutant viruses exhibited a differentially impaired ability to inhibit host transcription when compared with MP-12. It has been reported that NSs suppresses general transcription by interfering with the formation of the transcription factor IIH complex, through the degradation of the p62 subunit and sequestration of the p44 subunit. Our study results lead us to suggest that the ability of NSs to induce p62 degradation is the major contributor to its general transcription inhibition property, whereas its interaction with p44 may not play a significant role in this function. Importantly, RVFV MP-12-NSs mutant viruses with an impaired general transcription inhibition function showed a reduced cytotoxicity in cell culture and attenuated virulence in young mice, compared with its parental virus MP-12, highlighting the contribution of NSs-mediated general transcription inhibition towards RVFV virulence.

Reduced Immunogenicity of Arabidopsis hgl1 Mutant N-Glycans Caused by Altered Accessibility of Xylose and core Fucose Epitopes*

PubMed Central

Kaulfürst-Soboll, Heidi; Rips, Stephan; Koiwa, Hisashi; Kajiura, Hiroyuki; Fujiyama, Kazuhito; von Schaewen, Antje

2011-01-01

Arabidopsis N-glycosylation mutants with enhanced salt sensitivity show reduced immunoreactivity of complex N-glycans. Among them, hybrid glycosylation 1 (hgl1) alleles lacking Golgi α-mannosidase II are unique, because their glycoprotein N-glycans are hardly labeled by anti-complex glycan antibodies, even though they carry β1,2-xylose and α1,3-fucose epitopes. To dissect the contribution of xylose and core fucose residues to plant stress responses and immunogenic potential, we prepared Arabidopsis hgl1 xylT double and hgl1 fucTa fucTb triple mutants by crossing previously established T-DNA insertion lines and verified them by mass spectrometry analyses. Root growth assays revealed that hgl1 fucTa fucTb but not hgl1 xylT plants are more salt-sensitive than hgl1, hinting at the importance of core fucose modification and masking of xylose residues. Detailed immunoblot analyses with anti-β1,2-xylose and anti-α1,3-fucose rabbit immunoglobulin G antibodies as well as cross-reactive carbohydrate determinant-specific human immunoglobulin E antibodies (present in sera of allergy patients) showed that xylose-specific reactivity of hgl1 N-glycans is indeed reduced. Based on three-dimensional modeling of plant N-glycans, we propose that xylose residues are tilted by 30° because of untrimmed mannoses in hgl1 mutants. Glycosidase treatments of protein extracts restored immunoreactivity of hgl1 N-glycans supporting these models. Furthermore, among allergy patient sera, untrimmed mannoses persisting on the α1,6-arm of hgl1 N-glycans were inhibitory to immunoreaction with core fucoses to various degrees. In summary, incompletely trimmed glycoprotein N-glycans conformationally prevent xylose and, to lesser extent, core fucose accessibility. Thus, in addition to N-acetylglucosaminyltransferase I, Golgi α-mannosidase II emerges as a so far unrecognized target for lowering the immunogenic potential of plant-derived glycoproteins. PMID:21478158

Reaction mechanism of recombinant 3-oxoacyl-(acyl-carrier-protein) synthase III from Cuphea wrightii embryo, a fatty acid synthase type II condensing enzyme.

PubMed

Abbadi, A; Brummel, M; Schütt, B S; Slabaugh, M B; Schuch, R; Spener, F

2000-01-01

A unique feature of fatty acid synthase (FAS) type II of higher plants and bacteria is 3-oxoacyl-[acyl-carrier-protein (ACP)] synthase III (KAS III), which catalyses the committing condensing reaction. Working with KAS IIIs from Cuphea seeds we obtained kinetic evidence that KAS III catalysis follows a Ping-Pong mechanism and that these enzymes have substrate-binding sites for acetyl-CoA and malonyl-ACP. It was the aim of the present study to identify these binding sites and to elucidate the catalytic mechanism of recombinant Cuphea wrightii KAS III, which we expressed in Escherichia coli. We engineered mutants, which allowed us to dissect the condensing reaction into three stages, i.e. formation of acyl-enzyme, decarboxylation of malonyl-ACP, and final Claisen condensation. Incubation of recombinant enzyme with [1-(14)C]acetyl-CoA-labelled Cys(111), and the replacement of this residue by Ala and Ser resulted in loss of overall condensing activity. The Cys(111)Ser mutant, however, still was able to bind acetyl-CoA and to catalyse subsequent binding and decarboxylation of malonyl-ACP to acetyl-ACP. We replaced His(261) with Ala and Arg and found that the former lost activity, whereas the latter retained overall condensing activity, which indicated a general-base action of His(261). Double mutants Cys(111)Ser/His(261)Ala and Cys(111)Ser/His(261)Arg were not able to catalyse overall condensation, but the double mutant containing Arg induced decarboxylation of [2-(14)C]malonyl-ACP, a reaction indicating the role of His(261) in general-acid catalysis. Finally, alanine scanning revealed the involvement of Arg(150) and Arg(306) in KAS III catalysis. The results offer for the first time a detailed mechanism for a condensing reaction catalysed by a FAS type II condensing enzyme.

Reaction mechanism of recombinant 3-oxoacyl-(acyl-carrier-protein) synthase III from Cuphea wrightii embryo, a fatty acid synthase type II condensing enzyme.

PubMed Central

Abbadi, A; Brummel, M; Schütt, B S; Slabaugh, M B; Schuch, R; Spener, F

2000-01-01

A unique feature of fatty acid synthase (FAS) type II of higher plants and bacteria is 3-oxoacyl-[acyl-carrier-protein (ACP)] synthase III (KAS III), which catalyses the committing condensing reaction. Working with KAS IIIs from Cuphea seeds we obtained kinetic evidence that KAS III catalysis follows a Ping-Pong mechanism and that these enzymes have substrate-binding sites for acetyl-CoA and malonyl-ACP. It was the aim of the present study to identify these binding sites and to elucidate the catalytic mechanism of recombinant Cuphea wrightii KAS III, which we expressed in Escherichia coli. We engineered mutants, which allowed us to dissect the condensing reaction into three stages, i.e. formation of acyl-enzyme, decarboxylation of malonyl-ACP, and final Claisen condensation. Incubation of recombinant enzyme with [1-(14)C]acetyl-CoA-labelled Cys(111), and the replacement of this residue by Ala and Ser resulted in loss of overall condensing activity. The Cys(111)Ser mutant, however, still was able to bind acetyl-CoA and to catalyse subsequent binding and decarboxylation of malonyl-ACP to acetyl-ACP. We replaced His(261) with Ala and Arg and found that the former lost activity, whereas the latter retained overall condensing activity, which indicated a general-base action of His(261). Double mutants Cys(111)Ser/His(261)Ala and Cys(111)Ser/His(261)Arg were not able to catalyse overall condensation, but the double mutant containing Arg induced decarboxylation of [2-(14)C]malonyl-ACP, a reaction indicating the role of His(261) in general-acid catalysis. Finally, alanine scanning revealed the involvement of Arg(150) and Arg(306) in KAS III catalysis. The results offer for the first time a detailed mechanism for a condensing reaction catalysed by a FAS type II condensing enzyme. PMID:10600651

Genetic Dissection of the Role of Cannabinoid Type-1 Receptors in the Emotional Consequences of Repeated Social Stress in Mice

PubMed Central

Dubreucq, Sarah; Matias, Isabelle; Cardinal, Pierre; Häring, Martin; Lutz, Beat; Marsicano, Giovanni; Chaouloff, Francis

2012-01-01

The endocannabinoid system (ECS) tightly controls emotional responses to acute aversive stimuli. Repeated stress alters ECS activity but the role played by the ECS in the emotional consequences of repeated stress has not been investigated in detail. This study used social defeat stress, together with pharmacology and genetics to examine the role of cannabinoid type-1 (CB1) receptors on repeated stress-induced emotional alterations. Seven daily social defeat sessions increased water (but not food) intake, sucrose preference, anxiety, cued fear expression, and adrenal weight in C57BL/6N mice. The first and the last social stress sessions triggered immediate brain region-dependent changes in the concentrations of the principal endocannabinoids anandamide and 2-arachidonoylglycerol. Pretreatment before each of the seven stress sessions with the CB1 receptor antagonist rimonabant prolonged freezing responses of stressed mice during cued fear recall tests. Repeated social stress abolished the increased fear expression displayed by constitutive CB1 receptor-deficient mice. The use of mutant mice lacking CB1 receptors from cortical glutamatergic neurons or from GABAergic neurons indicated that it is the absence of the former CB1 receptor population that is responsible for the fear responses in socially stressed CB1 mutant mice. In addition, stress-induced hypolocomotor reactivity was amplified by the absence of CB1 receptors from GABAergic neurons. Mutant mice lacking CB1 receptors from serotonergic neurons displayed a higher anxiety but decreased cued fear expression than their wild-type controls. These mutant mice failed to show social stress-elicited increased sucrose preference. This study shows that (i) release of endocannabinoids during stress exposure impedes stress-elicited amplification of cued fear behavior, (ii) social stress opposes the increased fear expression and delayed between-session extinction because of the absence of CB1 receptors from cortical glutamatergic neurons, and (iii) CB1 receptors on central serotonergic neurons are involved in the sweet consumption response to repeated stress. PMID:22434220

Polyamines and Flower Development in the Male Sterile Stamenless-2 Mutant of Tomato (Lycopersicon esculentum Mill.) 1

PubMed Central

Rastogi, Rajeev; Sawhney, Vipen K.

1990-01-01

The floral organs of the male sterile stamenless-2 (sl-2/sl-2) mutant of tomato (Lycopersicon esculentum Mill.) contain significantly higher level of polyamines than those of the normal (R Rastogi, VK Sawhney [1990] Plant Physiol 93: 439-445). The effects of putrescine, spermidine and spermine, and three different inhibitors of polyamine biosynthesis on the in vitro development of floral buds of the normal and sl-2/sl-2 mutant were studied. The polyamines were inhibitory to the in vitro growth and development of both the normal and mutant floral buds and they induced abnormal stamen development in normal flowers. The inhibitors of polyamine biosynthesis also inhibited the growth and development of floral organs of the two genotypes, but the normal flowers showed greater sensitivity than the mutant. The inhibitors also promoted the formation of normal-looking pollen in stamens of some mutant flowers. The effect of the inhibitors on polyamine levels was not determined. The polyamine-induced abnormal stamen development in the normal, and the inhibitor-induced production of normal-looking pollen in mutant flowers support the suggestion that the elevated polyamine levels contribute to abnormal stamen development in the sl-2/sl-2 mutant of tomato. Images Figure 3 Figure 5 PMID:16667486

[The interactive neuroanatomical simulation and practical application of frontotemporal transsylvian exposure in neurosurgery].

PubMed

Balogh, Attila; Czigléczki, Gábor; Papal, Zsolt; Preul, Mark C; Banczerowski, Péter

2014-11-30

There is an increased need for new digital education tools in neurosurgical training. Illustrated textbooks offer anatomic and technical reference but do not substitute hands-on experience provided by surgery or cadaver dissection. Due to limited availability of cadaver dissections the need for development of simulation tools has been augmented. We explored simulation technology for producing virtual reality-like reconstructions of simulated surgical approaches on cadaver. Practical application of the simulation tool has been presented through frontotemporal transsylvian exposure. The dissections were performed on two cadaveric heads. Arteries and veins were prepared and injected with colorful silicon rubber. The heads were rigidly fixed in Mayfield headholder. A robotic microscope with two digital cameras in inverted cone method of image acquisition was used to capture images around a pivot point in several phases of dissections. Multilayered, high-resolution images have been built into interactive 4D environment by custom developed software. We have developed the simulation module of the frontotemporal transsylvian approach. The virtual specimens can be rotated or tilted to any selected angles and examined from different surgical perspectives at any stage of dissections. Important surgical issues such as appropriate head positioning or surgical maneuvers to expose deep situated neuroanatomic structures can be simulated and studied by using the module. The simulation module of the frontotemporal transsylvian exposure helps to examine effect of head positioning on the visibility of deep situated neuroanatomic structures and study surgical maneuvers required to achieve optimal exposure of deep situated anatomic structures. The simulation program is a powerful tool to study issues of preoperative planning and well suited for neurosurgical training.

Expression patterns of STM-like KNOX and Histone H4 genes in shoot development of the dissected-leaved basal eudicot plants Chelidonium majus and Eschscholzia californica (Papaveraceae).

PubMed

Groot, Edwin P; Sinha, Neelima; Gleissberg, Stefan

2005-06-01

Knotted-like homeobox (KNOX) genes encode important regulators of shoot development in flowering plants. In Arabidopsis, class I KNOX genes are part of a regulatory system that contributes to indeterminacy of shoot development, delimitation of leaf primordia and internode development. In other species, class I KNOX genes have also been recruited in the control of marginal blastozone fractionation during dissected leaf development. Here we report the isolation of class I KNOX genes from two species of the basal eudicot family Papaveraceae, Chelidonium majus and Eschscholzia californica. Sequence comparisons and expression patterns indicate that these genes are orthologs of SHOOTMERISTEMLESS (STM), a class I KNOX gene from Arabidopsis. Both genes are expressed in the center of vegetative and floral shoot apical meristems (SAM), but downregulated at leaf or floral organ initiating sites. While Eschscholzia californica STM (EcSTM) is again upregulated during acropetal pinna formation, in situ hybridization could not detect Chelidonium majus STM (CmSTM) transcripts at any stage of basipetal leaf development, indicating divergent evolution of STM gene function in leaves within Papaveraceae. Immunolocalization of KNOX proteins indicate that other gene family members may control leaf dissection in both species. The contrasting direction of pinna initiation in the two species was also investigated using Histone H4 expression. Leaves at early stages of development did not reveal notable differences in cell division activity of the elongating leaf axis, suggesting that differential meristematic growth may not play a role in determining the observed dissection patterns.

Registration of two allelic erect leaf mutants of sorghum

USDA-ARS?s Scientific Manuscript database

Two allelic sorghum [Sorghum bicolor (L.) Moench] erect leaf (erl) mutants were isolated from an Annotated Individually-pedigreed Mutagenized Sorghum (AIMS) mutant library developed at the Plant Stress and Germplasm Development Unit, at Lubbock, Texas. The two mutants, erl1-1 and erl1-2, were isol...

Quantitative analysis of bristle number in Drosophila mutants identifies genes involved in neural development

NASA Technical Reports Server (NTRS)

Norga, Koenraad K.; Gurganus, Marjorie C.; Dilda, Christy L.; Yamamoto, Akihiko; Lyman, Richard F.; Patel, Prajal H.; Rubin, Gerald M.; Hoskins, Roger A.; Mackay, Trudy F.; Bellen, Hugo J.

2003-01-01

BACKGROUND: The identification of the function of all genes that contribute to specific biological processes and complex traits is one of the major challenges in the postgenomic era. One approach is to employ forward genetic screens in genetically tractable model organisms. In Drosophila melanogaster, P element-mediated insertional mutagenesis is a versatile tool for the dissection of molecular pathways, and there is an ongoing effort to tag every gene with a P element insertion. However, the vast majority of P element insertion lines are viable and fertile as homozygotes and do not exhibit obvious phenotypic defects, perhaps because of the tendency for P elements to insert 5' of transcription units. Quantitative genetic analysis of subtle effects of P element mutations that have been induced in an isogenic background may be a highly efficient method for functional genome annotation. RESULTS: Here, we have tested the efficacy of this strategy by assessing the extent to which screening for quantitative effects of P elements on sensory bristle number can identify genes affecting neural development. We find that such quantitative screens uncover an unusually large number of genes that are known to function in neural development, as well as genes with yet uncharacterized effects on neural development, and novel loci. CONCLUSIONS: Our findings establish the use of quantitative trait analysis for functional genome annotation through forward genetics. Similar analyses of quantitative effects of P element insertions will facilitate our understanding of the genes affecting many other complex traits in Drosophila.

High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

PubMed

Kassir, Yona

2017-01-01

Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

Medical therapy and intervention do not improve uncomplicated isolated mesenteric artery dissection outcomes over observation alone.

PubMed

Loeffler, Jacob W; Obara, Hideaki; Fujimura, Naoki; Bove, Paul; Newton, Daniel H; Zettervall, Sara L; van Petersen, Andre S; Geelkerken, Robert H; Charlton-Ouw, Kristofer M; Shalhub, Sherene; Singh, Niten; Roussel, Arnaud; Glebova, Natalia O; Harlander-Locke, Michael P; Gasper, Warren J; Humphries, Misty D; Lawrence, Peter F

2017-07-01

Isolated dissection of the mesenteric vessels is rare but increasingly recognized. This study aimed to evaluate patient characteristics, primary treatment, and subsequent outcomes of mesenteric dissection using multi-institutional data. All patients at participant hospitals between January 2003 and December 2015 with dissection of the celiac artery (or its branches) or dissection of the superior mesenteric artery (SMA) were included. Patients with an aortic dissection were excluded. Demographic, treatment, and follow-up data were collected. The primary outcomes included late vessel thrombosis (LVT) and aneurysmal degeneration (AD). Twelve institutions identified 227 patients (220 with complete treatment records) with a mean age of 55 ± 12.5 years. Median time to last follow up was 15 months (interquartile range, 3.8-32). Most patients were men (82% vs 18% women) and symptomatic at presentation (162 vs 65 asymptomatic). Isolated SMA dissection was more common than celiac artery dissection (n = 158 and 81, respectively). Concomitant dissection of both arteries was rare (n = 12). The mean dissection length was significantly longer in symptomatic patients than in asymptomatic patients in both the celiac artery (27 vs 18 mm; P = .01) and the SMA (64 vs 40 mm; P < .001). Primary treatment was medical in 146 patients with oral anticoagulation or antiplatelet therapy (n = 76 and 70, respectively), whereas 56 patients were observed. LVT occurred in six patients, and 16 patients developed AD (3% and 8%, respectively). For symptomatic patients without evidence of ischemia (n = 134), there was no difference in occurrence of LVT with medical therapy compared with observation alone (9% vs 0%; P = .35). No asymptomatic patient (n = 64) had an episode of LVT at 5 years. AD rates did not differ among symptomatic patients without ischemia treated with medical therapy or observed (9% vs 5%; P = .95). Surgical or endovascular intervention was performed in 18 patients (3 ischemia, 13 pain, 1 AD, 1 asymptomatic). Excluding the patients treated for ischemia, there was no difference in LVT with surgical intervention vs medical management (one vs five; P = .57). Asymptomatic patients with isolated mesenteric artery dissection may be observed and followed up with intermittent imaging. Symptomatic patients tend to have longer dissections than asymptomatic patients. Symptomatic isolated mesenteric artery dissection without evidence of ischemia does not require anticoagulation and may be treated with antiplatelet therapy or observation alone. Copyright © 2017 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Genomic and transcriptomic analyses reveal distinct biological functions for cold shock proteins (VpaCspA and VpaCspD) in Vibrio parahaemolyticus CHN25 during low-temperature survival.

PubMed

Zhu, Chunhua; Sun, Boyi; Liu, Taigang; Zheng, Huajun; Gu, Wenyi; He, Wei; Sun, Fengjiao; Wang, Yaping; Yang, Meicheng; Bei, Weicheng; Peng, Xu; She, Qunxin; Xie, Lu; Chen, Lanming

2017-06-05

Vibrio parahaemolyticus causes serious seafood-borne gastroenteritis and death in humans. Raw seafood is often subjected to post-harvest processing and low-temperature storage. To date, very little information is available regarding the biological functions of cold shock proteins (CSPs) in the low-temperature survival of the bacterium. In this study, we determined the complete genome sequence of V. parahaemolyticus CHN25 (serotype: O5:KUT). The two main CSP-encoding genes (VpacspA and VpacspD) were deleted from the bacterial genome, and comparative transcriptomic analysis between the mutant and wild-type strains was performed to dissect the possible molecular mechanisms that underlie low-temperature adaptation by V. parahaemolyticus. The 5,443,401-bp V. parahaemolyticus CHN25 genome (45.2% G + C) consisted of two circular chromosomes and three plasmids with 4,724 predicted protein-encoding genes. One dual-gene and two single-gene deletion mutants were generated for VpacspA and VpacspD by homologous recombination. The growth of the ΔVpacspA mutant was strongly inhibited at 10 °C, whereas the VpacspD gene deletion strongly stimulated bacterial growth at this low temperature compared with the wild-type strain. The complementary phenotypes were observed in the reverse mutants (ΔVpacspA-com, and ΔVpacspD-com). The transcriptome data revealed that 12.4% of the expressed genes in V. parahaemolyticus CHN25 were significantly altered in the ΔVpacspA mutant when it was grown at 10 °C. These included genes that were involved in amino acid degradation, secretion systems, sulphur metabolism and glycerophospholipid metabolism along with ATP-binding cassette transporters. However, a low temperature elicited significant expression changes for 10.0% of the genes in the ΔVpacspD mutant, including those involved in the phosphotransferase system and in the metabolism of nitrogen and amino acids. The major metabolic pathways that were altered by the dual-gene deletion mutant (ΔVpacspAD) radically differed from those that were altered by single-gene mutants. Comparison of the transcriptome profiles further revealed numerous differentially expressed genes that were shared among the three mutants and regulators that were specifically, coordinately or antagonistically modulated by VpaCspA and VpaCspD. Our data also revealed several possible molecular coping strategies for low-temperature adaptation by the bacterium. This study is the first to describe the complete genome sequence of V. parahaemolyticus (serotype: O5:KUT). The gene deletions, complementary insertions, and comparative transcriptomics demonstrate that VpaCspA is a primary CSP in the bacterium, while VpaCspD functions as a growth inhibitor at 10 °C. These results have improved our understanding of the genetic basis for low-temperature survival by the most common seafood-borne pathogen worldwide.

Attenuation of Phosphate Starvation Responses by Phosphite in Arabidopsis1

PubMed Central

Ticconi, Carla A.; Delatorre, Carla A.; Abel, Steffen

2001-01-01

When inorganic phosphate is limiting, Arabidopsis has the facultative ability to metabolize exogenous nucleic acid substrates, which we utilized previously to identify insensitive phosphate starvation response mutants in a conditional genetic screen. In this study, we examined the effect of the phosphate analog, phosphite (Phi), on molecular and morphological responses to phosphate starvation. Phi significantly inhibited plant growth on phosphate-sufficient (2 mm) and nucleic acid-containing (2 mm phosphorus) media at concentrations higher than 2.5 mm. However, with respect to suppressing typical responses to phosphate limitation, Phi effects were very similar to those of phosphate. Phosphate starvation responses, which we examined and found to be almost identically affected by both anions, included changes in: (a) the root-to-shoot ratio; (b) root hair formation; (c) anthocyanin accumulation; (d) the activities of phosphate starvation-inducible nucleolytic enzymes, including ribonuclease, phosphodiesterase, and acid phosphatase; and (e) steady-state mRNA levels of phosphate starvation-inducible genes. It is important that induction of primary auxin response genes by indole-3-acetic acid in the presence of growth-inhibitory Phi concentrations suggests that Phi selectively inhibits phosphate starvation responses. Thus, the use of Phi may allow further dissection of phosphate signaling by genetic selection for constitutive phosphate starvation response mutants on media containing organophosphates as the only source of phosphorus. PMID:11706178

Molecular Signatures of Membrane Protein Complexes Underlying Muscular Dystrophy*

PubMed Central

Turk, Rolf; Hsiao, Jordy J.; Smits, Melinda M.; Ng, Brandon H.; Pospisil, Tyler C.; Jones, Kayla S.; Campbell, Kevin P.; Wright, Michael E.

2016-01-01

Mutations in genes encoding components of the sarcolemmal dystrophin-glycoprotein complex (DGC) are responsible for a large number of muscular dystrophies. As such, molecular dissection of the DGC is expected to both reveal pathological mechanisms, and provides a biological framework for validating new DGC components. Establishment of the molecular composition of plasma-membrane protein complexes has been hampered by a lack of suitable biochemical approaches. Here we present an analytical workflow based upon the principles of protein correlation profiling that has enabled us to model the molecular composition of the DGC in mouse skeletal muscle. We also report our analysis of protein complexes in mice harboring mutations in DGC components. Bioinformatic analyses suggested that cell-adhesion pathways were under the transcriptional control of NFκB in DGC mutant mice, which is a finding that is supported by previous studies that showed NFκB-regulated pathways underlie the pathophysiology of DGC-related muscular dystrophies. Moreover, the bioinformatic analyses suggested that inflammatory and compensatory mechanisms were activated in skeletal muscle of DGC mutant mice. Additionally, this proteomic study provides a molecular framework to refine our understanding of the DGC, identification of protein biomarkers of neuromuscular disease, and pharmacological interrogation of the DGC in adult skeletal muscle https://www.mda.org/disease/congenital-muscular-dystrophy/research. PMID:27099343

Acetobixan, an Inhibitor of Cellulose Synthesis Identified by Microbial Bioprospecting

PubMed Central

Xia, Ye; Lei, Lei; Brabham, Chad; Stork, Jozsef; Strickland, James; Ladak, Adam; Gu, Ying; Wallace, Ian; DeBolt, Seth

2014-01-01

In plants, cellulose biosynthesis is an essential process for anisotropic growth and therefore is an ideal target for inhibition. Based on the documented utility of small-molecule inhibitors to dissect complex cellular processes we identified a cellulose biosynthesis inhibitor (CBI), named acetobixan, by bio-prospecting among compounds secreted by endophytic microorganisms. Acetobixan was identified using a drug-gene interaction screen to sift through hundreds of endophytic microbial secretions for one that caused synergistic reduction in root expansion of the leaky AtcesA6prc1-1 mutant. We then mined this microbial secretion for compounds that were differentially abundant compared with Bacilli that failed to mimic CBI action to isolate a lead pharmacophore. Analogs of this lead compound were screened for CBI activity, and the most potent analog was named acetobixan. In living Arabidopsis cells visualized by confocal microscopy, acetobixan treatment caused CESA particles localized at the plasma membrane (PM) to rapidly re-localize to cytoplasmic vesicles. Acetobixan inhibited 14C-Glc uptake into crystalline cellulose. Moreover, cortical microtubule dynamics were not disrupted by acetobixan, suggesting specific activity towards cellulose synthesis. Previous CBI resistant mutants such as ixr1-2, ixr2-1 or aegeus were not cross resistant to acetobixan indicating that acetobixan targets a different aspect of cellulose biosynthesis. PMID:24748166

Application of Near Infrared Spectroscopy, Intravascular Ultrasound and the Coronary Calcium Score to Predict Adverse Coronary Events

DTIC Science & Technology

2012-10-01

hospitalization 9. Emergence of rhythm disturbances requiring treatment 10. Development of acute coronary syndrome 11. Cerebrovascular accident Adverse...catheterization. These will include coronary injury including dissection, perforation or occlusion, death, cerebrovascular accident , myocardial... cerebrovascular accident , bleeding, infection, arrhythmia, access site damage, coronary dissection, coronary thrombosis and myocardial infarction, among

Development of next-generation mapping populations: Multi-parent Advanced Generation Inter-Cross (MAGIC) and Marker-Assisted Recurrent Selection (MARS) populations in peanut

USDA-ARS?s Scientific Manuscript database

Generation Inter-Cross (MAGIC) and Marker-Assisted Recurrent Selection (MARS) have been proposed and used in many crops to dissect complex traits or QTL. MAGIC allows for dissecting genomic structure, and for improving breeding populations by integrating multiple alleles from different parents. MAR...

Fatal dissecting aneurysm of the aorta in a diver.

PubMed

James, R; Hayman, J A

1986-07-01

A 20-yr-old trained sports diver developed severe chest pain shortly after decompressing from a 40 m repetitive freshwater sinkhole dive, and died 6 h later. An autopsy examination showed a dissecting aneurysm of the aorta with rupture into the left pleural cavity. The relationship between the fatal event and the diving is discussed.

The Influence of Emotion on Students' Performance in Dissection Exercises

ERIC Educational Resources Information Center

Holstermann, Nina; Grube, Dietmar; Bogeholz, Susanne

2009-01-01

This paper investigates the issue of how emotions such as disgust influence students' self-efficacy belief in terms of mastering a dissection task and also how these affect their interest in the biology of the heart. Following models of intrinsic motivation and the development of motivation, we expected disgust to negatively impact on students'…

Responsible Use of Live Animals and Dissection in the Science Classroom. NSTA Position Statement

ERIC Educational Resources Information Center

National Science Teachers Association (NJ1), 2005

2005-01-01

National Science Teachers Association (NSTA), led by a panel of K-12 science teachers, has developed a new position statement, "Responsible Use of Live Animals and Dissection in the Science Classroom." This statement examines the issues surrounding the integration of animals into the K-12 science curriculum and highlights key…

Ascending aortic curvature as an independent risk factor for type A dissection, and ascending aortic aneurysm formation: a mathematical model.

PubMed

Poullis, Michael P; Warwick, Richard; Oo, Aung; Poole, Robert J

2008-06-01

To develop a mathematical model to demonstrate that ascending aortic curvature is an independent risk factor for type A dissections, in addition to hypertension, bicuspid aortic valve, aneurysm of ascending aorta, and intrinsic aortic tissue abnormalities, like Marfan's syndrome. A steady state one-dimensional flow analysis was performed, utilising Newton's third law of motion. Five different clinical scenarios were evaluated: (1) effect of aortic curvature; (2) effect of beta-blockers, (3) effect of patient size, (4) forces on a Marfan's aorta, and (5) site of entry flap in aortic dissection. Aortic curvature increases the forces exerted on the ascending aorta by a factor of over 10-fold. Aortic curvature can cause patients with a systolic blood pressure of 8 0mmHg to have greater forces exerted on their aorta despite smaller diameters and lower cardiac outputs, than patients with systolic blood pressures of 120 mmHg. In normal diameter aortas, beta-blockers have minimal effect compared with aortic curvature. Aortic curvature may help to explain why normal diameter aortas can dissect, and also that the point of the entry tear may be potentially predictable. Aortic curvature has major effects on the forces exerted on the aorta in patients with Marfan's syndrome. Aortic curvature is relatively more important that aortic diameter, blood pressure, cardiac output, beta-blocker use, and patient size with regard to the force acting on the aortic wall. This may explain why some patients with normal diameter ascending aortas with or without Marfan's syndrome develop type A dissections and aneurysms. Aortic curvature may also help to explain the site of entry tear in acute type A dissection. Further clinical study is needed to validate this study's finding.

Online dissection audio-visual resources for human anatomy: Undergraduate medical students' usage and learning outcomes.

PubMed

Choi-Lundberg, Derek L; Cuellar, William A; Williams, Anne-Marie M

2016-11-01

In an attempt to improve undergraduate medical student preparation for and learning from dissection sessions, dissection audio-visual resources (DAVR) were developed. Data from e-learning management systems indicated DAVR were accessed by 28% ± 10 (mean ± SD for nine DAVR across three years) of students prior to the corresponding dissection sessions, representing at most 58% ± 20 of assigned dissectors. Approximately 50% of students accessed all available DAVR by the end of semester, while 10% accessed none. Ninety percent of survey respondents (response rate 58%) generally agreed that DAVR improved their preparation for and learning from dissection when used. Of several learning resources, only DAVR usage had a significant positive correlation (P = 0.002) with feeling prepared for dissection. Results on cadaveric anatomy practical examination questions in year 2 (Y2) and year 3 (Y3) cohorts were 3.9% (P < 0.001, effect size d = -0.32) and 0.3% lower, respectively, with DAVR available compared to previous years. However, there were positive correlations between students' cadaveric anatomy question scores with the number and total time of DAVR viewed (Y2, r = 0.171, 0.090, P = 0.002, n.s., respectively; and Y3, r = 0.257, 0.253, both P < 0.001). Students accessing all DAVR scored 7.2% and 11.8% higher than those accessing none (Y2, P = 0.015, d = 0.48; and Y3, P = 0.005, d = 0.77, respectively). Further development and promotion of DAVR are needed to improve engagement and learning outcomes of more students. Anat Sci Educ 9: 545-554. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

On the risk of contracting AIDS at the dissection table.

PubMed

Ruggiero, Marco; Galletti, Matteo Prayer; Pacini, Stefania; Punzi, Tiziana; Morucci, Gabriele; Gulisano, Massimo

2009-01-01

Didactic dissection of the human body is still considered the best tool to teach and learn anatomy. Although the risk of being infected with pathogens during dissection has dramatically decreased, fear of infection is still widespread among medical students and health care professionals. The fear of contracting AIDS at the dissection table is of particular relevance because of the emotional implications accompanying the syndrome. In this study we analyze the actual risks of contracting AIDS during dissection in Italy by evaluating health policies and proportions of the epidemic. According to the Italian Ministry of Health, HIV infection and AIDS are not to be considered relevant threats to public health from the epidemiological point of view, and it is estimated that 99.7% of health care workers, who are exposed to HIV, will not be infected. In fact, there is only one well-documented case of an autopsy acquired HIV infection that happened in 1992 the United States. Furthermore, HIV infection is not necessarily associated with AIDS, and most HIV-positive subjects do not develop AIDS, provided that they do not assume toxic drugs or engage in risky behaviours. Conversely, according to the Ministry, AIDS can occur in the absence of signs of HIV infection. Taken together these considerations should help rationalizing the fear of contracting AIDS at the dissection table. The dissection hall can still be a dangerous place and the adoption of safe working practices and awareness of potential risks are mandatory; HIV serophobia, however, is unjustified.

Magnetic anchor guidance for endoscopic submucosal dissection and other endoscopic procedures

PubMed Central

Mortagy, Mohamed; Mehta, Neal; Parsi, Mansour A; Abe, Seiichiro; Stevens, Tyler; Vargo, John J; Saito, Yutaka; Bhatt, Amit

2017-01-01

Endoscopic submucosal dissection (ESD) is a well-established, minimally invasive treatment for superficial neoplasms of the gastrointestinal tract. The universal adoption of ESD has been limited by its slow learning curve, long procedure times, and high risk of complications. One technical challenge is the lack of a second hand that can provide traction, as in conventional surgery. Reliable tissue retraction that exposes the submucosal plane of dissection would allow for safer and more efficient dissection. Magnetic anchor guided endoscopic submucosal dissection (MAG-ESD) has potential benefits compared to other current traction methods. MAG-ESD offers dynamic tissue retraction independent of the endoscope mimicking a surgeon’s “second hand”. Two types of magnets can be used: electromagnets and permanent magnets. In this article we review the MAG-ESD technology, published work and studies of magnets in ESD. We also review the use of magnetic anchor guidance systems in natural orifice transluminal endoscopic surgery and the idea of magnetic non-contact retraction using surface ferromagentization. We discuss the current limitations, the future potential of MAG-ESD and the developments needed for adoption of this technology. PMID:28522906

[Surgical management of pregnancy-associated acute Stanford type A aortic dissection: analysis of 5 cases].

PubMed

Li, Xin; Zhang, Hong-Yu; Han, Feng-Zhen; Yu, Chang-Jiang; Fan, Xiao-Ping; Fan, Rui-Xin; Zhuang, Jian

2017-11-20

To explore the diagnosis and treatment of pregnancy-associated acute Stanford type A aortic dissection to improve the maternal and fetal outcomes. We analyzed the perioperative data of 5 pregnant women with acute Stanford type A aortic dissection treated between June, 2009 and February, 2017. The median age of the women was 30 years (range, 22-34 years) with gestational weeks of 23-38 weeks upon diagnosis. All the 5 patients received surgical interventions. Three patients underwent caesarean delivery and hysterectomy, and the fetuses survived after the surgery; 2 patients chose to continue pregnancy following the surgery, among whom one died due to postoperative complications and the other underwent termination of pregnancy. During follow-up, the surviving patients showed no endoleak in the descending aorta stent and the distal dissection remained stable. The maternal and fetal outcomes of pregnancy-associated acute Stanford type A aortic dissection can be improved by multidisciplinary cooperation and optimization of the surgical approaches according to the time of pregnancy, fetal development and conditions of the aortic lesions.

Evolution of the anatomical theatre in Padova.

PubMed

Macchi, Veronica; Porzionato, Andrea; Stecco, Carla; De Caro, Raffaele

2014-01-01

The anatomical theatre played a pivotal role in the evolution of medical education, allowing students to directly observe and participate in the process of dissection. Due to the increase of training programs in clinical anatomy, the Institute of Human Anatomy at the University of Padova has renovated its dissecting room. The main guidelines in planning a new anatomical theatre included: (1), the placement of the teacher and students on the same level in a horizontal anatomical theatre where it is possible to see (theatre) and to perform (dissecting room); (2), in the past, dissection activities were concentrated at the center of the theatre, while in the new anatomical theatre, such activities have been moved to the periphery through projection on surrounding screens-thus, students occupy the center of the theatre between the demonstration table, where the dissection can be seen in real time, and the wall screens, where particular aspects are magnified; (3), three groups of tables are placed with one in front with two lateral flanking tables in regards to the demonstration table, in a semicircular arrangement, and not attached to the floor, which makes the room multifunctional for surgical education, medical students and physician's continued professional development courses; (4), a learning station to introduce the students to the subject of the laboratory; (5), cooperation between anatomists and architects in order to combine the practical needs of a dissection laboratory with new technologies; (6), involvement of the students, representing the clients' needs; and (7), creation of a dissecting room of wide measurements with large windows, since a well-illuminated space could reduce the potentially negative psychological impact of the dissection laboratory on student morale. © 2014 American Association of Anatomists.

Pax3 gene expression is not altered during diaphragmatic development in nitrofen-induced congenital diaphragmatic hernia.

PubMed

Gosemann, Jan-Hendrik; Doi, Takashi; Kutasy, Balazs; Friedmacher, Florian; Dingemann, Jens; Puri, Prem

2012-06-01

Malformations of the pleuroperitoneal folds (PPFs) have been identified as the origin of the diaphragmatic defect in congenital diaphragmatic hernia (CDH). Pax3, expressed in muscle precursor cells (MPCs), plays a key role in regulating myogenesis and muscularization in the fetal diaphragm. Pax3 mutant mice display absence of muscular diaphragm. However, the distribution of muscle precursor cells is reported to be normal in the PPF of the nitrofen-CDH model. We designed this study to investigate the hypothesis that Pax3 gene expression is unaltered in the PPF and developing diaphragm in the nitrofen-induced CDH model. Pregnant rats were treated with nitrofen or vehicle on gestational day (D) 9 and sacrificed on D13, D18, and D21. Pleuroperitoneal folds (D13) and developing diaphragms (D18 and D21) were dissected, total RNA was extracted, and real-time quantitative polymerase chain reaction was performed to determine Pax3 messenger RNA levels. Confocal immunofluorescence microscopy was performed to evaluate protein expression/distribution of Pax3. Relative messenger RNA expression levels of Pax3 in PPFs and developing diaphragms were not significantly different in the nitrofen group compared with controls. Intensity of Pax3 immunofluorescence was also not altered in PPFs and developing diaphragms of the nitrofen group compared with controls. Pax3 gene expression is not altered in the PPFs and developing diaphragm of nitrofen-CDH model, suggesting that the diaphragmatic defect is not caused by disturbance of myogenesis and muscularization. Copyright © 2012 Elsevier Inc. All rights reserved.

Supportive techniques and devices for endoscopic submucosal dissection of gastric cancer.

PubMed

Sakurazawa, Nobuyuki; Kato, Shunji; Fujita, Itsuo; Kanazawa, Yoshikazu; Onodera, Hiroyuki; Uchida, Eiji

2012-06-16

The indications for endoscopic treatment have expanded in recent years, and relatively intestinal-type mucosal stomach carcinomas with a low potential for metastasis are now often resected en bloc by endoscopic submucosal dissection (ESD), even if they measure over 20 mm in size. However, ESD requires complex maneuvers, which entails a long operation time, and is often accompanied by complications such as bleeding and perforation. Many technical developments have been implemented to overcome these complications. The scope, cutting device, hemostasis device, and other supportive devices have been improved. However, even with these innovations, ESD remains a potentially complex procedure. One of the major difficulties is poor visualization of the submucosal layer resulting from the poor countertraction afforded during submucosal dissection. Recently, countertraction devices have been developed. In this paper, we introduce countertraction techniques and devices mainly for gastric cancer.

"Detached concern" of medical students in a cadaver dissection course: A phenomenological study.

PubMed

Tseng, Wei-Ting; Lin, Ya-Ping

2016-05-06

The cadaver dissection course remains a time-honored tradition in medical education, partly because of its importance in cultivating professional attitudes in students. This study aims to investigate students' attitudes-specifically characterized as "detached concern"-in a cadaver dissection course. An interpretative phenomenological analysis was performed with semi-structured, focus group interviews among 12 third-year medical students from a Taiwanese medical school to reveal their perceptions and learning experiences regarding human cadaver dissection. Based on these interviews, four relevant categories of perspectives were delineated: (1) initial emotional impact, (2) human referents, (3) coping strategies, and (4) ways of perceiving cadavers. Students were divided into two groups based on these categories. Students in Group 1 developed mechanisms described as "detachment" to cope with their initial emotional reactions to cadaveric dissection, which was noted to have disruptive effects on their learning. They considered human referents to be learning obstacles and avoided contact with or thinking about the human referents while performing dissections. Some of them faced a conflict between perceiving the cadaver as a learning tool versus as a human being. This impasse could be resolved if they latently adopted a "perspective switch" between the concept of a learning tool (rational aspect) and a human being (sensitive aspect). The students in Group 2 had no obvious initial emotional reaction. For them, the human referents functioned as learning supports, and the cadavers were consistently perceived as humans. These students held the notion that "cadaver dissection is an act of love"; therefore, they did not experience any need to detach themselves from their feelings during dissection. This alternative attitude revealed that detached concern alone is not sufficient to describe the entire range of medical students' attitudes toward cadaver dissection. Anat Sci Educ 9: 265-271. © 2015 American Association of Anatomists. © 2015 American Association of Anatomists.

Hairless Streaks in Cattle Implicate TSR2 in Early Hair Follicle Formation

PubMed Central

Murgiano, Leonardo; Shirokova, Vera; Welle, Monika Maria; Jagannathan, Vidhya; Plattet, Philippe; Oevermann, Anna; Pienkowska-Schelling, Aldona; Gallo, Daniele; Gentile, Arcangelo; Mikkola, Marja; Drögemüller, Cord

2015-01-01

Four related cows showed hairless streaks on various parts of the body with no correlation to the pigmentation pattern. The stripes occurred in a consistent pattern resembling the lines of Blaschko. The non-syndromic hairlessness phenotype observed occurred across three generations of a single family and was compatible with an X-linked mode of inheritance. Linkage analysis and subsequent whole genome sequencing of one affected female identified two perfectly associated non-synonymous sequence variants in the critical interval on bovine chromosome X. Both variants occurred in complete linkage disequilibrium and were absent in more than 3900 controls. An ERCC6L missense mutation was predicted to cause an amino acid substitution of a non-conserved residue. Analysis in mice showed no specific Ercc6l expression pattern related to hair follicle development and therefore ERCC6L was not considered as causative gene. A point mutation at the 5'-splice junction of exon 5 of the TSR2, 20S rRNA accumulation, homolog (S. cerevisiae), gene led to the production of two mutant transcripts, both of which contain a frameshift and generate a premature stop codon predicted to truncate approximately 25% of the protein. Interestingly, in addition to the presence of both physiological TSR2 transcripts, the two mutant transcripts were predominantly detected in the hairless skin of the affected cows. Immunohistochemistry, using an antibody against the N-terminal part of the bovine protein demonstrated the specific expression of the TSR2 protein in the skin and the hair of the affected and the control cows as well as in bovine fetal skin and hair. The RNA hybridization in situ showed that Tsr2 was expressed in pre- and post-natal phases of hair follicle development in mice. Mammalian TSR2 proteins are highly conserved and are known to be broadly expressed, but their precise in vivo functions are poorly understood. Thus, by dissecting a naturally occurring mutation in a domestic animal species, we identified TSR2 as a regulator of hair follicle development. PMID:26203908

Transforming Growth Factor Beta (TGFβ1, TGFβ2 and TGFβ3) Null-Mutant Phenotypes in Embryonic Gonadal Development

PubMed Central

Memon, Mushtaq A.; Anway, Matthew D.; Covert, Trevor R.; Uzumcu, Mehmet; Skinner, Michael K.

2008-01-01

The role transforming growth factor beta (TGFb) isoforms TGFb1, TGFb2 and TGFb3 have in the regulation of embryonic gonadal development was investigated with the use of null-mutant (i.e. knockout) mice for each of the TGFb isoforms. Late embryonic gonadal development was investigated because homozygote TGFb null-mutant mice generally die around birth, with some embryonic loss as well. In the testis, the TGFb1 null-mutant mice had a decrease in the number of germ cells at birth, postnatal day 0 (P0). In the testis, the TGFb2 null-mutant mice had a decrease in the number of seminiferous cords at embryonic day 15 (E15). In the ovary, the TGFb2 null-mutant mice had an increase in the number of germ cells at P0. TGFb isoforms appear to have a role in gonadal development, but interactions between the isoforms is speculated to compensate in the different TGFb isoform null-mutant mice. PMID:18790002

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ito, Hisao; Yamada, Takayuki; Ishibashi, Tadashi

A 65-year-old man underwent a thromboexclusionoperation for management of chronic Stanford type B dissecting aneurysmin 1991. However, long-term follow-up CT scans after the operation revealed that the ascending aorta gradually enlarged and was eventually complicated by recurrent aortic dissection. The patient complained of frequent bloody sputum, whereas chest roentogenography showed no pulmonary abnormalities. Subsequent swallow esophagogram demonstrated that the upper esophagus was deviated to the right and the middle esophagus was greatly compressed by the aortic clamp. Esophageal endoscopy showed a bloody inner surface and marked swelling of the middle esophagus. The patient eventually died of massive hematemesis in 2001.more » We describe the imaging features of unanticipated complications such as recurrent dissecting aneurysm or impending esophageal rupture.Furthermore, we discuss the cause of hematemesis and document that the aortic clamp migrated and resulted in development of a recurrent aneurysmal dissection, which in turn resulted in esophageal rupture with aneurysmal disruption.« less

Transoral robotic thyroid surgery

PubMed Central

Clark, James H.; Kim, Hoon Yub

2015-01-01

There is currently significant demand for minimally invasive thyroid surgery; however the majority of proposed surgical approaches necessitate a compromise between minimal tissue dissection with a visible cervical scar or extensive tissue dissection with a remote, hidden scar. The development of transoral endoscopic thyroid surgery however provides an approach which is truly minimally invasive, as it conceals the incision within the oral cavity without significantly increasing the amount of required dissection. The transoral endoscopic approach however presents multiple technical challenges, which could be overcome with the incorporation of a robotic operating system. This manuscript summarizes the literature on the feasibility and current clinical experience with transoral robotic thyroid surgery. PMID:26425456

The implementation of clay modeling and rat dissection into the human anatomy and physiology curriculum of a large urban community college.

PubMed

Haspel, Carol; Motoike, Howard K; Lenchner, Erez

2014-01-01

After a considerable amount of research and experimentation, cat dissection was replaced with rat dissection and clay modeling in the human anatomy and physiology laboratory curricula at La Guardia Community College (LAGCC), a large urban community college of the City University of New York (CUNY). This article describes the challenges faculty overcame and the techniques used to solve them. Methods involved were: developing a laboratory manual in conjunction with the publisher, holding training sessions for faculty and staff, the development of instructional outlines for students and lesson plans for faculty, the installation of storage facilities to hold mannequins instead of cat specimens, and designing mannequin clean-up techniques that could be used by more than one thousand students each semester. The effectiveness of these curricular changes was assessed by examining student muscle practical examination grades and the responses of faculty and students to questionnaires. The results demonstrated that the majority of faculty felt prepared to teach using clay modeling and believed the activity was effective in presenting lesson content. Students undertaking clay modeling had significantly higher muscle practical examination grades than students undertaking cat dissection, and the majority of students believed that clay modeling was an effective technique to learn human skeletal, respiratory, and cardiovascular anatomy, which included the names and locations of blood vessels. Furthermore, the majority of students felt that rat dissection helped them learn nervous, digestive, urinary, and reproductive system anatomy. Faculty experience at LAGCC may serve as a resource to other academic institutions developing new curricula for large, on-going courses. © 2013 American Association of Anatomists.

Biology teachers' dissection practices and the influences that lead to their adoption: An exploratory research

NASA Astrophysics Data System (ADS)

Milano, Regina Nicole

The lack of resolution in the on-going animal dissection debate inspired this mixed methods study to identify Connecticut secondary biology teachers' dissection practices and the influences that lead to their adoption. Qualitative findings indicate past experiences, managing objections to dissection, school culture, goals of biology teaching and ethics as major influences on dissection practices with 58.4% (n=7) of the sample dissecting and 41.6% not dissecting (n=5). Quantitative findings reveal gender, standards and curriculum, advantages of dissection and experiences as a student as major influences on dissection practices with 71.9% (n=92) of the sample dissecting and 28.1% (n=36) not dissecting. The study concludes that dissection policies are necessary and imminent in Connecticut school districts. Furthermore, it advises teacher-initiated, qualitative and quantitative assessments to expose disparities between student dissection perspectives and their own, prior to conducting dissection. Finally, it provides suggestions for addressing potential differences including administrative involvement.

Infected Aneurysm after Endoscopic Submucosal Dissection.

PubMed

Gen, Shiko; Usui, Ryuichi; Sasaki, Takaya; Nobe, Kanako; Takahashi, Aya; Okudaira, Keisuke; Ikeda, Naofumi

2016-01-01

A 79-year-old man on hemodialysis was hospitalized for further investigation. Early gastric cancer was diagnosed by gastrointestinal endoscopy and endoscopic submucosal dissection (ESD) was performed. Fever and abdominal pain thereafter developed, and a severe inflammatory response was observed on a blood test. Contrast computed tomography (CT) showed ulcer-like projections and soft tissue surrounding the aorta, from the celiac to left renal artery. An infected aneurysm was diagnosed. Although infected aneurysms developing after laparoscopic cholecystectomy or biopsy of contiguous esophageal duplication cyst have been reported, those developing after ESD have not. When fever and abdominal pain develop after ESD, an infected aneurysm should be considered and contrast CT performed.

Resection in the popliteal fossa for metastatic melanoma.

PubMed

Marone, Ugo; Caracò, Corrado; Chiofalo, Maria Grazia; Botti, Gerardo; Mozzillo, Nicola

2007-01-19

Traditionally metastatic melanoma of the distal leg and the foot metastasize to the lymph nodes of the groin. Sometimes the first site of nodal disease can be the popliteal fossa. This is an infrequent event, with rare reports in literature and when it occurs, radical popliteal node dissection must be performed. We report a case of a 36-year old man presented with diagnosis of 2 mm thick, Clark's level II-III, non ulcerated melanoma of the left heel, which developed during the course of the disease popliteal node metastases, after a superficial and deep groin dissection for inguinal node involvement. Five months after popliteal lymph node dissection he developed systemic disease, therefore he received nine cycles of dacarbazine plus fotemustine. To date (56 months after prior surgery and 11 months after chemotherapy) he is alive with no evidence of disease. In case of groin metastases from melanoma of distal lower extremities, clinical and ultrasound examination of ipsilateral popliteal fossa is essential. When metastatic disease is found, radical popliteal dissection is the standard of care. Therefore knowledge of anatomy and surgical technique about popliteal lymphadenectomy are required to make preservation of structures that if injured, can produce a permanent, considerable disability.

Resection in the popliteal fossa for metastatic melanoma

PubMed Central

Marone, Ugo; Caracò, Corrado; Chiofalo, Maria Grazia; Botti, Gerardo; Mozzillo, Nicola

2007-01-01

Background Traditionally metastatic melanoma of the distal leg and the foot metastasize to the lymph nodes of the groin. Sometimes the first site of nodal disease can be the popliteal fossa. This is an infrequent event, with rare reports in literature and when it occurs, radical popliteal node dissection must be performed. Case presentation We report a case of a 36-year old man presented with diagnosis of 2 mm thick, Clark's level II-III, non ulcerated melanoma of the left heel, which developed during the course of the disease popliteal node metastases, after a superficial and deep groin dissection for inguinal node involvement. Five months after popliteal lymph node dissection he developed systemic disease, therefore he received nine cycles of dacarbazine plus fotemustine. To date (56 months after prior surgery and 11 months after chemotherapy) he is alive with no evidence of disease. Conclusion In case of groin metastases from melanoma of distal lower extremities, clinical and ultrasound examination of ipsilateral popliteal fossa is essential. When metastatic disease is found, radical popliteal dissection is the standard of care. Therefore knowledge of anatomy and surgical technique about popliteal lymphadenectomy are required to make preservation of structures that if injured, can produce a permanent, considerable disability. PMID:17239242

Pleiotropy and its dissection through a metabolic gene Miniature1 (Mn1) that encodes a cell wall invertase in developing seeds of maize.

PubMed

Chourey, Prem S; Li, Qin-Bao; Cevallos-Cevallos, Juan

2012-03-01

The Mn1-encoded endosperm-specific cell wall invertase is a major determinant of sink strength of developing seeds through its control of both sink size, cell number and cell size, and sink activity via sucrose hydrolysis and release of hexoses essential for energy and signaling functions. Consequently, loss-of-function mutations of the gene lead to the mn1 seed phenotype that shows ∼70% reduction in seed mass at maturity and several pleiotropic changes. A comparative analysis of endosperm and embryo mass in the Mn1 and mn1 genotypes showed here significant reductions of both tissues in the mn1 starting with early stages of development. Clearly, embryo development was endosperm-dependent. To gain a mechanistic understanding of the changes, sugar levels were measured in both endosperm and embryo samples. Changes in the levels of all sugars tested, glc, fru, suc, and sorbitol, were mainly observed in the endosperm. Greatly reduced fru levels in the mutant led to RNA level expression analyses by q-PCR of several genes that encode sucrose and fructose metabolizing enzymes. The mn1 endosperm showed reductions in gene expression, ranging from ∼70% to 99% of the Mn1 samples, for both suc-starch and suc--energy pathways, suggesting an in vivo metabolic coordinated regulation due to the hexose-deficiency. Together, these data provide evidence of the Mn1-dependent interconnected network of several pathways as a possible basis for pleiotropic changes in seed development. Published by Elsevier Ireland Ltd.

Dissection of Ire1 Functions Reveals Stress Response Mechanisms Uniquely Evolved in Candida glabrata

PubMed Central

Miyazaki, Taiga; Nakayama, Hironobu; Nagayoshi, Yohsuke; Kakeya, Hiroshi; Kohno, Shigeru

2013-01-01

Proper protein folding in the endoplasmic reticulum (ER) is vital in all eukaryotes. When misfolded proteins accumulate in the ER lumen, the transmembrane kinase/endoribonuclease Ire1 initiates splicing of HAC1 mRNA to generate the bZIP transcription factor Hac1, which subsequently activates its target genes to increase the protein-folding capacity of the ER. This cellular machinery, called the unfolded protein response (UPR), is believed to be an evolutionarily conserved mechanism in eukaryotes. In this study, we comprehensively characterized mutant phenotypes of IRE1 and other related genes in the human fungal pathogen Candida glabrata. Unexpectedly, Ire1 was required for the ER stress response independently of Hac1 in this fungus. C. glabrata Ire1 did not cleave mRNAs encoding Hac1 and other bZIP transcription factors identified in the C. glabrata genome. Microarray analysis revealed that the transcriptional response to ER stress is not mediated by Ire1, but instead is dependent largely on calcineurin signaling and partially on the Slt2 MAPK pathway. The loss of Ire1 alone did not confer increased antifungal susceptibility in C. glabrata contrary to UPR-defective mutants in other fungi. Taken together, our results suggest that the canonical Ire1-Hac1 UPR is not conserved in C. glabrata. It is known in metazoans that active Ire1 nonspecifically cleaves and degrades a subset of ER-localized mRNAs to reduce the ER load. Intriguingly, this cellular response could occur in an Ire1 nuclease-dependent fashion in C. glabrata. We also uncovered the attenuated virulence of the C. glabrata Δire1 mutant in a mouse model of disseminated candidiasis. This study has unveiled the unique evolution of ER stress response mechanisms in C. glabrata. PMID:23382685

Dissecting the role of histidine kinase and HOG1 mitogen-activated protein kinase signalling in stress tolerance and pathogenicity of Parastagonospora nodorum on wheat

PubMed Central

John, Evan; Lopez-Ruiz, Francisco; Rybak, Kasia; Mousley, Carl J.; Oliver, Richard P.

2016-01-01

The HOG1 mitogen-activated protein kinase (MAPK) pathway is activated through two-component histidine kinase (HK) signalling. This pathway was first characterized in the budding yeast Saccharomyces cerevisiae as a regulator of osmotolerance. The fungus Parastagonospora nodorum is the causal agent of septoria nodorum blotch of wheat. This pathogen uses host-specific effectors in tandem with general pathogenicity mechanisms to carry out its infection process. Genes showing strong sequence homology to S. cerevisiae HOG1 signalling pathway genes have been identified in the genome of P. nodorum. In this study, we examined the role of the pathway in the virulence of P. nodorum on wheat by disrupting putative pathway component genes: HOG1 (SNOG_13296) MAPK and NIK1 (SNOG_11631) hybrid HK. Mutants deleted in NIK1 and HOG1 were insensitive to dicarboximide and phenylpyrrole fungicides, but not a fungicide that targets ergosterol biosynthesis. Furthermore, both Δnik1 and Δhog1 mutants showed increased sensitivity to hyperosmotic stress. However, HOG1, but not NIK1, is required for tolerance to elevated temperatures. HOG1 deletion conferred increased tolerance to 6-methoxy-2-benzoxazolinone, a cereal phytoalexin. This suggests that the HOG1 signalling pathway is not exclusively associated with NIK1. Both Δnik1 and Δhog1 mutants retained the ability to infect and cause necrotic lesions on wheat. However, we observed that the Δhog1 mutation resulted in reduced production of pycnidia, asexual fruiting bodies that facilitate spore dispersal during late infection. Our study demonstrated the overlapping and distinct roles of a HOG1 MAPK and two-component HK signalling in P. nodorum growth and pathogenicity. PMID:26978567

Heterologous Expression of sahH Reveals That Biofilm Formation Is Autoinducer-2-independent in Streptococcus sanguinis but Is Associated with an Intact Activated Methionine Cycle*

PubMed Central

Redanz, Sylvio; Standar, Kerstin; Podbielski, Andreas; Kreikemeyer, Bernd

2012-01-01

Numerous studies have claimed deleterious effects of LuxS mutation on many bacterial phenotypes, including bacterial biofilm formation. Genetic complementation mostly restored the observed mutant phenotypes to WT levels, leading to the postulation that quorum sensing via a family of molecules generically termed autoinducer-2 (AI-2) is essential for many phenotypes. Because LuxS mutation has dual effects, this hypothesis needs to be investigated into the details for each bacterial species. In this study we used S. sanguinis SK36 as a model biofilm bacterium and employed physiological characterization and transcriptome approaches on WT and luxS-deficient strains, in combination with chemical, luxS, and sahH complementation experiments. SahH enables a direct conversion of SAH to homocysteine and thereby restores the activated methionine cycle in a luxS-negative background without formation of the AI-2 precursor 4,5-dihydroxy-2,3-pentanedione. With this strategy we were able to dissect the individual contribution of LuxS and AI-2 activity in detail. Our data revealed that S. sanguinis biofilm formation is independent from AI-2 substance pools and is rather supported by an intact activated methyl cycle. Of 216 differentially transcribed genes in the luxS mutant, 209 were restored by complementation with a gene encoding the S-adenosylhomocysteine hydrolase. Only nine genes, mainly involved in natural competence, were directly affected by the AI-2 quorum-sensing substance pool. Cumulatively, this suggested that biofilm formation in S. sanguinis is not under control of AI-2. Our study suggests that previously evaluated LuxS mutants in other species need to be revisited to resolve the precise contribution of AI-2 substance pools and the methionine pathways. PMID:22942290

A Restrictive Cardiomyopathy Mutation in an Invariant Proline at the Myosin Head/Rod Junction Enhances Head Flexibility and Function, Yielding Muscle Defects in Drosophila

PubMed Central

Achal, Madhulika; Trujillo, Adriana S.; Melkani, Girish C.; Farman, Gerrie P.; Ocorr, Karen; Viswanathan, Meera C.; Kaushik, Gaurav; Newhard, Christopher S.; Glasheen, Bernadette M.; Melkani, Anju; Suggs, Jennifer A.; Moore, Jeffrey R.; Swank, Douglas M.; Bodmer, Rolf; Cammarato, Anthony; Bernstein, Sanford I.

2016-01-01

An “invariant proline” separates the myosin S1 head from its S2 tail and is proposed to be critical for orienting S1 during its interaction with actin, a process that leads to muscle contraction. Mutation of the invariant proline to leucine (P838L) caused dominant restrictive cardiomyopathy in a pediatric patient (Karam et al., Congenit. Heart Dis. 3:138–43, 2008). Here, we use Drosophila melanogaster to model this mutation and dissect its effects on the biochemical and biophysical properties of myosin, as well as on the structure and physiology of skeletal and cardiac muscles. P838L mutant myosin isolated from indirect flight muscles of transgenic Drosophila showed elevated ATPase and actin sliding velocity in vitro. Furthermore, the mutant heads exhibited increased rotational flexibility, and there was an increase in the average angle between the two heads. Indirect flight muscle myofibril assembly was minimally affected in mutant homozygotes, and isolated fibers displayed normal mechanical properties. However, myofibrils degraded during aging, correlating with reduced flight abilities. In contrast, hearts from homozygotes and heterozygotes showed normal morphology, myofibrillar arrays, and contractile parameters. When P838L was placed in trans to Mhc5, an allele known to cause cardiac restriction in flies, it did not yield the constricted phenotype. Overall, our studies suggest that increased rotational flexibility of myosin S1 enhances myosin ATPase and actin sliding. Moreover, instability of P838L myofibrils leads to decreased function during aging of Drosophila skeletal muscle, but not cardiac muscle, despite the strong evolutionary conservation of the P838 residue. PMID:27107639

Ketoacylsynthase Domains of a Polyunsaturated Fatty Acid Synthase in Thraustochytrium sp. Strain ATCC 26185 Can Effectively Function as Stand-Alone Enzymes in Escherichia coli.

PubMed

Xie, Xi; Meesapyodsuk, Dauenpen; Qiu, Xiao

2017-05-01

Thraustochytrium sp. strain ATCC 26185 accumulates a high level of docosahexaenoic acid (DHA), a nutritionally important ω-3 very-long-chain polyunsaturated fatty acid (VLCPUFA) synthesized primarily by polyunsaturated fatty acid (PUFA) synthase, a type I polyketide synthase-like megaenzyme. The PUFA synthase in this species comprises three large subunits, each with multiple catalytic domains. It was hypothesized that among these domains, ketoacylsynthase (KS) domains might be critical for catalyzing the condensation of specific unsaturated acyl-acyl carrier proteins (ACPs) with malonyl-ACP, thereby retaining double bonds in an extended acyl chain. To investigate the functions of these putative KS domains, two segment sequences from subunit A (KS-A) and subunit B (KS-B) of the PUFA synthase were dissected and then expressed as stand-alone enzymes in Escherichia coli The results showed that both KS-A and KS-B domains could complement the defective phenotypes of both E. coli fabB and fabF mutants. Overexpression of these domains in wild-type E. coli led to increases in total fatty acid production. KS-B produced a higher ratio of unsaturated fatty acids (UFAs) to saturated fatty acids (SFAs), while KS-A could improve the overall production of fatty acids more effectively, particularly for the production of SFAs, implying that KS-A is more comparable to FabF, while KS-B is more similar to FabB in catalytic functions. Successful complementation and functional expression of the embedded KS domains in E. coli are the first step forward in studying the molecular mechanism of the PUFA synthase for the biosynthesis of VLCPUFAs in Thraustochytrium IMPORTANCE Very-long-chain polyunsaturated fatty acids (VLCPUFAs) are important for human health. They can be biosynthesized in either an aerobic pathway or an anaerobic pathway in nature. However, abundant VLCPUFAs in marine microorganisms are primarily synthesized by polyunsaturated fatty acid (PUFA) synthase, a megaenzyme with multiple subunits, each with multiple catalytic domains. Furthermore, the fundamental mechanism for this enzyme to synthesize these fatty acids still remains unknown. This report started with dissecting the embedded KS domains of the PUFA synthase from marine protist Thraustochytrium sp. strain ATCC 26185 and then expressing them in wild-type E. coli and mutants defective in condensation of acyl-ACP with malonyl-ACP. Successful complementation of the mutants and improved fatty acid production in the overexpression experiments indicate that these KS domains can effectively function as stand-alone enzymes in E. coli This result has paved the way for further studying of molecular mechanisms of the PUFA synthase for the biosynthesis of VLCPUFAs. Copyright © 2017 American Society for Microbiology.

Ketoacylsynthase Domains of a Polyunsaturated Fatty Acid Synthase in Thraustochytrium sp. Strain ATCC 26185 Can Effectively Function as Stand-Alone Enzymes in Escherichia coli

PubMed Central

Xie, Xi; Meesapyodsuk, Dauenpen

2017-01-01

ABSTRACT Thraustochytrium sp. strain ATCC 26185 accumulates a high level of docosahexaenoic acid (DHA), a nutritionally important ω-3 very-long-chain polyunsaturated fatty acid (VLCPUFA) synthesized primarily by polyunsaturated fatty acid (PUFA) synthase, a type I polyketide synthase-like megaenzyme. The PUFA synthase in this species comprises three large subunits, each with multiple catalytic domains. It was hypothesized that among these domains, ketoacylsynthase (KS) domains might be critical for catalyzing the condensation of specific unsaturated acyl-acyl carrier proteins (ACPs) with malonyl-ACP, thereby retaining double bonds in an extended acyl chain. To investigate the functions of these putative KS domains, two segment sequences from subunit A (KS-A) and subunit B (KS-B) of the PUFA synthase were dissected and then expressed as stand-alone enzymes in Escherichia coli. The results showed that both KS-A and KS-B domains could complement the defective phenotypes of both E. coli fabB and fabF mutants. Overexpression of these domains in wild-type E. coli led to increases in total fatty acid production. KS-B produced a higher ratio of unsaturated fatty acids (UFAs) to saturated fatty acids (SFAs), while KS-A could improve the overall production of fatty acids more effectively, particularly for the production of SFAs, implying that KS-A is more comparable to FabF, while KS-B is more similar to FabB in catalytic functions. Successful complementation and functional expression of the embedded KS domains in E. coli are the first step forward in studying the molecular mechanism of the PUFA synthase for the biosynthesis of VLCPUFAs in Thraustochytrium. IMPORTANCE Very-long-chain polyunsaturated fatty acids (VLCPUFAs) are important for human health. They can be biosynthesized in either an aerobic pathway or an anaerobic pathway in nature. However, abundant VLCPUFAs in marine microorganisms are primarily synthesized by polyunsaturated fatty acid (PUFA) synthase, a megaenzyme with multiple subunits, each with multiple catalytic domains. Furthermore, the fundamental mechanism for this enzyme to synthesize these fatty acids still remains unknown. This report started with dissecting the embedded KS domains of the PUFA synthase from marine protist Thraustochytrium sp. strain ATCC 26185 and then expressing them in wild-type E. coli and mutants defective in condensation of acyl-ACP with malonyl-ACP. Successful complementation of the mutants and improved fatty acid production in the overexpression experiments indicate that these KS domains can effectively function as stand-alone enzymes in E. coli. This result has paved the way for further studying of molecular mechanisms of the PUFA synthase for the biosynthesis of VLCPUFAs. PMID:28213537

Lessons from Animal Models of Cytoplasmic Intermediate Filament Proteins.

PubMed

Bouameur, Jamal-Eddine; Magin, Thomas M

Cytoplasmic intermediate filaments (IFs) represent a major cytoskeletal network contributing to cell shape, adhesion and migration as well as to tissue resilience and renewal in numerous bilaterians, including mammals. The observation that IFs are dispensable in cultured mammalian cells, but cause tissue-specific, life-threatening disorders, has pushed the need to investigate their function in vivo. In keeping with human disease, the deletion or mutation of murine IF genes resulted in highly specific pathologies. Epidermal keratins, together with desmin, are essential to protect corresponding tissues against mechanical force but also participate in stabilizing cell adhesion and in inflammatory signalling. Surprisingly, other IF proteins contribute to tissue integrity to a much lesser extent than anticipated, pointing towards their role in stress situations. In support, the overexpression of small chaperones or the interference with inflammatory signalling in several settings has been shown to rescue severe tissue pathologies that resulted from the expression of mutant IF proteins. It stills remains an open issue whether the wide range of IF disorders share similar pathomechanisms. Moreover, we lack an understanding how IF proteins participate in signalling processes. Now, with a large number of mouse models in hand, the next challenge will be to develop organotypic cell culture models to dissect pathomechanisms at the molecular level, to employ Crispr/Cas-mediated genome engineering to optimize models and, finally, to combine available animal models with medicinal chemistry for the development of molecular therapies.

Identification of the essential protein domains for Mib2 function during the development of the Drosophila larval musculature and adult flight muscles

PubMed Central

Domsch, Katrin; Acs, Andreas; Obermeier, Claudia; Nguyen, Hanh T.

2017-01-01

The proper differentiation and maintenance of myofibers is fundamental to a functional musculature. Disruption of numerous mostly structural factors leads to perturbations of these processes. Among the limited number of known regulatory factors for these processes is Mind bomb2 (Mib2), a muscle-associated E3 ubiquitin ligase, which was previously established to be required for maintaining the integrity of larval muscles. In this study, we have examined the mechanistic aspects of Mib2 function by performing a detailed functional dissection of the Mib2 protein. We show that the ankyrin repeats, in its entirety, and the hitherto uncharacterized Mib-specific domains (MIB), are important for the major function of Mib2 in skeletal and visceral muscles in the Drosophila embryo. Furthermore, we characterize novel mib2 alleles that have arisen from a forward genetic screen aimed at identifying regulators of myogenesis. Two of these alleles are viable, but flightless hypomorphic mib2 mutants, and harbor missense mutations in the MIB domain and RING finger, respectively. Functional analysis of these new alleles, including in vivo imaging, demonstrates that Mib2 plays an additional important role in the development of adult thorax muscles, particularly in maintaining the larval templates for the dorsal longitudinal indirect flight muscles during metamorphosis. PMID:28282454

Robotic selective neck dissection using a gasless postauricular facelift approach for early head and neck cancer: technical feasibility and safety.

PubMed

Tae, Kyung; Ji, Yong Bae; Song, Chang Myeon; Min, Hyun Jung; Kim, Kyung Rae; Park, Chul Won

2013-03-01

Abstract Background: Scarless and minimally invasive surgery is becoming popular in the head and neck area. We have developed a new robotic selective neck dissection procedure for head and neck squamous cell carcinoma (HNSCC) to avoid a long visible lateral neck scar. Here we report on the technical feasibility and safety of our procedure. We prospectively analyzed 4 patients with early HNSCC who underwent transoral robotic surgery (TORS) and concomitant robotic selective neck dissection via a gasless postauricular facelift approach using the da Vinci(®) Surgical System (Intuitive Surgical Inc., Sunnyvale, CA). Of these patients, 3 were male, and 1 was female. The mean age was 59.0±8.8 years. All patients had tongue cancer, with a clinically negative neck. Three patients were T1, and 1 patient was T2. All patients underwent partial glossectomy by TORS and elective robotic selective neck dissection including levels I, II, and III. The robotic selective neck dissection procedure was completed successfully in all patients. The mean operative time was 276±48 minutes. The mean number of lymph nodes removed was 19.3±7.3. Postoperative hematoma and transient marginal nerve palsy occurred in 1 patient each. Cosmetic satisfaction was excellent in all patients. Preliminary results indicate that robotic selective neck dissection via a gasless postauricular facelift approach is feasible and safe and allows for excellent postoperative cosmesis. Further studies are necessary to determine the oncologic safety and surgical completeness of this procedure compared with conventional neck dissection.

Anatomists' views on human body dissection and donation: an international survey.

PubMed

Arráez-Aybar, Luis-Alfonso; Bueno-López, José Luis; Moxham, Bernard John

2014-12-01

A survey was conducted to test three hypotheses: anatomists believe that dissection by students conveys not just anatomical knowledge but also essential skills and attitudes, including professionalism; anatomists approve of the donation of their own bodies or body parts/organs for medical/health-care training and research; attitudes towards body dissection and donation are not dependent upon gender or upon the extent of teaching experience, but are related to transcendental convictions relating to beliefs in the afterlife. Eighty-one anatomists, from 29 countries responded to the survey; 80% indicated that they required medical/health-care students to dissect human cadavers (60% females-86% males, p=0.02). Most teachers recorded that dissection was an instrument for training undergraduate students, an instrument for the development of professional skills, and an instrument to help to control emotions in the future doctor rather than being only a means of teaching/learning anatomy facts. Males were more receptive to the concept that dissection helps to control emotions in the future doctor (p=0.02). Most teachers (75%) said they were willing to donate their bodies, 41% saying they would donate body organs only, 9% would donate their entire bodies only, 25% would separately donate organs and also the entire body. The willingness to donate increased significantly with the years of teaching experience (p=0.04). Teachers who were not believers in the afterlife were more likely to donate their organs/bodies than were believers (p=0.03). Our findings showed that anatomists' attitudes towards body dissection and donation are dependent upon gender, upon the extent of teaching experience, and upon transcendental convictions.

[A case of bilateral medial medullary infarction caused by unilateral vertebral artery dissection].

PubMed

Akimoto, Takayoshi; Hara, Makoto; Saito, Mari; Takahashi, Keiko; Kamei, Satoshi

2015-01-01

A 34-year-old man developed right neck pain. Several hours later, he felt numbness of his extremities and presented at our hospital. He developed right hemiparesis and hypoesthesia of the right extremities. A few hours later, upbeat nystagmus and dysarthria appeared along with a sensory disturbance that spread to all extremities, and right hemiparesis progressed to tetraplegia. Brain MR diffusion-weighted images revealed a high-intensity lesion in the bilateral medial medulla oblongata and we diagnosed this bilateral medial medullary infarction. Three dimentional CT angiography revealed dissection of the right VA. We administered intravenous argatroban, edaravone, glycerin and oral clopidogrel. He was assessed as having modified Rankin scale 4 and was transferred to another hospital for rehabilitation on day 30. When the medial medulla oblongata is supplied by the unilateral VA, a unilateral VA dissection can cause bilateral medial medullary infarction.

Routine exposure of recurrent laryngeal nerve in thyroid surgery can prevent nerve injury.

PubMed

Shen, Chenling; Xiang, Mingliang; Wu, Hao; Ma, Yan; Chen, Li; Cheng, Lan

2013-06-15

To determine the value of dissecting the recurrent laryngeal nerve during thyroid surgery with respect to preventing recurrent laryngeal nerve injury, we retrospectively analyzed clinical data from 5 344 patients undergoing thyroidectomy. Among these cases, 548 underwent dissection of the recurrent laryngeal nerve, while 4 796 did not. There were 12 cases of recurrent laryngeal nerve injury following recurrent laryngeal nerve dissection (injury rate of 2.2%) and 512 cases of recurrent laryngeal nerve injury in those not undergoing nerve dissection (injury rate of 10.7%). This difference remained statistically significant between the two groups in terms of type of thyroid disease, type of surgery, and number of surgeries. Among the 548 cases undergoing recurrent laryngeal nerve dissection, 128 developed anatomical variations of the recurrent laryngeal nerve (incidence rate of 23.4%), but no recurrent laryngeal nerve injury was found. In addition, the incidence of recurrent laryngeal nerve injury was significantly lower in patients with the inferior parathyroid gland and middle thyroid veins used as landmarks for locating the recurrent laryngeal nerve compared with those with the entry of the recurrent laryngeal nerve into the larynx as a landmark. These findings indicate that anatomical variations of the recurrent laryngeal nerve are common, and that dissecting the recurrent laryngeal nerve during thyroid surgery is an effective means of preventing nerve injury.

Routine exposure of recurrent laryngeal nerve in thyroid surgery can prevent nerve injury★

PubMed Central

Shen, Chenling; Xiang, Mingliang; Wu, Hao; Ma, Yan; Chen, Li; Cheng, Lan

2013-01-01

To determine the value of dissecting the recurrent laryngeal nerve during thyroid surgery with respect to preventing recurrent laryngeal nerve injury, we retrospectively analyzed clinical data from 5 344 patients undergoing thyroidectomy. Among these cases, 548 underwent dissection of the recurrent laryngeal nerve, while 4 796 did not. There were 12 cases of recurrent laryngeal nerve injury following recurrent laryngeal nerve dissection (injury rate of 2.2%) and 512 cases of recurrent laryngeal nerve injury in those not undergoing nerve dissection (injury rate of 10.7%). This difference remained statistically significant between the two groups in terms of type of thyroid disease, type of surgery, and number of surgeries. Among the 548 cases undergoing recurrent laryngeal nerve dissection, 128 developed anatomical variations of the recurrent laryngeal nerve (incidence rate of 23.4%), but no recurrent laryngeal nerve injury was found. In addition, the incidence of recurrent laryngeal nerve injury was significantly lower in patients with the inferior parathyroid gland and middle thyroid veins used as landmarks for locating the recurrent laryngeal nerve compared with those with the entry of the recurrent laryngeal nerve into the larynx as a landmark. These findings indicate that anatomical variations of the recurrent laryngeal nerve are common, and that dissecting the recurrent laryngeal nerve during thyroid surgery is an effective means of preventing nerve injury. PMID:25206452

Tracheobronchial lesions following esophagectomy: erosions, ulcers, and fistulae, and the predictive value of lymph node-related factors.

PubMed

Maruyama, Kiyotomi; Motoyama, Satoru; Sato, Yusuke; Hayashi, Kaori; Usami, Shuetu; Minamiya, Yoshihiro; Ogawa, Jun-ichi

2009-04-01

Following esophagectomy, tracheobronchial lesions (TBLs) can occur as a result of ischemia caused by extensive dissection around the tracheobronchus. In this study we assessed the causes and clinical features of these complications, paying particular attention to lymph node (LN)-related factors. Between January 2000 and March 2007, 305 consecutive patients underwent subtotal esophagectomy using a transthoracic approach with LN dissection for thoracic esophageal cancer. TBLs, including erosions, ulcers, and fistulae, without traumatic injury during the operation, were detected during bronchoscopic examinations performed twice daily after the operation. The correlation between TBLs and tumor or surgical factors were analyzed. TBLs were observed in 14 patients, accounting for an overall incidence of 5%; these included 6 fistulae, 5 ulcers, and 3 erosions. Cases with TBLs significantly more often involved three-field LN dissections (3FLD) than those without TBLs. Six (43%) patients with TBLs had more than four metastatic lymph nodes, while 9 (64%) had cervical and upper-mediastinal LN metastasis (p=0.034 and 0.041, respectively). More than 60 LNs were dissected from 10 (71%) patients with TBLs (p=0.021), and logistic regression analysis revealed that dissection of more than 60 lymph nodes and 3FLD were independent predictors of TBLs. Esophageal cancer patients requiring extensive LN dissection of more than 60 nodes and/or 3FLD have an increased risk of developing a TBL during their postoperative course.

Aortic Dissection in Turner Syndrome

PubMed Central

Bondy, Carolyn A.

2009-01-01

Purpose of review Turner syndrome (TS) is a relatively common disorder of female development with cardinal features of short stature and congenital cardiovascular defects (CHD). TS is the most common established cause of aortic dissection in young women, but has received little attention outside of pediatric literature. This review focuses on emerging knowledge of the characteristics of aortic disease in TS in comparison with Marfan-like syndromes and isolated aortic valve disease. Recent findings The incidence of aortic dissection is significantly increased in individuals with TS at all ages, highest during young adult years and in pregnancy. Pediatric patients with dissection have known CHD, but adults often have aortic valve and arch abnormalities detected only by screening cardiac MR (CMR). Thoracic aortic dilation in TS must be evaluated in relation to body surface area (BSA). Dilation is most prominent at the ascending aorta similar to the pattern seen in non-syndromic bicuspid aortic valve (BAV), is equally prevalent (20-30%) in children and adults, and does not seem to be rapidly progressive. Cardiovascular anomalies and risk for aortic dissection in TS are strongly linked to a history of fetal lymphedema, evidenced by the presence of neck webbing and shield chest. Summary Risk for acute aortic dissection is increased by more than 100-fold in young and middle-aged women with TS. Monitoring frequency and treatment modalities are decided on an individual basis until more information on outcomes becomes available. PMID:18839441

The basic helix-loop-helix transcription factor, heart and neural crest derivatives expressed transcript 2, marks hepatic stellate cells in zebrafish: analysis of stellate cell entry into the developing liver.

PubMed

Yin, Chunyue; Evason, Kimberley J; Maher, Jacquelyn J; Stainier, Didier Y R

2012-11-01

Hepatic stellate cells (HSCs) are liver-specific mesenchymal cells that play vital roles in liver development and injury. Our knowledge of HSC biology is limited by the paucity of in vivo data. HSCs and sinusoidal endothelial cells (SECs) reside in close proximity, and interactions between these two cell types are potentially critical for their development and function. Here, we introduce a transgenic zebrafish line, Tg(hand2:EGFP), that labels HSCs. We find that zebrafish HSCs share many similarities with their mammalian counterparts, including morphology, location, lipid storage, gene-expression profile, and increased proliferation and matrix production, in response to an acute hepatic insult. Using the Tg(hand2:EGFP) line, we conducted time-course analyses during development to reveal that HSCs invade the liver after SECs do. However, HSCs still enter the liver in mutants that lack most endothelial cells, including SECs, indicating that SECs are not required for HSC differentiation or their entry into the liver. In the absence of SECs, HSCs become abnormally associated with hepatic biliary cells, suggesting that SECs influence HSC localization during liver development. We analyzed factors that regulate HSC development and show that inhibition of vascular endothelial growth factor signaling significantly reduces the number of HSCs that enter the liver. We also performed a pilot chemical screen and identified two compounds that affect HSC numbers during development. Our work provides the first comprehensive description of HSC development in zebrafish and reveals the requirement of SECs in HSC localization. The Tg(hand2:EGFP) line represents a unique tool for in vivo analysis and molecular dissection of HSC behavior. Copyright © 2012 American Association for the Study of Liver Diseases.

Prognostic Value of p16 Status on the Development of a Complete Response in Involved Oropharynx Cancer Neck Nodes After Cisplatin-Based Chemoradiation: A Secondary Analysis of NRG Oncology RTOG 0129

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galloway, Thomas J., E-mail: thomas.galloway@fccc.edu; Zhang, Qiang; Nguyen-Tan, Phuc Felix

Purpose: To determine the relationship between p16 status and the regional response of patients with node-positive oropharynx cancer treated on NRG Oncology RTOG 0129. Methods and Materials: Patients with N1-N3 oropharynx cancer and known p16 status who underwent treatment on RTOG 0129 were analyzed. Pathologic complete response (pCR) rates in patients treated with a postchemoradiation neck dissection (with p16-positive or p16-negative cancer) were compared by Fisher exact test. Patients managed expectantly were compared with those treated with a neck dissection. Results: Ninety-nine (34%) of 292 patients with node-positive oropharynx cancer and known p16 status underwent a posttreatment neck dissection (p16-positive:more » n=69; p16-negative: n=30). The remaining 193 patients with malignant lymphadenopathy at diagnosis were observed. Neck dissection was performed a median of 70 (range, 17-169) days after completion of chemoradiation. Neither the pretreatment nodal stage (P=.71) nor the postradiation, pre-neck dissection clinical/radiographic neck assessment (P=.42) differed by p16 status. A pCR was more common among p16-positive patients (78%) than p16-negative patients (53%, P=.02) and was associated with a reduced incidence of local–regional failure (hazard ratio 0.33, P=.003). On multivariate analysis of local–regional failure, a test for interaction between pCR and p16 status was not significant (P=.37). One-hundred ninety-three (66%) of 292 of initially node-positive patients were managed without a posttreatment neck dissection. Development of a clinical (cCR) was not significantly influenced by p16-status (P=.42). Observed patients with a clinical nodal CR had disease control outcomes similar to those in patients with a pCR neck dissection. Conclusions: Patients with p16-positive tumors had significantly higher pCR and locoregional control rates than those with p16-negative tumors.« less

Prognostic Value of p16 Status on the Development of a Complete Response in Involved Oropharynx Cancer Neck Nodes After Cisplatin-Based Chemoradiation: A Secondary Analysis of NRG Oncology RTOG 0129.

PubMed

Galloway, Thomas J; Zhang, Qiang Ed; Nguyen-Tan, Phuc Felix; Rosenthal, David I; Soulieres, Denis; Fortin, André; Silverman, Craig L; Daly, Megan E; Ridge, John A; Hammond, J Alexander; Le, Quynh-Thu

2016-10-01

To determine the relationship between p16 status and the regional response of patients with node-positive oropharynx cancer treated on NRG Oncology RTOG 0129. Patients with N1-N3 oropharynx cancer and known p16 status who underwent treatment on RTOG 0129 were analyzed. Pathologic complete response (pCR) rates in patients treated with a postchemoradiation neck dissection (with p16-positive or p16-negative cancer) were compared by Fisher exact test. Patients managed expectantly were compared with those treated with a neck dissection. Ninety-nine (34%) of 292 patients with node-positive oropharynx cancer and known p16 status underwent a posttreatment neck dissection (p16-positive: n=69; p16-negative: n=30). The remaining 193 patients with malignant lymphadenopathy at diagnosis were observed. Neck dissection was performed a median of 70 (range, 17-169) days after completion of chemoradiation. Neither the pretreatment nodal stage (P=.71) nor the postradiation, pre-neck dissection clinical/radiographic neck assessment (P=.42) differed by p16 status. A pCR was more common among p16-positive patients (78%) than p16-negative patients (53%, P=.02) and was associated with a reduced incidence of local-regional failure (hazard ratio 0.33, P=.003). On multivariate analysis of local-regional failure, a test for interaction between pCR and p16 status was not significant (P=.37). One-hundred ninety-three (66%) of 292 of initially node-positive patients were managed without a posttreatment neck dissection. Development of a clinical (cCR) was not significantly influenced by p16-status (P=.42). Observed patients with a clinical nodal CR had disease control outcomes similar to those in patients with a pCR neck dissection. Patients with p16-positive tumors had significantly higher pCR and locoregional control rates than those with p16-negative tumors. Copyright © 2016 Elsevier Inc. All rights reserved.

Posterior approach to kidney dissection: An old surgical approach for integrated medical curricula.

PubMed

Daly, Frank J; Bolender, David L; Jain, Deepali; Uyeda, Sheryl; Hoagland, Todd M

2015-01-01

Integrated medical curricular changes are altering the historical regional anatomy approach to abdominal dissection. The renal system is linked physiologically and biochemically to the cardiovascular and respiratory systems; yet, anatomists often approach the urinary system as part of the abdomen and pelvic regions. As part of an integrated curriculum, the renal system must be covered relatively quickly after the thorax in the cadaver laboratory, often without the opportunity to fully appreciate the rest of the abdominal contents. This article provides dissection instructions that follow one of the historical surgical approaches for nephrectomy, including preservation of the posterior abdominal wall neurovasclature. Dissection procedures were developed for first-year medical students, intending this posterior approach to the kidneys to be their first introduction to the renal system. It has been successfully implemented with the first-year medical students at the University of New England, College of Osteopathic Medicine. Utilizing this posterior approach to the kidney enabled the study of the anatomy of the kidneys, suprarenal glands, and renal vessels, as well as the muscles of the lumbar spine, while maintaining the integrity of the anterior abdominal wall and peritoneal cavity for future gastrointestinal and reproductive system-based dissections. © 2015 American Association of Anatomists.

The Effect of a Prior Dissection Simulation on Middle School Students' Dissection Performance and Understanding of the Anatomy and Morphology of the Frog

NASA Astrophysics Data System (ADS)

Akpan, Joseph Paul; Andre, Thomas

1999-06-01

Science teachers, school administrators, educators, and the scientific community are faced with ethical controversies over animal dissection in classrooms. Simulation has been proposed as a way of dealing with this issue. One intriguing previous finding was that use of an interactive videodisc dissection facilitated performance on a subsequent actual dissection. This study examined the prior use of simulation of frog dissection in improving students' actual dissection performance and learning of frog anatomy and morphology. There were three experimental conditions: simulation before dissection (SBD); dissection before simulation (DBS); or dissection-only (DO). Results of the study indicated that students receiving SBD performed significantly better than students receiving DBS or DO on both actual dissection and knowledge of the anatomy and morphology. Students' attitudes toward the use of animals for dissection did not change significantly from pretest to posttest and did not interact with treatment. The genders did not differ in achievement, but males were more favorable towards dissection and computers than were females.

Imaginal Disc Abnormalities in Lethal Mutants of Drosophila

PubMed Central

Shearn, Allen; Rice, Thomas; Garen, Alan; Gehring, Walter

1971-01-01

Late lethal mutants of Drosophila melanogaster, dying after the larval stage of development, were isolated. The homozygous mutant larvae were examined for abnormal imaginal disc morphology, and the discs were injected into normal larval hosts to test their capacities to differentiate into adult structures. In about half of the mutants analyzed, disc abnormalities were found. Included among the abnormalities were missing discs, small discs incapable of differentiating, morphologically normal discs with limited capacities for differentiation, and discs with homeotic transformations. In some mutants all discs were affected, and in others only certain discs. The most extreme abnormal phenotype is a class of “discless” mutants. The viability of these mutant larvae indicates that the discs are essential only for the development of an adult and not of a larva. The late lethals are therefore a major source of mutants for studying the genetic control of disc formation. Images PMID:5002822

Secondary science classroom dissections: Informing policy by evaluating cognitive outcomes and exploring affective outcomes

NASA Astrophysics Data System (ADS)

Allspaw, Kathleen M.

Animal protection organizations claim that dissection is pedagogically unsound and that it will cause students to lose respect for non-human animals. Science teacher organizations support curricula that teach respect for animal life and include dissection. Prior research compared dissection to dissection alternatives. Four of the six studies revealed no difference between groups on tests of cognitive outcomes. One study revealed that dissection was superior, and one revealed that the alternative was superior. No differences in attitudes toward science, dissection or school were found. Attitudes toward non-human animals were not measured. This study focused on the dissections of earthworms and frogs in middle and high school classrooms. Pre and post-tests of conceptual understanding revealed failing scores and no significant pre/post differences. Because these tests required critical thinking skills, and the dissection activities did not, it is difficult to determine if the poor performance on these tests indicates the inability of the students to think critically, and/or if it indicates the ineffectiveness of dissection. Further studies of dissections that focus on critical thinking would be necessary to make this distinction. Classroom observations, student written narratives, and student and adult interviews revealed mixed attitudes toward non-human animals. Student behaviors during dissection were similar to those behaviors exhibited during non-dissection activities. Most students and adults readily supported worm dissections while they expressed some trepidation about frog dissections. Students and adults universally expressed affection for their pets and opposed the use of their own pets for dissection/research. There was slight support for the use of dogs and cats for dissection/research, but only those students who expressed hate for cats said that they could dissect cats. None of the students or adults expressed a willingness to dissect dogs. Some students abandoned plans for life science careers because they did not want to do further dissections. Students and adults often expressed confliction about the use of animals for food and/or research. Students and adults employed psychological mechanisms including dissociation, conflict reduction and viewing animals as an "outgroup" to rationalize their support for the use of animals for food, dissection and research.

A genetic dissection of the photophobic response of Paramecium tetraurelia.

PubMed

Hinrichsen, Robert; Peters, Christian

2013-05-01

Paramecium tetraurelia displayed two behavioral responses upon the initiation of a light stimulus at 7 x 10(4) lux. The cells exhibited a photophobic response in the form of behavioral avoiding reactions, followed by an increase in forward swimming velocity that was significantly higher than prior to the light stimulus activation. It was determined that an intensity of approximately 6.5 x 10(3) lux was required to initiate a moderate avoidance behavioral response. Following the avoiding response, a gradual increase in speed occurred as the intensity increased, indicating that increased swimming speeds are dependent on the light intensity. Two mutants, pawnA and Dancer, were utilized since they affect known Ca(2+)-currents of the cell. The use of pawnA cells, which lack voltage-dependent Ca(2+) channel activity, showed that the two responses to light could be genetically separated, in that the cells showed no avoiding reactions, but did increase their swimming speed. The Dancer cells, which display exaggerated Ca(2+) channel activity, exhibited similar initial avoiding responses as the wild type cells, however did not increase their swimming speed as the intensity of the light was increased. This phenotype as replicated in wildtype cells that had been placed in 25 μM 8-Br-cGMP. These data demonstrate that the photophobic light response of Paramecium tetraurelia can be genetically dissected as a means of elucidating the molecular mechanisms of the light response. Copyright © 2013 Elsevier GmbH. All rights reserved.

Identification and utilization of a sow thistle powdery mildew as a poorly adapted pathogen to dissect post-invasion non-host resistance mechanisms in Arabidopsis

PubMed Central

Wen, Yingqiang; Wang, Wenming; Feng, Jiayue; Luo, Ming-Cheng; Tsuda, Kenichi; Katagiri, Fumiaki; Bauchan, Gary; Xiao, Shunyuan

2011-01-01

To better dissect non-host resistance against haustorium-forming powdery mildew pathogens, a sow thistle powdery mildew isolate designated Golovinomyces cichoracearum UMSG1 that has largely overcome penetration resistance but is invariably stopped by post-invasion non-host resistance of Arabidopsis thaliana was identified. The post-invasion non-host resistance is mainly manifested as the formation of a callosic encasement of the haustorial complex (EHC) and hypersensitive response (HR), which appears to be controlled by both salicylic acid (SA)-dependent and SA-independent defence pathways, as supported by the susceptibility of the pad4/sid2 double mutant to the pathogen. While the broad-spectrum resistance protein RPW8.2 enhances post-penetration resistance against G. cichoracearum UCSC1, a well-adapted powdery mildew pathogen, RPW8.2, is dispensable for post-penetration resistance against G. cichoracearum UMSG1, and its specific targeting to the extrahaustorial membrane is physically blocked by the EHC, resulting in HR cell death. Taken together, the present work suggests an evolutionary scenario for the Arabidopsis–powdery mildew interaction: EHC formation is a conserved subcellular defence evolved in plants against haustorial invasion; well-adapted powdery mildew has evolved the ability to suppress EHC formation for parasitic growth and reproduction; RPW8.2 has evolved to enhance EHC formation, thereby conferring haustorium-targeted, broad-spectrum resistance at the post-invasion stage. PMID:21193574

Video: laparoscopy distinctive technique for suprapancreatic lymph node dissection: medial approach for laparoscopic gastric cancer surgery.

PubMed

Kanaya, Seiichiro; Haruta, Shusuke; Kawamura, Yuichiro; Yoshimura, Fumihiro; Inaba, Kazuki; Hiramatsu, Yoshihiro; Ishida, Yoshinori; Taniguchi, Keizo; Isogaki, Jun; Uyama, Ichiro

2011-12-01

Suprapancreatic lymph node (LN) dissection is critical for gastric cancer surgery. Until currently, a number of laparoscopic gastrectomy procedures have been performed in the same manner as open surgery procedures [3, 4, 6]. Using the characteristic of laparoscopic surgery, the authors developed a new technique of suprapancreatic LN dissection. After division of the duodenum, No. 8a LN is raised, and the surrounding tissue is dissected to identify the outmost layer of the nerves around the common hepatic artery. This layer can be dissected as the next step is headed for the root of the left gastric artery. Thin layers can be identified on the left and right sides of the artery. After this step, the LN dissection is performed toward both lateral sites, keeping the outmost layer of the nerves. At this stage, the surgeon should envision the "U" shape on the right side and the "V" shape on the left side for a superior performance. This technique was performed by the same surgeon for 20 consecutive patients with advanced gastric cancer. All the patients successfully underwent laparoscopic distal gastrectomy with D2 LN dissection. The mean number of regional LNs retrieved was 45.1 ± 13.5. The mean number of only LNs around the celiac artery (No. 7, 8a, 9, 11p, and 12a) was 17.8 ± 5.5. This was not less than reported previously [1, 2, 5]. The mean blood loss was 91.1 ml, and the mean operative time was 296.0 min. At this writing, all the patients are disease free after a mean follow-up period of 15.4 months. The nerves are thick and sturdy around the root of the left gastric artery. Additionally, the magnified and horizontal laparoscope view provides a straightforward approach and visibility to the layer. The authors believe that the "medial approach" is a straightforward method of suprapancreatic LN dissection in laparoscopic gastric cancer surgery.

The nature of dissection: Exploring student conceptions

NASA Astrophysics Data System (ADS)

York, Katharine

The model of conceptual change in science describes the process of learning as a complete restructuring of knowledge, when learners discover or are shown more plausible, intelligent alternatives to existing conceptions. Emotions have been acknowledged as part of a learner's conceptual ecology, but the effects of emotions on learning have yet to be described. This research was conducted to examine the role that emotions have on learning for thirteen high school students, as they dissected cats in a Human Anatomy and Physiology class. The project also investigated whether a student's emotional reactions may be used to develop a sense of connectedness with the nonhuman world, which is defined as ecological literacy. This study utilized a grounded theory approach, in which student responses to interviews were the primary source of data. Interviews were transcribed, and responses were coded according to a constant comparative method of analysis. Responses were compared with the four conditions necessary for conceptual change to occur, and also to five principles of ecological literacy. Students who had negative reactions to dissection participated less in the activity, and demonstrated less conceptual change. Two female students showed the strongest emotional reactions to dissection, and also the lowest amount of conceptual change. One male student also had strong negative reactions to death, and showed no conceptual change. The dissection experiences of the students in this study did not generally reflect ecological principles. The two students whose emotional reactions to dissection were the most negative demonstrated the highest degree of ecological literacy. These results provide empirical evidence of the effects that emotions have on learning, and also supports the opinions of educators who do not favor dissection, because it does not teach students to respect all forms of life.

A guide for effective anatomical vascularization studies: useful ex vivo methods for both CT and MRI imaging before dissection.

PubMed

Renard, Yohann; Hossu, Gabriela; Chen, Bailiang; Krebs, Marine; Labrousse, Marc; Perez, Manuela

2018-01-01

The objective of this study was to develop a simple and useful injection protocol for imaging cadaveric vascularization and dissection. Mixtures of contrast agent and cast product should provide adequate contrast for two types of ex vivo imaging (MRI and CT) and should harden to allow gross dissection of the injected structures. We tested the most popular contrast agents and cast products, and selected the optimal mixture composition based on their availability and ease of use. All mixtures were first tested in vitro to adjust dilution parameters of each contrast agent and to fine-tune MR imaging acquisition sequences. Mixtures were then injected in 24 pig livers and one human pancreas for MR and computed tomography (CT) imaging before anatomical dissection. Colorized latex, gadobutrol and barite mixture met the above objective. Mixtures composed of copper sulfate (CuSO 4 ) gadoxetic acid (for MRI) and iodine (for CT) gave an inhomogeneous signal or extravasation of the contrast agent. Agar did not harden sufficiently for gross dissection but appears useful for CT and magnetic resonance imaging (MRI) studies without dissection. Silicone was very hard to inject but achieved the goals of the study. Resin is particularly difficult to use but could replace latex as an alternative for corrosion instead of dissection. This injection protocol allows CT and MRI images to be obtained of cadaveric vascularization and anatomical casts in the same anatomic specimen. Post-imaging processing software allow easy 3D reconstruction of complex anatomical structures using this technique. Applications are numerous, e.g. surgical training, teaching methods, postmortem anatomic studies, pathologic studies, and forensic diagnoses. © 2017 Anatomical Society.

Endoscopic Submucosal Dissection: Indications and Application in Western Endoscopy Practice.

PubMed

Bourke, Michael J; Neuhaus, Horst; Bergman, Jacques J

2018-05-01

Endoscopic submucosal dissection was developed in Japan, early in this century, to provide a minimally invasive yet curative treatment for the large numbers of patients with early gastric cancer identified by the national screening program. Previously, the majority of these patients were treated surgically at substantial cost and with significant risk of short- and long-term morbidity. En-bloc excision of these early cancers, most with a limited risk of nodal metastasis, allowed complete staging of the tumor, stratification of the subsequent therapeutic approach, and potential cure. This transformative innovation changed the nature of endoscopic treatment for superficial mucosal neoplasia and, ultimately, for the first time allowed endoscopists to assert that the early cancer had been definitively cured. Subsequently, Western endoscopists have increasingly embraced the therapeutic possibilities offered by endoscopic submucosal dissection, but with some justifiable scientific caution. Here we provide an evidence-based critical appraisal of the role of endoscopic submucosal dissection in advanced endoscopic tissue resection. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

The Criminal Corpse, Anatomists and the Criminal Law: Parliamentary Attempts to Extend the Dissection of Offenders in Late Eighteenth-Century England

PubMed Central

Ward, Richard M.

2015-01-01

In the later eighteenth century two schemes were introduced in Parliament for extending the practice of handing over the bodies of executed offenders to anatomists for dissection. Both measures were motivated by the needs of anatomy — including the improvement of surgical skill, the development of medical teaching in the provinces, and for conducting public anatomical demonstrations. Yet both failed to pass into law due to concerns about the possibly damaging effects in terms of criminal justice. Through a detailed analysis of the origins and progress of these two parliamentary measures — a moment when the competing claims of anatomy and criminal justice vied for supremacy over the criminal corpse — the following article sheds light on judicial attitudes to dissection as a method of punishment and adds to our understanding of why the dread of dissection would come to fall upon the dead poor (rather than executed offenders) in the nineteenth century. PMID:25821241

Development and implementation of a technical and didactical training program for student tutors in the dissection course.

PubMed

Shiozawa, Thomas; Hirt, Bernhard; Celebi, Nora; Baur, Friederike; Weyrich, Peter; Lammerding-Köppel, Maria

2010-12-20

student tutors have a long tradition in gross anatomy instruction. However, the full potential of the tutors is generally not tapped, since little attention is paid to their technical and didactical training. The aim of this paper is to report a systematic approach to the development, didactic reasoning and implementation of a curriculum for training student tutors in gross anatomy. the training program was developed using the six-step approach of Kern's curriculum development model. For needs assessment, the literature research was amended by a survey among the 1st and 2nd year students of the dissection course (n=167) and two independent 90 min focus group interviews with the tutors who supervised these students (n=15). Protocols were transcribed and analyzed by margin coding. The training curriculum was setup on the basis of these data. corresponding to the literature, the students want student tutors with good teaching competence as well as adequate content knowledge and technical competence. Supporting that, the tutors request a training program enhancing their didactic skills as well as their knowledge of content and working using relevant methods. Thus, a combined didactic and professional training program has been developed. Six professional and 11 didactic learning objectives were defined. A 3 weeks training curriculum was implemented, using microteaching and group exercises for didactics and active dissection for technical training. Both parts were interlocked on a contextual and practical level. our focus group analyses revealed that a specific training program for student tutors in the dissection course is necessary. We describe a feasible task-oriented training curriculum combining didactic and professional objectives. 2010. Published by Elsevier GmbH.

Trampolines, children, and strokes.

PubMed

Wechsler, B; Kim, H; Hunter, J

2001-08-01

Strokes in children related to sports injuries are rare, but pediatric trampoline injuries are dramatically increasing. Minor trauma to the vulnerable extracranial vertebral arteries as they travel superficially through the dorsum of the neck can begin a cascade of events that results in arterial dissection, thrombus formation, and embolization with cerebral infarction. We present the case of an 11-yr-old boy who developed left vertebral artery dissection subsequent to a trampoline injury.

Description of a novel allelic “thick leafed” mutant of sorghum

USDA-ARS?s Scientific Manuscript database

An allelic sorghum [Sorghum bicolor (L.) Moench] mutant with thick and narrow erect leaves (thl) and reduced adaxial stomatal density was isolated from the Annotated Individually pedigreed Mutagenized Sorghum (AIMS) mutant library developed at the Plant Stress and Germplasm Development Unit at Lubbo...

Smad3 mutant mice develop colon cancer with overexpression of COX-2

PubMed Central

Zhu, Yu-Ping; Liu, Zhuo; Fu, Zhi-Xuan; Li, De-Chuan

2017-01-01

Colon cancer is the second most common cause of cancer-associated mortality in human populations. The aim of the present study was to identify the role of cyclooxygenase-2 (COX-2) in Smad3 mutant mice, which are known to develop colon cancer. Homozygous Smad3 (−/−) mutant mice were generated from inbred and hybrid Smad3 mouse strains by intercrossing the appropriate heterozygotes. Immunohistochemistry with COX-2 antibody was performed throughout this experiment and the data was validated and cross-checked with reverse transcription-polymerase chain reaction (RT-PCR). Homozygous mutant Smad3 mice were generated and the overexpression pattern of COX-2 was identified by immunohistochemistry and validated with RT-PCR. The results of the present study demonstrated a link between the Smad3 mutant mice, colon cancer and COX-2. In addition, the overexpression pattern of COX-2 in Smad3 mutant mice that develop colon cancer was identified. PMID:28454287

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

Modeling Autism by SHANK Gene Mutations in Mice

PubMed Central

Jiang, Yong-hui; Ehlers, Michael D.

2013-01-01

Summary Shank family proteins (Shank1, Shank2, and Shank3) are synaptic scaffolding proteins that organize an extensive protein complex at the postsynaptic density (PSD) of excitatory glutamatergic synapses. Recent human genetic studies indicate that SHANK family genes (SHANK1, SHANK2, and SHANK3) are causative genes for idiopathic autism spectrum disorders (ASD). Neurobiological studies of Shank mutations in mice support a general hypothesis of synaptic dysfunction in the pathophysiology of ASD. However, the molecular diversity of SHANK family gene products, as well as the heterogeneity in human and mouse phenotypes, pose challenges to modeling human SHANK mutations. Here, we review the molecular genetics of SHANK mutations in human ASD and discuss recent findings where such mutations have been modeled in mice. Conserved features of synaptic dysfunction and corresponding behaviors in Shank mouse mutants may help dissect the pathophysiology of ASD, but also highlight divergent phenotypes that arise from different mutations in the same gene. PMID:23583105

Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.C.; Deschenes, S.P.; Roberts, E.J.

Nonsense and frameshift mutations, which predict premature termination of translation, often cause a dramatic reduction in the amount of transcript from the mutant allele (nonsense-mediated mRNA decay). In some genes, these mutations also influence RNA splicing and induce skipping of the exon that contains the nonsense codon. To begin to dissect how premature termination alters the metabolism of RNA from the COL1A1 gene, we studied nonsense and frameshift mutations distributed over exons 11-49 of the gene. These mutations were originally identified in 10 unrelated families with osteogenesis imperfecta (OI) type I. We observed marked reduction in steady-state amounts of mRNAmore » from the mutant allele in both total cellular and nuclear RNA extracts of cells from affected individuals, suggesting that nonsense-mediated decay of COL1A1 RNA is a nuclear phenomenon. Position of the mutation within the gene did not influence this observation. None of the mutations induced skipping of either the exon containing the mutation or, for the frameshifts, the downstream exons with the new termination sites. Our data suggest that nonsense and frameshift mutations throughout most of the COL1A1 gene result in a null allele, which is associated with the predictable mild clinical phenotype, OI type I. 42 refs., 6 figs., 1 tab.« less

A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia

PubMed Central

Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric

2014-01-01

In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163

Kinesin-5–dependent Poleward Flux and Spindle Length Control in Drosophila Embryo Mitosis

PubMed Central

Brust-Mascher, Ingrid; Sommi, Patrizia; Cheerambathur, Dhanya K.

2009-01-01

We used antibody microinjection and genetic manipulations to dissect the various roles of the homotetrameric kinesin-5, KLP61F, in astral, centrosome-controlled Drosophila embryo spindles and to test the hypothesis that it slides apart interpolar (ip) microtubules (MT), thereby controlling poleward flux and spindle length. In wild-type and Ncd null mutant embryos, anti-KLP61F dissociated the motor from spindles, producing a spatial gradient in the KLP61F content of different spindles, which was visible in KLP61F-GFP transgenic embryos. The resulting mitotic defects, supported by gene dosage experiments and time-lapse microscopy of living klp61f mutants, reveal that, after NEB, KLP61F drives persistent MT bundling and the outward sliding of antiparallel MTs, thereby contributing to several processes that all appear insensitive to cortical disruption. KLP61F activity contributes to the poleward flux of both ipMTs and kinetochore MTs and to the length of the metaphase spindle. KLP61F activity maintains the prometaphase spindle by antagonizing Ncd and another unknown force-generator and drives anaphase B, although the rate of spindle elongation is relatively insensitive to the motor's concentration. Finally, KLP61F activity contributes to normal chromosome congression, kinetochore spacing, and anaphase A rates. Thus, a KLP61F-driven sliding filament mechanism contributes to multiple aspects of mitosis in this system. PMID:19158379

Blocking neutrophil integrin activation prevents ischemia-reperfusion injury.

PubMed

Yago, Tadayuki; Petrich, Brian G; Zhang, Nan; Liu, Zhenghui; Shao, Bojing; Ginsberg, Mark H; McEver, Rodger P

2015-07-27

Neutrophil recruitment, mediated by β2 integrins, combats pyogenic infections but also plays a key role in ischemia-reperfusion injury and other inflammatory disorders. Talin induces allosteric rearrangements in integrins that increase affinity for ligands (activation). Talin also links integrins to actin and other proteins that enable formation of adhesions. Structural studies have identified a talin1 mutant (L325R) that perturbs activation without impairing talin's capacity to link integrins to actin and other proteins. Here, we found that mice engineered to express only talin1(L325R) in myeloid cells were protected from renal ischemia-reperfusion injury. Dissection of neutrophil function in vitro and in vivo revealed that talin1(L325R) neutrophils had markedly impaired chemokine-induced, β2 integrin-mediated arrest, spreading, and migration. Surprisingly, talin1(L325R) neutrophils exhibited normal selectin-induced, β2 integrin-mediated slow rolling, in sharp contrast to the defective slow rolling of neutrophils lacking talin1 or expressing a talin1 mutant (W359A) that blocks talin interaction with integrins. These studies reveal the importance of talin-mediated activation of integrins for renal ischemia-reperfusion injury. They further show that neutrophil arrest requires talin recruitment to and activation of integrins. However, although neutrophil slow rolling requires talin recruitment to integrins, talin-mediated integrin activation is dispensable. © 2015 Yago et al.

Blocking neutrophil integrin activation prevents ischemia–reperfusion injury

PubMed Central

Yago, Tadayuki; Petrich, Brian G.; Zhang, Nan; Liu, Zhenghui; Shao, Bojing; Ginsberg, Mark H.

2015-01-01

Neutrophil recruitment, mediated by β2 integrins, combats pyogenic infections but also plays a key role in ischemia–reperfusion injury and other inflammatory disorders. Talin induces allosteric rearrangements in integrins that increase affinity for ligands (activation). Talin also links integrins to actin and other proteins that enable formation of adhesions. Structural studies have identified a talin1 mutant (L325R) that perturbs activation without impairing talin’s capacity to link integrins to actin and other proteins. Here, we found that mice engineered to express only talin1(L325R) in myeloid cells were protected from renal ischemia–reperfusion injury. Dissection of neutrophil function in vitro and in vivo revealed that talin1(L325R) neutrophils had markedly impaired chemokine-induced, β2 integrin–mediated arrest, spreading, and migration. Surprisingly, talin1(L325R) neutrophils exhibited normal selectin-induced, β2 integrin–mediated slow rolling, in sharp contrast to the defective slow rolling of neutrophils lacking talin1 or expressing a talin1 mutant (W359A) that blocks talin interaction with integrins. These studies reveal the importance of talin-mediated activation of integrins for renal ischemia–reperfusion injury. They further show that neutrophil arrest requires talin recruitment to and activation of integrins. However, although neutrophil slow rolling requires talin recruitment to integrins, talin-mediated integrin activation is dispensable. PMID:26169939

Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin.

PubMed

Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

2011-11-01

Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.

Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin

PubMed Central

Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

2011-01-01

Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment. PMID:22011578

Sarcomere protein gene mutations and inherited heart disease: a beta-cardiac myosin heavy chain mutation causing endocardial fibroelastosis and heart failure.

PubMed

Kamisago, Mitsuhiro; Schmitt, Joachim P; McNamara, Dennis; Seidman, Christine; Seidman, J G

2006-01-01

Inherited human cardiomyopathies often lead to heart failure. A common feature of these conditions is that affected individuals can express the disease causing mutations for many years without showing clinical signs of the disease. Previous studies have demonstrated that sarcomere protein gene mutations can cause either dilated cardiomyopathy or hypertrophic cardiomyopathy. Here we demonstrate that the Arg442His missense mutation in beta-cardiac myosin heavy chain (betaMHC) causes dilated cardiomyopathy, endocardial fibroelastosis and heart failure at a very early age. Using standard genetic engineering tools we and others have made murine models by introducing human disease causing mutations into mice. The central hypothesis of these studies has been that by identifying the pathophysiological pathways activated by these mutations we can define enzymatic activities that are modified during the disease process and which may be involved in pathways that involve more common forms of cardiac disease. Murine models bearing different mutant myosins are being used to address whether each disease causing mutant betaMHC activates the same or different cellular pathways. Dissecting the molecular pathways modulated by mutations in sarcomere protein genes as well as other genes has already demonstrated that there are multiple pathways leading to cardiac remodelling and heart failure. Defining the mechanisms by which mutations in the same genes activate different cellular pathways remains an important question.

HPA axis dysregulation and behavioral analysis of mouse mutants with altered GR or MR function

PubMed Central

Kolber, Benedict J.; Wieczorek, Lindsay; Muglia, Louis J.

2009-01-01

Corticosteroid receptors are critical for the maintenance of homeostasis after both psychological and physiological stress. To properly understand the different roles and interactions of the glucocorticoid receptor (GR) and mineralocorticoid receptor (MR) during stress, it is necessary to dissect the role of corticosteroid signaling at both the system and sub-system level. A variety of GR transgenic mouse lines have recently been used to characterize the role of GR in the CNS as a whole and particularly in the forebrain. We will describe both the behavioral and cellular/molecular implications of disrupting GR function in these animal models and describe the implications of this data for our understanding of normal endocrine function and stress adaptation. MRs in tight epithelia have a long established role in sodium homeostasis. Recently however, evidence has suggested that limbic MRs also play an important role in psychological stress. Just as with GR, targeted mutations in MR induce a variety of behavioral changes associated with stress adaptation. In this review, we will discuss the implications of this work on MR. Finally, we will discuss the possible interaction between MR and GR and how future work using double mutants (through conventional means or virus based gene alteration) will be needed to fully understand how signaling through these two steroid receptors provides the adaptive mechanisms to deal with a variety of stressors. PMID:18609295

The non-canonical BMP and Wnt/β-catenin signaling pathways orchestrate early tooth development

PubMed Central

Yuan, Guohua; Yang, Guobin; Zheng, Yuqian; Zhu, Xiaojing; Chen, Zhi; Zhang, Zunyi; Chen, YiPing

2015-01-01

BMP and Wnt signaling pathways play a crucial role in organogenesis, including tooth development. Despite extensive studies, the exact functions, as well as if and how these two pathways act coordinately in regulating early tooth development, remain elusive. In this study, we dissected regulatory functions of BMP and Wnt pathways in early tooth development using a transgenic noggin (Nog) overexpression model (K14Cre;pNog). It exhibits early arrested tooth development, accompanied by reduced cell proliferation and loss of odontogenic fate marker Pitx2 expression in the dental epithelium. We demonstrated that overexpression of Nog disrupted BMP non-canonical activity, which led to a dramatic reduction of cell proliferation rate but did not affect Pitx2 expression. We further identified a novel function of Nog by inhibiting Wnt/β-catenin signaling, causing loss of Pitx2 expression. Co-immunoprecipitation and TOPflash assays revealed direct binding of Nog to Wnts to functionally prevent Wnt/β-catenin signaling. In situ PLA and immunohistochemistry on Nog mutants confirmed in vivo interaction between endogenous Nog and Wnts and modulation of Wnt signaling by Nog in tooth germs. Genetic rescue experiments presented evidence that both BMP and Wnt signaling pathways contribute to cell proliferation regulation in the dental epithelium, with Wnt signaling also controlling the odontogenic fate. Reactivation of both BMP and Wnt signaling pathways, but not of only one of them, rescued tooth developmental defects in K14Cre;pNog mice, in which Wnt signaling can be substituted by transgenic activation of Pitx2. Our results reveal the orchestration of non-canonical BMP and Wnt/β-catenin signaling pathways in the regulation of early tooth development. PMID:25428587

Prognosis of carotid dissecting aneurysms

PubMed Central

Larsson, Susanna C.; King, Alice; Madigan, Jeremy; Levi, Christopher; Norris, John W.

2017-01-01

Objective: To determine the natural history of dissecting aneurysm (DA) and whether DA is associated with an increased recurrent stroke risk and whether type of antithrombotic drugs (antiplatelets vs anticoagulants) modifies the persistence or development of DA. Methods: We included 264 patients with extracranial cervical artery dissection (CAD) from the Cervical Artery Dissection in Stroke Study (CADISS), a multicenter prospective study that compared antiplatelet with anticoagulation therapy. Logistic regression was used to estimate age- and sex-adjusted odds ratios. We conducted a systematic review of published studies assessing the natural history of DA and stroke risk in patients with non-surgically-treated extracranial CAD with DA. Results: In CADISS, DA was present in 24 of 264 patients at baseline. In 36 of 248 patients with follow-up neuroimaging at 3 months, 12 of the 24 baseline DAs persisted, and 24 new DA had developed. There was no association between treatment allocation (antiplatelets vs anticoagulants) and whether DA at baseline persisted at follow-up or whether new DA developed. During 12 months of follow-up, stroke occurred in 1 of 48 patients with DA and in 7 of 216 patients without DA (age- and sex-adjusted odds ratio 0.84; 95% confidence interval 0.10–7.31; p = 0.88). Published studies, mainly retrospective, showed a similarly low risk of stroke and no evidence of an increased stroke rate in patients with DA. Conclusions: The results of CADISS provide evidence suggesting that DAs may have benign prognosis and therefore medical treatment should be considered. PMID:28087823

Principles for Management of Intraoperative Acute Type A Aortic Dissection.

PubMed

Gukop, Philemon; Chandrasekaran, Vankatachalam

2015-12-01

Intraoperative Type A aortic dissection is a rare pathology with incidence of 0.06-0.32%. It is associated with a high mortality between 30-50%. Some associated risk factors, including hypertension, enlarged aorta, peripheral vascular disease, advanced age, atheroma, and high arterial pressure on cardiopulmonary bypass, have been identified. Modification of these risk factors could reduce the incidence of this event. Prompt diagnosis and management, with the aid of intraoperative trans-esophageal echocardiography and/or epi-aortic ultrasound has been shown to reduce the mortality to 17%. We illustrate the principles of management of this pathology with the case of a 62-year-old female who developed acute Type A aortic dissection while undergoing minimally invasive mitral valve repair.

A variant of nested dissection for solving n by n grid problems

NASA Technical Reports Server (NTRS)

George, A.; Poole, W. G., Jr.; Voigt, R. G.

1976-01-01

Nested dissection orderings are known to be very effective for solving the sparse positive definite linear systems which arise from n by n grid problems. In this paper nested dissection is shown to be the final step of incomplete nested dissection, an ordering which corresponds to the premature termination of dissection. Analyses of the arithmetic and storage requirements for incomplete nested dissection are given, and the ordering is shown to be competitive with nested dissection under certain conditions.

High-Throughput Identification of Loss-of-Function Mutations for Anti-Interferon Activity in the Influenza A Virus NS Segment

PubMed Central

Wu, Nicholas C.; Young, Arthur P.; Al-Mawsawi, Laith Q.; Olson, C. Anders; Feng, Jun; Qi, Hangfei; Luan, Harding H.; Li, Xinmin; Wu, Ting-Ting

2014-01-01

ABSTRACT Viral proteins often display several functions which require multiple assays to dissect their genetic basis. Here, we describe a systematic approach to screen for loss-of-function mutations that confer a fitness disadvantage under a specified growth condition. Our methodology was achieved by genetically monitoring a mutant library under two growth conditions, with and without interferon, by deep sequencing. We employed a molecular tagging technique to distinguish true mutations from sequencing error. This approach enabled us to identify mutations that were negatively selected against, in addition to those that were positively selected for. Using this technique, we identified loss-of-function mutations in the influenza A virus NS segment that were sensitive to type I interferon in a high-throughput fashion. Mechanistic characterization further showed that a single substitution, D92Y, resulted in the inability of NS to inhibit RIG-I ubiquitination. The approach described in this study can be applied under any specified condition for any virus that can be genetically manipulated. IMPORTANCE Traditional genetics focuses on a single genotype-phenotype relationship, whereas high-throughput genetics permits phenotypic characterization of numerous mutants in parallel. High-throughput genetics often involves monitoring of a mutant library with deep sequencing. However, deep sequencing suffers from a high error rate (∼0.1 to 1%), which is usually higher than the occurrence frequency for individual point mutations within a mutant library. Therefore, only mutations that confer a fitness advantage can be identified with confidence due to an enrichment in the occurrence frequency. In contrast, it is impossible to identify deleterious mutations using most next-generation sequencing techniques. In this study, we have applied a molecular tagging technique to distinguish true mutations from sequencing errors. It enabled us to identify mutations that underwent negative selection, in addition to mutations that experienced positive selection. This study provides a proof of concept by screening for loss-of-function mutations on the influenza A virus NS segment that are involved in its anti-interferon activity. PMID:24965464

Structural snapshots along the reaction pathway of Yersinia pestis RipA, a putative butyryl-CoA transferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Torres, Rodrigo; Lan, Benson; Latif, Yama

2014-04-01

The crystal structures of Y. pestis RipA mutants were determined to provide insights into the CoA transferase reaction pathway. Yersinia pestis, the causative agent of bubonic plague, is able to survive in both extracellular and intracellular environments within the human host, although its intracellular survival within macrophages is poorly understood. A novel Y. pestis three-gene rip (required for intracellular proliferation) operon, and in particular ripA, has been shown to be essential for survival and replication in interferon γ-induced macrophages. RipA was previously characterized as a putative butyryl-CoA transferase proposed to yield butyrate, a known anti-inflammatory shown to lower macrophage-produced NOmore » levels. RipA belongs to the family I CoA transferases, which share structural homology, a conserved catalytic glutamate which forms a covalent CoA-thioester intermediate and a flexible loop adjacent to the active site known as the G(V/I)G loop. Here, functional and structural analyses of several RipA mutants are presented in an effort to dissect the CoA transferase mechanism of RipA. In particular, E61V, M31G and F60M RipA mutants show increased butyryl-CoA transferase activities when compared with wild-type RipA. Furthermore, the X-ray crystal structures of E61V, M31G and F60M RipA mutants, when compared with the wild-type RipA structure, reveal important conformational changes orchestrated by a conserved acyl-group binding-pocket phenylalanine, Phe85, and the G(V/I)G loop. Binary structures of M31G RipA and F60M RipA with two distinct CoA substrate conformations are also presented. Taken together, these data provide CoA transferase reaction snapshots of an open apo RipA, a closed glutamyl-anhydride intermediate and an open CoA-thioester intermediate. Furthermore, biochemical analyses support essential roles for both the catalytic glutamate and the flexible G(V/I)G loop along the reaction pathway, although further research is required to fully understand the function of the acyl-group binding pocket in substrate specificity.« less

An improved method for generating axenic entomopathogenic nematodes.

PubMed

Yadav, Shruti; Shokal, Upasana; Forst, Steven; Eleftherianos, Ioannis

2015-09-19

Steinernema carpocapsae are parasitic nematodes that invade and kill insects. The nematodes are mutualistically associated with the bacteria Xenorhabdus nematophila and together form an excellent model to study pathogen infection processes and host anti-nematode/antibacterial immune responses. To determine the contribution of S. carpocapsae and their associated X. nematophila to the successful infection of insects as well as to investigate the interaction of each mutualistic partner with the insect immune system, it is important to develop and establish robust methods for generating nematodes devoid of their bacteria. To produce S. carpocapsae nematodes without their associated X. nematophila bacteria, we have modified a previous method, which involves the use of a X. nematophila rpoS mutant strain that fails to colonize the intestine of the worms. We confirmed the absence of bacteria in the nematodes using a molecular diagnostic and two rounds of an axenicity assay involving appropriate antibiotics and nematode surface sterilization. We used axenic and symbiotic S. carpocapsae to infect Drosophila melanogaster larvae and found that both types of nematodes were able to cause insect death at similar rates. Generation of entomopathogenic nematodes lacking their mutualistic bacteria provides an excellent tool to dissect the molecular and genetic basis of nematode parasitism and to identify the insect host immune factors that participate in the immune response against nematode infections.

Beyond 'knock-out' mice: new perspectives for the programmed modification of the mammalian genome.

PubMed

Cohen-Tannoudji, M; Babinet, C

1998-10-01

The emergence of gene inactivation by homologous recombination methodology in embryonic stem cells has revolutionized the field of mouse genetics. Indeed, the availability of a rapidly growing number of mouse null mutants has represented an invaluable source of knowledge on mammalian development, cellular biology and physiology and has provided many models for human inherited diseases. In recent years, improvements of the original 'knock-out' strategy, as well as the exploitation of exogenous enzymatic systems that are active in the recombination process, have considerably extended the range of genetic manipulations that can be produced. For example, it is now possible to create a mouse bearing a targeted point mutation as the unique change in its entire genome therefore allowing very fine dissection of gene function in vivo. Chromosome alterations such as large deletions, inversions or translocations can also be designed and will facilitate the global functional analysis of the mouse genome. This will extend the possibilities of creating models of human pathologies that frequently originate from various chromosomal disorders. Finally, the advent of methods allowing conditional gene targeting will open the way for the analysis of the consequence of a particular mutation in a defined organ and at a specific time during the life of a mouse.

Developing and implementing an assessment method to evaluate a virtual canine anatomy program.

PubMed

Linton, Andrea; Schoenfeld-Tacher, Regina; Whalen, L Ray

2005-01-01

A computer-based anatomy program, Virtual Canine Anatomy: The Head, was incorporated into a first-year veterinary dissection laboratory two years ago to address challenges inherent in the traditional pedagogical approach. The program uses specimen photographs, QuickTime Virtual Reality, and interactive features to help students study the dissection, osteology, and radiology of the canine head. Photographs of each phase of dissection are displayed in the program, along with dissection instructions. Students can click on anatomical structures in each photograph to highlight the selected structure and display a complete description of it. Related structures and views are accessible through hyperlinks. This study was designed to measure student and faculty attitudes toward the instructional software, to gauge its effect on student achievement, and to propose evaluation methodology and instrumentation for similar projects. Observations, interviews, focus groups, surveys, and test results were used for this assessment. Results suggest positive student and faculty attitudes toward the program. Students felt the program met their needs, increased their confidence and efficiency, and was easy to use. Both students and instructors felt the program was beneficial during dissection. There was no significant change in student achievement on course tests. Future research will measure the program's effect on student-instructor interactions.

High definition video teaching module for learning neck dissection.

PubMed

Mendez, Adrian; Seikaly, Hadi; Ansari, Kal; Murphy, Russell; Cote, David

2014-03-25

Video teaching modules are proven effective tools for enhancing student competencies and technical skills in the operating room. Integration into post-graduate surgical curricula, however, continues to pose a challenge in modern surgical education. To date, video teaching modules for neck dissection have yet to be described in the literature. To develop and validate an HD video-based teaching module (HDVM) to help instruct post-graduate otolaryngology trainees in performing neck dissection. This prospective study included 6 intermediate to senior otolaryngology residents. All consented subjects first performed a control selective neck dissection. Subjects were then exposed to the video teaching module. Following a washout period, a repeat procedure was performed. Recordings of the both sets of neck dissections were de-identified and reviewed by an independent evaluator and scored using the Observational Clinical Human Reliability Assessment (OCHRA) system. In total 91 surgical errors were made prior to the HDVM and 41 after exposure, representing a 55% decrease in error occurrence. The two groups were found to be significantly different. Similarly, 66 and 24 staff takeover events occurred pre and post HDVM exposure, respectively, representing a statistically significant 64% decrease. HDVM is a useful adjunct to classical surgical training. Residents performed significantly less errors following exposure to the HD-video module. Similarly, significantly less staff takeover events occurred following exposure to the HDVM.

Harmonic Scalpel versus Electrocautery Dissection in Modified Radical Mastectomy for Breast Cancer: A Meta-Analysis.

PubMed

Huang, Jinbo; Yu, Yinghua; Wei, Changyuan; Qin, Qinghong; Mo, Qinguo; Yang, Weiping

2015-01-01

Despite the common use of conventional electrocautery in modified radical mastectomy for breast cancer, the harmonic scalpel is recently emerging as a dominant surgical instrument for dissection and haemostasis, which is thought to reduce the morbidity, such as seroma and blood loss. But the results of published trials are inconsistent. So we made the meta-analysis to assess the intraoperative and postoperative endpoints among women undergoing modified radical mastectomy with harmonic scalpel or electrocautery. A comprehensive literature search of case-control studies from PubMed, MEDLINE, EMBASE and Cochrane Library databases involving modified radical mastectomy with harmonic scalpel or electrocautery was performed. We carried out a meta-analysis of primary endpoints including postoperative drainage, seroma development, intraoperative blood loss and secondly endpoints including operative time and wound complications. We used odds ratios (ORs) with 95% confidence intervals (CIs) to evaluate the effect size for categorical outcomes and standardised mean differences (SMDs) for continuous outcomes. A total of 11 studies with 702 patients were included for this meta-analysis. There was significant difference in total postoperative drainage (SMD: -0.74 [95%CI: -1.31, -0.16]; P< 0.01), seroma development[OR: 0.49 (0.34, 0.70); P < 0.01], intraoperative blood loss(SMD: -1.14 [95%CI: -1.81,-0.47]; P < 0.01) and wound complications [OR: 0.38 (0.24, 0.59); P < 0.01] between harmonic scalpel dissection and standard electrocautery in modified radical mastectomy for breast cancer. No difference was found as for operative time between harmonic scalpel dissection and standard electrocautery (SMD: 0.04 [95%CI: -0.41, 0.50]; P = 0.85). Compared to standard electrocautery, harmonic scalpel dissection presents significant advantages in decreasing postoperative drainage, seroma development, intraoperative blood loss and wound complications in modified radical mastectomy for breast cancer, without increasing operative time. Harmonic scalpel can be recommended as a preferential surgical instrument in modified radical mastectomy.

Harmonic Scalpel versus Electrocautery Dissection in Modified Radical Mastectomy for Breast Cancer: A Meta-Analysis

PubMed Central

Huang, Jinbo; Yu, Yinghua; Wei, Changyuan; Qin, Qinghong; Mo, Qinguo; Yang, Weiping

2015-01-01

Background Despite the common use of conventional electrocautery in modified radical mastectomy for breast cancer, the harmonic scalpel is recently emerging as a dominant surgical instrument for dissection and haemostasis, which is thought to reduce the morbidity, such as seroma and blood loss. But the results of published trials are inconsistent. So we made the meta-analysis to assess the intraoperative and postoperative endpoints among women undergoing modified radical mastectomy with harmonic scalpel or electrocautery. Methods A comprehensive literature search of case-control studies from PubMed, MEDLINE, EMBASE and Cochrane Library databases involving modified radical mastectomy with harmonic scalpel or electrocautery was performed. We carried out a meta-analysis of primary endpoints including postoperative drainage, seroma development, intraoperative blood loss and secondly endpoints including operative time and wound complications. We used odds ratios (ORs) with 95% confidence intervals (CIs) to evaluate the effect size for categorical outcomes and standardised mean differences (SMDs) for continuous outcomes. Results A total of 11 studies with 702 patients were included for this meta-analysis. There was significant difference in total postoperative drainage (SMD: -0.74 [95%CI: -1.31, -0.16]; P< 0.01), seroma development[OR: 0.49 (0.34, 0.70); P < 0.01], intraoperative blood loss(SMD: -1.14 [95%CI: -1.81,-0.47]; P < 0.01) and wound complications [OR: 0.38 (0.24, 0.59); P < 0.01] between harmonic scalpel dissection and standard electrocautery in modified radical mastectomy for breast cancer. No difference was found as for operative time between harmonic scalpel dissection and standard electrocautery (SMD: 0.04 [95%CI: -0.41, 0.50]; P = 0.85). Conclusion Compared to standard electrocautery, harmonic scalpel dissection presents significant advantages in decreasing postoperative drainage, seroma development, intraoperative blood loss and wound complications in modified radical mastectomy for breast cancer, without increasing operative time. Harmonic scalpel can be recommended as a preferential surgical instrument in modified radical mastectomy. PMID:26544716

A "crick" in the neck followed by massage offered him a stroke: An uncommon case of vertebral artery dissection.

PubMed

Dutta, Gautam; Jagetia, Anita; Srivastava, Arvind K; Singh, Daljit; Singh, Hukum; Saran, Ravindra K

2018-04-10

We present an unusual case of vertebral artery dissection in a 30-year-old male patient following an episode of neck massage. He developed headache, nausea, vomiting, blurred vision, diplopia, dizziness, and ataxia following the procedure. We also discuss a review of the pathology, diagnosis, symptomatology, treatment, prognosis, and occurrence of this rare entity. Copyright © 2018 Elsevier Inc. All rights reserved.

Characterization of a Weak Allele of Zebrafish cloche Mutant

PubMed Central

Ma, Ning; Huang, Zhibin; Chen, Xiaohui; He, Fei; Wang, Kun; Liu, Wei; Zhao, Linfeng; Xu, Xiangmin; Liao, Wangjun; Ruan, Hua; Luo, Shenqiu; Zhang, Wenqing

2011-01-01

Hematopoiesis is a complicated and dynamic process about which the molecular mechanisms remain poorly understood. Danio rerio (zebrafish) is an excellent vertebrate system for studying hematopoiesis and developmental mechanisms. In the previous study, we isolated and identified a cloche 172 (clo 172) mutant, a novel allele compared to the original cloche (clo) mutant, through using complementation test and initial mapping. Here, according to whole mount in-situ hybridization, we report that the endothelial cells in clo 172 mutant embryos, although initially developed, failed to form the functional vascular system eventually. In addition, further characterization indicates that the clo 172 mutant exhibited weaker defects instead of completely lost in primitive erythroid cells and definitive hematopoietic cells compared with the clo s5 mutant. In contrast, primitive myeloid cells were totally lost in clo 172 mutant. Furthermore, these reappeared definitive myeloid cells were demonstrated to initiate from the remaining hematopoietic stem cells (HSCs) in clo 172 mutant, confirmed by the dramatic decrease of lyc in clo 172 runx1w84x double mutant. Collectively, the clo 172 mutant is a weak allele compared to the clo s5 mutant, therefore providing a model for studying the early development of hematopoietic and vascular system, as well as an opportunity to further understand the function of the cloche gene. PMID:22132109

Anatomical bases of the surgical dissection of the interatrial septum: a morphological and histological study.

PubMed

Filaire, Marc; Nohra, Olivier; Sakka, Laurent; Chadeyras, Jean Baptiste; Da Costa, Valence; Naamee, Adel; Bailly, Patrick; Escande, Georges

2008-06-01

The interatrial septum (IAS) can be dissected to resect pulmonary tumors invading the left atrium. The aim of this study was to describe the dissected structures, and to expose the benefits, the limits, and the embryologic reasons of such dissection. We dissected the IAS of 11 fresh, non-embalmed human hearts. The dissected structures were described and the length and depth of the dissection were measured. A histological study was performed in four other fresh hearts to identify and differentiate between dissectible and non-dissectible structures. The dissection was performed through a fatty tissue located between two muscular walls. The depth limit of the IAS dissection was identified as the limbus of the fossa ovalis and the muscular roof of the atria. The section of the latter doubles the depth of the dissection at the level of the upper pulmonary veins. Mean length of the dissected IAS was 77 mm (55-90). Mean depths of the IAS were 41 mm (35-50) at the level of the left upper pulmonary vein, 27 mm (12-35) between the upper and lower pulmonary veins, and 14 mm (8-20) at the level of the left inferior pulmonary vein The surgical dissection of the IAS is performed through the septum secundum that appears as an infold of the atrial wall. The length of the resectable left atrial cuff reaches a mean of 40 mm at the level of the upper pulmonary vein.

Method for Dissecting the Auditory Epithelium (Basilar Papilla) in Developing Chick Embryos.

PubMed

Levic, Snezana; Yamoah, Ebenezer N

2016-01-01

Chickens are an invaluable model for exploring auditory physiology. Similar to humans, the chicken inner ear is morphologically and functionally close to maturity at the time of hatching. In contrast, chicks can regenerate hearing, an ability lost in all mammals, including humans. The extensive morphological, physiological, behavioral, and pharmacological data available, regarding normal development in the chicken auditory system, has driven the progress of the field. The basilar papilla is an attractive model system to study the developmental mechanisms of hearing. Here, we describe the dissection technique for isolating the basilar papilla in developing chick inner ear. We also provide detailed examples of physiological (patch clamping) experiments using this preparation.

Interrelationships between mitochondrial fusion, energy metabolism and oxidative stress during development in Caenorhabditis elegans.

PubMed

Yasuda, Kayo; Hartman, Philip S; Ishii, Takamasa; Suda, Hitoshi; Akatsuka, Akira; Shoyama, Tetsuji; Miyazawa, Masaki; Ishii, Naoaki

2011-01-21

Mitochondria are known to be dynamic structures with the energetically and enzymatically mediated processes of fusion and fission responsible for maintaining a constant flux. Mitochondria also play a role of reactive oxygen species production as a byproduct of energy metabolism. In the current study, interrelationships between mitochondrial fusion, energy metabolism and oxidative stress on development were explored using a fzo-1 mutant defective in the fusion process and a mev-1 mutant overproducing superoxide from mitochondrial electron transport complex II of Caenorhabditis elegans. While growth and development of both single mutants was slightly delayed relative to the wild type, the fzo-1;mev-1 double mutant experienced considerable delay. Oxygen sensitivity during larval development, superoxide production and carbonyl protein accumulation of the fzo-1 mutant were similar to wild type. fzo-1 animals had significantly lower metabolism than did N2 and mev-1. These data indicate that mitochondrial fusion can profoundly affect energy metabolism and development. Copyright © 2010 Elsevier Inc. All rights reserved.

Assessment of stent edge dissections by fractional flow reserve.

PubMed

Chung, Ju-Hyun; Ann, Soe Hee; Koo, Bon-Kwon; Nam, Chang-Wook; Doh, Joon-Hyung; Singh, Gillian Balbir; Kim, Hyung Il; Shin, Eun-Seok

2015-04-15

Edge dissections after intervention have been studied with imaging techniques, however, functional assessment has not been studied yet. We investigated the relationship between fractional flow reserve (FFR) and the angiographic type of stent edge dissections and tried to assess the use of FFR-guided management for edge dissection. 51 edge dissections assessed by FFR were included in this prospective observational study. FFR was measured for each type of edge dissection and compared with quantitative coronary angiographic findings. Clinical outcomes were evaluated based on FFR measurements. Edge dissections were classified as type A (47.1%; 24/51), type B (41.2%; 21/51), type C (2.0%; 1/51) and type D (9.8%; 5/51). Mean FFR in type A dissection was 0.87 ± 0.09, in type B 0.86 ± 0.07, in type C 0.72 and in type D 0.57 ± 0.08. All type C and D dissections (6/51) had FFR ≤ 0.8 and were treated with additional stents. Among the 45 type A and B dissections, 8 had a FFR ≤ 0.8 (17.8%), and 50% received additional stenting. All dissections with FFR >0.8 were left untreated except one long dissection case. There was no death, myocardial infarction or target lesion revascularization during hospitalization or the follow-up period (median 152 days; IQR 42-352 days). FFR correlates well with an angiographic type of edge dissection. Angiographic findings are sufficient for deciding the treatment of severe dissections such as types C and D, while FFR-guided management may be safe and effective for mild edge dissections such as types A and B. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

CT versus MR Techniques in the Detection of Cervical Artery Dissection.

PubMed

Hanning, Uta; Sporns, Peter B; Schmiedel, Meilin; Ringelstein, Erich B; Heindel, Walter; Wiendl, Heinz; Niederstadt, Thomas; Dittrich, Ralf

2017-11-01

Spontaneous cervical artery dissection (sCAD) is an important etiology of juvenile stroke. The gold standard for the diagnosis of sCAD is convential angiography. However, magnetic resonance imaging (MRI)/MR angiography (MRA) and computed tomography (CT)/CT angiography (CTA) are frequently used alternatives. New developments such as multislice CT/CTA have enabled routine acquisition of thinner sections with rapid imaging times. The goal of this study was to compare the capability of recent developed 128-slice CT/CTA to MRI/MRA to detect radiologic features of sCAD. Retrospective review of patients with suspected sCAD (n = 188) in a database of our Stroke center (2008-2014), who underwent CT/CTA and MRI/MRA on initial clinical work-up. A control group of 26 patients was added. All Images were evaluated concerning specific and sensitive radiological features for dissection by two experienced neuroradiologists. Imaging features were compared between the two modalities. Forty patients with 43 dissected arteries received both modalities (29 internal carotid arteries [ICAs] and 14 vertebral arteries [VAs]). All CADs were identified in CT/CTA and MRI/MRA. The features intimal flap, stenosis, and lumen irregularity appeared in both modalities. One high-grade stenosis was identified by CT/CTA that was expected occluded on MRI/MRA. Two MRI/MRA-confirmed pseudoaneurysms were missed by CT/CTA. None of the controls evidenced specific imaging signs for dissection. CT/CTA is a reliable and better available alternative to MRI/MRA for diagnosis of sCAD. CT/CTA should be used to complement MRI/MRA in cases where MRI/MRA suggests occlusion. Copyright © 2017 by the American Society of Neuroimaging.

Movement to curtail animal dissections in zoology curriculum: review of the Indian experience.

PubMed

Akbarsha, Mohammad Abdulkader

2007-01-01

Animal dissections have been dropped from the curriculum in several developed countries, and virtual laboratories are taking their place, or at least the concept of the "three R's" is becoming accepted. Yet, the scenario in the developing countries in this regard has been dismal. However, recently, a movement has started in India in this area, thanks to the aggressive approach of PfA, I-CARE and InterNICHE, supported by a few zoology educators and policy makers, who joined this movement as freelancers. The aggressive campaigners against animal dissections put up convincing arguments to the orthodox zoology educators and higher education planners with such veracity that the arguments cannot be ignored. The arguments, to be presented in detail at the conference, and the campaign have been rewarded with success such that a few universities and autonomous colleges have revamped their zoology curricula so as to dispense with or reduce animal dissections. The Bharathidasan University, Tiruchirappalli, Tamil Nadu, India, has been the trendsetter, evolving what is known as the "Bharathidasan University Model". A memorandum from I-CARE and PfA to the University Grants Commission, Government of India, New Delhi, was sent out by the UGC to the universities with a request to consider the points positively. However, there is still a need to bring about an attitudinal change in the zoology educators and higher education planners such that they participate willingly in this endeavour. The role-players at all levels are identified and approached with a language that is understandable to each and are adequately supported by hands-on training in the alternative methods. Ultimately, the responsibility in this regard lies with the educators themselves, since they are the ones who, working in the academic committees that design the curricula, can cut down on the requirement for dissections.

How can we deal with mental distress in the dissection room?-An evaluation of the need for psychological support.

PubMed

Boeckers, Anja; Brinkmann, Anke; Jerg-Bretzke, Lucia; Lamp, Christoph; Traue, Harald C; Boeckers, Tobias M

2010-12-20

The dissection course (DC) is an essential part of the preclinical medical curriculum that mediates professionalism. The process of dissecting, however, has an inherent additional stress potential. Our study determined student mental stress, their need of psychological support and factors influencing this need. A quantitative longitudinal query before, during and after the DC was performed including the Brief Symptom Inventory (BSI) as well as self-formulated questions used a 5-point Likert scale. Half of the students who anticipated dissection to be a stress factor reported that this declined significantly over time. Instead, student fear of not being able to cope with the work load increased significantly. As many as 64% of the students favored psychological support on the first course day, while 75% rejected this during the period of dissection and 39% appreciated this after the course. Moreover, 42% emphasized the importance of the funeral ceremony. Additionally, 75% documented their need for support in coping with stress and learning strategies. Gender, previous medical training, and BSI levels were identified as psychosocial influence factors. A majority of students named friends, members of their family or workmates as partners with whom they could talk about mental stress. Our results document the need to develop an optimum support during the DC taking into account the ascertained indicators. Exemplarily the Institute of Anatomy and Cell Biology at Ulm University suggests several options like a step by step approach for optimization. These measures reduce mental stress and help students to cope with it by the development of "detached concern" towards their "first patient" as this will decisively influence their future professional behavior. 2010 Elsevier GmbH. All rights reserved.

Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume.

PubMed

Grassini, Daniela R; Lagendijk, Anne K; De Angelis, Jessica E; Da Silva, Jason; Jeanes, Angela; Zettler, Nicole; Bower, Neil I; Hogan, Benjamin M; Smith, Kelly A

2018-05-11

Atrial natriuretic peptide ( nppa/anf ) and brain natriuretic peptide ( nppb/bnp ) form a gene cluster with expression in the chambers of the developing heart. Despite restricted expression, a function in cardiac development has not been demonstrated by mutant analysis. This is attributed to functional redundancy however their genomic location in cis has impeded formal analysis. Using genome-editing, we generated mutants for nppa and nppb and found single mutants indistinguishable from wildtype whereas nppa / nppb double mutants display heart morphogenesis defects and pericardial oedema. Analysis of atrioventricular canal (AVC) markers show expansion of bmp4 , tbx2b, has2 and versican expression into the atrium of double mutants. This expanded expression correlates with increased extracellular matrix in the atrium. Using a biosensor for Hyaluronic acid to measure the cardiac jelly (cardiac extracellular matrix), we confirm cardiac jelly expansion in nppa / nppb double mutants. Finally, bmp4 knockdown rescues the expansion of has2 expression and cardiac jelly in double mutants. This definitively shows that nppa and nppb function redundantly during cardiac development to restrict gene expression to the AVC, preventing excessive cardiac jelly synthesis in the atrial chamber. © 2018. Published by The Company of Biologists Ltd.

Differential effects of lesion mimic mutants in barley on disease development by facultative pathogens

PubMed Central

McGrann, Graham R. D.; Steed, , Andrew; Burt, Christopher; Nicholson, Paul; Brown, James K. M.

2015-01-01

Lesion mimic mutants display spontaneous necrotic spots and chlorotic leaves as a result of mis-regulated cell death programmes. Typically these mutants have increased resistance to biotrophic pathogens but their response to facultative fungi that cause necrotrophic diseases is less well studied. The effect of altered cell death regulation on the development of disease caused by Ramularia collo-cygni, Fusarium culmorum and Oculimacula yallundae was explored using a collection of barley necrotic (nec) lesion mimic mutants. nec8 mutants displayed lower levels of all three diseases compared to nec9 mutants, which had increased R. collo-cygni but decreased F. culmorum disease symptoms. nec1 mutants reduced disease development caused by both R. collo-cygni and F. culmorum. The severity of the nec1-induced lesion mimic phenotype and F. culmorum symptom development was reduced by mutation of the negative cell death regulator MLO. The significant reduction in R. collo-cygni symptoms caused by nec1 was completely abolished in the presence of the mlo-5 allele and both symptoms and fungal biomass were greater than in the wild-type. These results indicate that physiological pathways involved in regulation of cell death interact with one another in their effects on different fungal pathogens. PMID:25873675

A Laboratory Manual for Stepwise Cerebral White Matter Fiber Dissection.

PubMed

Koutsarnakis, Christos; Liakos, Faidon; Kalyvas, Aristotelis V; Sakas, Damianos E; Stranjalis, George

2015-08-01

White matter fiber dissection is an important method in acquiring a thorough neuroanatomic knowledge for surgical practice. Previous studies have definitely improved our understanding of intrinsic brain anatomy and emphasized on the significance of this technique in modern neurosurgery. However, current literature lacks a complete and concentrated laboratory guide about the entire dissection procedure. Hence, our primary objective is to introduce a detailed laboratory manual for cerebral white matter dissection by highlighting consecutive dissection steps, and to stress important technical comments facilitating this complex procedure. Twenty adult, formalin-fixed cerebral hemispheres were included in the study. Ten specimens were dissected in the lateromedial and 10 in the mediolateral direction, respectively, using the fiber dissection technique and the microscope. Eleven and 8 consecutive and distinctive dissection steps are recommended for the lateromedial and mediolateral dissection procedures, respectively. Photographs highlighting various anatomic landmarks accompany every step. Technical recommendations, facilitating the dissection process, are also indicated. The fiber dissection technique, although complex and time consuming, offers a three-dimensional knowledge of intrinsic brain anatomy and architecture, thus improving both the quality of microneurosurgery and the patient's standard of care. The present anatomic study provides a thorough dissection manual to those who study brain anatomy using this technique. Copyright © 2015 Elsevier Inc. All rights reserved.

Mutants in the mouse NuRD/Mi2 component P66alpha are embryonic lethal.

PubMed

Marino, Susan; Nusse, Roel

2007-06-13

The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66alpha and p66beta. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. We made loss of function mutants in the mouse p66alpha gene (mp66alpha, official name Gatad2a, MGI:2384585). We found that mp66alpha is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66alpha in gene silencing. mp66alpha is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing.

Endovascular treatment of patients with types A and B thoracic aortic dissection using Relay thoracic stent-grafts: results from the RESTORE Patient Registry.

PubMed

Zipfel, Burkhart; Czerny, Martin; Funovics, Martin; Coppi, Gioacchino; Ferro, Carlo; Rousseau, Hervé; Berti, Sergio; Tealdi, Domenico G; Riambau, Vincent; Mangialardi, Nicola; Sassi, Carlo

2011-04-01

To evaluate the safety and performance of Relay stent-grafts in patients with acute or chronic aortic dissections. Patients with types A or B aortic dissections suitable for treatment with Relay stent-grafts and followed for 2 years after thoracic endovascular aortic repair (TEVAR) were identified from a company-sponsored registry database established in January 2006. Ninety-one consecutive patients (69 men; mean age 65 years) underwent TEVAR with Relay stent-grafts for dissection. Most patients (76, 84%) had type B dissections; 61 of all patients were classified as chronic and 30 as acute. The technical success rate was 95% (97% in acute, 95% in chronic, and 93% in type B dissections). The type I endoleak rate was 7% (7% in acute and 8% in chronic dissections); all occurred in patients with type B dissections. Paraplegia, paraparesis, and stroke occurred in 4, 1, and 2 patients, respectively; 2 cases of paraplegia occurred in patients with acute type B dissections. Thirty-day mortality was 8% (13% in acute and 5% in chronic dissections); all deaths occurred in patients with type B dissections. The 2-year survival rate was 82% in the overall population and 84% in patients with type B dissections. The combination of Relay's features, such as stent conformability, radial force, atraumatic design, and controlled deployment and fixation, may contribute to the safety of the Relay stent-grafts for the treatment of thoracic aortic dissections, including acute and chronic type B dissections.

Dissecting Seed Mucilage Adherence Mediated by FEI2 and SOS5

PubMed Central

Griffiths, Jonathan S.; Crepeau, Marie-Jeanne; Ralet, Marie-Christine; Seifert, Georg J.; North, Helen M.

2016-01-01

The plant cell wall is held together by the interactions between four major components: cellulose, pectin, hemicellulose, and proteins. Mucilage is a powerful model system to study the interactions between these components as it is formed of polysaccharides that are deposited in the apoplast of seed coat epidermal cells during seed development. When seeds are hydrated, these polysaccharides expand rapidly out of the apoplastic pocket, and form an adherent halo of mucilage around the seed. In Arabidopsis, mutations in multiple genes have similar loss of mucilage adherence phenotypes including CELLULOSE SYNTHASE 5 (CESA5)/MUCILAGE-MODIFIED 3 (MUM3), MUM5/MUCI21, SALT-OVERLY SENSITIVE 5 (SOS5), and FEI2. Here, we examine the interactions between these factors to better understand how they participate to control mucilage adherence. Double mutant phenotypes indicated that MUM5 and CESA5 function in a common mechanism that adheres pectin to the seed through the biosynthesis of cellulose and xylan, whereas SOS5 and FEI2, encoding a fasciclin-like arabinogalactan protein or a receptor-like kinase, respectively, function through an independent pathway. Cytological analyses of mucilage indicates that heteromannans are associated with cellulose, and not in the pathway involving SOS5 or FEI2. A SOS5 fluorescent protein fusion (SOS5-mCITRINE) was localized throughout the mucilage pocket, consistent with a structural role in pectin adhesion. The relationship between SOS5 and FEI2 mediated mucilage adherence was examined in more detail and while sos5 and fei2 mutants show similar phenotypes, key differences in the macromolecular characteristics and amounts of mucilage polymers were observed. FEI2 thus appears to have additional, as well as overlapping functions, with SOS5. Given that FEI2 is required for SOS5 function, we propose that FEI2 serves to localize SOS5 at the plasma membrane where it establishes interactions with mucilage polysaccharides, notably pectins, required for mucilage adherence prior to SOS5 being released into the apoplast. PMID:27524986

Pain, quality of life, and spinal accessory nerve status after neck dissection.

PubMed

Terrell, J E; Welsh, D E; Bradford, C R; Chepeha, D B; Esclamado, R M; Hogikyan, N D; Wolf, G T

2000-04-01

To assess quality of life (QOL) in patients with head and neck cancer who underwent neck dissection and to compare QOL scores for patients in whom the spinal accessory nerve (CN XI) was resected or preserved. SETTING AND DESIGN AND OUTCOMES MEASURES: Three hundred ninety-seven patients who had undergone treatment for head and neck cancer completed the University of Michigan Head and Neck Quality of Life (HNQOL) instrument, the Medical Outcomes Study SF-12 General Health Survey, and questions on "pain despite pain medications" and headaches. Of the 397 patients, 222 had no neck dissection, 46 had neck dissections resecting CN XI, and 129 had dissection sparing CN XI. Of the latter group, 68 patients had dissections sparing level V and 61 dissections included level V. Age, sex, primary site distribution, and T stage were not different between the groups. Patients who had neck dissections sparing CN XI had better scores on the HNQOL pain domain (P = .002), had less shoulder or neck pain (P = .003), and took pain medications less frequently (P = .0004) compared with patients who had neck dissections sacrificing CN XI. When CN XI was preserved, patients who had no level V dissection had better pain domain scores (P = .03) and eating domain scores (P = .007) on the HNQOL, had less shoulder or neck pain (P = .006), and had less physical problems (P = .03) than patients who had level V dissected. On multivariate analysis, pain-related QOL scores after neck dissection were significantly better (P < .01) if patients had dissections with preservation of CN XI and if level V was not dissected. Neck dissections sparing CN XI are associated with better pain scores on the HNQOL, less shoulder and neck pain, and less need for medications. When CN XI is spared, not dissecting level V of the neck is associated with better HNQOL pain scores, less shoulder or neck pain, and fewer physical problems.

Advances in Procedural Techniques - Antegrade

PubMed Central

Wilson, William; Spratt, James C.

2014-01-01

There have been many technological advances in antegrade CTO PCI, but perhaps most importantly has been the evolution of the “hybrid’ approach where ideally there exists a seamless interplay of antegrade wiring, antegrade dissection re-entry and retrograde approaches as dictated by procedural factors. Antegrade wire escalation with intimal tracking remains the preferred initial strategy in short CTOs without proximal cap ambiguity. More complex CTOs, however, usually require either a retrograde or an antegrade dissection re-entry approach, or both. Antegrade dissection re-entry is well suited to long occlusions where there is a healthy distal vessel and limited “interventional” collaterals. Early use of a dissection re-entry strategy will increase success rates, reduce complications, and minimise radiation exposure, contrast use as well as procedural times. Antegrade dissection can be achieved with a knuckle wire technique or the CrossBoss catheter whilst re-entry will be achieved in the most reproducible and reliable fashion by the Stingray balloon/wire. It should be avoided where there is potential for loss of large side branches. It remains to be seen whether use of newer dissection re-entry strategies will be associated with lower restenosis rates compared with the more uncontrolled subintimal tracking strategies such as STAR and whether stent insertion in the subintimal space is associated with higher rates of late stent malapposition and stent thrombosis. It is to be hoped that the algorithms, which have been developed to guide CTO operators, allow for a better transfer of knowledge and skills to increase uptake and acceptance of CTO PCI as a whole. PMID:24694104

Analysis of flow patterns in a patient-specific aortic dissection model.

PubMed

Cheng, Z; Tan, F P P; Riga, C V; Bicknell, C D; Hamady, M S; Gibbs, R G J; Wood, N B; Xu, X Y

2010-05-01

Aortic dissection is the most common acute catastrophic event affecting the thoracic aorta. The majority of patients presenting with an uncomplicated type B dissection are treated medically, but 25% of these patients develop subsequent aneurysmal dilatation of the thoracic aorta. This study aimed at gaining more detailed knowledge of the flow phenomena associated with this condition. Morphological features and flow patterns in a dissected aortic segment of a presurgery type B dissection patient were analyzed based on computed tomography images acquired from the patient. Computational simulations of blood flow in the patient-specific model were performed by employing a correlation-based transitional version of Menter's hybrid k-epsilon/k-omega shear stress transport turbulence model implemented in ANSYS CFX 11. Our results show that the dissected aorta is dominated by locally highly disturbed, and possibly turbulent, flow with strong recirculation. A significant proportion (about 80%) of the aortic flow enters the false lumen, which may further increase the dilatation of the aorta. High values of wall shear stress have been found around the tear on the true lumen wall, perhaps increasing the likelihood of expanding the tear. Turbulence intensity in the tear region reaches a maximum of 70% at midsystolic deceleration phase. Incorporating the non-Newtonian behavior of blood into the same transitional flow model has yielded a slightly lower peak wall shear stress and higher maximum turbulence intensity without causing discernible changes to the distribution patterns. Comparisons between the laminar and turbulent flow simulations show a qualitatively similar distribution of wall shear stress but a significantly higher magnitude with the transitional turbulence model.

Development of instructional, interactive, multimedia anatomy dissection software: a student-led initiative.

PubMed

Inwood, Matthew J; Ahmad, Jamil

2005-11-01

Although dissection provides an unparalleled means of teaching gross anatomy, it constitutes a significant logistical and financial investment for educational institutions. The increasing availability and waning cost of computer equipment has enabled many institutions to supplement their anatomy curriculum with Computer Aided Learning (CAL) software. At the Royal College of Surgeons in Ireland, two undergraduate medical students designed and produced instructional anatomy dissection software for use by first and second year medical students. The software consists of full-motion, narrated, QuickTime MPG movies presented in a Macromedia environment. Forty-four movies, between 1-11 min in duration, were produced. Each movie corresponds to a dissection class and precisely demonstrates the dissection and educational objectives for that class. The software is distributed to students free of charge and they are encouraged to install it on their Apple iBook computers. Results of a student evaluation indicated that the software was useful, easy to use, and improved the students' experience in the dissection classes. The evaluation also indicated that only a minority of students regularly used the software or had it installed on their laptop computers. Accordingly, effort should also be directed toward making the software more accessible and increasing students' comfort and familiarity with novel instructional media. The successful design and implementation of this software demonstrates that CAL software can be employed to augment, enhance and improve anatomy instruction. In addition, effective, high quality, instructional multimedia software can be tailored to an educational institution's requirements and produced by novice programmers at minimal cost. Copyright 2005 Wiley-Liss, Inc

Endovascular Treatment of Ruptured Vertebrobasilar Dissecting Aneurysms Using Flow Diversion Embolization Devices: Single-Institution Experience.

PubMed

Guerrero, Waldo R; Ortega-Gutierrez, Santiago; Hayakawa, Minako; Derdeyn, Colin P; Rossen, James D; Hasan, David; Samaniego, Edgar A

2018-01-01

Treatment of ruptured posterior circulation dissecting aneurysms is technically challenging with potentially high morbidity and mortality. We sought to assess the safety and feasibility of using a flow-diversion device (FDD) and a specific acute antiplatelet aggregation protocol in the management of ruptured dissecting aneurysms. Subjects with ruptured dissecting aneurysms treated during a 3-year period were retrospectively identified from a prospective registry. Intraoperative complications, morbidity, and mortality were recorded. Tirofiban maintenance infusion without bolus was administered intravenously immediately after deployment of the FDD, and almost all patients were loaded with dual antiplatelet (aspirin and clopidogrel) post procedure. Clinical follow-up evaluation and modified Rankin Scale were assessed. Nine subjects with ruptured posterior circulation dissecting aneurysms were treated with an FDD: 5 vertebral artery, 2 basilar artery, and 2 posterior inferior cerebellar artery aneurysms. Average World Federation of Neurosurgical Societies score was 2 (range 1-5). Seven patients had external ventricular drain placed acutely for hydrocephalus. Eight patients received tirofiban infusion without bolus after FDD. No intraoperative complications occurred. Two subjects developed asymptomatic intraparenchymal hemorrhage found on surveillance noncontrast computed tomography. One subject suffered a major intraparenchymal hemorrhage and died a few days post intervention after additional anticoagulation was started for a left ventricular assist device. Follow-up modified Rankin Scale within 12 months was 0 in 3 subjects, 1 in 3 subjects, 2 in 1 subject, and 4 in 1. Treatment of dissecting posterior circulation aneurysms with FDDs is feasible and a potential alternative to deconstructive techniques. Copyright © 2017 Elsevier Inc. All rights reserved.

Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis

PubMed Central

Basu, Debarati; Showalter, Allan M.

2015-01-01

Hydroxyproline-O-galactosyltransferase (GALT) initiates O-glycosylation of arabinogalactan-proteins (AGPs). We previously characterized GALT2 (At4g21060), and now report on functional characterization of GALT5 (At1g74800). GALT5 was identified using heterologous expression in Pichia and an in vitro GALT assay. Product characterization showed GALT5 specifically adds galactose to hydroxyproline in AGP protein backbones. Functions of GALT2 and GALT5 were elucidated by phenotypic analysis of single and double mutant plants. Allelic galt5 and galt2 mutants, and particularly galt2 galt5 double mutants, demonstrated lower GALT activities and reductions in β-Yariv-precipitated AGPs compared to wild type. Mutant plants showed pleiotropic growth and development phenotypes (defects in root hair growth, root elongation, pollen tube growth, flowering time, leaf development, silique length, and inflorescence growth), which were most severe in the double mutants. Conditional mutant phenotypes were also observed, including salt-hypersensitive root growth and root tip swelling as well as reduced inhibition of pollen tube growth and root growth in response to β-Yariv reagent. These mutants also phenocopy mutants for an AGP, SOS5, and two cell wall receptor-like kinases, FEI1 and FEI2, which exist in a genetic signaling pathway. In summary, GALT5 and GALT2 function as redundant GALTs that control AGP O-glycosylation, which is essential for normal growth and development. PMID:25974423

Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis.

PubMed

Basu, Debarati; Wang, Wuda; Ma, Siyi; DeBrosse, Taylor; Poirier, Emily; Emch, Kirk; Soukup, Eric; Tian, Lu; Showalter, Allan M

2015-01-01

Hydroxyproline-O-galactosyltransferase (GALT) initiates O-glycosylation of arabinogalactan-proteins (AGPs). We previously characterized GALT2 (At4g21060), and now report on functional characterization of GALT5 (At1g74800). GALT5 was identified using heterologous expression in Pichia and an in vitro GALT assay. Product characterization showed GALT5 specifically adds galactose to hydroxyproline in AGP protein backbones. Functions of GALT2 and GALT5 were elucidated by phenotypic analysis of single and double mutant plants. Allelic galt5 and galt2 mutants, and particularly galt2 galt5 double mutants, demonstrated lower GALT activities and reductions in β-Yariv-precipitated AGPs compared to wild type. Mutant plants showed pleiotropic growth and development phenotypes (defects in root hair growth, root elongation, pollen tube growth, flowering time, leaf development, silique length, and inflorescence growth), which were most severe in the double mutants. Conditional mutant phenotypes were also observed, including salt-hypersensitive root growth and root tip swelling as well as reduced inhibition of pollen tube growth and root growth in response to β-Yariv reagent. These mutants also phenocopy mutants for an AGP, SOS5, and two cell wall receptor-like kinases, FEI1 and FEI2, which exist in a genetic signaling pathway. In summary, GALT5 and GALT2 function as redundant GALTs that control AGP O-glycosylation, which is essential for normal growth and development.

Neck dissection

MedlinePlus

... cancer - neck dissection; Throat cancer - neck dissection; Squamous cell cancer - neck dissection ... blood cells around the body to fight infection. Cancer cells in the mouth or throat can travel in ...

The quest for epigenetic regulation underlying unisexual flower development in Cucumis melo.

PubMed

Latrasse, David; Rodriguez-Granados, Natalia Y; Veluchamy, Alaguraj; Mariappan, Kiruthiga Gayathri; Bevilacqua, Claudia; Crapart, Nicolas; Camps, Celine; Sommard, Vivien; Raynaud, Cécile; Dogimont, Catherine; Boualem, Adnane; Benhamed, Moussa; Bendahmane, Abdelhafid

2017-01-01

Melon ( Cucumis melo ) is an important vegetable crop from the Cucurbitaceae family and a reference model specie for sex determination, fruit ripening and vascular fluxes studies. Nevertheless, the nature and role of its epigenome in gene expression regulation and more specifically in sex determination remains largely unknown. We have investigated genome wide H3K27me3 and H3K9ac histone modifications and gene expression dynamics, in five melon organs. H3K9ac and H3K27me3 were mainly distributed along gene-rich regions and constrained to gene bodies. H3K9ac was preferentially located at the TSS, whereas H3K27me3 distributed uniformly from TSS to TES. As observed in other species, H3K9ac and H3K27me3 correlated with high and low gene expression levels, respectively. Comparative analyses of unisexual flowers pointed out sex-specific epigenetic states of TFs involved in ethylene response and flower development. Chip-qPCR analysis of laser dissected carpel and stamina primordia, revealed sex-specific histone modification of MADS-box genes. Using sex transition mutants, we demonstrated that the female promoting gene, CmACS11 , represses the expression of the male promoting gene CmWIP1 via deposition of H3K27me3. Our findings reveal the organ-specific landscapes of H3K9ac and H3K27me3 in melon. Our results also provide evidence that the sex determination genes recruit histone modifiers to orchestrate unisexual flower development in monoecious species.

Surgical model pig ex vivo for venous dissection teaching in medical schools.

PubMed

Tube, Milton Ignacio Carvalho; Spencer-Netto, Fernando Antonio Campelo; Oliveira, Anderson Igor Pereira de; Holanda, Arthur Cesário de; Barros, Bruno Leão Dos Santos; Rezende, Caio Cezar Gomes; Cavalcanti, João Pedro Guerra; Batista, Marília Apolinário; Campos, Josemberg Marins

2017-02-01

To investigate a method for development of surgical skills in medical students simulating venous dissection in surgical ex vivo pig model. Prospective, analytical, experimental, controlled study with four stages: selection, theoretical teaching, training and assessment. Sample of 312 students was divided into two groups: Group A - 2nd semester students; Group B - students of 8th semester. The groups were divided into five groups of 12 students, trained two hours per week in the semester. They set up four models to three students in each skill station assisted by a monitor. Teaching protocol emergency procedures training were applied to venous dissection, test goal-discursive and OSATS scale. The pre-test confirmed that the methodology has not been previously applied to the students. The averages obtained in the theoretical evaluation reached satisfactory parameters in both groups. The results of applying OSATS scale showed the best performance in group A compared to group B, however, both groups had satisfactory medium. The method was enough to raise a satisfactory level of skill both groups in venous dissection running on surgical swine ex vivo models.

En Bloc Hilar Dissection of the Right Hepatic Artery in Continuity with the Bile Duct: a Technique to Reduce Biliary Complications After Adult Living-Donor Liver Transplantation.

PubMed

Abu-Gazala, Samir; Olthoff, Kim M; Goldberg, David S; Shaked, Abraham; Abt, Peter L

2016-04-01

Techniques that preserve the right hepatic artery and the common bile duct in continuity during the dissection may be associated with lower rates of biliary complications in living-donor liver transplants. This study sought to determine whether en bloc hilar dissections were associated with fewer biliary complications in living-donor liver transplants. This was a retrospective review of 41 adult LDLTs performed in a single, liver transplant center between February 2007 and September 2014. The primary outcome of interest was the occurrence of at least one of the following biliary complications: anastomotic leak, stricture, or biloma. The primary predictor of interest was the hilar dissection technique: conventional hilar dissection vs. en bloc hilar dissection. A total of 41 LDLTs were identified, 24 had a conventional, and 17 an en bloc hilar biliary dissection. The occurrence of any biliary complication was significantly more common in the conventional hilar dissection group compared to the en bloc hilar dissection group (66.7 vs. 35.3%, respectively, p = 0.047). In particularly, anastomotic strictures were significantly more common in the conventional hilar dissection group compared to the en bloc hilar dissection group (54.2 vs. 23.5%., respectively, p = 0.049). En bloc hilar dissection technique may decrease biliary complication rates in living donor liver transplants.

[Development of elastameric sealant designed for arterial field].

PubMed

Matsuda, Takehisa; Nakajima, Nobuyuki

2013-04-01

The development of a reliable surgical sealant specific for arterial tissues has been long awaited. In this article, first the "ideal" adhesion mechanism formulated from biomechanical concept is proposed for ensured hemostasis in dissected arteries with pulsatile flow. An urethane prepolymer prepared along the design criteria is viscous liquid. Due to its high water absorbility and high reactivity with water, the sealant applied to vascular tissues becomes an elastomer within several minutes. When the sealant was applied to dissected canine abdominal arteries with 3 stay sutures, followed by declamping 5 minutes, neither bleeding nor detrimental effect on tissue morphogenesis was observed. This sealant is being ready to the market.

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Transcriptional profiles of Arabidopsis stomataless mutants reveal developmental and physiological features of life in the absence of stomata

PubMed Central

de Marcos, Alberto; Triviño, Magdalena; Pérez-Bueno, María Luisa; Ballesteros, Isabel; Barón, Matilde; Mena, Montaña; Fenoll, Carmen

2015-01-01

Loss of function of the positive stomata development regulators SPCH or MUTE in Arabidopsis thaliana renders stomataless plants; spch-3 and mute-3 mutants are extreme dwarfs, but produce cotyledons and tiny leaves, providing a system to interrogate plant life in the absence of stomata. To this end, we compared their cotyledon transcriptomes with that of wild-type plants. K-means clustering of differentially expressed genes generated four clusters: clusters 1 and 2 grouped genes commonly regulated in the mutants, while clusters 3 and 4 contained genes distinctively regulated in mute-3. Classification in functional categories and metabolic pathways of genes in clusters 1 and 2 suggested that both mutants had depressed secondary, nitrogen and sulfur metabolisms, while only a few photosynthesis-related genes were down-regulated. In situ quenching analysis of chlorophyll fluorescence revealed limited inhibition of photosynthesis. This and other fluorescence measurements matched the mutant transcriptomic features. Differential transcriptomes of both mutants were enriched in growth-related genes, including known stomata development regulators, which paralleled their epidermal phenotypes. Analysis of cluster 3 was not informative for developmental aspects of mute-3. Cluster 4 comprised genes differentially up−regulated in mute−3, 35% of which were direct targets for SPCH and may relate to the unique cell types of mute−3. A screen of T-DNA insertion lines in genes differentially expressed in the mutants identified a gene putatively involved in stomata development. A collection of lines for conditional overexpression of transcription factors differentially expressed in the mutants rendered distinct epidermal phenotypes, suggesting that these proteins may be novel stomatal development regulators. Thus, our transcriptome analysis represents a useful source of new genes for the study of stomata development and for characterizing physiology and growth in the absence of stomata. PMID:26157447

Virtual fetal pig dissection as an agent of knowledge acquisition and attitudinal change in female high school biology students

NASA Astrophysics Data System (ADS)

Maloney, Rebecca Scudari

One way to determine if all students can learn through the use of computers is to introduce a lesson taught completely via computers and compare the results with those gained when the same lesson is taught in a traditional manner. This study attempted to determine if a virtual fetal pig dissection can be used as a viable alternative for an actual dissection for females enrolled in high school biology classes by comparing the knowledge acquisition and attitudinal change between the experimental (virtual dissection) and control (actual dissection) groups. Two hundred and twenty-four students enrolled in biology classes in a suburban all-girl parochial high school participated in this study. Female students in an all-girl high school were chosen because research shows differences in science competency and computer usage between the genders that may mask the performance of females on computer-based tasks in a science laboratory exercise. Students who completed the virtual dissection scored significantly higher on practical test and objective tests that were used to measure knowledge acquisition. Attitudinal change was measured by examining the students' attitudes toward dissections, computer usage in the classroom, and toward biology both before and after the dissections using pre and post surveys. Significant results in positive gain scores were found in the virtual dissection group's attitude toward dissections, and their negative gain score toward virtual dissections. Attitudinal changes toward computers and biology were not significant. A purposefully selected sample of the students were interviewed, in addition to gathering a sample of the students' daily dissection journals, as data highlighting their thoughts and feelings about their dissection experience. Further research is suggested to determine if a virtual laboratory experience can be a substitute for actual dissections, or may serve as an enhancement to an actual dissection.

Talking about death: implementing peer discussion as a coping mechanism to overcome fears about dissection, death, and dying.

PubMed

Kotzé, Sanet Henriët; Mole, Calvin Gerald

2013-01-01

Many studies have reported on the perceptions of medical students toward dissection. It is important to understand the feelings and symptoms experienced during dissection so that they can be adequately handled. Prior to dissection, first year students are given lectures on aspects of dissection, death and dying, and death rituals in various cultures. Two separate questionnaires, one given during the first week of dissection and another given one month into the program were then completed anonymously by dissection groups. The questions were designed to be open-ended, thereby encouraging group discussion amongst students. The questionnaires were used to determine the perception of students to dissection and to discover if these perceptions change during the dissection program. The first questionnaire revealed that students do experience fears and anxiety prior to and at the beginning of dissection; however, most of these fears dissipated by the time of the second questionnaire. One month into dissection students cited talking to peers as their main coping mechanism and fewer students mentioned emotional detachment from their cadaver as a coping mechanism, as was the case in the first questionnaire. Dissection was perceived as a positive experience by our student cohort and most students cited the main advantage of dissection as the ability to visualize organs in three dimensions. The comprehensive answers received from the students indicated that thorough discussion of feelings amongst peers occurred, introducing students to an important coping mechanism at an early stage of their learning. Copyright © 2012 American Association of Anatomists.

Are all hands-on activities equally effective? Effect of using plastic models, organ dissections, and virtual dissections on student learning and perceptions.

PubMed

Lombardi, Sara A; Hicks, Reimi E; Thompson, Katerina V; Marbach-Ad, Gili

2014-03-01

This study investigated the impact of three commonly used cardiovascular model-assisted activities on student learning and student attitudes and perspectives about science. College students enrolled in a Human Anatomy and Physiology course were randomly assigned to one of three experimental groups (organ dissections, virtual dissections, or plastic models). Each group received a 15-min lecture followed by a 45-min activity with one of the treatments. Immediately after the lesson and then 2 mo later, students were tested on anatomy and physiology knowledge and completed an attitude survey. Students who used plastic models achieved significantly higher overall scores on both the initial and followup exams than students who performed organ or virtual dissections. On the initial exam, students in the plastic model and organ dissection treatments scored higher on anatomy questions than students who performed virtual dissections. Students in the plastic model group scored higher than students who performed organ dissections on physiology questions. On the followup exam, when asked anatomy questions, students in the plastic model group scored higher than dissection students and virtual dissection students. On attitude surveys, organ dissections had higher perceived value and were requested for inclusion in curricula twice as often as any other activity. Students who performed organ dissections were more likely than the other treatment groups to agree with the statement that "science is fun," suggesting that organ dissections may promote positive attitudes toward science. The findings of this study provide evidence for the importance of multiple types of hands-on activities in anatomy laboratory courses.

Feeding-Related Traits Are Affected by Dosage of the foraging Gene in Drosophila melanogaster

PubMed Central

Allen, Aaron M.; Anreiter, Ina; Neville, Megan C.; Sokolowski, Marla B.

2017-01-01

Nutrient acquisition and energy storage are critical parts of achieving metabolic homeostasis. The foraging gene in Drosophila melanogaster has previously been implicated in multiple feeding-related and metabolic traits. Before foraging’s functions can be further dissected, we need a precise genetic null mutant to definitively map its amorphic phenotypes. We used homologous recombination to precisely delete foraging, generating the for0 null allele, and used recombineering to reintegrate a full copy of the gene, generating the {forBAC} rescue allele. We show that a total loss of foraging expression in larvae results in reduced larval path length and food intake behavior, while conversely showing an increase in triglyceride levels. Furthermore, varying foraging gene dosage demonstrates a linear dose-response on these phenotypes in relation to foraging gene expression levels. These experiments have unequivocally proven a causal, dose-dependent relationship between the foraging gene and its pleiotropic influence on these feeding-related traits. Our analysis of foraging’s transcription start sites, termination sites, and splicing patterns using rapid amplification of cDNA ends (RACE) and full-length cDNA sequencing, revealed four independent promoters, pr1–4, that produce 21 transcripts with nine distinct open reading frames (ORFs). The use of alternative promoters and alternative splicing at the foraging locus creates diversity and flexibility in the regulation of gene expression, and ultimately function. Future studies will exploit these genetic tools to precisely dissect the isoform- and tissue-specific requirements of foraging’s functions and shed light on the genetic control of feeding-related traits involved in energy homeostasis. PMID:28007892

Dissecting structural and electronic effects in inducible nitric oxide synthase.

PubMed

Hannibal, Luciana; Page, Richard C; Haque, Mohammad Mahfuzul; Bolisetty, Karthik; Yu, Zhihao; Misra, Saurav; Stuehr, Dennis J

2015-04-01

Nitric oxide synthases (NOSs) are haem-thiolate enzymes that catalyse the conversion of L-arginine (L-Arg) into NO and citrulline. Inducible NOS (iNOS) is responsible for delivery of NO in response to stressors during inflammation. The catalytic performance of iNOS is proposed to rely mainly on the haem midpoint potential and the ability of the substrate L-Arg to provide a hydrogen bond for oxygen activation (O-O scission). We present a study of native iNOS compared with iNOS-mesohaem, and investigate the formation of a low-spin ferric haem-aquo or -hydroxo species (P) in iNOS mutant W188H substituted with mesohaem. iNOS-mesohaem and W188H-mesohaem were stable and dimeric, and presented substrate-binding affinities comparable to those of their native counterparts. Single turnover reactions catalysed by iNOSoxy with L-Arg (first reaction step) or N-hydroxy-L-arginine (second reaction step) showed that mesohaem substitution triggered higher rates of Fe(II)O₂ conversion and altered other key kinetic parameters. We elucidated the first crystal structure of a NOS substituted with mesohaem and found essentially identical features compared with the structure of iNOS carrying native haem. This facilitated the dissection of structural and electronic effects. Mesohaem substitution substantially reduced the build-up of species P in W188H iNOS during catalysis, thus increasing its proficiency towards NO synthesis. The marked structural similarities of iNOSoxy containing native haem or mesohaem indicate that the kinetic behaviour observed in mesohaem-substituted iNOS is most heavily influenced by electronic effects rather than structural alterations.

DISSECTING STRUCTURAL AND ELECTRONIC EFFECTS IN INDUCIBLE NITRIC OXIDE SYNTHASE

PubMed Central

Hannibal, Luciana; Page, Richard C.; Haque, Mohammad Mahfuzul; Bolisetty, Karthik; Yu, Zhihao; Misra, Saurav; Stuehr, Dennis J.

2015-01-01

Nitric oxide synthases (NOS) are haem-thiolate enzymes that catalyse the conversion of L-Arginine (LArg) into NO and citrulline. Inducible NOS (iNOS) is responsible for delivery of NO in response to stressors during inflammation. The catalytic performance of iNOS is proposed to rely mainly on the haem midpoint potential and the ability of the substrate L-Arg to provide an H-bond for oxygen activation (O-O scission). We present a comparative study of native iNOS versus iNOS-mesohaem, and investigate the formation of a low-spin ferric haem-aquo or -hydroxo species (P) in iNOS mutant W188H substituted with mesohaem. iNOS-mesohaem and W188H-mesohaem were stable and dimeric, and presented substrate-binding affinities comparable to their native counterparts. Single turnover reactions catalysed by iNOSoxy with LArg (first reaction step) or N-hydroxyarginine (second reaction step) showed that mesohaem substitution triggered faster rates of FeIIO2 conversion and altered other key kinetic parameters. We elucidated the first crystal structure of a NOS substituted with mesohaem and found essentially identical features compared to the structure of iNOS carrying native haem. This facilitated the dissection of structural and electronic effects. Mesohaem substitution substantially reduced the build-up of species P in W188H iNOS during catalysis, thus increasing its proficiency toward NO synthesis. The marked structural similarities of iNOSoxy containing native haem or mesohaem indicate that the kinetic behaviour observed in mesohaem-substituted iNOS is most heavily influenced by electronic effects rather than structural alterations. PMID:25608846

Subarachnoid Hemorrhage Because of Distal Superior Cerebellar Artery Dissection in Neurofibromatosis Type 1.

PubMed

Takeshima, Yuki; Ohmori, Yuki; Nakagawa, Takashi; Kaku, Yasuyuki; Kuratsu, Jun-Ichi; Yano, Shigetoshi

2017-09-01

Neurofibromatosis type 1 (NF1) is a rare disease with an incidence of 1 in every 3000 births. Numerous studies have focused on the main function of NF1 as a tumor suppressor, whereas few have examined the cerebrovascular abnormalities observed in patients with NF1. It is worth noting that intracranial aneurysms are uncommon in this condition. We report a case of NF1 with a dissection of the distal segment of the superior cerebellar artery. A 36-year-old woman presented with a distal superior cerebellar artery (SCA) dissection causing subarachnoid hemorrhage. Subsequently, because of the rich collateral blood flow distal to the dissection, N-butyl cyanoacrylate (NBCA) glue embolization was unsuccessful. Therefore, direct trapping of the artery was necessary. The patient was discharged after an uneventful postoperative period, and has remained without complications. In the treatment of subarachnoid hemorrhage because of a distal SCA dissection in patients with NF1, NBCA glue embolization may be a safer option than microsurgery or coil embolization, in the acute phase, considering the possible vulnerability of the vessel wall, accessibility, morphology of the lesions, and the risk of developing unpredictable infarcts in the case of parent artery occlusion. However, regular reevaluation of the blood flow is necessary to monitor recurrence, given the rich collateral circulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Significance of prophylactic modified radical neck dissection for patients with low-risk papillary thyroid carcinoma measuring 1.1-3.0 cm: first report of a trial at Kuma Hospital.

PubMed

Ito, Yasuhiro; Tsushima, Yukiko; Masuoka, Hiroo; Yabuta, Tomonori; Fukushima, Mitsuhiro; Inoue, Hiroyuki; Tomoda, Chisato; Kihara, Minoru; Higashiyama, Takuya; Takamura, Yuuki; Kobayashi, Kaoru; Miya, Akihiro; Miyauchi, Akira

2011-11-01

Papillary thyroid carcinoma (PTC) frequently metastasizes to and recurs in regional lymph nodes. Of the two compartments, the central compartment can be dissected through the same wound as the thyroidectomy, and the central node dissection (CND) is routinely performed in most Japanese surgical departments. However, the indications for prophylactic lateral compartment dissection (modified radical neck dissection [MND]) for low-risk PTC remain unclear. In this study, we investigated the indications for prophylactic MND for PTC patients with tumor measuring 1.1-3.0 cm without significant extrathyroid extension or distant metastasis. We investigated the lymph node disease-free survival (LN-DFS) rates of 829 patients who underwent CND and of 414 patients who underwent MND and CND between 2005 and 2007 at Kuma Hospital. The LN-DFS of these two groups was not significantly different. In the subset of patients with CND only, clinical central node metastasis (N1a) significantly predicted a worse LN-DFS. All N1a patients recognized as showing recurrence developed such recurrence in the lateral compartment. Other conventional prognostic factors, such as sex and age, were not related to LN-DFS. Taken together, N1a patients with low-risk PTC measuring 1.1-3.0 cm can be considered as candidates for prophylactic MND.

Diagnostic implication of fibrin degradation products and D-dimer in aortic dissection

NASA Astrophysics Data System (ADS)

Dong, Jian; Duan, Xianli; Feng, Rui; Zhao, Zhiqing; Feng, Xiang; Lu, Qingsheng; Jing, Qing; Zhou, Jian; Bao, Junmin; Jing, Zaiping

2017-03-01

Fibrin degradation products (FDP) and D-dimer have been considered to be involved in many vascular diseases. In this study we aimed to explore the diagnostic implication of FDP and D-dimer in aortic dissection patients. 202 aortic dissection patients were collected as the case group, 150 patients with other cardiovascular diseases, including myocardial infarction (MI, n = 45), pulmonary infarction (n = 51) and abdominal aortic aneurysm (n = 54) were collected as non-dissection group, and 27 healthy people were in the blank control group. The FDP and D-dimer levels were detected with immune nephelometry. Logist regression analysis was performed to evaluate the influence of FDP and D-dimer for the aortic dissection patients. ROC curve was used to determine the diagnostic value of FDP and D-dimer. The FDP and D-dimer levels were significantly higher in aortic dissection patients than in non-dissection patients and the healthy controls. FDP and D-dimer were both the risk factors for patients with aortic dissection. From the ROC analysis, diagnostic value of FDP and D-dimer were not high to distinguish aortic dissection patients from the non-dissection patients. However FDP and D-dimer could be valuable diagnostic marker to differentiate aortic dissection patients and healthy controls with both AUC 0.863.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Candidate genes for panhypopituitarism identified by gene expression profiling

PubMed Central

Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis

2011-01-01

Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248

Medical Student Dissection of Cadavers Improves Performance on Practical Exams but not on the NBME Anatomy Subject Exam.

PubMed

Sargent Jones, Leslie; Paulman, Lance E; Thadani, Raj; Terracio, Louis

2001-12-01

We have examined whether cadaver dissection by first year medical students (MIs) affected their performance in two test measures: the NBME Gross Anatomy and Embryology Subject Exam (dissection-relevant questions only), and practical exams given at the end of each major section within the course. The dissections for the entire course were divided into 18 regional dissection units and each student was assigned to dissect one third of the regional units; the other two-thirds of the material was learned from the partner-prosected cadavers. Performance for each student on the exams was then assessed as a function of the regions those students actually dissected. While the results indicated a small performance advantage for MIs answering questions on material they had dissected on the NBME Subject Exam questions relevant to dissection (78-88% of total exam), the results were not statistically significant. However, a similar, small performance advantage on the course practical exams was highly significant.

Er:YAG laser for the surgical treatment of the carpal tunnel syndrome

NASA Astrophysics Data System (ADS)

Russ, Detlef; Ebinger, Thomas; Illich, Wolfgang; Steiner, Rudolf W.

2003-10-01

We developed a new surgical procedure to improve the recurrence rate using an Er:YAG laser as dissection tool for the carpal ligament with the objective to ablate a small amount of the carpal ligament and to denaturate its ends. The Er:YAG Laser was transmitted to the applicator via a GeO fiber. With this system we proceeded 10 carpal ligament dissections without any complications in the follow-up period. All patients were free of pain and recurrence.

Isolation, characterization, and expression analyses of tryptophan aminotransferase genes in a maize dek18 mutant

USDA-ARS?s Scientific Manuscript database

The dek18 mutant of maize has decreased auxin content in kernels. Molecular and functional characterization of this mutant line offers the possibility to better understand auxin biology in maize seed development. Seeds of the dek18 mutants are smaller compared to wild type seeds and the vegetative d...

Mutants in the Mouse NuRD/Mi2 Component P66α Are Embryonic Lethal

PubMed Central

Marino, Susan; Nusse, Roel

2007-01-01

Background The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66α and p66β. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. Methodology We made loss of function mutants in the mouse p66α gene (mp66α, official name Gatad2a, MGI:2384585). We found that mp66α is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66α in gene silencing. Conclusion mp66α is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing. PMID:17565372

Talking about Death: Implementing Peer Discussion as a Coping Mechanism to Overcome Fears about Dissection, Death, and Dying

ERIC Educational Resources Information Center

Kotze, Sanet Henriet; Mole, Calvin Gerald

2013-01-01

Many studies have reported on the perceptions of medical students toward dissection. It is important to understand the feelings and symptoms experienced during dissection so that they can be adequately handled. Prior to dissection, first year students are given lectures on aspects of dissection, death and dying, and death rituals in various…

Partial lower axillary dissection for patients with clinically node-negative breast cancer.

PubMed

Kodama, H; Mise, K; Kan, N

2012-01-01

To evaluate retrospectively the outcomes of partial lower axillary lymph node dissection caudal to the intercostobrachial nerve in patients with clinically node-negative (N(0)) breast cancer. Numbers of dissected and metastatic nodes, overall and disease-free survival rates, postoperative complication rates, and axillary recurrence were compared between patients who underwent breast cancer surgery with partial axillary node dissection (n = 1043) and historical controls who underwent conventional dissection (n = 1084). The 5-year overall and disease-free survival rates were 95.6% and 89.7%, and 94.9% and 88.4%, respectively, in the partial dissection and conventional dissection groups; the differences were not significant. Mean duration of surgery (41.6 min versus 60.9 min), intraoperative blood loss (28.0 ml versus 51.3 ml), volume of lymphatic drainage at 2 weeks postoperatively (488 ml versus 836 ml), and persistent arm lymphoedema (0.0% versus 11.8%) were significantly different between the partial and conventional dissection groups, respectively. Partial axillary lymph node dissection was associated with similar survival rates (but lower postoperative complication rates) compared with conventional axillary dissection and is recommended in patients with N(0) breast cancer.

Isolation and characterization of gallium resistant Pseudomonas aeruginosa mutants.

PubMed

García-Contreras, Rodolfo; Lira-Silva, Elizabeth; Jasso-Chávez, Ricardo; Hernández-González, Ismael L; Maeda, Toshinari; Hashimoto, Takahiro; Boogerd, Fred C; Sheng, Lili; Wood, Thomas K; Moreno-Sánchez, Rafael

2013-12-01

Pseudomonas aeruginosa PA14 cells resistant to the novel antimicrobial gallium nitrate (Ga) were developed using transposon mutagenesis and by selecting spontaneous mutants. The mutants showing the highest growth in the presence of Ga were selected for further characterization. These mutants showed 4- to 12-fold higher Ga minimal inhibitory growth concentrations and a greater than 8-fold increase in the minimum biofilm eliminating Ga concentration. Both types of mutants produced Ga resistant biofilms whereas the formation of wild-type biofilms was strongly inhibited by Ga. The gene interrupted in the transposon mutant was hitA, which encodes a periplasmic iron binding protein that delivers Fe³⁺ to the HitB iron permease; complementation of the mutant with the hitA gene restored the Ga sensitivity. This hitA mutant showed a 14-fold decrease in Ga internalization versus the wild-type strain, indicating that the HitAB system is also involved in the Ga uptake. Ga uptake in the spontaneous mutant was also lower, although no mutations were found in the hitAB genes. Instead, this mutant harbored 64 non-silent mutations in several genes including those of the phenazine pyocyanin biosynthesis. The spontaneous mutant produced 2-fold higher pyocyanin basal levels than the wild-type; the addition of this phenazine to wild-type cultures protected them from the Ga bacteriostatic effect. The present data indicate that mutations affecting Ga transport and probably pyocyanin biosynthesis enable cells to develop resistance to Ga. Copyright © 2013 Elsevier GmbH. All rights reserved.

The complementary role of magnetic resonance imaging, Doppler echocardiography, and computed tomography in the diagnosis of dissecting thoracic aneurysms.

PubMed

Goldman, A P; Kotler, M N; Scanlon, M H; Ostrum, B; Parameswaran, R; Parry, W R

1986-05-01

Non-ECG gated MRI was compared with 2DE and/or CT scans in 10 patients with dissecting aneurysms proven by angiography and/or surgery. Patient ages ranged from 48 to 85 years (mean 69.6). Six had DeBakey type I dissections and four had DeBakey type III dissections. MRI was diagnostic for aortic dissection in nine cases and suggestive in the tenth. 2DE was diagnostic in six out of nine patients, suggestive in two patients, and nondiagnostic in one patient. CT was diagnostic in the three cases in which it was employed. MRI demonstrated a dilated ascending aorta with thickened walls in all type I dissections as well as an intimal flap and slow flow in the false channel in four patients. In the other two patients with type I dissection, MRI detected the intimal flap in the descending aorta but not in the ascending aorta, whereas 2DE revealed the ascending aortic intimal flap in both of these patients and CT showed it in one of them. In the type III dissections, MRI demonstrated a thickened wall and thrombus in the lumen in all four cases, and the intimal flap in three out of the four. 2DE excluded ascending aortic involvement in all three type III dissections. Six other patients with fusiform dilated ascending aortas had no evidence of dissection by MRI, 2DE, and aortography. Thus, non-ECG gated MRI alone or in combination with 2DE and/or CT is useful in the diagnosis of dissecting thoracic aneurysm and in assessing the extent of the dissection. In addition, the differentiation of dissecting aneurysms of the aorta from fusiform dilatation of the aorta is made possible by these noninvasive techniques.

Water-jet dissection for parenchymal division during hepatectomy1

PubMed Central

Dixon, Elijah; Sahajpal, Ajay; Cattral, Mark S.; Grant, David R.; Gallinger, Steven; Taylor, Bryce R.; Greig, Paul D.

2006-01-01

Background. High-pressure water-jet dissection was originally developed for industry where ultra-precise cutting and engraving were desirable. This technology has been adapted for medical applications with favorable results, but little is understood about its performance in hepatic resections. Blood loss may be limited by the thin laminar liquid-jet effect that provides precise, controllable, tissue-selective dissection with excellent visualization and minimal trauma to surrounding fibrous structures. Patients and methods. The efficacy of the Water-jet system for hepatic parenchymal dissection was examined in a consecutive case series of 101 hepatic resections (including 22 living donor transplantation resections) performed over 11 months. Perioperative outcomes, including blood loss, transfusion requirements, complications, and length of stay (LOS), were assessed. Results. Three-quarters of the cases were major hepatectomies and 22% were cirrhotic. Malignancy was the most common indication (77%). Median operative time was 289 min. Median estimated blood loss (EBL) was 900 ml for all cases, and only 14% of patients had >2000 ml EBL. Furthermore, EBL was 1000 ml for major resections, 775 ml for living donor resections, 600 ml in cirrhotic patients, and 1950 ml for steatotic livers. In all, 14% of patients received heterologous packed red blood cell (PRBC) transfusions for an average of 0.59 units per case. Median LOS was 7 days. EBL, transfusion requirements, and LOS were slightly increased in the major resection cohort. There was one mortality (1%) overall. These results are equivalent to, or better than, those from our contemporary series of resections performed with ultrasonic dissection. Conclusion. Water-jet dissection minimizes large blood volume loss, requirements for transfusion, and complications. This initial experience suggests that this precision tool is safe and effective for hepatic division, and compares favorably to other established methods for hepatic parenchymal transection. PMID:18333091

Revolutionary treatment of aneurysms and dissections of descending aorta: the endovascular approach.

PubMed

Buffolo, Enio; da Fonseca, José Honório Palma; de Souza, José Augusto Marcondes; Alves, Claudia Maria Rodrigues

2002-11-01

Acute aortic dissection is a life-threatening medical condition. It is associated with high morbidity and mortality. Type B dissections are usually managed clinically during the acute phase. Conventional surgery carries high mortality rates due to the presence of serious complications. We herein present treatment of this condition with a less invasive endovascular approach. Other clinical situations such as penetrating ulcers, intramural hematomas, and true aneurysms of descending aorta were similarly treated. From December 1996 to March 2002, 191 patients with type B dissections were treated with self-expandable, polyester-covered stents. There were 120 patients (62.8%) with type B dissections, 61 patients (31.9%) with true aneurysms, 6 patients (3.1%) with penetrating ulcers or intramural hematomas, and 4 patients (2.1%) with trauma. Patients with abdominal aneurysms (44) and stents introduced under direct vision through the aortic arch (70) were excluded. The stent graft was delivered in the catheterization laboratory under general anesthesia, with induced hypotension and heparinization. All stents used were made in Brazil (Braile Biomedics, Sao Jose do Rio Preto, SP). The procedure was performed in 191 consecutive cases. The success rate was 91.1% (174/191). Success was defined as occlusion of the thoracic intimal tear, or exclusion of the aneurysm without leaks. Hospital mortality was 10.4% (20/191 patients), due to preoperative comorbidities. Six patients required conversion to surgery. No case of paraplegia was observed. An actuarial survival curve showed 87.4% +/- 29% survival in the late follow-up period. Stent grafts are an important development in the treatment of descending aortic aneurysms or dissections. This novel approach may replace conventional surgical treatment of these conditions, with earlier intervention and less morbidity.

Acute aortic syndromes: new insights from electrocardiographically gated computed tomography.

PubMed

Fleischmann, Dominik; Mitchell, R Scott; Miller, D Craig

2008-01-01

The development of retrospective electrocardiographic (ECG)-gating has proved to be a diagnostic and therapeutic boon for computed tomography (CT) imaging of patients with acute thoracic aortic diseases, such as aortic dissection/intramural hematoma (AD/IMH), penetrating atherosclerotic ulcer (APU), and ruptured/leaking aneurysm. The notorious pulsation motion artifacts in the ascending aorta confounding regular CT scanning can be eliminated, and involvement of the sinuses of Valsalva, the valve cusps, the aortic annulus, and the coronary arteries in aortic dissection can be clearly depicted or excluded. Motion-free images also allow reliable identification of the site of the primary intimal tear, the location, and extent of the intimomedial flap, and branch artery involvement. ECG-gated CTA also allows the detection of more subtle lesions and variants of aortic dissection, which may ultimately expand our understanding of these complex, life-threatening disorders.

Fertilization-independent seed development in Arabidopsis thaliana

PubMed Central

Chaudhury, Abdul M.; Ming, Luo; Miller, Celia; Craig, Stuart; Dennis, Elizabeth S.; Peacock, W. James

1997-01-01

We report mutants in Arabidopsis thaliana (fertilization-independent seed: fis) in which certain processes of seed development are uncoupled from the double fertilization event that occurs after pollination. These mutants were isolated as ethyl methanesulfonate-induced pseudo-revertants of the pistillata phenotype. Although the pistillata (pi) mutant has short siliques devoid of seed, the fis mutants in the pi background have long siliques containing developing seeds, even though the flowers remain free of pollen. The three fis mutations map to loci on three different chromosomes. In fis1 and fis2 seeds, the autonomous endosperm nuclei are diploid and the endosperm develops to the point of cellularization; the partially developed seeds then atrophy. In these two mutants, proembryos are formed in a low proportion of seeds and do not develop beyond the globular stage. When FIS/fis plants are pollinated by pollen from FIS/FIS plants, ≈50% of the resulting seeds contain fully developed embryos; these seeds germinate and form viable seedlings (FIS/FIS). The other 50% of seeds shrivel and do not germinate; they contain embryos arrested at the torpedo stage (FIS/fis). In normal sexual reproduction, the products of the FIS genes are likely to play important regulatory roles in the development of seed after fertilization. PMID:9108133

Fertilization-independent seed development in Arabidopsis thaliana.

PubMed

Chaudhury, A M; Ming, L; Miller, C; Craig, S; Dennis, E S; Peacock, W J

1997-04-15

We report mutants in Arabidopsis thaliana (fertilization-independent seed:fis) in which certain processes of seed development are uncoupled from the double fertilization event that occurs after pollination. These mutants were isolated as ethyl methanesulfonate-induced pseudo-revertants of the pistillata phenotype. Although the pistillata (pi) mutant has short siliques devoid of seed, the fis mutants in the pi background have long siliques containing developing seeds, even though the flowers remain free of pollen. The three fis mutations map to loci on three different chromosomes. In fis1 and fis2 seeds, the autonomous endosperm nuclei are diploid and the endosperm develops to the point of cellularization; the partially developed seeds then atrophy. In these two mutants, proembryos are formed in a low proportion of seeds and do not develop beyond the globular stage. When FIS/fis plants are pollinated by pollen from FIS/FIS plants, approximately 50% of the resulting seeds contain fully developed embryos; these seeds germinate and form viable seedlings (FIS/FIS). The other 50% of seeds shrivel and do not germinate; they contain embryos arrested at the torpedo stage (FIS/fis). In normal sexual reproduction, the products of the FIS genes are likely to play important regulatory roles in the development of seed after fertilization.

QSAR-Based Models for Designing Quinazoline/Imidazothiazoles/Pyrazolopyrimidines Based Inhibitors against Wild and Mutant EGFR

PubMed Central

Chauhan, Jagat Singh; Dhanda, Sandeep Kumar; Singla, Deepak; Agarwal, Subhash M.; Raghava, Gajendra P. S.

2014-01-01

Overexpression of EGFR is responsible for causing a number of cancers, including lung cancer as it activates various downstream signaling pathways. Thus, it is important to control EGFR function in order to treat the cancer patients. It is well established that inhibiting ATP binding within the EGFR kinase domain regulates its function. The existing quinazoline derivative based drugs used for treating lung cancer that inhibits the wild type of EGFR. In this study, we have made a systematic attempt to develop QSAR models for designing quinazoline derivatives that could inhibit wild EGFR and imidazothiazoles/pyrazolopyrimidines derivatives against mutant EGFR. In this study, three types of prediction methods have been developed to design inhibitors against EGFR (wild, mutant and both). First, we developed models for predicting inhibitors against wild type EGFR by training and testing on dataset containing 128 quinazoline based inhibitors. This dataset was divided into two subsets called wild_train and wild_valid containing 103 and 25 inhibitors respectively. The models were trained and tested on wild_train dataset while performance was evaluated on the wild_valid called validation dataset. We achieved a maximum correlation between predicted and experimentally determined inhibition (IC50) of 0.90 on validation dataset. Secondly, we developed models for predicting inhibitors against mutant EGFR (L858R) on mutant_train, and mutant_valid dataset and achieved a maximum correlation between 0.834 to 0.850 on these datasets. Finally, an integrated hybrid model has been developed on a dataset containing wild and mutant inhibitors and got maximum correlation between 0.761 to 0.850 on different datasets. In order to promote open source drug discovery, we developed a webserver for designing inhibitors against wild and mutant EGFR along with providing standalone (http://osddlinux.osdd.net/) and Galaxy (http://osddlinux.osdd.net:8001) version of software. We hope our webserver (http://crdd.osdd.net/oscadd/ntegfr/) will play a vital role in designing new anticancer drugs. PMID:24992720

Isolation and Identification of Pathogenicity Mutant of Curvularia lunata via Restriction Enzyme-Mediated Integration.

PubMed

Wang, Y J; Liu, T; Hou, J M; Zuo, Y H

2013-09-01

In this report, 156 hygromycin-resistant mutants were generated via restriction enzyme-mediated insertional (REMI) mutagenesis. All mutants were subjected to a bioassay on detached leaves. Five mutants (T4, T39, T71, T91, and T135) showed reduced symptom development, whereas one mutant (T120) did not exhibit any symptoms on the leaves compared with the wild type. The pathogenicity of these mutants was further assayed through the spray inoculation of whole seedlings. The results demonstrated that the pathogenicity of the T4, T39, T71, T91, and T135 mutants was reduced, whereas the T120 mutant lost its pathogenicity. Southern blot analysis revealed that the plasmids were inserted at different sites in the genome with different copy numbers. Flanking sequences approximately 550, 860, and 150 bp were obtained from T7, T91, and T120, respectively through plasmids rescue. Sequence analysis of the flanking sequences from T7 and T91 showed no homology to any known sequences in GenBank. The flanking sequence from the T120 mutant was highly homologous to MAPKK kinases, which regulates sexual/asexual development, melanization, pathogenicity from Cochliobolus heterostrophus. These results indicate that REMI and plasmids rescue have great potential for finding pathogenicity genes.

Experiences with dissection courses in human anatomy: a comparison between Germany and Ethiopia.

PubMed

Bekele, Assegedech; Reissig, Dieter; Löffler, Sabine; Hinz, Andreas

2011-03-01

Dissection courses in human anatomy are laborious, and new teaching tools have become available. Therefore, some universities intend to reduce the dissection course. Furthermore, little is known about dissection courses in African universities. The aim of this study is to compare the students' experiences with and evaluations of the dissection courses in two universities: Leipzig (Germany) and Gondar (Ethiopia). Since the Gondar Medical College was founded in cooperation with the Leipzig University in 1978, the anatomy courses in both universities follow roughly the same rules. A structured questionnaire was used to assess the dissection courses from the students' point of view. The sample of students consisted of 109 German and 124 Ethiopian first year undergraduate medical students. Most students in both countries (94% in Germany and 82% in Ethiopia) judge the dissection course to be highly relevant compared to other courses. Perceived health hazards associated with dissection of the cadaver show significant differences between Germany (14%) and Ethiopia (44%). Most students had normal feelings again at the end of the dissection course. Further similarities and differences between the courses in Germany and Ethiopia are described. Dissection courses are highly appreciated also in Africa. The high degree of affirmation of the dissection courses should be taken into consideration when discussing modifications of gross anatomy curriculum or changes in the teacher to student ratio. Copyright © 2010 Elsevier GmbH. All rights reserved.

Dissecting Dissection.

ERIC Educational Resources Information Center

AV Magazine, 1996

1996-01-01

This journal features articles covering various aspects of dissection. "Biology--The Study of Life" (George Russell) offers students experiments that do not require using invasive procedures. "Animal Cruelty--Behind the Scenes" (Zoe Weil) describes sources of laboratory animals. "Doing without Dissection" (Juliana…

Traditional versus Computer-Based Dissections in Enhancing Learning in a Tertiary Setting: A Student Perspective.

ERIC Educational Resources Information Center

Franklin, Sue; Peat, Mary; Lewis, Alison

2002-01-01

Describes a study that investigates both the use and usefulness of laboratory dissections and computer-based dissections in a tertiary, first-year human biology course. Explores attitudes toward dissection. (DDR)

Development of the mouse vestibular system in the absence of gravity perception

NASA Technical Reports Server (NTRS)

Smith, Michael; Yuan Wang, Xiang; Wolgemuth, Debra J.; Murashov, Alexander K.

2003-01-01

The tilted mutant mouse, which lacks otoconia in the inner ear, was used to study development of the mouse vestibular system in the absence of gravity perception. Otoconia are dense particles composed of proteins and calcium carbonate crystals suspended in the gelatinous macular membrane. They enhance, and are largely responsible for, sensitivity to gravity. Morphometric analysis of the vestibular ganglion showed that the mutant developed more slowly than the normal controls, both in rate of development and cell number, particularly during the first week of post-natal development. The mutant ganglia also exhibited a reduction of cells during the first 6 days of post-natal development.

Scoping review of the literature on shoulder impairments and disability after neck dissection.

PubMed

Goldstein, David P; Ringash, Jolie; Bissada, Eric; Jaquet, Yves; Irish, Jonathan; Chepeha, Douglas; Davis, Aileen M

2014-02-01

The purpose of this article was to provide a review of the literature on shoulder disability after neck dissection. A literature review was performed using Ovid Medline and Embase databases. A total of 306 abstracts and 78 full-text articles were reviewed. Forty-two articles were eligible for inclusion. Patients undergoing nerve-sacrifice neck dissections have greater disability and lower quality of life scores than those undergoing neck dissections with the least manipulation (ie, selective neck dissections). Shoulder impairments can still occur in patients undergoing selective neck dissections. Disability typically improves over time in patients undergoing nerve-sparing neck dissections. There was significant variability in the literature in terms of the prevalence and recovery of shoulder morbidity after neck dissection. This variability may not just be related to surgical technique or rehabilitation, but also to study design, definitions, and the variability in disability questionnaires used. Copyright © 2013 Wiley Periodicals, Inc.

RNF4-mediated polyubiquitination regulates the Fanconi anemia/BRCA pathway.

PubMed

Xie, Jenny; Kim, Hyungjin; Moreau, Lisa A; Puhalla, Shannon; Garber, Judy; Al Abo, Muthana; Takeda, Shunichi; D'Andrea, Alan D

2015-04-01

The Fanconi anemia/BRCA (FA/BRCA) pathway is a DNA repair pathway that is required for excision of DNA interstrand cross-links. The 17 known FA proteins, along with several FA-associated proteins (FAAPs), cooperate in this pathway to detect, unhook, and excise DNA cross-links and to subsequently repair the double-strand breaks generated in the process. In the current study, we identified a patient with FA with a point mutation in FANCA, which encodes a mutant FANCA protein (FANCAI939S). FANCAI939S failed to bind to the FAAP20 subunit of the FA core complex, leading to decreased stability. Loss of FAAP20 binding exposed a SUMOylation site on FANCA at amino acid residue K921, resulting in E2 SUMO-conjugating enzyme UBC9-mediated SUMOylation, RING finger protein 4-mediated (RNF4-mediated) polyubiquitination, and proteasome-mediated degradation of FANCA. Mutation of the SUMOylation site of FANCA rescued the expression of the mutant protein. Wild-type FANCA was also subject to SUMOylation, RNF4-mediated polyubiquitination, and degradation, suggesting that regulated release of FAAP20 from FANCA is a critical step in the normal FA pathway. Consistent with this model, cells lacking RNF4 exhibited interstrand cross-linker hypersensitivity, and the gene encoding RNF4 was epistatic with the other genes encoding members of the FA/BRCA pathway. Together, the results from our study underscore the importance of analyzing unique patient-derived mutations for dissecting complex DNA repair processes.

RNF4-mediated polyubiquitination regulates the Fanconi anemia/BRCA pathway

PubMed Central

Xie, Jenny; Kim, Hyungjin; Moreau, Lisa A.; Puhalla, Shannon; Garber, Judy; Al Abo, Muthana; Takeda, Shunichi; D’Andrea, Alan D.

2015-01-01

The Fanconi anemia/BRCA (FA/BRCA) pathway is a DNA repair pathway that is required for excision of DNA interstrand cross-links. The 17 known FA proteins, along with several FA-associated proteins (FAAPs), cooperate in this pathway to detect, unhook, and excise DNA cross-links and to subsequently repair the double-strand breaks generated in the process. In the current study, we identified a patient with FA with a point mutation in FANCA, which encodes a mutant FANCA protein (FANCAI939S). FANCAI939S failed to bind to the FAAP20 subunit of the FA core complex, leading to decreased stability. Loss of FAAP20 binding exposed a SUMOylation site on FANCA at amino acid residue K921, resulting in E2 SUMO-conjugating enzyme UBC9-mediated SUMOylation, RING finger protein 4–mediated (RNF4-mediated) polyubiquitination, and proteasome-mediated degradation of FANCA. Mutation of the SUMOylation site of FANCA rescued the expression of the mutant protein. Wild-type FANCA was also subject to SUMOylation, RNF4-mediated polyubiquitination, and degradation, suggesting that regulated release of FAAP20 from FANCA is a critical step in the normal FA pathway. Consistent with this model, cells lacking RNF4 exhibited interstrand cross-linker hypersensitivity, and the gene encoding RNF4 was epistatic with the other genes encoding members of the FA/BRCA pathway. Together, the results from our study underscore the importance of analyzing unique patient-derived mutations for dissecting complex DNA repair processes. PMID:25751062

Lanosterol reverses protein aggregation in cataracts.

PubMed

Zhao, Ling; Chen, Xiang-Jun; Zhu, Jie; Xi, Yi-Bo; Yang, Xu; Hu, Li-Dan; Ouyang, Hong; Patel, Sherrina H; Jin, Xin; Lin, Danni; Wu, Frances; Flagg, Ken; Cai, Huimin; Li, Gen; Cao, Guiqun; Lin, Ying; Chen, Daniel; Wen, Cindy; Chung, Christopher; Wang, Yandong; Qiu, Austin; Yeh, Emily; Wang, Wenqiu; Hu, Xun; Grob, Seanna; Abagyan, Ruben; Su, Zhiguang; Tjondro, Harry Christianto; Zhao, Xi-Juan; Luo, Hongrong; Hou, Rui; Jefferson, J; Perry, P; Gao, Weiwei; Kozak, Igor; Granet, David; Li, Yingrui; Sun, Xiaodong; Wang, Jun; Zhang, Liangfang; Liu, Yizhi; Yan, Yong-Bin; Zhang, Kang

2015-07-30

The human lens is comprised largely of crystallin proteins assembled into a highly ordered, interactive macro-structure essential for lens transparency and refractive index. Any disruption of intra- or inter-protein interactions will alter this delicate structure, exposing hydrophobic surfaces, with consequent protein aggregation and cataract formation. Cataracts are the most common cause of blindness worldwide, affecting tens of millions of people, and currently the only treatment is surgical removal of cataractous lenses. The precise mechanisms by which lens proteins both prevent aggregation and maintain lens transparency are largely unknown. Lanosterol is an amphipathic molecule enriched in the lens. It is synthesized by lanosterol synthase (LSS) in a key cyclization reaction of a cholesterol synthesis pathway. Here we identify two distinct homozygous LSS missense mutations (W581R and G588S) in two families with extensive congenital cataracts. Both of these mutations affect highly conserved amino acid residues and impair key catalytic functions of LSS. Engineered expression of wild-type, but not mutant, LSS prevents intracellular protein aggregation of various cataract-causing mutant crystallins. Treatment by lanosterol, but not cholesterol, significantly decreased preformed protein aggregates both in vitro and in cell-transfection experiments. We further show that lanosterol treatment could reduce cataract severity and increase transparency in dissected rabbit cataractous lenses in vitro and cataract severity in vivo in dogs. Our study identifies lanosterol as a key molecule in the prevention of lens protein aggregation and points to a novel strategy for cataract prevention and treatment.

Dissecting the role of NtrC and RpoN in the expression of assimilatory nitrate and nitrite reductases in Bradyrhizobium diazoefficiens.

PubMed

López, María F; Cabrera, Juan J; Salas, Ana; Delgado, María J; López-García, Silvina L

2017-04-01

Bradyrhizobium diazoefficiens, a nitrogen-fixing endosymbiont of soybeans, is a model strain for studying rhizobial denitrification. This bacterium can also use nitrate as the sole nitrogen (N) source during aerobic growth by inducing an assimilatory nitrate reductase encoded by nasC located within the narK-bjgb-flp-nasC operon along with a nitrite reductase encoded by nirA at a different chromosomal locus. The global nitrogen two-component regulatory system NtrBC has been reported to coordinate the expression of key enzymes in nitrogen metabolism in several bacteria. In this study, we demonstrate that disruption of ntrC caused a growth defect in B. diazoefficiens cells in the presence of nitrate or nitrite as the sole N source and a decreased activity of the nitrate and nitrite reductase enzymes. Furthermore, the expression of narK-lacZ or nirA-lacZ transcriptional fusions was significantly reduced in the ntrC mutant after incubation under nitrate assimilation conditions. A B. diazoefficiens rpoN 1/2 mutant, lacking both copies of the gene encoding the alternative sigma factor σ 54 , was also defective in aerobic growth with nitrate as the N source as well as in nitrate and nitrite reductase expression. These results demonstrate that the NtrC regulator is required for expression of the B. diazoefficiens nasC and nirA genes and that the sigma factor RpoN is also involved in this regulation.

Genetic dissection of the Gpnmb network in the eye.

PubMed

Lu, Hong; Wang, Xusheng; Pullen, Matthew; Guan, Huaijin; Chen, Hui; Sahu, Shwetapadma; Zhang, Bing; Chen, Hao; Williams, Robert W; Geisert, Eldon E; Lu, Lu; Jablonski, Monica M

2011-06-13

To use a systematic genetics approach to investigate the regulation of Gpnmb, a gene that contributes to pigmentary dispersion syndrome (PDS) and pigmentary glaucoma (PG) in the DBA/2J (D2) mouse. Global patterns of gene expression were studied in whole eyes of a large family of BXD mouse strains (n = 67) generated by crossing the PDS- and PG-prone parent (DBA/2J) with a resistant strain (C57BL/6J). Quantitative trait locus (eQTL) mapping methods and gene set analysis were used to evaluate Gpnmb coexpression networks in wild-type and mutant cohorts. The level of Gpnmb expression was associated with a highly significant cis-eQTL at the location of the gene itself. This autocontrol of Gpnmb is likely to be a direct consequence of the known premature stop codon in exon 4. Both gene ontology and coexpression network analyses demonstrated that the mutation in Gpnmb radically modified the set of genes with which Gpnmb expression is correlated. The covariates of wild-type Gpnmb are involved in biological processes including melanin synthesis and cell migration, whereas the covariates of mutant Gpnmb are involved in the biological processes of posttranslational modification, stress activation, and sensory processing. These results demonstrated that a systematic genetics approach provides a powerful tool for constructing coexpression networks that define the biological process categories within which similarly regulated genes function. The authors showed that the R150X mutation in Gpnmb dramatically modified its list of genetic covariates, which may explain the associated ocular pathology.

Activation of MTK1/MEKK4 by GADD45 through induced N-C dissociation and dimerization-mediated trans autophosphorylation of the MTK1 kinase domain.

PubMed

Miyake, Zenshi; Takekawa, Mutsuhiro; Ge, Qingyuan; Saito, Haruo

2007-04-01

The mitogen-activated protein kinase (MAPK) module, composed of a MAPK, a MAPK kinase (MAPKK), and a MAPKK kinase (MAPKKK), is a cellular signaling device that is conserved throughout the eukaryotic world. In mammalian cells, various extracellular stresses activate two major subfamilies of MAPKs, namely, the Jun N-terminal kinases and the p38/stress-activated MAPK (SAPK). MTK1 (also called MEKK4) is a stress-responsive MAPKKK that is bound to and activated by the stress-inducible GADD45 family of proteins (GADD45alpha/beta/gamma). Here, we dissected the molecular mechanism of MTK1 activation by GADD45 proteins. The MTK1 N terminus bound to its C-terminal segment, thereby inhibiting the C-terminal kinase domain. This N-C interaction was disrupted by the binding of GADD45 to the MTK1 N-terminal GADD45-binding site. GADD45 binding also induced MTK1 dimerization via a dimerization domain containing a coiled-coil motif, which is essential for the trans autophosphorylation of MTK1 at Thr-1493 in the kinase activation loop. An MTK1 alanine substitution mutant at Thr-1493 has a severely reduced activity. Thus, we conclude that GADD45 binding induces MTK1 N-C dissociation, dimerization, and autophosphorylation at Thr-1493, leading to the activation of the kinase catalytic domain. Constitutively active MTK1 mutants induced the same events, but in the absence of GADD45.

Zebrafish pit1 mutants lack three pituitary cell types and develop severe dwarfism.

PubMed

Nica, Gabriela; Herzog, Wiebke; Sonntag, Carmen; Hammerschmidt, Matthias

2004-05-01

The Pou domain transcription factor Pit-1 is required for lineage determination and cellular commitment processes during mammalian adenohypophysis development. Here we report the cloning and mutational analysis of a pit1 homolog from zebrafish. Compared with mouse, zebrafish pit1 starts to be expressed at a much earlier stage of adenohypophysis development. However, as in the mouse, expression is restricted to a subset of pituitary cell types, excluding proopiomelanocortin (pomc)-expressing cells (corticotropes, melanotropes) and possibly gonadotropes. We could identify two N-ethyl-N-nitrosourea-induced zebrafish pit1 null mutants. Most mutants die during larval stages, whereas survivors develop severe dwarfism. Mutant larvae lack lactotropes, somatotropes, and thyrotropes, although the adenohypophysis is of normal size, without any sign of increased apoptosis rates. Instead, mutant embryos initiate ectopic expression of pomc in pit1-positive cells, leading to an expansion of the Pomc lineage. Similarly, the number of gonadotropes seems increased, as indicated by the expression of gsualpha, a marker for thyrotropes and gonadotropes. In pit1 mutants, the total number of gsualpha-positive cells is normal despite the loss of gsualpha and tshbeta coexpressing cells. Together, these data suggest a transfating of the Pit1 lineage to the Pomc and possibly the gonadotroph lineages in the mutant, and a pomc- and gonadotropin-repressive role of Pit1 during normal zebrafish development. This is different from mouse, for which a repressive role of Pit-1 has only been reported for the gonadotropin Lhbeta, but not for Pomc. In sum, our data point to both conserved and class-specific aspects of Pit1 function during pituitary development in different vertebrate species.

Characterization of the snowy cotyledon 1 mutant of Arabidopsis thaliana: the impact of chloroplast elongation factor G on chloroplast development and plant vitality.

PubMed

Albrecht, Verónica; Ingenfeld, Anke; Apel, Klaus

2006-03-01

During seedling development chloroplast formation marks the transition from heterotrophic to autotrophic growth. The development and activity of chloroplasts may differ in cotyledons that initially serve as a storage organ and true leaves whose primary function is photosynthesis. A genetic screen was used for the identification of genes that affect selectively chloroplast function in cotyledons of Arabidopsis thaliana. Several mutants exhibiting pale cotyledons and green true leaves were isolated and dubbed snowy cotyledon (sco). One of the mutants, sco1, was characterized in more detail. The mutated gene was identified using map-based cloning. The mutant contains a point mutation in a gene encoding the chloroplast elongation factor G, leading to an amino acid exchange within the predicted 70S ribosome-binding domain. The mutation results in a delay in the onset of germination. At this early developmental stage embryos still contain undifferentiated proplastids, whose proper function seems necessary for seed germination. In light-grown sco1 seedlings the greening of cotyledons is severely impaired, whereas the following true leaves develop normally as in wild-type plants. Despite this apparent similarity of chloroplast development in true leaves of mutant and wild-type plants various aspects of mature plant development are also affected by the sco1 mutation such as the onset of flowering, the growth rate, and seed production. The onset of senescence in the mutant and the wild-type plants occurs, however, at the same time, suggesting that in the mutant this particular developmental step does not seem to suffer from reduced protein translation efficiency in chloroplasts.

Evolution of Fitness Cost-Neutral Mutant PfCRT Conferring P. falciparum 4-Aminoquinoline Drug Resistance Is Accompanied by Altered Parasite Metabolism and Digestive Vacuole Physiology

PubMed Central

Gabryszewski, Stanislaw J.; Dhingra, Satish K.; Lewis, Ian A.; Callaghan, Paul S.; Hassett, Matthew R.; Siriwardana, Amila; Henrich, Philipp P.; Lee, Andrew H.; Gnädig, Nina F.; Musset, Lise; Llinás, Manuel; Egan, Timothy J.; Roepe, Paul D.

2016-01-01

Southeast Asia is an epicenter of multidrug-resistant Plasmodium falciparum strains. Selective pressures on the subcontinent have recurrently produced several allelic variants of parasite drug resistance genes, including the P. falciparum chloroquine resistance transporter (pfcrt). Despite significant reductions in the deployment of the 4-aminoquinoline drug chloroquine (CQ), which selected for the mutant pfcrt alleles that halted CQ efficacy decades ago, the parasite pfcrt locus is continuously evolving. This is highlighted by the presence of a highly mutated allele, Cam734 pfcrt, which has acquired the singular ability to confer parasite CQ resistance without an associated fitness cost. Here, we used pfcrt-specific zinc-finger nucleases to genetically dissect this allele in the pathogenic setting of asexual blood-stage infection. Comparative analysis of drug resistance and growth profiles of recombinant parasites that express Cam734 or variants thereof, Dd2 (the most common Southeast Asian variant), or wild-type pfcrt, revealed previously unknown roles for PfCRT mutations in modulating parasite susceptibility to multiple antimalarial agents. These results were generated in the GC03 strain, used in multiple earlier pfcrt studies, and might differ in natural isolates harboring this allele. Results presented herein show that Cam734-mediated CQ resistance is dependent on the rare A144F mutation that has not been observed beyond Southeast Asia, and reveal distinct impacts of this and other Cam734-specific mutations on CQ resistance and parasite growth rates. Biochemical assays revealed a broad impact of mutant PfCRT isoforms on parasite metabolism, including nucleoside triphosphate levels, hemoglobin catabolism and disposition of heme, as well as digestive vacuole volume and pH. Results from our study provide new insights into the complex molecular basis and physiological impact of PfCRT-mediated antimalarial drug resistance, and inform ongoing efforts to characterize novel pfcrt alleles that can undermine the efficacy of first-line antimalarial drug regimens. PMID:27832198

R248Q mutation--Beyond p53-DNA binding.

PubMed

Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

2015-12-01

R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

A new fuzzless seed locus in an upland cotton (Gossypium hirsutum L.) mutant

USDA-ARS?s Scientific Manuscript database

Various fiber mutants of cotton have been reported since 1920. Two of the best characterized mutants are the naked seed loci, N1N1 and n2n2. Recently, a naked-tufted mutant called 9023n4t was developed from the cultivar SC 9023 through chemical mutagenesis. The objective of this research was to dete...

Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.

PubMed

Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin

2017-12-15

TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.

The utility of cadaver dissection in endoscopic sinus surgery training courses.

PubMed

Zuckerman, Jodi D; Wise, Sarah K; Rogers, G Aaron; Senior, Brent A; Schlosser, Rodney J; DelGaudio, John M

2009-01-01

Understanding paranasal sinus anatomy is crucial for successful outcomes in endoscopic sinus surgery (ESS). This study was designed to evaluate subjective and objective differences in ESS cadaver dissections among participants of varying experience levels in association with the use of image guidance and computer-aided technologies in a physician training cadaver dissection laboratory. Participants in a 2-day cadaver dissection course completed daily predissection surveys evaluating subjective comfort with ESS. Pre- and postdissection computer tomography (CT) scans assessed completeness of dissection. Images were analyzed for maxillary antrostomy, frontal and sphenoid sinusotomy, residual ethmoid cells and partitions, and residual frontal recess cells. Fifty-one sides were dissected. Participant comfort increased significantly from day 1 to 2 for overall ESS (p = 0.001) and for individual sinuses (p < 0.001 to p = 0.047). Participants with more years in practice had fewer unopened ethmoid cells (p = 0.015) and frontal recess cells (p = 0.014) on dissection day 1. Participants with increased comfort in ethmoid dissection had fewer retained ethmoid partitions on day 1 (p = 0.017). Observed differences on dissection day 1 for unopened ethmoid and frontal recess cells and retained ethmoid partitions were not present on day 2. No significant differences were found based on use of image guidance for any parameter. Surgeons with increased comfort and more years in practice had more complete endoscopic cadaver dissections initially. Differences among participants diminished on dissection day 2, indicating the ability to review postdissection CT scans may improve surgeon comfort level and completeness of dissection.

Isolation and Characterization of Sex-Linked Female-Sterile Mutants in DROSOPHILA MELANOGASTER

PubMed Central

Gans, Madeleine; Audit, Claudie; Masson, Michele

1975-01-01

The purpose of the experiments described was to identify X chromosome genes functioning mainly or exclusively during oogenesis. Two mutagenesis experiments were carried out with ethyl methane sulfonate. Following treatment inducing 60% lethals, 9% of the treated X chromosomes carried a female sterility mutation which did not otherwise seriously affect viability. Among —95 isolated mutants, 19 were heat-sensitive and 5 cold-sensitive. The mutants have been classified as follows: I (16 mutants; 12 complementation groups): the females laid few or no eggs; the defect concerned either ovulation or oogenesis. II (37 mutants; 18 complementation groups): the female laid morphologically abnormal eggs, often with increased membrane permeability. III A (13 mutants; at least 8 complementation groups): the homozygous females were sterile if mated to mutant males; their progeny (homo- and hemizygous) died at a late embryonic stage (11 mutants), at the larval stage (1 mutant) or at the pupal stage (1 mutant). However fertility was partly restored by breeding to wild-type males as shown by survival of some heterozygous descendants. III B (29 mutants; 22 complementation groups): the fertility of the females was not restored by breeding to a wild-type male. Most of the eggs of 13 of the mutants died at a late stage of embryogenesis. The eggs of the others ceased development earlier or, perhaps, remained unfertilized. The distribution of the number of mutants per complementation group led to an estimation of a total of about 150 X-linked genes involved in female fertility. The females of three mutants, heat-sensitive and totally sterile at 29°, produced at a lower temperature descendants morphologically abnormal or deprived of germ cells. Three other mutants not described in detail showed a reduction in female fertility with many descendants lacking germ cells. A desirable mutant which was not recovered was one with normal fertile females producing descendants which, regardless of their genotype, bore specific morphological abnormalities. The value of the mutants isolated for analysis of the complex processes leading to egg formation and initiation of development is discussed. PMID:814037

Do we need dissection in an integrated problem-based learning medical course? Perceptions of first- and second-year students.

PubMed

Azer, Samy A; Eizenberg, Norm

2007-03-01

The introduction of a problem-based learning (PBL) curriculum at the School of Medicine of the University of Melbourne has necessitated a reduction in the number of lectures and limited the use of dissection in teaching anatomy. In the new curriculum, students learn the anatomy of different body systems using PBL tutorials, practical classes, pre-dissected specimens, computer-aided learning multimedia and a few dissection classes. The aims of this study are: (1) to assess the views of first- and second-year medical students on the importance of dissection in learning about the anatomy, (2) to assess if students' views have been affected by demographic variables such as gender, academic background and being a local or an international student, and (3) to assess which educational tools helped them most in learning the anatomy and whether dissection sessions have helped them in better understanding anatomy. First- and second-year students enrolled in the medical course participated in this study. Students were asked to fill out a 5-point Likert scale questionnaire. Data was analysed using Mann-Whitney's U test, Wilcoxon's signed-ranks or the calculation of the Chi-square value. The response rates were 89% for both first- and second-year students. Compared to second-year students, first-year students perceived dissection to be important for deep understanding of anatomy (P < 0.001), making learning interesting (P < 0.001) and introducing them to emergency procedures (P < 0.001). Further, they preferred dissection over any other approach (P < 0.001). First-year students ranked dissection (44%), textbooks (23%), computer-aided learning (CAL), multimedia (10%), self-directed learning (6%) and lectures (5%) as the most valuable resources for learning anatomy, whereas second-year students found textbooks (38%), dissection (18%), pre-dissected specimens (11%), self-directed learning (9%), lectures (7%) and CAL programs (7%) as most useful. Neither of the groups showed a significant preference for pre-dissected specimens, CAL multimedia or lectures over dissection. Both first- and second-year students, regardless of their gender, academic background, or citizenship felt that the time devoted to dissection classes were not adequate. Students agreed that dissection deepened their understanding of anatomical structures, provided them with a three-dimensional perspective of structures and helped them recall what they learnt. Although their perception about the importance of dissection changed as they progressed in the course, good anatomy textbooks were perceived as an excellent resource for learning anatomy. Interestingly, innovations used in teaching anatomy, such as interactive multimedia resources, have not replaced students' perceptions about the importance of dissection.

Does a coffee plant develop from one initial cell in the shoot apex of an embryo ?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moh, C. C.

1961-01-01

Evidence obtained from Ri morphological mutants suggests that except for the epidermis, development of a young coffee shoot is from a single initial cell of the corpus. This conclusion is supported by the high frequency of Ri non- chimeric mutants, shapes of the dosage response curves with x rays and neutrons and the association of pollen sterility with some of the mutants.

Dwarfism and increased adiposity in the gh1 mutant zebrafish vizzini.

PubMed

McMenamin, Sarah K; Minchin, James E N; Gordon, Tiffany N; Rawls, John F; Parichy, David M

2013-04-01

Somatic growth and adipogenesis are closely associated with the development of obesity in humans. In this study, we identify a zebrafish mutant, vizzini, that exhibits both a severe defect in somatic growth and increased accumulation of adipose tissue. Positional cloning of vizzini revealed a premature stop codon in gh1. Although the effects of GH are largely through igfs in mammals, we found no decrease in the expression of igf transcripts in gh1 mutants during larval development. As development progressed, however, we found overall growth to be progressively retarded and the attainment of specific developmental stages to occur at abnormally small body sizes relative to wild type. Moreover, both subcutaneous (sc) and visceral adipose tissues underwent precocious development in vizzini mutants, and at maturity, the sizes of different fat deposits were greatly expanded relative to wild type. In vivo confocal imaging of sc adipose tissue (SAT) expansion revealed that vizzini mutants exhibit extreme enlargement of adipocyte lipid droplets without a corresponding increase in lipid droplet number. These findings suggest that GH1 signaling restricts SAT hypertrophy in zebrafish. Finally, nutrient deprivation of vizzini mutants revealed that SAT mobilization was greatly diminished during caloric restriction, further implicating GH1 signaling in adipose tissue homeostasis. Overall, the zebrafish gh1 mutant, vizzini, exhibits decreased somatic growth, increased adipose tissue accumulation, and disrupted adipose plasticity after nutrient deprivation and represents a novel model to investigate the in vivo dynamics of vertebrate obesity.

Dwarfism and Increased Adiposity in the gh1 Mutant Zebrafish vizzini

PubMed Central

McMenamin, Sarah K.; Minchin, James E.N.; Gordon, Tiffany N.

2013-01-01

Somatic growth and adipogenesis are closely associated with the development of obesity in humans. In this study, we identify a zebrafish mutant, vizzini, that exhibits both a severe defect in somatic growth and increased accumulation of adipose tissue. Positional cloning of vizzini revealed a premature stop codon in gh1. Although the effects of GH are largely through igfs in mammals, we found no decrease in the expression of igf transcripts in gh1 mutants during larval development. As development progressed, however, we found overall growth to be progressively retarded and the attainment of specific developmental stages to occur at abnormally small body sizes relative to wild type. Moreover, both subcutaneous (sc) and visceral adipose tissues underwent precocious development in vizzini mutants, and at maturity, the sizes of different fat deposits were greatly expanded relative to wild type. In vivo confocal imaging of sc adipose tissue (SAT) expansion revealed that vizzini mutants exhibit extreme enlargement of adipocyte lipid droplets without a corresponding increase in lipid droplet number. These findings suggest that GH1 signaling restricts SAT hypertrophy in zebrafish. Finally, nutrient deprivation of vizzini mutants revealed that SAT mobilization was greatly diminished during caloric restriction, further implicating GH1 signaling in adipose tissue homeostasis. Overall, the zebrafish gh1 mutant, vizzini, exhibits decreased somatic growth, increased adipose tissue accumulation, and disrupted adipose plasticity after nutrient deprivation and represents a novel model to investigate the in vivo dynamics of vertebrate obesity. PMID:23456361

A Factor Linking Floral Organ Identity and Growth Revealed by Characterization of the Tomato Mutant unfinished flower development (ufd).

PubMed

Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Yuste-Lisbona, Fernando J; Pons, Clara; Giménez, Estela; Angosto, Trinidad; Granell, Antonio; Capel, Juan; Lozano, Rafael

2016-01-01

Floral organogenesis requires coordinated interactions between genes specifying floral organ identity and those regulating growth and size of developing floral organs. With the aim to isolate regulatory genes linking both developmental processes (i.e., floral organ identity and growth) in the tomato model species, a novel mutant altered in the formation of floral organs was further characterized. Under normal growth conditions, floral organ primordia of mutant plants were correctly initiated, however, they were unable to complete their development impeding the formation of mature and fertile flowers. Thus, the growth of floral buds was blocked at an early stage of development; therefore, we named this mutant as unfinished flower development ( ufd ). Genetic analysis performed in a segregating population of 543 plants showed that the abnormal phenotype was controlled by a single recessive mutation. Global gene expression analysis confirmed that several MADS-box genes regulating floral identity as well as other genes participating in cell division and different hormonal pathways were affected in their expression patterns in ufd mutant plants. Moreover, ufd mutant inflorescences showed higher hormone contents, particularly ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) and strigol compared to wild type. Such results indicate that UFD may have a key function as positive regulator of the development of floral primordia once they have been initiated in the four floral whorls. This function should be performed by affecting the expression of floral organ identity and growth genes, together with hormonal signaling pathways.

Influence of a Dissection Video Clip on Anxiety, Affect, and Self-Efficacy in Educational Dissection: A Treatment Study

PubMed Central

Randler, Christoph; Demirhan, Eda; Wüst-Ackermann, Peter; Desch, Inga H.

2016-01-01

In science education, dissections of animals are an integral part of teaching, but they often evoke negative emotions. We aimed at reducing negative emotions (anxiety, negative affect [NA]) and increasing positive affect (PA) and self-efficacy by an experimental intervention using a predissection video to instruct students about fish dissection. We compared this treatment with another group that watched a life history video about the fish. The participants were 135 students studying to become biology teachers. Seventy received the treatment with the dissection video, and 65 viewed the life history video. We applied a pre/posttest treatment-comparison design and used the Positive and Negative Affect Schedule (PANAS), the State–Trait–Anxiety Inventory for State (STAI-S), and a self-efficacy measure three times: before the lesson (pretest), after the film treatment (posttest 1), and after the dissection (posttest 2). The dissection film group scored higher in PA, NA, and state anxiety (STAI-S) after the dissection video treatment and higher in self-efficacy after the dissection. The life history group showed no differences between the pretest and posttest 1. The dissection film has clear benefits—increasing PA and self-efficacy—that come at the cost of higher NA and higher STAI-S. PMID:27290738

Dissection videos do not improve anatomy examination scores.

PubMed

Mahmud, Waqas; Hyder, Omar; Butt, Jamaal; Aftab, Arsalan

2011-01-01

In this quasi-experimental study, we describe the effect of showing dissection videos on first-year medical students' performance in terms of test scores during a gross anatomy course. We also surveyed students' perception regarding the showing of dissection videos. Two hundred eighty-seven first-year medical students at Rawalpindi Medical College in Pakistan, divided into two groups, dissected one limb in first term and switched over to the other limb in the second term. During the second term, instruction was supplemented by dissection videos. Second-term anatomy examination marks were compared with first-term scores and with results from first-year medical students in previous years. Multiple linear regression analysis was performed, with term scores (continuous, 0-200) as the dependent variable. Students shown dissection videos scored 1.26 marks higher than those not shown. The relationship was not statistically significant (95% CI: -1.11, 3.70; P = 0.314). Ninety-three percent of students favored regular inclusion of dissection videos in curriculum, and 50% termed it the best source for learning gross anatomy. Seventy-six percent of students did not perform regular cadaver dissection. The most frequent reason cited for not performing regular dissection was high student-cadaver ratio. Dissection videos did not improve performance on final examination scores; however, students favored their use. Copyright © 2011 American Association of Anatomists.

Influence of a Dissection Video Clip on Anxiety, Affect, and Self-Efficacy in Educational Dissection: A Treatment Study.

PubMed

Randler, Christoph; Demirhan, Eda; Wüst-Ackermann, Peter; Desch, Inga H

2016-01-01

In science education, dissections of animals are an integral part of teaching, but they often evoke negative emotions. We aimed at reducing negative emotions (anxiety, negative affect [NA]) and increasing positive affect (PA) and self-efficacy by an experimental intervention using a predissection video to instruct students about fish dissection. We compared this treatment with another group that watched a life history video about the fish. The participants were 135 students studying to become biology teachers. Seventy received the treatment with the dissection video, and 65 viewed the life history video. We applied a pre/posttest treatment-comparison design and used the Positive and Negative Affect Schedule (PANAS), the State-Trait-Anxiety Inventory for State (STAI-S), and a self-efficacy measure three times: before the lesson (pretest), after the film treatment (posttest 1), and after the dissection (posttest 2). The dissection film group scored higher in PA, NA, and state anxiety (STAI-S) after the dissection video treatment and higher in self-efficacy after the dissection. The life history group showed no differences between the pretest and posttest 1. The dissection film has clear benefits - increasing PA and self-efficacy - that come at the cost of higher NA and higher STAI-S.

The dissection room experience: A factor in the choice of organ and whole body donation--a Nigerian survey.

PubMed

Anyanwu, Emeka G; Obikili, Emmanuel N; Agu, Augustine U

2014-01-01

The psychosocial impact of human dissection on the lives of medical and health science students has been noted. To assess the impact of the dissection room experience on one's willingness to become a whole body and organ donor, the attitudes of 1,350 students and professionals from the medical, health, and non-health related disciplines to body and organ donation were studied. The participants were broken into categories according to degree of exposure to human dissection. Participants who were never exposed to the dissection experience showed more willingness to donate their bodies than those who were exposed. With the exception of the physiotherapy department, the students and professionals from the health science departments who were exposed to the dissection room but never engaged in dissection showed the most unwillingness to donate their bodies (P < 0.001). An unwillingness to donate oneself was noted as one of the negative impacts associated with exposure to the dissection room. Willingness to donate an organ correlated positively with the level of exposure to the dissection room (P < 0.001). Most of the reasons for unwillingness were traceable to negative perceptions of the dissection room as a result of poor and disrespectful management of the human cadavers. © 2013 American Association of Anatomists.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

AINTEGUMENTA-LIKE genes have partly overlapping functions with AINTEGUMENTA but make distinct contributions to Arabidopsis thaliana flower development

PubMed Central

Krizek, Beth A.

2015-01-01

AINTEGUMENTA (ANT) is an important regulator of Arabidopsis flower development that has overlapping functions with the related AINTEGUMENTA-LIKE6 (AIL6) gene in floral organ initiation, identity specification, growth, and patterning. Two other AINTEGUMENTA-LIKE (AIL) genes, AIL5 and AIL7, are expressed in developing flowers in spatial domains that partly overlap with those of ANT. Here, it is shown that AIL5 and AIL7 also act in a partially redundant manner with ANT. The results demonstrate that AIL genes exhibit unequal genetic redundancy with roles for AIL5, AIL6, and AIL7 only revealed in the absence of ANT function. ant ail5 and ant ail7 double mutant flowers show alterations in floral organ positioning and growth, sepal fusion, and reductions in petal number. In ant ail5, petals are often replaced by filaments or dramatically reduced in size. ant ail7 double mutants produce increased numbers of carpels, which have defects in valve fusion and a loss of apical tissues. The distinct phenotypes of ant ail5, ant ail7 and the previously characterized ant ail6 indicate that AIL5, AIL6, and AIL7 make unique contributions to flower development. These distinct roles are also supported by genetic analyses of ant ail triple mutants. While ant ail5 ail6 triple mutants closely resemble ant ail6 double mutants, ant ail5 ail7 triple mutants exhibit more severe deviations from the wild type than either ant ail5 or ant ail7 double mutants. Furthermore, it is shown that AIL5, AIL6, and AIL7 act in a dose dependent manners in ant and other mutant backgrounds. PMID:25956884

Neurogenin 1 Null Mutant Ears Develop Fewer, Morphologically Normal Hair Cells in Smaller Sensory Epithelia Devoid of Innervation

PubMed Central

Ma, Qiufu; Anderson, David J.

2000-01-01

The proneuronal gene neurogenin 1 (ngn1) is essential for development of the inner-ear sensory neurons that are completely absent in ngn1 null mutants. Neither afferent, efferent, nor autonomic nerve fibers were detected in the ears of ngn1 null mutants. We suggest that efferent and autonomic fibers are lost secondarily to the absence of afferents. In this article we show that ngn1 null mutants develop smaller sensory epithelia with morphologically normal hair cells. In particular, the saccule is reduced dramatically and forms only a small recess with few hair cells along a duct connecting the utricle with the cochlea. Hair cells of newborn ngn1 null mutants show no structural abnormalities, suggesting that embryonic development of hair cells is independent of innervation. However, the less regular pattern of dispersal within sensory epithelia may be caused by some effects of afferents or to the stunted growth of the sensory epithelia. Tracing of facial and stato-acoustic nerves in control and ngn1 null mutants showed that only the distal, epibranchial, placode-derived sensory neurons of the geniculate ganglion exist in mutants. Tracing further showed that these geniculate ganglion neurons project exclusively to the solitary tract. In addition to the normal complement of facial branchial and visceral motoneurons, ngn1 null mutants have some trigeminal motoneurons and contralateral inner-ear efferents projecting, at least temporarily, through the facial nerve. These data suggest that some neurons in the brainstem (e.g., inner-ear efferents, trigeminal motoneurons) require afferents to grow along and redirect to ectopic cranial nerve roots in the absence of their corresponding sensory roots. PMID:11545141

Not just gRASping at flaws: Finding vulnerabilities to develop novel therapies for treating KRAS mutant cancers

PubMed Central

Ebi, Hiromichi; Faber, Anthony C; Engelman, Jeffrey A; Yano, Seiji

2014-01-01

Mutations in Kirsten rat-sarcoma (KRAS) are well appreciated to be major drivers of human cancers through dysregulation of multiple growth and survival pathways. Similar to many other non-kinase oncogenes and tumor suppressors, efforts to directly target KRAS pharmaceutically have not yet materialized. As a result, there is broad interest in an alternative approach to develop therapies that induce synthetic lethality in cancers with mutant KRAS, therefore exposing the particular vulnerabilities of these cancers. Fueling these efforts is our increased understanding into the biology driving KRAS mutant cancers, in particular the important pathways that mutant KRAS governs to promote survival. In this mini-review, we summarize the latest approaches to treat KRAS mutant cancers and the rationale behind them. PMID:24612015

Is there a superior simulator for human anatomy education? How virtual dissection can overcome the anatomic and pedagogic limitations of cadaveric dissection.

PubMed

Darras, Kathryn E; de Bruin, Anique B H; Nicolaou, Savvas; Dahlström, Nils; Persson, Anders; van Merriënboer, Jeroen; Forster, Bruce B

2018-03-23

Educators must select the best tools to teach anatomy to future physicians and traditionally, cadavers have always been considered the "gold standard" simulator for living anatomy. However, new advances in technology and radiology have created new teaching tools, such as virtual dissection, which provide students with new learning opportunities. Virtual dissection is a novel way of studying human anatomy through patient computed tomography (CT) scans. Through touchscreen technology, students can work together in groups to "virtually dissect" the CT scans to better understand complex anatomic relationships. This article presents the anatomic and pedagogic limitations of cadaveric dissection and explains what virtual dissection is and how this new technology may be used to overcome these limitations.

Aortic Elongation and Stanford B Dissection: The Tübingen Aortic Pathoanatomy (TAIPAN) Project.

PubMed

Lescan, M; Veseli, K; Oikonomou, A; Walker, T; Lausberg, H; Blumenstock, G; Bamberg, F; Schlensak, C; Krüger, T

2017-08-01

Aortic elongation has not yet been considered as a potential risk factor for Stanford type B dissection (TBD). The role of both aortic elongation and dilatation in patients with TBD was evaluated. The aortic morphology of a healthy control group (n = 236) and patients with TBD (n = 96) was retrospectively examined using three dimensional computed tomography imaging. Curved multiplanar reformats were used to examine aortic diameters at defined landmarks and aortic segment lengths. Diameters at all landmarks were significantly larger in the TBD group. The greatest diameter difference (56%) was measured in dissected descending aortas (p < .001). The segment with the most considerable difference between the study groups with regard to elongation was the non-dissected aortic arch of patients with TBD (36%; p < .001). Elongation in the aortic arch was accompanied by a diameter increase of 21% (p < .001). In receiver-operating curve analysis, the area under the curve was .85 for the diameter and .86 for the length of the aortic arch. In addition to dilatation, aortic arch elongation is associated with the development of TBD. The diameter and length of the non-dissected aortic arch may be predictive for TBD and may possibly be used for risk assessment in the future. This study provides the basis for further prospective evaluation of these parameters. Copyright © 2017 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

"And afterwards your body to be given for public dissection": a history of the murderers dissected in Glasgow and the west of Scotland.

PubMed

Kennedy, S S; McLeod, K J; McDonald, S W

2001-02-01

Between 1752 and 1832, the bodies of hanged murderers were dissected or gibbeted. During this period, 38 murderers were executed in the West of Scotland. The bodies of at least 23 were dissected in Glasgow. The stories of these murders are recounted. Insight is also given into the attitudes of the public and the anatomists to dissection of executed murderers.

Sequential segmental terminal lenticular side-cut dissection for safe and effective small-incision lenticule extraction in thin lenticules.

PubMed

Jacob, Soosan; Agarwal, Amar; Mazzotta, Cosimo; Agarwal, Athiya; Raj, John Michael

2017-04-01

Small-incision lenticule extraction may be associated with complications such as partial lenticular dissection, torn lenticule, lenticular adherence to cap, torn cap, and sub-cap epithelial ingrowth, some of which are more likely to occur during low-myopia corrections. We describe sequential segmental terminal lenticular side-cut dissection to facilitate minimally traumatic and smooth lenticular extraction. Anterior lamellar dissection is followed by central posterior lamellar dissection, leaving a thin peripheral rim and avoiding the lenticular side cut. This is followed by sequential segmental dissection of the lenticular side cut in a manner that fixates the lenticule and provides sufficient resistance for smooth and complete dissection of the posterior lamellar cut without undesired movements of the lenticule. The technique is advantageous in thin lenticules, where the risk for complications is high, but can also be used in thick lenticular dissection using wider sweeps to separate the lenticular side cut sequentially. Copyright © 2017 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Development of comprehensive nomograms for evaluating overall and cancer-specific survival of laryngeal squamous cell carcinoma patients treated with neck dissection

PubMed Central

Shi, Xiao; Hu, Wei-ping; Ji, Qing-hai

2017-01-01

Background Neck dissection for laryngeal squamous cell carcinoma (LSCC) patients could provide complementary prognostic information for AJCC N staging, like lymph node ratio (LNR). The aim of this study was to develop effective nomograms to better predict survival for LSCC patients treated with neck dissection. Results 2752 patients were identified and randomly divided into training (n = 2477) and validation (n = 275) cohorts. The 3- and 5-year probabilities of cancer-specific mortality (CSM) were 30.1% and 37.2% while 3- and 5-year death resulting from other causes (DROC) rate were 6.2% and 11.3%, respectively. 13 significant prognostic factors including LNR for overall (OS) and 12 (except race) for CSS were enrolled in the nomograms. Concordance index as a commonly used indicator of predictive performance, showed the nomograms had superiority over the no-LNR models and TNM classification (Training-cohort: OS: 0.713 vs 0.703 vs 0.667, CSS: 0.725 vs 0.713 vs 0.688; Validation-cohort: OS: 0.704 vs 0.690 vs 0.658, cancer-specific survival (CSS): 0.709 vs 0.693 vs 0.672). All calibration plots revealed good agreement between nomogram prediction and actual survival. Materials and Methods We identified LSCC patients undergoing neck dissection diagnosed between 1988 and 2008 from Surveillance, Epidemiology, and End Results (SEER) database. Optimal cutoff points were determined by X-tile program. Cumulative incidence function was used to analyze cancer-specific mortality (CSM) and death resulting from other causes (DROC). Significant predictive factors were used to establish nomograms estimating overall (OS) and cancer-specific survival (CSS). The nomograms were bootstrapped validated both internally and externally. Conclusions Comprehensive nomograms were constructed to predict OS and CSS for LSCC patients treated with neck dissection more accurately. PMID:28430613

Outcomes of Aortic Valve-Sparing Operations in Marfan Syndrome.

PubMed

David, Tirone E; David, Carolyn M; Manlhiot, Cedric; Colman, Jack; Crean, Andrew M; Bradley, Timothy

2015-09-29

In many cardiac units, aortic valve-sparing operations have become the preferred surgical procedure to treat aortic root aneurysm in patients with Marfan syndrome, based on relatively short-term outcomes. This study examined the long-term outcomes of aortic valve-sparing operations in patients with Marfan syndrome. All patients with Marfan syndrome operated on for aortic root aneurysm from 1988 through 2012 were followed prospectively for a median of 10 years. Follow-up was 100% complete. Time-to-event analyses were calculated using the Kaplan-Meier method with log-rank test for comparisons. A total of 146 patients with Marfan syndrome had aortic valve-sparing operations. Reimplantation of the aortic valve was performed in 121 and remodeling of the aortic root was performed in 25 patients. Mean age was 35.7 ± 11.4 years and two-thirds were men. Nine patients had acute, 2 had chronic type A, and 3 had chronic type B aortic dissections before surgery. There were 1 operative and 6 late deaths, 5 caused by complications of dissections. Mortality rate at 15 years was 6.8 ± 2.9%, higher than the general population matched for age and sex. Five patients required reoperation on the aortic valve: 2 for endocarditis and 3 for aortic insufficiency. Three patients developed severe, 4 moderate, and 3 mild-to-moderate aortic insufficiency. Rate of aortic insufficiency at 15 years was 7.9 ± 3.3%, lower after reimplantation than remodeling. Nine patients developed new distal aortic dissections during follow-up. Rate of dissection at 15 years was 16.5 ± 3.4%. Aortic valve-sparing operations in patients with Marfan syndrome were associated with low rates of valve-related complications in long-term follow-up. Residual and new aortic dissections were the leading cause of death. Copyright © 2015 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Role of Myofibril-Inducing RNA in cardiac TnT expression in developing Mexican axolotl

PubMed Central

Sferrazza, Gian-Franco; Zhang, Chi; Jia, Pingping; Lemanski, Sharon L.; Athauda, Gagani; Stassi, Alyssa; Halager, Kristine; Maier, Jennifer A.; Rueda-de-Leon, Elena; Gupta, Amit; Dube, Syamalima; Huang, Xupei; Prentice, Howard M.; Dube, Dipak K.; Lemanski, Larry F.

2007-01-01

The Mexican axolotl, Ambystoma mexicanum, has been a useful animal model to study heart development and cardiac myofibrillogenesis. A naturally-occurring recessive mutant, gene “c”, for cardiac non-function in the Mexican axolotl causes a failure of myofibrillogenesis due to a lack of tropomyosin expression in homozygous mutant (c/c) embryonic hearts.. Myofibril-Inducing RNA (MIR) rescues mutant hearts in vitro by promoting tropomyosin expression and myofibril formation thereafter. We have studied the effect of MIR on the expression of various isoforms of cardiac Troponin-T (cTnT), a component of the thin filament that binds with tropomyosin. Four alternatively spliced cTnT isoforms have been characterized from developing axolotl heart. The expression of various cTnT isoforms in normal, mutant, and mutant hearts corrected with MIR, is evaluated by real-time RT-PCR using isoform specific primer pairs; MIR affects the total transcription as well as the splicing of the cTnT in axolotl heart PMID:17408593

The ASK1 gene regulates development and interacts with the UFO gene to control floral organ identity in Arabidopsis.

PubMed

Zhao, D; Yang, M; Solava, J; Ma, H

1999-09-01

Normal flower development likely requires both specific and general regulators. We have isolated an Arabidopsis mutant ask1-1 (for -Arabidopsis skp1-like1-1), which exhibits defects in both vegetative and reproductive development. In the ask1-1mutant, rosette leaf growth is reduced, resulting in smaller than normal rosette leaves, and internodes in the floral stem are shorter than normal. Examination of cell sizes in these organs indicates that cell expansion is normal in the mutant, but cell number is reduced. In the mutant, the numbers of petals and stamens are reduced, and many flowers have one or more petals with a reduced size. In addition, all mutant flowers have short stamen filaments. Furthermore, petal/stamen chimeric organs are found in many flowers. These results indicate that the ASK1 gene affects the size of vegetative and floral organs. The ask1 floral phenotype resembles somewhat that of the Arabidopsis ufo mutants in that both genes affect whorls 2 and 3. We therefore tested for possible interactions between ASK1 and UFO by analyzing the phenotypes of ufo-2 ask1-1 double mutant plants. In these plants, vegetative development is similar to that of the ask1-1 single mutant, whereas the floral defects are more severe than those in either single mutant. Interior to the first whorl, the double mutant flowers have more sepals or sepal-like organs than are found in ufo-2, and less petals than ask1-1. Our results suggest that ASK1 interacts with UFO to control floral organ identity in whorls 2 and 3. This is very intriguing because ASK1 is very similar in sequence to the yeast SKP1 protein and UFO contains an F-box, a motif known to interact with SKP1 in yeast. Although the precise mechanism of ASK1 and UFO action is unknown, our results support the hypothesis that these two proteins physically interact in vivo. Copyright 1999 Wiley-Liss, Inc.

Natural history of optical coherence tomography-detected non-flow-limiting edge dissections following drug-eluting stent implantation.

PubMed

Radu, Maria D; Räber, Lorenz; Heo, Jungho; Gogas, Bill D; Jørgensen, Erik; Kelbæk, Henning; Muramatsu, Takashi; Farooq, Vasim; Helqvist, Steffen; Garcia-Garcia, Hector M; Windecker, Stephan; Saunamäki, Kari; Serruys, Patrick W

2014-01-22

Angiographic evidence of edge dissections has been associated with a risk of early stent thrombosis. Optical coherence tomography (OCT) is a high-resolution technology detecting a greater number of edge dissections--particularly non-flow-limiting--compared to angiography. Their natural history and clinical implications remain unclear. The objectives of the present study were to assess the morphology, healing response, and clinical outcomes of OCT-detected edge dissections using serial OCT imaging at baseline and at one year following drug-eluting stent (DES) implantation. Edge dissections were defined as disruptions of the luminal surface in the 5 mm segments proximal and distal to the stent, and categorised as flaps, cavities, double-lumen dissections or fissures. Qualitative and quantitative OCT analyses were performed every 0.5 mm at baseline and one year, and clinical outcomes were assessed. Sixty-three lesions (57 patients) were studied with OCT at baseline and one-year follow-up. Twenty-two non-flow-limiting edge dissections in 21 lesions (20 patients) were identified by OCT; only two (9%) were angiographically visible. Flaps were found in 96% of cases. The median longitudinal dissection length was 2.9 mm (interquartile range [IQR] 1.6-4.2 mm), whereas the circumferential and axial extensions amounted to 1.2 mm (IQR: 0.9-1.7 mm) and 0.6 mm (IQR: 0.4-0.7 mm), respectively. Dissections extended into the media and adventitia in seven (33%) and four (20%) cases, respectively. Eighteen (82%) OCT-detected edge dissections were also evaluated with intravascular ultrasound which identified nine (50%) of these OCT-detected dissections. No stent thrombosis or target lesion revascularisation occurred up to one year. At follow-up, 20 (90%) edge dissections were completely healed on OCT. The two cases exhibiting persistent dissection had the longest flaps (2.81 mm and 2.42 mm) at baseline. OCT-detected edge dissections which are angiographically silent in the majority of cases are not associated with acute stent thrombosis or restenosis up to one-year follow-up.

[Surgery and anatomy in the Renaissance].

PubMed

Romero-y Huesca, Andrés; Ramírez-Bollas, Julio; Ponce-Landín, Francisco Javier; Moreno-Rojas, Juan Carlos; Soto-Miranda, Miguel Angel

2005-01-01

The interest in the physical perfection and the corporal forms brings as a result the creation of new anatomical studies. The anatomical knowledge progressed in the second half of the XV century, conceiving the knowledge of the human body as a basic reality of Medicine. One of the greater contributions of the Italian Universities to medicine was the teaching of anatomy. The Universities of Padua, Bologna, and Pisa educated in their classrooms great physicians like Andres Vesalio, Gabriel Fallopio, Realdo Colombo, Mondino de Luzzi, Julio Ceasar Aranzio, and Gaspare Tagliacozzi, among others. The teaching of anatomy during the Renaissance was characterized by the development of dissection techniques and autopsy practice, which was recognized as an extremely valuable skill for anatomical study. The dissections were made in circular amphitheatres in the following way: a Medicine professor read the text book, another one made the dissection, and a third one indicated the structures referred.

Tracking cohesive subgroups over time in inferred social networks

NASA Astrophysics Data System (ADS)

Chin, Alvin; Chignell, Mark; Wang, Hao

2010-04-01

As a first step in the development of community trackers for large-scale online interaction, this paper shows how cohesive subgroup analysis using the Social Cohesion Analysis of Networks (SCAN; Chin and Chignell 2008) and Data-Intensive Socially Similar Evolving Community Tracker (DISSECT; Chin and Chignell 2010) methods can be applied to the problem of identifying cohesive subgroups and tracking them over time. Three case studies are reported, and the findings are used to evaluate how well the SCAN and DISSECT methods work for different types of data. In the largest of the case studies, variations in temporal cohesiveness are identified across a set of subgroups extracted from the inferred social network. Further modifications to the DISSECT methodology are suggested based on the results obtained. The paper concludes with recommendations concerning further research that would be beneficial in addressing the community tracking problem for online data.

Techniques for Preservation of the Frontotemporal Branch of Facial Nerve during Orbitozygomatic Approaches

PubMed Central

Spiriev, Toma; Poulsgaard, Lars; Fugleholm, Kaare

2014-01-01

Background During orbitozygomatic (OZ) approaches, the frontotemporal branch (FTB) of the facial nerve is exposed to injury if proper measures are not taken. This article describes in detail the nuances of the two most common techniques (interfascial and subfascial dissection). Design The FTB of the facial nerve was dissected and followed in its tissue planes on fresh-frozen cadaver heads. The interfascial and subfascial dissections were performed, and every step was photographed and examined. Results The interfascial dissection is safe to be started from the most anterior part of the superior temporal line and followed to the root of the zygoma. The dissection is continued on the deep temporalis fascia (DTF), and the interfascial fat pad is elevated. With the subfascial dissection, both the superficial temporalis fascia and the DTF are elevated. The interfascial dissection exposes the zygomatic arch directly, whereas the subfascial dissection requires an additional cut on the DTF to expose the zygomatic arch. Proper subperiosteal dissection on the zygomatic arch is another important step in FTB preservation. Conclusion Detailed understanding of the complex relationship of the tissue planes in the frontotemporal region is needed to perform OZ exposures safely. PMID:26225300

The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.

PubMed

Kulalert, Warakorn; Kim, Dennis H

2013-12-16

In response to unfavorable environmental conditions such as starvation, crowding, and elevated temperature, Caenorhabditis elegans larvae enter an alternative developmental stage known as dauer, which is characterized by adaptive changes in stress resistance and metabolism. The genetic dissection of the molecular mechanisms of the C. elegans dauer developmental decision has defined evolutionarily conserved signaling pathways of organismal neuroendocrine physiology. Here, we have identified a mechanism by which a dominant mutation in a neuronal insulin gene, daf-28(sa191), causes constitutive entry into dauer diapause. We demonstrate that expression of the mutant DAF-28 insulin peptide results in endoplasmic reticulum (ER) stress in the ASI pair of chemosensory neurons. The neuronal ER stress does not compromise cellular survival but activates PEK-1, the C. elegans ortholog of the mammalian eIF2α kinase PERK, which in turn phosphorylates Ser49 of eIF2α, specifically in the ASI neuron pair, to promote entry into dauer diapause. Our data establish a novel role for ER stress and the unfolded protein response (UPR) in promoting entry into dauer diapause and suggest that, in addition to cell-autonomous activities in the maintenance of ER homeostasis, the UPR may act in a non-cell-autonomous manner to promote organismal adaptation to stress during larval development. Copyright © 2013 Elsevier Ltd. All rights reserved.

Two Distinct Coagulase-Dependent Barriers Protect Staphylococcus aureus from Neutrophils in a Three Dimensional in vitro Infection Model

PubMed Central

Guggenberger, Christoph; Wolz, Christiane; Morrissey, Julie A.; Heesemann, Jürgen

2012-01-01

Staphylococcus aureus is a pyogenic abscess-forming facultative pathogenic microorganism expressing a large set of virulence-associated factors. Among these, secreted proteins with binding capacity to plasma proteins (e.g. fibrinogen binding proteins Eap and Emp) and prothrombin activators such as Coagulase (Coa) and vWbp are involved in abscess formation. By using a three-dimensional collagen gel (3D-CoG) supplemented with fibrinogen (Fib) we studied the growth behavior of S. aureus strain Newman and a set of mutants as well as their interaction with mouse neutrophils by real-time confocal microscopy. In 3D-CoG/Fib, S. aureus forms microcolonies which are surrounded by an inner pseudocapsule and an extended outer dense microcolony-associated meshwork (MAM) containing fibrin. Coa is involved in formation of the pseudocapsule whereas MAM formation depends on vWbp. Moreover, agr-dependent dispersal of late stage microcolonies could be observed. Furthermore, we demonstrate that the pseudocapsule and the MAM act as mechanical barriers against neutrophils attracted to the microcolony. The thrombin inhibitor argatroban is able to prevent formation of both pseudocapsule and MAM and supports access of neutrophils to staphylococci. Taken together, this model can simulate specific stages of S. aureus abscess formation by temporal dissection of bacterial growth and recruitment of immune cells. It can complement established animal infection models in the development of new treatment options. PMID:22253592

Dissecting plasmodesmata molecular composition by mass spectrometry-based proteomics.

PubMed

Salmon, Magali S; Bayer, Emmanuelle M F

2012-01-01

In plants, the intercellular communication through the membranous channels called plasmodesmata (PD; singular plasmodesma) plays pivotal roles in the orchestration of development, defence responses, and viral propagation. PD are dynamic structures embedded in the plant cell wall that are defined by specialized domains of the endoplasmic reticulum (ER) and the plasma membrane (PM). PD structure and unique functions are guaranteed by their particular molecular composition. Yet, up to recent years and despite numerous approaches such as mutant screens, immunolocalization, or screening of random cDNAs, only few PD proteins had been conclusively identified and characterized. A clear breakthrough in the search of PD constituents came from mass-spectrometry-based proteomic approaches coupled with subcellular fractionation strategies. Due to their position, firmly anchored in the extracellular matrix, PD are notoriously difficult to isolate for biochemical analysis. Proteomic-based approaches have therefore first relied on the use of cell wall fractions containing embedded PD then on "free" PD fractions whereby PD membranes were released from the walls by enzymatic degradation. To discriminate between likely contaminants and PD protein candidates, bioinformatics tools have often been used in combination with proteomic approaches. GFP fusion proteins of selected candidates have confirmed the PD association of several protein families. Here we review the accomplishments and limitations of the proteomic-based strategies to unravel the functional and structural complexity of PD. We also discuss the role of the identified PD-associated proteins.

Drosophila Embryos as Model Systems for Monitoring Bacterial Infection in Real Time

PubMed Central

Evans, Iwan R.; Waterfield, Nicholas; ffrench-Constant, Richard H.; Wood, Will

2009-01-01

Drosophila embryos are well studied developmental microcosms that have been used extensively as models for early development and more recently wound repair. Here we extend this work by looking at embryos as model systems for following bacterial infection in real time. We examine the behaviour of injected pathogenic (Photorhabdus asymbiotica) and non-pathogenic (Escherichia coli) bacteria and their interaction with embryonic hemocytes using time-lapse confocal microscopy. We find that embryonic hemocytes both recognise and phagocytose injected wild type, non-pathogenic E. coli in a Dscam independent manner, proving that embryonic hemocytes are phagocytically competent. In contrast, injection of bacterial cells of the insect pathogen Photorhabdus leads to a rapid ‘freezing’ phenotype of the hemocytes associated with significant rearrangement of the actin cytoskeleton. This freezing phenotype can be phenocopied by either injection of the purified insecticidal toxin Makes Caterpillars Floppy 1 (Mcf1) or by recombinant E. coli expressing the mcf1 gene. Mcf1 mediated hemocyte freezing is shibire dependent, suggesting that endocytosis is required for Mcf1 toxicity and can be modulated by dominant negative or constitutively active Rac expression, suggesting early and unexpected effects of Mcf1 on the actin cytoskeleton. Together these data show how Drosophila embryos can be used to track bacterial infection in real time and how mutant analysis can be used to genetically dissect the effects of specific bacterial virulence factors. PMID:19609447

Dissecting the HMO-benefits managers relationship: what to measure and why.

PubMed

Peltier, J W; Westfall, J

2000-01-01

The relationship between health maintenance organizations (HMO) and employee benefits managers (EBM) is multidimensional and complex. Relationship marketing theory is used to illustrate its role in strengthening interorganizational bonds and reducing defections to other health plans. The importance of various service dimensions in the HMO-EBM relationship can change depending on whether the measure used is overall satisfaction, overall quality, and loyalty to the HMO. By dissecting relationships in this way, HMOs can develop strategies that take multiple routes for building and maintaining strong partnerships with employee benefits managers.

Focal adhesion kinase (FAK) regulates polymerase activity of multiple influenza A virus subtypes.

PubMed

Elbahesh, Husni; Bergmann, Silke; Russell, Charles J

2016-12-01

Influenza A viruses (IAVs) cause numerous pandemics and yearly epidemics resulting in ~500,000 annual deaths globally. IAV modulates cellular signaling pathways at every step of the infection cycle. Focal adhesion kinase (FAK) has been shown to play a critical role in endosomal trafficking of influenza A viruses, yet it is unclear how FAK kinase activity regulates IAV replication. Using mini-genomes derived from H1N1, H5N1 and H7N9 viruses, we dissected RNA replication by IAVs independent of viral entry or release. Our results show FAK activity promotes efficient IAV polymerase activity and inhibiting FAK activity with a chemical inhibitor or a kinase-dead mutant significantly reduces IAV polymerase activity. Using co-immunoprecipitations and proximity ligation assays, we observed interactions between FAK and the viral nucleoprotein, supporting a direct role of FAK in IAV replication. Altogether, the data indicates that FAK kinase activity is important in promoting IAV replication by regulating its polymerase activity. Copyright © 2016 Elsevier Inc. All rights reserved.

Differential regulation of the Epr3 receptor coordinates membrane-restricted rhizobial colonization of root nodule primordia

PubMed Central

Kawaharada, Yasuyuki; Nielsen, Mette W.; Kelly, Simon; James, Euan K.; Andersen, Kasper R.; Rasmussen, Sheena R.; Füchtbauer, Winnie; Madsen, Lene H.; Heckmann, Anne B.; Radutoiu, Simona; Stougaard, Jens

2017-01-01

In Lotus japonicus, a LysM receptor kinase, EPR3, distinguishes compatible and incompatible rhizobial exopolysaccharides at the epidermis. However, the role of this recognition system in bacterial colonization of the root interior is unknown. Here we show that EPR3 advances the intracellular infection mechanism that mediates infection thread invasion of the root cortex and nodule primordia. At the cellular level, Epr3 expression delineates progression of infection threads into nodule primordia and cortical infection thread formation is impaired in epr3 mutants. Genetic dissection of this developmental coordination showed that Epr3 is integrated into the symbiosis signal transduction pathways. Further analysis showed differential expression of Epr3 in the epidermis and cortical primordia and identified key transcription factors controlling this tissue specificity. These results suggest that exopolysaccharide recognition is reiterated during the progressing infection and that EPR3 perception of compatible exopolysaccharide promotes an intracellular cortical infection mechanism maintaining bacteria enclosed in plant membranes. PMID:28230048

Talin-dependent integrin activation is required for fibrin clot retraction by platelets

PubMed Central

Haling, Jacob R.; Monkley, Susan J.; Critchley, David R.

2011-01-01

Talin functions both as a regulator of integrin affinity and as an important mechanical link between integrins and the cytoskeleton. Using genetic deletion of talin, we show for the first time that the capacity of talin to activate integrins is required for fibrin clot retraction by platelets. To further dissect which talin functions are required for this process, we tested clot retraction in platelets expressing a talin1(L325R) mutant that binds to integrins, but exhibits impaired integrin activation ascribable to disruption of the interaction between talin and the membrane-proximal region (MPR) in the β-integrin cytoplasmic domain. Talin-deficient and talin1(L325R) platelets were defective in retracting fibrin clots. However, the defect in clot retraction in talin1(L325R) platelets, but not talin-deficient platelets, was rescued by extrinsically activating integrins with manganese, thereby proving that integrin activation is required and showing that talin1(L325R) can form functional links to the actin cytoskeleton. PMID:20971947

Engineering A-kinase Anchoring Protein (AKAP)-selective Regulatory Subunits of Protein Kinase A (PKA) through Structure-based Phage Selection*

PubMed Central

Gold, Matthew G.; Fowler, Douglas M.; Means, Christopher K.; Pawson, Catherine T.; Stephany, Jason J.; Langeberg, Lorene K.; Fields, Stanley; Scott, John D.

2013-01-01

PKA is retained within distinct subcellular environments by the association of its regulatory type II (RII) subunits with A-kinase anchoring proteins (AKAPs). Conventional reagents that universally disrupt PKA anchoring are patterned after a conserved AKAP motif. We introduce a phage selection procedure that exploits high-resolution structural information to engineer RII mutants that are selective for a particular AKAP. Selective RII (RSelect) sequences were obtained for eight AKAPs following competitive selection screening. Biochemical and cell-based experiments validated the efficacy of RSelect proteins for AKAP2 and AKAP18. These engineered proteins represent a new class of reagents that can be used to dissect the contributions of different AKAP-targeted pools of PKA. Molecular modeling and high-throughput sequencing analyses revealed the molecular basis of AKAP-selective interactions and shed new light on native RII-AKAP interactions. We propose that this structure-directed evolution strategy might be generally applicable for the investigation of other protein interaction surfaces. PMID:23625929

Kinase inhibitor profiling reveals unexpected opportunities to inhibit disease-associated mutant kinases

PubMed Central

Duong-Ly, Krisna C.; Devarajan, Karthik; Liang, Shuguang; Horiuchi, Kurumi Y.; Wang, Yuren; Ma, Haiching; Peterson, Jeffrey R.

2016-01-01

Summary Small-molecule kinase inhibitors have typically been designed to inhibit wild-type kinases rather than the mutant forms that frequently arise in diseases such as cancer. Mutations can have serious clinical implications by increasing kinase catalytic activity or conferring therapeutic resistance. To identify opportunities to repurpose inhibitors against disease-associated mutant kinases, we conducted a large-scale functional screen of 183 known kinase inhibitors against 76 recombinant, mutant kinases. The results revealed lead compounds with activity against clinically important mutant kinases including ALK, LRRK2, RET, and EGFR as well as unexpected opportunities for repurposing FDA-approved kinase inhibitors as leads for additional indications. Furthermore, using T674I PDGFRα as an example, we show how single-dose screening data can provide predictive structure-activity data to guide subsequent inhibitor optimization. This study provides a resource for the development of inhibitors against numerous disease-associated mutant kinases and illustrates the potential of unbiased profiling as an approach to compound-centric inhibitor development. PMID:26776524

Carotid Artery Dissection and Ischemic Stroke Originating from Localized Aortic Arch Dissection.

PubMed

Kamimura, Teppei; Nomura, Eiichi; Hara, Naoyuki; Maetani, Yuta; Agari, Dai; Ichimura, Kouichi; Yoshida, Hideo; Yamawaki, Takemori

2016-11-01

Aortic dissection is an infrequent but important cause of acute ischemic stroke (AIS), and must not be overlooked because of a possible worse outcome, especially with the use of an intravenous recombinant tissue plasminogen activator. We report a case of left carotid artery dissection and AIS originating from localized aortic arch dissection, pathologically caused by cystic medial necrosis in the tunica media. Copyright © 2016 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Uric acid in aortic dissection: A meta-analysis.

PubMed

Li, Xiaodong; Jiang, Shanshan; He, Jiaan; Li, Nan; Fan, Yichuan; Zhao, Xingzhi; Hu, Xinhua

2018-06-04

Studies on the serum uric acid levels in patients with aortic dissection have yielded conflicting results. To compare the difference in serum uric acid (SUA) levels between aortic dissection patients and controls by meta-analysis. Electronic literature search was conducted in PubMed, Embase, CKNI, CBM, Wanfang, and VIP databases until January 31, 2018. All observational studies that investigated SUA levels in aortic dissection patients and controls were included. Weighted mean difference (WMD) with 95% confidence intervals (CI) was used to summarize the difference in SUA levels between aortic dissection and control group. A total of seven case-control studies involving 1197 patients and 1193 controls were included. Pooled analysis showed that SUA levels were significantly higher in aortic dissection patients compared with those in the controls (WMD 58.22 μmol/L; 95% CI 26.71-89.73) in a random effect model. No significant difference (WMD 9.94 μmol/L; 95% CI -17.89-37.76) was observed in SUA levels between Stanford type A and Stanford type B aortic dissection. This meta-analysis provides evidence that SUA levels are significantly higher among patients with aortic dissection than those in controls. Elevated SUA levels may contribute to the pathogenesis of aortic dissection. Further large clinical studies to investigate whether SUA levels are an independently risk factor for aortic dissection are warranted. Copyright © 2018 Elsevier B.V. All rights reserved.

A Cold-Inducible DEAD-Box RNA Helicase from Arabidopsis thaliana Regulates Plant Growth and Development under Low Temperature.

PubMed

Liu, Yuelin; Tabata, Daisuke; Imai, Ryozo

2016-01-01

DEAD-box RNA helicases comprise a large family and are involved in a range of RNA processing events. Here, we identified one of the Arabidopsis thaliana DEAD-box RNA helicases, AtRH7, as an interactor of Arabidopsis COLD SHOCK DOMAIN PROTEIN 3 (AtCSP3), which is an RNA chaperone involved in cold adaptation. Promoter:GUS transgenic plants revealed that AtRH7 is expressed ubiquitously and that its levels of the expression are higher in rapidly growing tissues. Knockout mutant lines displayed several morphological alterations such as disturbed vein pattern, pointed first true leaves, and short roots, which resemble ribosome-related mutants of Arabidopsis. In addition, aberrant floral development was also observed in rh7 mutants. When the mutants were germinated at low temperature (12°C), both radicle and first leaf emergence were severely delayed; after exposure of seedlings to a long period of cold, the mutants developed aberrant, fewer, and smaller leaves. RNA blots and circular RT-PCR revealed that 35S and 18S rRNA precursors accumulated to higher levels in the mutants than in WT under both normal and cold conditions, suggesting the mutants are partially impaired in pre-rRNA processing. Taken together, the results suggest that AtRH7 affects rRNA biogenesis and plays an important role in plant growth under cold.

Human cadaveric dissection: a historical account from ancient Greece to the modern era

PubMed Central

2015-01-01

The review article attempts to focus on the practice of human cadaveric dissection during its inception in ancient Greece in 3rd century BC, revival in medieval Italy at the beginning of 14th century and subsequent evolution in Europe and the United States of America over the centuries. The article highlights on the gradual change in attitude of religious authorities towards human dissection, the shift in the practice of human dissection being performed by barber surgeons to the anatomist himself dissecting the human body and the enactment of prominent legislations which proved to be crucial milestones during the course of the history of human cadaveric dissection. It particularly emphasizes on the different means of procuring human bodies which changed over the centuries in accordance with the increasing demand due to the rise in popularity of human dissection as a tool for teaching anatomy. Finally, it documents the rise of body donation programs as the source of human cadavers for anatomical dissection from the second half of the 20th century. Presently innovative measures are being introduced within the body donation programs by medical schools across the world to sensitize medical students such that they maintain a respectful, compassionate and empathetic attitude towards the human cadaver while dissecting the same. Human dissection is indispensable for a sound knowledge in anatomy which can ensure safe as well as efficient clinical practice and the human dissection lab could possibly be the ideal place to cultivate humanistic qualities among future physicians in the 21st century. PMID:26417475

A glimpse into the process of gaining permission for the educational dissection of human cadavers in the Ottoman Empire.

PubMed

Akkin, Salih Murat; Dinc, Gulten

2014-10-01

Dissection of the human body for educational purposes became officially permitted in the Ottoman Empire only after a long, difficult process. In the West, studies based on the findings of Galen had been taboo during a long period in which dissection of human bodies had been prohibited. Although the first dissection studies since ancient times began to appear in the Western literature in the late 13th and early 14th centuries, the post-Galen taboo against dissection was broken only in the 16th century by the studies of Vesalius. However, in the Eastern World, it was only fairly recently that the idea of the "sanctity of the human body" could be challenged. In the medieval Islamic world, as during the Middle Ages in the West, prohibitions against the dissection of human cadavers continued for social and religious reasons, although the Koran does not specifically ban such dissection. This prohibition also continued through the Ottoman era, which began in the 14th century. The first efforts to end the prohibition on dissection in the Ottoman Empire were made at the beginning of the 19th century during the reign of Sultan Selim III but official permission for dissection was given only in 1841 during the reign of Sultan Abdulmecid. Educational dissections in the Ottoman Empire officially began at the Istanbul Medical School following the granting of this permission. This article will discuss the attempts to end the prohibition of dissection in Ottomans within the scope of the history of anatomical study in Turkey. © 2014 Wiley Periodicals, Inc.

Growth and sporulation of a pyrimidine spore color mutant of Sordaria fimicola.

PubMed

el-Ani, A S

1967-04-07

A nonautonomous spore color mutant of Sordaria fimicola is a pyrimidine auxotroph that produces hyaline nonviable ascospores. Uracil, uridine, and cytidine are more effective growth factors than cytosine and thymine and, in high concentrations, render the mutant self-fertile by inducing the ascospores to resume development and maturation. Crosses with the unlinked arginine non-autonomus spore color mutant st-59 yielded the double mutant st-59 pyr that requires both arginine and a pyrimidine for growth, which indicates a lack of suppression of the pyrimidine requirement by the arginine locus.

DISSECTING COLONY DEVELOPMENT OF NEUROSPORA CRASSA USING mRNA PROFILING AND COMPARTATIVE GENOMICS APPROACHES

USDA-ARS?s Scientific Manuscript database

Colony development, which includes hyphal extension, branching, anastomosis and asexual sporulation are fundamental aspects of the lifecycle of filamentous fungi; genetic mechanisms underlying these phenomena are poorly understood. We conducted transcriptional profiling during colony development of...

Alternatives To Dissection. Second Edition.

ERIC Educational Resources Information Center

DeRosa, Bill, Ed.; Winiarskyj, Lesia, Ed.

This packet attempts to provide educationally sound alternatives to dissection in the classroom, thereby making it possible for teachers to eliminate dissection from the curriculum. This packet can also be used by educators who include dissection in their curricula but consider it important to respect the expression of students' ethical, moral, or…

78 FR 6838 - Certain Balloon Dissection Devices and Products Containing Same; Institution of Investigation

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-31

... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-865] Certain Balloon Dissection Devices... the United States after importation of certain dissection balloons and products containing the same by... importation of certain dissection balloons and products containing the same that infringe one or more of...

A Dissecting Competition for Medical Students

ERIC Educational Resources Information Center

Samalia, Latika; Stringer, Mark D.

2012-01-01

After repeated requests from medical students for more cadaver dissection opportunities, a voluntary dissecting "competition" was initiated for the third year medical students in 2006. This has been held annually on five occasions since, offering up to 30 dissection stations and accommodating an average of 53 students (range 40-66) per year,…

Perceived Disgust and Personal Experiences are Associated with Acceptance of Dissections in Schools

ERIC Educational Resources Information Center

Fancovicova, Jana; Prokop, Pavol; Leskova, Andrea

2013-01-01

Animal dissections are essential parts of anatomy/zoology courses, but their effectiveness is influenced by student attitudes and emotions. Here we examined attitudes toward dissections in 397 prospective biology teachers enrolling two Slovak universities. Perceived disgust of dissections negatively correlated with other attitudes toward…

Science Teachers and the Dissection Debate: Perspectives on Animal Dissection and Alternatives

ERIC Educational Resources Information Center

Oakley, Jan

2012-01-01

This study investigated Ontario science and biology teachers' practices and attitudes toward animal dissection and dissection alternatives. The data was collected through a mixed methods approach involving online surveys (n = 153) and subsequent telephone interviews (n = 9) with secondary school science and biology teachers. The findings indicate…

Mig6 Puts the Brakes on Mutant EGFR-Driven Lung Cancer | Center for Cancer Research

Cancer.gov

Lung cancer is the most common cause of cancer-related death worldwide. These cancers are often induced by mutations in the epidermal growth factor receptor (EGFR), resulting in constitutive activation of the protein’s tyrosine kinase domain. Lung cancers expressing these EGFR mutants are initially sensitive to tyrosine kinase inhibitors (TKIs), such as erlotinib, but often become resistant by developing compensatory mutations in EGFR or other growth-promoting pathways. To better understand how mutant EGFR initiates and maintains tumor growth in the hopes of identifying novel targets for drug development, Udayan Guha, M.D., Ph.D., of CCR’s Thoracic and Gastrointestinal Oncology Branch, and his colleagues examined the landscape of proteins phosphorylated in EGFR wild type and mutant cells. One protein hyper-phosphorylated in mutant EGFR cells was Mig6, a putative tumor suppressor.

Characterization of a Lignified Secondary Phloem Fibre‐deficient Mutant of Jute (Corchorus capsularis)

PubMed Central

SENGUPTA, GARGI; PALIT, P.

2004-01-01

• Background and Aims High lignin content of lignocellulose jute fibre does not favour its utilization in making finer fabrics and other value‐added products. To aid the development of low‐lignin jute fibre, this study aimed to identify a phloem fibre mutant with reduced lignin. • Methods An x‐ray‐induced mutant line (CMU) of jute (Corchorus capsularis) was morphologically evaluated and the accession (CMU 013) with the most undulated phenotype was compared with its normal parent (JRC 212) for its growth, secondary fibre development and lignification of the fibre cell wall. • Key Results The normal and mutant plants showed similar leaf photosynthetic rates. The mutant grew more slowly, had shorter internodes and yielded much less fibre after retting. The fibre of the mutant contained 50 % less lignin but comparatively more cellulose than that of the normal type. Differentiation of primary and secondary vascular tissues throughout the CMU 013 stem was regular but it did not have secondary phloem fibre bundles as in JRC 212. Instead, a few thin‐walled, less lignified fibre cells formed uni‐ or biseriate radial rows within the phloem wedges of the middle stem. The lower and earliest developed part of the mutant stem had no lignified fibre cells. This developmental deficiency in lignification of fibre cells was correlated to a similar deficiency in phenylalanine ammonia lyase activity, but not peroxidase activity, in the bark tissue along the stem axis. In spite of severe reduction in lignin synthesis in the phloem cells this mutant functioned normally and bred true. • Conclusions In view of the observations made, the mutant is designated as deficient lignified phloem fibre (dlpf). This mutant may be utilized to engineer low‐lignin jute fibre strains and may also serve as a model to study the positional information that coordinates secondary wall thickening of fibre cells. PMID:14707004

Introduction of a new laser-scalpel for partial kidney resection based on 1.94 micrometer fiber laser system: initial in vivo-data

NASA Astrophysics Data System (ADS)

Tedsen, Sönke; Theisen-Kunde, Dirk; Doehn, Christian; Kausch, Ingo; Jocham, Dieter

2009-02-01

The technique of nephron sparing surgery has matured significantly over the past decade and is emerging as an oncologically sound procedure for the management of renal tumors. Methods of tumor excision as well as parenchymal reconstruction in a hemostaticallly controlled field have evolved to make this procedure safer. In an attempt to find an improoved hemostatic cutting instrument we developed a 1.94 micrometer Laser-Scalpel system in a porcine model. We evaluated data for partial porcine kidney resection performed by a 1.94 micrometer Laser-Scalpel and compared the data to those of a standard HF- (High- Frequency) dissection device. In 12 pigs general anesthesia and a median laparotomy was performed to expose both kidneys. In each pig one kidney was partially resected with the Laser-Scalpel and the other side with the HF-dissection device. The first 6 pigs were euthanized immediately after the procedure. The following 6 pigs were allowed to recover and underwent 2-3 weeks later euthanasia. The final evaluation data included total resection time, blood loss, mass of dissected tissue, total ischemic time and histological examination. Mean resected kidney tissue mass was 4.75 g with the laser system and 5.57 g for the HF-dissector, respectively. Mean estimated blood loss was 22 ml for the Laser- Scalpel and 78.2 ml for the HF-dissection device. Resection time was 9.45 min for the Laser-scalpel compared to 10.16 min. No complications, specifically no postoperative bleeding, occured in any of the animals. Histological evaluation with H&E staining showed a carbonized zone of about 0.57 mm directly at the dissected edge followed by a thermal damaged zone of about 1.25 mm in width. Thereafter healthy tissue was found in all histological samples. Partial kidney resection was easily and fast performed by the use of a 1.94 micrometer Laser-Scalpel system. Hemostasis was highly sufficient, so blood loss was minimal compared to conventional HF-dissection device. Therefore the 1.94 micrometer Laser-Scalpel system is a very promising dissection device for urological surgery.

Cerebrovascular defects in Foxc1 mutants correlate with aberrant WNT and VEGF-A pathways downstream of retinoic acid from the meninges.

PubMed

Mishra, Swati; Choe, Youngshik; Pleasure, Samuel J; Siegenthaler, Julie A

2016-12-01

Growth and maturation of the cerebrovasculature is a vital event in neocortical development however mechanisms that control cerebrovascular development remain poorly understood. Mutations in or deletions that include the FOXC1 gene are associated with congenital cerebrovascular anomalies and increased stroke risk in patients. Foxc1 mutant mice display severe cerebrovascular hemorrhage at late gestational ages. While these data demonstrate Foxc1 is required for cerebrovascular development, its broad expression in the brain vasculature combined with Foxc1 mutant's complex developmental defects have made it difficult to pinpoint its function(s). Using global and conditional Foxc1 mutants, we find 1) significant cerebrovascular growth defects precede cerebral hemorrhage and 2) expression of Foxc1 in neural crest-derived meninges and brain pericytes, though not endothelial cells, is required for normal cerebrovascular development. We provide evidence that reduced levels of meninges-derived retinoic acid (RA), caused by defects in meninges formation in Foxc1 mutants, is a major contributing factor to the cerebrovascular growth defects in Foxc1 mutants. We provide data that suggests that meninges-derived RA ensures adequate growth of the neocortical vasculature via regulating expression of WNT pathway proteins and neural progenitor derived-VEGF-A. Our findings offer the first evidence for a role of the meninges in brain vascular development and provide new insight into potential causes of cerebrovascular defects in patients with FOXC1 mutations. Copyright © 2016 Elsevier Inc. All rights reserved.

Arabidopsis STERILE APETALA, a multifunctional gene regulating inflorescence, flower, and ovule development

PubMed Central

Byzova, Marina V.; Franken, John; Aarts, Mark G.M.; de Almeida-Engler, Janice; Engler, Gilbert; Mariani, Celestina; Van Lookeren Campagne, Michiel M.; Angenent, Gerco C.

1999-01-01

A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. In sap flowers, sepals are carpelloid, petals are short and narrow or absent, and anthers are degenerated. Megasporogenesis, the process of meiotic divisions preceding the female gametophyte formation, is arrested in sap ovules during or just after the first meiotic division. More severe aberrations were observed in double mutants between sap and mutant alleles of the floral homeotic gene APETALA2 (AP2) suggesting that both genes are involved in the initiation of female gametophyte development. Together with the organ identity gene AGAMOUS (AG) SAP is required for the maintenance of floral identity acting in a manner similar to APETALA1. In contrast to the outer two floral organs in sap mutant flowers, normal sepals and petals develop in ag/sap double mutants, indicating that SAP negatively regulates AG expression in the perianth whorls. This supposed cadastral function of SAP is supported by in situ hybridization experiments showing ectopic expression of AG in the sap mutant. We have cloned the SAP gene by transposon tagging and revealed that it encodes a novel protein with sequence motifs, that are also present in plant and animal transcription regulators. Consistent with the mutant phenotype, SAP is expressed in inflorescence and floral meristems, floral organ primordia, and ovules. Taken together, we propose that SAP belongs to a new class of transcription regulators essential for a number of processes in Arabidopsis flower development. PMID:10215627

Development and characterization of rice mutants for functional genomic studies and breeding

USDA-ARS?s Scientific Manuscript database

Mutagenesis is a powerful tool for creating genetic materials for studying functional genomics, breeding, and understanding the molecular basis of disease resistance. Approximately 100,000 putative mutants of rice (Oryza sativa L.) have been generated with mutagens. Numerous mutant genes involved in...

A Fiberless Seed Mutation in Cotton Is Associated with Lack of Fiber Cell Initiation in Ovule Epidermis and Alterations in Sucrose Synthase Expression and Carbon Partitioning in Developing Seeds1

PubMed Central

Ruan, Yong-Ling; Chourey, Prem S.

1998-01-01

Fiber cell initiation in the epidermal cells of cotton (Gossypium hirsutum L.) ovules represents a unique example of trichome development in higher plants. Little is known about the molecular and metabolic mechanisms controlling this process. Here we report a comparative analysis of a fiberless seed (fls) mutant (lacking fibers) and a normal (FLS) mutant to better understand the initial cytological events in fiber development and to analyze the metabolic changes that are associated with the loss of a major sink for sucrose during cellulose biosynthesis in the mutant seeds. On the day of anthesis (0 DAA), the mutant ovular epidermal cells lacked the typical bud-like projections that are seen in FLS ovules and are required for commitment to the fiber development pathway. Cell-specific gene expression analyses at 0 DAA showed that sucrose synthase (SuSy) RNA and protein were undetectable in fls ovules but were in abundant, steady-state levels in initiating fiber cells of the FLS ovules. Tissue-level analyses of developing seeds 15 to 35 DAA revealed an altered temporal pattern of SuSy expression in the mutant relative to the normal genotype. Whether the altered programming of SuSy expression is the cause or the result of the mutation is unknown. The developing seeds of the fls mutant have also shown several correlated changes that represent altered carbon partitioning in seed coats and cotyledons as compared with the FLS genotype. PMID:9765525

A fiberless seed mutation in cotton is associated with lack of fiber cell initiation in ovule epidermis and alterations in sucrose synthase expression and carbon partitioning in developing seeds

PubMed

Ruan; Chourey

1998-10-01

Fiber cell initiation in the epidermal cells of cotton (Gossypium hirsutum L.) ovules represents a unique example of trichome development in higher plants. Little is known about the molecular and metabolic mechanisms controlling this process. Here we report a comparative analysis of a fiberless seed (fls) mutant (lacking fibers) and a normal (FLS) mutant to better understand the initial cytological events in fiber development and to analyze the metabolic changes that are associated with the loss of a major sink for sucrose during cellulose biosynthesis in the mutant seeds. On the day of anthesis (0 DAA), the mutant ovular epidermal cells lacked the typical bud-like projections that are seen in FLS ovules and are required for commitment to the fiber development pathway. Cell-specific gene expression analyses at 0 DAA showed that sucrose synthase (SuSy) RNA and protein were undetectable in fls ovules but were in abundant, steady-state levels in initiating fiber cells of the FLS ovules. Tissue-level analyses of developing seeds 15 to 35 DAA revealed an altered temporal pattern of SuSy expression in the mutant relative to the normal genotype. Whether the altered programming of SuSy expression is the cause or the result of the mutation is unknown. The developing seeds of the fls mutant have also shown several correlated changes that represent altered carbon partitioning in seed coats and cotyledons as compared with the FLS genotype.

Extracranial vertebral artery rupture likely secondary to "cupping therapy" superimposed on spontaneous dissection.

PubMed

Choi, Jae Young; Huh, Chae Wook; Choi, Chang Hwa; Lee, Jae Il

2016-12-01

The extracranial vertebral artery (VA) is vulnerable to dissection and the V3 segment is the most common location for dissection. Dissection accounts for about 2% of all ischemic strokes and can occur after trauma or chiropractic neck maneuvers. We report an extremely rare case of spontaneous extracranial VA dissection presenting with posterior neck hematoma aggravated after cupping therapy, a treatment in traditional Oriental medicine. We treated the patient successfully by endovascular treatment without any complication. © The Author(s) 2016.

Current surgical results of acute type A aortic dissection in Japan.

PubMed

Okita, Yutaka

2016-07-01

Current surgical results of acute type A aortic dissection in Japan are presented. According to the annual survey by the Japanese Association of Thoracic Surgery, 4,444 patients with acute type A aortic dissection underwent surgical procedures and the overall hospital mortality was 9.1% in 2013. The prevalence of aortic root replacement with a valve sparing technique, total arch replacement (TAR), and frozen stent graft are presented and strategies for thrombosed dissection or organ malperfusion syndrome secondary to acute aortic dissection are discussed.

Comparative transcriptome analysis during early fruit development between three seedy citrus genotypes and their seedless mutants

USDA-ARS?s Scientific Manuscript database

Identification of genes with differential transcript abundance (GDTA) in seedless mutants may enhance understanding of seedless citrus development. Transcriptome analysis was conducted at three time points during early fruit development (Phase 1) of three seedy citrus genotypes: Fallglo [Bower citru...

Control of Maize Vegetative and Reproductive Development, Fertility, and rRNAs Silencing by HISTONE DEACETYLASE 108

PubMed Central

Forestan, Cristian; Farinati, Silvia; Rouster, Jacques; Lassagne, Hervé; Lauria, Massimiliano; Dal Ferro, Nicola; Varotto, Serena

2018-01-01

Histone deacetylases (HDACs) catalyze the removal of acetyl groups from acetylated histone tails that consequently interact more closely with DNA, leading to chromatin state refractory to transcription. Zea mays HDA108 belongs to the Rpd3/HDA1 HDAC family and is ubiquitously expressed during development. The newly isolated hda108/hda108 insertional mutant exhibited many developmental defects: significant reduction in plant height, alterations of shoot and leaf development, and alterations of inflorescence patterning and fertility. Western blot analyses and immunolocalization experiments revealed an evident increase in histone acetylation, accompanied by a marked reduction in H3K9 dimethylation, in mutant nuclei. The DNA methylation status, in the CHG sequence context, and the transcript level of ribosomal sequences were also affected in hda108 mutants, while enrichment in H3 and H4 acetylation characterizes both repetitive and nonrepetitive transcriptional up-regulated loci. RNA-Seq of both young leaf and anthers indicated that transcription factor expression is highly affected and that the pollen developmental program is disrupted in hda108 mutants. Crosses between hda108/hda108 and epiregulator mutants did not produce any double mutant progeny indicating possible genetic interactions of HDA108 with distinct epigenetic pathways. Our findings indicate that HDA108 is directly involved in regulation of maize development, fertility, and epigenetic regulation of genome activity. PMID:29382649

Embryonic epithelial Pten deletion through Nkx2.1-cre leads to thyroid tumorigenesis in a strain-dependent manner

PubMed Central

Tiozzo, Caterina; Danopoulos, Soula; Lavarreda-Pearce, Maria; Baptista, Sheryl; Varimezova, Radka; Al Alam, Denise; Warburton, David; Virender, Rehan; De Langhe, Stijn; Di Cristofano, Antonio

2014-01-01

Even though the role of the tyrosine phosphatase Pten as a tumor suppressor gene has been well established in thyroid cancer, its role during thyroid development is still elusive. We therefore targeted Pten deletion in the thyroid epithelium by crossing Ptenflox/flox with a newly developed Nkx2.1-cre driver line in the BALB/c and C57BL/6 genetic backgrounds. C57BL/6 homozygous Pten mutant mice died around 2 weeks of age due to tracheal and esophageal compression by a hyperplasic thyroid. By contrast, BALB/c homozygous Pten mutant mice survived up to 2 years, but with a slightly increased thyroid volume. Characterization of the thyroid glands from C57BL/6 homozygous Pten mutant mice at postnatal day 14 (PN14) showed abnormally enlarged tissue with areas of cellular hyperplasia, disruption of the normal architecture, and follicular degeneration. In addition, differing degrees of hypothyroidism, thyroxine (T4) decrease, and thyroid-stimulating hormone elevation between the strains in the mutants and the heterozygous mutant were detected at PN14. Finally, C57BL/6 heterozygous Pten mutant mice developed thyroid tumors after 2 years of age. Our results indicate that Pten has a pivotal role in thyroid development and its deletion results in thyroid tumor formation, with the timing and severity of the tumor depending on the particular genetic background. PMID:22167068

Standardized comparison of robot-assisted limited and extended pelvic lymphadenectomy for prostate cancer.

PubMed

Yuh, Bertram E; Ruel, Nora H; Mejia, Rosa; Novara, Giacomo; Wilson, Timothy G

2013-07-01

WHAT'S KNOWN ON THE SUBJECT? AND WHAT DOES THE STUDY ADD?: Extended pelvic lymphadenectomy is the present standard of care according to European Association of Urology guidelines. Extended dissection improves staging, removes more metastatic lymph nodes, and potentially has therapeutic benefits. Previous reports have examined the morbidity of extended dissection compared with a more limited dissection in the open and laparoscopic setting. While some have suggested an increased complication rate with extended node dissection, others have not. This represents the first study focused on comparing the complications associated with the extent of node dissection using the modified Clavien system and Martin criteria in the literature on robot-assisted surgery. In a single surgeon series, we found no statistically significant differences in complications. With careful anatomic dissection, robot-assisted extended lymph node dissection can be performed safely and effectively, although operating time and length of hospital of stay are slightly increased. To compare the perioperative course of patients undergoing robot-assisted limited lymph node dissection (LLND) or extended lymph node dissection (ELND) for prostate cancer. To examine the differential lymph node counts and rates of detection of lymph node metastases. Between 2008 and 2012, 406 consecutive patients with D'Amico intermediate- or high-risk prostate cancer underwent either bilateral LLND (n = 204) or ELND (n = 202) and robot-assisted laparoscopic radical prostatectomy by a single surgeon. The region of dissection was the obturator fossa for LLND, while ELND included, in addition, the common iliac, external iliac and internal iliac lymph nodes. All complications within 90 days of surgery were recorded according to a modified Clavien system. Clinical variables were summarized and compared. Logistic regression was used to identify predictors of complications. There were no differences in demographics when comparing patients who underwent ELND with those who underwent LLND. The median operating time was 3.0 h for the ELND cohort and 2.8 h in the LLND cohort (P < 0.001). Intraoperative blood loss was 200 mL in both cohorts. Hospital stay was longer for a small percentage of patients in the ELND cohort, with 75% of ELND patients and 85% of LLND patients staying 1 day (P = 0.004). No significant difference was found in the overall or major complication rates between LLND (21.6% overall; 6.9% major) and ELND (22.8% overall; 4.5% major). No difference was seen in the symptomatic lymphocele rate between LLND and ELND, 2.9 vs 2.5%, respectively. Overall, the lymph-node-positive rate was 12% compared with 4% for the ELND and LLND groups, respectively (P = 0.002). A higher Charlson comorbidity index score was associated with the development of major complications. ELND at the time of robot-assisted radical prostatectomy can be performed safely with minimal additional morbidity. Long-term oncological and functional outcomes require further study. © 2013 BJU International.

The Systemic Acquired Resistance Regulator OsNPR1 Attenuates Growth by Repressing Auxin Signaling through Promoting IAA-Amido Synthase Expression1[OPEN

PubMed Central

2016-01-01

Systemic acquired resistance is a long-lasting and broad-spectrum disease resistance to pathogens. Our previous study demonstrated that overexpression of NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 (OsNPR1), a master gene for systemic acquired resistance in rice (Oryza sativa), greatly enhanced resistance to bacterial blight caused by Xanthomonas oryzae pv oryzae. However, the growth and development of the OsNPR1 overexpression (OsNPR1-OX) plants were restrained, and the mechanism remained elusive. In this study, we dissected the OsNPR1-induced growth inhibition. We found that the OsNPR1-OX lines displayed phenotypes mimicking auxin-defective mutants, with decreases in root system, seed number and weight, internode elongation, and tiller number. Whole-genome expression analysis revealed that genes related to the auxin metabolism and signaling pathway were differentially expressed between the OsNPR1-OX and wild-type plants. Consistently, the indole-3-acetic acid (IAA) content was decreased and the auxin distribution pattern was altered in OsNPR1-OX plants. Importantly, we found that some GH3 family members, in particular OsGH3.8 coding IAA-amido synthetase, were constitutively up-regulated in OsNPR1-OX plants. Decreased OsGH3.8 expression by RNA interference could partially restore IAA level and largely rescue the restrained growth and development phenotypes but did not affect the disease resistance of OsNPR1-OX plants. Taken together, we revealed that OsNPR1 affects rice growth and development by disrupting the auxin pathway at least partially through indirectly up-regulating OsGH3.8 expression. PMID:27378815

Functional assessment using Constant's Shoulder Scale after modified radical and selective neck dissection.

PubMed

Chepeha, Douglas B; Taylor, Rodney J; Chepeha, Judith C; Teknos, Theodoros N; Bradford, Carol R; Sharma, Pramod K; Terrell, Jeffrey E; Wolf, Gregory T

2002-05-01

Constant's Shoulder Scale is a validated and widely applied instrument for assessment of shoulder function. We used this instrument to assess which treatment and demographic variables contribute to shoulder dysfunction after neck dissection in head and neck cancer patients. A convenience sample of 54 patients with 64 neck dissections and minimum follow-up of 11 months were evaluated. Thirty-two accessory nerve-sparing modified radical (MRND) and 32 selective neck (SND) dissections were performed. Multivariable regression analysis was used to determine the variables that were predictive for shoulder dysfunction. Clinical variables included age, time from surgery, handedness, weight, radiation therapy, neck dissection type, tumor stage, and site. Patients receiving MRND had significantly worse shoulder function than patients with SND (p =.0007). Radiation therapy contributed negatively, whereas weight contributed positively (p =.0001). The critical factors contributing to shoulder dysfunction after neck dissection were weight, radiation therapy, and neck dissection type. Copyright 2002 Wiley Periodicals, Inc.

Ultra-fast framing camera tube

DOEpatents

Kalibjian, Ralph

1981-01-01

An electronic framing camera tube features focal plane image dissection and synchronized restoration of the dissected electron line images to form two-dimensional framed images. Ultra-fast framing is performed by first streaking a two-dimensional electron image across a narrow slit, thereby dissecting the two-dimensional electron image into sequential electron line images. The dissected electron line images are then restored into a framed image by a restorer deflector operated synchronously with the dissector deflector. The number of framed images on the tube's viewing screen is equal to the number of dissecting slits in the tube. The distinguishing features of this ultra-fast framing camera tube are the focal plane dissecting slits, and the synchronously-operated restorer deflector which restores the dissected electron line images into a two-dimensional framed image. The framing camera tube can produce image frames having high spatial resolution of optical events in the sub-100 picosecond range.

Dissection of the aorta in Turner syndrome: two cases and review of 85 cases in the literature

PubMed Central

Carlson, M; Silberbach, M

2009-01-01

Patients with Turner syndrome (TS) are at risk for aortic dissection, but the clinical profile for those at risk is not well described. In addition to reporting two new cases, we performed an electronic search to identify all reported cases of aortic dissection associated with TS. In total, 85 cases of aortic dissection in TS were reported between 1961 and 2006. Dissection occurred at a young age, 30.7 (range 4–64) years, which is significantly earlier than its occurrence in the general female population (68 years). Importantly, in 11% of the cases, neither hypertension nor congenital heart disease were identified, suggesting that TS alone is an independent risk factor for aortic dissection; however, the cases where no risk factors were identified were very poorly documented. A TS aortic dissection registry has been established to determine the natural history and risk factors better (http://www.turnersyndrome.org/). PMID:21731587

Genetic interactions of the unfinished flower development (ufd) mutant support a significant role of the tomato UFD gene in regulating floral organogenesis.

PubMed

Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Bretones, Sandra; Yuste-Lisbona, Fernando J; Lozano, Rafael

2016-09-01

Genetic interactions of UFD gene support its specific function during reproductive development of tomato; in this process, UFD could play a pivotal role between inflorescence architecture and flower initiation genes. Tomato (Solanum lycopersicum L.) is a major vegetable crop that also constitutes a model species for the study of plant developmental processes. To gain insight into the control of flowering and floral development, a novel tomato mutant, unfinished flower development (ufd), whose inflorescence and flowers were unable to complete their normal development was characterized using double mutant and gene expression analyses. Genetic interactions of ufd with mutations affecting inflorescence fate (uniflora, jointless and single flower truss) were additive and resulted in double mutants displaying the inflorescence structure of the non-ufd parental mutant and the flower phenotype of the ufd mutant. In addition, ufd mutation promotes an earlier inflorescence meristem termination. Taken together, both results indicated that UFD is not involved in the maintenance of inflorescence meristem identity, although it could participate in the regulatory system that modulates the rate of meristem maturation. Regarding the floral meristem identity, the falsiflora mutation was epistatic to the ufd mutation even though FALSIFLORA was upregulated in ufd inflorescences. In terms of floral organ identity, the ufd mutation was epistatic to macrocalyx, and MACROCALYX expression was differently regulated depending on the inflorescence developmental stage. These results suggest that the UFD gene may play a pivotal role between the genes required for flowering initiation and inflorescence development (such as UNIFLORA, FALSIFLORA, JOINTLESS and SINGLE FLOWER TRUSS) and those required for further floral organ development such as the floral organ identity genes.

Virtual Frog Dissection Kit Version 2.2

Science.gov Websites

Virtual Frog Dissection Kit This award-winning interactive program is part of the "Whole Frog " project. You can interactively dissect a (digitized) frog named Fluffy, and play the Virtual Frog animals other than the frog that have a computer-graphics based virtual dissection page. We get frequent

Perceptions of a Mobile Technology on Learning Strategies in the Anatomy Laboratory

ERIC Educational Resources Information Center

Mayfield, Chandler H.; Ohara, Peter T.; O'Sullivan, Patricia S.

2013-01-01

Mobile technologies offer new opportunities to improve dissection learning. This study examined the effect of using an iPad-based multimedia dissection manual during anatomy laboratory instruction on learner's perception of anatomy dissection activities and use of time. Three experimental dissection tables used iPads and three tables served as a…

An Investigative Alternative to Single-Species Dissection in the Introductory Biology Laboratory

ERIC Educational Resources Information Center

Carlin, Joel L.

2010-01-01

Dissections of single species (e.g., fetal pig) are a common student learning activity in introductory biology courses. Such dissections demonstrate location of anatomical parts and provide dissection practice but provide less opportunity for student critical thinking, numeracy and demonstration of the scientific method. A comparative anatomy lab…

Analysis of a Partial Male-Sterile Mutant of Arabidopsis thaliana Isolated from a Low-Energy Argon Ion Beam Mutagenized Pool

NASA Astrophysics Data System (ADS)

Xu, Min; Bian, Po; Wu, Yuejin; Yu, Zengliang

2008-04-01

A screen for Arabidopsis fertility mutants, mutagenized by low-energy argon ion beam, yielded two partial male-sterile mutants tc243-1 and tc243-2 which have similar phenotypes. tc243-2 was investigated in detail. The segregation ratio of the mutant phenotypes in the M2 pools suggested that mutation behaved as single Mendelian recessive mutations. tc243 showed a series of mutant phenotypes, among which partial male-sterile was its striking mutant characteristic. Phenotype analysis indicates that there are four factors leading to male sterility. a. Floral organs normally develop inside the closed bud, but the anther filaments do not elongate sufficiently to position the locules above the stigma at anthesis. b. The anther locules do not dehisce at the time of flower opening (although limited dehiscence occurs later). c. Pollens of mutant plants develop into several types of pollens at the trinucleated stage, as determined by staining with DAPI (4',6-diamidino-2-phenylindole), which shows a variable size, shape and number of nucleus. d. The viability of pollens is lower than that of the wild type on the germination test in vivo and vitro.

Effectiveness of Intraoperative Indocyanine Green Videoangiography in Avoiding Failure in Proximal Clipping for Dissecting Vertebral Artery Aneurysm Associated with Double Origin of the Posterior Inferior Cerebellar Artery.

PubMed

Omoto, Koji; Motoyama, Yasushi; Shida, Yoichi; Nakagawa, Ichiro; Park, Young-Soo; Nakase, Hiroyuki

2016-06-01

Double origin of the posterior inferior cerebellar artery (PICA) is rarely reported but is associated with cerebral aneurysm and dissection. Such aneurysms and dissections with unusual anatomic dispositions present the surgeon or physician with difficulties during treatment. A 65-year-old man presented with severe subarachnoid hemorrhage caused by a left dissecting VA, which was treated with proximal clipping. No aberrant origin of the PICA was recognized on initial imaging. Dissecting VA was confirmed from mural discoloration and obliterated by clip application proximal to the dissection. However, the dissecting VA that should have been eliminated from the circulation was still depicted on indocyanine green videoangiography. Meticulous inspection revealed an aberrant branch connecting the VA with the PICA. Termination of the dissecting VA was accomplished by division of the aberrant stem of the PICA and was confirmed by indocyanine green videoangiography. Despite its rarity, the possibility of a double origin of the PICA should be considered when treating a dissecting VA. Missing a small aberrant origin of the PICA would lead to treatment failure but can be detected by indocyanine green videoangiography during open direct surgery. Copyright © 2016 Elsevier Inc. All rights reserved.

Vertebral artery dissection in hypertensive disorders of pregnancy: a case series and literature review.

PubMed

Shanmugalingam, Renuka; Reza Pour, Nina; Chuah, Siang Chye; Vo, Thi Mong; Beran, Roy; Hennessy, Annemarie; Makris, Angela

2016-07-16

Arterial dissection is a rare complication of pregnancy and puerperium. There have been reports of aortic, coronary and cervical artery dissection in association with preeclampsia, however, vertebral artery dissection is rarely reported particularly in the antenatal setting in the presence of a Hypertensive Disorder of Pregnancy (HDP).The general annual incidence of symptomatic spontaneous cervicocephalic arterial dissection is 0.0026 % and a data registry reported that 2.4 % of these occurred in the post-partum period. The actual incidence of vertebral artery dissection in HDP is unknown as the current literature consists of case series and reports only with most documenting adverse outcomes. Given the presence of collateral circulation, unilateral vertebral artery dissections may go unrecognised and may be more common than suspected. We present a case series of four patients with vertebral artery dissection in association with HDP, two of which occurred in the antenatal setting and two in the post-partum setting. All our patients had favourable outcome with no maternal neurological deficit and live infants. Our discussion covers the proposed pathophysiology of vertebral artery dissection in HDP and the management of it. Our case series highlights the need to consider VAD an important differential diagnosis when assessing pregnant women with headache and neck pain particularly in the context of HDP.

Indocyanine Green Videoangiography for Surgery of a Ruptured Dissecting Aneurysm in the Precommunicating Anterior Cerebral Artery: A Technical Case Report.

PubMed

Nagai, Yasunori; Goto, Masanori; Toda, Hiroki; Nishida, Namiko; Yoshimoto, Naoya; Iwasaki, Koichi

2017-08-01

Indocyanine green videoangiography (ICG-VA) is an important intraoperative adjunct for saccular aneurysm surgery, but its efficacy in surgery for dissecting aneurysms has rarely been reported. The authors describe the usefulness of preclipping ICG-VA in a rare case of a ruptured dissecting aneurysm located at the precommunicating (A1) segment of the anterior cerebral artery. A 52-year-old woman, with no history of connective tissue diseases or vascular disorders, presented with sudden headache and convulsion. The CT scan showed that the patient had subarachnoid hemorrhage. Angiography showed a dissecting aneurysm in the left A1 segment of the anterior cerebral artery. Thus, the patient underwent trapping of the dissecting aneurysm. ICG-VA was used as an intraoperative adjunct before and after clipping. The preclipping ICG-VA showed the heterogeneously bright dissecting aneurysm and branching arteries even in the presence of hematoma. Preclipping ICG-VA may enhance the advantage of direct surgery for dissecting aneurysm by allowing visualization of the extent of the dissected vascular wall and the related branching arteries. ICG-VA can be an indispensable adjunct to minimize the compromise from the surgical treatment for intracranial dissecting aneurysms. Copyright © 2017 by the Congress of Neurological Surgeons

Isolation, characterization, and expression analyses of tryptophan

USDA-ARS?s Scientific Manuscript database

The dek18 mutant of maize has decreased auxin content in kernels. Molecular and functional characterization of this mutant line offers the possibility to better understand auxin biology in maize seed development. Seeds of the dek18 mutants are smaller compared to wild type seeds and the vegetative d...

Mitochondrial protection impairs BET bromodomain inhibitor-mediated cell death and provides rationale for combination therapeutic strategies.

PubMed

Lasorsa, E; Smonksey, M; Kirk, J S; Rosario, S; Hernandez-Ilizaliturri, F J; Ellis, L

2015-12-10

Inhibitors of the bromodomain and extraterminal domain family (BETI) have recently entered phase I clinical trials. In patients with advanced leukemia's, potent antileukemia activity was displayed with minimum dose-limiting toxicity. In preclinical models of hematological malignancies, including aggressive B-cell lymphomas, BETI induced cell-cycle arrest and apoptosis. However, the underlying cell death mechanisms are still not well understood. Dissecting the mechanisms required by BETI to mediate cell death would provide strong direction on how to best utilize BETI to treat patients with aggressive hematological malignancies. Herein, we provide understanding of the molecular mechanisms underlying BETI-mediated cell death using I-BET762. Induction of cell death occurred in primary murine and human B-cell lymphomas through apoptosis. Genetic dissection using Eμ-myc B-cell lymphoma compound mutants demonstrated that I-BET762-induced apoptosis does not require the p53 pathway. Furthermore, deletion of Apaf1, and thus the absence of a functional apoptosome, is associated with a delayed drug response but do not provide long-term resistance. Prolonged treatment of this model in fact fails to suppress the therapeutic efficacy of the drug and is associated with biochemical features of autophagy. However, lack of mitochondrial permeability completely inhibited I-BET762-mediated tumor cell death, indicating mitochondrial damage as key events for its activity. Combination of I-BET762 with BH3-only mimetics ABT-263 or obatoclax, restored sensitivity to I-BET762 lymphoma killing; however, success was determined by expression of Bcl-2 family antiapoptotic proteins. Our study provides critical insight for clinical decisions regarding the appropriate strategy for using BETI as a single agent or in combination to treat patients with aggressive B-cell lymphomas.

Dissection of androgen receptor-promoter interactions: Steroid receptors partition their interaction energetics in parallel with their phylogenetic divergence

PubMed Central

De Angelis, Rolando W; Yang, Qin; Miura, Michael T; Bain, David L

2013-01-01

Steroid receptors comprise a homologous family of ligand-activated transcription factors. The members include androgen receptor (AR), estrogen receptor (ER), glucocorticoid receptor (GR), mineralocorticoid receptor (MR) and progesterone receptor (PR). Phylogenetic studies demonstrate that AR, GR, MR and PR are most closely related, falling into subgroup 3C. ER is more distantly related, falling into subgroup 3A. To determine the quantitative basis by which receptors generate their unique transcriptional responses, we are systematically dissecting the promoter-binding energetics of all receptors under a single “standard state” condition. Here we examine the self-assembly and promoter-binding energetics of full-length AR and a mutant associated with prostate cancer, T877A. We first demonstrate that both proteins exist only as monomers, showing no evidence of dimerization. Although this result contradicts the traditional understanding that steroid receptors dimerize in the absence of DNA, it is fully consistent with our previous work demonstrating that GR and two PR isoforms either do not dimerize or dimerize only weakly. Moreover, both AR proteins exhibit substantial cooperativity between binding sites, again as seen for GR and PR. In sharp contrast, the more distantly related ER-α dimerizes so strongly that energetics can only be measured indirectly, yet cooperativity is negligible. Thus homologous receptors partition their promoter-binding energetics quite differently. Moreover, since receptors most closely related by phylogeny partition their energetics similarly, such partitioning appears to be evolutionarily conserved. We speculate that such differences in energetics, coupled with different promoter architectures, serve as the basis for generating receptor-specific promoter occupancy and thus function. PMID:23917122

Repair of Multiple Subclavian and Axillary Artery Aneurysms in a 58-Year-Old Man with Marfan Syndrome.

PubMed

Dolapoglu, Ahmet; de la Cruz, Kim I; Preventza, Ourania; Coselli, Joseph S

2016-10-01

Dilation of the ascending aorta and aortic dissections are often seen in Marfan syndrome; however, true aneurysms of the subclavian and axillary arteries rarely seem to develop in patients who have this disease. We present the case of a 58-year-old man with Marfan syndrome who had undergone a Bentall procedure and thoracoabdominal aortic repair for an aortic dissection and who later developed multiple aneurysmal dilations of his right subclavian and axillary arteries. The aneurysms were successfully repaired by means of a surgical bypass technique in which a Dacron graft was placed between the carotid and brachial arteries. We also discuss our strategy for determining the optimal surgical approach in these patients.

Live imaging of mouse secondary palate fusion

PubMed Central

Kim, Seungil; Prochazka, Jan; Bush, Jeffrey O.

2017-01-01

LONG ABSTRACT The fusion of the secondary palatal shelves to form the intact secondary palate is a key process in mammalian development and its disruption can lead to cleft secondary palate, a common congenital anomaly in humans. Secondary palate fusion has been extensively studied leading to several proposed cellular mechanisms that may mediate this process. However, these studies have been mostly performed on fixed embryonic tissues at progressive timepoints during development or in fixed explant cultures analyzed at static timepoints. Static analysis is limited for the analysis of dynamic morphogenetic processes such a palate fusion and what types of dynamic cellular behaviors mediate palatal fusion is incompletely understood. Here we describe a protocol for live imaging of ex vivo secondary palate fusion in mouse embryos. To examine cellular behaviors of palate fusion, epithelial-specific Keratin14-cre was used to label palate epithelial cells in ROSA26-mTmGflox reporter embryos. To visualize filamentous actin, Lifeact-mRFPruby reporter mice were used. Live imaging of secondary palate fusion was performed by dissecting recently-adhered secondary palatal shelves of embryonic day (E) 14.5 stage embryos and culturing in agarose-containing media on a glass bottom dish to enable imaging with an inverted confocal microscope. Using this method, we have detected a variety of novel cellular behaviors during secondary palate fusion. An appreciation of how distinct cell behaviors are coordinated in space and time greatly contributes to our understanding of this dynamic morphogenetic process. This protocol can be applied to mutant mouse lines, or cultures treated with pharmacological inhibitors to further advance understanding of how secondary palate fusion is controlled. PMID:28784960

Enabling a Community to Dissect an Organism: Overview of the Neurospora Functional Genomics Project

PubMed Central

Dunlap, Jay C.; Borkovich, Katherine A.; Henn, Matthew R.; Turner, Gloria E.; Sachs, Matthew S.; Glass, N. Louise; McCluskey, Kevin; Plamann, Michael; Galagan, James E.; Birren, Bruce W.; Weiss, Richard L.; Townsend, Jeffrey P.; Loros, Jennifer J.; Nelson, Mary Anne; Lambreghts, Randy; Colot, Hildur V.; Park, Gyungsoon; Collopy, Patrick; Ringelberg, Carol; Crew, Christopher; Litvinkova, Liubov; DeCaprio, Dave; Hood, Heather M.; Curilla, Susan; Shi, Mi; Crawford, Matthew; Koerhsen, Michael; Montgomery, Phil; Larson, Lisa; Pearson, Matthew; Kasuga, Takao; Tian, Chaoguang; Baştürkmen, Meray; Altamirano, Lorena; Xu, Junhuan

2013-01-01

A consortium of investigators is engaged in a functional genomics project centered on the filamentous fungus Neurospora, with an eye to opening up the functional genomic analysis of all the filamentous fungi. The overall goal of the four interdependent projects in this effort is to acccomplish functional genomics, annotation, and expression analyses of Neurospora crassa, a filamentous fungus that is an established model for the assemblage of over 250,000 species of nonyeast fungi. Building from the completely sequenced 43-Mb Neurospora genome, Project 1 is pursuing the systematic disruption of genes through targeted gene replacements, phenotypic analysis of mutant strains, and their distribution to the scientific community at large. Project 2, through a primary focus in Annotation and Bioinformatics, has developed a platform for electronically capturing community feedback and data about the existing annotation, while building and maintaining a database to capture and display information about phenotypes. Oligonucleotide-based microarrays created in Project 3 are being used to collect baseline expression data for the nearly 11,000 distinguishable transcripts in Neurospora under various conditions of growth and development, and eventually to begin to analyze the global effects of loss of novel genes in strains created by Project 1. cDNA libraries generated in Project 4 document the overall complexity of expressed sequences in Neurospora, including alternative splicing alternative promoters and antisense transcripts. In addition, these studies have driven the assembly of an SNP map presently populated by nearly 300 markers that will greatly accelerate the positional cloning of genes. PMID:17352902

The diagnostic accuracy of the mediastinal width on supine anteroposterior chest radiographs with nontraumatic Stanford type A acute aortic dissection.

PubMed

Funakoshi, Hiraku; Mizobe, Michiko; Homma, Yosuke; Nakashima, Yoshiyuki; Takahashi, Jin; Shiga, Takashi

2018-03-01

Nontraumatic Stanford type A acute aortic dissection is a life-threatening condition; thus, the ability to make a precise diagnosis of nontraumatic Stanford type A acute aortic dissection is essential for the emergency physician. Several reports have shown that the mediastinal widening on a chest radiograph is useful for the diagnosis of nontraumatic Stanford type A acute aortic dissection; however, the exact cutoff value of the mediastinal width on plain radiographs is rarely defined. A single-center retrospective case-control study was conducted between October 1, 2013, and March 31, 2015. We evaluated the maximal mediastinal width of the anteroposterior chest X-ray at the level of the aortic knob in the supine position between patient groups with and without nontraumatic Stanford type A acute aortic dissection. We enrolled 72 patients (36 patients with nontraumatic Stanford type A acute aortic dissection and 36 patients without nontraumatic Stanford type A acute aortic dissection). The median mediastinal width of patients with nontraumatic Stanford type A acute aortic dissection was significantly larger than that of patients without nontraumatic Stanford type A acute aortic dissection (100.7 mm vs 77.7 mm, P  < .01). The optimal cutoff level was 87 mm (sensitivity, 81%; specificity, 89%). Using multivariable logistic regression, the odds ratio of a mediastinal width of >87 mm for a diagnosis nontraumatic Stanford type A acute aortic dissection was 57.1 (95% confidence interval, 11.2-290.2). A mediastinal width of >87 mm showed high sensitivity in the diagnosis of probable nontraumatic Stanford type A acute aortic dissection.

One-Hour PTH after Thyroidectomy Predicts Symptomatic Hypocalcemia

PubMed Central

Nocon, Cheryl; Nagar, Sapna; Kaplan, Edwin L.; Angelos, Peter; Grogan, Raymon H.

2015-01-01

Background A major morbidity following total thyroidectomy is hypocalcemia. While many clinical factors and laboratory studies have been correlated with both biochemical and symptomatic hypocalcemia, the ideal use and timing of these tests the remains unclear. We hypothesize one-hour (PACU) PTH will identify patients at risk for symptomatic hypocalcemia. Methods This prospective study evaluated 196 patients undergoing total thyroidectomy. Serum calcium and PTH levels were measured one hour after surgery and on postoperative day 1 (POD1). Performance of a central compartment lymph node dissection, parathyroid autotransplantation, indication for procedure, pathology, and presence of parathyroid tissue in the pathology specimen were recorded. Results Of 196 patients, 9 (4.6%) developed symptomatic hypocalcemia. 34 (17.3%) had a 1-hour PACU PTH ≤ 10 pg/dL while 31 (15.8%) had a POD1 PTH of ≤ 10. Five (56%) of the nine symptomatic patients underwent central compartment lymph node dissection, 4 (44%) had parathyroid autotransplantation and 4 (44%) had a PACU PTH ≤10. PACU and POD1 PTH levels were correlated (R2=0.682). Multivariate regression identified central compartment dissection, autotransplantation, and PACU or POD1 PTH correlated with symptomatic hypocalcemia. PACU PTH, POD1 PTH, PACU Ca, malignant final pathology, and Age ≤ 45 years correlated with biochemical hypocalcemia. Conclusion 1-hour postoperative PACU PTH is equivalent to POD1 PTH in predicting the development of symptomatic hypocalcemia. Biochemical hypocalcemia was not predictive of symptoms in the immediate post-operative period. Lymph node dissection and parathyroid autotransplantation correlated with symptomatic hypocalcemia and improve the sensitivity of biochemical screening alone. PMID:27020834

One-hour PTH after thyroidectomy predicts symptomatic hypocalcemia.

PubMed

White, Michael G; James, Benjamin C; Nocon, Cheryl; Nagar, Sapna; Kaplan, Edwin L; Angelos, Peter; Grogan, Raymon H

2016-04-01

A major morbidity after total thyroidectomy is hypocalcemia. Although many clinical factors and laboratory studies have been correlated with both biochemical and symptomatic hypocalcemia, the ideal use and timing of these tests remain unclear. We hypothesize 1-h (PACU) parathyroid hormone (PTH) will identify patients at risk for symptomatic hypocalcemia. This prospective study evaluated 196 patients undergoing total thyroidectomy. Serum calcium and PTH levels were measured 1 h after surgery and on postoperative day 1 (POD1). Performance of a central compartment lymph node dissection, parathyroid autotransplantation, indication for procedure, pathology, and presence of parathyroid tissue in the pathology specimen were recorded. Of 196 patients, nine (4.6%) developed symptomatic hypocalcemia. Thirty four (17.3%) had a 1-h PACU PTH ≤10 pg/dL, whereas 31 (15.8%) had a POD1 PTH of ≤10. Five (56%) of the nine symptomatic patients underwent central compartment lymph node dissection, four (44%) had parathyroid autotransplantation, and four (44%) had a PACU PTH ≤10. PACU and POD1 PTH levels were correlated (R(2) = 0.682). Multivariate regression identified central compartment dissection, autotransplantation, and PACU or POD1 PTH correlated with symptomatic hypocalcemia. PACU PTH, POD1 PTH, PACU Ca, malignant final pathology, and age ≤45 y correlated with biochemical hypocalcemia. A 1-h postoperative PACU PTH is equivalent to POD1 PTH in predicting the development of symptomatic hypocalcemia. Biochemical hypocalcemia was not predictive of symptoms in the immediate postoperative period. Lymph node dissection and parathyroid autotransplantation correlated with symptomatic hypocalcemia and improve the sensitivity of biochemical screening alone. Copyright © 2016 Elsevier Inc. All rights reserved.

Prevalence, Features, and Prognostic Importance of Edge Dissection After Drug-Eluting Stent Implantation: An ADAPT-DES Intravascular Ultrasound Substudy.

PubMed

Kobayashi, Nobuaki; Mintz, Gary S; Witzenbichler, Bernhard; Metzger, D Christopher; Rinaldi, Michael J; Duffy, Peter L; Weisz, Giora; Stuckey, Thomas D; Brodie, Bruce R; Parvataneni, Rupa; Kirtane, Ajay J; Stone, Gregg W; Maehara, Akiko

2016-07-01

Intravascular ultrasound detects stent edge dissections after percutaneous coronary intervention that are not seen angiographically. This study investigated the association between stent edge dissections and clinical outcomes. ADAPT-DES (Assessment of Dual Antiplatelet Therapy With Drug-Eluting Stents) was a large-scale, prospective, multicenter study of patients undergoing drug-eluting stent implantation. In this prospective substudy, 2062 patients (2433 lesions) were evaluated with intravascular ultrasound to characterize the morphological features and clinical outcomes of stent edge dissection after percutaneous coronary intervention. The prevalence of post-percutaneous coronary intervention stent edge dissection was 6.6% per lesion (161 of 2433). Calcified plaque at the proximal stent edge (relative risk [RR]=1.72; P=0.04) and proximal stent edge expansion (RR=1.18; P=0.004) were predictors for proximal dissection; attenuated plaque at the distal stent edge (RR=3.52; P=0.004), distal reference plaque burden (RR=1.56; P<0.0001), and distal edge stent expansion (RR=1.11; P=0.02) were predictors for distal dissection. At 1-year follow-up, target lesion revascularization was more common in lesions with versus without dissection (5.2% versus 2.7%; P=0.04). Multivariable analysis indicated that residual dissection was associated with target lesion revascularization at 1-year follow-up (RR=2.67; P=0.02). Among lesions with dissection, smaller effective lumen area increased the risk of target lesion revascularization at 1-year follow-up (cutoff value of 5.1 mm(2); P=0.05). Greater stent expansion and the presence of large, calcified, and/or attenuated plaques were independent predictors of stent edge dissection. Residual stent edge dissection, especially with a smaller effective lumen area, was associated with target lesion revascularization during 1-year follow-up after drug-eluting stent implantation. URL: http://www.clinicaltrials.gov. Unique identifier: NCT00638794. © 2016 American Heart Association, Inc.

Dissection and Aneurysm in Patients With Fibromuscular Dysplasia: Findings From the U.S. Registry for FMD.

PubMed

Kadian-Dodov, Daniella; Gornik, Heather L; Gu, Xiaokui; Froehlich, James; Bacharach, J Michael; Chi, Yung-Wei; Gray, Bruce H; Jaff, Michael R; Kim, Esther S H; Mace, Pamela; Sharma, Aditya; Kline-Rogers, Eva; White, Christopher; Olin, Jeffrey W

2016-07-12

Fibromuscular dysplasia (FMD) is a noninflammatory arterial disease that predominantly affects women. The arterial manifestations may include beading, stenosis, aneurysm, dissection, or tortuosity. This study compared the frequency, location, and outcomes of FMD patients with aneurysm and/or dissection to those of patients without. The U.S. Registry for FMD involves 12 clinical centers. This analysis included clinical history, diagnostic, and therapeutic procedure results for 921 FMD patients enrolled in the registry as of October 17, 2014. Aneurysm occurred in 200 patients (21.7%) and dissection in 237 patients (25.7%); in total, 384 patients (41.7%) had an aneurysm and/or a dissection by the time of FMD diagnosis. The extracranial carotid, renal, and intracranial arteries were the most common sites of aneurysm; dissection most often occurred in the extracranial carotid, vertebral, renal, and coronary arteries. FMD patients with dissection were younger at presentation (48.4 vs. 53.5 years of age, respectively; p < 0.0001) and experienced more neurological symptoms and other end-organ ischemic events than those without dissection. One-third of aneurysm patients (63 of 200) underwent therapeutic intervention for aneurysm repair. Patients with FMD have a high prevalence of aneurysm and/or dissection prior to or at the time of FMD diagnosis. Patients with dissection were more likely to experience ischemic events, and a significant number of patients with dissection or aneurysm underwent therapeutic procedures for these vascular events. Because of the high prevalence and associated morbidity in patients with FMD who have an aneurysm and/or dissection, it is recommended that every patient with FMD undergo one-time cross-sectional imaging from head to pelvis with computed tomographic angiography or magnetic resonance angiography. Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

The effects of computer simulation versus hands-on dissection and the placement of computer simulation within the learning cycle on student achievement and attitude

NASA Astrophysics Data System (ADS)

Hopkins, Kathryn Susan

The value of dissection as an instructional strategy has been debated, but not evidenced in research literature. The purpose of this study was to examine the efficacy of using computer simulated frog dissection as a substitute for traditional hands-on frog dissection and to examine the possible enhancement of achievement by combining the two strategies in a specific sequence. In this study, 134 biology students at two Central Texas schools were divided into the five following treatment groups: computer simulation of frog dissection, computer simulation before dissection, traditional hands-on frog dissection, dissection before computer simulation, and textual worksheet materials. The effects on achievement were evaluated by labeling 10 structures on three diagrams, identifying 11 pinned structures on a prosected frog, and answering 9 multiple-choice questions over the dissection process. Attitude was evaluated using a thirty item survey with a five-point Likert scale. The quasi-experimental design was pretest/post-test/post-test nonequivalent group for both control and experimental groups, a 2 x 2 x 5 completely randomized factorial design (gender, school, five treatments). The pretest/post-test design was incorporated to control for prior knowledge using analysis of covariance. The dissection only group evidenced a significantly higher performance than all other treatments except dissection-then-computer on the post-test segment requiring students to label pinned anatomical parts on a prosected frog. Interactions between treatment and school in addition to interaction between treatment and gender were found to be significant. The diagram and attitude post-tests evidenced no significant difference. Results on the nine multiple-choice questions about dissection procedures indicated a significant difference between schools. The interaction between treatment and school was also found to be significant. On a delayed post-test, a significant difference in gender was found on the diagram labeling segment of the post-test. Males were reported to have the higher score. Since existing research conflicts with this study's results, additional research using authentic assessment is recommended. Instruction should be aligned with dissection content and process objectives for each treatment group, and the teacher variable should be controlled.

Usefulness of a multifunctional snare designed for colorectal hybrid endoscopic submucosal dissection (with video).

PubMed

Ohata, Ken; Muramoto, Takashi; Minato, Yohei; Chiba, Hideyuki; Sakai, Eiji; Matsuhashi, Nobuyuki

2018-02-01

Since colorectal endoscopic submucosal dissection (ESD) remains technically difficult, hybrid ESD was developed as an alternative therapeutic option to achieve en bloc resection of relatively large lesions. In this feasibility study, we evaluated the safety and efficacy of hybrid colorectal ESD using a newly developed multifunctional snare. From June to August 2016, we prospectively enrolled 10 consecutive patients with non-pedunculated intramucosal colorectal tumors 20 - 30 mm in diameter. All of the hybrid ESD steps were performed using the "SOUTEN" snare. The knob-shaped tip attached to the loop top helps to stabilize the needle-knife, making it less likely to slip during circumferential incision and enables partial submucosal dissection. All of the lesions were curatively resected by hybrid ESD, with a short mean procedure time (16.1 ± 4.8 minutes). The mean diameters of the resected specimens and tumors were 30.5 ± 4.9 and 26.0 ± 3.5 mm, respectively. No perforations occurred, while delayed bleeding occurred in 1 patient. In conclusion, hybrid ESD using a multifunctional snare enables easy, safe, and cost-effective resection of relatively large colorectal tumors to be achieved. UMIN000022545.

Conservative management versus endovascular or open surgery in the spectrum of type B aortic dissection.

PubMed

Yuan, Xun; Mitsis, Andreas; Ghonem, Mohammed; Iakovakis, Ilias; Nienaber, Christoph A

2018-01-01

Type B aortic dissection is a life-threatening acute aortic condition often with acute ischemic signs or symptoms. With initial management focusing on alleviating malperfusion and pain, and avoiding propagation of dissection or rupture both systolic blood and pulse pressure should be reduced initially by an aggressive medical approach. In the setting of persistent signs of complications endovascular strategies have replaced open surgery and led to a fourfold increase in early survival and better long-term outcomes. An electronic health database search was performed on articles published between January 2006 and July 2017. Publications were included in this review if (I) the index aortic pathology was type B aortic (distal) dissection; (II) when medical management, open surgical replacement or thoracic endovascular aortic repair were among those options; (III) when at least one of all basic outcome criteria such as survival, spinal cord ischemia and cerebrovascular accident was reported; (IV) when ≥15 serial patients were included. A total of 62 studies were eligible and analysed. Our manuscript has summarized data collected over 12 years on management specific outcomes in the setting of distal aortic dissection and provides an up-to-date interpretation of the published evidence. For complicated cases, treated acutely, the 30-day or in-hospital mortality was 7.3% when managed by endovascular means, whereas the pooled rate for 30-day or in-hospital mortality was 19.0% when subjected to open repair. For acute uncomplicated type B dissection usually treated with blood pressure lowering medications, the pooled 30-day or in-hospital mortality rate was 2.4%. Survival rates at 5 years averaged at 60% (40% mortality). Freedom from any aortic event ranged from 34.0% to 83.9%, underlining an inherent risk of progression and late complications. For chronic complicated type B dissection, the rates of stroke, paraplegia and operative mortality following endovascular repair ranged from 5% to 13%, 2% to 13% and 2 to 13%, respectively, while 5-year survival rates after open repair ranged from 60% to 90%. In chronic uncomplicated type B dissection almost 90% of patients survive initial hospitalization and were subjected to medical management with a 5-year survival of 50-80%. However, up to 20-55% of medically treated patients develop aneurysmal degeneration after 5 years with an unknown risk of rupture. Currently, the less invasive strategy of endovascular repair (as compared to open surgery) provides improved 30-day or in-hospital survival in the setting of complicated acute type B aortic dissection and may seek broad application. Open surgical aortic reconstruction should be left to experienced aortic centres if endovascular management is not an option.

Mannosyltransferase is required for cell wall biosynthesis, morphology and control of asexual development in Neurospora crassa.

PubMed

Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J

2005-01-01

Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.