Enriching the Environment of [alpha]CaMKII[superscript T286A] Mutant Mice Reveals that LTD Occurs in Memory Processing but Must be Subsequently Reversed by LTP

ERIC Educational Resources Information Center

Soto, Florentina; Giese, K. Peter; Edwards, Frances A.; Parsley, Stephanie L.; Pilgram, Sara M.

2007-01-01

[alpha]CaMKII[superscript T286A] mutant mice lack long-term potentiation (LTP) in the hippocampal CA1 region and are impaired in spatial learning. In situ hybridization confirms that the mutant mice show the same developmental expression of [alpha]CaMKII as their wild-type littermates. A simple hypothesis would suggest that if LTP is a substrate…

Acentriolar mitosis activates a p53-dependent apoptosis pathway in the mouse embryo

PubMed Central

Bazzi, Hisham; Anderson, Kathryn V.

2014-01-01

Centrosomes are the microtubule-organizing centers of animal cells that organize interphase microtubules and mitotic spindles. Centrioles are the microtubule-based structures that organize centrosomes, and a defined set of proteins, including spindle assembly defective-4 (SAS4) (CPAP/CENPJ), is required for centriole biogenesis. The biological functions of centrioles and centrosomes vary among animals, and the functions of mammalian centrosomes have not been genetically defined. Here we use a null mutation in mouse Sas4 to define the cellular and developmental functions of mammalian centrioles in vivo. Sas4-null embryos lack centrosomes but survive until midgestation. As expected, Sas4−/− mutants lack primary cilia and therefore cannot respond to Hedgehog signals, but other developmental signaling pathways are normal in the mutants. Unlike mutants that lack cilia, Sas4−/− embryos show widespread apoptosis associated with global elevated expression of p53. Cell death is rescued in Sas4−/− p53−/− double-mutant embryos, demonstrating that mammalian centrioles prevent activation of a p53-dependent apoptotic pathway. Expression of p53 is not activated by abnormalities in bipolar spindle organization, chromosome segregation, cell-cycle profile, or DNA damage response, which are normal in Sas4−/− mutants. Instead, live imaging shows that the duration of prometaphase is prolonged in the mutants while two acentriolar spindle poles are assembled. Independent experiments show that prolonging spindle assembly is sufficient to trigger p53-dependent apoptosis. We conclude that a short delay in the prometaphase caused by the absence of centrioles activates a previously undescribed p53-dependent cell death pathway in the rapidly dividing cells of the mouse embryo. PMID:24706806

E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis.

PubMed

Park, Kyeong-Su; Kim, Ju Hee; Shin, Hee Won; Chung, Kyung-Sook; Im, Dong-Soo; Lim, Jung Hwa; Jung, Cho-Rok

2015-10-26

Missense mutation of VHL gene is frequently detected in type 2 VHL diseases and linked to a wide range of pVHL functions and stability. Certain mutant pVHLs retain ability to regulate HIFs but lose their function by instability. In this case, regulating of degradation of mutant pVHLs, can be postulated as therapeutic method. The stability and cellular function of missense mutant pVHLs were determine in HEK293T transient expressing cell and 786-O stable cell line. Ubiquitination assay of mutant VHL proteins was performed in vitro system. Anticancer effect of adenovirus mediated shUCP expressing was evaluated using ex vivo mouse xenograft assay. Three VHL missense mutants (V155A, L158Q, and Q164R) are directly ubiquitinated by E2-EPF UCP (UCP) in vitro. Mutant pVHLs are more unstable than wild type in cell. Missense mutant pVHLs interact with UCP directly in both in vitro and cellular systems. Lacking all of lysine residues of pVHL result in resistance to ubiquitination thereby increase its stability. Missense mutant pVHLs maintained the function of E3 ligase to ubiquitinate HIF-1α in vitro. In cells expressing mutant pVHLs, Glut-1 and VEGF were relatively upregulated compared to their levels in cells expressing wild-type. Depletion of UCP restored missense mutant pVHLs levels and inhibited cell growth. Adenovirus-mediated shUCP RNA delivery inhibited tumor growth in ex vivo mouse xenograft model. These data suggest that targeting of UCP can be one of therapeutic method in type 2 VHL disease caused by unstable but functional missense mutant pVHL.

Altered striatal function in a mutant mouse lacking D1A dopamine receptors.

PubMed Central

Drago, J; Gerfen, C R; Lachowicz, J E; Steiner, H; Hollon, T R; Love, P E; Ooi, G T; Grinberg, A; Lee, E J; Huang, S P

1994-01-01

Of the five known dopamine receptors, D1A and D2 represent the major subtypes expressed in the striatum of the adult brain. Within the striatum, these two subtypes are differentially distributed in the two main neuronal populations that provide direct and indirect pathways between the striatum and the output nuclei of the basal ganglia. Movement disorders, including Parkinson disease and various dystonias, are thought to result from imbalanced activity in these pathways. Dopamine regulates movement through its differential effects on D1A receptors expressed by direct output neurons and D2 receptors expressed by indirect output neurons. To further examine the interaction of D1A and D2 neuronal pathways in the striatum, we used homologous recombination to generate mutant mice lacking functional D1A receptors (D1A-/-). D1A-/- mutants are growth retarded and die shortly after weaning age unless their diet is supplemented with hydrated food. With such treatment the mice gain weight and survive to adulthood. Neurologically, D1A-/- mice exhibit normal coordination and locomotion, although they display a significant decrease in rearing behavior. Examination of the striatum revealed changes associated with the altered phenotype of these mutants. D1A receptor binding was absent in striatal sections from D1A-/- mice. Striatal neurons normally expressing functional D1A receptors are formed and persist in adult homozygous mutants. Moreover, substance P mRNA, which is colocalized specifically in striatal neurons with D1A receptors, is expressed at a reduced level. In contrast, levels of enkephalin mRNA, which is expressed in striatal neurons with D2 receptors, are unaffected. These findings show that D1A-/- mice exhibit selective functional alterations in the striatal neurons giving rise to the direct striatal output pathway. Images Fig. 2 Fig. 4 PMID:7809078

Lack of tau proteins rescues neuronal cell death and decreases amyloidogenic processing of APP in APP/PS1 mice.

PubMed

Leroy, Karelle; Ando, Kunie; Laporte, Vincent; Dedecker, Robert; Suain, Valérie; Authelet, Michèle; Héraud, Céline; Pierrot, Nathalie; Yilmaz, Zehra; Octave, Jean-Noël; Brion, Jean-Pierre

2012-12-01

Lack of tau expression has been reported to protect against excitotoxicity and to prevent memory deficits in mice expressing mutant amyloid precursor protein (APP) identified in familial Alzheimer disease. In APP mice, mutant presenilin 1 (PS1) enhances generation of Aβ42 and inhibits cell survival pathways. It is unknown whether the deficient phenotype induced by concomitant expression of mutant PS1 is rescued by absence of tau. In this study, we have analyzed the effect of tau deletion in mice expressing mutant APP and PS1. Although APP/PS1/tau(+/+) mice had a reduced survival, developed spatial memory deficits at 6 months and motor impairments at 12 months, these deficits were rescued in APP/PS1/tau(-/-) mice. Neuronal loss and synaptic loss in APP/PS1/tau(+/+) mice were rescued in the APP/PS1/tau(-/-) mice. The amyloid plaque burden was decreased by roughly 50% in the cortex and the spinal cord of the APP/PS1/tau(-/-) mice. The levels of soluble and insoluble Aβ40 and Aβ42, and the Aβ42/Aβ40 ratio were reduced in APP/PS1/tau(-/-) mice. Levels of phosphorylated APP, of β-C-terminal fragments (CTFs), and of β-secretase 1 (BACE1) were also reduced, suggesting that β-secretase cleavage of APP was reduced in APP/PS1/tau(-/-) mice. Our results indicate that tau deletion had a protective effect against amyloid induced toxicity even in the presence of mutant PS1 and reduced the production of Aβ. Copyright © 2012 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Purkinje Cell Compartmentation in the Cerebellum of the Lysosomal Acid Phosphatase 2 Mutant Mouse (Nax - Naked-Ataxia Mutant Mouse)

PubMed Central

Bailey, Karen; Rahimi Balaei, Maryam; Mannan, Ashraf; Del Bigio, Marc R.; Marzban, Hassan

2014-01-01

The Acp2 gene encodes the beta subunit of lysosomal acid phosphatase, which is an isoenzyme that hydrolyzes orthophosphoric monoesters. In mice, a spontaneous mutation in Acp2 results in severe cerebellar defects. These include a reduced size, abnormal lobulation, and an apparent anterior cerebellar disorder with an absent or hypoplastic vermis. Based on differential gene expression in the cerebellum, the mouse cerebellar cortex can normally be compartmentalized anteroposteriorly into four transverse zones and mediolaterally into parasagittal stripes. In this study, immunohistochemistry was performed using various Purkinje cell compartmentation markers to examine their expression patterns in the Acp2 mutant. Despite the abnormal lobulation and anterior cerebellar defects, zebrin II and PLCβ4 showed similar expression patterns in the nax mutant and wild type cerebellum. However, fewer stripes were found in the anterior zone of the nax mutant, which could be due to a lack of Purkinje cells or altered expression of the stripe markers. HSP25 expression was uniform in the central zone of the nax mutant cerebellum at around postnatal day (P) 18–19, suggesting that HSP25 immunonegative Purkinje cells are absent or delayed in stripe pattern expression compared to the wild type. HSP25 expression became heterogeneous around P22–23, with twice the number of parasagittal stripes in the nax mutant compared to the wild type. Aside from reduced size and cortical disorganization, both the posterior zone and nodular zone in the nax mutant appeared less abnormal than the rest of the cerebellum. From these results, it is evident that the anterior zone of the nax mutant cerebellum is the most severely affected, and this extends beyond the primary fissure into the rostral central zone/vermis. This suggests that ACP2 has critical roles in the development of the anterior cerebellum and it may regulate anterior and central zone compartmentation. PMID:24722417

Evidence for transceptor function of cellodextrin transporters in Neurospora crassa.

PubMed

Znameroski, Elizabeth A; Li, Xin; Tsai, Jordan C; Galazka, Jonathan M; Glass, N Louise; Cate, Jamie H D

2014-01-31

Neurospora crassa colonizes burnt grasslands and metabolizes both cellulose and hemicellulose from plant cell walls. When switched from a favored carbon source to cellulose, N. crassa dramatically up-regulates expression and secretion of genes encoding lignocellulolytic enzymes. However, the means by which N. crassa and other filamentous fungi sense the presence of cellulose in the environment remains unclear. Previously, we have shown that a N. crassa mutant carrying deletions of three β-glucosidase enzymes (Δ3βG) lacks β-glucosidase activity, but efficiently induces cellulase gene expression and cellulolytic activity in the presence of cellobiose as the sole carbon source. These observations indicate that cellobiose, or a modified version of cellobiose, functions as an inducer of lignocellulolytic gene expression and activity in N. crassa. Here, we show that in N. crassa, two cellodextrin transporters, CDT-1 and CDT-2, contribute to cellulose sensing. A N. crassa mutant carrying deletions for both transporters is unable to induce cellulase gene expression in response to crystalline cellulose. Furthermore, a mutant lacking genes encoding both the β-glucosidase enzymes and cellodextrin transporters (Δ3βGΔ2T) does not induce cellulase gene expression in response to cellobiose. Point mutations that severely reduce cellobiose transport by either CDT-1 or CDT-2 when expressed individually do not greatly impact cellobiose induction of cellulase gene expression. These data suggest that the N. crassa cellodextrin transporters act as "transceptors" with dual functions - cellodextrin transport and receptor signaling that results in downstream activation of cellulolytic gene expression. Similar mechanisms of transceptor activity likely occur in related ascomycetes used for industrial cellulase production.

Post-Transcriptional Dysregulation by miRNAs Is Implicated in the Pathogenesis of Gastrointestinal Stromal Tumor [GIST

PubMed Central

Kelly, Lorna; Bryan, Kenneth; Kim, Su Young; Janeway, Katherine A.; Killian, J. Keith; Schildhaus, Hans-Ulrich; Miettinen, Markku; Helman, Lee; Meltzer, Paul S.; van de Rijn, Matt; Debiec-Rychter, Maria; O’Sullivan, Maureen

2013-01-01

In contrast to adult mutant gastrointestinal stromal tumors [GISTs], pediatric/wild-type GISTs remain poorly understood overall, given their lack of oncogenic activating tyrosine kinase mutations. These GISTs, with a predilection for gastric origin in female patients, show limited response to therapy with tyrosine kinase inhibitors and generally pursue a more indolent course, but still may prove fatal. Defective cellular respiration appears to underpin tumor development in these wild-type cases, which as a group lack expression of succinate dehydrogenase [SDH] B, a surrogate marker for respiratory chain metabolism. Yet, only a small subset of the wild-type tumors show mutations in the genes coding for the SDH subunits [SDHx]. To explore additional pathogenetic mechanisms in these wild-type GISTs, we elected to investigate post-transcriptional regulation of these tumors by conducting microRNA (miRNA) profiling of a mixed cohort of 73 cases including 18 gastric pediatric wild-type, 25 (20 gastric, 4 small bowel and 1 retroperitoneal) adult wild-type GISTs and 30 gastric adult mutant GISTs. By this approach we have identified distinct signatures for GIST subtypes which correlate tightly with clinico-pathological parameters. A cluster of miRNAs on 14q32 show strikingly different expression patterns amongst GISTs, a finding which appears to be explained at least in part by differential allelic methylation of this imprinted region. Small bowel and retroperitoneal wild-type GISTs segregate with adult mutant GISTs and express SDHB, while adult wild-type gastric GISTs are dispersed amongst adult mutant and pediatric wild-type cases, clustering in this situation on the basis of SDHB expression. Interestingly, global methylation analysis has recently similarly demonstrated that these wild-type, SDHB-immunonegative tumors show a distinct pattern compared with KIT and PDGFRA mutant tumors, which as a rule do express SDHB. All cases with Carney triad within our cohort cluster together tightly. PMID:23717541

Post-transcriptional dysregulation by miRNAs is implicated in the pathogenesis of gastrointestinal stromal tumor [GIST].

PubMed

Kelly, Lorna; Bryan, Kenneth; Kim, Su Young; Janeway, Katherine A; Killian, J Keith; Schildhaus, Hans-Ulrich; Miettinen, Markku; Helman, Lee; Meltzer, Paul S; van de Rijn, Matt; Debiec-Rychter, Maria; O'Sullivan, Maureen

2013-01-01

In contrast to adult mutant gastrointestinal stromal tumors [GISTs], pediatric/wild-type GISTs remain poorly understood overall, given their lack of oncogenic activating tyrosine kinase mutations. These GISTs, with a predilection for gastric origin in female patients, show limited response to therapy with tyrosine kinase inhibitors and generally pursue a more indolent course, but still may prove fatal. Defective cellular respiration appears to underpin tumor development in these wild-type cases, which as a group lack expression of succinate dehydrogenase [SDH] B, a surrogate marker for respiratory chain metabolism. Yet, only a small subset of the wild-type tumors show mutations in the genes coding for the SDH subunits [SDHx]. To explore additional pathogenetic mechanisms in these wild-type GISTs, we elected to investigate post-transcriptional regulation of these tumors by conducting microRNA (miRNA) profiling of a mixed cohort of 73 cases including 18 gastric pediatric wild-type, 25 (20 gastric, 4 small bowel and 1 retroperitoneal) adult wild-type GISTs and 30 gastric adult mutant GISTs. By this approach we have identified distinct signatures for GIST subtypes which correlate tightly with clinico-pathological parameters. A cluster of miRNAs on 14q32 show strikingly different expression patterns amongst GISTs, a finding which appears to be explained at least in part by differential allelic methylation of this imprinted region. Small bowel and retroperitoneal wild-type GISTs segregate with adult mutant GISTs and express SDHB, while adult wild-type gastric GISTs are dispersed amongst adult mutant and pediatric wild-type cases, clustering in this situation on the basis of SDHB expression. Interestingly, global methylation analysis has recently similarly demonstrated that these wild-type, SDHB-immunonegative tumors show a distinct pattern compared with KIT and PDGFRA mutant tumors, which as a rule do express SDHB. All cases with Carney triad within our cohort cluster together tightly.

Mutants with Enhanced Nitrogenase Activity in Hydroponic Azospirillum brasilense-Wheat Associations

PubMed Central

Pereg Gerk, Lily; Gilchrist, Kate; Kennedy, Ivan R.

2000-01-01

The effect of a mutation affecting flocculation, differentiation into cyst-like forms, and root colonization on nitrogenase expression by Azospirillum brasilense is described. The gene flcA of strain Sp7 restored these phenotypes in spontaneous mutants of both strains Sp7 and Sp245. Employing both constitutive pLA-lacZ and nifH-lacZ reporter fusions expressed in situ, the colony morphology, colonization pattern, and potential for nitrogenase activity of spontaneous mutants and flcA Tn5-induced mutants were established. The results of this study show that the ability of Sp7 and Sp245 mutant strains to remain in a vegetative form improved their ability to express nitrogenase activity in association with wheat in a hydroponic system. Restoring the cyst formation and colonization pattern to the spontaneous mutant Sp7-S reduced nitrogenase activity rates in association with plants to that of the wild-type Sp7. Although Tn5-induced flcA mutants showed higher potentials for nitrogenase expression than Sp7, their potentials were lower than that of Sp7-S, indicating that other factors in this strain contribute to its exceptional nitrogenase activity rates on plants. The lack of lateral flagella is not one of these factors, as Sp7-PM23, a spontaneous mutant impaired in swarming and lateral-flagellum production but not in flocculation, showed wild-type nitrogenase activity and expression. The results also suggest factors of importance in evolving an effective symbiosis between Azospirillum and wheat, such as increasing the availability of microaerobic niches along the root, increased supply of carbon sources by the plant, and the retention of the bacterial cells in vegetative form for faster metabolism. PMID:10788397

Expression of the Flp proteins by Haemophilus ducreyi is necessary for virulence in human volunteers.

PubMed

Janowicz, Diane M; Cooney, Sean A; Walsh, Jessica; Baker, Beth; Katz, Barry P; Fortney, Kate R; Zwickl, Beth W; Ellinger, Sheila; Munson, Robert S

2011-09-22

Haemophilus ducreyi, the causative agent of the sexually transmitted disease chancroid, contains a flp (fimbria like protein) operon that encodes proteins predicted to contribute to adherence and pathogenesis. H. ducreyi mutants that lack expression of Flp1 and Flp2 or TadA, which has homology to NTPases of type IV secretion systems, have decreased abilities to attach to and form microcolonies on human foreskin fibroblasts (HFF). A tadA mutant is attenuated in its ability to cause disease in human volunteers and in the temperature dependent rabbit model, but a flp1flp2 mutant is virulent in rabbits. Whether a flp deletion mutant would cause disease in humans is not clear. We constructed 35000HPΔflp1-3, a deletion mutant that lacks expression of all three Flp proteins but has an intact tad secretion system. 35000HPΔflp1-3 was impaired in its ability to form microcolonies and to attach to HFF in vitro when compared to its parent (35000HP). Complementation of the mutant with flp1-3 in trans restored the parental phenotype. To test whether expression of Flp1-3 was necessary for virulence in humans, ten healthy adult volunteers were experimentally infected with a fixed dose of 35000HP (ranging from 54 to 67 CFU) on one arm and three doses of 35000HPΔflp1-3 (ranging from 63 to 961 CFU) on the other arm. The overall papule formation rate for the parent was 80% (95% confidence interval, CI, 55.2%-99.9%) and for the mutant was 70.0% (95% CI, 50.5%-89.5%) (P = 0.52). Mutant papules were significantly smaller (mean, 11.2 mm2) than were parent papules (21.8 mm2) 24 h after inoculation (P = 0.018). The overall pustule formation rates were 46.7% (95% CI 23.7-69.7%) at 30 parent sites and 6.7% (95% CI, 0.1-19.1%) at 30 mutant sites (P = 0.001). These data suggest that production and secretion of the Flp proteins contributes to microcolony formation and attachment to HFF cells in vitro. Expression of flp1-3 is also necessary for H. ducreyi to initiate disease and progress to pustule formation in humans. Future studies will focus on how Flp proteins contribute to microcolony formation and attachment in vivo. © 2011 Janowicz et al; licensee BioMed Central Ltd.

Examining the specific contributions of individual Arabidopsis metallothioneins to copper distribution and metal tolerance.

PubMed

Guo, Woei-Jiun; Meetam, Metha; Goldsbrough, Peter B

2008-04-01

Metallothioneins (MTs) are small cysteine-rich proteins found in various eukaryotes. Plant MTs are classified into four types based on the arrangement of cysteine residues. To determine whether all four types of plant MTs function as metal chelators, six Arabidopsis (Arabidopsis thaliana) MTs (MT1a, MT2a, MT2b, MT3, MT4a, and MT4b) were expressed in the copper (Cu)- and zinc (Zn)-sensitive yeast mutants, Deltacup1 and Deltazrc1 Deltacot1, respectively. All four types of Arabidopsis MTs provided similar levels of Cu tolerance and accumulation to the Deltacup1 mutant. The type-4 MTs (MT4a and MT4b) conferred greater Zn tolerance and higher accumulation of Zn than other MTs to the Deltazrc1 Deltacot1 mutant. To examine the functions of MTs in plants, we studied Arabidopsis plants that lack MT1a and MT2b, two MTs that are expressed in phloem. The lack of MT1a, but not MT2b, led to a 30% decrease in Cu accumulation in roots of plants exposed to 30 mum CuSO(4). Ectopic expression of MT1a RNA in the mt1a-2 mt2b-1 mutant restored Cu accumulation in roots. The mt1a-2 mt2b-1 mutant had normal metal tolerance. However, when MT deficiency was combined with phytochelatin deficiency, growth of the mt1a-2 mt2b-1 cad1-3 triple mutant was more sensitive to Cu and cadmium compared to the cad1-3 mutant. Together these results provide direct evidence for functional contributions of MTs to plant metal homeostasis. MT1a, in particular, plays a role in Cu homeostasis in the roots under elevated Cu. Moreover, MTs and phytochelatins function cooperatively to protect plants from Cu and cadmium toxicity.

Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development.

PubMed

Rijpma, Sanna R; van der Velden, Maarten; Annoura, Takeshi; Matz, Joachim M; Kenthirapalan, Sanketha; Kooij, Taco W A; Matuschewski, Kai; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Siebelink-Stoter, Rianne; Graumans, Wouter; Ramesar, Jai; Klop, Onny; Russel, Frans G M; Sauerwein, Robert W; Janse, Chris J; Franke-Fayard, Blandine M; Koenderink, Jan B

2016-07-01

Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of malaria parasites. Four P. berghei genes (encoding MDR1, 4, 6 and 7) were refractory to deletion, indicating a vital role during blood stage multiplication and validating them as potential targets for antimalarial drugs. Mutants lacking expression of MDR2, MDR3 and MDR5 were generated in both P. berghei and P. falciparum, indicating a dispensable role for blood stage development. Whereas P. berghei mutants lacking MDR3 and MDR5 had a reduced blood stage multiplication in vivo, blood stage growth of P. falciparum mutants in vitro was not significantly different. Oocyst maturation and sporozoite formation in Plasmodium mutants lacking MDR2 or MDR5 was reduced. Sporozoites of these P. berghei mutants were capable of infecting mice and life cycle completion, indicating the absence of vital roles during liver stage development. Our results demonstrate vital and dispensable roles of MDR proteins during blood stages and an important function in sporogony for MDR2 and MDR5 in both Plasmodium species. © 2016 John Wiley & Sons Ltd.

Comprehensive Gene Expression Analysis of Rice Aleurone Cells: Probing the Existence of an Alternative Gibberellin Receptor1

PubMed Central

Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

2015-01-01

Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. PMID:25511432

Selective rescue of selenoprotein expression in mice lacking a highly specialized methyl group in selenocysteine tRNA.

PubMed

Carlson, Bradley A; Xu, Xue-Ming; Gladyshev, Vadim N; Hatfield, Dolph L

2005-02-18

Selenocysteine (Sec) is the 21st amino acid in the genetic code. Its tRNA is variably methylated on the 2'-O-hydroxyl site of the ribosyl moiety at position 34 (Um34). Herein, we identified a role of Um34 in regulating the expression of some, but not all, selenoproteins. A strain of knock-out transgenic mice was generated, wherein the Sec tRNA gene was replaced with either wild type or mutant Sec tRNA transgenes. The mutant transgene yielded a tRNA that lacked two base modifications, N(6)-isopentenyladenosine at position 37 (i(6)A37) and Um34. Several selenoproteins, including glutathione peroxidases 1 and 3, SelR, and SelT, were not detected in mice rescued with the mutant transgene, whereas other selenoproteins, including thioredoxin reductases 1 and 3 and glutathione peroxidase 4, were expressed in normal or reduced levels. Northern blot analysis suggested that other selenoproteins (e.g. SelW) were also poorly expressed. This novel regulation of protein expression occurred at the level of translation and manifested a tissue-specific pattern. The available data suggest that the Um34 modification has greater influence than the i(6)A37 modification in regulating the expression of various mammalian selenoproteins and Um34 is required for synthesis of several members of this protein class. Many proteins that were poorly rescued appear to be involved in responses to stress, and their expression is also highly dependent on selenium in the diet. Furthermore, their mRNA levels are regulated by selenium and are subject to nonsense-mediated decay. Overall, this study described a novel mechanism of regulation of protein expression by tRNA modification that is in turn regulated by levels of the trace element, selenium.

Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

PubMed

Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

2016-05-01

Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

Bradyrhizobium japonicum mutants with enhanced sensitivity to genistein resulting in altered nod gene regulation.

PubMed

Ip, H; D'Aoust, F; Begum, A A; Zhang, H; Smith, D L; Driscoll, B T; Charles, T C

2001-12-01

Bradyrhizobium japonicum mutants with altered nod gene induction characteristics were isolated by screening mutants for genistein-independent nod gene expression. Plasmid pZB32, carrying a nodY::lacZ transcriptional gene fusion, was introduced into B. japonicum cells that had been subjected to UV mutagenesis. Ten independent transformants producing a blue color on plates containing 5bromo-4chloro-3indolyl-beta-D-galactopyranoside but lacking genistein, indicative of constitutive expression of the nodY::lacZ reporter gene, were isolated. Beta-galactosidase activity assays revealed that while all of the 10 strains were sensitive to low concentrations of genistein, none exhibited truly constitutive nodY::lacZ expression in liquid culture. Soybean plants inoculated with three of the mutants were chlorotic and stunted, with shoot dry weights close to those of the uninoculated plants, indicating the absence of nitrogen fixation. Differences in the kinetics of nodY::lacZ expression and lipochitin oligosaccharide Nod signal production suggested that the strains carried different mutations. Some of these strains may be useful in mitigating the low root zone temperature-associated delay in soybean nodulation at the northern extent of soybean cultivation.

Identification and cloning of a regulatory gene for nitrogen assimilation in the cyanobacterium Synechococcus sp. strain PCC 7942.

PubMed Central

Vega-Palas, M A; Madueño, F; Herrero, A; Flores, E

1990-01-01

Twenty-seven mutants that were unable to assimilate nitrate were isolated from Synechococcus sp. strain PCC 7942. In addition to mutants that lacked nitrate reductase or nitrite reductase, seven pleiotropic mutants impaired in both reductases, glutamine synthetase, and methylammonium transport were also isolated. One of the pleiotropic mutants was complemented by transformation with a cosmid gene bank from wild-type strain PCC 7942. Three complementing cosmids were isolated, and a 3.1-kilobase-pair DNA fragment that was still able to complement the mutant was identified. The regulatory gene that was cloned (ntcA) appeared to be required for full expression of proteins subject to ammonium repression in Synechococcus sp. PMID:1967601

Restricted growth and insulin-like growth factor-1 deficiency in mice lacking presenilin-1 in the neural crest cell lineage

PubMed Central

Nakajima, Mitsunari; Watanabe, Sono; Okuyama, Satoshi; Shen, Jie; Furukawa, Yoshiko

2012-01-01

Presenilin-1 (PS1) is a transmembrane protein that is in many cases responsible for the development of early-onset familial Alzheimer’s disease. PS1 is essential for neurogenesis, somitogenesis, angiogenesis, and cardiac morphogenesis. We report here that PS1 is also required for maturation and/or maintenance of the pituitary gland. We generated PS1-conditional knockout (PS1-cKO) mice by crossing floxed PS1 and Wnt1-cre mice, in which PS1 was lacking in the neural crest-derived cell lineage. Although the PS1-cKO mice exhibited no obvious phenotypic abnormalities for several days after birth, reduced body weight in the mutant was evident by the age of 3 to 5 weeks. Pituitary weight and serum insulin-like growth factor (IGF)-1 level were also reduced in the mutant. Histologic analysis revealed severe atrophy of the cytosol in the anterior and intermediate pituitary lobes of the mutant. Immunohistochemistry did not reveal clear differences in the expression levels of thyroid-stimulating hormone, adrenocorticotropic hormone, or prolactin in the mutant pituitary. In contrast, growth hormone expression levels were reduced in the anterior lobe of the mutant. PS1 was defective in the posterior lobe, but not the anterior or intermediate lobes, in the mutant pituitary. These findings suggest that PS1 indirectly mediates the development and/or maintenance of the anterior and intermediate lobes in the pituitary gland via actions in other regions, such as the posterior lobe. PMID:19665542

Reassimilation of Photorespiratory Ammonium in Lotus japonicus Plants Deficient in Plastidic Glutamine Synthetase

PubMed Central

Pérez-Delgado, Carmen M.; García-Calderón, Margarita; Márquez, Antonio J.; Betti, Marco

2015-01-01

It is well established that the plastidic isoform of glutamine synthetase (GS2) is the enzyme in charge of photorespiratory ammonium reassimilation in plants. The metabolic events associated to photorespiratory NH4 + accumulation were analyzed in a Lotus japonicus photorespiratory mutant lacking GS2. The mutant plants accumulated high levels of NH4 + when photorespiration was active, followed by a sudden drop in the levels of this compound. In this paper it was examined the possible existence of enzymatic pathways alternative to GS2 that could account for this decline in the photorespiratory ammonium. Induction of genes encoding for cytosolic glutamine synthetase (GS1), glutamate dehydrogenase (GDH) and asparagine synthetase (ASN) was observed in the mutant in correspondence with the diminishment of NH4 +. Measurements of gene expression, polypeptide levels, enzyme activity and metabolite levels were carried out in leaf samples from WT and mutant plants after different periods of time under active photorespiratory conditions. In the case of asparagine synthetase it was not possible to determine enzyme activity and polypeptide content; however, an increased asparagine content in parallel with the induction of ASN gene expression was detected in the mutant plants. This increase in asparagine levels took place concomitantly with an increase in glutamine due to the induction of cytosolic GS1 in the mutant, thus revealing a major role of cytosolic GS1 in the reassimilation and detoxification of photorespiratory NH4 + when the plastidic GS2 isoform is lacking. Moreover, a diminishment in glutamate levels was observed, that may be explained by the induction of NAD(H)-dependent GDH activity. PMID:26091523

Root-expressed maize lipoxygenase 3 negatively regulates induced systemic resistance to Colletotrichum graminicola in shoots

PubMed Central

Constantino, Nasie N.; Mastouri, Fatemeh; Damarwinasis, Ramadhika; Borrego, Eli J.; Moran-Diez, Maria E.; Kenerley, Charley M.; Gao, Xiquan; Kolomiets, Michael V.

2013-01-01

We have previously reported that disruption of a maize root-expressed 9-lipoxygenase (9-LOX) gene, ZmLOX3, results in dramatic increase in resistance to diverse leaf and stalk pathogens. Despite evident economic significance of these findings, the mechanism behind this increased resistance remained elusive. In this study, we found that increased resistance of the lox3-4 mutants is due to constitutive activation of induced systemic resistance (ISR) signaling. We showed that ZmLOX3 lacked expression in leaves in response to anthracnose leaf blight pathogen Colletotrichum graminicola, but was expressed constitutively in the roots, thus, prompting our hypothesis: the roots of lox3-4 mutants are the source of increased resistance in leaves. Supporting this hypothesis, treatment of wild-type plants (WT) with xylem sap of lox3-4 mutant induced resistance to C. graminicola to the levels comparable to those observed in lox3-4 mutant. Moreover, treating mutants with the sap collected from WT plants partially restored the susceptibility to C. graminicola. lox3-4 mutants showed primed defense responses upon infection, which included earlier and greater induction of defense-related PAL and GST genes compared to WT. In addition to the greater expression of the octadecanoid pathway genes, lox3-4 mutant responded earlier and with a greater accumulation of H2O2 in response to C. graminicola infection or treatment with alamethicin. These findings suggest that lox3-4 mutants display constitutive ISR-like signaling. In support of this idea, root colonization by Trichoderma virens strain GV29-8 induced the same level of disease resistance in WT as the treatment with the mutant sap, but had no additional resistance effect in lox3-4 mutant. While treatment with T. virens GV29 strongly and rapidly suppressed ZmLOX3 expression in hydroponically grown WT roots, T. virens Δsml mutant, which is deficient in ISR induction, was unable to suppress expression of ZmLOX3, thus, providing genetic evidence that SM1 function in ISR, at least in part, by suppressing host ZmLOX3 gene. This study and the genetic tools generated herein will allow the identification of the signals regulating the induction of resistance to aboveground attackers by beneficial soil microorganisms in the future. PMID:24391653

Epidermal Phytochrome B Inhibits Hypocotyl Negative Gravitropism Non-Cell-Autonomously.

PubMed

Kim, Jaewook; Song, Kijong; Park, Eunae; Kim, Keunhwa; Bae, Gabyong; Choi, Giltsu

2016-11-01

Seedling hypocotyls display negative gravitropism in the dark but agravitropism in the light. The Arabidopsis thaliana pif quadruple mutant (pifQ), which lacks four PHYTOCHROME-INTERACTING FACTORS (PIFs), is agravitropic in the dark. Endodermis-specific expression of PIF1 rescues gravitropism in pifQ mutant seedlings. Since phytochromes induce light responses by inhibiting PIFs and the COP1-SPA ubiquitin E3 ligase complex in the nucleus, we asked whether phyB can cell autonomously inhibit hypocotyl negative gravitropism in the endodermis. We found that while epidermis-specific expression of PHYB rescues hypocotyl negative gravitropism and all other phyB mutant phenotypes, endodermis-specific expression of PHYB does not. Epidermal phyB induces the phosphorylation and degradation of endodermal PIFs in response to red light. This induces a global gene expression pattern similar to that induced by red light treatment of seedlings expressing PHYB under the control of its own endogenous promoter. Our results imply that epidermal phyB generates an unidentified mobile signal that travels to the endodermis where it promotes PIF degradation and inhibits hypocotyl negative gravitropism. © 2016 American Society of Plant Biologists. All rights reserved.

Epidermal Phytochrome B Inhibits Hypocotyl Negative Gravitropism Non-Cell-Autonomously

PubMed Central

Kim, Jaewook; Song, Kijong; Park, Eunae; Kim, Keunhwa; Choi, Giltsu

2016-01-01

Seedling hypocotyls display negative gravitropism in the dark but agravitropism in the light. The Arabidopsis thaliana pif quadruple mutant (pifQ), which lacks four PHYTOCHROME-INTERACTING FACTORS (PIFs), is agravitropic in the dark. Endodermis-specific expression of PIF1 rescues gravitropism in pifQ mutant seedlings. Since phytochromes induce light responses by inhibiting PIFs and the COP1-SPA ubiquitin E3 ligase complex in the nucleus, we asked whether phyB can cell autonomously inhibit hypocotyl negative gravitropism in the endodermis. We found that while epidermis-specific expression of PHYB rescues hypocotyl negative gravitropism and all other phyB mutant phenotypes, endodermis-specific expression of PHYB does not. Epidermal phyB induces the phosphorylation and degradation of endodermal PIFs in response to red light. This induces a global gene expression pattern similar to that induced by red light treatment of seedlings expressing PHYB under the control of its own endogenous promoter. Our results imply that epidermal phyB generates an unidentified mobile signal that travels to the endodermis where it promotes PIF degradation and inhibits hypocotyl negative gravitropism. PMID:27758895

Lovastatin synergizes with itraconazole against planktonic cells and biofilms of Candida albicans through the regulation on ergosterol biosynthesis pathway.

PubMed

Zhou, Yujie; Yang, Hong; Zhou, Xuedong; Luo, Hongke; Tang, Fan; Yang, Jin; Alterovitz, Gil; Cheng, Lei; Ren, Biao

2018-06-01

The increase of fungal infectious diseases and lack of safe and efficacious antifungal drugs result in the urgent need of new therapeutic strategies. Here, we repurposed the lovastatin (LOV) as a synergistic antifungal potentiator to itraconazole (ITZ) against Candida albicans planktonic cells and biofilms in vitro for the first time. Mutants from ergosterol biosynthesis pathway were employed and key gene expression profiles of ergosterol pathway were also measured. LOV single treatment was unable to inhibit C. albicans strains except the ERG3 and ERG11 double mutant. LOV and ITZ combination was capable of inhibiting the C. albicans planktonic cells and biofilms synergistically including the ITZ resistant mutants. The synergistic antifungal ability was stronger in either ERG11 or ERG3 dysfunctional mutants compared to wild type. The combination lost the synergistic activities in the ERG11 and ERG3 double mutant, while it was sensitive to LOV single treatment. The expression of HMG1, encoding HMG-CoA the target of LOV, was significantly upregulated in ERG11 and ERG3 double mutant strain by the treatment of the combination at 1.5 and 3 h. The combination also significantly increased the HMG1 expression in mutants from ergosterol pathway compared with wild type. The ERG11 and ERG3 gene expressions were upregulated by ITZ and its combination with LOV, but seemingly not by LOV single treatment after 1.5 and 3 h. The combination of LOV and ITZ on C. albicans planktonic cells and biofilms highlights its potential clinical practice especially against the azole drug-resistant mutants.

The Kinase Activity of Ataxia-Telangiectasia Mutated Interferes with Adenovirus E4 Mutant DNA Replication

PubMed Central

Gautam, Dipendra

2013-01-01

Adenovirus (Ad) mutants that lack early region 4 (E4) are unable to produce the early regulatory proteins that normally inactivate the Mre11/Rad50/Nbs1 (MRN) sensor complex, which is a critical component for the ability of cells to respond to DNA damage. E4 mutant infection therefore activates a DNA damage response, which in turn interferes with a productive viral infection. MRN complex proteins localize to viral DNA replication centers in E4 mutant-infected cells, and this complex is critical for activating the kinases ataxia-telangiectasia mutated (ATM) and ATM and Rad3-related (ATR), which phosphorylate numerous substrates important for DNA repair, cell cycle checkpoint activation, and apoptosis. E4 mutant growth defects are substantially rescued in cells lacking an intact MRN complex. We have assessed the role of the downstream ATM and ATR kinases in several MRN-dependent E4 mutant phenotypes. We did not identify a role for either ATM or ATR in “repair” of E4 mutant genomes to form concatemers. ATR was also not observed to contribute to E4 mutant defects in late protein production. In contrast, the kinase activity of ATM was important for preventing efficient E4 mutant DNA replication and late gene expression. Our results suggest that the MRN complex interferes with E4 mutant DNA replication at least in part through its ability to activate ATM. PMID:23740981

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

PubMed

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

Airways in smooth muscle α-actin null mice experience a compensatory mechanism that modulates their contractile response.

PubMed

Shardonofsky, Felix R; Moore, Joan; Schwartz, Robert J; Boriek, Aladin M

2012-03-01

We hypothesized that ablation of smooth muscle α-actin (SM α-A), a contractile-cytoskeletal protein expressed in airway smooth muscle (ASM) cells, abolishes ASM shortening capacity and decreases lung stiffness. In both SM α-A knockout and wild-type (WT) mice, airway resistance (Raw) determined by the forced oscillation technique rose in response to intravenous methacholine (Mch). However, the slope of Raw (cmH(2)O·ml(-1)·s) vs. log(2) Mch dose (μg·kg(-1)·min(-1)) was lower (P = 0.007) in mutant (0.54 ± 0.14) than in WT mice (1.23 ± 0.19). RT-PCR analysis performed on lung tissues confirmed that mutant mice lacked SM α-A mRNA and showed that these mice had robust expressions of both SM γ-A mRNA and skeletal muscle (SKM) α-A mRNA, which were not expressed in WT mice, and an enhanced SM22 mRNA expression relative to that in WT mice. Compared with corresponding spontaneously breathing mice, mechanical ventilation-induced lung mechanical strain increased the expression of SM α-A mRNA in WT lungs; in mutant mice, it augmented the expressions of SM γ-A mRNA and SM22 mRNA and did not alter that of SKM α-A mRNA. In mutant mice, the expression of SM γ-A mRNA in the lung during spontaneous breathing and its enhanced expression following mechanical ventilation are consistent with the likely possibility that in the absence of SM α-A, SM γ-A underwent polymerization and interacted with smooth muscle myosin to produce ASM shortening during cholinergic stimulation. Thus our data are consistent with ASM in mutant mice experiencing compensatory mechanisms that modulated its contractile muscle capacity.

Endosomal/Lysosomal Processing of Gangliosides Affects Neuronal Cholesterol Sequestration in Niemann-Pick Disease Type C

PubMed Central

Zhou, Sharon; Davidson, Cristin; McGlynn, Robert; Stephney, Gloria; Dobrenis, Kostantin; Vanier, Marie T.; Walkley, Steven U.

2011-01-01

Niemann-Pick disease type C (NPC) is a severe neurovisceral lysosomal storage disorder caused by defects in NPC1 or NPC2 proteins. Although numerous studies support the primacy of cholesterol storage, neurons of double-mutant mice lacking both NPC1 and an enzyme required for synthesis of all complex gangliosides (β1,4GalNAc transferase) have been reported to exhibit dramatically reduced cholesterol sequestration. Here we show that NPC2-deficient mice lacking this enzyme also exhibit reduced cholesterol, but that genetically restricting synthesis to only a-series gangliosides fully restores neuronal cholesterol storage to typical disease levels. Examining the subcellular locations of sequestered compounds in neurons lacking NPC1 or NPC2 by confocal microscopy revealed that cholesterol and the two principal storage gangliosides (GM2 and GM3) were not consistently co-localized within the same intracellular vesicles. To determine whether the lack of GM2 and GM3 co-localization was due to differences in synthetic versus degradative pathway expression, we generated mice lacking both NPC1 and lysosomal β-galactosidase, and therefore unable to generate GM2 and GM3 in lysosomes. Double mutants lacked both gangliosides, indicating that each is the product of endosomal/lysosomal processing. Unexpectedly, GM1 accumulation in double mutants increased compared to single mutants consistent with a direct role for NPC1 in ganglioside salvage. These studies provide further evidence that NPC1 and NPC2 proteins participate in endosomal/lysosomal processing of both sphingolipids and cholesterol. PMID:21708114

CRYPTOCHROME mediates behavioral executive choice in response to UV light

PubMed Central

Baik, Lisa S.; Fogle, Keri J.; Roberts, Logan; Galschiodt, Alexis M.; Chevez, Joshua A.; Recinos, Yocelyn; Nguy, Vinh; Holmes, Todd C.

2017-01-01

Drosophila melanogaster CRYPTOCHROME (CRY) mediates behavioral and electrophysiological responses to blue light coded by circadian and arousal neurons. However, spectroscopic and biochemical assays of heterologously expressed CRY suggest that CRY may mediate functional responses to UV-A (ultraviolet A) light as well. To determine the relative contributions of distinct phototransduction systems, we tested mutants lacking CRY and mutants with disrupted opsin-based phototransduction for behavioral and electrophysiological responses to UV light. CRY and opsin-based external photoreceptor systems cooperate for UV light-evoked acute responses. CRY mediates behavioral avoidance responses related to executive choice, consistent with its expression in central brain neurons. PMID:28062690

Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Seong K., E-mail: skim1@lsuhsc.edu; Kim, Seongman; Dai Gan

2011-09-01

The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% ofmore » control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. - Highlights: > We examine the functional domains of IR2P that mediates negative regulation. > IR2P inhibits at the transcriptional level. > DNA-binding mutant or TFIIB-binding mutant fails to inhibit. > C-terminal aa 707 to 1116 are required for full inhibition. > Inhibition requires the DNA-binding domain, TFIIB-binding domain, and C-terminus.« less

Roles of the outer membrane protein AsmA of Salmonella enterica in the control of marRAB expression and invasion of epithelial cells.

PubMed

Prieto, Ana I; Hernández, Sara B; Cota, Ignacio; Pucciarelli, M Graciela; Orlov, Yuri; Ramos-Morales, Francisco; García-del Portillo, Francisco; Casadesús, Josep

2009-06-01

A genetic screen for suppressors of bile sensitivity in DNA adenine methylase (dam) mutants of Salmonella enterica serovar Typhimurium yielded insertions in an uncharacterized locus homologous to the Escherichia coli asmA gene. Disruption of asmA suppressed bile sensitivity also in phoP and wec mutants of S. enterica and increased the MIC of sodium deoxycholate for the parental strain ATCC 14028. Increased levels of marA mRNA were found in asmA, asmA dam, asmA phoP, and asmA wec strains of S. enterica, suggesting that lack of AsmA activates expression of the marRAB operon. Hence, asmA mutations may enhance bile resistance by inducing gene expression changes in the marRAB-controlled Mar regulon. In silico analysis of AsmA structure predicted the existence of one transmembrane domain. Biochemical analysis of subcellular fractions revealed that the asmA gene of S. enterica encodes a protein of approximately 70 kDa located in the outer membrane. Because AsmA is unrelated to known transport and/or efflux systems, we propose that activation of marRAB in asmA mutants may be a consequence of envelope reorganization. Competitive infection of BALB/c mice with asmA(+) and asmA isogenic strains indicated that lack of AsmA attenuates Salmonella virulence by the oral route but not by the intraperitoneal route. Furthermore, asmA mutants showed a reduced ability to invade epithelial cells in vitro.

pigk Mutation underlies macho behavior and affects Rohon-Beard cell excitability

PubMed Central

Carmean, V.; Yonkers, M. A.; Tellez, M. B.; Willer, J. R.; Willer, G. B.; Gregg, R. G.; Geisler, R.; Neuhauss, S. C.

2015-01-01

The study of touch-evoked behavior allows investigation of both the cells and circuits that generate a response to tactile stimulation. We investigate a touch-insensitive zebrafish mutant, macho (maco), previously shown to have reduced sodium current amplitude and lack of action potential firing in sensory neurons. In the genomes of mutant but not wild-type embryos, we identify a mutation in the pigk gene. The encoded protein, PigK, functions in attachment of glycophosphatidylinositol anchors to precursor proteins. In wild-type embryos, pigk mRNA is present at times when mutant embryos display behavioral phenotypes. Consistent with the predicted loss of function induced by the mutation, knock-down of PigK phenocopies maco touch insensitivity and leads to reduced sodium current (INa) amplitudes in sensory neurons. We further test whether the genetic defect in pigk underlies the maco phenotype by overexpressing wild-type pigk in mutant embryos. We find that ubiquitous expression of wild-type pigk rescues the touch response in maco mutants. In addition, for maco mutants, expression of wild-type pigk restricted to sensory neurons rescues sodium current amplitudes and action potential firing in sensory neurons. However, expression of wild-type pigk limited to sensory cells of mutant embryos does not allow rescue of the behavioral touch response. Our results demonstrate an essential role for pigk in generation of the touch response beyond that required for maintenance of proper INa density and action potential firing in sensory neurons. PMID:26133798

Old yellow enzymes protect against acrolein toxicity in the yeast Saccharomyces cerevisiae.

PubMed

Trotter, Eleanor W; Collinson, Emma J; Dawes, Ian W; Grant, Chris M

2006-07-01

Acrolein is a ubiquitous reactive aldehyde which is formed as a product of lipid peroxidation in biological systems. In this present study, we screened the complete set of viable deletion strains in Saccharomyces cerevisiae for sensitivity to acrolein to identify cell functions involved in resistance to reactive aldehydes. We identified 128 mutants whose gene products are localized throughout the cell. Acrolein-sensitive mutants were distributed among most major biological processes but particularly affected gene expression, metabolism, and cellular signaling. Surprisingly, the screen did not identify any antioxidants or similar stress-protective molecules, indicating that acrolein toxicity may not be mediated via reactive oxygen species. Most strikingly, a mutant lacking an old yellow enzyme (OYE2) was identified as being acrolein sensitive. Old yellow enzymes are known to reduce alpha,beta-unsaturated carbonyl compounds in vitro, but their physiological roles have remained uncertain. We show that mutants lacking OYE2, but not OYE3, are sensitive to acrolein, and overexpression of both isoenzymes increases acrolein tolerance. Our data indicate that OYE2 is required for basal levels of tolerance, whereas OYE3 expression is particularly induced following acrolein stress. Despite the range of alpha,beta-unsaturated carbonyl compounds that have been identified as substrates of old yellow enzymes in vitro, we show that old yellow enzymes specifically mediate resistance to small alpha,beta-unsaturated carbonyl compounds, such as acrolein, in vivo.

ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2

PubMed Central

Jain, Devanshi; Puno, M Rhyan; Meydan, Cem; Lailler, Nathalie; Mason, Christopher E; Lima, Christopher D; Anderson, Kathryn V

2018-01-01

Mechanisms regulating mammalian meiotic progression are poorly understood. Here we identify mouse YTHDC2 as a critical component. A screen yielded a sterile mutant, ‘ketu’, caused by a Ythdc2 missense mutation. Mutant germ cells enter meiosis but proceed prematurely to aberrant metaphase and apoptosis, and display defects in transitioning from spermatogonial to meiotic gene expression programs. ketu phenocopies mutants lacking MEIOC, a YTHDC2 partner. Consistent with roles in post-transcriptional regulation, YTHDC2 is cytoplasmic, has 3′→5′ RNA helicase activity in vitro, and has similarity within its YTH domain to an N6-methyladenosine recognition pocket. Orthologs are present throughout metazoans, but are diverged in nematodes and, more dramatically, Drosophilidae, where Bgcn is descended from a Ythdc2 gene duplication. We also uncover similarity between MEIOC and Bam, a Bgcn partner unique to schizophoran flies. We propose that regulation of gene expression by YTHDC2-MEIOC is an evolutionarily ancient strategy for controlling the germline transition into meiosis. PMID:29360036

Synovial joint formation requires local Ext1 expression and heparan sulfate production in developing mouse embryo limbs and spine.

PubMed

Mundy, Christina; Yasuda, Tadashi; Kinumatsu, Takashi; Yamaguchi, Yu; Iwamoto, Masahiro; Enomoto-Iwamoto, Motomi; Koyama, Eiki; Pacifici, Maurizio

2011-03-01

Heparan sulfate proteoglycans (HSPGs) regulate a number of major developmental processes, but their roles in synovial joint formation remain unknown. Here we created conditional mouse embryo mutants lacking Ext1 in developing joints by mating Ext1(f/f) and Gdf5-Cre mice. Ext1 encodes a subunit of the Ext1/Ext2 Golgi-associated protein complex responsible for heparan sulfate (HS) synthesis. The proximal limb joints did form in the Gdf5-Cre;Ext1(f/f) mutants, but contained an uneven articulating superficial zone that expressed very low lubricin levels. The underlying cartilaginous epiphysis was deranged as well and displayed random patterns of cell proliferation and matrillin-1 and collagen IIA expression, indicative of an aberrant phenotypic definition of the epiphysis itself. Digit joints were even more affected, lacked a distinct mesenchymal interzone and were often fused likely as a result of local abnormal BMP and hedgehog activity and signaling. Interestingly, overall growth and lengthening of long bones were also delayed in the mutants. To test whether Ext1 function is needed for joint formation at other sites, we examined the spine. Indeed, entire intervertebral discs, normally composed by nucleus pulposus surrounded by the annulus fibrosus, were often missing in Gdf5-Cre;Ext1(f/f) mice. When disc remnants were present, they displayed aberrant organization and defective joint marker expression. Similar intervertebral joint defects and fusions occurred in Col2-Cre;β-catenin(f/f) mutants. The study provides novel evidence that local Ext1 expression and HS production are needed to maintain the phenotype and function of joint-forming cells and coordinate local signaling by BMP, hedgehog and Wnt/β-catenin pathways. The data indicate also that defects in joint formation reverberate on, and delay, overall long bone growth. Copyright © 2011 Elsevier Inc. All rights reserved.

Amino- and carboxy-terminal deletion mutants of Gs alpha are localized to the particulate fraction of transfected COS cells

PubMed Central

1992-01-01

To elucidate the structural basis for membrane attachment of the alpha subunit of the stimulatory G protein (Gs alpha), mutant Gs alpha cDNAs with deletions of amino acid residues in the amino and/or carboxy termini were transiently expressed in COS-7 cells. The particulate and soluble fractions prepared from these cells were analyzed by immunoblot using peptide specific antibodies to monitor distribution of the expressed proteins. Transfection of mutant forms of Gs alpha with either 26 amino terminal residues deleted (delta 3-28) or with 59 amino terminal residues deleted (delta 1-59) resulted in immunoreactive proteins which localized primarily to the particulate fraction. Similarly, mutants with 10 (delta 385-394), 32 (delta 353-384), or 42 (delta 353-394) amino acid residues deleted from the carboxy terminus also localized to the particulate fraction, as did a mutant form of Gs alpha lacking amino acid residues at both the amino and carboxy termini (delta 3-28)/(delta 353-384). Mutant and wild type forms of Gs alpha demonstrated a similar degree of tightness in their binding to membranes as demonstrated by treatment with 2.5 M NaCl or 6 M urea, but some mutant forms were relatively resistant compared with wild type Gs alpha to solubilization by 15 mM NaOH or 1% sodium cholate. We conclude that: (a) deletion of significant portions of the amino and/or carboxyl terminus of Gs alpha is still compatible with protein expression; (b) deletion of these regions is insufficient to cause cytosolic localization of the expressed protein. The basis of Gs alpha membrane targeting remains to be elucidated. PMID:1400589

Inactivation of Cellobiose Dehydrogenases Modifies the Cellulose Degradation Mechanism of Podospora anserina.

PubMed

Tangthirasunun, Narumon; Navarro, David; Garajova, Sona; Chevret, Didier; Tong, Laetitia Chan Ho; Gautier, Valérie; Hyde, Kevin D; Silar, Philippe; Berrin, Jean-Guy

2017-01-15

Conversion of biomass into high-value products, including biofuels, is of great interest to developing sustainable biorefineries. Fungi are an inexhaustible source of enzymes to degrade plant biomass. Cellobiose dehydrogenases (CDHs) play an important role in the breakdown through synergistic action with fungal lytic polysaccharide monooxygenases (LPMOs). The three CDH genes of the model fungus Podospora anserina were inactivated, resulting in single and multiple CDH mutants. We detected almost no difference in growth and fertility of the mutants on various lignocellulose sources, except on crystalline cellulose, on which a 2-fold decrease in fertility of the mutants lacking P. anserina CDH1 (PaCDH1) and PaCDH2 was observed. A striking difference between wild-type and mutant secretomes was observed. The secretome of the mutant lacking all CDHs contained five beta-glucosidases, whereas the wild type had only one. P. anserina seems to compensate for the lack of CDH with secretion of beta-glucosidases. The addition of P. anserina LPMO to either the wild-type or mutant secretome resulted in improvement of cellulose degradation in both cases, suggesting that other redox partners present in the mutant secretome provided electrons to LPMOs. Overall, the data showed that oxidative degradation of cellulosic biomass relies on different types of mechanisms in fungi. Plant biomass degradation by fungi is a complex process involving dozens of enzymes. The roles of each enzyme or enzyme class are not fully understood, and utilization of a model amenable to genetic analysis should increase the comprehension of how fungi cope with highly recalcitrant biomass. Here, we report that the cellobiose dehydrogenases of the model fungus Podospora anserina enable it to consume crystalline cellulose yet seem to play a minor role on actual substrates, such as wood shavings or miscanthus. Analysis of secreted proteins suggests that Podospora anserina compensates for the lack of cellobiose dehydrogenase by increasing beta-glucosidase expression and using an alternate electron donor for LPMO. Copyright © 2016 American Society for Microbiology.

Inactivation of Cellobiose Dehydrogenases Modifies the Cellulose Degradation Mechanism of Podospora anserina

PubMed Central

Tangthirasunun, Narumon; Navarro, David; Garajova, Sona; Chevret, Didier; Tong, Laetitia Chan Ho; Gautier, Valérie; Hyde, Kevin D.

2016-01-01

ABSTRACT Conversion of biomass into high-value products, including biofuels, is of great interest to developing sustainable biorefineries. Fungi are an inexhaustible source of enzymes to degrade plant biomass. Cellobiose dehydrogenases (CDHs) play an important role in the breakdown through synergistic action with fungal lytic polysaccharide monooxygenases (LPMOs). The three CDH genes of the model fungus Podospora anserina were inactivated, resulting in single and multiple CDH mutants. We detected almost no difference in growth and fertility of the mutants on various lignocellulose sources, except on crystalline cellulose, on which a 2-fold decrease in fertility of the mutants lacking P. anserina CDH1 (PaCDH1) and PaCDH2 was observed. A striking difference between wild-type and mutant secretomes was observed. The secretome of the mutant lacking all CDHs contained five beta-glucosidases, whereas the wild type had only one. P. anserina seems to compensate for the lack of CDH with secretion of beta-glucosidases. The addition of P. anserina LPMO to either the wild-type or mutant secretome resulted in improvement of cellulose degradation in both cases, suggesting that other redox partners present in the mutant secretome provided electrons to LPMOs. Overall, the data showed that oxidative degradation of cellulosic biomass relies on different types of mechanisms in fungi. IMPORTANCE Plant biomass degradation by fungi is a complex process involving dozens of enzymes. The roles of each enzyme or enzyme class are not fully understood, and utilization of a model amenable to genetic analysis should increase the comprehension of how fungi cope with highly recalcitrant biomass. Here, we report that the cellobiose dehydrogenases of the model fungus Podospora anserina enable it to consume crystalline cellulose yet seem to play a minor role on actual substrates, such as wood shavings or miscanthus. Analysis of secreted proteins suggests that Podospora anserina compensates for the lack of cellobiose dehydrogenase by increasing beta-glucosidase expression and using an alternate electron donor for LPMO. PMID:27836848

Low-energy N-ion beam biotechnology application in the induction of Thai jasmine rice mutant with improved seed storability

NASA Astrophysics Data System (ADS)

Semsang, Nuananong; Techarang, Jiranat; Yu, Liangdeng; Phanchaisri, Boonrak

2018-06-01

Low-energy heavy-ion beam is a novel biotechnology used for mutation induction in plants. We used a low-energy N-ion beam to induce mutations in Thai jasmine rice (Oryza sativa L. cv. KDML 105) to improve the yield and seed quality. Seeds of BKOS6, a Thai jasmine rice mutant previously induced by ion beams, were re-bombarded with 60-kV-accelerated N-ions (N++N2+) to fluences of 1-2 × 1016 ions/cm2. The resulting mutant, named HyKOS21, exhibited photoperiod insensitivity, semi-dwarfness, and high yield potential. Seed storability of the mutant was studied in natural and accelerated ageing conditions and compared to that of KDML 105 and six other Thai rice varieties. In both testing conditions, HyKOS21 mutant had the highest seed storability among the tested varieties. After storage in the natural condition for 18 months, HyKOS21 had a seed germination percentage nearly two times as that of the original KDML 105. Biochemical analysis showed that the lipid peroxidation level of the mutant seeds was the lowest among those of the tested varieties. Furthermore, an expression analysis of genes encoding lipoxygenase isoenzyme (lox1, lox2, and lox3) revealed that the mutant lacked expression of lox1 and lox2 and expressed only lox3 in seeds. These results may explain the improved seed longevity of the mutant after storage. This work provides further evidence of the modification of biological materials using a low-energy ion beam to produce rice mutants with improved yield and seed storability. The benefits of this technology, to create new varieties with improved values, could serve for local economic development.

Comprehensive gene expression analysis of rice aleurone cells: probing the existence of an alternative gibberellin receptor.

PubMed

Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

2015-02-01

Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. © 2015 American Society of Plant Biologists. All Rights Reserved.

Decreased capacity for sodium export out of Arabidopsis chloroplasts impairs salt tolerance, photosynthesis and plant performance.

PubMed

Müller, Maria; Kunz, Hans-Henning; Schroeder, Julian I; Kemp, Grant; Young, Howard S; Neuhaus, H Ekkehard

2014-05-01

Salt stress is a widespread phenomenon, limiting plant performance in large areas around the world. Although various types of plant sodium/proton antiporters have been characterized, the physiological function of NHD1 from Arabidopsis thaliana has not been elucidated in detail so far. Here we report that the NHD1-GFP fusion protein localizes to the chloroplast envelope. Heterologous expression of AtNHD1 was sufficient to complement a salt-sensitive Escherichia coli mutant lacking its endogenous sodium/proton exchangers. Transport competence of NHD1 was confirmed using recombinant, highly purified carrier protein reconstituted into proteoliposomes, proving Na(+) /H(+) antiport. In planta NHD1 expression was found to be highest in mature and senescent leaves but was not induced by sodium chloride application. When compared to wild-type controls, nhd1 T-DNA insertion mutants showed decreased biomasses and lower chlorophyll levels after sodium feeding. Interestingly, if grown on sand and supplemented with high sodium chloride, nhd1 mutants exhibited leaf tissue Na(+) levels similar to those of wild-type plants, but the Na(+) content of chloroplasts increased significantly. These high sodium levels in mutant chloroplasts resulted in markedly impaired photosynthetic performance as revealed by a lower quantum yield of photosystem II and increased non-photochemical quenching. Moreover, high Na(+) levels might hamper activity of the plastidic bile acid/sodium symporter family protein 2 (BASS2). The resulting pyruvate deficiency might cause the observed decreased phenylalanine levels in the nhd1 mutants due to lack of precursors. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

The non-essential UL50 gene of avian infectious laryngotracheitis virus encodes a functional dUTPase which is not a virulence factor.

PubMed

Fuchs, W; Ziemann, K; Teifke, J P; Werner, O; Mettenleiter, T C

2000-03-01

The DNA sequence of the infectious laryngotracheitis virus (ILTV) UL50, UL51 and UL52 gene homologues was determined. Although the deduced UL50 protein lacks the first of five conserved domains of the corresponding proteins of mammalian alphaherpesviruses, the ILTV gene product was also shown to possess dUTPase activity. The generation of UL50-negative ILTV mutants was facilitated by recombination plasmids encoding green fluorescent protein (GFP), and expression constructs of predicted transactivator proteins of ILTV (alphaTIF, ICP4) were successfully used to increase the infectivity of viral genomic DNA. A GFP-expressing UL50-deletion mutant of ILTV showed reduced cell-to-cell spread in vitro, and was attenuated in vivo. A similar deletion mutant without the foreign gene, however, propagated like wild-type ILTV in cell culture and was pathogenic in chickens. We conclude that the viral dUTPase is not required for efficient replication of ILTV in the respiratory tract of infected animals. The replication defect of the GFP-expressing ILTV recombinant is most likely caused by toxic effects of the reporter gene product, since spontaneously occurring inactivation mutants exhibited wild-type-like growth.

Comprehensive Profiling of Ethylene Response Factor Expression Identifies Ripening-Associated ERF Genes and Their Link to Key Regulators of Fruit Ripening in Tomato1[OPEN

PubMed Central

Gomes, Bruna Lima; Mila, Isabelle; Frasse, Pierre; Zouine, Mohamed; Bouzayen, Mondher

2016-01-01

Our knowledge of the factors mediating ethylene-dependent ripening of climacteric fruit remains limited. The transcription of ethylene-regulated genes is mediated by ethylene response factors (ERFs), but mutants providing information on the specific role of the ERFs in fruit ripening are still lacking, likely due to functional redundancy among this large multigene family of transcription factors. We present here a comprehensive expression profiling of tomato (Solanum lycopersicum) ERFs in wild-type and tomato ripening-impaired tomato mutants (Never-ripe [Nr], ripening-inhibitor [rin], and non-ripening [nor]), indicating that out of the 77 ERFs present in the tomato genome, 27 show enhanced expression at the onset of ripening while 28 display a ripening-associated decrease in expression, suggesting that different ERFs may have contrasting roles in fruit ripening. Among the 19 ERFs exhibiting the most consistent up-regulation during ripening, the expression of 11 ERFs is strongly down-regulated in rin, nor, and Nr tomato ripening mutants, while only three are consistently up-regulated. Members of subclass E, SlERF.E1, SlERF.E2, and SlERF.E4, show dramatic down-regulation in the ripening mutants, suggesting that their expression might be instrumental in fruit ripening. This study illustrates the high complexity of the regulatory network connecting RIN and ERFs and identifies subclass E members as the most active ERFs in ethylene- and RIN/NOR-dependent ripening. PMID:26739234

Library Screen Identifies Enterococcus faecalis CcpA, the Catabolite Control Protein A, as an Effector of Ace, a Collagen Adhesion Protein Linked to Virulence

PubMed Central

Gao, Peng; Pinkston, Kenneth L.; Bourgogne, Agathe; Cruz, Melissa R.; Garsin, Danielle A.; Murray, Barbara E.

2013-01-01

The Enterococcus faecalis cell wall-anchored protein Ace is an important virulence factor involved in cell adhesion and infection. Expression of Ace on the cell surface is affected by many factors, including stage of growth, culture temperature, and environmental components, such as serum, urine, and collagen. However, the mechanisms that regulate or modulate Ace display are not well understood. With interest in identifying genes associated with Ace expression, we utilized a whole-cell enzyme-linked immunosorbent assay (ELISA)-based screening method to identify mutants from a transposon insertion mutant library which exhibited distinct Ace surface expression profiles. We identified a ccpA insertion mutant which showed significantly decreased levels of Ace surface expression at early growth phase versus those of wild-type OG1RF. Confirmation of the observation was achieved through flow cytometry and complementation analysis. Compared to the wild type, the E. faecalis ccpA mutant had an impaired ability to adhere to collagen when grown to early exponential phase, consistent with the lack of Ace expression in the early growth phase. As a key component of carbon catabolite regulation, CcpA has been previously reported to play a critical role in regulating expression of proteins involved in E. faecalis carbohydrate uptake and utilization. Our discovery is the first to associate CcpA with the production of a major E. faecalis virulence factor, providing new insights into the regulation of E. faecalis pathogenesis. PMID:23974022

CopM is a novel copper-binding protein involved in copper resistance in Synechocystis sp. PCC 6803.

PubMed

Giner-Lamia, Joaquín; López-Maury, Luis; Florencio, Francisco J

2015-02-01

Copper resistance system in the cyanobacterium Synechocystis sp. PCC 6803 comprises two operons, copMRS and copBAC, which are expressed in response to copper in the media. copBAC codes for a heavy-metal efflux-resistance nodulation and division (HME-RND) system, while copMRS codes for a protein of unknown function, CopM, and a two-component system CopRS, which controls the expression of these two operons. Here, we report that CopM is a periplasmic protein able to bind Cu(I) with high affinity (KD ~3 × 10(-16) ). Mutants lacking copM showed a sensitive copper phenotype similar to mutants affected in copB, but lower than mutants of the two-component system CopRS, suggesting that CopBAC and CopM constitute two independent resistance mechanisms. Moreover, constitutive expression of copM is able to partially suppress the copper sensitivity of the copR mutant strain, pointing out that CopM per se is able to confer copper resistance. Furthermore, constitutive expression of copM was able to reduce total cellular copper content of the copR mutant to the levels determined in the wild-type (WT) strain. Finally, CopM was localized not only in the periplasm but also in the extracellular space, suggesting that CopM can also prevent copper accumulation probably by direct copper binding outside the cell. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

CopM is a novel copper-binding protein involved in copper resistance in Synechocystis sp. PCC 6803

PubMed Central

Giner-Lamia, Joaquín; López-Maury, Luis; Florencio, Francisco J

2015-01-01

Copper resistance system in the cyanobacterium Synechocystis sp. PCC 6803 comprises two operons, copMRS and copBAC, which are expressed in response to copper in the media. copBAC codes for a heavy-metal efflux–resistance nodulation and division (HME-RND) system, while copMRS codes for a protein of unknown function, CopM, and a two-component system CopRS, which controls the expression of these two operons. Here, we report that CopM is a periplasmic protein able to bind Cu(I) with high affinity (KD ∼3 × 10−16). Mutants lacking copM showed a sensitive copper phenotype similar to mutants affected in copB, but lower than mutants of the two-component system CopRS, suggesting that CopBAC and CopM constitute two independent resistance mechanisms. Moreover, constitutive expression of copM is able to partially suppress the copper sensitivity of the copR mutant strain, pointing out that CopM per se is able to confer copper resistance. Furthermore, constitutive expression of copM was able to reduce total cellular copper content of the copR mutant to the levels determined in the wild-type (WT) strain. Finally, CopM was localized not only in the periplasm but also in the extracellular space, suggesting that CopM can also prevent copper accumulation probably by direct copper binding outside the cell. PMID:25545960

A zebrafish sox9 gene required for cartilage morphogenesis.

PubMed

Yan, Yi-Lin; Miller, Craig T; Nissen, Robert M; Singer, Amy; Liu, Dong; Kirn, Anette; Draper, Bruce; Willoughby, John; Morcos, Paul A; Amsterdam, Adam; Chung, Bon-Chu; Westerfield, Monte; Haffter, Pascal; Hopkins, Nancy; Kimmel, Charles; Postlethwait, John H; Nissen, Robert

2002-11-01

The molecular genetic mechanisms of cartilage construction are incompletely understood. Zebrafish embryos homozygous for jellyfish (jef) mutations show craniofacial defects and lack cartilage elements of the neurocranium, pharyngeal arches, and pectoral girdle similar to humans with campomelic dysplasia. We show that two alleles of jef contain mutations in sox9a, one of two zebrafish orthologs of the human transcription factor SOX9. A mutation induced by ethyl nitrosourea changed a conserved nucleotide at a splice junction and severely reduced splicing of sox9a transcript. A retrovirus insertion into sox9a disrupted its DNA-binding domain. Inhibiting splicing of the sox9a transcript in wild-type embryos with splice site-directed morpholino antisense oligonucleotides produced a phenotype like jef mutant larvae, and caused sox9a transcript to accumulate in the nucleus; this accumulation can serve as an assay for the efficacy of a morpholino independent of phenotype. RNase-protection assays showed that in morpholino-injected animals, the percent of splicing inhibition decreased from 80% at 28 hours post fertilization to 45% by 4 days. Homozygous mutant embryos had greatly reduced quantities of col2a1 message, the major collagen of cartilage. Analysis of dlx2 expression showed that neural crest specification and migration was normal in jef (sox9a) embryos. Confocal images of living embryos stained with BODIPY-ceramide revealed at single-cell resolution the formation of precartilage condensations in mutant embryos. Besides the lack of overt cartilage differentiation, pharyngeal arch condensations in jef (sox9a) mutants lacked three specific morphogenetic behaviors: the stacking of chondrocytes into orderly arrays, the individuation of pharyngeal cartilage organs and the proper shaping of individual cartilages. Despite the severe reduction of cartilages, analysis of titin expression showed normal muscle patterning in jef (sox9a) mutants. Likewise, calcein labeling revealed that early bone formation was largely unaffected in jef (sox9a) mutants. These studies show that jef (sox9a) is essential for both morphogenesis of condensations and overt cartilage differentiation.

Inappropriate Expression of an NLP Effector in Colletotrichum orbiculare Impairs Infection on Cucurbitaceae Cultivars via Plant Recognition of the C-Terminal Region.

PubMed

Azmi, Nur Sabrina Ahmad; Singkaravanit-Ogawa, Suthitar; Ikeda, Kyoko; Kitakura, Saeko; Inoue, Yoshihiro; Narusaka, Yoshihiro; Shirasu, Ken; Kaido, Masanori; Mise, Kazuyuki; Takano, Yoshitaka

2018-01-01

The hemibiotrophic pathogen Colletotrichum orbiculare preferentially expresses a necrosis and ethylene-inducing peptide 1 (Nep1)-like protein named NLP1 during the switch to necrotrophy. Here, we report that the constitutive expression of NLP1 in C. orbiculare blocks pathogen infection in multiple Cucurbitaceae cultivars via their enhanced defense responses. NLP1 has a cytotoxic activity that induces cell death in Nicotiana benthamiana. However, C. orbiculare transgenic lines constitutively expressing a mutant NLP1 lacking the cytotoxic activity still failed to infect cucumber, indicating no clear relationship between cytotoxic activity and the NLP1-dependent enhanced defense. NLP1 also possesses the microbe-associated molecular pattern (MAMP) sequence called nlp24, recognized by Arabidopsis thaliana at its central region, similar to NLPs of other pathogens. Surprisingly, inappropriate expression of a mutant NLP1 lacking the MAMP signature is also effective for blocking pathogen infection, uncoupling the infection block from the corresponding MAMP. Notably, the deletion analyses of NLP1 suggested that the C-terminal region of NLP1 is critical to enhance defense in cucumber. The expression of mCherry fused with the C-terminal 32 amino acids of NLP1 was enough to trigger the defense of cucurbits, revealing that the C-terminal region of the NLP1 protein is recognized by cucurbits and, then, terminates C. orbiculare infection.

Disruption of DNA methylation-dependent long gene repression in Rett syndrome

PubMed Central

Gabel, Harrison W.; Kinde, Benyam Z.; Stroud, Hume; Gilbert, Caitlin S.; Harmin, David A.; Kastan, Nathaniel R.; Hemberg, Martin; Ebert, Daniel H.; Greenberg, Michael E.

2015-01-01

Disruption of the MECP2 gene leads to Rett syndrome (RTT), a severe neurological disorder with features of autism1. MECP2 encodes a methyl-DNA-binding protein2 that has been proposed to function as a transcriptional repressor, but despite numerous studies examining neuronal gene expression in Mecp2 mutants, no clear model has emerged for how MeCP2 regulates transcription3–9. Here we identify a genome-wide length-dependent increase in gene expression in MeCP2 mutant mouse models and human RTT brains. We present evidence that MeCP2 represses gene expression by binding to methylated CA sites within long genes, and that in neurons lacking MeCP2, decreasing the expression of long genes attenuates RTT-associated cellular deficits. In addition, we find that long genes as a population are enriched for neuronal functions and selectively expressed in the brain. These findings suggest that mutations in MeCP2 may cause neurological dysfunction by specifically disrupting long gene expression in the brain. PMID:25762136

Heterogeneity of signal transduction by Na-K-ATPase α-isoforms: role of Src interaction.

PubMed

Yu, Hui; Cui, Xiaoyu; Zhang, Jue; Xie, Joe X; Banerjee, Moumita; Pierre, Sandrine V; Xie, Zijian

2018-02-01

Of the four Na-K-ATPase α-isoforms, the ubiquitous α1 Na-K-ATPase possesses both ion transport and Src-dependent signaling functions. Mechanistically, we have identified two putative pairs of domain interactions between α1 Na-K-ATPase and Src that are critical for α1 signaling function. Our subsequent report that α2 Na-K-ATPase lacks these putative Src-binding sites and fails to carry on Src-dependent signaling further supported our proposed model of direct interaction between α1 Na-K-ATPase and Src but fell short of providing evidence for a causative role. This hypothesis was specifically tested here by introducing key residues of the two putative Src-interacting domains present on α1 but not α2 sequence into the α2 polypeptide, generating stable cell lines expressing this mutant, and comparing its signaling properties to those of α2-expressing cells. The mutant α2 was fully functional as a Na-K-ATPase. In contrast to wild-type α2, the mutant gained α1-like signaling function, capable of Src interaction and regulation. Consistently, the expression of mutant α2 redistributed Src into caveolin-1-enriched fractions and allowed ouabain to activate Src-mediated signaling cascades, unlike wild-type α2 cells. Finally, mutant α2 cells exhibited a growth phenotype similar to that of the α1 cells and proliferated much faster than wild-type α2 cells. These findings reveal the structural requirements for the Na-K-ATPase to function as a Src-dependent receptor and provide strong evidence of isoform-specific Src interaction involving the identified key amino acids. The sequences surrounding the putative Src-binding sites in α2 are highly conserved across species, suggesting that the lack of Src binding may play a physiologically important and isoform-specific role.

Modulating the folding of P-glycoprotein and cystic fibrosis transmembrane conductance regulator truncation mutants with pharmacological chaperones.

PubMed

Wang, Ying; Loo, Tip W; Bartlett, M Claire; Clarke, David M

2007-03-01

Cystic fibrosis transmembrane conductance regulator (CFTR) and P-glycoprotein (P-gp) are ATP-binding cassette (ABC) transporters that have two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs). Defective folding of CFTR lacking phenylalanine 508 (DeltaPhe508) in NBD1 is the most common cause of cystic fibrosis. The Phe508 position seems to be universally important in ABC transporters because deletion of the equivalent residue (Tyr490) in P-gp also inhibits maturation of the protein. The pharmacological chaperone VRT-325 can repair the DeltaPhe508-type folding defects in P-gp or CFTR. VRT-325 may repair the folding defects by promoting dimerization of the two NBDs or by promoting folding of the TMDs. To distinguish between these two mechanisms, we tested the ability of VRT-325 to promote folding of truncation mutants lacking one or both NBDs. Sensitivity to glycosidases was used as an indirect indicator of folding. It was found that VRT-325 could promote maturation of truncation mutants lacking NBD2. Truncation mutants of CFTR or P-gp lacking both NBDs showed deficiencies in core-glycosylation that could be partially reversed by carrying out expression in the presence of VRT-325. The results show that dimerization of the two NBDs to form a "nucleotide-sandwich" structure or NBD interactions with the TMDs are not essential for VRT-325 enhancement of folding. Instead, VRT-325 can promote folding of the TMDs alone. The ability of VRT-325 to promote core-glycosylation of the NBD-less truncation mutants suggests that one mechanism whereby the compound enhances folding is by promoting proper insertion of TM segments attached to the glycosylated loops so that they adopt an orientation favorable for glycosylation.

Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit.

PubMed

Liu, Cheng-Qian; Hu, Kang-Di; Li, Ting-Ting; Yang, Ying; Yang, Feng; Li, Yan-Hong; Liu, He-Ping; Chen, Xiao-Yan; Zhang, Hua

2017-01-01

Aspergillus niger, a saprophytic fungus, is widely distributed in soil, air and cereals, and can cause postharvest diseases in fruit. Polygalacturonase (PG) is one of the main enzymes in fungal pathogens to degrade plant cell wall. To evaluate whether the deletion of an exo-polygalacturonase gene pgxB would influence fungal pathogenicity to fruit, pgxB gene was deleted in Aspergillus niger MA 70.15 (wild type) via homologous recombination. The ΔpgxB mutant showed similar growth behavior compared with the wild type. Pectin medium induced significant higher expression of all pectinase genes in both wild type and ΔpgxB in comparison to potato dextrose agar medium. However, the ΔpgxB mutant was less virulent on apple fruits as the necrosis diameter caused by ΔpgxB mutant was significantly smaller than that of wild type. Results of quantitive-PCR showed that, in the process of infection in apple fruit, gene expressions of polygalacturonase genes pgaI, pgaII, pgaA, pgaC, pgaD and pgaE were enhanced in ΔpgxB mutant in comparison to wild type. These results prove that, despite the increased gene expression of other polygalacturonase genes in ΔpgxB mutant, the lack of pgxB gene significantly reduced the virulence of A. niger on apple fruit, suggesting that pgxB plays an important role in the infection process on the apple fruit.

A Mutant Receptor Tyrosine Phosphatase, CD148, Causes Defects in Vascular Development

PubMed Central

Takahashi, Takamune; Takahashi, Keiko; St. John, Patricia L.; Fleming, Paul A.; Tomemori, Takuya; Watanabe, Toshio; Abrahamson, Dale R.; Drake, Christopher J.; Shirasawa, Takuji; Daniel, Thomas O.

2003-01-01

Vascularization defects in genetic recombinant mice have defined critical roles for a number of specific receptor tyrosine kinases. Here we evaluated whether an endothelium-expressed receptor tyrosine phosphatase, CD148 (DEP-1/PTPη), participates in developmental vascularization. A mutant allele, CD148ΔCyGFP, was constructed to eliminate CD148 phosphatase activity by in-frame replacement of cytoplasmic sequences with enhanced green fluorescent protein sequences. Homozygous mutant mice died at midgestation, before embryonic day 11.5 (E11.5), with vascularization failure marked by growth retardation and disorganized vascular structures. Structural abnormalities were observed as early as E8.25 in the yolk sac, prior to the appearance of intraembryonic defects. Homozygous mutant mice displayed enlarged vessels comprised of endothelial cells expressing markers of early differentiation, including VEGFR2 (Flk1), Tal1/SCL, CD31, ephrin-B2, and Tie2, with notable lack of endoglin expression. Increased endothelial cell numbers and mitotic activity indices were demonstrated. At E9.5, homozygous mutant embryos showed homogeneously enlarged primitive vessels defective in vascular remodeling and branching, with impaired pericyte investment adjacent to endothelial structures, in similarity to endoglin-deficient embryos. Developing cardiac tissues showed expanded endocardial projections accompanied by defective endocardial cushion formation. These findings implicate a member of the receptor tyrosine phosphatase family, CD148, in developmental vascular organization and provide evidence that it regulates endothelial proliferation and endothelium-pericyte interactions. PMID:12588999

The Drosophila Neurally Altered Carbohydrate Mutant Has a Defective Golgi GDP-fucose Transporter*

PubMed Central

Geisler, Christoph; Kotu, Varshika; Sharrow, Mary; Rendić, Dubravko; Pöltl, Gerald; Tiemeyer, Michael; Wilson, Iain B. H.; Jarvis, Donald L.

2012-01-01

Studying genetic disorders in model organisms can provide insights into heritable human diseases. The Drosophila neurally altered carbohydrate (nac) mutant is deficient for neural expression of the HRP epitope, which consists of N-glycans with core α1,3-linked fucose residues. Here, we show that a conserved serine residue in the Golgi GDP-fucose transporter (GFR) is substituted by leucine in nac1 flies, which abolishes GDP-fucose transport in vivo and in vitro. This loss of function is due to a biochemical defect, not to destabilization or mistargeting of the mutant GFR protein. Mass spectrometry and HPLC analysis showed that nac1 mutants lack not only core α1,3-linked, but also core α1,6-linked fucose residues on their N-glycans. Thus, the nac1 Gfr mutation produces a previously unrecognized general defect in N-glycan core fucosylation. Transgenic expression of a wild-type Gfr gene restored the HRP epitope in neural tissues, directly demonstrating that the Gfr mutation is solely responsible for the neural HRP epitope deficiency in the nac1 mutant. These results validate the Drosophila nac1 mutant as a model for the human congenital disorder of glycosylation, CDG-IIc (also known as LAD-II), which is also the result of a GFR deficiency. PMID:22745127

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shiau, Celia E.; Kaufman, Zoe; Meireles, Ana M.

Interferon regulatory factor 8 (Irf8) is critical for mammalian macrophage development and innate immunity, but its role in teleost myelopoiesis remains incompletely understood. Specifically, genetic tools to analyze the role of irf8 in zebrafish macrophage development at larval and adult stages are lacking. In this study, we generated irf8 null mutants in zebrafish using TALEN-mediated targeting. Our analysis defines different requirements for irf8 at different stages. irf8 is required for formation of all macrophages during primitive and transient definitive hematopoiesis, but not during adult-phase definitive hematopoiesis starting at 5-6 days postfertilization. At early stages, irf8 mutants have excess neutrophils andmore » excess cell death in pu.1-expressing myeloid cells. Macrophage fates were recovered in irf8 mutants after wildtype irf8 expression in neutrophil and macrophage lineages, suggesting that irf8 regulates macrophage specification and survival. In juvenile irf8 mutant fish, mature macrophages are present, but at numbers significantly reduced compared to wildtype, indicating an ongoing requirement for irf8 after embryogenesis. As development progresses, tissue macrophages become apparent in zebrafish irf8 mutants, with the possible exception of microglia. Our study defines distinct requirement for irf8 in myelopoiesis before and after transition to the adult hematopoietic system.« less

C. elegans MCM-4 is a general DNA replication and checkpoint component with an epidermis-specific requirement for growth and viability.

PubMed

Korzelius, Jerome; The, Inge; Ruijtenberg, Suzan; Portegijs, Vincent; Xu, Huihong; Horvitz, H Robert; van den Heuvel, Sander

2011-02-15

DNA replication and its connection to M phase restraint are studied extensively at the level of single cells but rarely in the context of a developing animal. C. elegans lin-6 mutants lack DNA synthesis in postembryonic somatic cell lineages, while entry into mitosis continues. These mutants grow slowly and either die during larval development or develop into sterile adults. We found that lin-6 corresponds to mcm-4 and encodes an evolutionarily conserved component of the MCM2-7 pre-RC and replicative helicase complex. The MCM-4 protein is expressed in all dividing cells during embryonic and postembryonic development and associates with chromatin in late anaphase. Induction of cell cycle entry and differentiation continues in developing mcm-4 larvae, even in cells that went through abortive division. In contrast to somatic cells in mcm-4 mutants, the gonad continues DNA replication and cell division until late larval development. Expression of MCM-4 in the epidermis (also known as hypodermis) is sufficient to rescue the growth retardation and lethality of mcm-4 mutants. While the somatic gonad and germline show substantial ability to cope with lack of zygotic mcm-4 function, mcm-4 is specifically required in the epidermis for growth and survival of the whole organism. Thus, C. elegans mcm-4 has conserved functions in DNA replication and replication checkpoint control but also shows unexpected tissue-specific requirements. Copyright © 2010 Elsevier Inc. All rights reserved.

C. elegans MCM-4 is a general DNA replication and checkpoint component with an epidermis-specific requirement for growth and viability

PubMed Central

Korzelius, Jerome; The, Inge; Ruijtenberg, Suzan; Portegijs, Vincent; Xu, Huihong; Horvitz, H. Robert; van den Heuvel, Sander

2012-01-01

DNA replication and its connection to M phase restraint are studied extensively at the level of single cells but rarely in the context of a developing animal. C. elegans lin-6 mutants lack DNA synthesis in postembryonic somatic cell lineages, while entry into mitosis continues. These mutants grow slowly and either die during larval development or develop into sterile adults. We found that lin-6 corresponds to mcm-4 and encodes an evolutionarily conserved component of the MCM2-7 pre-RC and replicative helicase complex. The MCM-4 protein is expressed in all dividing cells during embryonic and postembryonic development and associates with chromatin in late anaphase. Induction of cell-cycle entry and differentiation continues in developing mcm-4 larvae, even in cells that went through abortive division. In contrast to somatic cells in mcm-4 mutants, the gonad continues DNA replication and cell division until late larval development. Expression of MCM-4 in the epidermis (also known as hypodermis) is sufficient to rescue the growth retardation and lethality of mcm-4 mutants. While the somatic gonad and germline show substantial ability to cope with lack of zygotic mcm-4 function, mcm-4 is specifically required in the epidermis for growth and survival of the whole organism. Thus, C. elegans mcm-4 has conserved functions in DNA replication and replication checkpoint control but also shows unexpected tissue-specific requirements. PMID:21146520

Genetic dissection of the role of cannabinoid type-1 receptors in the emotional consequences of repeated social stress in mice.

PubMed

Dubreucq, Sarah; Matias, Isabelle; Cardinal, Pierre; Häring, Martin; Lutz, Beat; Marsicano, Giovanni; Chaouloff, Francis

2012-07-01

The endocannabinoid system (ECS) tightly controls emotional responses to acute aversive stimuli. Repeated stress alters ECS activity but the role played by the ECS in the emotional consequences of repeated stress has not been investigated in detail. This study used social defeat stress, together with pharmacology and genetics to examine the role of cannabinoid type-1 (CB(1)) receptors on repeated stress-induced emotional alterations. Seven daily social defeat sessions increased water (but not food) intake, sucrose preference, anxiety, cued fear expression, and adrenal weight in C57BL/6N mice. The first and the last social stress sessions triggered immediate brain region-dependent changes in the concentrations of the principal endocannabinoids anandamide and 2-arachidonoylglycerol. Pretreatment before each of the seven stress sessions with the CB(1) receptor antagonist rimonabant prolonged freezing responses of stressed mice during cued fear recall tests. Repeated social stress abolished the increased fear expression displayed by constitutive CB(1) receptor-deficient mice. The use of mutant mice lacking CB(1) receptors from cortical glutamatergic neurons or from GABAergic neurons indicated that it is the absence of the former CB(1) receptor population that is responsible for the fear responses in socially stressed CB(1) mutant mice. In addition, stress-induced hypolocomotor reactivity was amplified by the absence of CB(1) receptors from GABAergic neurons. Mutant mice lacking CB(1) receptors from serotonergic neurons displayed a higher anxiety but decreased cued fear expression than their wild-type controls. These mutant mice failed to show social stress-elicited increased sucrose preference. This study shows that (i) release of endocannabinoids during stress exposure impedes stress-elicited amplification of cued fear behavior, (ii) social stress opposes the increased fear expression and delayed between-session extinction because of the absence of CB(1) receptors from cortical glutamatergic neurons, and (iii) CB(1) receptors on central serotonergic neurons are involved in the sweet consumption response to repeated stress.

Cytokinin response factor 4 (CRF4) is induced by cold and involved in freezing tolerance.

PubMed

Zwack, Paul J; Compton, Margaret A; Adams, Cami I; Rashotte, Aaron M

2016-03-01

Cytokinin response factor 4 (CRF4) shows a short-term induction by cold (4 °C) that appears to play a role in non-acclimated freezing tolerance as seen in mutant and overexpression lines. Responses to abiotic stresses, such as cold stress, are critical to plant growth and optimal production. Examination of Arabidopsis cytokinin response factors (CRFs) showed transcriptional induction after exposure to cold (4 °C). In particular, CRF4 was strongly induced in both root and shoot tissues. As CRF4 is one of several CRFs not transcriptionally regulated by cytokinin, we further investigated its response to cold. Peak CRF4 induction occurred 6 h post cold exposure, after which expression was maintained at moderately elevated levels during extended cold and subsequent treatment recovery. Examination of CRF4 mutant and overexpression lines under standard (non-cold) conditions revealed little difference from WT. One exception was a small, but significant increase in primary root growth of overexpression plants (CRF4OX). Under cold conditions, the only phenotype observed was a reduction in the rate of germination of CRF4OX seeds. The pattern of CRF4 expression along with the lack of strong phenotype at 4 °C led us to hypothesize that cold induction of CRF4 could play a role in short-term cold acclimation leading to increased freeze tolerance. Examination of CRF4OX and crf4 plants exposed to freezing temperatures revealed mutants lacking expression of CRF4 were more sensitive to freezing, while CRF4OXs with increased levels CRF4 levels were more tolerant. Altered transcript expression of CBF and COR15a cold signaling pathway genes in crf4 mutant and overexpression lines suggest that CRF4 may be potentially connected to this pathway. Overall this indicates that CRF4 plays an important role in both cold response and freezing stress.

Genetic Dissection of the Role of Cannabinoid Type-1 Receptors in the Emotional Consequences of Repeated Social Stress in Mice

PubMed Central

Dubreucq, Sarah; Matias, Isabelle; Cardinal, Pierre; Häring, Martin; Lutz, Beat; Marsicano, Giovanni; Chaouloff, Francis

2012-01-01

The endocannabinoid system (ECS) tightly controls emotional responses to acute aversive stimuli. Repeated stress alters ECS activity but the role played by the ECS in the emotional consequences of repeated stress has not been investigated in detail. This study used social defeat stress, together with pharmacology and genetics to examine the role of cannabinoid type-1 (CB1) receptors on repeated stress-induced emotional alterations. Seven daily social defeat sessions increased water (but not food) intake, sucrose preference, anxiety, cued fear expression, and adrenal weight in C57BL/6N mice. The first and the last social stress sessions triggered immediate brain region-dependent changes in the concentrations of the principal endocannabinoids anandamide and 2-arachidonoylglycerol. Pretreatment before each of the seven stress sessions with the CB1 receptor antagonist rimonabant prolonged freezing responses of stressed mice during cued fear recall tests. Repeated social stress abolished the increased fear expression displayed by constitutive CB1 receptor-deficient mice. The use of mutant mice lacking CB1 receptors from cortical glutamatergic neurons or from GABAergic neurons indicated that it is the absence of the former CB1 receptor population that is responsible for the fear responses in socially stressed CB1 mutant mice. In addition, stress-induced hypolocomotor reactivity was amplified by the absence of CB1 receptors from GABAergic neurons. Mutant mice lacking CB1 receptors from serotonergic neurons displayed a higher anxiety but decreased cued fear expression than their wild-type controls. These mutant mice failed to show social stress-elicited increased sucrose preference. This study shows that (i) release of endocannabinoids during stress exposure impedes stress-elicited amplification of cued fear behavior, (ii) social stress opposes the increased fear expression and delayed between-session extinction because of the absence of CB1 receptors from cortical glutamatergic neurons, and (iii) CB1 receptors on central serotonergic neurons are involved in the sweet consumption response to repeated stress. PMID:22434220

lbtA and lbtB Are Required for Production of the Legionella pneumophila Siderophore Legiobactin

PubMed Central

Allard, Kimberly A.; Viswanathan, V. K.; Cianciotto, Nicholas P.

2006-01-01

Under iron stress, Legionella pneumophila secretes legiobactin, a nonclassical siderophore that is reactive in the chrome azurol S (CAS) assay. Here, we have optimized conditions for legiobactin expression, shown its biological activity, and identified two genes, lbtA and lbtB, which are involved in legiobactin production. lbtA appears to be iron repressed and encodes a protein that has significant homology with siderophore synthetases, and FrgA, a previously described iron-regulated protein of L. pneumophila. lbtB encodes a protein homologous with members of the major facilitator superfamily of multidrug efflux pumps. Mutants lacking lbtA or lbtB were defective for legiobactin, producing 40 to 70% less CAS reactivity in deferrated chemically defined medium (CDM). In bioassays, mutant CDM culture supernatants, unlike those of the wild type, did not support growth of iron-limited wild-type bacteria in 2′,2′-dipyridyl-containing buffered charcoal yeast extract (BCYE) agar and a ferrous iron transport mutant on BCYE agar without added iron. The lbtA mutant was modestly defective for growth in deferrated CDM containing the iron chelator citrate, indicating that legiobactin is required in conditions of severe iron limitation. Complementation of the lbt mutants restored both siderophore expression, as measured by the CAS assay and bioassays, and bacterial growth in deferrated, citrate-containing media. The lbtA mutant replicated as the wild type did in macrophages, amoebae, and the lungs of mice. However, L. pneumophila expresses lbtA in the macrophage, suggesting that legiobactin, though not required, may play a dispensable role in intracellular growth. The discovery of lbtAB represents the first identification of genes required for L. pneumophila siderophore expression. PMID:16452417

Medulloblastomas derived from Cxcr6 mutant mice respond to treatment with a smoothened inhibitor.

PubMed

Sasai, Ken; Romer, Justyna T; Kimura, Hiromichi; Eberhart, Derek E; Rice, Dennis S; Curran, Tom

2007-04-15

The sonic hedgehog (Shh) pathway is activated in approximately 30% of human medulloblastoma resulting in increased expression of downstream target genes. In about half of these cases, this has been shown to be a consequence of mutations in regulatory genes within the pathway, including Ptc1, Smo, and Sufu. However, for some tumors, no mutations have been detected in known pathway genes. This suggests that either mutations in other genes promote tumorigenesis or that epigenetic alterations increase pathway activity in these tumors. Here, we report that 3% to 4% of mice lacking either one or both functional copies of Cxcr6 develop medulloblastoma. Although CXCR6 is not known to be involved in Shh signaling, tumors derived from Cxcr6 mutant mice expressed Shh pathway target genes including Gli1, Gli2, Ptc2, and Sfrp1, indicating elevated pathway activity. Interestingly, the level of Ptc1 expression was decreased in tumor cells although two normal copies of Ptc1 were retained. This implies that reduced CXCR6 function leads to suppression of Ptc1 thereby increasing Smoothened function and promoting tumorigenesis. We used a direct transplant model to test the sensitivity of medulloblastoma arising in Cxcr6 mutant mice to a small-molecule inhibitor of Smoothened (HhAntag). We found that transplanted tumors were dramatically inhibited in mice treated for only 4 days with HhAntag. These findings suggest that HhAntag may be effective against tumors lacking mutations in known Shh pathway genes.

Epidermal jasmonate perception is sufficient for all aspects of jasmonate-mediated male fertility in Arabidopsis.

PubMed

Jewell, Jeremy B; Browse, John

2016-03-01

Jasmonate (JA) signaling is essential for several environmental responses and reproductive development in many plant species. In Arabidopsis thaliana, the most obvious phenotype of JA biosynthetic and perception mutants is profound sporophytic male sterility characterized by failure of stamen filament elongation, severe delay of anther dehiscence and pollen inviability. The site of action of JA in the context of reproductive development has been discussed, but the ideas have not been tested experimentally. To this end we used targeted expression of a COI1-YFP transgene in the coi1-1 mutant background. As COI1 is an essential component of the JA co-receptor complex, the null coi1-1 mutant is male sterile due to lack of JA perception. We show that expression of COI1-YFP in the epidermis of the stamen filament and anther in coi1 mutant plants is sufficient to rescue filament elongation, anther dehiscence and pollen viability. In contrast, filament expression alone or expression in the tapetum do not restore dehiscence and pollen viability. These results demonstrate that epidermal JA perception is sufficient for anther function and pollen viability, and suggest the presence of a JA-dependent non-autonomous signal produced in the anther epidermis to synchronize both anther dehiscence and pollen maturation. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Disruption of non-anchored cell wall protein NCW-1 promotes cellulase production by increasing cellobiose uptake in Neurospora crassa.

PubMed

Lin, Liangcai; Chen, Yong; Li, Jingen; Wang, Shanshan; Sun, Wenliang; Tian, Chaoguang

2017-04-01

To elucidate the mechanism of cellulase signal transduction in filamentous fungi including the components of the cellulase induction pathway. Neurospora crassa ncw-1 encodes a non-anchored cell wall protein. The absence of ncw-1 increased cellulase gene expression and this is not due to relieving carbon catabolite repression mediated by the cre-1 pathway. A mutant lacking genes encoding both three major β-glucosidase enzymes and NCW-1 (Δ3βGΔncw-1) was constructed. Transcriptome analysis of the quadruple mutant demonstrated enhanced expression of cellodextrin transporters after ncw-1 deletion, indicating that ncw-1 affects cellulase expression and production by inhibiting the uptake of the cellodextrin. NCW-1 is a novel component that plays a critical role in the cellulase induction signaling pathway.

Suppression of abnormal morphology and extracytoplasmic function sigma activity in Bacillus subtilis ugtP mutant cells by expression of heterologous glucolipid synthases from Acholeplasma laidlawii.

PubMed

Matsuoka, Satoshi; Seki, Takahiro; Matsumoto, Kouji; Hara, Hiroshi

2016-12-01

Glucolipids in Bacillus subtilis are synthesized by UgtP processively transferring glucose from UDP-glucose to diacylglycerol. Here we conclude that the abnormal morphology of a ugtP mutant is caused by lack of glucolipids, since the same morphology arises after abolition of glucolipid production by disruption of pgcA and gtaB, which are involved in UDP-glucose synthesis. Conversely, expression of a monoglucosyldiacylglycerol (MGlcDG) produced by 1,2-diacylglycerol 3-glucosyltransferase from Acholeplasma laidlawii (alMGS) almost completely suppressed the ugtP disruptant phenotype. Activation of extracytoplasmic function (ECF) sigmas (SigM, SigV, and SigX) in the ugtP mutant was decreased by alMGS expression, and was suppressed to low levels by MgSO 4 addition. When alMGS and alDGS (A. laidlawii 1,2-diacylglycerol-3-glucose (1-2)-glucosyltransferase producing diglucosyldiacylglycerol (DGlcDG)) were simultaneously expressed, SigX activation was repressed to wild type level. These observations suggest that MGlcDG molecules are required for maintenance of B. subtilis cell shape and regulation of ECF sigmas, and DGlcDG regulates SigX activity.

Combined action of the major secreted exo- and endopolygalacturonases is required for full virulence of Fusarium oxysporum.

PubMed

Bravo Ruiz, Gustavo; Di Pietro, Antonio; Roncero, M Isabel G

2016-04-01

The genome of the tomato pathogen Fusarium oxysporum f. sp. lycopersici encodes eight different polygalacturonases (PGs): four endoPGs and four exoPGs. Quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) revealed that endoPGs pg1 and pg5 and exoPGs pgx4 and pgx6 are expressed at significant levels during growth on citrus pectin, polygalacturonic acid or the monomer galacturonic acid, as well as during the infection of tomato plants. The remaining PG genes exhibit low expression levels under all the conditions tested. Secreted PG activity was decreased significantly during growth on pectin in the single deletion mutants lacking either pg1 or pgx6, as well as in the double mutant. Although the single deletion mutants did not display a significant virulence reduction on tomato plants, the Δpg1Δpgx6 double mutant was significantly attenuated in virulence. The combined action of exoPGs and endoPGs is thus essential for plant infection by the vascular wilt fungus F. oxysporum. © 2015 BSPP and John Wiley & Sons Ltd.

Characterization of a spontaneous avirulent mutant of Legionella pneumophila Serogroup 6: evidence of DotA and flagellin involvement in the loss of virulence.

PubMed

Scaturro, Maria; Meschini, Stefania; Arancia, Giuseppe; Stefano, Fontana; Ricci, Maria Luisa

2009-12-01

The pathogenesis of Legionella pneumophila mainly resides in its ability to inhibit the phagosome-lysosome fusion, which normally prevents the killing of the host cells. In order to characterize the molecular alterations that occurred in a spontaneous avirulent mutant of Legionella pneumophila serogroup 6, named Vir-, we investigated the ability of the mutant to adhere to and multiply in the WI26VA4 alveolar epithelial cell line and in human macrophages, when compared to its parental strain, Vir+. We also determined the colocalization of bacteria with LAMP-1 to gain an insight into the phagosome-lysosome fusion process. Additionally, we determined the flagellin expression and dotA nucleotide sequencing. We observed a lack of expression of flagellin and an in-frame mutation in the dotA. gene. The data obtained strongly suggest the loss of virulence of the mutant could probably be due to the absence of flagellin and the dysfunctional type IV secretion System, resulting from the DotA protein being severely compromised.

Analysis of Photosynthetic Antenna Function in a Mutant of Arabidopsis thaliana (L.) Lacking trans-Hexadecenoic Acid 1

PubMed Central

McCourt, Peter; Browse, John; Watson, Jan; Arntzen, Charles J.; Somerville, Chris R.

1985-01-01

Several lines of evidence support the proposal that the unusual chloroplast-specific lipid acyl group Δ3,trans-hexadecenoic acid (trans-C16:1) stimulates the formation or maintenance of the oligomeric form of the light-harvesting chlorophyll a/b complex (LHCP). To assess the functional significance of this apparent association we have analyzed LHCP structure and function in a mutant of Arabidopsis thaliana (L.) which lacks trans-C16:1 by electrophoretic analysis of the protein-chlorophyll complexes and by measurements of chlorophyll fluorescence under a variety of conditions. By these criteria the putative oligomeric form of LHCP appears to be slightly more labile to detergent-mediated dissociation in the mutant. The oligomeric PSI chlorophyll-protein complex, associated with PSI, was also more labile to detergent-mediated dissociation in the mutant, suggesting a previously unsuspected association of trans-C16:1 with the PSI complex. However, no significant effect of the mutation on the efficiency of energy transfer from LHCP to the photochemical reaction centers was observed under any of the various conditions imposed. Also, the stability of the chlorophyll-protein complexes to temperature-induced dissociation was unaffected in the mutant. The role of trans-C16:1 is very subtle or is only conditionally expressed. Images Fig. 1 PMID:16664340

Overlap of copper and iron uptake systems in mitochondria in Saccharomyces cerevisiae

PubMed Central

Wang, Jing; Gammon, Micah G.; Maynard, Margaret K.; White, Olivia L.; Cobine, Jai A.; Mahone, Wilkerson K.

2016-01-01

In Saccharomyces cerevisiae, the mitochondrial carrier family protein Pic2 imports copper into the matrix. Deletion of PIC2 causes defects in mitochondrial copper uptake and copper-dependent growth phenotypes owing to decreased cytochrome c oxidase activity. However, copper import is not completely eliminated in this mutant, so alternative transport systems must exist. Deletion of MRS3, a component of the iron import machinery, also causes a copper-dependent growth defect on non-fermentable carbon. Deletion of both PIC2 and MRS3 led to a more severe respiratory growth defect than either individual mutant. In addition, MRS3 expressed from a high copy number vector was able to suppress the oxygen consumption and copper uptake defects of a strain lacking PIC2. When expressed in Lactococcus lactis, Mrs3 mediated copper and iron import. Finally, a PIC2 and MRS3 double mutant prevented the copper-dependent activation of a heterologously expressed copper sensor in the mitochondrial intermembrane space. Taken together, these data support a role for the iron transporter Mrs3 in copper import into the mitochondrial matrix. PMID:26763345

Role of Arginine decarboxylase (ADC) in Arabidopsis thaliana defence against the pathogenic bacterium Pseudomonas viridiflava.

PubMed

Rossi, F R; Marina, M; Pieckenstain, F L

2015-07-01

Polyamine biosynthesis starts with putrescine production through the decarboxylation of arginine or ornithine. In Arabidopsis thaliana, putrescine is synthesised exclusively by arginine decarboxylase (ADC), which exists as two isoforms (ADC1 and 2) that are differentially regulated by abiotic stimuli, but their role in defence against pathogens has not been studied in depth. This work analysed the participation of ADC in Arabidopsis defence against Pseudomonas viridiflava. ADC activity and expression, polyamine levels and bacterial resistance were analysed in null mutants of each ADC isoform. In non-infected wild-type (WT) plants, ADC2 expression was much higher than ADC1. Analysis of adc mutants demonstrated that ADC2 contributes to a much higher extent than ADC1 to basal ADC activity and putrescine biosynthesis. In addition, adc2 mutants showed increased basal expression of salicylic acid- and jasmonic acid-dependent PR genes. Bacterial infection induced putrescine accumulation and ADC1 expression in WT plants, but pathogen-induced putrescine accumulation was blocked in adc1 mutants. Results suggest a specific participation of ADC1 in defence, although basal resistance was not decreased by dysfunction of either of the two ADC genes. In addition, and as opposed to WT plants, bacterial infection increased ADC2 expression and ADC activity in adc1 mutants, which could counterbalance the lack of ADC1. Results demonstrate a major contribution of ADC2 to total ADC activity and the specific induction of ADC1 in response to infection. A certain degree of functional redundancy between the two isoforms in relation to their contribution to basal resistance is also evident. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

Zn2+ Uptake in Streptococcus pyogenes: Characterization of adcA and lmb Null Mutants.

PubMed

Tedde, Vittorio; Rosini, Roberto; Galeotti, Cesira L

2016-01-01

An effective regulation of metal ion homeostasis is essential for the growth of microorganisms in any environment and in pathogenic bacteria is strongly associated with their ability to invade and colonise their hosts. To gain a better insight into zinc acquisition in Group A Streptococcus (GAS) we characterized null deletion mutants of the adcA and lmb genes of Streptococcus pyogenes strain MGAS5005 encoding the orthologues of AdcA and AdcAII, the two surface lipoproteins with partly redundant roles in zinc homeostasis in Streptococcus pneumoniae. Null adcA and lmb mutants were analysed for their capability to grow in zinc-depleted conditions and were found to be more susceptible to zinc starvation, a phenotype that could be rescued by the addition of Zn2+ ions to the growth medium. Expression of AdcA, Lmb and HtpA, the polyhistidine triad protein encoded by the gene adjacent to lmb, during growth under conditions of limited zinc availability was examined by Western blot analysis in wild type and null mutant strains. In the wild type strain, AdcA was always present with little variation in expression levels between conditions of excess or limited zinc availability. In contrast, Lmb and HtpA were expressed at detectable levels only during growth in the presence of low zinc concentrations or in the null adcA mutant, when expression of lmb is required to compensate for the lack of adcA expression. In the latter case, Lmb and HtpA were overexpressed by several fold, thus indicating that also in GAS AdcA is a zinc-specific importer and, although it shares this function with Lmb, the two substrate-binding proteins do not show fully overlapping roles in zinc homeostasis.

[A case of familial Marfan syndrome without manifested ocular anomalies].

PubMed

Kavtaradze, N P; Natriashvili, G D; Kapanadze, N B

1989-01-01

Three sibs aged 14, 13 and 10 years are described. The Marfan's syndrome was inherited from their father. Full penetration and pseudovariable expressivity of the mutant gene were characteristic of the case. With pronounced phenotypic manifestations of the mutation inherited, the lack of typical ocular anomalies was evident.

Revealing impaired pathways in the an11 mutant by high-throughput characterization of Petunia axillaris and Petunia inflata transcriptomes.

PubMed

Zenoni, Sara; D'Agostino, Nunzio; Tornielli, Giovanni B; Quattrocchio, Francesca; Chiusano, Maria L; Koes, Ronald; Zethof, Jan; Guzzo, Flavia; Delledonne, Massimo; Frusciante, Luigi; Gerats, Tom; Pezzotti, Mario

2011-10-01

Petunia is an excellent model system, especially for genetic, physiological and molecular studies. Thus far, however, genome-wide expression analysis has been applied rarely because of the lack of sequence information. We applied next-generation sequencing to generate, through de novo read assembly, a large catalogue of transcripts for Petunia axillaris and Petunia inflata. On the basis of both transcriptomes, comprehensive microarray chips for gene expression analysis were established and used for the analysis of global- and organ-specific gene expression in Petunia axillaris and Petunia inflata and to explore the molecular basis of the seed coat defects in a Petunia hybrida mutant, anthocyanin 11 (an11), lacking a WD40-repeat (WDR) transcription regulator. Among the transcripts differentially expressed in an11 seeds compared with wild type, many expected targets of AN11 were found but also several interesting new candidates that might play a role in morphogenesis of the seed coat. Our results validate the combination of next-generation sequencing with microarray analyses strategies to identify the transcriptome of two petunia species without previous knowledge of their genome, and to develop comprehensive chips as useful tools for the analysis of gene expression in P. axillaris, P. inflata and P. hybrida. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

Host range and cell cycle activation properties of polyomavirus large T-antigen mutants defective in pRB binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freund, R.; Bauer, P.H.; Benjamin, T.L.

1994-11-01

The authors have examined the growth properties of polyomavirus large T-antigen mutants that ar unable to bind pRB, the product of the retinoblastoma tumor suppressor gene. These mutants grow poorly on primary mouse cells yet grow well on NIH 3T3 and other established mouse cell lines. Preinfection of primary baby mouse kidney (BMK) epithelial cells with wild-type simian virus 40 renders these cells permissive to growth of pRB-binding polyomavirus mutants. Conversely, NIH 3T3 cells transfected by and expressing wild-type human pRB become nonpermissive. Primary fibroblasts for mouse embryos that carry a homozygous knockout of the RB gene are permissive, whilemore » those from normal littermates are nonpermissive. The host range of polyomavirus pRB-binding mutants is thus determined by expression or lack of expression of functional pRB by the host. These results demonstrate the importance of pRB binding by large T antigen for productive viral infection in primary cells. Failure of pRB-binding mutants to grow well in BMK cells correlates with their failure to induce progression from G{sub 0} or G{sub 1} through the S phase of the cell cycle. Time course studies show delayed synthesis and lower levels of accumulation of large T antigen, viral DNA, and VP1 in mutant compared with wild-type virus-infected BMK cells. These results support a model in which productive infection by polyomavirus in normal mouse cells is tightly coupled to the induction and progression of the cell cycle. 48 refs., 6 figs., 5 tabs.« less

The same enhancer regulates the earliest Emx2 expression in caudal forebrain primordium, subsequent expression in dorsal telencephalon and later expression in the cortical ventricular zone.

PubMed

Suda, Yoko; Kokura, Kenji; Kimura, Jun; Kajikawa, Eriko; Inoue, Fumitaka; Aizawa, Shinichi

2010-09-01

We have analyzed Emx2 enhancers to determine how Emx2 functions during forebrain development are regulated. The FB (forebrain) enhancer we identified immediately 3' downstream of the last coding exon is well conserved among tetrapods and unexpectedly directed all the Emx2 expression in forebrain: caudal forebrain primordium at E8.5, dorsal telencephalon at E9.5-E10.5 and the cortical ventricular zone after E12.5. Otx, Tcf, Smad and two unknown transcription factor binding sites were essential to all these activities. The mutant that lacked this enhancer demonstrated that Emx2 expression under the enhancer is solely responsible for diencephalon development. However, in telencephalon, the FB enhancer did not have activities in cortical hem or Cajal-Retzius cells, nor was its activity in the cortex graded. Emx2 expression was greatly reduced, but persisted in the telencephalon of the enhancer mutant, indicating that there exists another enhancer for Emx2 expression unique to mammalian telencephalon.

Expression of recombinant CD59 with an N-terminal peptide epitope facilitates analysis of residues contributing to its complement-inhibitory function.

PubMed

Zhou, Q; Zhao, J; Hüsler, T; Sims, P J

1996-10-01

CD59 is a plasma membrane-anchored glycoprotein that serves to protect human cells from lysis by the C5b-9 complex of complement. The immunodominant epitopes of CD59 are known to be sensitive to disruption of native tertiary structure, complicating immunological measurement of expressed mutant constructs for structure function analysis. In order to quantify cell-surface expression of wild-type and mutant forms of this complement inhibitor, independent of CD59 antigen, an 11-residue peptide (TAG) recognized by monoclonal antibody (mAb) 9E10 was inserted before the N-terminal codon (L1) of mature CD59, in a pcDNA3 expression plasmid. SV-T2 cells were transfected with this plasmid, yielding cell lines expressing 0 to > 10(5) CD59/cell. The TAG-CD59 fusion protein was confirmed to be GPI-anchored, N-glycosylated and showed identical complement-inhibitory function to wild-type CD59, lacking the TAG peptide sequence. Using this construct, the contribution of each of four surface-localized aromatic residues (4Y, 47F, 61Y, and 62Y) to CD59's complement-inhibitory function was examined. These assays revealed normal surface expression with complete loss of complement-inhibitory function in the 4Y --> S, 47F --> G and 61Y --> S mutants. By contrast, 62Y --> S mutants retained approximately 40% of function of wild-type CD59. These studies confirmed the utility of the TAG-CD59 construct for quantifying CD59 surface expression and activity, and implicate surface aromatic residues 4Y, 47F, 61Y and 62Y as essential to maintenance of CD59's normal complement-regulatory function.

Coordinate regulation of the Suf and Isc Fe-S cluster biogenesis pathways by IscR is essential for viability of Escherichia coli.

PubMed

Mettert, Erin L; Kiley, Patricia J

2014-12-01

Fe-S cluster biogenesis is essential for the viability of most organisms. In Escherichia coli, this process requires either the housekeeping Isc or the stress-induced Suf pathway. The global regulator IscR coordinates cluster synthesis by repressing transcription of the isc operon by [2Fe-2S]-IscR and activating expression of the suf operon. We show that either [2Fe-2S]-IscR or apo-IscR can activate suf, making expression sensitive to mainly IscR levels and not the cluster state, unlike isc expression. We also demonstrate that in the absence of isc, IscR-dependent suf activation is essential since strains lacking both the Isc pathway and IscR were not viable unless Suf was expressed ectopically. Similarly, removal of the IscR binding site in the sufA promoter also led to a requirement for isc. Furthermore, suf expression was increased in a Δisc mutant, presumably due to increased IscR levels in this mutant. This was surprising because the iron-dependent repressor Fur, whose higher-affinity binding at the sufA promoter should occlude IscR binding, showed only partial repression. In addition, Fur derepression was not sufficient for viability in the absence of IscR and the Isc pathway, highlighting the importance of direct IscR activation. Finally, a mutant lacking Fur and the Isc pathway increased suf expression to the highest observed levels and nearly restored [2Fe-2S]-IscR activity, providing a mechanism for regulating IscR activity under stress conditions. Together, these findings have enhanced our understanding of the homeostatic mechanism by which cells use one regulator, IscR, to differentially control Fe-S cluster biogenesis pathways to ensure viability. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

The ZIP family zinc transporters support the virulence of Cryptococcus neoformans

PubMed Central

Do, Eunsoo; Hu, Guanggan; Caza, Mélissa; Kronstad, James W.; Jung, Won Hee

2016-01-01

Zinc is an essential element in living organisms and a cofactor for various metalloproteins. To disseminate and survive, a pathogenic microbe must obtain zinc from the host, which is an environment with extremely limited zinc availability. In this study, we investigated the roles of the ZIP family zinc transporters Zip1 and Zip2 in the human pathogenic fungus Cryptococcus neoformans. Zip1 and Zip2 are homologous to Zrt1 and Zrt2 of the model fungus, Saccharomyces cerevisiae, respectively. We found that the expression of ZIP1 was regulated by the zinc concentration in the environment. Furthermore, the mutant lacking ZIP1 displayed a severe growth defect under zinc-limited conditions, while the mutant lacking ZIP2 displayed normal growth. Inductively coupled plasma–atomic emission spectroscopy analysis showed that the absence of Zip1 expression significantly reduced total cellular zinc levels relative to that in the wild type, while overexpression of Zip1 was associated with increased cellular zinc levels. These findings suggested that Zip1 plays roles in zinc uptake in C. neoformans. We also constructed a Zip1-FLAG fusion protein and found, by immunofluorescence, not only that the protein was localized to the periphery implying it is a membrane transporter, but also that the protein was N-glycosylated. Furthermore, the mutant lacking ZIP1 showed attenuated virulence in a murine inhalation model of cryptococcosis and reduced survival within murine macrophages. Overall, our data suggest that Zip1 plays essential roles in zinc transport and the virulence of C. neoformans. PMID:27118799

Development and Function of the Mouse Vestibular System in the Absence of Gravity Perception

NASA Technical Reports Server (NTRS)

Wolgemuth, Debra J.

2005-01-01

The hypothesis that was tested in this research was that the absence of gravity perception, such as would occur in space, would affect the development and function of the vestibular and central nervous systems. Further, we postulated that these effects would be more significant at specific stages of post-natal development of the animal. We also proposed the use of molecular genetic approaches that would provide important information as to the hierarchy of gene function during the development and subsequent function of the vestibular system. The tilted (tlt) mutant mouse has been characterized as lacking the ability to provide sensory input to the gravity receptors. The tlt/tlt mutant mice were a particularly attractive model for the study of vestibular function since the primary defect was limited to the receptor part of the vestibular system, and there were no detectable abnormal phenotypes in other organ systems. The goal of the proposed studies was to assess immediate and delayed effects of the lack of gravity perception on the vestibular system. Particular attention was paid to characterizing primarily affected periods of vestibular morphogenesis, and to identifying downstream genetic pathways that are altered in the CNS of the tlt/tlt mutant mouse. The specific aims were: (1) to characterize the postnatal morphogenesis of the CNS in the tlt mutant mouse, using detailed morphometric analysis of isolated vestibular ganglia and brain tissue at different stages of postnatal development and assessment of apoptotic cell death; (2) to examine the expression of selected genes implicated by mutational analysis to be important in vestibular development or function by in situ hybridization or immunohistochemistry in the mutant mice; and (3) to identify other genes involved in vestibular development and function, using differential cloning strategies to isolate genes whose expression is changed in the mutant versus normal vestibular system.

Growth factor independence-1 (Gfi-1) plays a role in mediating specific granule deficiency (SGD) in a patient lacking a gene-inactivating mutation in the C/EBPϵ gene

PubMed Central

Khanna-Gupta, Arati; Sun, Hong; Zibello, Theresa; Lee, Han Myung; Dahl, Richard; Boxer, Laurence A.

2007-01-01

Neutrophil-specific granule deficiency (SGD) is a rare congenital disorder marked by recurrent bacterial infections. Neutrophils from SGD patients lack secondary and tertiary granules and their content proteins and lack normal neutrophil functions. Gene-inactivating mutations in the C/EBPϵ gene have been identified in 2 SGD patients. Our studies on a third SGD patient revealed a heterozygous mutation in the C/EBPϵ gene. However, we demonstrate elevated levels of C/EBPϵ and PU.1 proteins in the patient's peripheral blood neutrophils. The expression of the transcription factor growth factor independence-1 (Gfi-1), however, was found to be markedly reduced in our SGD patient despite the absence of an obvious mutation in this gene. This may explain the elevated levels of both C/EBPϵ and PU.1, which are targets of Gfi-1 transcriptional repression. We have generated a growth factor–dependent EML cell line from the bone marrow of Gfi-1+/− and Gfi-1+/+ mice as a model for Gfi-1–deficient SGD, and demonstrate that lower levels of Gfi-1 expression in the Gfi-1+/− EML cells is associated with reduced levels of secondary granule protein (SGP) gene expression. Furthermore, we demonstrate a positive role for Gfi-1 in SGP expression, in that Gfi-1 binds to and up-regulates the promoter of neutrophil collagenase (an SGP gene), in cooperation with wild-type but not with mutant C/EBPϵ. We hypothesize that decreased Gfi-1 levels in our SGD patient, together with the mutant C/EBPϵ, block SGP expression, thereby contributing to the underlying etiology of the disease in our patient. PMID:17244686

Down regulation of miR-124 in both Werner syndrome DNA helicase mutant mice and mutant Caenorhabditis elegans wrn-1 reveals the importance of this microRNA in accelerated aging

PubMed Central

Dallaire, Alexandra; Garand, Chantal; Paquet, Eric R.; Mitchell, Sarah J.; de Cabo, Rafael; Simard, Martin J.

2012-01-01

Small non-coding microRNAs are believed to be involved in the mechanism of aging but nothing is known on the impact of microRNAs in the progeroid disorder Werner syndrome (WS). WS is a premature aging disorder caused by mutations in a RecQ-like DNA helicase. Mice lacking the helicase domain of the WRN ortholog exhibit many phenotypic features of WS, including a pro-oxidant status and a shorter mean life span. Caenorhabditis elegans (C. elegans) with a nonfunctional wrn-1 DNA helicase also exhibit a shorter life span. Thus, both models are relevant to study the expression of microRNAs involved in WS. In this study, we show that miR-124 expression is lost in the liver of Wrn helicase mutant mice. Interestingly, the expression of this conserved miR-124 in whole wrn-1 mutant worms is also significantly reduced. The loss of mir-124 in C. elegans increases reactive oxygen species formation and accumulation of the aging marker lipofuscin, reduces whole body ATP levels and results in a reduction in life span. Finally, supplementation of vitamin C normalizes the median life span of wrn-1 and mir-124 mutant worms. These results suggest that biological pathways involving WRN and miR-124 are conserved in the aging process across different species. PMID:23075628

Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit

PubMed Central

Yang, Ying; Yang, Feng; Li, Yan-Hong; Liu, He-Ping; Chen, Xiao-Yan

2017-01-01

Aspergillus niger, a saprophytic fungus, is widely distributed in soil, air and cereals, and can cause postharvest diseases in fruit. Polygalacturonase (PG) is one of the main enzymes in fungal pathogens to degrade plant cell wall. To evaluate whether the deletion of an exo-polygalacturonase gene pgxB would influence fungal pathogenicity to fruit, pgxB gene was deleted in Aspergillus niger MA 70.15 (wild type) via homologous recombination. The ΔpgxB mutant showed similar growth behavior compared with the wild type. Pectin medium induced significant higher expression of all pectinase genes in both wild type and ΔpgxB in comparison to potato dextrose agar medium. However, the ΔpgxB mutant was less virulent on apple fruits as the necrosis diameter caused by ΔpgxB mutant was significantly smaller than that of wild type. Results of quantitive-PCR showed that, in the process of infection in apple fruit, gene expressions of polygalacturonase genes pgaI, pgaII, pgaA, pgaC, pgaD and pgaE were enhanced in ΔpgxB mutant in comparison to wild type. These results prove that, despite the increased gene expression of other polygalacturonase genes in ΔpgxB mutant, the lack of pgxB gene significantly reduced the virulence of A. niger on apple fruit, suggesting that pgxB plays an important role in the infection process on the apple fruit. PMID:28257463

Cloning and characterization of ftsZ and pyrF from the archaeon Thermoplasma acidophilum

NASA Technical Reports Server (NTRS)

Yaoi, T.; Laksanalamai, P.; Jiemjit, A.; Kagawa, H. K.; Alton, T.; Trent, J. D.

2000-01-01

To characterize cytoskeletal components of archaea, the ftsZ gene from Thermoplasma acidophilum was cloned and sequenced. In T. acidophilum ftsZ, which is involved in cell division, was found to be in an operon with the pyrF gene, which encodes orotidine-5'-monophosphate decarboxylase (ODC), an essential enzyme in pyrimidine biosynthesis. Both ftsZ and pyrF from T. acidophilum were expressed in Escherichia coli and formed functional proteins. FtsZ expression in wild-type E. coli resulted in the filamentous phenotype characteristic of ftsZ mutants. T. acidophilum pyrF expression in an E. coli mutant lacking pyrF complemented the mutation and rescued the strain. Sequence alignments of ODCs from archaea, bacteria, and eukarya reveal five conserved regions, two of which have homology to 3-hexulose-6-phosphate synthase (HPS), suggesting a common substrate recognition and binding motif. Copyright 2000 Academic Press.

Capsicum annuum S (CaS) promotes reproductive transition and is required for flower formation in pepper (Capsicum annuum).

PubMed

Cohen, Oded; Borovsky, Yelena; David-Schwartz, Rakefet; Paran, Ilan

2014-05-01

The genetic control of the transition to flowering has mainly been studied in model species, while few data are available in crop species such as pepper (Capsicum spp.). To elucidate the genetic control of the transition to flowering in pepper, mutants that lack flowers were isolated and characterized. Genetic mapping and sequencing allowed the identification of the gene disrupted in the mutants. Double mutants and expression analyses were used to characterize the relationships between the mutated gene and other genes controlling the transition to flowering and flower differentiation. The mutants were characterized by a delay in the initiation of sympodial growth, a delay in the termination of sympodial meristems and complete inhibition of flower formation. Capsicum annuum S (CaS), the pepper (Capsicum annuum) ortholog of tomato (Solanum lycopersicum) COMPOUND INFLORESCENCE and petunia (Petunia hybrida) EVERGREEN, was found to govern the mutant phenotype. CaS is required for the activity of the flower meristem identity gene Ca-ANANTHA and does not affect the expression of CaLEAFY. CaS is epistatic over other genes controlling the transition to flowering with respect to flower formation. Comparative homologous mutants in the Solanaceae indicate that CaS has uniquely evolved to have a critical role in flower formation, while its role in meristem maturation is conserved in pepper, tomato and petunia. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Use of bioluminescence mutant screening for identification of Edwardsiella ictaluri genes involved in channel catfish (Ictalurus punctatus) skin colonization.

PubMed

Menanteau-Ledouble, Simon; Lawrence, Mark L

2013-03-23

Initial invasion of the host is the first and vital part of any infection process. We have demonstrated that Edwardsiella ictaluri is capable of colonizing and penetrating catfish skin. Therefore, a mutant library was constructed by random insertion of the Mar2xT7 transposon into the chromosome of E. ictaluri harboring the bioluminescence plasmid pAKgfplux1. This library was then screened through a series of three consecutive challenges for mutants showing a decreased ability to colonize the catfish epithelium. Eighteen mutants were identified that have decreased adhesion and virulence. Mutated genes encoded one sensor protein, two transport proteins, five enzymes, two regulatory proteins, and five hypothetical proteins. Among the mutated genes, the first one identified was a gene encoding for RstA/B, which is known to play a role in regulating the expression of invasion genes in Salmonella enterica Typhimurium. Another mutant was lacking a putative ribonuclease similar to a Shigella protein that regulates the expression of adhesin. A third mutant was defective in a protein similar to a Brucella protein that was initially identified as a transporter, but actually is a member of a newly discovered adhesin family. Results from this study could enable development of a new strategy for blocking E. ictaluri invasion at the initial adherence stage. Copyright © 2012 Elsevier B.V. All rights reserved.

The alternative sigma factor, sigmaS, affects polyhydroxyalkanoate metabolism in Pseudomonas putida.

PubMed

Raiger-Iustman, Laura J; Ruiz, Jimena A

2008-07-01

To determine whether the stationary sigma factor, sigma(S), influences polyhydroxyalkanoate metabolism in Pseudomonas putida KT2440, an rpoS-negative mutant was constructed to evaluate polyhydroxyalkanoate accumulation and expression of a translational fusion to the promoter region of the genes that code for polyhydroxyalkanoate synthase 1 (phaC1) and polyhydroxyalkanoate depolymerase (phaZ). By comparison with the wild-type, the rpoS mutant showed a higher polyhydroxyalkanoate degradation rate and increased expression of the translational fusion during the stationary growth phase. These results suggest that sigma(S) might control the genes involved in polyhydroxyalkanoate metabolism, possibly in an indirect manner. In addition, survival and oxidative stress assays performed under polyhydroxyalkanoate- and nonpolyhydroxyalkanoate- accumulating conditions demonstrated that the accumulated polyhydroxyalkanoate increased the survival and stress tolerance of the rpoS mutant. According to this, polyhydroxyalkanoate accumulation would help cells to overcome the adverse conditions encountered during the stationary phase in the strain that lacks RpoS.

Late-onset of spinal neurodegeneration in knock-in mice expressing a mutant BiP.

PubMed

Jin, Hisayo; Mimura, Naoya; Kashio, Makiko; Koseki, Haruhiko; Aoe, Tomohiko

2014-01-01

Most human neurodegenerative diseases are sporadic, and appear later in life. While the underlying mechanisms of the progression of those diseases are still unclear, investigations into the familial forms of comparable diseases suggest that endoplasmic reticulum (ER) stress is involved in the pathogenesis. Binding immunoglobulin protein (BiP) is an ER chaperone that is central to ER function. We produced knock-in mice expressing a mutant BiP that lacked the retrieval sequence in order to evaluate the effect of a functional defect in an ER chaperone in multi-cellular organisms. Here we report that heterozygous mutant BiP mice revealed motor disabilities in aging. We found a degeneration of some motoneurons in the spinal cord accompanied by accumulations of ubiquitinated proteins. The defect in retrieval of BiP by the KDEL receptor leads to impaired activities in quality control and autophagy, suggesting that functional defects in the ER chaperones may contribute to the late onset of neurodegenerative diseases.

Transcription Analysis of the Beta-Glucosidase Precursor in Wild-Type and l-4i Mutant Bombyx mori (Lepidoptera: Bombycidae).

PubMed

Kang, Lequn; Huang, Fei; Wu, Fan; Zhao, Qiaoling

2015-01-01

Lethal fourth-instar larvae (l-4i) mutant of Bombyx mori, a recently discovered novel mutant, die from energy depletion due to genetic mutation. Beta-glucosidase is a common digestive enzyme that hydrolyzes cellulose in the diet to provide energy. In this study, the mRNA expression profiles of B. mori beta-glucosidase precursor (BmpreBG) were characterized by reverse transcription polymerase chain reaction and quantitative real-time polymerase chain reaction. The transcription level of BmpreBG varied in different tissues and developmental stages, except in the pupa and moth, which are the no-diet period. Remarkably, the mRNA expression level of BmpreBG was sharply reduced in l-4i but not in the wild type, which suggested that the digestive function of the mutant was severely damaged. This was consistent with the l-4i phenotypic traits of not eating mulberries, lack of energy, and ultimate death. 5'-rapid amplification of cDNA ends showed, for the first time, that BmpreBG has a 160-bp 5'-untranslated region. These findings suggested that B. mori β-glucosidase precursor was involved in the death process of l-4i mutant larvae. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

Differential requirement for irf8 in formation of embryonic and adult macrophages in zebrafish

DOE PAGES

Shiau, Celia E.; Kaufman, Zoe; Meireles, Ana M.; ...

2015-01-23

Interferon regulatory factor 8 (Irf8) is critical for mammalian macrophage development and innate immunity, but its role in teleost myelopoiesis remains incompletely understood. Specifically, genetic tools to analyze the role of irf8 in zebrafish macrophage development at larval and adult stages are lacking. In this study, we generated irf8 null mutants in zebrafish using TALEN-mediated targeting. Our analysis defines different requirements for irf8 at different stages. irf8 is required for formation of all macrophages during primitive and transient definitive hematopoiesis, but not during adult-phase definitive hematopoiesis starting at 5-6 days postfertilization. At early stages, irf8 mutants have excess neutrophils andmore » excess cell death in pu.1-expressing myeloid cells. Macrophage fates were recovered in irf8 mutants after wildtype irf8 expression in neutrophil and macrophage lineages, suggesting that irf8 regulates macrophage specification and survival. In juvenile irf8 mutant fish, mature macrophages are present, but at numbers significantly reduced compared to wildtype, indicating an ongoing requirement for irf8 after embryogenesis. As development progresses, tissue macrophages become apparent in zebrafish irf8 mutants, with the possible exception of microglia. Our study defines distinct requirement for irf8 in myelopoiesis before and after transition to the adult hematopoietic system.« less

Structural basis of the lack of endo-glucanase inhibitory activity of Lupinus albus γ-conglutin.

PubMed

Scarafoni, Alessio; Consonni, Alessandro; Pessina, Stefano; Balzaretti, Silvia; Capraro, Jessica; Galanti, Elisabetta; Duranti, Marcello

2016-02-01

Lupin γ-conglutin and soybean BG7S are two legume seed proteins strongly similar to plant endo-β-glucanases inhibitors acting against fungal GH11 and GH12 glycoside hydrolase. However these proteins lack inhibitory activity. Here we describe the conversion of lupin γ-conglutin to an active inhibitor of endo-β-glucanases belonging to GH11 family. A set of γ-conglutin mutants was designed and expressed in Pichia pastoris, along with the wild-type protein. Unexpectedly, this latter was able to inhibit a GH11 enzyme, but not GH12, whereas the mutants were able to modulate the inhibition capacity. In lupin, γ-conglutin is naturally cleaved in two subunits, whereas in P. pastoris it is not. The lack of proteolytic cleavage is one of the reasons at the basis of the inhibitory activity of recombinant γ-conglutin. The results provide new insights about structural features at the basis of the lack of inhibitory activity of wild-type γ-conglutin and its legume homologues. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

C-Terminal Truncation of α-COP Affects Functioning of Secretory Organelles and Calcium Homeostasis in Hansenula polymorpha

PubMed Central

Chechenova, Maria B.; Romanova, Nina V.; Deev, Alexander V.; Packeiser, Anna N.; Smirnov, Vladimir N.; Agaphonov, Michael O.; Ter-Avanesyan, Michael D.

2004-01-01

In eukaryotic cells, COPI vesicles retrieve resident proteins to the endoplasmic reticulum and mediate intra-Golgi transport. Here, we studied the Hansenula polymorpha homologue of the Saccharomyces cerevisiae RET1 gene, encoding α-COP, a subunit of the COPI protein complex. H. polymorpha ret1 mutants, which expressed truncated α-COP lacking more than 300 C-terminal amino acids, manifested an enhanced ability to secrete human urokinase-type plasminogen activator (uPA) and an inability to grow with a shortage of Ca2+ ions, whereas a lack of α-COP expression was lethal. The α-COP defect also caused alteration of intracellular transport of the glycosylphosphatidylinositol-anchored protein Gas1p, secretion of abnormal uPA forms, and reductions in the levels of Pmr1p, a Golgi Ca2+-ATPase. Overexpression of Pmr1p suppressed some ret1 mutant phenotypes, namely, Ca2+ dependence and enhanced uPA secretion. The role of COPI-dependent vesicular transport in cellular Ca2+ homeostasis is discussed. PMID:14871936

Genomic position affects the expression of tobacco mosaic virus movement and coat protein genes.

PubMed Central

Culver, J N; Lehto, K; Close, S M; Hilf, M E; Dawson, W O

1993-01-01

Alterations in the genomic position of the tobacco mosaic virus (TMV) genes encoding the 30-kDa cell-to-cell movement protein or the coat protein greatly affected their expression. Higher production of 30-kDa protein was correlated with increased proximity of the gene to the viral 3' terminus. A mutant placing the 30-kDa open reading frame 207 nucleotides nearer the 3' terminus produced at least 4 times the wild-type TMV 30-kDa protein level, while a mutant placing the 30-kDa open reading frame 470 nucleotides closer to the 3' terminus produced at least 8 times the wild-type TMV 30-kDa protein level. Increases in 30-kDa protein production were not correlated with the subgenomic mRNA promoter (SGP) controlling the 30-kDa gene, since mutants with either the native 30-kDa SGP or the coat protein SGP in front of the 30-kDa gene produced similar levels of 30-kDa protein. Lack of coat protein did not affect 30-kDa protein expression, since a mutant with the coat protein start codon removed did not produce increased amounts of 30-kDa protein. Effects of gene positioning on coat protein expression were examined by using a mutant containing two different tandemly positioned tobamovirus (TMV and Odontoglossum ringspot virus) coat protein genes. Only coat protein expressed from the gene positioned nearest the 3' viral terminus was detected. Analysis of 30-kDa and coat protein subgenomic mRNAs revealed no proportional increase in the levels of mRNA relative to the observed levels of 30-kDa and coat proteins. This suggests that a translational mechanism is primarily responsible for the observed effect of genomic position on expression of 30-kDa movement and coat protein genes. Images Fig. 2 Fig. 3 Fig. 4 PMID:8446627

The Yeast Saccharomyces cerevisiae Contains Two Glutaredoxin Genes That Are Required for Protection against Reactive Oxygen Species

PubMed Central

Luikenhuis, Sandra; Perrone, Gabriel; Dawes, Ian W.; Grant, Chris M.

1998-01-01

Glutaredoxins are small heat-stable proteins that act as glutathione-dependent disulfide oxidoreductases. Two genes, designated GRX1 and GRX2, which share 40–52% identity and 61–76% similarity with glutaredoxins from bacterial and mammalian species, were identified in the yeast Saccharomyces cerevisiae. Strains deleted for both GRX1 and GRX2 were viable but lacked heat-stable oxidoreductase activity using β-hydroxyethylene disulfide as a substrate. Surprisingly, despite the high degree of homology between Grx1 and Grx2 (64% identity), the grx1 mutant was unaffected in oxidoreductase activity, whereas the grx2 mutant displayed only 20% of the wild-type activity, indicating that Grx2 accounted for the majority of this activity in vivo. Expression analysis indicated that this difference in activity did not arise as a result of differential expression of GRX1 and GRX2. In addition, a grx1 mutant was sensitive to oxidative stress induced by the superoxide anion, whereas a strain that lacked GRX2 was sensitive to hydrogen peroxide. Sensitivity to oxidative stress was not attributable to altered glutathione metabolism or cellular redox state, which did not vary between these strains. The expression of both genes was similarly elevated under various stress conditions, including oxidative, osmotic, heat, and stationary phase growth. Thus, Grx1 and Grx2 function differently in the cell, and we suggest that glutaredoxins may act as one of the primary defenses against mixed disulfides formed following oxidative damage to proteins. PMID:9571241

Dopamine induces soluble α-synuclein oligomers and nigrostriatal degeneration

PubMed Central

Mor, Danielle E.; Tsika, Elpida; Mazzulli, Joseph R.; Gould, Neal S.; Kim, Hanna; Daniels, Malcolm J.; Doshi, Shachee; Gupta, Preetika; Grossman, Jennifer L.; Tan, Victor X.; Kalb, Robert G.; Caldwell, Kim A.; Caldwell, Guy A.; Wolfe, John H.; Ischiropoulos, Harry

2018-01-01

Parkinson’s disease is defined by the loss of dopaminergic neurons in the substantia nigra and formation of Lewy body inclusions containing aggregated α-synuclein. Efforts to explain dopamine neuron vulnerability are hindered by the lack of dopaminergic cell death in α-synuclein transgenic mice. To address this, we manipulated dopamine levels in addition to α-synuclein expression. Nigra-targeted expression of mutant tyrosine hydroxylase with enhanced catalytic activity increased dopamine without damaging neurons in non-transgenic mice. In contrast, raising dopamine in mice expressing human A53T mutant α-synuclein induced progressive nigrostriatal degeneration and reduced locomotion. Dopamine elevation in A53T mice increased levels of potentially toxic α-synuclein oligomers, resulting in conformationally and functionally modified species. Moreover, in genetically tractable C. elegans models expression of α-synuclein mutated at the site of interaction with dopamine prevented dopamine-induced toxicity. The data suggest a unique mechanism linking two cardinal features of Parkinson’s disease, dopaminergic cell death and α-synuclein aggregation. PMID:28920936

Dopamine induces soluble α-synuclein oligomers and nigrostriatal degeneration.

PubMed

Mor, Danielle E; Tsika, Elpida; Mazzulli, Joseph R; Gould, Neal S; Kim, Hanna; Daniels, Malcolm J; Doshi, Shachee; Gupta, Preetika; Grossman, Jennifer L; Tan, Victor X; Kalb, Robert G; Caldwell, Kim A; Caldwell, Guy A; Wolfe, John H; Ischiropoulos, Harry

2017-11-01

Parkinson's disease (PD) is defined by the loss of dopaminergic neurons in the substantia nigra and the formation of Lewy body inclusions containing aggregated α-synuclein. Efforts to explain dopamine neuron vulnerability are hindered by the lack of dopaminergic cell death in α-synuclein transgenic mice. To address this, we manipulated both dopamine levels and α-synuclein expression. Nigrally targeted expression of mutant tyrosine hydroxylase with enhanced catalytic activity increased dopamine levels without damaging neurons in non-transgenic mice. In contrast, raising dopamine levels in mice expressing human A53T mutant α-synuclein induced progressive nigrostriatal degeneration and reduced locomotion. Dopamine elevation in A53T mice increased levels of potentially toxic α-synuclein oligomers, resulting in conformationally and functionally modified species. Moreover, in genetically tractable Caenorhabditis elegans models, expression of α-synuclein mutated at the site of interaction with dopamine prevented dopamine-induced toxicity. These data suggest that a unique mechanism links two cardinal features of PD: dopaminergic cell death and α-synuclein aggregation.

A Lysine at the C-Terminus of an Odorant-Binding Protein is Involved in Binding Aldehyde Pheromone Components in Two Helicoverpa Species

PubMed Central

Sun, Ya-Lan; Huang, Ling-Qiao; Pelosi, Paolo; Wang, Chen-Zhu

2013-01-01

Odorant-binding proteins (OBPs) are soluble proteins, whose role in olfaction of insects is being recognized as more and more important. We have cloned, expressed and purified an OBP (HarmOBP7) from the antennae of the moth Helicoverpa armigera. Western blot experiments indicate specific expression of this protein in the antennae of adults. HarmOBP7 binds both pheromone components Z-11-hexadecenal and Z-9-hexadecenal with good affinity. We have also performed a series of binding experiments with linear aldehydes, alcohols and esters, as well as with other compounds and found a requirement of medium size for best affinity. The affinity of OBP7, as well as that of a mutant lacking the last 6 residues does not substantially decrease in acidic conditions, but increases at basic pH values with no significant differences between wild-type and mutant. Binding to both pheromone components, instead, is negatively affected by the lack of the C-terminus. A second mutant, where one of the three lysine residues in the C-terminus (Lys123) was replaced by methionine showed reduced affinity to both pheromone components, as well as to their analogues, thus indicating that Lys123 is involved in binding these compounds, likely forming hydrogen bonds with the functional groups of the ligands. PMID:23372826

A Herpesvirus Ribosome-Associated, RNA-Binding Protein Confers a Growth Advantage upon Mutants Deficient in a GADD34-Related Function†

PubMed Central

Mulvey, Matthew; Poppers, Jeremy; Ladd, Alison; Mohr, Ian

1999-01-01

The herpes simplex virus type 1 γ34.5 gene product and the cellular GADD34 protein both contain similar domains that can regulate the activity of eukaryotic initiation factor 2 (eIF2), a critical translation initiation factor. Viral mutants that lack the GADD34-related function grow poorly on a variety of malignant human cells, as activation of the cellular PKR kinase leads to the accumulation of inactive, phosphorylated eIF2 at late times postinfection. Termination of translation prior to the completion of the viral reproductive cycle leads to impaired growth. Extragenic suppressors that regain the ability to synthesize proteins efficiently in the absence of the viral GADD34-related function have been isolated. These suppressor alleles are dominant in trans and affect the steady-state accumulation of several viral mRNA species. We demonstrate that deregulated expression of Us11, a virus-encoded RNA-binding, ribosome-associated protein is necessary and sufficient to confer a growth advantage upon viral mutants that lack a GADD34-related function. Ectopic expression of Us11 reduces the accumulation of the activated cellular PKR kinase and allows for sustained protein synthesis. Thus, an RNA-binding, ribosome-associated protein (Us11) and a GADD34-related protein (γ34.5) both function in a signal pathway that regulates translation by modulating eIF2 phosphorylation. PMID:10074192

endodermal-amyloplast less 1 is a novel allele of SHORT-ROOT

NASA Astrophysics Data System (ADS)

Morita, Miyo T.; Saito, Chieko; Nakano, Akihiko; Tasaka, Masao

Plants can sense the direction of gravity and change the growth orientation of their organs. Arabidopsis mutants have been isolated and characterized in order to elucidate the molecular mechanisms of gravitropism. endodermal-amyloplast less 1 ( eal1) is a unique mutant that completely lacks gravitropism in inflorescence stems and exhibits reduced gravitropism in hypocotyls, whereas its roots showed normal gravitropism. Previously, it was suggested that differentiation or development of amyloplasts in shoot statocytes (endodermal cells) is affected by the eal1 mutation. Here, we have identified EAL1 as a SHORT-ROOT ( SHR) allele based on map position. Three nucleotides in the SHR coding region were deleted in the eal1 mutant, resulting in the deletion of just one amino acid. The protein encoded by the novel allele of SHR appears to have retained its function as a transcription factor since the endodermal cell layer was formed both in roots and in shoots of eal1. SCARECROW (SCR) promoter activity monitored by reporter protein expression was significantly decreased in eal1, suggesting that the activity of SHR lacking one amino acid is reduced. In addition, transcription levels of SHOOT GRAVITROPISM 5 (SGR5), which is mainly expressed in the endodermis of inflorescence stems, was markedly decreased. Together with the presence of abnormal endodermal amyloplasts in eal1, these results strongly suggest that the endodermis observed in eal1 is not sufficiently differentiated to execute shoot gravitropism.

The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

PubMed Central

Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

2016-01-01

The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

Overactivation of hedgehog signaling alters development of the ovarian vasculature in mice.

PubMed

Ren, Yi; Cowan, Robert G; Migone, Fernando F; Quirk, Susan M

2012-06-01

The hedgehog (HH) signaling pathway is critical for ovarian function in Drosophila, but its role in the mammalian ovary has not been defined. Previously, expression of a dominant active allele of the HH signal transducer protein smoothened (SMO) in Amhr2(cre/+)SmoM2 mice caused anovulation in association with a lack of smooth muscle in the theca of developing follicles. The current study examined events during the first 2 wk of life in Amhr2(cre/+)SmoM2 mice to gain insight into the cause of anovulation. Expression of transcriptional targets of HH signaling, Gli1, Ptch1, and Hhip, which are used as measures of pathway activity, were elevated during the first several days of life in Amhr2(cre/+)SmoM2 mice compared to controls but were similar to controls in older mice. Microarray analysis showed that genes with increased expression in 2-day-old mutants compared to controls were enriched for the processes of vascular and tube development and steroidogenesis. The density of platelet endothelial cell adhesion molecule (PECAM)-labeled endothelial tubes was increased in the cortex of newborn ovaries of mutant mice. Costaining of preovulatory follicles for PECAM and smooth muscle actin showed that muscle-type vascular support cells are deficient in theca of mutant mice. Expression of genes for steroidogenic enzymes that are normally expressed in the fetal adrenal gland were elevated in newborn ovaries of mutant mice. In summary, overactivation of HH signaling during early life alters gene expression and vascular development and this is associated with the lifelong development of anovulatory follicles in which the thecal vasculature fails to mature appropriately.

Overactivation of Hedgehog Signaling Alters Development of the Ovarian Vasculature in Mice1

PubMed Central

Ren, Yi; Cowan, Robert G.; Migone, Fernando F.; Quirk, Susan M.

2012-01-01

ABSTRACT The hedgehog (HH) signaling pathway is critical for ovarian function in Drosophila, but its role in the mammalian ovary has not been defined. Previously, expression of a dominant active allele of the HH signal transducer protein smoothened (SMO) in Amhr2cre/+SmoM2 mice caused anovulation in association with a lack of smooth muscle in the theca of developing follicles. The current study examined events during the first 2 wk of life in Amhr2cre/+SmoM2 mice to gain insight into the cause of anovulation. Expression of transcriptional targets of HH signaling, Gli1, Ptch1, and Hhip, which are used as measures of pathway activity, were elevated during the first several days of life in Amhr2cre/+SmoM2 mice compared to controls but were similar to controls in older mice. Microarray analysis showed that genes with increased expression in 2-day-old mutants compared to controls were enriched for the processes of vascular and tube development and steroidogenesis. The density of platelet endothelial cell adhesion molecule (PECAM)-labeled endothelial tubes was increased in the cortex of newborn ovaries of mutant mice. Costaining of preovulatory follicles for PECAM and smooth muscle actin showed that muscle-type vascular support cells are deficient in theca of mutant mice. Expression of genes for steroidogenic enzymes that are normally expressed in the fetal adrenal gland were elevated in newborn ovaries of mutant mice. In summary, overactivation of HH signaling during early life alters gene expression and vascular development and this is associated with the lifelong development of anovulatory follicles in which the thecal vasculature fails to mature appropriately. PMID:22402963

A General Method for Selection of α-Acetolactate Decarboxylase-Deficient Lactococcus lactis Mutants To Improve Diacetyl Formation

PubMed Central

Curic, Mirjana; Stuer-Lauridsen, Birgitte; Renault, Pierre; Nilsson, Dan

1999-01-01

The enzyme acetolactate decarboxylase (Ald) plays a key role in the regulation of the α-acetolactate pool in both pyruvate catabolism and the biosynthesis of the branched-chain amino acids, isoleucine, leucine, and valine (ILV). This dual role of Ald, due to allosteric activation by leucine, was used as a strategy for the isolation of Ald-deficient mutants of Lactococcus lactis subsp. lactis biovar diacetylactis. Such mutants can be selected as leucine-resistant mutants in ILV- or IV-prototrophic strains. Most dairy lactococcus strains are auxotrophic for the three amino acids. Therefore, the plasmid pMC004 containing the ilv genes (encoding the enzymes involved in the biosynthesis of IV) of L. lactis NCDO2118 was constructed. Introduction of pMC004 into ILV-auxotrophic dairy strains resulted in an isoleucine-prototrophic phenotype. By plating the strains on a chemically defined medium supplemented with leucine but not valine and isoleucine, spontaneous leucine-resistant mutants were obtained. These mutants were screened by Western blotting with Ald-specific antibodies for the presence of Ald. Selected mutants lacking Ald were subsequently cured of pMC004. Except for a defect in the expression of Ald, the resulting strain, MC010, was identical to the wild-type strain, as shown by Southern blotting and DNA fingerprinting. The mutation resulting in the lack of Ald in MC010 occurred spontaneously, and the strain does not contain foreign DNA; thus, it can be regarded as food grade. Nevertheless, its application in dairy products depends on the regulation of genetically modified organisms. These results establish a strategy to select spontaneous Ald-deficient mutants from transformable L. lactis strains. PMID:10049884

Pseudo-constitutivity of nitrate-responsive genes in nitrate reductase mutants

PubMed Central

Schinko, Thorsten; Gallmetzer, Andreas; Amillis, Sotiris; Strauss, Joseph

2013-01-01

In fungi, transcriptional activation of genes involved in NO3- assimilation requires the presence of an inducer (nitrate or nitrite) and low intracellular concentrations of the pathway products ammonium or glutamine. In Aspergillus nidulans, the two transcription factors NirA and AreA act synergistically to mediate nitrate/nitrite induction and nitrogen metabolite derepression, respectively. In all studied fungi and in plants, mutants lacking nitrate reductase (NR) activity express nitrate-metabolizing enzymes constitutively without the addition of inducer molecules. Based on their work in A. nidulans, Cove and Pateman proposed an “autoregulation control” model for the synthesis of nitrate metabolizing enzymes in which the functional nitrate reductase molecule would act as co-repressor in the absence and as co-inducer in the presence of nitrate. However, NR mutants could simply show “pseudo-constitutivity” due to induction by nitrate which accumulates over time in NR-deficient strains. Here we examined this possibility using strains which lack flavohemoglobins (fhbs), and are thus unable to generate nitrate internally, in combination with nitrate transporter mutations (nrtA, nrtB) and a GFP-labeled NirA protein. Using different combinations of genotypes we demonstrate that nitrate transporters are functional also in NR null mutants and show that the constitutive phenotype of NR mutants is not due to nitrate accumulation from intracellular sources but depends on the activity of nitrate transporters. However, these transporters are not required for nitrate signaling because addition of external nitrate (10 mM) leads to standard induction of nitrate assimilatory genes in the nitrate transporter double mutants. We finally show that NR does not regulate NirA localization and activity, and thus the autoregulation model, in which NR would act as a co-repressor of NirA in the absence of nitrate, is unlikely to be correct. Results from this study instead suggest that transporter-mediated NO3- accumulation in NR deficient mutants, originating from traces of nitrate in the media, is responsible for the constitutive expression of NirA-regulated genes, and the associated phenotype is thus termed “pseudo-constitutive”. PMID:23454548

Reduced expression of the NMDA receptor-interacting protein SynGAP causes behavioral abnormalities that model symptoms of Schizophrenia.

PubMed

Guo, Xiaochuan; Hamilton, Peter J; Reish, Nicholas J; Sweatt, J David; Miller, Courtney A; Rumbaugh, Gavin

2009-06-01

Abnormal function of NMDA receptors is believed to be a contributing factor to the pathophysiology of schizophrenia. NMDAR subunits and postsynaptic-interacting proteins of these channels are abnormally expressed in some patients with this illness. In mice, reduced NMDAR expression leads to behaviors analogous to symptoms of schizophrenia, but reports of animals with mutations in core postsynaptic density proteins having similar a phenotype have yet to be reported. Here we show that reduced expression of the neuronal RasGAP and NMDAR-associated protein, SynGAP, results in abnormal behaviors strikingly similar to that reported in mice with reduced NMDAR function. SynGAP mutant mice exhibited nonhabituating and persistent hyperactivity that was ameliorated by the antipsychotic clozapine. An NMDAR antagonist, MK-801, induced hyperactivity in normal mice but SynGAP mutants were less responsive, suggesting that NMDAR hypofunction contributes to this behavioral abnormality. SynGAP mutants exhibited enhanced startle reactivity and impaired sensory-motor gating. These mice also displayed a complete lack of social memory and a propensity toward social isolation. Finally, SynGAP mutants had deficits in cued fear conditioning and working memory, indicating abnormal function of circuits that control emotion and choice. Our results demonstrate that SynGAP mutant mice have gross neurological deficits similar to other mouse models of schizophrenia. Because SynGAP interacts with NMDARs, and the signaling activity of this protein is regulated by these channels, our data in dicate that SynGAP lies downstream of NMDARs and is a required intermediate for normal neural circuit function and behavior. Taken together, these data support the idea that schizophrenia may arise from abnormal signaling pathways that are mediated by NMDA receptors.

The transcription factor SKN7 regulates conidiation, thermotolerance, apoptotic-like cell death and parasitism in the nematode endoparasitic fungus Hirsutella minnesotensis

PubMed Central

Hussain, Muzammil; Hamid, M. Imran; Wang, Niuniu; Bin, Lin; Xiang, Meichun; Liu, Xingzhong

2016-01-01

The transcription factor SKN7 is a highly conserved protein among fungi and was initially recognized as a response regulator that protects cells from oxidative stress and maintains cell wall integrity in yeast. Orthologs of SKN7 are extensively present in biocontrol agents of plant pathogens, but they had not been functionally characterized. Here, we identified and characterized the transcription factor SKN7 in the nematode endoparasitic fungus Hirsutella minnesotensis. Null mutant lacking HIM-SKN7 (HIM_03620), which was generated by a gene disruption strategy, demonstrated reduced conidiation, increased sensitivity to high temperature, hydrogen peroxide, mannitol and ethanol, and reduced fungal resistance to farnesol. However, over-expression mutant showed increased conidial production, thermotolerance and resistance to farnesol, suggesting that HIM-SKN7 regulates antiapoptotic-like cell death in H. minnesotensis. Moreover, the results showed that in null mutant, H. minnesotensis had decreased endoparasitic ability as compared to wild type and over-expression strain. During the infection process, the relative expression of the HIM-SKN7 gene was significantly induced in the wild type and over-expression strain. The results of the present study advance our understanding of the functions of the SKN7 gene in biocontrol agents, in particular, nematode endoparasitic fungi. PMID:27436205

FGF signaling supports Drosophila fertility by regulating development of ovarian muscle tissues

PubMed Central

Irizarry, Jihyun; Stathopoulos, Angelike

2015-01-01

The thisbe (ths) gene encodes a Drosophila fibroblast growth factor (FGF), and mutant females are viable but sterile suggesting a link between FGF signaling and fertility. Ovaries exhibit abnormal morphology including lack of epithelial sheaths, muscle tissues that surround ovarioles. Here we investigated how FGF influences Drosophila ovary morphogenesis and identified several roles. Heartless (Htl) FGF receptor was found expressed within somatic cells at the larval and pupal stages, and phenotypes were uncovered using RNAi. Differentiation of terminal filament cells was affected, but this effect did not alter ovariole number. In addition, proliferation of epithelial sheath progenitors, the apical cells, was decreased in both htl and ths mutants, while ectopic expression of the Ths ligand led to these cells’ over-proliferation suggesting that FGF signaling supports ovarian muscle sheath formation by controlling apical cell number in the developing gonad. Additionally, live imaging of adult ovaries was used to show that htl RNAi mutants, hypomorphic mutants in which epithelial sheaths are present, exhibit abnormal muscle contractions. Collectively, our results demonstrate that proper formation of ovarian muscle tissues is regulated by FGF signaling in the larval and pupal stages through control of apical cell proliferation and is required to support fertility. PMID:25958090

Plant hormones in arbuscular mycorrhizal symbioses: an emerging role for gibberellins.

PubMed

Foo, Eloise; Ross, John J; Jones, William T; Reid, James B

2013-05-01

Arbuscular mycorrhizal symbioses are important for nutrient acquisition in >80 % of terrestrial plants. Recently there have been major breakthroughs in understanding the signals that regulate colonization by the fungus, but the roles of the known plant hormones are still emerging. Here our understanding of the roles of abscisic acid, ethylene, auxin, strigolactones, salicylic acid and jasmonic acid is discussed, and the roles of gibberellins and brassinosteroids examined. Pea mutants deficient in gibberellins, DELLA proteins and brassinosteroids are used to determine whether fungal colonization is altered by the level of these hormones or signalling compounds. Expression of genes activated during mycorrhizal colonization is also monitored. Arbuscular mycorrhizal colonization of pea roots is substantially increased in gibberellin-deficient na-1 mutants compared with wild-type plants. This is reversed by application of GA3. Mutant la cry-s, which lacks gibberellin signalling DELLA proteins, shows reduced colonization. These changes were parallelled by changes in the expression of genes associated with mycorrhizal colonization. The brassinosteroid-deficient lkb mutant showed no change in colonization. Biologically active gibberellins suppress arbuscule formation in pea roots, and DELLA proteins are essential for this response, indicating that this role occurs within the root cells.

Anaerobic respiration of Escherichia coli in the mouse intestine.

PubMed

Jones, Shari A; Gibson, Terri; Maltby, Rosalie C; Chowdhury, Fatema Z; Stewart, Valley; Cohen, Paul S; Conway, Tyrrell

2011-10-01

The intestine is inhabited by a large microbial community consisting primarily of anaerobes and, to a lesser extent, facultative anaerobes, such as Escherichia coli, which we have shown requires aerobic respiration to compete successfully in the mouse intestine (S. A. Jones et al., Infect. Immun. 75:4891-4899, 2007). If facultative anaerobes efficiently lower oxygen availability in the intestine, then their sustained growth must also depend on anaerobic metabolism. In support of this idea, mutants lacking nitrate reductase or fumarate reductase have extreme colonization defects. Here, we further explore the role of anaerobic respiration in colonization using the streptomycin-treated mouse model. We found that respiratory electron flow is primarily via the naphthoquinones, which pass electrons to cytochrome bd oxidase and the anaerobic terminal reductases. We found that E. coli uses nitrate and fumarate in the intestine, but not nitrite, dimethyl sulfoxide, or trimethylamine N-oxide. Competitive colonizations revealed that cytochrome bd oxidase is more advantageous than nitrate reductase or fumarate reductase. Strains lacking nitrate reductase outcompeted fumarate reductase mutants once the nitrate concentration in cecal mucus reached submillimolar levels, indicating that fumarate is the more important anaerobic electron acceptor in the intestine because nitrate is limiting. Since nitrate is highest in the absence of E. coli, we conclude that E. coli is the only bacterium in the streptomycin-treated mouse large intestine that respires nitrate. Lastly, we demonstrated that a mutant lacking the NarXL regulator (activator of the NarG system), but not a mutant lacking the NarP-NarQ regulator, has a colonization defect, consistent with the advantage provided by NarG. The emerging picture is one in which gene regulation is tuned to balance expression of the terminal reductases that E. coli uses to maximize its competitiveness and achieve the highest possible population in the intestine.

Generation of a glucose de-repressed mutant of Trichoderma reesei using disparity mutagenesis.

PubMed

Iwakuma, Hidekazu; Koyama, Yoshiyuki; Miyachi, Ayako; Nasukawa, Masashi; Matsumoto, Hitoshi; Yano, Shuntaro; Ogihara, Jun; Kasumi, Takafumi

2016-01-01

We obtained a novel glucose de-repressed mutant of Trichoderma reesei using disparity mutagenesis. A plasmid containing DNA polymerase δ lacking proofreading activity, and AMAI, an autonomously replicating sequence was introduced into T. reesei ATCC66589. The rate of mutation evaluated with 5-fluoroorotic acid resistance was approximately 30-fold higher than that obtained by UV irradiation. The transformants harboring incompetent DNA polymerase δ were then selected on 2-deoxyglucose agar plates with hygromycin B. The pNP-lactoside hydrolyzing activities of mutants were 2 to 5-fold higher than the parent in liquid medium containing glucose. Notably, the amino acid sequence of cre1, a key gene involved in glucose repression, was identical in the mutant and parent strains, and further, the cre1 expression levels was not abolished in the mutant. Taken together, these results demonstrate that the strains of T. reesei generated by disparity mutagenesis are glucose de-repressed variants that contain mutations in yet-unidentified factors other than cre1.

Lack of hormone binding in COS-7 cells expressing a mutated growth hormone receptor found in Laron dwarfism.

PubMed Central

Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A

1993-01-01

A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064

Relative importance of bacteriocin-like genes in antagonism of Xanthomonas perforans tomato race 3 to Xanthomonas euvesicatoria tomato race 1 strains.

PubMed

Hert, A P; Roberts, P D; Momol, M T; Minsavage, G V; Tudor-Nelson, S M; Jones, J B

2005-07-01

In a previous study, tomato race 3 (T3) strains of Xanthomonas perforans became predominant in fields containing both X. euvesicatoria and X. perforans races T1 and T3, respectively. This apparent ability to take over fields led to the discovery that there are three bacteriocin-like compounds associated with T3 strains. T3 strain 91-118 produces at least three different bacteriocin-like compounds (BCN-A, BCN-B, and BCN-C) antagonistic toward T1 strains. We determined the relative importance of the bacteriocin-like compounds by constructing the following mutant forms of a wild-type (WT) T3 strain to evaluate the antagonism to WT T1 strains: Mut-A (BCN-A-), Mut-B (BCN-B-), Mut-C (BCN-C-), Mut-AB, Mut-BC, and Mut-ABC. Although all mutant and WT T3 strains reduced the T1 populations in in planta growth room experiments, Mut-B and WT T3 were significantly more effective. Mutants expressing BCN-B and either BCN-A or BCN-C reduced T1 populations less than mutants expressing only BCN-A or BCN-C. The triple-knockout mutant Mut-ABC also had a significant competitive advantage over the T1 strain. In pairwise-inoculation field experiments where plants were coinoculated with an individual mutant or WT T3 strain and the T1 strain, the mutant strains and the WT T3 strain were reisolated from more than 70% of the lesions. WT T3 and Mut-B were the most frequently reisolated strains. In field experiments where plants were group inoculated with Mut-A, Mut-B, Mut-C, Mut-ABC, and WT T1 and T3 strains, Mut-B populations dominated all three seasons. In greenhouse and field experiments, the WT and mutant T3 strains had a selective advantage over T1 strains. Bacterial strains expressing both BCN-A and BCN-C appeared to have a competitive advantage over all other mutant and WT strains. Furthermore, BCN-B appeared to be a negative factor, with mutant T3 strains lacking BCN-B having a selective advantage in the field.

The role of the cytoplasmic domain of the L1 cell adhesion molecule in brain development

PubMed Central

Nakamura, Yukiko; Lee, Suni; Haddox, Candace L.; Weaver, Eli J.; Lemmon, Vance P.

2011-01-01

Mutations in the human L1CAM gene cause X-linked Hydrocephalus and MASA syndrome. In vitro studies have shown the L1 cytoplasmic domain (L1CD) is involved in L1 trafficking, neurite branching, signaling, and interactions with the cytoskeleton. L1cam knock-out (L1KO) mice have hydrocephalus, a small cerebellum, hyperfasciculation of corticothalamic tracts and abnormal peripheral nerves. To explore the function of the L1CD, we made three new mice lines in which different parts of the L1CD have been altered. In all mutant lines L1 protein is expressed and transported into the axon. Interestingly, these new L1CD mutant lines display normal brain morphology. However, the expression of L1 protein in the adult is dramatically reduced in the two L1CD mutant lines that lack the ankyrin-binding region and they show defects in motor function. Therefore, the L1CD is not responsible for the major defects observed in L1KO mice, yet it is required for continued L1 protein expression and motor function in the adult. PMID:20127821

Histone acetyltransferase Enok regulates oocyte polarization by promoting expression of the actin nucleation factor spire.

PubMed

Huang, Fu; Paulson, Ariel; Dutta, Arnob; Venkatesh, Swaminathan; Smolle, Michaela; Abmayr, Susan M; Workman, Jerry L

2014-12-15

KAT6 histone acetyltransferases (HATs) are highly conserved in eukaryotes and have been shown to play important roles in transcriptional regulation. Here, we demonstrate that the Drosophila KAT6 Enok acetylates histone H3 Lys 23 (H3K23) in vitro and in vivo. Mutants lacking functional Enok exhibited defects in the localization of Oskar (Osk) to the posterior end of the oocyte, resulting in loss of germline formation and abdominal segments in the embryo. RNA sequencing (RNA-seq) analysis revealed that spire (spir) and maelstrom (mael), both required for the posterior localization of Osk in the oocyte, were down-regulated in enok mutants. Chromatin immunoprecipitation showed that Enok is localized to and acetylates H3K23 at the spir and mael genes. Furthermore, Gal4-driven expression of spir in the germline can largely rescue the defective Osk localization in enok mutant ovaries. Our results suggest that the Enok-mediated H3K23 acetylation (H3K23Ac) promotes the expression of spir, providing a specific mechanism linking oocyte polarization to histone modification. © 2014 Huang et al.; Published by Cold Spring Harbor Laboratory Press.

The Agr quorum-sensing system regulates fibronectin binding but not hemolysis in the absence of a functional electron transport chain.

PubMed

Pader, Vera; James, Ellen H; Painter, Kimberley L; Wigneshweraraj, Sivaramesh; Edwards, Andrew M

2014-10-01

Staphylococcus aureus is responsible for numerous chronic and recurrent infections, which are frequently associated with the emergence of small-colony variants (SCVs) that lack a functional electron transport chain. SCVs exhibit enhanced expression of fibronectin-binding protein (FnBP) and greatly reduced hemolysin production, although the basis for this is unclear. One hypothesis is that these phenotypes are a consequence of the reduced Agr activity of SCVs, while an alternative is that the lack of a functional electron transport chain and the resulting reduction in ATP production are responsible. Disruption of the electron transport chain of S. aureus genetically (hemB and menD) or chemically, using 2-n-heptyl-4-hydroxyquinoline N-oxide (HQNO), inhibited both growth and Agr activity and conferred an SCV phenotype. Supplementation of the culture medium with synthetic autoinducing peptide (sAIP) significantly increased Agr expression in both hemB mutant strains and S. aureus grown with HQNO and significantly reduced staphylococcal adhesion to fibronectin. However, sAIP did not promote hemolysin expression in hemB mutant strains or S. aureus grown with HQNO. Therefore, while Agr regulates fibronectin binding in SCVs, it cannot promote hemolysin production in the absence of a functional electron transport chain. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

The Agr Quorum-Sensing System Regulates Fibronectin Binding but Not Hemolysis in the Absence of a Functional Electron Transport Chain

PubMed Central

Pader, Vera; James, Ellen H.; Painter, Kimberley L.; Wigneshweraraj, Sivaramesh

2014-01-01

Staphylococcus aureus is responsible for numerous chronic and recurrent infections, which are frequently associated with the emergence of small-colony variants (SCVs) that lack a functional electron transport chain. SCVs exhibit enhanced expression of fibronectin-binding protein (FnBP) and greatly reduced hemolysin production, although the basis for this is unclear. One hypothesis is that these phenotypes are a consequence of the reduced Agr activity of SCVs, while an alternative is that the lack of a functional electron transport chain and the resulting reduction in ATP production are responsible. Disruption of the electron transport chain of S. aureus genetically (hemB and menD) or chemically, using 2-n-heptyl-4-hydroxyquinoline N-oxide (HQNO), inhibited both growth and Agr activity and conferred an SCV phenotype. Supplementation of the culture medium with synthetic autoinducing peptide (sAIP) significantly increased Agr expression in both hemB mutant strains and S. aureus grown with HQNO and significantly reduced staphylococcal adhesion to fibronectin. However, sAIP did not promote hemolysin expression in hemB mutant strains or S. aureus grown with HQNO. Therefore, while Agr regulates fibronectin binding in SCVs, it cannot promote hemolysin production in the absence of a functional electron transport chain. PMID:25092909

The Lack of the Essential LptC Protein in the Trans-Envelope Lipopolysaccharide Transport Machine Is Circumvented by Suppressor Mutations in LptF, an Inner Membrane Component of the Escherichia coli Transporter

PubMed Central

Benedet, Mattia; Falchi, Federica A.; Puccio, Simone; Di Benedetto, Cristiano; Peano, Clelia; Polissi, Alessandra

2016-01-01

The lipopolysaccharide (LPS) transport (Lpt) system is responsible for transferring LPS from the periplasmic surface of the inner membrane (IM) to the outer leaflet of the outer membrane (OM), where it plays a crucial role in OM selective permeability. In E. coli seven essential proteins are assembled in an Lpt trans-envelope complex, which is conserved in γ-Proteobacteria. LptBFG constitute the IM ABC transporter, LptDE form the OM translocon for final LPS delivery, whereas LptC, an IM-anchored protein with a periplasmic domain, interacts with the IM ABC transporter, the periplasmic protein LptA, and LPS. Although essential, LptC can tolerate several mutations and its role in LPS transport is unclear. To get insights into the functional role of LptC in the Lpt machine we searched for viable mutants lacking LptC by applying a strong double selection for lptC deletion mutants. Genome sequencing of viable ΔlptC mutants revealed single amino acid substitutions at a unique position in the predicted large periplasmic domain of the IM component LptF (LptFSupC). In complementation tests, lptFSupC mutants suppress lethality of both ΔlptC and lptC conditional expression mutants. Our data show that mutations in a specific residue of the predicted LptF periplasmic domain can compensate the lack of the essential protein LptC, implicate such LptF domain in the formation of the periplasmic bridge between the IM and OM complexes, and suggest that LptC may have evolved to improve the performance of an ancestral six-component Lpt machine. PMID:27529623

The Lack of the Essential LptC Protein in the Trans-Envelope Lipopolysaccharide Transport Machine Is Circumvented by Suppressor Mutations in LptF, an Inner Membrane Component of the Escherichia coli Transporter.

PubMed

Benedet, Mattia; Falchi, Federica A; Puccio, Simone; Di Benedetto, Cristiano; Peano, Clelia; Polissi, Alessandra; Dehò, Gianni

2016-01-01

The lipopolysaccharide (LPS) transport (Lpt) system is responsible for transferring LPS from the periplasmic surface of the inner membrane (IM) to the outer leaflet of the outer membrane (OM), where it plays a crucial role in OM selective permeability. In E. coli seven essential proteins are assembled in an Lpt trans-envelope complex, which is conserved in γ-Proteobacteria. LptBFG constitute the IM ABC transporter, LptDE form the OM translocon for final LPS delivery, whereas LptC, an IM-anchored protein with a periplasmic domain, interacts with the IM ABC transporter, the periplasmic protein LptA, and LPS. Although essential, LptC can tolerate several mutations and its role in LPS transport is unclear. To get insights into the functional role of LptC in the Lpt machine we searched for viable mutants lacking LptC by applying a strong double selection for lptC deletion mutants. Genome sequencing of viable ΔlptC mutants revealed single amino acid substitutions at a unique position in the predicted large periplasmic domain of the IM component LptF (LptFSupC). In complementation tests, lptFSupC mutants suppress lethality of both ΔlptC and lptC conditional expression mutants. Our data show that mutations in a specific residue of the predicted LptF periplasmic domain can compensate the lack of the essential protein LptC, implicate such LptF domain in the formation of the periplasmic bridge between the IM and OM complexes, and suggest that LptC may have evolved to improve the performance of an ancestral six-component Lpt machine.

In vivo gene expression and the adaptive response: from pathogenesis to vaccines and antimicrobials.

PubMed Central

Heithoff, D M; Sinsheimer, R L; Low, D A; Mahan, M J

2000-01-01

Microbial pathogens possess a repertoire of virulence determinants that each make unique contributions to fitness during infection. Analysis of these in vivo-expressed functions reveals the biology of the infection process, encompassing the bacterial infection strategies and the host ecological and environmental retaliatory strategies designed to combat them (e.g. thermal, osmotic, oxygen, nutrient and acid stress). Many of the bacterial virulence functions that contribute to a successful infection are normally only expressed during infection. A genetic approach was used to isolate mutants that ectopically expressed many of these functions in a laboratory setting. Lack of DNA adenine methylase (Dam) in Salmonella typhimurium abolishes the preferential expression of many bacterial virulence genes in host tissues. Dam- Salmonella were proficient in colonization of mucosal sites but were defective in colonization of deeper tissue sites. Additionally, Dam- mutants were totally avirulent and effective as live vaccines against murine typhoid fever. Since dam is highly conserved in many pathogenic bacteria that cause significant morbidity and mortality worldwide, Dams are potentially excellent targets for both vaccines and antimicrobials. PMID:10874736

Reversion of autocrine transformation by a dominant negative platelet-derived growth factor mutant.

PubMed Central

Vassbotn, F S; Andersson, M; Westermark, B; Heldin, C H; Ostman, A

1993-01-01

A non-receptor-binding mutant of the platelet-derived growth factor (PDGF) A chain, PDGF-0, was generated by exchanging 7 amino acids in the sequence. The mutant chains formed dimers that were similar to wild-type PDGF-AA with regard to stability and rate of processing to the mature 30-kDa secreted forms. Moreover, the mutant chains formed disulfide-bonded heterodimers with the PDGF B chain in NIH 3T3 cells heterodimer underwent the same processing and secretion as PDGF-AB. Transfection of c-sis-expressing 3T3 cells with PDGF-0 significantly inhibited the transformed phenotype of these cells, as determined by the following criteria. (i) Compared with PDGF-0-negative clones, PDGF-0-producing clones showed a reverted morphology. (ii) Clones producing PDGF-0 grew more slowly than PDGF-0-negative clones, with a fivefold difference in cell number after 14 days in culture. (iii) The expression of PDGF-0 completely inhibited the ability of the c-sis-expressing 3T3 cells to form colonies in soft agar; this inhibition was overcome by the addition of recombinant PDGF-BB to the culture medium, showing that the lack of colony formation of these cells was not due to a general unresponsiveness to PDGF. The specific expression of a PDGF-0/PDGF wild-type heterodimer in COS cells revealed that the affinity of the mutant heterodimer for the PDGF alpha receptor was decreased by approximately 50-fold compared with that of PDGF-AA. Thus, we show that a non-receptor-binding PDGF A-chain mutant neutralizes in a trans-dominant manner the autocrine transforming potential of the c-sis/PDGF B chain by forming low-affinity heterodimers with wild-type PDGF chains. This method of specifically antagonizing the effect of PDGF may be useful in investigations of the role of PDGF in normal and pathological conditions. Images PMID:8321214

Reversion of autocrine transformation by a dominant negative platelet-derived growth factor mutant.

PubMed

Vassbotn, F S; Andersson, M; Westermark, B; Heldin, C H; Ostman, A

1993-07-01

A non-receptor-binding mutant of the platelet-derived growth factor (PDGF) A chain, PDGF-0, was generated by exchanging 7 amino acids in the sequence. The mutant chains formed dimers that were similar to wild-type PDGF-AA with regard to stability and rate of processing to the mature 30-kDa secreted forms. Moreover, the mutant chains formed disulfide-bonded heterodimers with the PDGF B chain in NIH 3T3 cells heterodimer underwent the same processing and secretion as PDGF-AB. Transfection of c-sis-expressing 3T3 cells with PDGF-0 significantly inhibited the transformed phenotype of these cells, as determined by the following criteria. (i) Compared with PDGF-0-negative clones, PDGF-0-producing clones showed a reverted morphology. (ii) Clones producing PDGF-0 grew more slowly than PDGF-0-negative clones, with a fivefold difference in cell number after 14 days in culture. (iii) The expression of PDGF-0 completely inhibited the ability of the c-sis-expressing 3T3 cells to form colonies in soft agar; this inhibition was overcome by the addition of recombinant PDGF-BB to the culture medium, showing that the lack of colony formation of these cells was not due to a general unresponsiveness to PDGF. The specific expression of a PDGF-0/PDGF wild-type heterodimer in COS cells revealed that the affinity of the mutant heterodimer for the PDGF alpha receptor was decreased by approximately 50-fold compared with that of PDGF-AA. Thus, we show that a non-receptor-binding PDGF A-chain mutant neutralizes in a trans-dominant manner the autocrine transforming potential of the c-sis/PDGF B chain by forming low-affinity heterodimers with wild-type PDGF chains. This method of specifically antagonizing the effect of PDGF may be useful in investigations of the role of PDGF in normal and pathological conditions.

Novel features of a PIWI-like protein homolog in the parasitic protozoan Leishmania.

PubMed

Padmanabhan, Prasad K; Dumas, Carole; Samant, Mukesh; Rochette, Annie; Simard, Martin J; Papadopoulou, Barbara

2012-01-01

In contrast to nearly all eukaryotes, the Old World Leishmania species L. infantum and L. major lack the bona fide RNAi machinery genes. Interestingly, both Leishmania genomes code for an atypical Argonaute-like protein that possesses a PIWI domain but lacks the PAZ domain found in Argonautes from RNAi proficient organisms. Using sub-cellular fractionation and confocal fluorescence microscopy, we show that unlike other eukaryotes, the PIWI-like protein is mainly localized in the single mitochondrion in Leishmania. To predict PIWI function, we generated a knockout mutant for the PIWI gene in both L. infantum (Lin) and L. major species by double-targeted gene replacement. Depletion of PIWI has no effect on the viability of insect promastigote forms but leads to an important growth defect of the mammalian amastigote lifestage in vitro and significantly delays disease pathology in mice, consistent with a higher expression of the PIWI transcript in amastigotes. Moreover, amastigotes lacking PIWI display a higher sensitivity to apoptosis inducing agents than wild type parasites, suggesting that PIWI may be a sensor for apoptotic stimuli. Furthermore, a whole-genome DNA microarray analysis revealed that loss of LinPIWI in Leishmania amastigotes affects mostly the expression of specific subsets of developmentally regulated genes. Several transcripts encoding surface and membrane-bound proteins were found downregulated in the LinPIWI((-/-)) mutant whereas all histone transcripts were upregulated in the null mutant, supporting the possibility that PIWI plays a direct or indirect role in the stability of these transcripts. Although our data suggest that PIWI is not involved in the biogenesis or the stability of small noncoding RNAs, additional studies are required to gain further insights into the role of this protein on RNA regulation and amastigote development in Leishmania.

Mitochondrial dysfunction precedes neurodegeneration in mahogunin (Mgrn1) mutant mice

PubMed Central

Sun, Kaihua; Johnson, Brian S.; Gunn, Teresa M.

2007-01-01

Oxidative stress, ubiquitination defects and mitochondrial dysfunction are commonly associated with neurodegeneration. Mice lacking mahogunin ring finger-1 (MGRN1) or attractin (ATRN) develop age-dependent spongiform neurodegeneration through an unknown mechanism. It has been suggested that they act in a common pathway. As MGRN1 is an E3 ubiquitin ligase, proteomic analysis of Mgrn1 mutant and control brains was performed to explore the hypothesis that loss of MGRN1 causes neurodegeneration via accumulation of its substrates. Many mitochondrial proteins were reduced in Mgrn1 mutants. Subsequent assays confirmed significantly reduced mitochondrial complex IV expression and activity as well as increased oxidative stress in mutant brains. Mitochondrial dysfunction was obvious many months before onset of vacuolation, implicating this as a causative factor. Compatible with the hypothesis that ATRN and MGRN1 act in the same pathway, mitochondrial dysfunction and increased oxidative stress were also observed in the brains of Atrn mutants. Our results suggest that the study of Mgrn1 and Atrn mutant mice will provide insight into a causative molecular mechanism common to many neurodegenerative disorders. PMID:17720281

Medicago truncatula Mtha1-2 mutants loose metabolic responses to mycorrhizal colonization.

PubMed

Hubberten, Hans-Michael; Sieh, Daniela; Zöller, Daniela; Hoefgen, Rainer; Krajinski, Franziska

2015-01-01

Bidirectional nutrient transfer is one of the key features of the arbuscular mycorrhizal symbiosis. Recently we were able to identify a Medicago truncatula mutant (mtha1-2) that is defective in the uptake of phosphate from the periarbuscular space due to a lack of the energy providing proton gradient provided by the symbiosis specific proton ATPase MtHA1 In order to further characterize the impact of fungal colonization on the plant metabolic status, without the beneficial aspect of improved mineral nutrition, we performed leaf ion analyses in mutant and wildtype plants with and without fungal colonization. Although frequency of fungal colonization was unaltered, the mutant did not show a positive growth response to mycorrhizal colonization. This indicates that nutrient transfer into the plant cell fails in the truncated arbuscules due to lacking expression of a functional MtHA1 protein. The leaves of wildtype plants showed clear metabolic responses to root mycorrhizal colonization, whereas no changes of leaf metabolite levels of mycorrhizal mtha1-2 plants were detected, even though they were colonized. These results show that MtHa1 is indispensable for a functional mycorrhizal symbiosis and, moreover, suggest that fungal root colonization per se does not depend on nutrient transfer to the plant host.

Defective membrane expression of human growth hormone (GH) receptor causes Laron-type GH insensitivity syndrome.

PubMed Central

Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M

1991-01-01

Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554

Disturbed neuronal ER-Golgi sorting of unassembled glycine receptors suggests altered subcellular processing is a cause of human hyperekplexia.

PubMed

Schaefer, Natascha; Kluck, Christoph J; Price, Kerry L; Meiselbach, Heike; Vornberger, Nadine; Schwarzinger, Stephan; Hartmann, Stephanie; Langlhofer, Georg; Schulz, Solveig; Schlegel, Nadja; Brockmann, Knut; Lynch, Bryan; Becker, Cord-Michael; Lummis, Sarah C R; Villmann, Carmen

2015-01-07

Recent studies on the pathogenic mechanisms of recessive hyperekplexia indicate disturbances in glycine receptor (GlyR) α1 biogenesis. Here, we examine the properties of a range of novel glycine receptor mutants identified in human hyperekplexia patients using expression in transfected cell lines and primary neurons. All of the novel mutants localized in the large extracellular domain of the GlyR α1 have reduced cell surface expression with a high proportion of receptors being retained in the ER, although there is forward trafficking of glycosylated subpopulations into the ER-Golgi intermediate compartment and cis-Golgi compartment. CD spectroscopy revealed that the mutant receptors have proportions of secondary structural elements similar to wild-type receptors. Two mutants in loop B (G160R, T162M) were functional, but none of those in loop D/β2-3 were. One nonfunctional truncated mutant (R316X) could be rescued by coexpression with the lacking C-terminal domain. We conclude that a proportion of GlyR α1 mutants can be transported to the plasma membrane but do not necessarily form functional ion channels. We suggest that loop D/β2-3 is an important determinant for GlyR trafficking and functionality, whereas alterations to loop B alter agonist potencies, indicating that residues here are critical elements in ligand binding. Copyright © 2015 the authors 0270-6474/15/350422-16$15.00/0.

Reactive oxygen species and transcript analysis upon excess light treatment in wild-type Arabidopsis thaliana vs a photosensitive mutant lacking zeaxanthin and lutein

PubMed Central

2011-01-01

Background Reactive oxygen species (ROS) are unavoidable by-products of oxygenic photosynthesis, causing progressive oxidative damage and ultimately cell death. Despite their destructive activity they are also signalling molecules, priming the acclimatory response to stress stimuli. Results To investigate this role further, we exposed wild type Arabidopsis thaliana plants and the double mutant npq1lut2 to excess light. The mutant does not produce the xanthophylls lutein and zeaxanthin, whose key roles include ROS scavenging and prevention of ROS synthesis. Biochemical analysis revealed that singlet oxygen (1O2) accumulated to higher levels in the mutant while other ROS were unaffected, allowing to define the transcriptomic signature of the acclimatory response mediated by 1O2 which is enhanced by the lack of these xanthophylls species. The group of genes differentially regulated in npq1lut2 is enriched in sequences encoding chloroplast proteins involved in cell protection against the damaging effect of ROS. Among the early fine-tuned components, are proteins involved in tetrapyrrole biosynthesis, chlorophyll catabolism, protein import, folding and turnover, synthesis and membrane insertion of photosynthetic subunits. Up to now, the flu mutant was the only biological system adopted to define the regulation of gene expression by 1O2. In this work, we propose the use of mutants accumulating 1O2 by mechanisms different from those activated in flu to better identify ROS signalling. Conclusions We propose that the lack of zeaxanthin and lutein leads to 1O2 accumulation and this represents a signalling pathway in the early stages of stress acclimation, beside the response to ADP/ATP ratio and to the redox state of both plastoquinone pool. Chloroplasts respond to 1O2 accumulation by undergoing a significant change in composition and function towards a fast acclimatory response. The physiological implications of this signalling specificity are discussed. PMID:21481232

Delayed pubertal onset and prepubertal Kiss1 expression in female mice lacking central oestrogen receptor beta.

PubMed

Naulé, Lydie; Robert, Vincent; Parmentier, Caroline; Martini, Mariangela; Keller, Matthieu; Cohen-Solal, Martine; Hardin-Pouzet, Hélène; Grange-Messent, Valérie; Franceschini, Isabelle; Mhaouty-Kodja, Sakina

2015-12-20

Ovarian oestradiol is essential for pubertal maturation and adult physiology of the female reproductive axis. It acts at central and peripheral sites through two main oestrogen receptors (ER) α and β. Here we investigate the role of ERβ on central effects of oestradiol, by generating a mouse line specifically lacking the ERβ gene in neuronal and glial cells. Central ERβ deletion delays the age at vaginal opening and first oestrous and reduces uterine weight without affecting body growth. Analysis of factors necessary for pubertal progression shows reduced levels of Kiss1 transcripts at postnatal (P) day 25 in the preoptic area, but not in the mediobasal hypothalamus (MBH) of mutant females. In agreement with these data, the number of kisspeptin-immunoreactive neurons was decreased by 57-72% in the three subdivisions of the rostral periventricular area of the third ventricle (RP3V), whereas the density of kisspeptin-immunoreactive fibres was unchanged in the arcuate nucleus of mutant mice. These alterations do not involve changes in ERα mRNAs in the preoptic area and protein levels in the RP3V. The number and distribution of GnRH-immunoreactive cells were unaffected, but gonadotropin-releasing hormone (GnRH) transcript levels were higher in the P25 preoptic area of mutants. At adulthood, mutant females have normal oestrous cyclicity, kisspeptin system and exhibit unaltered sexual behaviour. They display, however, reduced ovary weight and increased anxiety-related behaviour during the follicular phase. This argues for the specific involvement of central ERβ in the regulation of pubertal onset in female reproduction, possibly through prepubertal induction of kisspeptin expression in the RP3V. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Wild-type and mutant AvrA- Salmonella induce broadly similar immune pathways in the chicken ceca with key differences in signaling intermediates and inflammation.

PubMed

Arsenault, Ryan J; Genovese, Kenneth J; He, Haiqi; Wu, Huixia; Neish, Andrew S; Kogut, Michael H

2016-02-01

Salmonella enterica serovar Typhimurium (ST) is a serious infectious disease throughout the world, and a major reservoir for Salmonella is chicken. Chicken infected with Salmonella do not develop clinical disease, this may be the result of important host interactions with key virulence proteins. To study this, we inoculated chicken with mutant Salmonella Typhimurium that lacked the virulence protein AvrA (AvrA(-)). AvrA is referred to as an avirulence factor, as it moderates the host immune response. The lack of the AvrA virulence gene in ST resulted in reduced weight gain, enhanced persistence and greater extraintestinal organ invasion in chickens, as compared to wild-type (WT) ST. Kinome analysis was performed on inoculated cecal tissue. The majority of the signal transduction pathways induced by AvrA(-) and WT ST were similar; however, we observed alterations in innate immune system signaling. In addition, a leukocyte migration pathway was altered by AvrA(-) ST that may allow greater gut barrier permeability and invasion by the mutant. Cytokine expression did not appear significantly altered at 7 d post-inoculation; at 14 d post-inoculation, there was an observed increase in the expression of anti-inflammatory IL-10 in the WT inoculated ceca. This study is the first to describe mutant AvrA(-) ST infection of chicken and provides further insight into the Salmonella responses observed in chicken relative to other species such as humans and cattle. Published by Oxford University Press on behalf of Poultry Science Association 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Engrailed negatively regulates the expression of cell adhesion molecules connectin and neuroglian in embryonic Drosophila nervous system.

PubMed

Siegler, M V; Jia, X X

1999-02-01

Engrailed is expressed in subsets of interneurons that do not express Connectin or appreciable Neuroglian, whereas other neurons that are Engrailed negative strongly express these adhesion molecules. Connectin and Neuroglian expression are virtually eliminated in interneurons when engrailed expression is driven ubiquitously in neurons, and greatly increased when engrailed genes are lacking in mutant embryos. The data suggest that Engrailed is normally a negative regulator of Connectin and neuroglian. These are the first two "effector" genes identified in the nervous system of Drosophila as regulatory targets for Engrailed. We argue that differential Engrailed expression is crucial in determining the pattern of expression of cell adhesion molecules and thus constitutes an important determinant of neuronal shape and perhaps connectivity.

Two closely related members of Arabidopsis 13-lipoxygenases (13-LOXs), LOX3 and LOX4, reveal distinct functions in response to plant-parasitic nematode infection.

PubMed

Ozalvo, Rachel; Cabrera, Javier; Escobar, Carolina; Christensen, Shawn A; Borrego, Eli J; Kolomiets, Michael V; Castresana, Carmen; Iberkleid, Ionit; Brown Horowitz, Sigal

2014-05-01

The responses of two closely related members of Arabidopsis 13-lipoxygenases (13-LOXs), LOX3 and LOX4, to infection by the sedentary nematodes root-knot nematode (Meloidogyne javanica) and cyst nematode (Heterodera schachtii) were analysed in transgenic Arabidopsis seedlings. The tissue localization of LOX3 and LOX4 gene expression using β-glucuronidase (GUS) reporter gene constructs showed local induction of LOX3 expression when second-stage juveniles reached the vascular bundle and during the early stages of plant-nematode interaction through gall and syncytia formation. Thin sections of nematode-infested knots indicated LOX3 expression in mature giant cells, and high expression in neighbouring cells and those surrounding the female body. LOX4 promoter was also activated by nematode infection, although the GUS signal weakened as infection and disease progressed. Homozygous insertion mutants lacking LOX3 were less susceptible than wild-type plants to root-knot nematode infection, as reflected by a decrease in female counts. Conversely, deficiency in LOX4 function led to a marked increase in females and egg mass number and in the female to male ratio of M. javanica and H. schachtii, respectively. The susceptibility of lox4 mutants was accompanied by increased expression of allene oxide synthase, allene oxide cyclase and ethylene-responsive transcription factor 4, and the accumulation of jasmonic acid, measured in the roots of lox4 mutants. This response was not found in lox3 mutants. Taken together, our results reveal that LOX4 and LOX3 interfere differentially with distinct metabolic and signalling pathways, and that LOX4 plays a major role in controlling plant defence against nematode infection. © 2013 BSPP AND JOHN WILEY & SONS LTD.

Parvoviral Left-End Hairpin Ears Are Essential during Infection for Establishing a Functional Intranuclear Transcription Template and for Efficient Progeny Genome Encapsidation

PubMed Central

Li, Lei; Cotmore, Susan F.

2013-01-01

The 121-nucleotide left-end telomere of Minute Virus of Mice (MVM) can be folded into a Y-shaped hairpin with short axial ears that are highly conserved within genus Parvovirus. To explore their potential role(s) during infection, we constructed infectious plasmid clones that lacked one or other ear. Although these were nonviable when transfected into A9 cells, excision of the viral genome and DNA amplification appeared normal, and viral transcripts and proteins were expressed, but progeny virion production was minimal, supporting the idea of a potential role for the ears in genome packaging. To circumvent the absence of progeny that confounded further analysis of these mutants, plasmids were transfected into 293T cells both with and without an adenovirus helper construct, generating single bursts of progeny. These virions bound to A9 cells and were internalized but failed to initiate viral transcription, protein expression, or DNA replication. No defects in mutant virion stability or function could be detected in vitro. Significantly, mutant capsid gene expression and DNA replication could be rescued by coinfection with wild-type virions carrying a replication-competent, capsid-gene-replacement vector. To pinpoint where such complementation occurred, prior transfection of plasmids expressing only MVM nonstructural proteins was explored. NS1 alone, but not NS2, rescued transcription and protein expression from both P4 and P38 promoters, whereas NS1 molecules deleted for their C-terminal transactivation domain did not. These results suggest that the mutant virions reach the nucleus, uncoat, and are converted to duplex DNA but require an intact left-end hairpin structure to form the initiating transcription complex. PMID:23903839

Arabidopsis thaliana plants lacking the ARP2/3 complex show defects in cell wall assembly and auxin distribution.

PubMed

Pratap Sahi, Vaidurya; Cifrová, Petra; García-González, Judith; Kotannal Baby, Innu; Mouillé, Gregory; Gineau, Emilie; Müller, Karel; Baluška, František; Soukup, Aleš; Petrášek, Jan; Schwarzerová, Katerina

2017-12-25

The cytoskeleton plays an important role in the synthesis of plant cell walls. Both microtubules and actin cytoskeleton are known to be involved in the morphogenesis of plant cells through their role in cell wall building. The role of ARP2/3-nucleated actin cytoskeleton in the morphogenesis of cotyledon pavement cells has been described before. Seedlings of Arabidopsis mutants lacking a functional ARP2/3 complex display specific cell wall-associated defects. In three independent Arabidopsis mutant lines lacking subunits of the ARP2/3 complex, phenotypes associated with the loss of the complex were analysed throughout plant development. Organ size and anatomy, cell wall composition, and auxin distribution were investigated. ARP2/3-related phenotype is associated with changes in cell wall composition, and the phenotype is manifested especially in mature tissues. Cell walls of mature plants contain less cellulose and a higher amount of homogalacturonan, and display changes in cell wall lignification. Vascular bundles of mutant inflorescence stems show a changed pattern of AUX1-YFP expression. Plants lacking a functional ARP2/3 complex have decreased basipetal auxin transport. The results suggest that the ARP2/3 complex has a morphogenetic function related to cell wall synthesis and auxin transport. © The Author(s) 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Interaction of metronidazole with DNA repair mutants of Escherichia coli.

PubMed

Yeung, T C; Beaulieu, B B; McLafferty, M A; Goldman, P

1984-01-01

It has been proposed that one of metronidazole's partially reduced intermediates interacts either with DNA to exert a bactericidal effect or with water to form acetamide. To test this hypothesis we have examined the effect of metronidazole on several mutants of Escherichia coli that are defective in DNA repair. UV-susceptible RecA- and UvrB- point mutants have an increased susceptibility to metronidazole as manifested by both a decreased minimal inhibitory concentration and a greater bactericidal response to metronidazole in resting cultures. By these criteria, however, we find that UvrB- deletion mutants, which lack the ability to reduce nitrate and chlorate, are no more susceptible to metronidazole than is the wild type. We find, however, that these deletion mutants also lack the ability to reduce metronidazole and thus possibly to form its reactive species. When metronidazole's bactericidal effect is expressed in terms of the concurrent accumulation of acetamide derived from metronidazole, then all RecA- and UvrB- mutants are killed more efficiently than their wild types. The data are consistent, therefore, with metronidazole's lethal effect being mediated by a partially reduced intermediate on the metabolic pathway between metronidazole and acetamide. Defects in other aspects of the DNA repair system do not confer this increased susceptibility to the proposed intermediate. A Tag- mutant, for example, which is defective in 3-methyl-adenine-DNA glycosylase, does not have this increased susceptibility to the presumed precursor of acetamide. Thus, these results provide further support for the hypothesis that the bactericidal effect of metronidazole is mediated by a partially reduced intermediate in the metabolic conversion of metronidazole to acetamide and suggest that this intermediate interacts with DNA to produce a lesion similar to that caused by UV light.

Interaction of metronidazole with DNA repair mutants of Escherichia coli.

PubMed Central

Yeung, T C; Beaulieu, B B; McLafferty, M A; Goldman, P

1984-01-01

It has been proposed that one of metronidazole's partially reduced intermediates interacts either with DNA to exert a bactericidal effect or with water to form acetamide. To test this hypothesis we have examined the effect of metronidazole on several mutants of Escherichia coli that are defective in DNA repair. UV-susceptible RecA- and UvrB- point mutants have an increased susceptibility to metronidazole as manifested by both a decreased minimal inhibitory concentration and a greater bactericidal response to metronidazole in resting cultures. By these criteria, however, we find that UvrB- deletion mutants, which lack the ability to reduce nitrate and chlorate, are no more susceptible to metronidazole than is the wild type. We find, however, that these deletion mutants also lack the ability to reduce metronidazole and thus possibly to form its reactive species. When metronidazole's bactericidal effect is expressed in terms of the concurrent accumulation of acetamide derived from metronidazole, then all RecA- and UvrB- mutants are killed more efficiently than their wild types. The data are consistent, therefore, with metronidazole's lethal effect being mediated by a partially reduced intermediate on the metabolic pathway between metronidazole and acetamide. Defects in other aspects of the DNA repair system do not confer this increased susceptibility to the proposed intermediate. A Tag- mutant, for example, which is defective in 3-methyl-adenine-DNA glycosylase, does not have this increased susceptibility to the presumed precursor of acetamide. Thus, these results provide further support for the hypothesis that the bactericidal effect of metronidazole is mediated by a partially reduced intermediate in the metabolic conversion of metronidazole to acetamide and suggest that this intermediate interacts with DNA to produce a lesion similar to that caused by UV light. PMID:6367636

Altered fast- and slow-twitch muscle fibre characteristics in female mice with a (S248F) knock-in mutation of the brain neuronal nicotinic acetylcholine receptor.

PubMed

Cannata, David J; Finkelstein, David I; Gantois, Ilse; Teper, Yaroslav; Drago, John; West, Jan M

2009-01-01

We generated a mouse line with a missense mutation (S248F) in the gene (CHRNA4) encoding the alpha4 subunit of neuronal nicotinic acetylcholine receptor (nAChR). Mutant mice demonstrate brief nicotine induced dystonia that resembles the clinical events seen in patients with the same mutation. Drug-induced dystonia is more pronounced in female mice, thus our aim was to determine if the S248F mutation changed the properties of fast- and slow-twitch muscle fibres from female mutant mice. Reverse transcriptase-PCR confirmed CHRNA4 gene expression in the brain but not skeletal muscles in normal and mutant mice. Ca(2+) and Sr(2+) force activation curves were obtained using skinned muscle fibres prepared from slow-twitch (soleus) and fast-twitch (EDL) muscles. Two significant results were found: (1) the (pCa(50) - pSr(50)) value from EDL fibres was smaller in mutant mice than in wild type (1.01 vs. 1.30), (2) the percentage force produced at pSr 5.5 was larger in mutants than in wild type (5.76 vs. 0.24%). Both results indicate a shift to slow-twitch characteristics in the mutant. This conclusion is supported by the identification of the myosin heavy chain (MHC) isoforms. Mutant EDL fibres expressed MHC I (usually only found in slow-twitch fibres) as well as MHC IIa. Despite the lack of spontaneous dystonic events, our findings suggest that mutant mice may be having subclinical events or the mutation results in a chronic alteration to muscle neural input.

Tissue-Specific Profiling Reveals Transcriptome Alterations in Arabidopsis Mutants Lacking Morphological Phenotypes[C][W

PubMed Central

Simon, Marissa; Bruex, Angela; Kainkaryam, Raghunandan M.; Zheng, Xiaohua; Huang, Ling; Woolf, Peter J.; Schiefelbein, John

2013-01-01

Traditional genetic analysis relies on mutants with observable phenotypes. Mutants lacking visible abnormalities may nevertheless exhibit molecular differences useful for defining gene function. To examine this, we analyzed tissue-specific transcript profiles from Arabidopsis thaliana transcription factor gene mutants with known roles in root epidermis development, but lacking a single-gene mutant phenotype due to genetic redundancy. We discovered substantial transcriptional changes in each mutant, preferentially affecting root epidermal genes in a manner consistent with the known double mutant effects. Furthermore, comparing transcript profiles of single and double mutants, we observed remarkable variation in the sensitivity of target genes to the loss of one or both paralogous genes, including preferential effects on specific branches of the epidermal gene network, likely reflecting the pathways of paralog subfunctionalization during evolution. In addition, we analyzed the root epidermal transcriptome of the transparent testa glabra2 mutant to clarify its role in the network. These findings provide insight into the molecular basis of genetic redundancy and duplicate gene diversification at the level of a specific gene regulatory network, and they demonstrate the usefulness of tissue-specific transcript profiling to define gene function in mutants lacking informative visible changes in phenotype. PMID:24014549

Constitutive expression of ftsZ overrides the whi developmental genes to initiate sporulation of Streptomyces coelicolor.

PubMed

Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P

2012-03-01

The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.

Analysis of NPR-1 reveals a circuit mechanism for behavioral quiescence in C. elegans

PubMed Central

Choi, Seungwon; Chatzigeorgiou, Marios; Taylor, Kelsey P.; Schafer, William R.; Kaplan, Joshua M.

2013-01-01

SUMMARY Animals undergo periods of behavioral quiescence and arousal in response to environmental, circadian, or developmental cues. During larval molts, C. elegans undergoes a period of profound behavioral quiescence termed lethargus. Locomotion quiescence during lethargus was abolished in mutants lacking a neuropeptide receptor (NPR-1), and was reduced in mutants lacking NPR-1 ligands (FLP-18 and -21). Wild type strains are polymorphic for the npr-1 gene, and their lethargus behavior varies correspondingly. Locomotion quiescence and arousal were mediated by decreased and increased secretion of an arousal neuropeptide (PDF-1) from central neurons. PDF receptors (PDFR-1) expressed in peripheral mechanosensory neurons enhanced touch-evoked calcium transients. Thus, a central circuit stimulates arousal from lethargus by enhancing the sensitivity of peripheral mechanosensory neurons in the body. These results define a circuit mechanism controlling a developmentally programmed form of quiescence. PMID:23764289

Leishmania HASP and SHERP Genes Are Required for In Vivo Differentiation, Parasite Transmission and Virulence Attenuation in the Host

PubMed Central

Doehl, Johannes S. P.; Sádlová, Jovana; Aslan, Hamide; Pružinová, Kateřina; Votýpka, Jan; Kamhawi, Shaden; Volf, Petr

2017-01-01

Differentiation of extracellular Leishmania promastigotes within their sand fly vector, termed metacyclogenesis, is considered to be essential for parasites to regain mammalian host infectivity. Metacyclogenesis is accompanied by changes in the local parasite environment, including secretion of complex glycoconjugates within the promastigote secretory gel and colonization and degradation of the sand fly stomodeal valve. Deletion of the stage-regulated HASP and SHERP genes on chromosome 23 of Leishmania major is known to stall metacyclogenesis in the sand fly but not in in vitro culture. Here, parasite mutants deficient in specific genes within the HASP/SHERP chromosomal region have been used to investigate their role in metacyclogenesis, parasite transmission and establishment of infection. Metacyclogenesis was stalled in HASP/SHERP mutants in vivo and, although still capable of osmotaxis, these mutants failed to secrete promastigote secretory gel, correlating with a lack of parasite accumulation in the thoracic midgut and failure to colonise the stomodeal valve. These defects prevented parasite transmission to a new mammalian host. Sand fly midgut homogenates modulated parasite behaviour in vitro, suggesting a role for molecular interactions between parasite and vector in Leishmania development within the sand fly. For the first time, stage-regulated expression of the small HASPA proteins in Leishmania (Leishmania) has been demonstrated: HASPA2 is expressed only in extracellular promastigotes and HASPA1 only in intracellular amastigotes. Despite its lack of expression in amastigotes, replacement of HASPA2 into the null locus background delays onset of pathology in BALB/c mice. This HASPA2-dependent effect is reversed by HASPA1 gene addition, suggesting that the HASPAs may have a role in host immunomodulation. PMID:28095465

Organization and expression of genes responsible for type 1 piliation in Escherichia coli.

PubMed Central

Orndorff, P E; Falkow, S

1984-01-01

The genetic organization of a segment of recombinant DNA conferring the capacity of synthesize E. coli type 1 pili was examined. This 11.2-kilobase (kb) segment of DNA, derived from a clinical isolate, conferred a piliated phenotype (Pil+) on a nonpiliated (Pil-) strain of E. coli K-12 that lacked DNA homologous to the 11.2-kb region. Insertional mutagenesis, deletion mutagenesis, and subcloning of various regions of the 11.2-kb fragment allowed the localization of five genes, each encoding a polypeptide, that were associated with pilus expression. Three gene products, 17, 86, and 30 kilodaltons (kd) in size, were involved in pilus assembly; assembly of the 17-kd structural (pilin) protein into pili was not seen in mutants lacking either the 86- or 30-kd proteins, but pilin synthesis and proteolytic processing were not affected. The fourth polypeptide, 23 kd in size, appeared to be involved in the regulation of pilus expression because mutants lacking this protein exhibited a 40-fold increase in the amount of pilin antigen per cell. The last protein, 14 kd in size, was not associated with piliation by genetic criteria; however, the 14-kd protein was immunoprecipitated with pili, suggesting an association with pili or immunological cross-reactivity with pilin. Immunoprecipitates of minicell transcription translation products revealed that pilus polymerization was taking place in minicells. This may facilitate the study of the molecular steps in pilus biosynthesis and, as a consequence, provide clues to the assembly of supramolecular structures in general. Images PMID:6146599

COLLAPSED ABNORMAL POLLEN1 Gene Encoding the Arabinokinase-Like Protein Is Involved in Pollen Development in Rice1[C][W][OA

PubMed Central

Ueda, Kenji; Yoshimura, Fumiaki; Miyao, Akio; Hirochika, Hirohiko; Nonomura, Ken-Ichi; Wabiko, Hiroetsu

2013-01-01

We isolated a pollen-defective mutant, collapsed abnormal pollen1 (cap1), from Tos17 insertional mutant lines of rice (Oryza sativa). The cap1 heterozygous plant produced equal numbers of normal and collapsed abnormal grains. The abnormal pollen grains lacked almost all cytoplasmic materials, nuclei, and intine cell walls and did not germinate. Genetic analysis of crosses revealed that the cap1 mutation did not affect female reproduction or vegetative growth. CAP1 encodes a protein consisting of 996 amino acids that showed high similarity to Arabidopsis (Arabidopsis thaliana) l-arabinokinase, which catalyzes the conversion of l-arabinose to l-arabinose 1-phosphate. A wild-type genomic DNA segment containing CAP1 restored mutants to normal pollen grains. During rice pollen development, CAP1 was preferentially expressed in anthers at the bicellular pollen stage, and the effects of the cap1 mutation were mainly detected at this stage. Based on the metabolic pathway of l-arabinose, cap1 pollen phenotype may have been caused by toxic accumulation of l-arabinose or by inhibition of cell wall metabolism due to the lack of UDP-l-arabinose derived from l-arabinose 1-phosphate. The expression pattern of CAP1 was very similar to that of another Arabidopsis homolog that showed 71% amino acid identity with CAP1. Our results suggested that CAP1 and related genes are critical for pollen development in both monocotyledonous and dicotyledonous plants. PMID:23629836

A novel protein involved in heart development in Ambystoma mexicanum is localized in endoplasmic reticulum.

PubMed

Jia, P; Zhang, C; Huang, X P; Poda, M; Akbas, F; Lemanski, S L; Erginel-Unaltuna, N; Lemanski, L F

2008-11-01

The discovery of the naturally occurring cardiac non-function (c) animal strain in Ambystoma mexicanum (axolotl) provides a valuable animal model to study cardiomyocyte differentiation. In homozygous mutant animals (c/c), rhythmic contractions of the embryonic heart are absent due to a lack of organized myofibrils. We have previously cloned a partial sequence of a peptide cDNA (N1) from an anterior-endoderm-conditioned-medium RNA library that had been shown to be able to rescue the mutant phenotype. In the current studies we have fully cloned the N1 full length cDNA sequence from the library. N1 protein has been detected in both adult heart and skeletal muscle but not in any other adult tissues. GFP-tagged expression of the N1 protein has revealed localization of the N1 protein in the endoplasmic reticulum (ER). Results from in situ hybridization experiments have confirmed the dramatic decrease of expression of N1 mRNA in mutant (c/c) embryos indicating that the N1 gene is involved in heart development.

Disruption of the psbA gene by the copy correction mechanism reveals that the expression of plastid-encoded genes is regulated by photosynthesis activity.

PubMed

Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi

2007-05-01

The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.

Brown adipose tissue macrophages control tissue innervation and homeostatic energy expenditure

PubMed Central

Cortese, Nina; Haimon, Zhana; Sar Shalom, Hadas; Kuperman, Yael; Kalchenko, Vyacheslav; Brandis, Alexander; David, Eyal; Segal-Hayoun, Yifat; Chappell-Maor, Louise; Yaron, Avraham; Jung, Steffen

2017-01-01

Tissue macrophages provide immune defense and contribute to establishment and maintenance of tissue homeostasis. Here we used constitutive and inducible mutagenesis to delete the nuclear transcription regulator methyl-CpG binding protein 2 (Mecp2) in defined tissue macrophages. Animals lacking the Rett syndrome-associated gene in macrophages did not show signs of neurodevelopmental disorder, but displayed spontaneous obesity, which could be linked to impaired brown adipose tissue (BAT) function. Specifically, mutagenesis of a BAT-resident CX3CR1+ macrophage subpopulation compromised homeostatic, though not acute cold-induced thermogenesis. Mechanistically, BAT malfunction of pre-obese mice harboring mutant macrophages was associated with decreased sympathetic innervation and local norepinephrine titers, resulting in reduced adipocyte expression of thermogenic factors. Mutant macrophages over-expressed PlexinA4, which might contribute to the phenotype by repulsion of Sema6A-expressing sympathetic axons. Collectively, we report a previously unappreciated homeostatic role of macrophages in the control of tissue innervation, disruption of which in BAT results in metabolic imbalance. PMID:28459435

In vivo system for analyzing the function of the PsbP protein using Chlamydomonas reinhardtii.

PubMed

Nishimura, Taishi; Sato, Fumihiko; Ifuku, Kentaro

2017-09-01

The PsbP protein is an extrinsic subunit of photosystem II (PSII) specifically developed in green-plant species including land plants and green algae. The protein-protein interactions involving PsbP and its effect on oxygen evolution have been investigated in vitro using isolated PSII membranes. However, the importance of those interactions needs to be examined at the cellular level. To this end, we developed a system expressing exogenous PsbP in the background of the Chlamydomonas BF25 mutant lacking native PsbP. Expression of His-tagged PsbP successfully restored the oxygen-evolving activity and photoautotrophic growth of the mutant, while PsbP-∆15 lacking the N-terminal 15 residues, which are crucial for the oxygen-evolving activity of spinach PSII in vitro, only partially did. This demonstrated the importance of N-terminal sequence of PsbP for the photosynthetic activity in vivo. Furthermore, the PSII-LHCII supercomplex can be specifically purified from the Chlamydomonas cells having His-tagged PsbP using a metal affinity chromatography. This study provides a platform not only for the functional analysis of PsbP in vivo but also for structural analysis of the PSII-LHCII supercomplex from green algae.

Overexpression of the active diacylglycerol acyltransferase variant transforms Saccharomyces cerevisiae into an oleaginous yeast.

PubMed

Kamisaka, Yasushi; Kimura, Kazuyoshi; Uemura, Hiroshi; Yamaoka, Masakazu

2013-08-01

Lipid production by Saccharomyces cerevisiae was improved by overexpression of the yeast diacylglycerol acyltransferase Dga1p lacking the N-terminal 29 amino acids (Dga1∆Np), which was previously found to be an active form in the ∆snf2 mutant. Overexpression of Dga1∆Np in the ∆snf2 mutant, however, did not increase lipid content as expected, which prompted us to search for a more suitable strain in which to study the role of Dga1∆Np in lipid accumulation. We found that the overexpression of Dga1∆Np in the ∆dga1 mutant effectively increased the lipid content up to about 45 % in the medium containing 10 % glucose. The high lipid content of the transformant was dependent on glucose concentration, nitrogen limitation, and active leucine biosynthesis. To better understand the effect of dga1 disruption on the ability of Dga1∆Np to stimulate lipid accumulation, the ∆dga1-1 mutant, in which the 3'-terminal 36 bp of the dga1 open reading frame (ORF) remained, and the ∆dga1-2 mutant, in which the 3'-terminal 36 bp were also deleted, were prepared with URA3 disruption cassettes. Surprisingly, the overexpression of Dga1∆Np in the ∆dga1-1 mutant had a lower lipid content than the original ∆dga1 mutant, whereas overexpression in the ∆dga1-2 mutant led to a high lipid content of about 45 %. These results indicated that deletion of the 3' terminal region of the dga1 ORF, rather than abrogation of genomic Dga1p expression, was crucial for the effect of Dga1∆Np on lipid accumulation. To investigate whether dga1 disruption affected gene expression adjacent to DGA1, we found that the overexpression of Esa1p together with Dga1∆Np in the ∆dga1 mutant reverted the lipid content to the level of the wild-type strain overexpressing Dga1∆Np. In addition, RT-qPCR analysis revealed that ESA1 mRNA expression in the ∆dga1 mutant was decreased compared to the wild-type strain at the early stages of culture, suggesting that lowered Esa1p expression is involved in the effect of dga1 disruption on Dga1∆Np-dependent lipid accumulation. These results provide a new strategy to engineer S. cerevisiae for optimal lipid production.

Photoreceptor Cell Death, Proliferation and Formation of Hybrid Rod/S-Cone Photoreceptors in the Degenerating STK38L Mutant Retina

PubMed Central

Berta, Ágnes I.; Boesze-Battaglia, Kathleen; Genini, Sem; Goldstein, Orly; O'Brien, Paul J.; Szél, Ágoston; Acland, Gregory M.; Beltran, William A.; Aguirre, Gustavo D.

2011-01-01

A homozygous mutation in STK38L in dogs impairs the late phase of photoreceptor development, and is followed by photoreceptor cell death (TUNEL) and proliferation (PCNA, PHH3) events that occur independently in different cells between 7–14 weeks of age. During this period, the outer nuclear layer (ONL) cell number is unchanged. The dividing cells are of photoreceptor origin, have rod opsin labeling, and do not label with markers specific for macrophages/microglia (CD18) or Müller cells (glutamine synthetase, PAX6). Nestin labeling is absent from the ONL although it labels the peripheral retina and ciliary marginal zone equally in normals and mutants. Cell proliferation is associated with increased cyclin A1 and LATS1 mRNA expression, but CRX protein expression is unchanged. Coincident with photoreceptor proliferation is a change in the photoreceptor population. Prior to cell death the photoreceptor mosaic is composed of L/M- and S-cones, and rods. After proliferation, both cone types remain, but the majority of rods are now hybrid photoreceptors that express rod opsin and, to a lesser extent, cone S-opsin, and lack NR2E3 expression. The hybrid photoreceptors renew their outer segments diffusely, a characteristic of cones. The results indicate the capacity for terminally differentiated, albeit mutant, photoreceptors to divide with mutations in this novel retinal degeneration gene. PMID:21980341

NilD CRISPR RNA contributes to Xenorhabdus nematophila colonization of symbiotic host nematodes

PubMed Central

Veesenmeyer, Jeff L.; Andersen, Aaron W.; Lu, Xiaojun; Hussa, Elizabeth A.; Murfin, Kristen E.; Chaston, John M.; Dillman, Adler R.; Wassarman, Karen M.; Sternberg, Paul W.; Goodrich-Blair, Heidi

2014-01-01

Summary The bacterium Xenorhabdus nematophila is a mutualist of entomopathogenic Steinernema carpocapsae nematodes and facilitates infection of insect hosts. X. nematophila colonizes the intestine of S. carpocapsae which carries it between insects. In the X. nematophila colonization-defective mutant nilD6::Tn5, the transposon is inserted in a region lacking obvious coding potential. We demonstrate that the transposon disrupts expression of a single CRISPR RNA, NilD RNA. A variant NilD RNA also is expressed by X. nematophila strains from S. anatoliense and S. websteri nematodes. Only nilD from the S. carpocapsae strain of X. nematophila rescued the colonization defect of the nilD6::Tn5 mutant, and this mutant was defective in colonizing all three nematode host species. NilD expression depends on the presence of the associated Cas6e but not Cas3, components of the Type I-E CRISPR-associated machinery. While cas6e deletion in the complemented strain abolished nematode colonization, its disruption in the wild-type parent did not. Likewise, nilD deletion in the parental strain did not impact colonization of the nematode, revealing that the requirement for NilD is evident only in certain genetic backgrounds. Our data demonstrate that NilD RNA is conditionally necessary for mutualistic host colonization and suggest that it functions to regulate endogenous gene expression. PMID:25041533

AmgRS-mediated envelope stress-inducible expression of the mexXY multidrug efflux operon of Pseudomonas aeruginosa

PubMed Central

Lau, Calvin Ho-Fung; Krahn, Thomas; Gilmour, Christie; Mullen, Erin; Poole, Keith

2015-01-01

AmgRS is an envelope stress-responsive two-component system and aminoglycoside resistance determinant in Pseudomonas aeruginosa that is proposed to protect cells from membrane damage caused by aminoglycoside-generated mistranslated polypeptides. Consistent with this, a ΔamgR strain showed increased aminoglycoside-promoted membrane damage, damage that was largely absent in AmgRS-activated amgS-mutant strains. Intriguingly, one such mutation, V121G, while providing for enhanced resistance to aminoglycosides, rendered P. aeruginosa susceptible to several ribosome-targeting nonaminoglycoside antimicrobials that are inducers and presumed substrates of the MexXY-OprM multidrug efflux system. Surprisingly, the amgSV121G mutation increased mexXY expression threefold, suggesting that export of these nonaminoglycosides was compromised in the amgSV121G mutant. Nonetheless, a link was established between AmgRS activation and mexXY expression and this was confirmed in studies showing that aminoglycoside-promoted mexXY expression is dependent on AmgRS. While nonaminoglycosides also induced mexXY expression, this was not AmgRS-dependent, consistent with these agents not generating mistranslated polypeptides and not activating AmgRS. The aminoglycoside inducibility of mexXY was abrogated in a mutant lacking the AmgRS target genes htpX and PA5528, encoding a presumed cytoplasmic membrane-associated protease and a membrane protein of unknown function, respectively. Thus, aminoglycoside induction of mexXY is a response to membrane damage and activation of the AmgRS two-component system. PMID:25450797

Plant hormones in arbuscular mycorrhizal symbioses: an emerging role for gibberellins

PubMed Central

Foo, Eloise; Ross, John J.; Jones, William T.; Reid, James B.

2013-01-01

Background and Aims Arbuscular mycorrhizal symbioses are important for nutrient acquisition in >80 % of terrestrial plants. Recently there have been major breakthroughs in understanding the signals that regulate colonization by the fungus, but the roles of the known plant hormones are still emerging. Here our understanding of the roles of abscisic acid, ethylene, auxin, strigolactones, salicylic acid and jasmonic acid is discussed, and the roles of gibberellins and brassinosteroids examined. Methods Pea mutants deficient in gibberellins, DELLA proteins and brassinosteroids are used to determine whether fungal colonization is altered by the level of these hormones or signalling compounds. Expression of genes activated during mycorrhizal colonization is also monitored. Key Results Arbuscular mycorrhizal colonization of pea roots is substantially increased in gibberellin-deficient na-1 mutants compared with wild-type plants. This is reversed by application of GA3. Mutant la cry-s, which lacks gibberellin signalling DELLA proteins, shows reduced colonization. These changes were parallelled by changes in the expression of genes associated with mycorrhizal colonization. The brassinosteroid-deficient lkb mutant showed no change in colonization. Conclusions Biologically active gibberellins suppress arbuscule formation in pea roots, and DELLA proteins are essential for this response, indicating that this role occurs within the root cells. PMID:23508650

Multiproteomic and Transcriptomic Analysis of Oncogenic β-Catenin Molecular Networks.

PubMed

Ewing, Rob M; Song, Jing; Gokulrangan, Giridharan; Bai, Sheldon; Bowler, Emily H; Bolton, Rachel; Skipp, Paul; Wang, Yihua; Wang, Zhenghe

2018-06-01

The dysregulation of Wnt signaling is a frequent occurrence in many different cancers. Oncogenic mutations of CTNNB1/β-catenin, the key nuclear effector of canonical Wnt signaling, lead to the accumulation and stabilization of β-catenin protein with diverse effects in cancer cells. Although the transcriptional response to Wnt/β-catenin signaling activation has been widely studied, an integrated understanding of the effects of oncogenic β-catenin on molecular networks is lacking. We used affinity-purification mass spectrometry (AP-MS), label-free liquid chromatography-tandem mass spectrometry, and RNA-Seq to compare protein-protein interactions, protein expression, and gene expression in colorectal cancer cells expressing mutant (oncogenic) or wild-type β-catenin. We generate an integrated molecular network and use it to identify novel protein modules that are associated with mutant or wild-type β-catenin. We identify a DNA methyltransferase I associated subnetwork that is enriched in cells with mutant β-catenin and a subnetwork enriched in wild-type cells associated with the CDKN2A tumor suppressor, linking these processes to the transformation of colorectal cancer cells through oncogenic β-catenin signaling. In summary, multiomics analysis of a defined colorectal cancer cell model provides a significantly more comprehensive identification of functional molecular networks associated with oncogenic β-catenin signaling.

Lack of promoter IV-driven BDNF transcription results in depression-like behavior.

PubMed

Sakata, K; Jin, L; Jha, S

2010-10-01

Transcription of Bdnf is controlled by multiple promoters, in which promoter IV contributes significantly to activity-dependent Bdnf transcription. We have generated promoter IV mutant mice [brain-derived neurotrophic factor (BDNF)-KIV] in which promoter IV-driven expression of BDNF is selectively disrupted by inserting a green fluorescent protein (GFP)-STOP cassette within the Bdnf exon IV locus. BDNF-KIV animals exhibited depression-like behavior as shown by the tail suspension test (TST), sucrose preference test (SPT) and learned helplessness test (LHT). In addition, BDNF-KIV mice showed reduced activity in the open field test (OFT) and reduced food intake in the novelty-suppressed feeding test (NSFT). The mutant mice did not display anxiety-like behavior in the light and dark box test and elevated plus maze tests. Interestingly, the mutant mice showed defective response inhibition in the passive avoidance test (PAT) even though their learning ability was intact when measured with the active avoidance test (AAT). These results suggest that promoter IV-dependent BDNF expression plays a critical role in the control of mood-related behaviors. This is the first study that directly addressed the effects of endogenous promoter-driven expression of BDNF in depression-like behavior. © 2010 The Authors. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

Salmonella DNA Adenine Methylase Mutants Confer Cross-Protective Immunity

PubMed Central

Heithoff, Douglas M.; Enioutina, Elena Y.; Daynes, Raymond A.; Sinsheimer, Robert L.; Low, David A.; Mahan, Michael J.

2001-01-01

Salmonella isolates that lack or overproduce DNA adenine methylase (Dam) elicited a cross-protective immune response to different Salmonella serovars. The protection afforded by the Salmonella enterica serovar Typhimurium Dam vaccine was greater than that elicited in mice that survived a virulent infection. S. enterica serovar Typhimurium Dam mutant strains exhibited enhanced sensitivity to mediators of innate immunity such as antimicrobial peptides, bile salts, and hydrogen peroxide. Also, S. enterica serovar Typhimurium Dam− vaccines were not immunosuppressive; unlike wild-type vaccines, they failed to induce increased nitric oxide levels and permitted a subsequent robust humoral response to diptheria toxoid antigen in infected mice. Dam mutant strains exhibited a low-grade persistence which, coupled with the nonimmunosuppression and the ectopic protein expression caused by altered levels of Dam, may provide an expanded source of potential antigens in vaccinated hosts. PMID:11598044

Oncogenic activation of c-Abl in non-small cell lung cancer cells lacking FUS1 expression: inhibition of c-Abl by the tumor suppressor gene product Fus1.

PubMed

Lin, J; Sun, T; Ji, L; Deng, W; Roth, J; Minna, J; Arlinghaus, R

2007-10-25

In lung cancer, frequent loss of one allele of chromosome 3p is seen in both small cell lung cancer and non-small cell lung cancer (NSCLC), providing evidence of tumor suppressor genes (TSGs) in this chromosomal region. The mechanism of Fus1 tumor suppressor activity is unknown. We have found that a Fus1 peptide inhibits the Abl tyrosine kinase in vitro (IC(50) 35 microM). The inhibitory Fus1 sequence was derived from a region that was deleted in a mutant FUS1 gene (FUS1 (1-80)) detected in some lung cancer cell lines. Importantly, a stearic acid-modified form of this peptide was required for the inhibition, but stearic acid alone was not inhibitory. Two NSCLC cell lines, which lack expression of wild-type Fus1, contain activated c-Abl. Forced expression of an inducible FUS1 cDNA in H1299 NSCLC cells decreased levels of activated c-Abl and inhibited its tyrosine kinase activity. Similarly, treatment of c-Abl immune complexes with the inhibitory Fus1 peptide also reduced the level of c-Abl in these immune complexes. The size and number of colonies of the NSCLC cell line, H1,299, in soft agar was strongly inhibited by the Abl kinase inhibitor imatinib mesylate. Co-expression of FUS1 and c-ABL in COS1 cells blocked activation of c-Abl tyrosine kinase. In contrast, co-expression of mutant FUS1 (1-80) with c-ABL had little inhibitory activity against c-Abl. These findings provide strong evidence that c-Abl is a possible target in NSCLC patients that have reduced expression of Fus1 in their tumor cells.

Transmembrane transporter expression regulated by the glucosylceramide pathway in Cryptococcus neoformans.

PubMed

Singh, Arpita; Rella, Antonella; Schwacke, John; Vacchi-Suzzi, Caterina; Luberto, Chiara; Del Poeta, Maurizio

2015-11-16

The sphingolipid glucosylceramide (GlcCer) and factors involved in the fungal GlcCer pathways were shown earlier to be an integral part of fungal virulence, especially in fungal replication at 37 °C, in neutral/alkaline pH and 5 % CO2 environments (e.g. alveolar spaces). Two mutants, ∆gcs 1 lacking glucosylceramide synthase 1 gene (GCS1) which catalyzes the formation of sphingolipid GlcCer from the C9-methyl ceramide and ∆smt1 lacking sphingolipid C9 methyltransferase gene (SMT1), which adds a methyl group to position nine of the sphingosine backbone of ceramide, of this pathway were attenuated in virulence and have a growth defect at the above-mentioned conditions. These mutants with either no or structurally modified GlcCer located on the cell-membrane have reduced membrane rigidity, which may have altered not only the physical location of membrane proteins but also their expression, as the pathogen's mode of adaptation to changing need. Importantly, pathogens are known to adapt themselves to the changing host environments by altering their patterns of gene expression. By transcriptional analysis of gene expression, we identified six genes whose expression was changed from their wild-type counterpart grown in the same conditions, i.e. they became either down regulated or up regulated in these two mutants. The microarray data was validated by real-time PCR, which confirmed their fold change in gene expression. All the six genes we identified, viz siderochrome-iron transporter (CNAG_02083), monosaccharide transporter (CNAG_05340), glucose transporter (CNAG_03772), membrane protein (CNAG_03912), membrane transport protein (CNAG_00539), and sugar transporter (CNAG_06963), are membrane-localized and have significantly altered gene expression levels. Therefore, we hypothesize that these genes function either independently or in tandem with a structurally modified cell wall/plasma membrane resulting from the modifications of the GlcCer pathway and thus possibly disrupt transmembrane signaling complex, which in turn contributes to cryptococcal osmotic, pH, ion homeostasis and its pathobiology. Six genes identified from gene expression microarrays by gene set enrichment analysis and validated by RT-PCR, are membrane located and associated with the growth defect at neutral-alkaline pH due to the absence and or presence of a structurally modified GlcCer. They may be involved in the transmembrane signaling network in Cryptococcus neoformans, and therefore the pathobiology of the fungus in these conditions.

Initiation of olfactory placode development and neurogenesis is blocked in mice lacking both Six1 and Six4.

PubMed

Chen, Binglai; Kim, Eun-Hee; Xu, Pin-Xian

2009-02-01

Mouse olfactory epithelium (OE) originates from ectodermally derived placode, the olfactory placode that arises at the anterior end of the neural plate. Tissue grafting and recombination experiments suggest that the placode is derived from a common preplacodal domain around the neural plate and its development is directed by signals arising from the underlying mesoderm and adjacent neuroectoderm. In mice, loss of Six1 affects OE morphogenesis but not placode formation. We show here that embryos lacking both Six1 and Six4 failed to form the olfactory placode but the preplacodal region appeared to be specified as judged by the expression of Eya2, which marks the common preplacodal domain, suggesting a synergistic requirement of Six1 and Six4 in patterning the preplacodal ectoderm to a morphologic placode. Our results show that Six1 and Six4 are coexpressed in the preplacodal ectoderm from E8.0. In the olfactory pit, Six4 expression was observed in the peripheral precursors that overlap with Mash1-expressing cells, the early committed neuronal lineage. In contrast, Six1 is highly distributed in the peripheral regions where stem cells reside at E10.5 and it overlaps with Sox2 expression. Both genes are expressed in the basal and apical neuronal progenitors in the OE. Analyses of Six1;Six4 double mutant embryos demonstrated that the slightly thickened epithelium observed in the mutant was not induced for neuronal development. In contrast, in Six1(-/-) embryos, all neuronal lineage markers were initially expressed but the pattern of their expression was altered. Although very few, the pioneer neurons were initially present in the Six1 mutant OE. However, neurogenesis ceased by E12.5 due to markedly increased cell apoptosis and reduced proliferation, thus defining the cellular defects occurring in Six1(-/-) OE that have not been previously observed. Our findings demonstrate that Six1/4 function at the top of early events controlling olfactory placode formation and neuronal development. Our analyses show that the threshold of Six1/4 may be crucial for the expression of olfactory specific genes and that Six1 and Six4 may act synergistically to mediate olfactory placode specification and patterning through Fgf and Bmp signaling pathways.

Mutants of Streptomyces cattleya defective in the synthesis of a factor required for thienamycin production.

PubMed

Buchan, T; Roach, C; Ruby, C; Taylor, D; Preisig, C; Reeves, C

1994-09-01

Thienamycin non-producing mutants of Streptomydes cattleya were identified that displayed a cross-feeding relationship. A diffusible product from one of these mutants (RK-11) resulted in restoration of thienamycin production when fed to cultures of another mutant (RK-4). In vivo radiolabeling experiments were conducted to test whether the RK-11 mutant produced a late biosynthetic intermediate which contained a carbapenem ring and a cysteaminyl and/or a hydroxyethyl side chain. Both [35S]cystine and [methyl-3H]methionine were used to label the RK-11 product which was then fed to RK-4 cultures. None of the thienamycin subsequently produced by RK-4 converter cells was labeled, implying the lack of either side chain of the thienamycin molecule in the RK-11 product. Further stability studies suggested that the RK-11 product does not contain a carbapenem ring. Additional feeding experiments with RK-4 cells also ruled out the possibility that the RK-11 product is a co-factor necessary for thienamycin production. It is concluded that the RK-11 product may regulate expression of the thienamycin gene cluster.

Transcriptomic and molecular genetic analysis of the cell wall salvage response of Aspergillus niger to the absence of galactofuranose synthesis.

PubMed

Park, Joohae; Hulsman, Mark; Arentshorst, Mark; Breeman, Matthijs; Alazi, Ebru; Lagendijk, Ellen L; Rocha, Marina C; Malavazi, Iran; Nitsche, Benjamin M; van den Hondel, Cees A M J J; Meyer, Vera; Ram, Arthur F J

2016-09-01

The biosynthesis of cell surface-located galactofuranose (Galf)-containing glycostructures such as galactomannan, N-glycans and O-glycans in filamentous fungi is important to secure the integrity of the cell wall. UgmA encodes an UDP-galactopyranose mutase, which is essential for the formation of Galf. Consequently, the ΔugmA mutant lacks Galf-containing molecules. Our previous work in Aspergillus niger work suggested that loss of function of ugmA results in activation of the cell wall integrity (CWI) pathway which is characterized by increased expression of the agsA gene, encoding an α-glucan synthase. In this study, the transcriptional response of the ΔugmA mutant was further linked to the CWI pathway by showing the induced and constitutive phosphorylation of the CWI-MAP kinase in the ΔugmA mutant. To identify genes involved in cell wall remodelling in response to the absence of galactofuranose biosynthesis, a genome-wide expression analysis was performed using RNAseq. Over 400 genes were higher expressed in the ΔugmA mutant compared to the wild-type. These include genes that encode enzymes involved in chitin (gfaB, gnsA, chsA) and α-glucan synthesis (agsA), and in β-glucan remodelling (bgxA, gelF and dfgC), and also include several glycosylphosphatidylinositol (GPI)-anchored cell wall protein-encoding genes. In silico analysis of the 1-kb promoter regions of the up-regulated genes in the ΔugmA mutant indicated overrepresentation of genes with RlmA, MsnA, PacC and SteA-binding sites. The importance of these transcription factors for survival of the ΔugmA mutant was analysed by constructing the respective double mutants. The ΔugmA/ΔrlmA and ΔugmA/ΔmsnA double mutants showed strong synthetic growth defects, indicating the importance of these transcription factors to maintain cell wall integrity in the absence of Galf biosynthesis. © 2016 The Authors Cellular Microbiology Published by John Wiley & Sons Ltd.

Dental and Cranial Pathologies in Mice Lacking the Cl−/H+-Exchanger ClC-7

PubMed Central

WEN, Xin; LACRUZ, Rodrigo S.; PAINE, Michael L.

2015-01-01

ClC-7 is a 2Cl−/1H+-exchanger expressed at late endosomes and lysosomes, as well as the ruffled border of osteoclasts. ClC-7 deficiencies in mice and humans lead to impaired osteoclast function and therefore osteopetrosis. Failure of tooth eruption is also apparent in ClC-7 mutant animals, and this has been attributed to the osteoclast dysfunction and the subsequent defect in alveolar bone resorptive activity surrounding tooth roots. Ameloblasts also express ClC-7, and this study aims to determine the significance of ClC-7 in enamel formation by examining the dentitions of ClC-7 mutant mice. Micro-CT analysis revealed that the molar teeth of 3-week old ClC-7 mutant mice had no roots, and the incisors were smaller than their age-matched controls. Despite these notable developmental differences, the enamel and dentin densities of the mutant mice were comparable to those of the wild type littermates. Scanning electron microscopy (SEM) showed normal enamel crystallite and prismatic organization in the ClC-7 mutant mice, although the enamel was thinner (hypoplastic) than in controls. These results suggested that ClC-7 was not critical to enamel and dentin formation, and the observed tooth defects may be related more to a resulting alveolar bone phenotype. Micro-CT analysis also revealed abnormal features in the calvarial bones of the mutant mice. The cranial sutures in ClC-7 mutant mice remained open compared to the closed sutures seen in the control mice at 3 weeks. These data demonstrate that ClC-7 deficiency impacts the development of the dentition and calvaria, but does not significantly disrupt amelogenesis. PMID:25663454

Probing transcription-specific outputs of β-catenin in vivo

PubMed Central

Valenta, Tomas; Gay, Max; Steiner, Sarah; Draganova, Kalina; Zemke, Martina; Hoffmans, Raymond; Cinelli, Paolo; Aguet, Michel; Sommer, Lukas; Basler, Konrad

2011-01-01

β-Catenin, apart from playing a cell-adhesive role, is a key nuclear effector of Wnt signaling. Based on activity assays in Drosophila, we generated mouse strains where the endogenous β-catenin protein is replaced by mutant forms, which retain the cell adhesion function but lack either or both of the N- and the C-terminal transcriptional outputs. The C-terminal activity is essential for mesoderm formation and proper gastrulation, whereas N-terminal outputs are required later during embryonic development. By combining the double-mutant β-catenin with a conditional null allele and a Wnt1-Cre driver, we probed the role of Wnt/β-catenin signaling in dorsal neural tube development. While loss of β-catenin protein in the neural tube results in severe cell adhesion defects, the morphology of cells and tissues expressing the double-mutant form is normal. Surprisingly, Wnt/β-catenin signaling activity only moderately regulates cell proliferation, but is crucial for maintaining neural progenitor identity and for neuronal differentiation in the dorsal spinal cord. Our model animals thus allow dissecting signaling and structural functions of β-catenin in vivo and provide the first genetic tool to generate cells and tissues that entirely and exclusively lack canonical Wnt pathway activity. PMID:22190459

Identification of Mutant Genes and Introgressed Tiger Salamander DNA in the Laboratory Axolotl, Ambystoma mexicanum.

PubMed

Woodcock, M Ryan; Vaughn-Wolfe, Jennifer; Elias, Alexandra; Kump, D Kevin; Kendall, Katharina Denise; Timoshevskaya, Nataliya; Timoshevskiy, Vladimir; Perry, Dustin W; Smith, Jeramiah J; Spiewak, Jessica E; Parichy, David M; Voss, S Randal

2017-01-31

The molecular genetic toolkit of the Mexican axolotl, a classic model organism, has matured to the point where it is now possible to identify genes for mutant phenotypes. We used a positional cloning-candidate gene approach to identify molecular bases for two historic axolotl pigment phenotypes: white and albino. White (d/d) mutants have defects in pigment cell morphogenesis and differentiation, whereas albino (a/a) mutants lack melanin. We identified in white mutants a transcriptional defect in endothelin 3 (edn3), encoding a peptide factor that promotes pigment cell migration and differentiation in other vertebrates. Transgenic restoration of Edn3 expression rescued the homozygous white mutant phenotype. We mapped the albino locus to tyrosinase (tyr) and identified polymorphisms shared between the albino allele (tyr a ) and tyr alleles in a Minnesota population of tiger salamanders from which the albino trait was introgressed. tyr a has a 142 bp deletion and similar engineered alleles recapitulated the albino phenotype. Finally, we show that historical introgression of tyr a significantly altered genomic composition of the laboratory axolotl, yielding a distinct, hybrid strain of ambystomatid salamander. Our results demonstrate the feasibility of identifying genes for traits in the laboratory Mexican axolotl.

Lack of AcrB Efflux Function Confers Loss of Virulence on Salmonella enterica Serovar Typhimurium

PubMed Central

Wang-Kan, Xuan; Chirullo, Barbara; Betts, Jonathan; La Ragione, Roberto M.; Ivens, Alasdair; Ricci, Vito; Opperman, Timothy J.

2017-01-01

ABSTRACT AcrAB-TolC is the paradigm resistance-nodulation-division (RND) multidrug resistance efflux system in Gram-negative bacteria, with AcrB being the pump protein in this complex. We constructed a nonfunctional AcrB mutant by replacing D408, a highly conserved residue essential for proton translocation. Western blotting confirmed that the AcrB D408A mutant had the same native level of expression of AcrB as the parental strain. The mutant had no growth deficiencies in rich or minimal medium. However, compared with wild-type SL1344, the mutant had increased accumulation of Hoechst 33342 dye and decreased efflux of ethidium bromide and was multidrug hypersusceptible. The D408A mutant was attenuated in vivo in mouse and Galleria mellonella models and showed significantly reduced invasion into intestinal epithelial cells and macrophages in vitro. A dose-dependent inhibition of invasion was also observed when two different efflux pump inhibitors were added to the wild-type strain during infection of epithelial cells. RNA sequencing (RNA-seq) revealed downregulation of bacterial factors necessary for infection, including those in the Salmonella pathogenicity islands 1, 2, and 4; quorum sensing genes; and phoPQ. Several general stress response genes were upregulated, probably due to retention of noxious molecules inside the bacterium. Unlike loss of AcrB protein, loss of efflux function did not induce overexpression of other RND efflux pumps. Our data suggest that gene deletion mutants are unsuitable for studying membrane transporters and, importantly, that inhibitors of AcrB efflux function will not induce expression of other RND pumps. PMID:28720734

A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

PubMed

Kück, Ulrich

2005-10-01

Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

Comparison of the Gene Expression Profiles from Normal and Fgfrl1 Deficient Mouse Kidneys Reveals Downstream Targets of Fgfrl1 Signaling

PubMed Central

Gerber, Simon D.; Amann, Ruth; Wyder, Stefan; Trueb, Beat

2012-01-01

Fgfrl1 (fibroblast growth factor receptor-like 1) is a transmembrane receptor that is essential for the development of the metanephric kidney. It is expressed in all nascent nephrogenic structures and in the ureteric bud. Fgfrl1 null mice fail to develop the metanephric kidneys. Mutant kidney rudiments show a dramatic reduction of ureteric branching and a lack of mesenchymal-to-epithelial transition. Here, we compared the expression profiles of wildtype and Fgfrl1 mutant kidneys to identify genes that act downstream of Fgfrl1 signaling during the early steps of nephron formation. We detected 56 differentially expressed transcripts with 2-fold or greater reduction, among them many genes involved in Fgf, Wnt, Bmp, Notch, and Six/Eya/Dach signaling. We validated the microarray data by qPCR and whole-mount in situ hybridization and showed the expression pattern of candidate genes in normal kidneys. Some of these genes might play an important role during early nephron formation. Our study should help to define the minimal set of genes that is required to form a functional nephron. PMID:22432025

Lifespan decrease in a Caenorhabditis elegans mutant lacking TRX-1, a thioredoxin expressed in ASJ sensory neurons.

PubMed

Miranda-Vizuete, Antonio; Fierro González, Juan Carlos; Gahmon, Gabriele; Burghoorn, Jan; Navas, Plácido; Swoboda, Peter

2006-01-23

Thioredoxins are a class of small proteins that play a key role in regulating many cellular redox processes. We report here the characterization of the first member of the thioredoxin family in metazoans that is mainly associated with neurons. The Caenorhabditis elegans gene B0228.5 encodes a thioredoxin (TRX-1) that is expressed in ASJ ciliated sensory neurons, and to some extent also in the posterior-most intestinal cells. TRX-1 is active at reducing protein disulfides in the presence of a heterologous thioredoxin reductase. A mutant worm strain carrying a null allele of the trx-1 gene displays a reproducible decrease in both mean and maximum lifespan when compared to wild-type. The identification and characterization of TRX-1 paves the way to use C. elegans as an in vivo model to study the role of thioredoxins in lifespan and nervous system physiology and pathology.

Functional domains of the poliovirus receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koike, Satoshi; Ise, Iku; Nomoto, Akio

1991-05-15

A number of mutant cDNAs of the human poliovirus receptor were constructed to identify essential regions of the molecule as the receptor. All mutant cDNAs carrying the sequence coding for the entire N-terminal immunoglobulin-like domain (domain I) confer permissiveness for poliovirus to mouse L cells, but a mutant cDNA lacking the sequence for domain I does not. The transformants permissive for poliovirus were able to bind the virus and were also recognized by monoclonal antibody D171, which competes with poliovirus for the cellular receptor. These results strongly suggest that the poliovirus binding site resides in domain I of the receptor.more » Mutant cDNAs for the sequence encoding the intracellular peptide were also constructed and expressed in mouse L cells. Susceptibility of these cells to poliovirus revealed that the entire putative cytoplasmic domain is not essential for virus infection. Thus, the cytoplasmic domain of the molecule appears not to play a role in the penetration of poliovirus.« less

Loss of Atg16 delays the alcohol-induced sedation response via regulation of Corazonin neuropeptide production in Drosophila.

PubMed

Varga, Kata; Nagy, Péter; Arsikin Csordás, Katarina; Kovács, Attila L; Hegedűs, Krisztina; Juhász, Gábor

2016-10-06

Autophagy defects lead to the buildup of damaged proteins and organelles, reduced survival during starvation and infections, hypersensitivity to stress and toxic substances, and progressive neurodegeneration. Here we show that, surprisingly, Drosophila mutants lacking the core autophagy gene Atg16 are not only defective in autophagy but also exhibit increased resistance to the sedative effects of ethanol, unlike Atg7 or Atg3 null mutant flies. This mutant phenotype is rescued by the re-expression of Atg16 in Corazonin (Crz)-producing neurosecretory cells that are known to promote the sedation response during ethanol exposure, and RNAi knockdown of Atg16 specifically in these cells also delays the onset of ethanol-induced coma. We find that Atg16 and Crz colocalize within these neurosecretory cells, and both Crz protein and mRNA levels are decreased in Atg16 mutant flies. Thus, Atg16 promotes Crz production to ensure a proper organismal sedation response to ethanol.

Adaptation to copper stress influences biofilm formation in Alteromonas macleodii.

PubMed

Cusick, Kathleen D; Dale, Jason R; Fitzgerald, Lisa A; Little, Brenda J; Biffinger, Justin C

2017-07-01

An Alteromonas macleodii strain was isolated from copper-containing coupons incubated in surface seawater (Key West, FL, USA). In addition to the original isolate, a copper-adapted mutant was created and maintained with 0.78 mM Cu 2+ . Biofilm formation was compared between the two strains under copper-amended and low-nutrient conditions. Biofilm formation was significantly increased in the original isolate under copper amendment, while biofilm formation was significantly higher in the mutant under low-nutrient conditions. Biofilm expression profiles of diguanylate cyclase (DGC) genes, as well as genes involved in secretion, differed between the strains. Comparative genomic analysis demonstrated that both strains possessed a large number of gene attachment harboring cyclic di-GMP synthesis and/or degradation domains. One of the DGC genes, induced at very high levels in the mutant, possessed a degradation domain in the original isolate that was lacking in the mutant. The genetic and transcriptional mechanisms contributing to biofilm formation are discussed.

Dampened Hedgehog signaling but normal Wnt signaling in zebrafish without cilia

PubMed Central

Huang, Peng; Schier, Alexander F.

2009-01-01

Summary Cilia have been implicated in Hedgehog (Hh) and Wnt signaling in mouse but not in Drosophila. To determine whether the role of cilia is conserved in zebrafish, we generated maternal-zygotic (MZ) oval (ovl; ift88) mutants that lack all cilia. MZovl mutants display normal canonical and non-canonical Wnt signaling but show defects in Hh signaling. As in mouse, zebrafish cilia are required to mediate the activities of Hh, Ptc, Smo and PKA. However, in contrast to mouse Ift88 mutants, which show a dramatic reduction in Hh signaling, zebrafish MZovl mutants display dampened, but expanded, Hh pathway activity. This activity is largely due to gli1, the expression of which is fully dependent on Hh signaling in mouse but not in zebrafish. These results reveal a conserved requirement for cilia in transducing the activity of upstream regulators of Hh signaling but distinct phenotypic effects due to differential regulation and differing roles of transcriptional mediators. PMID:19700616

A dual selection based, targeted gene replacement tool for Magnaporthe grisea and Fusarium oxysporum.

PubMed

Khang, Chang Hyun; Park, Sook-Young; Lee, Yong-Hwan; Kang, Seogchan

2005-06-01

Rapid progress in fungal genome sequencing presents many new opportunities for functional genomic analysis of fungal biology through the systematic mutagenesis of the genes identified through sequencing. However, the lack of efficient tools for targeted gene replacement is a limiting factor for fungal functional genomics, as it often necessitates the screening of a large number of transformants to identify the desired mutant. We developed an efficient method of gene replacement and evaluated factors affecting the efficiency of this method using two plant pathogenic fungi, Magnaporthe grisea and Fusarium oxysporum. This method is based on Agrobacterium tumefaciens-mediated transformation with a mutant allele of the target gene flanked by the herpes simplex virus thymidine kinase (HSVtk) gene as a conditional negative selection marker against ectopic transformants. The HSVtk gene product converts 5-fluoro-2'-deoxyuridine to a compound toxic to diverse fungi. Because ectopic transformants express HSVtk, while gene replacement mutants lack HSVtk, growing transformants on a medium amended with 5-fluoro-2'-deoxyuridine facilitates the identification of targeted mutants by counter-selecting against ectopic transformants. In addition to M. grisea and F. oxysporum, the method and associated vectors are likely to be applicable to manipulating genes in a broad spectrum of fungi, thus potentially serving as an efficient, universal functional genomic tool for harnessing the growing body of fungal genome sequence data to study fungal biology.

Activation of the Saccharomyces cerevisiae filamentation/invasion pathway by osmotic stress in high-osmolarity glycogen pathway mutants

NASA Technical Reports Server (NTRS)

Davenport, K. D.; Williams, K. E.; Ullmann, B. D.; Gustin, M. C.; McIntire, L. V. (Principal Investigator)

1999-01-01

Mitogen-activated protein kinase (MAPK) cascades are frequently used signal transduction mechanisms in eukaryotes. Of the five MAPK cascades in Saccharomyces cerevisiae, the high-osmolarity glycerol response (HOG) pathway functions to sense and respond to hypertonic stress. We utilized a partial loss-of-function mutant in the HOG pathway, pbs2-3, in a high-copy suppressor screen to identify proteins that modulate growth on high-osmolarity media. Three high-copy suppressors of pbs2-3 osmosensitivity were identified: MSG5, CAK1, and TRX1. Msg5p is a dual-specificity phosphatase that was previously demonstrated to dephosphorylate MAPKs in yeast. Deletions of the putative MAPK targets of Msg5p revealed that kss1delta could suppress the osmosensitivity of pbs2-3. Kss1p is phosphorylated in response to hyperosmotic shock in a pbs2-3 strain, but not in a wild-type strain nor in a pbs2-3 strain overexpressing MSG5. Both TEC1 and FRE::lacZ expressions are activated in strains lacking a functional HOG pathway during osmotic stress in a filamentation/invasion-pathway-dependent manner. Additionally, the cellular projections formed by a pbs2-3 mutant on high osmolarity are absent in strains lacking KSS1 or STE7. These data suggest that the loss of filamentation/invasion pathway repression contributes to the HOG mutant phenotype.

Activation of the Saccharomyces cerevisiae filamentation/invasion pathway by osmotic stress in high-osmolarity glycogen pathway mutants.

PubMed Central

Davenport, K D; Williams, K E; Ullmann, B D; Gustin, M C

1999-01-01

Mitogen-activated protein kinase (MAPK) cascades are frequently used signal transduction mechanisms in eukaryotes. Of the five MAPK cascades in Saccharomyces cerevisiae, the high-osmolarity glycerol response (HOG) pathway functions to sense and respond to hypertonic stress. We utilized a partial loss-of-function mutant in the HOG pathway, pbs2-3, in a high-copy suppressor screen to identify proteins that modulate growth on high-osmolarity media. Three high-copy suppressors of pbs2-3 osmosensitivity were identified: MSG5, CAK1, and TRX1. Msg5p is a dual-specificity phosphatase that was previously demonstrated to dephosphorylate MAPKs in yeast. Deletions of the putative MAPK targets of Msg5p revealed that kss1delta could suppress the osmosensitivity of pbs2-3. Kss1p is phosphorylated in response to hyperosmotic shock in a pbs2-3 strain, but not in a wild-type strain nor in a pbs2-3 strain overexpressing MSG5. Both TEC1 and FRE::lacZ expressions are activated in strains lacking a functional HOG pathway during osmotic stress in a filamentation/invasion-pathway-dependent manner. Additionally, the cellular projections formed by a pbs2-3 mutant on high osmolarity are absent in strains lacking KSS1 or STE7. These data suggest that the loss of filamentation/invasion pathway repression contributes to the HOG mutant phenotype. PMID:10545444

Astrocytes expressing mutant SOD1 and TDP43 trigger motoneuron death that is mediated via sodium channels and nitroxidative stress

PubMed Central

Rojas, Fabiola; Cortes, Nicole; Abarzua, Sebastian; Dyrda, Agnieszka; van Zundert, Brigitte

2013-01-01

Amyotrophic lateral sclerosis (ALS) is a fatal paralytic disorder caused by dysfunction and degeneration of motor neurons. Multiple disease-causing mutations, including in the genes for SOD1 and TDP-43, have been identified in ALS. Astrocytes expressing mutant SOD1 are strongly implicated in the pathogenesis of ALS: we have shown that media conditioned by astrocytes carrying mutant SOD1G93A contains toxic factor(s) that kill motoneurons by activating voltage-sensitive sodium (Nav) channels. In contrast, a recent study suggests that astrocytes expressing mutated TDP43 contribute to ALS pathology, but do so via cell-autonomous processes and lack non-cell-autonomous toxicity. Here we investigate whether astrocytes that express diverse ALS-causing mutations release toxic factor(s) that induce motoneuron death, and if so, whether they do so via a common pathogenic pathway. We exposed primary cultures of wild-type spinal cord cells to conditioned medium derived from astrocytes (ACM) that express SOD1 (ACM-SOD1G93A and ACM-SOD1G86R) or TDP43 (ACM-TDP43A315T) mutants; we show that such exposure rapidly (within 30–60 min) increases dichlorofluorescein (DCF) fluorescence (indicative of nitroxidative stress) and leads to extensive motoneuron-specific death within a few days. Co-application of the diverse ACMs with anti-oxidants Trolox or esculetin (but not with resveratrol) strongly improves motoneuron survival. We also find that co-incubation of the cultures in the ACMs with Nav channel blockers (including mexiletine, spermidine, or riluzole) prevents both intracellular nitroxidative stress and motoneuron death. Together, our data document that two completely unrelated ALS models lead to the death of motoneuron via non-cell-autonomous processes, and show that astrocytes expressing mutations in SOD1 and TDP43 trigger such cell death through a common pathogenic pathway that involves nitroxidative stress, induced at least in part by Nav channel activity. PMID:24570655

The Bmi-1 helix-turn and ring finger domains are required for Bmi-1 antagonism of (-) epigallocatechin-3-gallate suppression of skin cancer cell survival.

PubMed

Balasubramanian, Sivaprakasam; Scharadin, Tiffany M; Han, Bingshe; Xu, Wen; Eckert, Richard L

2015-07-01

The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (-) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21(Cip1) and p27(Kip1) expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix-turn-helix-turn-helix-turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. Copyright © 2015 Elsevier Inc. All rights reserved.

Wt1 dictates the fate of fetal and adult Leydig cells during development in the mouse testis.

PubMed

Wen, Qing; Zheng, Qiao-Song; Li, Xi-Xia; Hu, Zhao-Yuan; Gao, Fei; Cheng, C Yan; Liu, Yi-Xun

2014-12-15

Wilms' tumor 1 (Wt1) is a tumor suppressor gene encoding ∼24 zinc finger transcription factors. In the mammalian testis, Wt1 is expressed mostly by Sertoli cells (SCs) involved in testis development, spermatogenesis, and adult Leydig cell (ALC) steroidogenesis. Global knockout (KO) of Wt1 is lethal in mice due to defects in embryogenesis. Herein, we showed that Wt1 is involved in regulating fetal Leydig cell (FLC) degeneration and ALC differentiation during testicular development. Using Wt1(-/flox);Amh-Cre mice that specifically deleted Wt1 in the SC vs. age-matched wild-type (WT) controls, FLC-like-clusters were found in Wt1-deficient testes that remained mitotically active from postnatal day 1 (P1) to P56, and no ALC was detected at these ages. Leydig cells in mutant adult testes displayed morphological features of FLC. Also, FLC-like cells in adult mutant testes had reduced expression in ALC-associated genes Ptgds, Sult1e1, Vcam1, Hsd11b1, Hsd3b6, and Hsd17b3 but high expression of FLC-associated genes Thbs2 and Hsd3b1. Whereas serum LH and testosterone level in mutant mice were not different from controls, intratesticular testosterone level was significantly reduced. Deletion of Wt1 gene also perturbed the expression of steroidogenic enzymes Star, P450c17, Hsd3b6, Hsd3b1, Hsd17b1, and Hsd17b3. FLCs in adult mutant testes failed to convert androstenedione to testosterone due to a lack of Hsd17b3, and this defect was rescued by coculturing with fetal SCs. In summary, FLC-like cells in mutant testes are putative FLCs that remain mitotically active in adult mice, illustrating that Wt1 dictates the fate of FLC and ALC during postnatal testis development. Copyright © 2014 the American Physiological Society.

Dominant-negative inhibitors of the Clostridium perfringens epsilon-toxin.

PubMed

Pelish, Teal M; McClain, Mark S

2009-10-23

The Clostridium perfringens epsilon-toxin is responsible for a severe, often lethal intoxication. In this study, we characterized dominant-negative inhibitors of the epsilon-toxin. Site-specific mutations were introduced into the gene encoding epsilon-toxin, and recombinant proteins were expressed in Escherichia coli. Paired cysteine substitutions were introduced at locations predicted to form a disulfide bond. One cysteine in each mutant was introduced into the membrane insertion domain of the toxin; the second cysteine was introduced into the protein backbone. Mutant proteins with cysteine substitutions at amino acid positions I51/A114 and at V56/F118 lacked detectable cytotoxic activity in a MDCK cell assay. Cytotoxic activity could be reconstituted in both mutant proteins by incubation with dithiothreitol, indicating that the lack of cytotoxic activity was attributable to the formation of a disulfide bond. Fluorescent labeling of the cysteines also indicated that the introduced cysteines participated in a disulfide bond. When equimolar mixtures of wild-type epsilon-toxin and mutant proteins were added to MDCK cells, the I51C/A114C and V56C/F118C mutant proteins each inhibited the activity of wild-type epsilon-toxin. Further analysis of the inhibitory activity of the I51C/A114C and V56C/F118C mutant proteins indicated that these proteins inhibit the ability of the active toxin to form stable oligomeric complexes in the context of MDCK cells. These results provide further insight into the properties of dominant-negative inhibitors of oligomeric pore-forming toxins and provide the basis for developing new therapeutics for treating intoxication by epsilon-toxin.

Articular cartilage endurance and resistance to osteoarthritic changes require transcription factor Erg.

PubMed

Ohta, Yoichi; Okabe, Takahiro; Larmour, Colleen; Di Rocco, Agnese; Maijenburg, Marijke W; Phillips, Amanda; Speck, Nancy A; Wakitani, Shigeyuki; Nakamura, Takashi; Yamada, Yoshihiko; Enomoto-Iwamoto, Motomi; Pacifici, Maurizio; Iwamoto, Masahiro

2015-10-01

To determine whether and how the transcription factor Erg participates in the genesis, establishment, and maintenance of articular cartilage. Floxed Erg mice were mated with Gdf5-Cre mice to generate conditional mutants lacking Erg in their joints. Joints of mutant and control mice were subjected to morphologic and molecular characterization and also to experimental surgically induced osteoarthritis (OA). Gene expression, promoter reporter assays, and gain- and loss-of-function in vitro tests were used to characterize molecular mechanisms of Erg action. Conditional Erg ablation did not elicit obvious changes in limb joint development and overall phenotype in juvenile mice. However, as mice aged, joints of mutant mice degenerated spontaneously and exhibited clear OA-like phenotypic defects. Joints in juvenile mutant mice were more sensitive to surgically induced OA and became defective sooner than operated joints in control mice. Global gene expression data and other studies identified parathyroid hormone-related protein (PTHrP) and lubricin as possible downstream effectors and mediators of Erg action in articular chondrocytes. Reporter assays using control and mutated promoter-enhancer constructs indicated that Erg acted on Ets DNA binding sites to stimulate PTHrP expression. Erg was up-regulated in severely affected areas in human OA articular cartilage but remained barely appreciable in areas of less affected cartilage. The study shows for the first time that Erg is a critical molecular regulator of the endurance of articular cartilage during postnatal life and that Erg can mitigate spontaneous and experimental OA. Erg appears to do this through regulating expression of PTHrP and lubricin, factors known for their protective roles in joints. © 2015, American College of Rheumatology.

Metal Tolerance Protein 8 Mediates Manganese Homeostasis and Iron Reallocation during Seed Development and Germination.

PubMed

Eroglu, Seckin; Giehl, Ricardo F H; Meier, Bastian; Takahashi, Michiko; Terada, Yasuko; Ignatyev, Konstantin; Andresen, Elisa; Küpper, Hendrik; Peiter, Edgar; von Wirén, Nicolaus

2017-07-01

Metal accumulation in seeds is a prerequisite for germination and establishment of plants but also for micronutrient delivery to humans. To investigate metal transport processes and their interactions in seeds, we focused on METAL TOLERANCE PROTEIN8 (MTP8), a tonoplast transporter of the manganese (Mn) subclade of cation diffusion facilitators, which in Arabidopsis ( Arabidopsis thaliana ) is expressed in embryos of seeds. The x-ray fluorescence imaging showed that expression of MTP8 was responsible for Mn localization in subepidermal cells on the abaxial side of the cotyledons and in cortical cells of the hypocotyl. Accordingly, under low Mn availability, MTP8 increased seed stores of Mn, required for efficient seed germination. In mutant embryos lacking expression of VACUOLAR IRON TRANSPORTER1 ( VIT1 ), MTP8 built up iron (Fe) hotspots in MTP8 -expressing cells types, suggesting that MTP8 transports Fe in addition to Mn. In mtp8 vit1 double mutant seeds, Mn and Fe were distributed in all cell types of the embryo. An Fe transport function of MTP8 was confirmed by its ability to complement Fe hypersensitivity of a yeast mutant defective in vacuolar Fe transport. Imbibing mtp8-1 mutant seeds in the presence of Mn or subjecting seeds to wet-dry cycles showed that MTP8 conferred Mn tolerance. During germination, MTP8 promoted reallocation of Fe from the vasculature. These results indicate that cell type-specific accumulation of Mn and Fe in seeds depends on MTP8 and that this transporter plays an important role in the generation of seed metal stores as well as for metal homeostasis and germination efficiency under challenging environmental conditions. © 2017 American Society of Plant Biologists. All Rights Reserved.

Metal Tolerance Protein 8 Mediates Manganese Homeostasis and Iron Reallocation during Seed Development and Germination1[OPEN

PubMed Central

Takahashi, Michiko; Terada, Yasuko

2017-01-01

Metal accumulation in seeds is a prerequisite for germination and establishment of plants but also for micronutrient delivery to humans. To investigate metal transport processes and their interactions in seeds, we focused on METAL TOLERANCE PROTEIN8 (MTP8), a tonoplast transporter of the manganese (Mn) subclade of cation diffusion facilitators, which in Arabidopsis (Arabidopsis thaliana) is expressed in embryos of seeds. The x-ray fluorescence imaging showed that expression of MTP8 was responsible for Mn localization in subepidermal cells on the abaxial side of the cotyledons and in cortical cells of the hypocotyl. Accordingly, under low Mn availability, MTP8 increased seed stores of Mn, required for efficient seed germination. In mutant embryos lacking expression of VACUOLAR IRON TRANSPORTER1 (VIT1), MTP8 built up iron (Fe) hotspots in MTP8-expressing cells types, suggesting that MTP8 transports Fe in addition to Mn. In mtp8 vit1 double mutant seeds, Mn and Fe were distributed in all cell types of the embryo. An Fe transport function of MTP8 was confirmed by its ability to complement Fe hypersensitivity of a yeast mutant defective in vacuolar Fe transport. Imbibing mtp8-1 mutant seeds in the presence of Mn or subjecting seeds to wet-dry cycles showed that MTP8 conferred Mn tolerance. During germination, MTP8 promoted reallocation of Fe from the vasculature. These results indicate that cell type-specific accumulation of Mn and Fe in seeds depends on MTP8 and that this transporter plays an important role in the generation of seed metal stores as well as for metal homeostasis and germination efficiency under challenging environmental conditions. PMID:28461400

A Mutant Connexin50 with Enhanced Hemichannel Function Leads to Cell Death

PubMed Central

Minogue, Peter J.; Tong, Jun-Jie; Arora, Anita; Russell-Eggitt, Isabelle; Hunt, David M.; Moore, Anthony T.; Ebihara, Lisa; Beyer, Eric C.; Berthoud, Viviana M.

2009-01-01

PURPOSE To determine the consequences of expression of a novel connexin50 (CX50) mutant identified in a child with congenital total cataracts. METHODS The GJA8 gene was directly sequenced. Formation of functional channels was assessed by two-microelectrode voltage-clamp. Connexin protein levels and distribution were assessed by immunoblotting and immunofluorescence. The proportion of apoptotic cells was determined by flow cytometry. RESULTS Direct sequencing of the GJA8 gene identified a 137 G>T transition that resulted in the replacement of glycine by valine at position 46 of the coding region of CX50 (CX50G46V). Both CX50 and CX50G46V induced gap junctional currents in pairs of Xenopus oocytes. In single Xenopus oocytes, CX50G46V induced connexin hemichannel currents that were activated by removal of external calcium; their magnitudes were much higher than those in oocytes injected with similar amounts of CX50 cRNA. When expressed in HeLa cells under the control of an inducible promoter, both CX50 and CX50G46V formed gap junctional plaques. Induction of CX50G46V expression led to a decrease in cell number and an increase in the proportion of apoptotic cells. CX50G46V-induced cell death was prevented by high concentrations of extracellular calcium ions. CONCLUSIONS Unlike previously characterized CX50 mutants that exhibit impaired trafficking and/or lack of function, CX50G46V traffics properly to the plasma membrane and forms functional hemichannels and gap junction channels; however, it causes cell death even when expressed at minute levels. The biochemical results indirectly suggest a potential novel mechanism by which connexin mutants could lead to cataracts: cytotoxicity due to enhanced hemichannel function. PMID:19684000

Familial Amyotrophic Lateral Sclerosis-linked Mutations in Profilin 1 Exacerbate TDP-43-induced Degeneration in the Retina of Drosophila melanogaster through an Increase in the Cytoplasmic Localization of TDP-43.

PubMed

Matsukawa, Koji; Hashimoto, Tadafumi; Matsumoto, Taisei; Ihara, Ryoko; Chihara, Takahiro; Miura, Masayuki; Wakabayashi, Tomoko; Iwatsubo, Takeshi

2016-11-04

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by progressive and selective loss of motor neurons. Causative genes for familial ALS (fALS), e.g. TARDBP or FUS/TLS, have been found, among which mutations within the profilin 1 (PFN1) gene have recently been identified in ALS18. To elucidate the mechanism whereby PFN1 mutations lead to neuronal death, we generated transgenic Drosophila melanogaster overexpressing human PFN1 in the retinal photoreceptor neurons. Overexpression of wild-type or fALS mutant PFN1 caused no degenerative phenotypes in the retina. Double overexpression of fALS mutant PFN1 and human TDP-43 markedly exacerbated the TDP-43-induced retinal degeneration, i.e. vacuolation and thinning of the retina, whereas co-expression of wild-type PFN1 did not aggravate the degenerative phenotype. Notably, co-expression of TDP-43 with fALS mutant PFN1 increased the cytoplasmic localization of TDP-43, the latter remaining in nuclei upon co-expression with wild-type PFN1, whereas co-expression of TDP-43 lacking the nuclear localization signal with the fALS mutant PFN1 did not aggravate the retinal degeneration. Knockdown of endogenous Drosophila PFN1 did not alter the degenerative phenotypes of the retina in flies overexpressing wild-type TDP-43 These data suggest that ALS-linked PFN1 mutations exacerbate TDP-43-induced neurodegeneration in a gain-of-function manner, possibly by shifting the localization of TDP-43 from nuclei to cytoplasm. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

ERECTA-family receptor kinases regulate stem cell homeostasis via buffering its cytokinin responsiveness in the shoot apical meristem.

PubMed

Uchida, Naoyuki; Shimada, Masanori; Tasaka, Masao

2013-03-01

Shoot apical meristems (SAMs), which are maintained at the tips of stems, are indeterminate structures and sources of stem cells from which all aerial organs are ultimately derived. Although mechanisms that regulate the homeostasis of the stem cells have been extensively investigated, identification of further unknown regulators should provide better understanding of the regulation. Here, we report that members of the Arabidopsis ERECTA (ER) receptor kinase family redundantly play a significant role in the regulation of stem cell homeostasis. In wild-type seedlings, the expression of WUSCHEL (WUS), a central regulator of the stem cell population, is stimulated by cytokinin. Interestingly, however, the SAM morphology and the expression of CLAVATA3 (CLV3), which is expressed in stem cells and therefore serves as a stem cell marker, are relatively stable against cytokinin treatment regardless of increased WUS expression. These findings indicate the presence of a mechanism to buffer stem cell homeostasis against an increase in cytokinin. Mutant seedlings lacking all ER-family members, which are expressed in the SAM, show an increase in the stem cell population and also the up-regulation of a cytokinin-responsive gene in the SAM. In this mutant, WUS expression is stimulated by cytokinin treatment as efficiently as in wild-type plants. However, in contrast to wild-type plants, SAM morphology and CLV3 expression respond drastically to cytokinin treatment, suggesting that the buffering mechanism to maintain stem cell homeostasis against an increase in cytokinin is severely impaired in this mutant. We suggest that the ER family regulates stem cell homeostasis via buffering its cytokinin responsiveness in the SAM.

FGF8 is essential for formation of the ductal system in the male reproductive tract

PubMed Central

Kitagaki, Jirouta; Ueda, Yutaka; Chi, Xuan; Sharma, Nirmala; Elder, Cynthia M.; Truffer, Erika; Costantini, Frank; Lewandoski, Mark; Perantoni, Alan O.

2011-01-01

During development of the urogenital tract, fibroblast growth factor 8 (Fgf8) is expressed in mesonephric tubules, but its role in this tissue remains undefined. An evaluation of previously generated T-Cre-mediated Fgf8-deficient mice (T-Cre; Fgf8flox/Δ2,3 mice), which lack Fgf8 expression in the mesoderm, revealed that the cranial region of the Wolffian duct degenerated prematurely and the cranial mesonephric tubules were missing. As a result, the epididymis, vas deferens and efferent ductules were largely absent in mutant mice. Rarb2-Cre was used to eliminate FGF8 from the mesonephric tubules but to allow expression in the adjacent somites. These mutants retained the cranial end of the Wolffian duct and formed the epididymis and vas deferens, but failed to elaborate the efferent ductules, indicating that Fgf8 expression by the mesonephric tubules is required specifically for the formation of the ductules. Ret knockout mice do not form the ureteric bud, a caudal outgrowth of the Wolffian duct and progenitor for the collecting duct network in the kidney, but they do develop the cranial end normally. This indicates that Fgf8, but not Ret, expression is essential to the outgrowth of the cranial mesonephric tubules from the Wolffian duct and to the development of major portions of the sex accessory tissues in the male reproductive tract. Mechanistically, FGF8 functions upstream of Lhx1 expression in forming the nephron, and analysis of Fgf8 mutants similarly shows deficient Lhx1 expression in the mesonephric tubules. These results demonstrate a multifocal requirement for FGF8 in establishing the male reproductive tract ducts and implicate Lhx1 signaling in tubule elongation. PMID:22110055

The Transcriptional Response of Lactobacillus sanfranciscensis DSM 20451T and Its tcyB Mutant Lacking a Functional Cystine Transporter to Diamide Stress

PubMed Central

Stetina, Mandy; Behr, Jürgen

2014-01-01

As a result of its strong adaptation to wheat and rye sourdoughs, Lactobacillus sanfranciscensis has the smallest genome within the genus Lactobacillus. The concomitant absence of some important antioxidative enzymes and the inability to synthesize glutathione suggest a role of cystine transport in maintenance of an intracellular thiol balance. Diamide [synonym 1,1′-azobis(N,N-dimethylformamide)] disturbs intracellular and membrane thiol levels in oxidizing protein thiols depending on its initial concentration. In this study, RNA sequencing was used to reveal the transcriptional response of L. sanfranciscensis DSM 20451T (wild type [WT]) and its ΔtcyB mutant with a nonfunctional cystine transporter after thiol stress caused by diamide. Along with the different expression of genes involved in amino acid starvation, pyrimidine synthesis, and energy production, our results show that thiol stress in the wild type can be compensated through activation of diverse chaperones and proteases whereas the ΔtcyB mutant shifts its metabolism in the direction of survival. Only a small set of genes are significantly differentially expressed between the wild type and the mutant. In the WT, mainly genes which are associated with a heat shock response are upregulated whereas glutamine import and synthesis genes are downregulated. In the ΔtcyB mutant, the whole opp operon was more highly expressed, as well as a protein which probably includes enzymes for methionine transport. The two proteins encoded by spxA and nrdH, which are involved in direct or indirect oxidative stress responses, are also upregulated in the mutant. This work emphasizes that even in the absence of definitive antioxidative enzymes, bacteria with a small genome and a high frequency of gene inactivation and elimination use small molecules such as the cysteine/cystine couple to overcome potential cell damage resulting from oxidative stress. PMID:24795368

The transcriptional response of Lactobacillus sanfranciscensis DSM 20451T and its tcyB mutant lacking a functional cystine transporter to diamide stress.

PubMed

Stetina, Mandy; Behr, Jürgen; Vogel, Rudi F

2014-07-01

As a result of its strong adaptation to wheat and rye sourdoughs, Lactobacillus sanfranciscensis has the smallest genome within the genus Lactobacillus. The concomitant absence of some important antioxidative enzymes and the inability to synthesize glutathione suggest a role of cystine transport in maintenance of an intracellular thiol balance. Diamide [synonym 1,1'-azobis(N,N-dimethylformamide)] disturbs intracellular and membrane thiol levels in oxidizing protein thiols depending on its initial concentration. In this study, RNA sequencing was used to reveal the transcriptional response of L. sanfranciscensis DSM 20451(T) (wild type [WT]) and its ΔtcyB mutant with a nonfunctional cystine transporter after thiol stress caused by diamide. Along with the different expression of genes involved in amino acid starvation, pyrimidine synthesis, and energy production, our results show that thiol stress in the wild type can be compensated through activation of diverse chaperones and proteases whereas the ΔtcyB mutant shifts its metabolism in the direction of survival. Only a small set of genes are significantly differentially expressed between the wild type and the mutant. In the WT, mainly genes which are associated with a heat shock response are upregulated whereas glutamine import and synthesis genes are downregulated. In the ΔtcyB mutant, the whole opp operon was more highly expressed, as well as a protein which probably includes enzymes for methionine transport. The two proteins encoded by spxA and nrdH, which are involved in direct or indirect oxidative stress responses, are also upregulated in the mutant. This work emphasizes that even in the absence of definitive antioxidative enzymes, bacteria with a small genome and a high frequency of gene inactivation and elimination use small molecules such as the cysteine/cystine couple to overcome potential cell damage resulting from oxidative stress. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Loss of Vacuolar H+-ATPase (V-ATPase) Activity in Yeast Generates an Iron Deprivation Signal That Is Moderated by Induction of the Peroxiredoxin TSA2 *

PubMed Central

Diab, Heba I.; Kane, Patricia M.

2013-01-01

Vacuolar H+-ATPases (V-ATPases) acidify intracellular organelles and help to regulate overall cellular pH. Yeast vma mutants lack V-ATPase activity and allow exploration of connections between cellular pH, iron, and redox homeostasis common to all eukaryotes. A previous microarray study in a vma mutant demonstrated up-regulation of multiple iron uptake genes under control of Aft1p (the iron regulon) and only one antioxidant gene, the peroxiredoxin TSA2 (Milgrom, E., Diab, H., Middleton, F., and Kane, P. M. (2007) Loss of vacuolar proton-translocating ATPase activity in yeast results in chronic oxidative stress. J. Biol. Chem. 282, 7125–7136). Fluorescent biosensors placing GFP under transcriptional control of either an Aft1-dependent promoter (PFIT2-GFP) or the TSA2 promoter (PTSA2-GFP) were constructed to monitor transcriptional signaling. Both biosensors were up-regulated in the vma2Δ mutant, and acute V-ATPase inhibition with concanamycin A induced coordinate up-regulation from both promoters. PTSA2-GFP induction was Yap1p-dependent, indicating an oxidative stress signal. Total cell iron measurements indicate that the vma2Δ mutant is iron-replete, despite up-regulation of the iron regulon. Acetic acid up-regulated PFIT2-GFP expression in wild-type cells, suggesting that loss of pH control contributes to an iron deficiency signal in the mutant. Iron supplementation significantly decreased PFIT2-GFP expression and, surprisingly, restored PTSA2-GFP to wild-type levels. A tsa2Δ mutation induced both nuclear localization of Aft1p and PFIT2-GFP expression. The data suggest a novel function for Tsa2p as a negative regulator of Aft1p-driven transcription, which is induced in V-ATPase mutants to limit transcription of the iron regulon. This represents a new mechanism bridging the antioxidant and iron-regulatory pathways that is intimately linked to pH homeostasis. PMID:23457300

Prolonged Stationary-Phase Incubation Selects for lrp Mutations in Escherichia coli K-12

PubMed Central

Zinser, Erik R.; Kolter, Roberto

2000-01-01

Evolution by natural selection occurs in cultures of Escherichia coli maintained under carbon starvation stress. Mutants of increased fitness express a growth advantage in stationary phase (GASP) phenotype, enabling them to grow and displace the parent as the majority population. The first GASP mutation was identified as a loss-of-function allele of rpoS, encoding the stationary-phase global regulator, ςS (M. M. Zambrano, D. A. Siegele, M. A. Almirón, A. Tormo, and R. Kolter, Science 259:1757–1760, 1993). We now report that a second global regulator, Lrp, can also play a role in stationary-phase competition. We found that a mutant that took over an aged culture of an rpoS strain had acquired a GASP mutation in lrp. This GASP allele, lrp-1141, encodes a mutant protein lacking the critical glycine in the turn of the helix-turn-helix DNA-binding domain. The lrp-1141 allele behaves as a null mutation when in single copy and is dominant negative when overexpressed. Hence, the mutant protein appears to retain stability and the ability to dimerize but lacks DNA-binding activity. We also demonstrated that a lrp null allele generated by a transposon insertion has a fitness gain identical to that of the lrp-1141 allele, verifying that cells lacking Lrp activity have a competitive advantage during prolonged starvation. Finally, we tested by genetic analysis the hypothesis that the lrp-1141 GASP mutation confers a fitness gain by enhancing amino acid catabolism during carbon starvation. We found that while amino acid catabolism may play a role, it is not necessary for the lrp GASP phenotype, and hence the lrp GASP phenotype is due to more global physiological changes. PMID:10894750

GOLDEN2-LIKE transcription factors coordinate the tolerance to Cucumber mosaic virus in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Xue-Ying; Li, Peng-Xu; Zou, Li-Juan

Arabidopsis thaliana GOLDEN2-LIKE (GLKs) transcription factors play important roles in regulation of photosynthesis-associated nuclear genes, as well as participate in chloroplast development. However, the involvement of GLKs in plants resistance to virus remains largely unknown. Here, the relationship between GLKs and Cucumber mosaic virus (CMV) stress response was investigated. Our results showed that the Arabidopsis glk1glk2 double-mutant was more susceptible to CMV infection and suffered more serious damages (such as higher oxidative damages, more compromised in PSII photochemistry and more reactive oxygen species accumulation) when compared with the wild-type plants. Interestingly, there was little difference between single mutant (glk1 ormore » glk2) and wild-type plants in response to CMV infection, suggesting GLK1 and GLK2 might function redundant in virus resistance in Arabidopsis. Furthermore, the induction of antioxidant system and defense-associated genes expression in the double mutant were inhibited when compared with single mutant or wild-type plants after CMV infection. Further evidences showed that salicylic acid (SA) and jasmonic acid (JA) might be involved in GLKs-mediated virus resistance, as SA or JA level and synthesis-related genes transcription were impaired in glk1glk2 mutant. Taken together, our results indicated that GLKs played a positively role in virus resistance in Arabidopsis. - Highlights: • GLKs play a positive role in CMV resistance in Arabidopsis. • Defective of GLKs suffered more ROS accumulation. • Arabidopsis lacking GLKs have damaged photosynthesis. • Arabidopsis lacking GLKs show low SA and JA accumulation.« less

Purification of Legiobactin and importance of this siderophore in lung infection by Legionella pneumophila.

PubMed

Allard, Kimberly A; Dao, Jenny; Sanjeevaiah, Prakash; McCoy-Simandle, Kessler; Chatfield, Christa H; Crumrine, David S; Castignetti, Domenic; Cianciotto, Nicholas P

2009-07-01

When cultured in a low-iron medium, Legionella pneumophila secretes a siderophore (legiobactin) that is both reactive in the chrome azurol S (CAS) assay and capable of stimulating the growth of iron-starved legionellae. Using anion-exchange high-pressure liquid chromatography (HPLC), we purified legiobactin from culture supernatants of a virulent strain of L. pneumophila. In the process, we detected the ferrated form of legiobactin as well as other CAS-reactive substances. Purified legiobactin had a yellow-gold color and absorbed primarily from 220 nm and below. In accordance, nuclear magnetic resonance spectroscopy revealed that legiobactin lacks aromatic carbons, and among the 13 aliphatics present, there were 3 carbonyls. When examined by HPLC, supernatants from L. pneumophila mutants inactivated for lbtA and lbtB completely lacked legiobactin, indicating that the LbtA and LbtB proteins are absolutely required for siderophore activity. Independently derived lbtA mutants, but not a complemented derivative, displayed a reduced ability to infect the lungs of A/J mice after intratracheal inoculation, indicating that legiobactin is required for optimal intrapulmonary survival by L. pneumophila. This defect, however, was not evident when the lbtA mutant and its parental strain were coinoculated into the lung, indicating that legiobactin secreted by the wild type can promote growth of the mutant in trans. Legiobactin mutants grew normally in murine lung macrophages and alveolar epithelial cells, suggesting that legiobactin promotes something other than intracellular infection of resident lung cells. Overall, these data represent the first documentation of a role for siderophore expression in the virulence of L. pneumophila.

Intergenotypic replacement of lyssavirus matrix proteins demonstrates the role of lyssavirus M proteins in intracellular virus accumulation.

PubMed

Finke, Stefan; Granzow, Harald; Hurst, Jose; Pollin, Reiko; Mettenleiter, Thomas C

2010-02-01

Lyssavirus assembly depends on the matrix protein (M). We compared lyssavirus M proteins from different genotypes for their ability to support assembly and egress of genotype 1 rabies virus (RABV). Transcomplementation of M-deficient RABV with M from European bat lyssavirus (EBLV) types 1 and 2 reduced the release of infectious virus. Stable introduction of the heterogenotypic M proteins into RABV led to chimeric viruses with reduced virus release and intracellular accumulation of virus genomes. Although the chimeras indicated genotype-specific evolution of M, rapid selection of a compensatory mutant suggested conserved mechanisms of lyssavirus assembly and the requirement for only few adaptive mutations to fit the heterogenotypic M to a RABV backbone. Whereas the compensatory mutant replicated to similar infectious titers as RABV M-expressing virus, ultrastructural analysis revealed that both nonadapted EBLV M chimeras and the compensatory mutant differed from RABV M expressing viruses in the lack of intracellular viruslike structures that are enveloped and accumulate in cisterna of the degranulated and dilated rough endoplasmic reticulum compartment. Moreover, all viruses were able to bud at the plasma membrane. Since the lack of the intracellular viruslike structures correlated with the type of M protein but not with the efficiency of virus release, we hypothesize that the M proteins of EBLV-1 and RABV differ in their target membranes for virus assembly. Although the biological function of intracellular assembly and accumulation of viruslike structures in the endoplasmic reticulum remain unclear, the observed differences could contribute to diverse host tropism or pathogenicity.

EphB2 guides axons at the midline and is necessary for normal vestibular function

NASA Technical Reports Server (NTRS)

Cowan, C. A.; Yokoyama, N.; Bianchi, L. M.; Henkemeyer, M.; Fritzsch, B.

2000-01-01

Mice lacking the EphB2 receptor tyrosine kinase display a cell-autonomous, strain-specific circling behavior that is associated with vestibular phenotypes. In mutant embryos, the contralateral inner ear efferent growth cones exhibit inappropriate pathway selection at the midline, while in mutant adults, the endolymph-filled lumen of the semicircular canals is severely reduced. EphB2 is expressed in the endolymph-producing dark cells in the inner ear epithelium, and these cells show ultrastructural defects in the mutants. A molecular link to fluid regulation is provided by demonstrating that PDZ domain-containing proteins that bind the C termini of EphB2 and B-ephrins can also recognize the cytoplasmic tails of anion exchangers and aquaporins. This suggests EphB2 may regulate ionic homeostasis and endolymph fluid production through macromolecular associations with membrane channels that transport chloride, bicarbonate, and water.

Salmonella promotes virulence by repressing cellulose production

PubMed Central

Pontes, Mauricio H.; Lee, Eun-Jin; Choi, Jeongjoon; Groisman, Eduardo A.

2015-01-01

Cellulose is the most abundant organic polymer on Earth. In bacteria, cellulose confers protection against environmental insults and is a constituent of biofilms typically formed on abiotic surfaces. We report that, surprisingly, Salmonella enterica serovar Typhimurium makes cellulose when inside macrophages. We determine that preventing cellulose synthesis increases virulence, whereas stimulation of cellulose synthesis inside macrophages decreases virulence. An attenuated mutant lacking the mgtC gene exhibited increased cellulose levels due to increased expression of the cellulose synthase gene bcsA and of cyclic diguanylate, the allosteric activator of the BcsA protein. Inactivation of bcsA restored wild-type virulence to the Salmonella mgtC mutant, but not to other attenuated mutants displaying a wild-type phenotype regarding cellulose. Our findings indicate that a virulence determinant can promote pathogenicity by repressing a pathogen's antivirulence trait. Moreover, they suggest that controlling antivirulence traits increases long-term pathogen fitness by mediating a trade-off between acute virulence and transmission. PMID:25848006

OsCSLD1, a cellulose synthase-like D1 gene, is required for root hair morphogenesis in rice.

PubMed

Kim, Chul Min; Park, Sung Han; Je, Byoung Il; Park, Su Hyun; Park, Soon Ju; Piao, Hai Long; Eun, Moo Young; Dolan, Liam; Han, Chang-deok

2007-03-01

Root hairs are long tubular outgrowths that form on the surface of specialized epidermal cells. They are required for nutrient and water uptake and interact with the soil microflora. Here we show that the Oryza sativa cellulose synthase-like D1 (OsCSLD1) gene is required for root hair development, as rice (Oryza sativa) mutants that lack OsCSLD1 function develop abnormal root hairs. In these mutants, while hair development is initiated normally, the hairs elongate less than the wild-type hairs and they have kinks and swellings along their length. Because the csld1 mutants develop the same density and number of root hairs along their seminal root as the wild-type plants, we propose that OsCSLD1 function is required for hair elongation but not initiation. Both gene trap expression pattern and in situ hybridization analyses indicate that OsCSLD1 is expressed in only root hair cells. Furthermore, OsCSLD1 is the only member of the four rice CSLD genes that shows root-specific expression. Given that the Arabidopsis (Arabidopsis thaliana) gene KOJAK/AtCSLD3 is required for root hair elongation and is expressed in the root hair, it appears that OsCSLD1 may be the functional ortholog of KOJAK/AtCSLD3 and that these two genes represent the root hair-specific members of this family of proteins. Thus, at least part of the mechanism of root hair morphogenesis in Arabidopsis is conserved in rice.

90K Glycoprotein Promotes Degradation of Mutant β-Catenin Lacking the ISGylation or Phosphorylation Sites in the N-terminus.

PubMed

Park, So-Yeon; Yoon, Somy; Kim, Hangun; Kim, Kyung Keun

2016-10-01

β-Catenin is a major transducer of the Wnt signaling pathway, which is aberrantly expressed in colorectal and other cancers. Previously, we showed that β-catenin is downregulated by the 90K glycoprotein via ISGylation-dependent degradation. However, the further mechanisms of β-catenin degradation by 90K-mediated ISGylation pathway were not investigated. This study aimed to identify the β-catenin domain responsible for the action of 90K and to compare the mechanism of 90K on β-catenin degradation with phosphorylation-dependent ubiquitinational degradation of β-catenin. The deletion mutants of β-catenin lacking N- or C-terminal domain or mutating the N-terminal lysine or nonlysine residue were employed to delineate the characteristics of β-catenin degradation by 90K-mediated ISGylation pathway. 90K induced Herc5 and ISG15 expression and reduced β-catenin levels in HeLa and CSC221 cells. The N-terminus of β-catenin is required for 90K-induced β-catenin degradation, but the N-terminus of β-catenin is not essential for interaction with Herc5. However, substituting lysine residues in the N-terminus of β-catenin with arginine or deleting serine or threonine residue containing domains from the N-terminus does not affect 90K-induced β-catenin degradation, indicating that the N-terminal 86 amino acids of β-catenin are crucial for 90K-mediated ISGylation/degradation of β-catenin in which the responsible lysine or nonlysine residues were not identified. Our present results highlight the action of 90K on promoting degradation of mutant β-catenin lacking the phosphorylation sites in the N-terminus. It provides further insights into the discrete pathway downregulating the stabilized β-catenin via acquiring mutations at the serine/threonine residues in the N-terminus. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Norepinephrine is required to promote wakefulness and for hypocretin-induced arousal in zebrafish

PubMed Central

Singh, Chanpreet; Oikonomou, Grigorios; Prober, David A

2015-01-01

Pharmacological studies in mammals suggest that norepinephrine (NE) plays an important role in promoting arousal. However, the role of endogenous NE is unclear, with contradicting reports concerning the sleep phenotypes of mice lacking NE due to mutation of dopamine β-hydroxylase (dbh). To investigate NE function in an alternative vertebrate model, we generated dbh mutant zebrafish. In contrast to mice, these animals exhibit dramatically increased sleep. Surprisingly, despite an increase in sleep, dbh mutant zebrafish have a reduced arousal threshold. These phenotypes are also observed in zebrafish treated with small molecules that inhibit NE signaling, suggesting that they are caused by the lack of NE. Using genetic overexpression of hypocretin (Hcrt) and optogenetic activation of hcrt-expressing neurons, we also find that NE is important for Hcrt-induced arousal. These results establish a role for endogenous NE in promoting arousal and indicate that NE is a critical downstream effector of Hcrt neurons. DOI: http://dx.doi.org/10.7554/eLife.07000.001 PMID:26374985

Deficient Gene Expression in Protein Kinase Inhibitor α Null Mutant Mice

PubMed Central

Gangolli, Esha A.; Belyamani, Mouna; Muchinsky, Sara; Narula, Anita; Burton, Kimberly A.; McKnight, G. Stanley; Uhler, Michael D.; Idzerda, Rejean L.

2000-01-01

Protein kinase inhibitor (PKI) is a potent endogenous inhibitor of the cyclic AMP (cAMP)-dependent protein kinase (PKA). It functions by binding the free catalytic (C) subunit with a high affinity and is also known to export nuclear C subunit to the cytoplasm. The significance of these actions with respect to PKI's physiological role is not well understood. To address this, we have generated by homologous recombination mutant mice that are deficient in PKIα, one of the three isoforms of PKI. The mice completely lack PKI activity in skeletal muscle and, surprisingly, show decreased basal and isoproterenol-induced gene expression in muscle. Further examination revealed reduced levels of the phosphorylated (active) form of the transcription factor CREB (cAMP response element binding protein) in the knockouts. This phenomenon stems, at least in part, from lower basal PKA activity levels in the mutants, arising from a compensatory increase in the level of the RIα subunit of PKA. The deficit in gene induction, however, is not easily explained by current models of PKI function and suggests that PKI may play an as yet undescribed role in PKA signaling. PMID:10779334

Loss of DDB1 Leads to Transcriptional p53 Pathway Activation in Proliferating Cells, Cell Cycle Deregulation, and Apoptosis in Zebrafish Embryos.

PubMed

Hu, Zhilian; Holzschuh, Jochen; Driever, Wolfgang

2015-01-01

DNA damage-binding protein 1 (DDB1) is a large subunit of the heterodimeric DDB complex that recognizes DNA lesions and initiates the nucleotide excision repair process. DDB1 is also a component of the CUL4 E3 ligase complex involved in a broad spectrum of cellular processes by targeted ubiquitination of key regulators. Functions of DDB1 in development have been addressed in several model organisms, however, are not fully understood so far. Here we report an ENU induced mutant ddb1 allele (ddb1m863) identified in zebrafish (Danio rerio), and analyze its effects on development. Zebrafish ddb1 is expressed broadly, both maternally and zygotically, with enhanced expression in proliferation zones. The (ddb1m863 mutant allele affects the splice acceptor site of exon 20, causing a splicing defect that results in truncation of the 1140 amino acid protein after residue 800, lacking part of the β-propeller domain BPC and the C-terminal helical domain CTD. ddb1m863 zygotic mutant embryos have a pleiotropic phenotype, including smaller and abnormally shaped brain, head skeleton, eyes, jaw, and branchial arches, as well as reduced dopaminergic neuron groups. However, early forming tissues develop normally in zygotic ddb1m863 mutant embryos, which may be due to maternal rescue. In ddb1m863 mutant embryos, pcna-expressing proliferating cell populations were reduced, concurrent with increased apoptosis. We also observed a concomitant strong up-regulation of transcripts of the tumor suppressor p53 (tp53) and the cell cycle inhibitor cdkn1a (p21a/bCIP1/WAF1) in proliferating tissues. In addition, transcription of cyclin genes ccna2 and ccnd1 was deregulated in ddb1m863 mutants. Reduction of p53 activity by anti-sense morpholinos alleviated the apoptotic phenotype in ddb1m863 mutants. These results imply that Ddb1 may be involved in maintaining proper cell cycle progression and viability of dividing cells during development through transcriptional mechanisms regulating genes involved in cell cycle control and cell survival.

Modification of tRNALys UUU by Elongator Is Essential for Efficient Translation of Stress mRNAs

PubMed Central

Sansó, Miriam; Buhne, Karin; Carmona, Mercè; Paulo, Esther; Hermand, Damien; Rodríguez-Gabriel, Miguel; Ayté, José; Leidel, Sebastian; Hidalgo, Elena

2013-01-01

The Elongator complex, including the histone acetyl transferase Sin3/Elp3, was isolated as an RNA polymerase II-interacting complex, and cells deficient in Elongator subunits display transcriptional defects. However, it has also been shown that Elongator mediates the modification of some tRNAs, modulating translation efficiency. We show here that the fission yeast Sin3/Elp3 is important for oxidative stress survival. The stress transcriptional program, governed by the Sty1-Atf1-Pcr1 pathway, is affected in mutant cells, but not severely. On the contrary, cells lacking Sin3/Elp3 cannot modify the uridine wobble nucleoside of certain tRNAs, and other tRNA modifying activities such as Ctu1-Ctu2 are also essential for normal tolerance to H2O2. In particular, a plasmid over-expressing the tRNALys UUU complements the stress-related phenotypes of Sin3/Elp3 mutant cells. We have determined that the main H2O2-dependent genes, including those coding for the transcription factors Atf1 and Pcr1, are highly expressed mRNAs containing a biased number of lysine-coding codons AAA versus AAG. Thus, their mRNAs are poorly translated after stress in cells lacking Sin3/Elp3 or Ctu2, whereas a mutated atf1 transcript with AAA-to-AAG lysine codons is efficiently translated in all strain backgrounds. Our study demonstrates that the lack of a functional Elongator complex results in stress phenotypes due to its contribution to tRNA modification and subsequent translation inefficiency of certain stress-induced, highly expressed mRNAs. These results suggest that the transcriptional defects of these strain backgrounds may be a secondary consequence of the deficient expression of a transcription factor, Atf1-Pcr1, and other components of the transcriptional machinery. PMID:23874237

Modification of tRNA(Lys) UUU by elongator is essential for efficient translation of stress mRNAs.

PubMed

Fernández-Vázquez, Jorge; Vargas-Pérez, Itzel; Sansó, Miriam; Buhne, Karin; Carmona, Mercè; Paulo, Esther; Hermand, Damien; Rodríguez-Gabriel, Miguel; Ayté, José; Leidel, Sebastian; Hidalgo, Elena

2013-01-01

The Elongator complex, including the histone acetyl transferase Sin3/Elp3, was isolated as an RNA polymerase II-interacting complex, and cells deficient in Elongator subunits display transcriptional defects. However, it has also been shown that Elongator mediates the modification of some tRNAs, modulating translation efficiency. We show here that the fission yeast Sin3/Elp3 is important for oxidative stress survival. The stress transcriptional program, governed by the Sty1-Atf1-Pcr1 pathway, is affected in mutant cells, but not severely. On the contrary, cells lacking Sin3/Elp3 cannot modify the uridine wobble nucleoside of certain tRNAs, and other tRNA modifying activities such as Ctu1-Ctu2 are also essential for normal tolerance to H2O2. In particular, a plasmid over-expressing the tRNA(Lys) UUU complements the stress-related phenotypes of Sin3/Elp3 mutant cells. We have determined that the main H2O2-dependent genes, including those coding for the transcription factors Atf1 and Pcr1, are highly expressed mRNAs containing a biased number of lysine-coding codons AAA versus AAG. Thus, their mRNAs are poorly translated after stress in cells lacking Sin3/Elp3 or Ctu2, whereas a mutated atf1 transcript with AAA-to-AAG lysine codons is efficiently translated in all strain backgrounds. Our study demonstrates that the lack of a functional Elongator complex results in stress phenotypes due to its contribution to tRNA modification and subsequent translation inefficiency of certain stress-induced, highly expressed mRNAs. These results suggest that the transcriptional defects of these strain backgrounds may be a secondary consequence of the deficient expression of a transcription factor, Atf1-Pcr1, and other components of the transcriptional machinery.

The Social Amoeba Polysphondylium pallidum Loses Encystation and Sporulation, but Can Still Erect Fruiting Bodies in the Absence of Cellulose

PubMed Central

Du, Qingyou; Schaap, Pauline

2014-01-01

Amoebas and other freely moving protists differentiate into walled cysts when exposed to stress. As cysts, amoeba pathogens are resistant to biocides, preventing treatment and eradication. Lack of gene modification procedures has left the mechanisms of encystation largely unexplored. Genetically tractable Dictyostelium discoideum amoebas require cellulose synthase for formation of multicellular fructifications with cellulose-rich stalk and spore cells. Amoebas of its distant relative Polysphondylium pallidum (Ppal), can additionally encyst individually in response to stress. Ppal has two cellulose synthase genes, DcsA and DcsB, which we deleted individually and in combination. Dcsa- mutants formed fruiting bodies with normal stalks, but their spore and cyst walls lacked cellulose, which obliterated stress-resistance of spores and rendered cysts entirely non-viable. A dcsa-/dcsb- mutant made no walled spores, stalk cells or cysts, although simple fruiting structures were formed with a droplet of amoeboid cells resting on an sheathed column of decaying cells. DcsB is expressed in prestalk and stalk cells, while DcsA is additionally expressed in spores and cysts. We conclude that cellulose is essential for encystation and that cellulose synthase may be a suitable target for drugs to prevent encystation and render amoeba pathogens susceptible to conventional antibiotics. PMID:25113829

Cytochrome oxidase assembly does not require catalytically active cytochrome C.

PubMed

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

Wild-type cells rescue genotypically Math1-null hair cells in the inner ears of chimeric mice.

PubMed

Du, Xiaoping; Jensen, Patricia; Goldowitz, Daniel; Hamre, Kristin M

2007-05-15

The transcription factor Math1 has been shown to be critical in the formation of hair cells (HCs) in the inner ear. However, the influence of environmental factors in HC specification suggests that cell extrinsic factors are also crucial to their development. To test whether extrinsic factors impact development of Math1-null (Math1(beta-Gal/beta-Gal)) HCs, we examined neonatal (postnatal ages P0-P4.5) Math1-null chimeric mice in which genotypically mutant and wild-type cells intermingle to form the inner ear. We provide the first direct evidence that Math1-null HCs are able to be generated and survive in the conducive chimeric environment. beta-Galactosidase expression was used to identify genetically mutant cells while cells were phenotypically defined as HCs by morphological characteristics notably the expression of HC-specific markers. Genotypically mutant HCs were found in all sensory epithelia of the inner ear at all ages examined. Comparable results were obtained irrespective of the wild-type component of the chimeric mice. Thus, genotypically mutant cells retain the competence to differentiate into HCs. The implication is that the lack of the Math1 gene in HC precursors can be overcome by environmental influences, such as cell-cell interactions with wild-type cells, to ultimately result in the formation of HCs.

Requirements for FGF3 and FGF10 during inner ear formation.

PubMed

Alvarez, Yolanda; Alonso, Maria Teresa; Vendrell, Victor; Zelarayan, Laura Cecilia; Chamero, Pablo; Theil, Thomas; Bösl, Michael R; Kato, Shigeaki; Maconochie, Mark; Riethmacher, Dieter; Schimmang, Thomas

2003-12-01

Members of the fibroblast growth factor (FGF) gene family control formation of the body plan and organogenesis in vertebrates. FGF3 is expressed in the developing hindbrain and has been shown to be involved in inner ear development of different vertebrate species, including zebrafish, Xenopus, chick and mouse. In the mouse, insertion of a neomycin resistance gene into the Fgf3 gene via homologous recombination results in severe developmental defects during differentiation of the otic vesicle. We have addressed the precise roles of FGF3 and other FGF family members during formation of the murine inner ear using both loss- and gain-of-function experiments. We generated a new mutant allele lacking the entire FGF3-coding region but surprisingly found no evidence for severe defects either during inner ear development or in the mature sensory organ, suggesting the functional involvement of other FGF family members during its formation. Ectopic expression of FGF10 in the developing hindbrain of transgenic mice leads to the formation of ectopic vesicles, expressing some otic marker genes and thus indicating a role for FGF10 during otic vesicle formation. Expression analysis of FGF10 during mouse embryogenesis reveals a highly dynamic pattern of expression in the developing hindbrain, partially overlapping with FGF3 expression and coinciding with formation of the inner ear. However, FGF10 mutant mice have been reported to display only mild defects during inner ear differentiation. We thus created double mutant mice for FGF3 and FGF10, which form severely reduced otic vesicles, suggesting redundant roles of these FGFs, acting in combination as neural signals for otic vesicle formation.

Burkholderia thailandensis oacA mutants facilitate the expression of Burkholderia mallei-like O polysaccharides.

PubMed

Brett, Paul J; Burtnick, Mary N; Heiss, Christian; Azadi, Parastoo; DeShazer, David; Woods, Donald E; Gherardini, Frank C

2011-02-01

Previous studies have shown that the O polysaccharides (OPS) expressed by Burkholderia mallei are similar to those produced by Burkholderia thailandensis except that they lack the 4-O-acetyl modifications on their 6-deoxy-α-l-talopyranosyl residues. In the present study, we describe the identification and characterization of an open reading frame, designated oacA, expressed by B. thailandensis that accounts for this phenomenon. Utilizing the B. thailandensis and B. mallei lipopolysaccharide (LPS)-specific monoclonal antibodies Pp-PS-W and 3D11, Western immunoblot analyses demonstrated that the LPS antigens expressed by the oacA mutant, B. thailandensis ZT0715, were antigenically similar to those produced by B. mallei ATCC 23344. In addition, immunoblot analyses demonstrated that when B. mallei ATCC 23344 was complemented in trans with oacA, it synthesized B. thailandensis-like LPS antigens. To elucidate the structure of the OPS moieties expressed by ZT0715, purified samples were analyzed via nuclear magnetic resonance spectroscopy. As predicted, these studies demonstrated that the loss of OacA activity influenced the O acetylation phenotype of the OPS moieties. Unexpectedly, however, the results indicated that the O methylation status of the OPS antigens was also affected by the loss of OacA activity. Nonetheless, it was revealed that the LPS moieties expressed by the oacA mutant reacted strongly with the B. mallei LPS-specific protective monoclonal antibody 9C1-2. Based on these findings, it appears that OacA is required for the 4-O acetylation and 2-O methylation of B. thailandensis OPS antigens and that ZT0715 may provide a safe and cost-effective source of B. mallei-like OPS to facilitate the synthesis of glanders subunit vaccine candidates.

Forced Expression of Heat Shock Protein 27 (Hsp27) Reverses P-Glycoprotein (ABCB1)-mediated Drug Efflux and MDR1 Gene Expression in Adriamycin-resistant Human Breast Cancer Cells*

PubMed Central

Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy

2011-01-01

Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846

Forced expression of heat shock protein 27 (Hsp27) reverses P-glycoprotein (ABCB1)-mediated drug efflux and MDR1 gene expression in Adriamycin-resistant human breast cancer cells.

PubMed

Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy

2011-09-23

Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.

Genetic inactivation of mGlu5 receptor improves motor coordination in the Grm1crv4 mouse model of SCAR13 ataxia.

PubMed

Bossi, Simone; Musante, Ilaria; Bonfiglio, Tommaso; Bonifacino, Tiziana; Emionite, Laura; Cerminara, Maria; Cervetto, Chiara; Marcoli, Manuela; Bonanno, Giambattista; Ravazzolo, Roberto; Pittaluga, Anna; Puliti, Aldamaria

2018-01-01

Deleterious mutations in the glutamate receptor metabotropic 1 gene (GRM1) cause a recessive form of cerebellar ataxia, SCAR13. GRM1 and GRM5 code for the metabotropic glutamate type 1 (mGlu1) and type 5 (mGlu5) receptors, respectively. Their different expression profiles suggest they could have distinct functional roles. In a previous study, homozygous mice lacking mGlu1 receptors (Grm1 crv4/crv4 ) and exhibiting ataxia presented cerebellar overexpression of mGlu5 receptors, that was proposed to contribute to the mouse phenotype. To test this hypothesis, we here crossed Grm1 crv4 and Grm5 ko mice to generate double mutants (Grm1 crv4/crv4 Grm5 ko/ko ) lacking both mGlu1 and mGlu5 receptors. Double mutants and control mice were analyzed for spontaneous behavior and for motor activity by rotarod and footprint analyses. In the same mice, the release of glutamate from cerebellar nerve endings (synaptosomes) elicited by 12mM KCl or by α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) was also evaluated. Motor coordination resulted improved in double mutants when compared to Grm1 crv4/crv4 mice. Furthermore, in in vitro studies, glutamate release elicited by both KCl depolarization and activation of AMPA autoreceptors resulted reduced in Grm1 crv4/crv4 mice compared to wild type mice, while it presented normal levels in double mutants. Moreover, we found that Grm1 crv4/crv4 mice showed reduced expression of GluA2/3 AMPA receptor subunits in cerebellar synaptosomes, while it resulted restored to wild type level in double mutants. To conclude, blocking of mGlu5 receptor reduced the dysregulation of glutamate transmission and improved motor coordination in the Grm1 crv4 mouse model of SCAR13, thus suggesting the possible usefulness of pharmacological therapies based on modulation of mGlu5 receptor activity for the treatment of this type of ataxia. Copyright © 2017 Elsevier Inc. All rights reserved.

Metabolic engineering of Escherichia coli for the biosynthesis of 2-pyrrolidone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jingwei; Kao, Emily; Wang, George

2-Pyrrolidone is a valuable bulk chemical with myriad applications as a solvent, polymer precursor and active pharmaceutical intermediate. A novel 2-pyrrolidone synthase, ORF27, from Streptomyces aizunensis was identified to catalyze the ring closing dehydration of γ-aminobutyrate. ORF27's tendency to aggregate was resolved by expression at low temperature and fusion to the maltose binding protein (MBP). Recombinant Escherichia coli was metabolically engineered for the production of 2-pyrrolidone from glutamate by expressing both the genes encoding GadB, a glutamate decarboxylase, and ORF27. Incorporation of a GadB mutant lacking H465 and T466, GadB_δHT, improved the efficiency of one-pot 2-pyrrolidone biosynthesis in vivo. Whenmore » the recombinant E. coli strain expressing the E. coli GadB_δHT mutant and the ORF27-MBP fusion was cultured in ZYM-5052 medium containing 9. g/L of l-glutamate, 7.7. g/L of l-glutamate was converted to 1.1. g/L of 2-pyrrolidone within 31. h, achieving 25% molar yield from the consumed substrate.« less

Lack of A-factor production induces the expression of nutrient scavenging and stress-related proteins in Streptomyces griseus.

PubMed

Birkó, Zsuzsanna; Swiatek, Magdalena; Szájli, Emília; Medzihradszky, Katalin F; Vijgenboom, Erik; Penyige, András; Keseru, Judit; van Wezel, Gilles P; Biró, Sándor

2009-10-01

The small gamma-butyrolactone A-factor is an important autoregulatory signaling molecule for the soil-inhabiting streptomycetes. Starvation is a major trigger for development, and nutrients are provided by degradation of the vegetative mycelium via a process of programmed cell death, reusing proteins, nucleic acids, and cell wall material. The A-factor regulon includes many extracellular hydrolases. Here we show via proteomics analysis that many nutrient-scavenging and stress-related proteins were overexpressed in an A-factor non-producing mutant of Streptomyces griseus B-2682. Transcript analysis showed that this is primarily due to differential transcription of the target genes during early development. The targets include proteins relating to nutrient stress and environmental stress and an orthologue of the Bacillus sporulation control protein Spo0M. The enhanced expression of these proteins underlines the stress that is generated by the absence of A-factor. Wild-type developmental gene expression was restored to the A-factor non-producing mutant by the signaling protein Factor C in line with our earlier observation that Factor C triggers A-factor production.

Metabolic engineering of Escherichia coli for the biosynthesis of 2-pyrrolidone

DOE PAGES

Zhang, Jingwei; Kao, Emily; Wang, George; ...

2016-12-01

2-Pyrrolidone is a valuable bulk chemical with myriad applications as a solvent, polymer precursor and active pharmaceutical intermediate. A novel 2-pyrrolidone synthase, ORF27, from Streptomyces aizunensis was identified to catalyze the ring closing dehydration of γ-aminobutyrate. ORF27's tendency to aggregate was resolved by expression at low temperature and fusion to the maltose binding protein (MBP). Recombinant Escherichia coli was metabolically engineered for the production of 2-pyrrolidone from glutamate by expressing both the genes encoding GadB, a glutamate decarboxylase, and ORF27. Incorporation of a GadB mutant lacking H465 and T466, GadB_δHT, improved the efficiency of one-pot 2-pyrrolidone biosynthesis in vivo. Whenmore » the recombinant E. coli strain expressing the E. coli GadB_δHT mutant and the ORF27-MBP fusion was cultured in ZYM-5052 medium containing 9. g/L of l-glutamate, 7.7. g/L of l-glutamate was converted to 1.1. g/L of 2-pyrrolidone within 31. h, achieving 25% molar yield from the consumed substrate.« less

Caenorhabditis elegans flamingo cadherin fmi-1 regulates GABAergic neuronal development.

PubMed

Najarro, Elvis Huarcaya; Wong, Lianna; Zhen, Mei; Carpio, Edgar Pinedo; Goncharov, Alexandr; Garriga, Gian; Lundquist, Erik A; Jin, Yishi; Ackley, Brian D

2012-03-21

In a genetic screen for regulators of synaptic morphology, we identified the single Caenorhabditis elegans flamingo-like cadherin fmi-1. The fmi-1 mutants exhibit defective axon pathfinding, reduced synapse number, aberrant synapse size and morphology, as well as an abnormal accumulation of synaptic vesicles at nonsynaptic regions. Although FMI-1 is primarily expressed in the nervous system, it is not expressed in the ventral D-type (VD) GABAergic motorneurons, which are defective in fmi-1 mutants. The axon and synaptic defects of VD neurons could be rescued when fmi-1 was expressed exclusively in non-VD neighboring neurons, suggesting a cell nonautonomous action of FMI-1. FMI-1 protein that lacked its intracellular domain still retained its ability to rescue the vesicle accumulation defects of GABAergic motorneurons, indicating that the extracellular domain was sufficient for this function of FMI-1 in GABAergic neuromuscular junction development. Mutations in cdh-4, a Fat-like cadherin, cause similar defects in GABAergic motorneurons. The cdh-4 is expressed by the VD neurons and seems to function in the same genetic pathway as fmi-1 to regulate GABAergic neuron development. Thus, fmi-1 and cdh-4 cadherins might act together to regulate synapse development and axon pathfinding.

GATA-Dependent Glutaminolysis Drives Appressorium Formation in Magnaporthe oryzae by Suppressing TOR Inhibition of cAMP/PKA Signaling

PubMed Central

Marroquin-Guzman, Margarita; Wilson, Richard A.

2015-01-01

Fungal plant pathogens are persistent and global food security threats. To invade their hosts they often form highly specialized infection structures, known as appressoria. The cAMP/ PKA- and MAP kinase-signaling cascades have been functionally delineated as positive-acting pathways required for appressorium development. Negative-acting regulatory pathways that block appressorial development are not known. Here, we present the first detailed evidence that the conserved Target of Rapamycin (TOR) signaling pathway is a powerful inhibitor of appressorium formation by the rice blast fungus Magnaporthe oryzae. We determined TOR signaling was activated in an M. oryzae mutant strain lacking a functional copy of the GATA transcription factor-encoding gene ASD4. Δasd4 mutant strains could not form appressoria and expressed GLN1, a glutamine synthetase-encoding orthologue silenced in wild type. Inappropriate expression of GLN1 increased the intracellular steady-state levels of glutamine in Δasd4 mutant strains during axenic growth when compared to wild type. Deleting GLN1 lowered glutamine levels and promoted appressorium formation by Δasd4 strains. Furthermore, glutamine is an agonist of TOR. Treating Δasd4 mutant strains with the specific TOR kinase inhibitor rapamycin restored appressorium development. Rapamycin was also shown to induce appressorium formation by wild type and Δcpka mutant strains on non-inductive hydrophilic surfaces but had no effect on the MAP kinase mutant Δpmk1. When taken together, we implicate Asd4 in regulating intracellular glutamine levels in order to modulate TOR inhibition of appressorium formation downstream of cPKA. This study thus provides novel insight into the metabolic mechanisms that underpin the highly regulated process of appressorium development. PMID:25901357

A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

PubMed

Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

2016-07-01

In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model.

A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus

PubMed Central

McGregor, Alistair

2016-01-01

In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107–179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

Decreased Anxiety-Like Behavior and Gαq/11-Dependent Responses in the Amygdala of Mice Lacking TRPC4 Channels

PubMed Central

Riccio, Antonio; Li, Yan; Tsvetkov, Evgeny; Gapon, Svetlana; Yao, Gui Lan; Smith, Kiersten S.; Engin, Elif; Rudolph, Uwe; Bolshakov, Vadim Y.

2014-01-01

Transient receptor potential (TRP) channels are abundant in the brain where they regulate transmission of sensory signals. The expression patterns of different TRPC subunits (TRPC1, 4, and 5) are consistent with their potential role in fear-related behaviors. Accordingly, we found recently that mutant mice lacking a specific TRP channel subunit, TRPC5, exhibited decreased innate fear responses. Both TRPC5 and another member of the same subfamily, TRPC4, form heteromeric complexes with the TRPC1 subunit (TRPC1/5 and TRPC1/4, respectively). As TRP channels with specific subunit compositions may have different functional properties, we hypothesized that fear-related behaviors could be differentially controlled by TRPCs with distinct subunit arrangements. In this study, we focused on the analysis of mutant mice lacking the TRPC4 subunit, which, as we confirmed in experiments on control mice, is expressed in brain areas implicated in the control of fear and anxiety. In behavioral experiments, we found that constitutive ablation of TRPC4 was associated with diminished anxiety levels (innate fear). Furthermore, knockdown of TRPC4 protein in the lateral amygdala via lentiviral-mediated gene delivery of RNAi mimicked the behavioral phenotype of constitutive TRPC4-null (TRPC4−/−) mouse. Recordings in brain slices demonstrated that these behavioral modifications could stem from the lack of TRPC4 potentiation in neurons in the lateral nucleus of the amygdala through two Gαq/11 protein-coupled signaling pathways, activated via Group I metabotropic glutamate receptors and cholecystokinin 2 receptors, respectively. Thus, TRPC4 and the structurally and functionally related subunit, TRPC5, may both contribute to the mechanisms underlying regulation of innate fear responses. PMID:24599464

Ectopic norrin induces growth of ocular capillaries and restores normal retinal angiogenesis in Norrie disease mutant mice.

PubMed

Ohlmann, Andreas; Scholz, Michael; Goldwich, Andreas; Chauhan, Bharesh K; Hudl, Kristiane; Ohlmann, Anne V; Zrenner, Eberhart; Berger, Wolfgang; Cvekl, Ales; Seeliger, Mathias W; Tamm, Ernst R

2005-02-16

Norrie disease is an X-linked retinal dysplasia that presents with congenital blindness, sensorineural deafness, and mental retardation. Norrin, the protein product of the Norrie disease gene (NDP), is a secreted protein of unknown biochemical function. Norrie disease (Ndp(y/-)) mutant mice that are deficient in norrin develop blindness, show a distinct failure in retinal angiogenesis, and completely lack the deep capillary layers of the retina. We show here that the transgenic expression of ectopic norrin under control of a lens-specific promoter restores the formation of a normal retinal vascular network in Ndp(y/-) mutant mice. The improvement in structure correlates with restoration of neuronal function in the retina. In addition, lenses of transgenic mice with ectopic expression of norrin show significantly more capillaries in the hyaloid vasculature that surrounds the lens during development. In vitro, lenses of transgenic mice in coculture with microvascular endothelial cells induce proliferation of the cells. Transgenic mice with ectopic expression of norrin show more bromodeoxyuridine-labeled retinal progenitor cells at embryonic day 14.5 and thicker retinas at postnatal life than wild-type littermates, indicating a putative direct neurotrophic effect of norrin. These data provide direct evidence that norrin induces growth of ocular capillaries and that pharmacologic modulation of norrin might be used for treatment of the vascular abnormalities associated with Norrie disease or other vascular disorders of the retina.

Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

PubMed Central

Arthur, A K; Höss, A; Fanning, E

1988-01-01

The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

Contralateral migration of oculomotor neurons is regulated by Slit/Robo signaling.

PubMed

Bjorke, Brielle; Shoja-Taheri, Farnaz; Kim, Minkyung; Robinson, G Eric; Fontelonga, Tatiana; Kim, Kyung-Tai; Song, Mi-Ryoung; Mastick, Grant S

2016-10-22

Oculomotor neurons develop initially like typical motor neurons, projecting axons out of the ventral midbrain to their ipsilateral targets, the extraocular muscles. However, in all vertebrates, after the oculomotor nerve (nIII) has reached the extraocular muscle primordia, the cell bodies that innervate the superior rectus migrate to join the contralateral nucleus. This motor neuron migration represents a unique strategy to form a contralateral motor projection. Whether migration is guided by diffusible cues remains unknown. We examined the role of Slit chemorepellent signals in contralateral oculomotor migration by analyzing mutant mouse embryos. We found that the ventral midbrain expresses high levels of both Slit1 and 2, and that oculomotor neurons express the repellent Slit receptors Robo1 and Robo2. Therefore, Slit signals are in a position to influence the migration of oculomotor neurons. In Slit 1/2 or Robo1/2 double mutant embryos, motor neuron cell bodies migrated into the ventral midbrain on E10.5, three days prior to normal migration. These early migrating neurons had leading projections into and across the floor plate. In contrast to the double mutants, embryos which were mutant for single Slit or Robo genes did not have premature migration or outgrowth on E10.5, demonstrating a cooperative requirement of Slit1 and 2, as well as Robo1 and 2. To test how Slit/Robo midline repulsion is modulated, we found that the normal migration did not require the receptors Robo3 and CXCR4, or the chemoattractant, Netrin 1. The signal to initiate contralateral migration is likely autonomous to the midbrain because oculomotor neurons migrate in embryos that lack either nerve outgrowth or extraocular muscles, or in cultured midbrains that lacked peripheral tissue. Overall, our results demonstrate that a migratory subset of motor neurons respond to floor plate-derived Slit repulsion to properly control the timing of contralateral migration.

Overexpression of the ADP (E3-11.6K) protein increases cell lysis and spread of adenovirus.

PubMed

Doronin, Konstantin; Toth, Karoly; Kuppuswamy, Mohan; Krajcsi, Peter; Tollefson, Ann E; Wold, William S M

2003-01-20

Adenoviruses replicate in the nucleus and induce lytic cell death. We have shown previously that efficient cell lysis and release of adenovirus from infected cells requires an 11.6-kDa protein named Adenovirus Death Protein (ADP). The adp gene is located in the early E3 transcription unit, but the gene is expressed primarily at very late stages of infection. The putative function of ADP was discerned previously from the use of virus mutants that lack functional ADP. Here we describe two adenovirus mutants, named VRX-006 and VRX-007, that overexpress ADP. VRX-006 lacks all other genes in the E3 region, and VRX-007 lacks all other E3 genes except 12.5K. VRX-006 and VRX-007 display the phenotype predicted by the proposed function for ADP: they produce early cytopathic effect, early cell lysis, large plaques, and increased cell-to-cell spread. They grow as well in cultured cells as does adenovirus type 5. These results are consistent with the conclusion that ADP functions in adenovirus infections to promote virus release from cells at the culmination of infection.

An opioid-like system regulating feeding behavior in C. elegans

PubMed Central

Cheong, Mi Cheong; Artyukhin, Alexander B; You, Young-Jai; Avery, Leon

2015-01-01

Neuropeptides are essential for the regulation of appetite. Here we show that neuropeptides could regulate feeding in mutants that lack neurotransmission from the motor neurons that stimulate feeding muscles. We identified nlp-24 by an RNAi screen of 115 neuropeptide genes, testing whether they affected growth. NLP-24 peptides have a conserved YGGXX sequence, similar to mammalian opioid neuropeptides. In addition, morphine and naloxone respectively stimulated and inhibited feeding in starved worms, but not in worms lacking NPR-17, which encodes a protein with sequence similarity to opioid receptors. Opioid agonists activated heterologously expressed NPR-17, as did at least one NLP-24 peptide. Worms lacking the ASI neurons, which express npr-17, did not response to naloxone. Thus, we suggest that Caenorhabditis elegans has an endogenous opioid system that acts through NPR-17, and that opioids regulate feeding via ASI neurons. Together, these results suggest C. elegans may be the first genetically tractable invertebrate opioid model. DOI: http://dx.doi.org/10.7554/eLife.06683.001 PMID:25898004

IDC1, a pezizomycotina-specific gene that belongs to the PaMpk1 MAP kinase transduction cascade of the filamentous fungus Podospora anserina.

PubMed

Jamet-Vierny, Corinne; Debuchy, Robert; Prigent, Magali; Silar, Philippe

2007-12-01

Components involved in the activation of the MAPK cascades in filamentous fungi are not well known. Here, we provide evidence that IDC1, a pezizomycotina-specific gene is involved along with the PaNox1 NADPH oxidase in the nuclear localization of the PaMpk1 MAP kinase, a prerequisite for MAPK activity. Mutants of IDC1 display the same phenotypes as mutants in PaNox1 and PaMpk1, i.e., lack of pigment and of aerial hyphae, female sterility, impairment in hyphal interference and inability to develop Crippled Growth cell degeneration. As observed for the PaNox1 mutant, IDC1 mutants are hypostatic to PaMpk1 mutants. IDC1 seems to play a key role in sexual reproduction. Indeed, fertility is diminished in strains with lower level of IDC1. In strains over-expressing IDC1, protoperithecia reach a later stage of development towards perithecia without fertilization; however, upon fertilization maturation of fertile perithecia is diminished and delayed. In addition, heterokaryon construction shows that IDC1 is necessary together with PaNox1 in the perithecial envelope but not in the dikaryon resulting from fertilization.

The role of RNase H2 in processing ribonucleotides incorporated during DNA replication.

PubMed

Williams, Jessica S; Gehle, Daniel B; Kunkel, Thomas A

2017-05-01

Saccharomyces cerevisiae RNase H2 resolves RNA-DNA hybrids formed during transcription and it incises DNA at single ribonucleotides incorporated during nuclear DNA replication. To distinguish between the roles of these two activities in maintenance of genome stability, here we investigate the phenotypes of a mutant of yeast RNase H2 (rnh201-RED; ribonucleotide excision defective) that retains activity on RNA-DNA hybrids but is unable to cleave single ribonucleotides that are stably incorporated into the genome. The rnh201-RED mutant was expressed in wild type yeast or in a strain that also encodes a mutant allele of DNA polymerase ε (pol2-M644G) that enhances ribonucleotide incorporation during DNA replication. Similar to a strain that completely lacks RNase H2 (rnh201Δ), the pol2-M644G rnh201-RED strain exhibits replication stress and checkpoint activation. Moreover, like its null mutant counterpart, the double mutant pol2-M644G rnh201-RED strain and the single mutant rnh201-RED strain delete 2-5 base pairs in repetitive sequences at a high rate that is topoisomerase 1-dependent. The results highlight an important role for RNase H2 in maintaining genome integrity by removing single ribonucleotides incorporated during DNA replication. Published by Elsevier B.V.

TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain

PubMed Central

Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A.; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

2014-01-01

Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology. PMID:24381309

TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain.

PubMed

Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

2014-05-15

Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology.

Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways

PubMed Central

Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz

2017-01-01

ABSTRACT The glucose/mannose-phosphotransferase system (PTS) permease EIIMan encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EIIFru, respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EIIMan. Expression of genes for EIIMan and EIIFru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN. Carbohydrate transport by EIIMan had a negative influence on expression of manLMN but not fruRKI. In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR. Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and express virulence-related traits. Mutants lacking the FruR regulator or a particular phosphofructokinase, FruK, display changes in expression of a large number of genes encoding transcriptional regulators, enzymes required for energy metabolism, biofilm development, biosynthetic and degradative processes, and tolerance of a spectrum of environmental stressors. Since fructose is a major component of the modern human diet, the results have substantial significance in the context of oral health and the development of dental caries. PMID:28821551

Flies lacking all synapsins are unexpectedly healthy but are impaired in complex behaviour.

PubMed

Godenschwege, Tanja A; Reisch, Dietmar; Diegelmann, Sören; Eberle, Kai; Funk, Natalja; Heisenberg, Martin; Hoppe, Viviane; Hoppe, Jürgen; Klagges, Bert R E; Martin, Jean-René; Nikitina, Ekaterina A; Putz, Gabi; Reifegerste, Rita; Reisch, Natascha; Rister, Jens; Schaupp, Michael; Scholz, Henrike; Schwärzel, Martin; Werner, Ursula; Zars, Troy D; Buchner, Sigrid; Buchner, Erich

2004-08-01

Vertebrate synapsins are abundant synaptic vesicle phosphoproteins that have been proposed to fine-regulate neurotransmitter release by phosphorylation-dependent control of synaptic vesicle motility. However, the consequences of a total lack of all synapsin isoforms due to a knock-out of all three mouse synapsin genes have not yet been investigated. In Drosophila a single synapsin gene encodes several isoforms and is expressed in most synaptic terminals. Thus the targeted deletion of the synapsin gene of Drosophila eliminates the possibility of functional knock-out complementation by other isoforms. Unexpectedly, synapsin null mutant flies show no obvious defects in brain morphology, and no striking qualitative changes in behaviour are observed. Ultrastructural analysis of an identified 'model' synapse of the larval nerve muscle preparation revealed no difference between wild-type and mutant, and spontaneous or evoked excitatory junction potentials at this synapse were normal up to a stimulus frequency of 5 Hz. However, when several behavioural responses were analysed quantitatively, specific differences between mutant and wild-type flies are noted. Adult locomotor activity, optomotor responses at high pattern velocities, wing beat frequency, and visual pattern preference are modified. Synapsin mutant flies show faster habituation of an olfactory jump response, enhanced ethanol tolerance, and significant defects in learning and memory as measured using three different paradigms. Larval behavioural defects are described in a separate paper. We conclude that Drosophila synapsins play a significant role in nervous system function, which is subtle at the cellular level but manifests itself in complex behaviour.

The effects of disruption of phosphoglucose isomerase gene on carbon utilisation and cellulase production in Trichoderma reesei Rut-C30

PubMed Central

2011-01-01

Background Cellulase and hemicellulase genes in the fungus Trichoderma reesei are repressed by glucose and induced by lactose. Regulation of the cellulase genes is mediated by the repressor CRE1 and the activator XYR1. T. reesei strain Rut-C30 is a hypercellulolytic mutant, obtained from the natural strain QM6a, that has a truncated version of the catabolite repressor gene, cre1. It has been previously shown that bacterial mutants lacking phosphoglucose isomerase (PGI) produce more nucleotide precursors and amino acids. PGI catalyzes the second step of glycolysis, the formation of fructose-6-P from glucose-6-P. Results We deleted the gene pgi1, encoding PGI, in the T. reesei strain Rut-C30 and we introduced the cre1 gene in a Δpgi1 mutant. Both Δpgi1 and cre1+Δpgi1 mutants showed a pellet-like and growth as well as morphological alterations compared with Rut-C30. None of the mutants grew in media with fructose, galactose, xylose, glycerol or lactose but they grew in media with glucose, with fructose and glucose, with galactose and fructose or with lactose and fructose. No growth was observed in media with xylose and glucose. On glucose, Δpgi1 and cre1+Δpgi1 mutants showed higher cellulase activity than Rut-C30 and QM6a, respectively. But in media with lactose, none of the mutants improved the production of the reference strains. The increase in the activity did not correlate with the expression of mRNA of the xylanase regulator gene, xyr1. Δpgi1 mutants were also affected in the extracellular β-galactosidase activity. Levels of mRNA of the glucose 6-phosphate dehydrogenase did not increase in Δpgi1 during growth on glucose. Conclusions The ability to grow in media with glucose as the sole carbon source indicated that Trichoderma Δpgi1 mutants were able to use the pentose phosphate pathway. But, they did not increase the expression of gpdh. Morphological characteristics were the result of the pgi1 deletion. Deletion of pgi1 in Rut-C30 increased cellulase production, but only under repressing conditions. This increase resulted partly from the deletion itself and partly from a genetic interaction with the cre1-1 mutation. The lower cellulase activity of these mutants in media with lactose could be attributed to a reduced ability to hydrolyse this sugar but not to an effect on the expression of xyr1. PMID:21609467

Skeletal development of mice lacking bone sialoprotein (BSP)--impairment of long bone growth and progressive establishment of high trabecular bone mass.

PubMed

Bouleftour, Wafa; Boudiffa, Maya; Wade-Gueye, Ndeye Marième; Bouët, Guénaëlle; Cardelli, Marco; Laroche, Norbert; Vanden-Bossche, Arnaud; Thomas, Mireille; Bonnelye, Edith; Aubin, Jane E; Vico, Laurence; Lafage-Proust, Marie Hélène; Malaval, Luc

2014-01-01

Adult Ibsp-knockout mice (BSP-/-) display shorter stature, lower bone turnover and higher trabecular bone mass than wild type, the latter resulting from impaired bone resorption. Unexpectedly, BSP knockout also affects reproductive behavior, as female mice do not construct a proper "nest" for their offsprings. Multiple crossing experiments nonetheless indicated that the shorter stature and lower weight of BSP-/- mice, since birth and throughout life, as well as their shorter femur and tibia bones are independent of the genotype of the mothers, and thus reflect genetic inheritance. In BSP-/- newborns, µCT analysis revealed a delay in membranous primary ossification, with wider cranial sutures, as well as thinner femoral cortical bone and lower tissue mineral density, reflected in lower expression of bone formation markers. However, trabecular bone volume and osteoclast parameters of long bones do not differ between genotypes. Three weeks after birth, osteoclast number and surface drop in the mutants, concomitant with trabecular bone accumulation. The growth plates present a thinner hypertrophic zone in newborns with lower whole bone expression of IGF-1 and higher IHH in 6 days old BSP-/- mice. At 3 weeks the proliferating zone is thinner and the hypertrophic zone thicker in BSP-/- than in BSP+/+ mice of either sex, maybe reflecting a combination of lower chondrocyte proliferation and impaired cartilage resorption. Six days old BSP-/- mice display lower osteoblast marker expression but higher MEPE and higher osteopontin(Opn)/Runx2 ratio. Serum Opn is higher in mutants at day 6 and in adults. Thus, lack of BSP alters long bone growth and membranous/cortical primary bone formation and mineralization. Endochondral development is however normal in mutant mice and the accumulation of trabecular bone observed in adults develops progressively in the weeks following birth. Compensatory high Opn may allow normal endochondral development in BSP-/- mice, while impairing primary mineralization.

Global alterations of the transcriptional landscape during yeast growth and development in the absence of Ume6-dependent chromatin modification

PubMed Central

Lardenois, Aurélie; Becker, Emmanuelle; Walther, Thomas; Law, Michael J.; Xie, Bingning; Demougin, Philippe; Strich, Randy

2017-01-01

Chromatin modification enzymes are important regulators of gene expression and some are evolutionarily conserved from yeast to human. Saccharomyces cerevisiae is a major model organism for genome-wide studies that aim at the identification of target genes under the control of conserved epigenetic regulators. Ume6 interacts with the upstream repressor site 1 (URS1) and represses transcription by recruiting both the conserved histone deacetylase Rpd3 (through the co-repressor Sin3) and the chromatin-remodeling factor Isw2. Cells lacking Ume6 are defective in growth, stress response, and meiotic development. RNA profiling studies and in vivo protein-DNA binding assays identified mRNAs or transcript isoforms that are directly repressed by Ume6 in mitosis. However, a comprehensive understanding of the transcriptional alterations, which underlie the complex ume6Δ mutant phenotype during fermentation, respiration, or sporulation, is lacking. We report the protein-coding transcriptome of a diploid MATa/α wild-type and ume6/ume6 mutant strains cultured in rich media with glucose or acetate as a carbon source, or sporulation-inducing medium. We distinguished direct from indirect effects on mRNA levels by combining GeneChip data with URS1 motif predictions and published high-throughput in vivo Ume6-DNA binding data. To gain insight into the molecular interactions between successive waves of Ume6-dependent meiotic genes, we integrated expression data with information on protein networks. Our work identifies novel Ume6 repressed genes during growth and development and reveals a strong effect of the carbon source on the derepression pattern of transcripts in growing and developmentally arrested ume6/ume6 mutant cells. Since yeast is a useful model organism for chromatin-mediated effects on gene expression, our results provide a rich source for further genetic and molecular biological work on the regulation of cell growth and cell differentiation in eukaryotes. PMID:25957495

Global alterations of the transcriptional landscape during yeast growth and development in the absence of Ume6-dependent chromatin modification.

PubMed

Lardenois, Aurélie; Becker, Emmanuelle; Walther, Thomas; Law, Michael J; Xie, Bingning; Demougin, Philippe; Strich, Randy; Primig, Michael

2015-10-01

Chromatin modification enzymes are important regulators of gene expression and some are evolutionarily conserved from yeast to human. Saccharomyces cerevisiae is a major model organism for genome-wide studies that aim at the identification of target genes under the control of conserved epigenetic regulators. Ume6 interacts with the upstream repressor site 1 (URS1) and represses transcription by recruiting both the conserved histone deacetylase Rpd3 (through the co-repressor Sin3) and the chromatin-remodeling factor Isw2. Cells lacking Ume6 are defective in growth, stress response, and meiotic development. RNA profiling studies and in vivo protein-DNA binding assays identified mRNAs or transcript isoforms that are directly repressed by Ume6 in mitosis. However, a comprehensive understanding of the transcriptional alterations, which underlie the complex ume6Δ mutant phenotype during fermentation, respiration, or sporulation, is lacking. We report the protein-coding transcriptome of a diploid MAT a/α wild-type and ume6/ume6 mutant strains cultured in rich media with glucose or acetate as a carbon source, or sporulation-inducing medium. We distinguished direct from indirect effects on mRNA levels by combining GeneChip data with URS1 motif predictions and published high-throughput in vivo Ume6-DNA binding data. To gain insight into the molecular interactions between successive waves of Ume6-dependent meiotic genes, we integrated expression data with information on protein networks. Our work identifies novel Ume6 repressed genes during growth and development and reveals a strong effect of the carbon source on the derepression pattern of transcripts in growing and developmentally arrested ume6/ume6 mutant cells. Since yeast is a useful model organism for chromatin-mediated effects on gene expression, our results provide a rich source for further genetic and molecular biological work on the regulation of cell growth and cell differentiation in eukaryotes.

Generation and analysis of knock-in mice carrying pseudohypoaldosteronism type II-causing mutations in the cullin 3 gene.

PubMed

Araki, Yuya; Rai, Tatemitsu; Sohara, Eisei; Mori, Takayasu; Inoue, Yuichi; Isobe, Kiyoshi; Kikuchi, Eriko; Ohta, Akihito; Sasaki, Sei; Uchida, Shinichi

2015-10-21

Pseudohypoaldosteronism type II (PHAII) is a hereditary hypertensive disease caused by mutations in four different genes: with-no-lysine kinases (WNK) 1 and 4, Kelch-like family member 3 (KLHL3), and cullin 3 (Cul3). Cul3 and KLHL3 form an E3 ligase complex that ubiquitinates and reduces the expression level of WNK4. PHAII-causing mutations in WNK4 and KLHL3 impair WNK4 ubiquitination. However, the molecular pathogenesis of PHAII caused by Cul3 mutations is unclear. In cultured cells and human leukocytes, PHAII-causing Cul3 mutations result in the skipping of exon 9, producing mutant Cul3 protein lacking 57 amino acids. However, whether this phenomenon occurs in the kidneys and is responsible for the pathogenesis of PHAII in vivo is unknown. We generated knock-in mice carrying a mutation in the C-terminus of intron 8 of Cul3, c.1207-1G>A, which corresponds to a PHAII-causing mutation in the human Cul3 gene. Heterozygous Cul3(G(-1)A/+) knock-in mice did not exhibit PHAII phenotypes, and the skipping of exon 9 was not evident in their kidneys. However, the level of Cul3 mRNA expression in the kidneys of heterozygous knock-in mice was approximately half that of wild-type mice. Furthermore, homozygous knock-in mice were nonviable. It suggested that the mutant allele behaved like a knockout allele and did not produce Cul3 mRNA lacking exon 9. A reduction in Cul3 expression alone was not sufficient to develop PHAII in the knock-in mice. Our findings highlighted the pathogenic role of mutant Cul3 protein and provided insight to explain why PHAII-causing mutations in Cul3 cause kidney-predominant PHAII phenotypes. © 2015. Published by The Company of Biologists Ltd.

Bioluminescence Resonance Energy Transfer Studies Reveal Constitutive Dimerization of the Human Lutropin Receptor and a Lack of Correlation between Receptor Activation and the Propensity for Dimerization*

PubMed Central

Guan, Rongbin; Feng, Xiuyan; Wu, Xueqing; Zhang, Meilin; Zhang, Xuesen; Hébert, Terence E.; Segaloff, Deborah L.

2009-01-01

Previous studies from our laboratory using co-immunoprecipitation techniques suggested that the human lutropin receptor (hLHR) constitutively self-associates into dimers/oligomers and that agonist treatment of cells either increased hLHR dimerization/oligomerization and/or stabilized hLHR dimers/oligomers to detergent solubilization (Tao, Y. X., Johnson, N. B., and Segaloff, D. L. (2004) J. Biol. Chem. 279, 5904–5914). In this study, bioluminescence resonance energy transfer (BRET2) analyses confirmed that the hLHR constitutively self-associates in living cells. After subcellular fractionation, hLHR dimers/oligomers were detected in both the plasma membrane and endoplasmic reticulum (ER). Further evidence supporting the constitutive formation of hLHR dimer/oligomers in the ER is provided by data showing homodimerization of misfolded hLHR mutants that are retained in the ER. These mutants, when co-expressed with wild-type receptor, are shown by BRET2 to heterodimerize, accounting for their dominant-negative effects on cell surface receptor expression. Hormone desorption assays using intact cells demonstrate allosterism between hLHR protomers, indicating functional cell surface hLHR dimers. However, quantitative BRET2 analyses in intact cells indicate a lack of effect of agonist on the propensity of the hLHR to dimerize. Using purified plasma membranes, human chorionic gonadotropin was similarly observed to have no effect on the BRET2 signal. An examination of the propensity for constitutively active and signaling inactive hLHR mutants to dimerize further showed no correlation between dimerization and the activation state of the hLHR. Taken altogether, our data suggest that hLHR dimers/oligomers are formed early in the biosynthetic pathway in the ER, are constitutively expressed on the plasma membrane, and are not affected by the activation state of the hLHR. PMID:19147490

Probing transcription-specific outputs of β-catenin in vivo.

PubMed

Valenta, Tomas; Gay, Max; Steiner, Sarah; Draganova, Kalina; Zemke, Martina; Hoffmans, Raymond; Cinelli, Paolo; Aguet, Michel; Sommer, Lukas; Basler, Konrad

2011-12-15

β-Catenin, apart from playing a cell-adhesive role, is a key nuclear effector of Wnt signaling. Based on activity assays in Drosophila, we generated mouse strains where the endogenous β-catenin protein is replaced by mutant forms, which retain the cell adhesion function but lack either or both of the N- and the C-terminal transcriptional outputs. The C-terminal activity is essential for mesoderm formation and proper gastrulation, whereas N-terminal outputs are required later during embryonic development. By combining the double-mutant β-catenin with a conditional null allele and a Wnt1-Cre driver, we probed the role of Wnt/β-catenin signaling in dorsal neural tube development. While loss of β-catenin protein in the neural tube results in severe cell adhesion defects, the morphology of cells and tissues expressing the double-mutant form is normal. Surprisingly, Wnt/β-catenin signaling activity only moderately regulates cell proliferation, but is crucial for maintaining neural progenitor identity and for neuronal differentiation in the dorsal spinal cord. Our model animals thus allow dissecting signaling and structural functions of β-catenin in vivo and provide the first genetic tool to generate cells and tissues that entirely and exclusively lack canonical Wnt pathway activity. © 2011 by Cold Spring Harbor Laboratory Press

A mutation that eliminates bundle sheath extensions reduces leaf hydraulic conductance, stomatal conductance and assimilation rates in tomato (Solanum lycopersicum).

PubMed

Zsögön, Agustin; Negrini, Ana Clarissa Alves; Peres, Lázaro Eustáquio Pereira; Nguyen, Hoa Thi; Ball, Marilyn C

2015-01-01

Bundle sheath extensions (BSEs) are key features of leaf structure whose distribution differs among species and ecosystems. The genetic control of BSE development is unknown, so BSE physiological function has not yet been studied through mutant analysis. We screened a population of ethyl methanesulfonate (EMS)-induced mutants in the genetic background of the tomato (Solanum lycopersicum) model Micro-Tom and found a mutant lacking BSEs. The leaf phenotype of the mutant strongly resembled the tomato mutant obscuravenosa (obv). We confirmed that obv lacks BSEs and that it is not allelic to our induced mutant, which we named obv-2. Leaves lacking BSEs had lower leaf hydraulic conductance and operated with lower stomatal conductance and correspondingly lower assimilation rates than wild-type leaves. This lower level of function occurred despite similarities in vein density, midvein vessel diameter and number, stomatal density, and leaf area between wild-type and mutant leaves, the implication being that the lack of BSEs hindered water dispersal within mutant leaves. Our results comparing near-isogenic lines within a single species confirm the hypothesised role of BSEs in leaf hydraulic function. They further pave the way for a genetic model-based analysis of a common leaf structure with deep ecological consequences. © 2014 The Authors New Phytologist © 2014 New Phytologist Trust.

Role of the cell envelope stress regulators BaeR and CpxR in control of RND-type multidrug efflux pumps and transcriptional cross talk with exopolysaccharide synthesis in Erwinia amylovora.

PubMed

Pletzer, Daniel; Stahl, Antje; Oja, Anna Elisabeth; Weingart, Helge

2015-08-01

The purpose of this study was to identify the role of the cell envelope stress-sensing systems BaeSR and CpxARP in regulation of multidrug efflux and exopolysaccharide synthesis in Erwinia amylovora. We have previously reported that BaeR activates transcription of the RND-type efflux pumps AcrD and MdtABC. In this study, we found that a cpxR-deficient mutant was highly susceptible to β-lactams, aminoglycosides and lincomycin, whereas a baeR mutant showed no change in antimicrobial sensitivity. However, overexpression of BaeR in a mutant lacking the major RND pump AcrB increased resistance of E. amylovora to several compounds that are not substrates of AcrD or MdtABC. Furthermore, we observed that overexpression of BaeR significantly increased amylovoran production. Moreover, the expression of RND-type efflux pumps was changed in regulatory mutants of exopolysaccharide production. Our data suggest that BaeSR and CpxARP regulate additional mechanisms, beside efflux, which are responsible for antimicrobial resistance of E. amylovora.

Genetic and Immunological Studies of Bacteriophage T4 Thymidylate Synthetase

PubMed Central

Krauss, S. W.; Stollar, B. D.; Friedkin, M.

1973-01-01

Thymidylate synthetase, which appears after infection of Escherichia coli with bacteriophage T4, has been partially purified. The phage enzyme is immunologically distinct from the host enzyme and has a molecular weight of 50,000 in comparison to 68,000 for the host enzyme. A system has been developed to characterize T4 td mutants previously known to have impaired expression of phage thymidylate synthetase. For this system, an E. coli host lacking thymidylate synthetase was isolated. Known genetic suppressors were transduced into this host. The resulting isogenic hosts were infected with phage T4 td mutants. The specific activities and amounts of cross-reacting material induced by several different types of phage mutants under conditions of suppression or non-suppression have been examined. The results show that the phage carries the structural gene specifying the thymidylate synthetase which appears after phage infection, and that the combination of plaque morphology, enzyme activity assays, and an assay for immunologically cross-reacting material provides a means for identifying true amber mutants of the phage gene. Images PMID:4575286

Determination of synthetic lethal interactions in KRAS oncogene-dependent cancer cells reveals novel therapeutic targeting strategies

PubMed Central

Steckel, Michael; Molina-Arcas, Miriam; Weigelt, Britta; Marani, Michaela; Warne, Patricia H; Kuznetsov, Hanna; Kelly, Gavin; Saunders, Becky; Howell, Michael; Downward, Julian; Hancock, David C

2012-01-01

Oncogenic mutations in RAS genes are very common in human cancer, resulting in cells with well-characterized selective advantages, but also less well-understood vulnerabilities. We have carried out a large-scale loss-of-function screen to identify genes that are required by KRAS-transformed colon cancer cells, but not by derivatives lacking this oncogene. Top-scoring genes were then tested in a larger panel of KRAS mutant and wild-type cancer cells. Cancer cells expressing oncogenic KRAS were found to be highly dependent on the transcription factor GATA2 and the DNA replication initiation regulator CDC6. Extending this analysis using a collection of drugs with known targets, we found that cancer cells with mutant KRAS showed selective addiction to proteasome function, as well as synthetic lethality with topoisomerase inhibition. Combination targeting of these functions caused improved killing of KRAS mutant cells relative to wild-type cells. These observations suggest novel targets and new ways of combining existing therapies for optimal effect in RAS mutant cancers, which are traditionally seen as being highly refractory to therapy. PMID:22613949

Caenorhabditis elegans syndecan (SDN-1) is required for normal egg laying and associates with the nervous system and the vulva.

PubMed

Minniti, Alicia N; Labarca, Mariana; Hurtado, Claudia; Brandan, Enrique

2004-10-01

In Caenorhabditis elegans, the identification of many enzymes involved in the synthesis and modification of glycosaminoglycans (GAGs), essential components of proteoglycans, has attained special attention in recent years. Mutations in all the genes that encode for GAG biosynthetic enzymes show defects in the development of the vulva, specifically in the invagination of the vulval epithelium. Mutants for certain heparan sulfate modifying enzymes present axonal and cellular guidance defects in specific neuronal classes. Although most of the enzymes involved in the biosynthesis and modification of heparan sulfate have been characterized in C. elegans, little is known regarding the core proteins to which these GAGs covalently bind in proteoglycans. A single syndecan homologue (sdn-1) has been identified in the C. elegans genome through sequence analysis. In the present study, we show that C. elegans synthesizes sulfated proteoglycans, seen as three distinct species in western blot analysis. In the sdn-1 (ok449) deletion mutant allele we observed the lack of one species, which corresponds to a 50 kDa product after heparitinase treatment. The expression of sdn-1 mRNA and sequencing revealed that sdn-1 (ok449) deletion mutants lack two glycosylation sites. Hence, the missing protein in the western blot analysis probably corresponds to SDN-1. In addition, we show that SDN-1 localizes to the C. elegans nerve ring, nerve cords and to the vulva. SDN-1 is found specifically phosphorylated in nerve ring neurons and in the vulva, in both wild-type worms and sdn-1 (ok449) deletion mutants. These mutants show a defective egg-laying phenotype. Our results show for the first time, the identification, localization and some functional aspects of syndecan in the nematode C. elegans.

Replacement of Lipopolysaccharide with Free Lipid A Molecules in Escherichia coli Mutants Lacking All Core Sugars

PubMed Central

Reynolds, C. Michael; Raetz, Christian R. H.

2009-01-01

Escherichia coli mutants deficient in 2-keto-3-deoxy-d-manno-octulosonic acid (Kdo) biosynthesis are conditionally lethal, but their phenotypes are bypassed by certain suppressor mutations or by over-expression of MsbA, the inner membrane flippase for core-lipid A. These strains grow on broth with the tetra-acylated precursor lipid IVA replacing lipopolysaccharide (Meredith, T. C. et al. ACS Chem. Biol. 1, 33–42, 2006). Deletion of kdtA, which encodes the Kdo transferase, is possible under these conditions. We now show that lipid IVA reaches the outer surface of the outer membrane in these strains, as judged by its accessibility to the lipase PagL. On the assumption that MsbA is optimized to transport penta- or hexa-acylated lipid A, we over-expressed the lauroyl or the myristoyl transferase of lipid A biosynthesis, encoded by lpxL and lpxM respectively, and demonstrated that kdtA deletion mutants were also viable in this setting. Although E. coli LpxL is stimulated by the presence of the Kdo-disaccharide in its acceptor substrate, LpxL does slowly acylate lipid IVA. Over-expression of LpxL from a plasmid suppressed the lethality of kdtA deletions on nutrient broth at 30 or 37 °C without the need for MsbA over-production. These strains accumulated penta- and hexa-acylated free lipid A containing a secondary laurate chain, or a laurate and a myristate chain, respectively. Deletion of kdtA in strains over-expressing LpxM accumulated penta-acylated lipid A with a secondary myristate moiety. None of the strains lacking kdtA grew in the presence of bile salts at any temperature or on nutrient broth at 42 °C. Our findings show that the main function of Kdo is to provide the right substrates for the acyltransferases LpxL and LpxM, resulting in the synthesis of penta- and hexa-acylated lipid A, which is optimal for the MsbA flippase. PMID:19754149

Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules.

PubMed Central

Tal-Singer, R; Peng, C; Ponce De Leon, M; Abrams, W R; Banfield, B W; Tufaro, F; Cohen, G H; Eisenberg, R J

1995-01-01

The entry of herpes simplex virus (HSV) into mammalian cells is a multistep process beginning with an attachment step involving glycoproteins gC and gB. A second step requires the interaction of glycoprotein gD with a cell surface molecule. We explored the interaction between gC and the cell surface by using purified proteins in the absence of detergent. Truncated forms of gC and gD, gC1(457t), gC2(426t), and gD1(306t), lacking the transmembrane and carboxyl regions were expressed in the baculovirus system. We studied the ability of these proteins to bind to mammalian cells, to bind to immobilized heparin, to block HSV type 1 (HSV-1) attachment to cells, and to inhibit plaque formation by HSV-1. Each of these gC proteins bound to conformation-dependent monoclonal antibodies and to human complement component C3b, indicating that they maintained the same conformation of gC proteins expressed in mammalian cells. Biotinylated gC1(457t) and gC2(426t) each bind to several cell lines. Binding was inhibited by an excess of unlabeled gC but not by gD, indicating specificity. The attachment of gC to cells involves primarily heparan sulfate proteoglycans, since heparitinase treatment of cells reduced gC binding by 50% but had no effect on gD binding. Moreover, binding of gC to two heparan sulfate-deficient L-cell lines, gro2C and sog9, both of which are mostly resistant to HSV infection, was markedly reduced. Purified gD1 (306t), however, bound equally well to the two mutant cell lines. In contrast, saturating amounts of gC1(457t) interfered with HSV-1 attachment to cells but failed to block plaque formation, suggesting a role for gC in attachment but not penetration. A mutant form of gC lacking residues 33 to 123, gC1(delta 33-123t), expressed in the baculovirus system, bound significantly less well to cells than did gC1(457t) and competed poorly with biotinylated gC1(457t) for binding. These results suggest that residues 33 to 123 are important for gC attachment to cells. In contrast, both the mutant and wild-type forms of gC bound to immobilized heparin, indicating that binding of these proteins to the cell surface involves more than a simple interaction with heparin. To determine that the contribution of the N-terminal region of gC is important for HSV attachment, we compared several properties of a mutant HSV-1 which contains gC lacking amino acids 33 to 123 to those of its parental virus, which contains full-length gC. The mutant bound less well to cells than the parental virus but exhibited normal growth properties.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:7769707

Accumulation of inorganic polyphosphate enables stress endurance and catalytic vigour in Pseudomonas putida KT2440

PubMed Central

2013-01-01

Background Accumulation of inorganic polyphosphate (polyP), a persistent trait throughout the whole Tree of Life, is claimed to play a fundamental role in enduring environmental insults in a large variety of microorganisms. The share of polyP in the tolerance of the soil bacterium Pseudomonas putida KT2440 to a suite of physicochemical stresses has been studied on the background of its capacity as a host of oxidative biotransformations. Results Cells lacking polyphosphate kinase (Ppk), which expectedly presented a low intracellular polyP level, were more sensitive to a number of harsh external conditions such as ultraviolet irradiation, addition of β-lactam antibiotics and heavy metals (Cd2+ and Cu2+). Other phenotypes related to a high-energy phosphate load (e.g., swimming) were substantially weakened as well. Furthermore, the ppk mutant was consistently less tolerant to solvents and its survival in stationary phase was significantly affected. In contrast, the major metabolic routes were not significantly influenced by the loss of Ppk as diagnosed from respiration patterns of the mutant in phenotypic microarrays. However, the catalytic vigour of the mutant decreased to about 50% of that in the wild-type strain as estimated from the specific growth rate of cells carrying the catabolic TOL plasmid pWW0 for m-xylene biodegradation. The catalytic phenotype of the mutant was restored by over-expressing ppk in trans. Some of these deficits could be explained by the effect of the ppk mutation on the expression profile of the rpoS gene, the stationary phase sigma factor, which was revealed by the analysis of a PrpoS → rpoS‘-’lacZ translational fusion. Still, every stress-related effect of lacking Ppk in P. putida was relatively moderate as compared to some of the conspicuous phenotypes reported for other bacteria. Conclusions While polyP can be involved in a myriad of cellular functions, the polymer seems to play a relatively secondary role in the genetic and biochemical networks that ultimately enable P. putida to endure environmental stresses. Instead, the main value of polyP could be ensuring a reservoire of energy during prolonged starvation. This is perhaps one of the reasons for polyP persistence in live systems despite its apparent lack of essentiality. PMID:23687963

Loss of Activity-Induced Phosphorylation of MeCP2 Enhances Synaptogenesis, LTP, and Spatial Memory

PubMed Central

Li, Hongda; Zhong, Xiaofen; Chau, Kevin Fongching; Williams, Emily Cunningham; Chang, Qiang

2012-01-01

DNA methylation-dependent epigenetic mechanisms underlie the development and function of the mammalian brain. MeCP2 expresses highly in neurons, and functions as a molecular linker between DNA methylation, chromatin remodeling and transcription regulation. Previous in vitro studies showed neuronal activity-induced phosphorylation (NAIP) of MeCP2 precedes its release from the Bdnf promoter and the ensuing Bdnf transcription. However, the in vivo function of this phosphorylation event remains elusive. We generated knockin mice that lack NAIP of MeCP2, and show here the Mecp2 phospho-mutant mice perform better in hippocampus-dependent memory tests, present enhanced LTP at two synapses in the hippocampus, and show increased excitatory synaptogenesis. At the molecular level, the phospho-mutant MeCP2 protein binds more tightly to several MeCP2 target gene promoters and alters the expression of these genes. Our results supply the first genetic evidence that NAIP of MeCP2 is required in modulating dynamic functions of the adult mouse brain. PMID:21765426

Low MITF/AXL ratio predicts early resistance to multiple targeted drugs in melanoma.

PubMed

Müller, Judith; Krijgsman, Oscar; Tsoi, Jennifer; Robert, Lidia; Hugo, Willy; Song, Chunying; Kong, Xiangju; Possik, Patricia A; Cornelissen-Steijger, Paulien D M; Geukes Foppen, Marnix H; Kemper, Kristel; Goding, Colin R; McDermott, Ultan; Blank, Christian; Haanen, John; Graeber, Thomas G; Ribas, Antoni; Lo, Roger S; Peeper, Daniel S

2014-12-15

Increased expression of the Microphthalmia-associated transcription factor (MITF) contributes to melanoma progression and resistance to BRAF pathway inhibition. Here we show that the lack of MITF is associated with more severe resistance to a range of inhibitors, while its presence is required for robust drug responses. Both in primary and acquired resistance, MITF levels inversely correlate with the expression of several activated receptor tyrosine kinases, most frequently AXL. The MITF-low/AXL-high/drug-resistance phenotype is common among mutant BRAF and NRAS melanoma cell lines. The dichotomous behaviour of MITF in drug response is corroborated in vemurafenib-resistant biopsies, including MITF-high and -low clones in a relapsed patient. Furthermore, drug cocktails containing AXL inhibitor enhance melanoma cell elimination by BRAF or ERK inhibition. Our results demonstrate that a low MITF/AXL ratio predicts early resistance to multiple targeted drugs, and warrant clinical validation of AXL inhibitors to combat resistance of BRAF and NRAS mutant MITF-low melanomas.

Multiple, Distinct Isoforms of Sucrose Synthase in Pea1

PubMed Central

Barratt, D.H. Paul; Barber, Lorraine; Kruger, Nicholas J.; Smith, Alison M.; Wang, Trevor L.; Martin, Cathie

2001-01-01

Genes encoding three isoforms of sucrose synthase (Sus1, Sus2, and Sus3) have been cloned from pea (Pisum sativum). The genes have distinct patterns of expression in different organs of the plant, and during organ development. Studies of the isoforms expressed as recombinant proteins in Escherichia coli show that they differ in kinetic properties. Although not of great magnitude, the differences in properties are consistent with some differentiation of physiological function between the isoforms. Evidence for differentiation of function in vivo comes from the phenotypes of rug4 mutants of pea, which carry mutations in the gene encoding Sus1. One mutant line (rug4-c) lacks detectable Sus1 protein in both the soluble and membrane-associated fractions of the embryo, and Sus activity in the embryo is reduced by 95%. The starch content of the embryo is reduced by 30%, but the cellulose content is unaffected. The results imply that different isoforms of Sus may channel carbon from sucrose towards different metabolic fates within the cell. PMID:11598239

The mammalian AMP-activated protein kinase complex mediates glucose regulation of gene expression in the yeast Saccharomyces cerevisiae.

PubMed

Ye, Tian; Bendrioua, Loubna; Carmena, David; García-Salcedo, Raúl; Dahl, Peter; Carling, David; Hohmann, Stefan

2014-06-05

The AMP-activated protein kinase (AMPK) controls energy homeostasis in eukaryotic cells. Here we expressed hetero-trimeric mammalian AMPK complexes in a Saccharomyces cerevisiae mutant lacking all five genes encoding yeast AMPK/SNF1 components. Certain mammalian complexes complemented the growth defect of the yeast mutant on non-fermentable carbon sources. Phosphorylation of the AMPK α1-subunit was glucose-regulated, albeit not by the Glc7-Reg1/2 phosphatase, which performs this function on yeast AMPK/SNF1. AMPK could take over SNF1 function in glucose derepression. While indirectly acting anti-diabetic drugs had no effect on AMPK in yeast, compound 991 stimulated α1-subunit phosphorylation. Our results demonstrate a remarkable functional conservation of AMPK and that glucose regulation of AMPK may not be mediated by regulatory features of a specific phosphatase. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

20-Aminosteroids as a novel class of selective and complete androgen receptor antagonists and inhibitors of prostate cancer cell growth.

PubMed

Fousteris, Manolis A; Schubert, Undine; Roell, Daniela; Roediger, Julia; Bailis, Nikolaos; Nikolaropoulos, Sotiris S; Baniahmad, Aria; Giannis, Athanassios

2010-10-01

Here, the synthesis and the evaluation of novel 20-aminosteroids on androgen receptor (AR) activity is reported. Compounds 11 and 18 of the series inhibit both the wild type and the T877A mutant AR-mediated transactivation indicating AR antagonistic function. Interestingly, minor structural changes such as stereoisomers of the amino lactame moiety exhibit preferences for antagonism among wild type and mutant AR. Other tested nuclear receptors are only weakly or not affected. In line with this, the prostate cancer cell growth of androgen-dependent but not of cancer cells lacking expression of the AR is inhibited. Further, the expression of the prostate specific antigen used as a diagnostic marker is also repressed. Finally steroid 18 enhances cellular senescence that might explain in part the growth inhibition mediated by this derivative. Steroids 11 and 18 are the first steroids that act as complete AR antagonists and exhibit AR specificity. Copyright © 2010 Elsevier Ltd. All rights reserved.

The relationship between thiamine and two symbioses: Root nodule symbiosis and arbuscular mycorrhiza.

PubMed

Nagae, Miwa; Parniske, Martin; Kawaguchi, Masayoshi; Takeda, Naoya

2016-12-01

Lotus japonicus THIC is expressed in all organs, and the encoded protein catalyzes thiamine biosynthesis. Loss of function produces chlorosis, a typical thiamine-deficiency phenotype, and mortality. To investigate thiamine's role in symbiosis, we focused on THI1, a thiamine-biosynthesis gene expressed in roots, nodules, and seeds. The thi1 mutant had green leaves, but formed small nodules and immature seeds. These phenotypes were rescued by THI1 complementation and by exogenous thiamine. Thus, THI1 is required for nodule enlargement and seed maturation. On the other hand, colonization by arbuscular mycorrhiza (AM) fungus Rhizophagus irregularis was not affected in the thi1 mutant or by exogenous thiamine. However, spores of R. irregularis stored more thiamine than the source (host plants), despite lacking thiamine biosynthesis genes. Therefore, disturbance of the thiamine supply would affect progeny phenotypes such as spore formation and hyphal growth. Further investigation will be required to elucidate thiamine's effect on AM.

Dual Function of a Tip Fimbrillin of Actinomyces in Fimbrial Assembly and Receptor Binding▿

PubMed Central

Wu, Chenggang; Mishra, Arunima; Yang, Jinghua; Cisar, John O.; Das, Asis; Ton-That, Hung

2011-01-01

Interaction of Actinomyces oris with salivary proline-rich proteins (PRPs), which serve as fimbrial receptors, involves type 1 fimbriae. Encoded by the gene locus fimQ-fimP-srtC1, the type 1 fimbria is comprised of the fimbrial shaft FimP and the tip fimbrillin FimQ. Fimbrial polymerization requires the fimbria-specific sortase SrtC1, which catalyzes covalent linkage of fimbrial subunits. Using genetics, biochemical methods, and electron microscopy, we provide evidence that the tip fimbrillin, FimQ, is involved in fimbrial assembly and interaction with PRPs. Specifically, while deletion of fimP completely abolished the type 1 fimbrial structures, surface display of monomeric FimQ was not affected by this mutation. Surprisingly, deletion of fimQ significantly reduced surface assembly of the type 1 fimbriae. This defect was rescued by recombinant FimQ ectopically expressed from a plasmid. In agreement with the role of type 1 fimbriae in binding to PRPs, aggregation of A. oris with PRP-coated beads was abrogated in cells lacking srtC1 or fimP. This aggregation defect of the ΔfimP mutant was mainly due to significant reduction of FimQ on the bacterial surface, as the aggregation was not observed in a strain lacking fimQ. Increasing expression of FimQ in the ΔfimP mutant enhanced aggregation, while overexpression of FimP in the ΔfimQ mutant did not. Furthermore, recombinant FimQ, not FimP, bound surface-associated PRPs in a dose-dependent manner. Thus, not only does FimQ function as the major adhesin of the type 1 fimbriae, it also plays an important role in fimbrial assembly. PMID:21531799

Biological effects of CCS in the absence of SOD1 enzyme activation: implications for disease in a mouse model for ALS.

PubMed

Proescher, Jody B; Son, Marjatta; Elliott, Jeffrey L; Culotta, Valeria C

2008-06-15

The CCS copper chaperone is critical for maturation of Cu, Zn-superoxide dismutase (SOD1) through insertion of the copper co-factor and oxidization of an intra-subunit disulfide. The disulfide helps stabilize the SOD1 polypeptide, which can be particularly important in cases of amyotrophic lateral sclerosis (ALS) linked to misfolding of mutant SOD1. Surprisingly, however, over-expressed CCS was recently shown to greatly accelerate disease in a G93A SOD1 mouse model for ALS. Herein we show that disease in these G93A/CCS mice correlates with incomplete oxidation of the SOD1 disulfide. In the brain and spinal cord, CCS over-expression failed to enhance oxidation of the G93A SOD1 disulfide and if anything, effected some accumulation of disulfide-reduced SOD1. This effect was mirrored in culture with a C244,246S mutant of CCS that has the capacity to interact with SOD1 but can neither insert copper nor oxidize the disulfide. In spite of disulfide effects, there was no evidence for increased SOD1 aggregation. If anything, CCS over-expression prevented SOD1 misfolding in culture as monitored by detergent insolubility. This protection against SOD1 misfolding does not require SOD1 enzyme activation as the same effect was obtained with the C244,246S allele of CCS. In the G93A SOD1 mouse, CCS over-expression was likewise associated with a lack of obvious SOD1 misfolding marked by detergent insolubility. CCS over-expression accelerates SOD1-linked disease without the hallmarks of misfolding and aggregation seen in other mutant SOD1 models. These studies are the first to indicate biological effects of CCS in the absence of SOD1 enzymatic activation.

Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

PubMed Central

Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

2004-01-01

NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

Interaction between sleep and the immune response in Drosophila: a role for the NFkappaB relish.

PubMed

Williams, Julie A; Sathyanarayanan, Sriram; Hendricks, Joan C; Sehgal, Amita

2007-04-01

The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFkappaB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response.

Interaction Between Sleep and the Immune Response in Drosophila: A Role for the NFκB Relish

PubMed Central

Williams, Julie A.; Sathyanarayanan, Sriram; Hendricks, Joan C.; Sehgal, Amita

2010-01-01

Study Objectives The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. Design We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. Results A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFκB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. Conclusion These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response. PMID:17520783

VH mutant rabbits lacking the VH1a2 gene develop a2+ B cells in the appendix by gene conversion-like alteration of a rearranged VH4 gene.

PubMed

Sehgal, D; Mage, R G; Schiaffella, E

1998-02-01

We investigated the molecular basis for the appearance of V(H)a2 allotype-bearing B cells in mutant Alicia rabbits. The mutation arose in an a2 rabbit; mutants exhibit altered expression of V(H) genes because of a small deletion encompassing V(H)1a2, the 3'-most gene in the V(H) locus. The V(H)1 gene is the major source of V(H)a allotype because this gene is preferentially rearranged in normal rabbits. In young homozygous ali/ali animals, the levels of a2 molecules found in the serum increase with age. In adult ali/ali rabbits, 20 to 50% of serum Igs and B cells bear a2 allotypic determinants. Previous studies suggested that positive selection results in expansion of a2 allotype-bearing B cells in the appendix of young mutant ali/ali rabbits. We separated appendix cells from a 6-wk-old Alicia rabbit by FACS based on the expression of surface IgM and a2 allotype. The VDJ portion of the expressed Ig mRNA was amplified from the IgM+ a2+ and IgM+ a2- populations by reverse transcriptase-PCR. The cDNAs from both populations were cloned and sequenced. Analysis of these sequences suggested that, in a2+ B cells, the first D proximal functional gene in Alicia rabbits, V(H)4a2, rearranged and was altered further by a gene conversion-like mechanism. Upstream V(H) genes were identified as potential gene sequence donors; V(H)9 was found to be the most frequently used gene donor. Among the a2- B cells, y33 was the most frequently rearranged gene.

Regulation of hippocampal synaptic plasticity thresholds and changes in exploratory and learning behavior in dominant negative NPR-B mutant rats

PubMed Central

Barmashenko, Gleb; Buttgereit, Jens; Herring, Neil; Bader, Michael; Özcelik, Cemil; Manahan-Vaughan, Denise; Braunewell, Karl H.

2014-01-01

The second messenger cyclic GMP affects synaptic transmission and modulates synaptic plasticity and certain types of learning and memory processes. The impact of the natriuretic peptide receptor B (NPR-B) and its ligand C-type natriuretic peptide (CNP), one of several cGMP producing signaling systems, on hippocampal synaptic plasticity and learning is, however, less well understood. We have previously shown that the NPR-B ligand CNP increases the magnitude of long-term depression (LTD) in hippocampal area CA1, while reducing the induction of long-term potentiation (LTP). We have extended this line of research to show that bidirectional plasticity is affected in the opposite way in rats expressing a dominant-negative mutant of NPR-B (NSE-NPR-BΔKC) lacking the intracellular guanylyl cyclase domain under control of a promoter for neuron-specific enolase. The brain cells of these transgenic rats express functional dimers of the NPR-B receptor containing the dominant-negative NPR-BΔKC mutant, and therefore show decreased CNP-stimulated cGMP-production in brain membranes. The NPR-B transgenic rats display enhanced LTP but reduced LTD in hippocampal slices. When the frequency-dependence of synaptic modification to afferent stimulation in the range of 1–100 Hz was assessed in transgenic rats, the threshold for both, LTP and LTD induction, was shifted to lower frequencies. In parallel, NPR-BΔKC rats exhibited an enhancement in exploratory and learning behavior. These results indicate that bidirectional plasticity and learning and memory mechanism are affected in transgenic rats expressing a dominant-negative mutant of NPR-B. Our data substantiate the hypothesis that NPR-B-dependent cGMP signaling has a modulatory role for synaptic information storage and learning. PMID:25520616

Integrated Transcriptomic and Metabolomic Characterization of the Low-Carbon Response Using an ndhR Mutant of Synechocystis sp. PCC 68031

PubMed Central

Klähn, Stephan; Orf, Isabel; Schwarz, Doreen; Matthiessen, Jasper K.F.; Kopka, Joachim; Hess, Wolfgang R.; Hagemann, Martin

2015-01-01

The acquisition and assimilation of inorganic carbon (Ci) represents the largest flux of inorganic matter in photosynthetic organisms; hence, this process is tightly regulated. We examined the Ci-dependent transcriptional and metabolic regulation in wild-type Synechocystis sp. PCC 6803 compared with a mutant defective in the main transcriptional repressor for Ci acquisition genes, the NAD(P)H dehydrogenase transcriptional regulator NdhR. The analysis revealed that many protein-coding transcripts that are normally repressed in the presence of high CO2 (HC) concentrations were strongly expressed in ∆ndhR, whereas other messenger RNAs were strongly down-regulated in mutant cells, suggesting a potential activating role for NdhR. A conserved NdhR-binding motif was identified in the promoters of derepressed genes. Interestingly, the expression of some NdhR-regulated genes remained further inducible under low-CO2 conditions, indicating the involvement of additional NdhR-independent Ci-regulatory mechanisms. Intriguingly, we also observed that the abundance of 52 antisense RNAs and 34 potential noncoding RNAs was affected by Ci supply, although most of these molecules were not regulated through NdhR. Thus, antisense and noncoding RNAs could contribute to NdhR-independent carbon regulation. In contrast to the transcriptome, the metabolome in ∆ndhR cells was similar to that of wild-type cells under HC conditions. This observation and the delayed metabolic responses to the low-CO2 shift in ∆ndhR, specifically the lack of transient increases in the photorespiratory pathway intermediates 2-phosphoglycolate, glycolate, and glycine, suggest that the deregulation of gene expression in the ΔndhR mutant successfully preacclimates cyanobacterial cells to lowered Ci supply under HC conditions. PMID:25630438

Ghrelin restoration of function in vitro in somatotropes from male mice lacking the Janus kinase (JAK)-binding site of the leptin receptor.

PubMed

Syed, Mohsin; Cozart, Michael; Haney, Anessa C; Akhter, Noor; Odle, Angela K; Allensworth-James, Melody; Crane, Christopher; Syed, Farhan M; Childs, Gwen V

2013-04-01

Deletion of the signaling domain of leptin receptors selectively in somatotropes, with Cre-loxP technology, reduced the percentage of immunolabeled GH cells and serum GH. We hypothesized that the deficit occurred when leptin's postnatal surge failed to stimulate an expansion in the cell population. To learn more about the deficiency in GH cells, we tested their expression of GHRH receptors and GH mRNA and the restorative potential of secretagogue stimulation in vitro. In freshly plated dissociated pituitary cells from control male mice, GHRH alone (0.3 nM) increased the percentage of immunolabeled GH cells from 27 ± 0.05% (vehicle) to 42 ± 1.8% (P < .002) and the secretion of GH 1.8-3×. Deletion mutant pituitary cells showed a 40% reduction in percentages of immunolabeled GH cells (16.7 ± 0.4%), which correlated with a 47% reduction in basal GH levels (50 ng/mL control; 26.7 ng/mL mutants P = .01). A 50% reduction in the percentage of mutant cells expressing GHRH receptors (to 12%) correlated with no or reduced responses to GHRH. Ghrelin alone (10 nM) stimulated more GH cells in mutants (from 16.7-23%). When added with 1-3 nM GHRH, ghrelin restored GH cell percentages and GH secretion to levels similar to those of stimulated controls. Counts of somatotropes labeled for GH mRNA confirmed normal percentages of somatotropes in the population. These discoveries suggest that leptin may optimize somatotrope function by facilitating expression of membrane GHRH receptors and the production or maintenance of GH stores.

A selective EP4 PGE2 receptor agonist alleviates disease in a new mouse model of X-linked nephrogenic diabetes insipidus

PubMed Central

Li, Jian Hua; Chou, Chung-Lin; Li, Bo; Gavrilova, Oksana; Eisner, Christoph; Schnermann, Jürgen; Anderson, Stasia A.; Deng, Chu-Xia; Knepper, Mark A.; Wess, Jürgen

2009-01-01

X-linked nephrogenic diabetes insipidus (XNDI) is a severe kidney disease caused by inactivating mutations in the V2 vasopressin receptor (V2R) gene that result in the loss of renal urine-concentrating ability. At present, no specific pharmacological therapy has been developed for XNDI, primarily due to the lack of suitable animal models. To develop what we believe to be the first viable animal model of XNDI, we generated mice in which the V2R gene could be conditionally deleted during adulthood by administration of 4-OH-tamoxifen. Radioligand-binding studies confirmed the lack of V2R-binding sites in kidneys following 4-OH-tamoxifen treatment, and further analysis indicated that upon V2R deletion, adult mice displayed all characteristic symptoms of XNDI, including polyuria, polydipsia, and resistance to the antidiuretic actions of vasopressin. Gene expression analysis suggested that activation of renal EP4 PGE2 receptors might compensate for the lack of renal V2R activity in XNDI mice. Strikingly, both acute and chronic treatment of the mutant mice with a selective EP4 receptor agonist greatly reduced all major manifestations of XNDI, including changes in renal morphology. These physiological improvements were most likely due to a direct action on EP4 receptors expressed on collecting duct cells. These findings illustrate the usefulness of the newly generated V2R mutant mice for elucidating and testing new strategies for the potential treatment of humans with XNDI. PMID:19729836

Generation of Mice Deficient in both KLF3/BKLF and KLF8 Reveals a Genetic Interaction and a Role for These Factors in Embryonic Globin Gene Silencing

PubMed Central

Funnell, Alister P. W.; Mak, Ka Sin; Twine, Natalie A.; Pelka, Gregory J.; Norton, Laura J.; Radziewic, Tania; Power, Melinda; Wilkins, Marc R.; Bell-Anderson, Kim S.; Fraser, Stuart T.; Perkins, Andrew C.; Tam, Patrick P.; Pearson, Richard C. M.

2013-01-01

Krüppel-like factors 3 and 8 (KLF3 and KLF8) are highly related transcriptional regulators that bind to similar sequences of DNA. We have previously shown that in erythroid cells there is a regulatory hierarchy within the KLF family, whereby KLF1 drives the expression of both the Klf3 and Klf8 genes and KLF3 in turn represses Klf8 expression. While the erythroid roles of KLF1 and KLF3 have been explored, the contribution of KLF8 to this regulatory network has been unknown. To investigate this, we have generated a mouse model with disrupted KLF8 expression. While these mice are viable, albeit with a reduced life span, mice lacking both KLF3 and KLF8 die at around embryonic day 14.5 (E14.5), indicative of a genetic interaction between these two factors. In the fetal liver, Klf3 Klf8 double mutant embryos exhibit greater dysregulation of gene expression than either of the two single mutants. In particular, we observe derepression of embryonic, but not adult, globin expression. Taken together, these results suggest that KLF3 and KLF8 have overlapping roles in vivo and participate in the silencing of embryonic globin expression during development. PMID:23716600

Production of ABA responses requires both the nuclear and cytoplasmic functional involvement of PYR1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, EunJoo; Kim, Tae-Houn

Abscisic acid (ABA) enhances stress tolerant responses in plants against unfavorable environmental conditions. In Arabidopsis, ABA promotes interactions between PYR/PYL/RCARs and PP2C, thereby allowing SnRK2s to phosphorylate downstream components required for the regulation of gene expression or for gating ion channels. Because PYR1 is known to localize to nucleus and cytoplasm it is a question whether nuclear or cytoplasmic PYR1 confer different functions to the ABA signaling pathway, as has been previously shown for regulatory proteins. In order to answer this question, transgenic lines expressing nuclear PYR1 were generated in an ABA insensitive mutant background. Enforced nuclear expression of PYR1more » was examined by confocal microscopy and western blot analysis. Physiological analyses of the transgenic lines demonstrated that nuclear PYR1 is sufficient to generate ABA responses, such as, the inhibition of seed germination, root growth inhibition, the induction of gene expression, and stomatal closing movement. However, for the full recovery of ABA responses in the mutant background cytoplasmic PYR1 was required. The study suggests both nuclear and cytoplasmic PYR1 participate in the control of ABA signal transduction. - Highlights: • Nuclear and cytoplasmic functions of PYR1 were studied in the mutant which lacked majority of ABA responses. • Nuclear PYR1 reconstituted partially the ABA responses during seed germination, root growth, and guard cell movement. • Both the nuclear and cytoplasmic functions of PYR1 were required for the full generation of ABA responses.« less

Hematopoietic Colony Formation from Human Growth Factor-Dependent TF1 Cells and Human Cord Blood Myeloid Progenitor Cells Depends on SHP2 Phosphatase Function

PubMed Central

Etienne-Julan, Maryse; Gotoh, Akihiko; Braun, Stephen E.; Lu, Li; Cooper, Scott; Feng, Gen-Sheng; Li, Xing Jun

2013-01-01

The protein tyrosine phosphatase, SHP2, is widely expressed; however, previous studies demonstrated that hematopoietic cell development more stringently requires Shp2 expression compared to other tissues. Furthermore, somatic gain-of-function SHP2 mutants are commonly found in human myeloid leukemias. Given that pharmacologic inhibitors to SHP2 phosphatase activity are currently in development as putative antileukemic agents, we conducted a series of experiments examining the necessity of SHP2 phosphatase activity for human hematopoiesis. Anti-sense oligonucleotides to human SHP2 coding sequences reduced human cord blood- and human cell line, TF1-derived colony formation. Expression of truncated SHP2 bearing its Src homology 2 (SH2) domains, but lacking the phosphatase domain similarly reduced human cord blood- and TF1-derived colony formation. Mechanistically, expression of truncated SHP2 reduced the interaction between endogenous, full-length SHP2 with the adapter protein, Grb2. To verify the role of SHP2 phosphatase function in human hematopoietic cell development, human cord blood CD34+ cells were transduced with a leukemia-associated phosphatase gain-of-function SHP2 mutant or with a phosphatase dead SHP2 mutant, which indicated that increased phosphatase function enhanced, while decreased SHP2 phosphatase function reduced, human cord blood-derived colonies. Collectively, these findings indicate that SHP2 phosphatase function regulates human hematopoietic cell development and imply that the phosphatase component of SHP2 may serve as a pharmacologic target in human leukemias bearing increased SHP2 phosphatase activity. PMID:23082805

Hematopoietic colony formation from human growth factor-dependent TF1 cells and human cord blood myeloid progenitor cells depends on SHP2 phosphatase function.

PubMed

Broxmeyer, Hal E; Etienne-Julan, Maryse; Gotoh, Akihiko; Braun, Stephen E; Lu, Li; Cooper, Scott; Feng, Gen-Sheng; Li, Xing Jun; Chan, Rebecca J

2013-03-15

The protein tyrosine phosphatase, SHP2, is widely expressed; however, previous studies demonstrated that hematopoietic cell development more stringently requires Shp2 expression compared to other tissues. Furthermore, somatic gain-of-function SHP2 mutants are commonly found in human myeloid leukemias. Given that pharmacologic inhibitors to SHP2 phosphatase activity are currently in development as putative antileukemic agents, we conducted a series of experiments examining the necessity of SHP2 phosphatase activity for human hematopoiesis. Anti-sense oligonucleotides to human SHP2 coding sequences reduced human cord blood- and human cell line, TF1-derived colony formation. Expression of truncated SHP2 bearing its Src homology 2 (SH2) domains, but lacking the phosphatase domain similarly reduced human cord blood- and TF1-derived colony formation. Mechanistically, expression of truncated SHP2 reduced the interaction between endogenous, full-length SHP2 with the adapter protein, Grb2. To verify the role of SHP2 phosphatase function in human hematopoietic cell development, human cord blood CD34+ cells were transduced with a leukemia-associated phosphatase gain-of-function SHP2 mutant or with a phosphatase dead SHP2 mutant, which indicated that increased phosphatase function enhanced, while decreased SHP2 phosphatase function reduced, human cord blood-derived colonies. Collectively, these findings indicate that SHP2 phosphatase function regulates human hematopoietic cell development and imply that the phosphatase component of SHP2 may serve as a pharmacologic target in human leukemias bearing increased SHP2 phosphatase activity.

Dam methylation is required for efficient biofilm production in Salmonella enterica serovar Enteritidis.

PubMed

Aya Castañeda, María del Rosario; Sarnacki, Sebastián Hernán; Noto Llana, Mariángeles; López Guerra, Adriana Gabriela; Giacomodonato, Mónica Nancy; Cerquetti, María Cristina

2015-01-16

The ecological success of Salmonella enterica to survive in different environments is due, in part, to the ability to form biofilms, something which is especially important for food industry. The aim of the current study was to evaluate the involvement of Dam methylation in biofilm production in S. Enteritidis strains. The ability to generate biofilms was analyzed in wild type and dam mutant strains. In S. Enteritidis, the absence of Dam affected the capacity to develop pellicles at the air-liquid interface and reduced the ability to form biofilm on polystyrene surfaces. Curli and cellulose production, determined by Congo red and calcofluor assays, were affected in dam mutant strains. Relative quantitative real-time PCR experiments showed that the expression of csgD and csgA genes is reduced in mutants lacking dam gene with respect to the wild type strains, whereas transcript levels of bcsA are not affected in the absence of Dam. To our knowledge, this is the first report on the participation of Dam methylation on biofilm production in Enteritidis or any other serovar of S. enterica. Results presented here suggest that changes in gene expression required for biofilm production are finely regulated by Dam methylation. Thus, Dam methylation could modulate csgD expression and upregulate the expression of factors related with biofilm production, including curli and cellulose. This study contributes to the understanding of biofilm regulation in Salmonella spp. and to the design of new strategies to prevent food contamination and humans and animals infections. Copyright © 2014. Published by Elsevier B.V.

Insm1 promotes the transition of olfactory progenitors from apical and proliferative to basal, terminally dividing and neuronogenic.

PubMed

Rosenbaum, Jason N; Duggan, Anne; García-Añoveros, Jaime

2011-02-01

Insm1 is a zinc-finger transcription factor transiently expressed throughout the developing nervous system in late progenitors and nascent neurons. Insm1 is also highly expressed in medulloblastomas and other neuroendocrine tumors. We generated mice lacking the Insm1 gene and used them to elucidate its role in neurogenic proliferation of the embryonic olfactory epithelium. We found that deletion of Insm1 results in more apical cells and fewer nascent and mature neurons. In the embryonic olfactory epithelium of Insm1 mutants we detect fewer basal progenitors, which produce neurons, and more apical progenitors, which at this stage produce additional progenitors. Furthermore, in the mutants we detect fewer progenitors expressing NEUROD1, a marker of terminally dividing, neuronogenic (neuron-producing) progenitors (immediate neuronal precursors), and more progenitors expressing ASCL1, a marker of the transit amplifying progenitors that migrate from the apical to the basal edges of the epithelium while dividing to generate the terminal, neuronogenic progenitors. Finally, with timed administration of nucleoside analogs we demonstrate that the Insm1 mutants contain fewer terminally dividing progenitors at embryonic day 12.5. Altogether, these results suggest a role for Insm1 in promoting the transition of progenitors from apical and proliferative to basal, terminal and neuronogenic. This role appears partially conserved with that of its nematode ortholog, egl-46. The similar effects of Insm1 deletion on progenitors of embryonic olfactory epithelium and cortex point to striking parallels in the development of these neuroepithelia, and particularly between the basal progenitors of olfactory epithelium and the subventricular zone progenitors of cortex.

Type 1 fimbriae contribute to catheter-associated urinary tract infections caused by Escherichia coli.

PubMed

Reisner, Andreas; Maierl, Mario; Jörger, Michael; Krause, Robert; Berger, Daniela; Haid, Andrea; Tesic, Dijana; Zechner, Ellen L

2014-03-01

Biofilm formation on catheters is thought to contribute to persistence of catheter-associated urinary tract infections (CAUTI), which represent the most frequent nosocomial infections. Knowledge of genetic factors for catheter colonization is limited, since their role has not been assessed using physicochemical conditions prevailing in a catheterized human bladder. The current study aimed to combine data from a dynamic catheterized bladder model in vitro with in vivo expression analysis for understanding molecular factors relevant for CAUTI caused by Escherichia coli. By application of the in vitro model that mirrors the physicochemical environment during human infection, we found that an E. coli K-12 mutant defective in type 1 fimbriae, but not isogenic mutants lacking flagella or antigen 43, was outcompeted by the wild-type strain during prolonged catheter colonization. The importance of type 1 fimbriae for catheter colonization was verified using a fimA mutant of uropathogenic E. coli strain CFT073 with human and artificial urine. Orientation of the invertible element (IE) controlling type 1 fimbrial expression in bacterial populations harvested from the colonized catheterized bladder in vitro suggested that the vast majority of catheter-colonizing cells (up to 88%) express type 1 fimbriae. Analysis of IE orientation in E. coli populations harvested from patient catheters revealed that a median level of ∼73% of cells from nine samples have switched on type 1 fimbrial expression. This study supports the utility of the dynamic catheterized bladder model for analyzing catheter colonization factors and highlights a role for type 1 fimbriae during CAUTI.

OsCSLD1, a Cellulose Synthase-Like D1 Gene, Is Required for Root Hair Morphogenesis in Rice1[C][W

PubMed Central

Kim, Chul Min; Park, Sung Han; Je, Byoung Il; Park, Su Hyun; Park, Soon Ju; Piao, Hai Long; Eun, Moo Young; Dolan, Liam; Han, Chang-deok

2007-01-01

Root hairs are long tubular outgrowths that form on the surface of specialized epidermal cells. They are required for nutrient and water uptake and interact with the soil microflora. Here we show that the Oryza sativa cellulose synthase-like D1 (OsCSLD1) gene is required for root hair development, as rice (Oryza sativa) mutants that lack OsCSLD1 function develop abnormal root hairs. In these mutants, while hair development is initiated normally, the hairs elongate less than the wild-type hairs and they have kinks and swellings along their length. Because the csld1 mutants develop the same density and number of root hairs along their seminal root as the wild-type plants, we propose that OsCSLD1 function is required for hair elongation but not initiation. Both gene trap expression pattern and in situ hybridization analyses indicate that OsCSLD1 is expressed in only root hair cells. Furthermore, OsCSLD1 is the only member of the four rice CSLD genes that shows root-specific expression. Given that the Arabidopsis (Arabidopsis thaliana) gene KOJAK/AtCSLD3 is required for root hair elongation and is expressed in the root hair, it appears that OsCSLD1 may be the functional ortholog of KOJAK/AtCSLD3 and that these two genes represent the root hair-specific members of this family of proteins. Thus, at least part of the mechanism of root hair morphogenesis in Arabidopsis is conserved in rice. PMID:17259288

Secisbp2 Is Essential for Embryonic Development and Enhances Selenoprotein Expression

PubMed Central

Seeher, Sandra; Atassi, Tarik; Mahdi, Yassin; Carlson, Bradley A.; Braun, Doreen; Wirth, Eva K.; Klein, Marc O.; Reix, Nathalie; Miniard, Angela C.; Schomburg, Lutz; Hatfield, Dolph L.; Driscoll, Donna M.

2014-01-01

Abstract Aims: The selenocysteine insertion sequence (SECIS)-binding protein 2 (Secisbp2) binds to SECIS elements located in the 3′-untranslated region of eukaryotic selenoprotein mRNAs. Selenoproteins contain the rare amino acid selenocysteine (Sec). Mutations in SECISBP2 in humans lead to reduced selenoprotein expression thereby affecting thyroid hormone-dependent growth and differentiation processes. The most severe cases also display myopathy, hearing impairment, male infertility, increased photosensitivity, mental retardation, and ataxia. Mouse models are needed to understand selenoprotein-dependent processes underlying the patients' pleiotropic phenotypes. Results: Unlike tRNA[Ser]Sec-deficient embryos, homozygous Secisbp2-deleted embryos implant, but fail before gastrulation. Heterozygous inactivation of Secisbp2 reduced the amount of selenoprotein expressed, but did not affect the thyroid hormone axis or growth. Conditional deletion of Secisbp2 in hepatocytes significantly decreased selenoprotein expression. Unexpectedly, the loss of Secisbp2 reduced the abundance of many, but not all, selenoprotein mRNAs. Transcript-specific and gender-selective effects on selenoprotein mRNA abundance were greater in Secisbp2-deficient hepatocytes than in tRNA[Ser]Sec-deficient cells. Despite the massive reduction of Dio1 and Sepp1 mRNAs, significantly more corresponding protein was detected in primary hepatocytes lacking Secisbp2 than in cells lacking tRNA[Ser]Sec. Regarding selenoprotein expression, compensatory nuclear factor, erythroid-derived, like 2 (Nrf2)-dependent gene expression, or embryonic development, phenotypes were always milder in Secisbp2-deficient than in tRNA[Ser]Sec-deficient mice. Innovation: We report the first Secisbp2 mutant mouse models. The conditional mutants provide a model for analyzing Secisbp2 function in organs not accessible in patients. Conclusion: In hepatocyte-specific conditional mouse models, Secisbp2 gene inactivation is less detrimental than tRNA[Ser]Sec inactivation. A role of Secisbp2 in stabilizing selenoprotein mRNAs in vivo was uncovered. Antioxid. Redox Signal. 21, 835–849. PMID:24274065

Surface Polysaccharide Mutants Reveal that Absence of O Antigen Reduces Biofilm Formation of Actinobacillus pleuropneumoniae

PubMed Central

Hathroubi, S.; Hancock, M. A.; Langford, P. R.; Tremblay, Y. D. N.; Labrie, J.

2015-01-01

Actinobacillus pleuropneumoniae is a Gram-negative bacterium belonging to the Pasteurellaceae family and the causative agent of porcine pleuropneumonia, a highly contagious lung disease causing important economic losses. Surface polysaccharides, including lipopolysaccharides (LPS) and capsular polysaccharides (CPS), are implicated in the adhesion and virulence of A. pleuropneumoniae, but their role in biofilm formation is still unclear. In this study, we investigated the requirement for these surface polysaccharides in biofilm formation by A. pleuropneumoniae serotype 1. Well-characterized mutants were used: an O-antigen LPS mutant, a truncated core LPS mutant with an intact O antigen, a capsule mutant, and a poly-N-acetylglucosamine (PGA) mutant. We compared the amount of biofilm produced by the parental strain and the isogenic mutants using static and dynamic systems. Compared to the findings for the biofilm of the parental or other strains, the biofilm of the O antigen and the PGA mutants was dramatically reduced, and it had less cell-associated PGA. Real-time PCR analyses revealed a significant reduction in the level of pgaA, cpxR, and cpxA mRNA in the biofilm cells of the O-antigen mutant compared to that in the biofilm cells of the parental strain. Specific binding between PGA and LPS was consistently detected by surface plasmon resonance, but the lack of O antigen did not abolish these interactions. In conclusion, the absence of the O antigen reduces the ability of A. pleuropneumoniae to form a biofilm, and this is associated with the reduced expression and production of PGA. PMID:26483403

Leptin receptor-deficient (knockout) medaka, Oryzias latipes, show chronical up-regulated levels of orexigenic neuropeptides, elevated food intake and stage specific effects on growth and fat allocation.

PubMed

Chisada, Shin-ichi; Kurokawa, Tadahide; Murashita, Koji; Rønnestad, Ivar; Taniguchi, Yoshihito; Toyoda, Atsushi; Sakaki, Yoshiyuki; Takeda, Shunichi; Yoshiura, Yasutoshi

2014-01-01

The first studies that identified leptin and its receptor (LepR) in mammals were based on mutant animals that displayed dramatic changes in body-weight and regulation of energy homeostasis. Subsequent studies have shown that a deficiency of leptin or LepR in homoeothermic mammals results in hyperphagia, obesity, infertility and a number of other abnormalities. The physiological roles of leptin-mediated signaling in ectothermic teleosts are still being explored. Here, we produced medaka with homozygous LepR gene mutation using the targeting induced local lesions in a genome method. This knockout mutant had a point mutation of cysteine for stop codon at the 357th amino acid just before the leptin-binding domain. The evidence for loss of function of leptin-mediated signaling in the mutant is based on a lack of response to feeding in the expression of key appetite-related neuropeptides in the diencephalon. The mutant lepr−/− medaka expressed constant up-regulated levels of mRNA for the orexigenic neuropeptide Ya and agouti-related protein and a suppressed level of anorexigenic proopiomelanocortin 1 in the diencephalon independent of feeding, which suggests that the mutant did not possess functional LepR. Phenotypes of the LepR-mutant medaka were analyzed in order to understand the effects on food intake, growth, and fat accumulation in the tissues. The food intake of the mutant medaka was higher in post-juveniles and adult stages than that of wild-type (WT) fish. The hyperphagia led to a high growth rate at the post-juvenile stage, but did not to significant alterations in final adult body size. There was no additional deposition of fat in the liver and muscle in the post-juvenile and adult mutants, or in the blood plasma in the adult mutant. However, adult LepR mutants possessed large deposits of visceral fat, unlike in the WT fish, in which there were none. Our analysis confirms that LepR in medaka exert a powerful influence on the control on food intake. Further analyses using the mutant will contribute to a better understanding of the role of leptin in fish. This is the first study to produce fish with leptin receptor deficiency.

Multiple ABC transporters are involved in the acquisition of petrobactin in Bacillus anthracis

PubMed Central

Dixon, Shandee D.; Janes, Brian K.; Bourgis, Alexandra; Carlson, Paul E.; Hanna, Philip C.

2012-01-01

Summary In Bacillus anthracis the siderophore petrobactin is vital for iron acquisition and virulence. The petrobactin-binding receptor FpuA is required for these processes. Here additional components of petrobactin reacquisition are described. To identify these proteins, mutants of candidate permease and ATPase genes were generated allowing for characterization of multiple petrobactin ATP-binding cassette (ABC)-import systems. Either of two distinct permeases, FpuB or FatCD, are required for iron acquisition and play redundant roles in petrobactin transport. A mutant strain lacking both permeases, ΔfpuBΔfatCD, was incapable of using petrobactin as an iron source and exhibited attenuated virulence in a murine model of inhalational anthrax infection. ATPase mutants were generated in either of the permease mutant backgrounds to identify the ATPase(s) interacting with each individual permease channel. Mutants lacking the FpuB permease and FatE ATPase (ΔfpuBΔfatE) and a mutant lacking the distinct ATPases FpuC and FpuD generated in the ΔfatCD background (ΔfatCDΔfpuCΔfpuD) displayed phenotypic characteristics of a mutant deficient in petrobactin import. A mutant lacking all three of the identified ATPases (ΔfatEΔfpuCΔfpuD) exhibited the same growth defect in iron-depleted conditions. Taken together, these results provide the first description of the permease and ATPase proteins required for the import of petrobactin in B. anthracis. PMID:22429808

The Functions of Grainy Head-Like Proteins in Animals and Fungi and the Evolution of Apical Extracellular Barriers

PubMed Central

Paré, Adam; Kim, Myungjin; Juarez, Michelle T.; Brody, Stuart; McGinnis, William

2012-01-01

The Grainy head (GRH) family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi – organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl). We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2) mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins. PMID:22590528

Differentially expressed genes in the ovary of the sixth day of pupal "Ming" lethal egg mutant of silkworm, Bombyx mori.

PubMed

Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng

2013-09-15

The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.

Proteomic analyses reveal the key roles of BrlA and AbaA in biogenesis of gliotoxin in Aspergillus fumigatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Kwang-Soo, E-mail: shinks@dju.kr; Kim, Young Hwan; Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon, 305-764

2015-07-31

The opportunistic human pathogenic fungus Aspergillus fumigatus primarily reproduces by forming a large number of asexual spores (conidia). Sequential activation of the central regulators BrlA, AbaA and WetA is necessary for the fungus to undergo asexual development. In this study, to address the presumed roles of these key developmental regulators during proliferation of the fungus, we analyzed and compared the proteomes of vegetative cells of wild type (WT) and individual mutant strains. Approximately 1300 protein spots were detectable from 2-D electrophoresis gels. Among these, 13 proteins exhibiting significantly altered accumulation levels were further identified by ESI-MS/MS. Markedly, we found thatmore » the GliM and GliT proteins associated with gliotoxin (GT) biosynthesis and self-protection of the fungus from GT were significantly down-regulated in the ΔabaA and ΔbrlA mutants. Moreover, mRNA levels of other GT biosynthetic genes including gliM, gliP, gliT, and gliZ were significantly reduced in both mutant strains, and no and low levels of GT were detectable in the ΔbrlA and ΔabaA mutant strains, respectively. As GliT is required for the protection of the fungus from GT, growth of the ΔbrlA mutant with reduced levels of GliT was severely impaired by exogenous GT. Our studies demonstrate that AbaA and BrlA positively regulate expression of the GT biosynthetic gene cluster in actively growing vegetative cells, and likely bridge morphological and chemical development during the life-cycle of A. fumigatus. - Highlights: • Proteome analyses of WT and mutants reveal 13 differentially expressed proteins. • The GliT and GliM proteins are significantly down-regulated by ΔabaA and ΔbrlA. • Expression of other gliotoxin biosynthetic genes is lowered by ΔabaA and ΔbrlA. • Growth of ΔbrlA strain lacking GliT is completely inhibited by exogenous gliotoxin. • BrlA and AbaA play key roles in biogenesis of gliotoxin in Aspergillus fumigatus.« less

Biochemical analyses and molecular modeling explain the functional loss of 17β-hydroxysteroid dehydrogenase 3 mutant G133R in three Tunisian patients with 46, XY Disorders of Sex Development.

PubMed

Engeli, Roger T; Rhouma, Bochra Ben; Sager, Christoph P; Tsachaki, Maria; Birk, Julia; Fakhfakh, Faiza; Keskes, Leila; Belguith, Neila; Odermatt, Alex

2016-01-01

Mutations in the HSD17B3 gene resulting in 17β-hydroxysteroid dehydrogenase type 3 (17β-HSD3) deficiency cause 46, XY Disorders of Sex Development (46, XY DSD). Approximately 40 different mutations in HSD17B3 have been reported; only few mutant enzymes have been mechanistically investigated. Here, we report novel compound heterozygous mutations in HSD17B3, composed of the nonsense mutation C206X and the missense mutation G133R, in three Tunisian patients from two non-consanguineous families. Mutants C206X and G133R were constructed by site-directed mutagenesis and expressed in HEK-293 cells. The truncated C206X enzyme, lacking part of the substrate binding pocket, was moderately expressed and completely lost its enzymatic activity. Wild-type 17β-HSD3 and mutant G133R showed comparable expression levels and intracellular localization. The conversion of Δ4-androstene-3,17-dione (androstenedione) to testosterone was almost completely abolished for mutant G133R compared with wild-type 17β-HSD3. To obtain further mechanistic insight, G133 was mutated to alanine, phenylalanine and glutamine. G133Q and G133F were almost completely inactive, whereas G133A displayed about 70% of wild-type activity. Sequence analysis revealed that G133 on 17β-HSD3 is located in a motif highly conserved in 17β-HSDs and other short-chain dehydrogenase/reductase (SDR) enzymes. A homology model of 17β-HSD3 predicted that arginine or any other bulky residue at position 133 causes steric hindrance of cofactor NADPH binding, whereas substrate binding seems to be unaffected. The results indicate an essential role of G133 in the arrangement of the cofactor binding pocket, thus explaining the loss-of-function of 17β-HSD3 mutant G133R in the patients investigated. Copyright © 2015 Elsevier Ltd. All rights reserved.

Loss of vacuolar H+-ATPase (V-ATPase) activity in yeast generates an iron deprivation signal that is moderated by induction of the peroxiredoxin TSA2.

PubMed

Diab, Heba I; Kane, Patricia M

2013-04-19

Vacuolar H(+)-ATPases (V-ATPases) acidify intracellular organelles and help to regulate overall cellular pH. Yeast vma mutants lack V-ATPase activity and allow exploration of connections between cellular pH, iron, and redox homeostasis common to all eukaryotes. A previous microarray study in a vma mutant demonstrated up-regulation of multiple iron uptake genes under control of Aft1p (the iron regulon) and only one antioxidant gene, the peroxiredoxin TSA2 (Milgrom, E., Diab, H., Middleton, F., and Kane, P. M. (2007) Loss of vacuolar proton-translocating ATPase activity in yeast results in chronic oxidative stress. J. Biol. Chem. 282, 7125-7136). Fluorescent biosensors placing GFP under transcriptional control of either an Aft1-dependent promoter (P(FIT2)-GFP) or the TSA2 promoter (P(TSA2)-GFP) were constructed to monitor transcriptional signaling. Both biosensors were up-regulated in the vma2Δ mutant, and acute V-ATPase inhibition with concanamycin A induced coordinate up-regulation from both promoters. PTSA2-GFP induction was Yap1p-dependent, indicating an oxidative stress signal. Total cell iron measurements indicate that the vma2Δ mutant is iron-replete, despite up-regulation of the iron regulon. Acetic acid up-regulated P(FIT2)-GFP expression in wild-type cells, suggesting that loss of pH control contributes to an iron deficiency signal in the mutant. Iron supplementation significantly decreased P(FIT2)-GFP expression and, surprisingly, restored P(TSA2)-GFP to wild-type levels. A tsa2Δ mutation induced both nuclear localization of Aft1p and P(FIT2)-GFP expression. The data suggest a novel function for Tsa2p as a negative regulator of Aft1p-driven transcription, which is induced in V-ATPase mutants to limit transcription of the iron regulon. This represents a new mechanism bridging the antioxidant and iron-regulatory pathways that is intimately linked to pH homeostasis.

BdBRD1, a brassinosteroid C-6 oxidase homolog in Brachypodium distachyon L., is required for multiple organ development.

PubMed

Xu, Yi; Zhang, Xia; Li, Qi; Cheng, Zhiyuan; Lou, Haijuan; Ge, Lei; An, Hailong

2015-01-01

Brassinosteroids (BRs), known as a kind of phytohormones, play essential roles in plant growth and development. Although the studies on the BR biosynthesis and signaling are extensive in Arabidopsis, little is known in temperate cereals. In this study, bdbrd1-1, a T-DNA insertion mutant from Brachypodium distachyon, was isolated and characterized in details. The bdbrd1-1 mutant showed lots of cellular and morphogenetic defects, including shortened cell shapes, severe dwarfing, twisted leaves and sterile spikes. Sequencing the flanking fragment of the T-DNA and complementation by genomic DNA in the mutant, confirmed that the developmental defects are caused by the T-DNA insertion in BdBRD1, a possible brassinosteroid C-6 oxidase gene. Application of 24-epicastasterone could partly rescue the bdbrd1-1 dwarfing phenotype. Expression analysis of BdBRD1 suggested that bdbrd1-1 is probably a null mutant and its wild type transcript is expressed in various tissues and highest in the leaf sheaths. Meanwhile, measurements on leaf numbers of the main stems or days to the emergence of the inflorescences suggested that bdbrd1-1 is late-flowering. The late-flowering phenotype could be converted by vernalization treatment, although there lacks a typical FLC gene in B. distachyon. The current data provide an insight into the relationship between BRs biosynthesis and individual development in B. distachyon, an emerging model plant for the temperate cereals. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

CD18 deficiency improves liver injury in the MCD model of steatohepatitis

PubMed Central

Pierce, Andrew A.; Siao, Kevin; Mattis, Aras N.; Goodsell, Amanda; Baron, Jody L.; Maher, Jacquelyn J.

2017-01-01

Neutrophils and macrophages are important constituents of the hepatic inflammatory infiltrate in non-alcoholic steatohepatitis. These innate immune cells express CD18, an adhesion molecule that facilitates leukocyte activation. In the context of fatty liver, activation of infiltrated leukocytes is believed to enhance hepatocellular injury. The objective of this study was to determine the degree to which activated innate immune cells promote steatohepatitis by comparing hepatic outcomes in wild-type and CD18-mutant mice fed a methionine-choline-deficient (MCD) diet. After 3 weeks of MCD feeding, hepatocyte injury, based on serum ALT elevation, was 40% lower in CD18-mutant than wild-type mice. Leukocyte infiltration into the liver was not impaired in CD18-mutant mice, but leukocyte activation was markedly reduced, as shown by the lack of evidence of oxidant production. Despite having reduced hepatocellular injury, CD18-mutant mice developed significantly more hepatic steatosis than wild-type mice after MCD feeding. This coincided with greater hepatic induction of pro-inflammatory and lipogenic genes as well as a modest reduction in hepatic expression of adipose triglyceride lipase. Overall, the data indicate that CD18 deficiency curbs MCD-mediated liver injury by limiting the activation of innate immune cells in the liver without compromising intrahepatic cytokine activation. Reduced liver injury occurs at the expense of increased hepatic steatosis, which suggests that in addition to damaging hepatocytes, infiltrating leukocytes may influence lipid homeostasis in the liver. PMID:28873429

CD18 deficiency improves liver injury in the MCD model of steatohepatitis.

PubMed

Pierce, Andrew A; Duwaerts, Caroline C; Siao, Kevin; Mattis, Aras N; Goodsell, Amanda; Baron, Jody L; Maher, Jacquelyn J

2017-01-01

Neutrophils and macrophages are important constituents of the hepatic inflammatory infiltrate in non-alcoholic steatohepatitis. These innate immune cells express CD18, an adhesion molecule that facilitates leukocyte activation. In the context of fatty liver, activation of infiltrated leukocytes is believed to enhance hepatocellular injury. The objective of this study was to determine the degree to which activated innate immune cells promote steatohepatitis by comparing hepatic outcomes in wild-type and CD18-mutant mice fed a methionine-choline-deficient (MCD) diet. After 3 weeks of MCD feeding, hepatocyte injury, based on serum ALT elevation, was 40% lower in CD18-mutant than wild-type mice. Leukocyte infiltration into the liver was not impaired in CD18-mutant mice, but leukocyte activation was markedly reduced, as shown by the lack of evidence of oxidant production. Despite having reduced hepatocellular injury, CD18-mutant mice developed significantly more hepatic steatosis than wild-type mice after MCD feeding. This coincided with greater hepatic induction of pro-inflammatory and lipogenic genes as well as a modest reduction in hepatic expression of adipose triglyceride lipase. Overall, the data indicate that CD18 deficiency curbs MCD-mediated liver injury by limiting the activation of innate immune cells in the liver without compromising intrahepatic cytokine activation. Reduced liver injury occurs at the expense of increased hepatic steatosis, which suggests that in addition to damaging hepatocytes, infiltrating leukocytes may influence lipid homeostasis in the liver.

The Drosophila muscle LIM protein, Mlp84B, cooperates with D-titin to maintain muscle structural integrity.

PubMed

Clark, Kathleen A; Bland, Jennifer M; Beckerle, Mary C

2007-06-15

Muscle LIM protein (MLP) is a cytoskeletal LIM-only protein expressed in striated muscle. Mutations in human MLP are associated with cardiomyopathy; however, the molecular mechanism by which MLP functions is not established. A Drosophila MLP homolog, mlp84B, displays many of the same features as the vertebrate protein, illustrating the utility of the fly for the study of MLP function. Animals lacking Mlp84B develop into larvae with a morphologically intact musculature, but the mutants arrest during pupation with impaired muscle function. Mlp84B displays muscle-specific expression and is a component of the Z-disc and nucleus. Preventing nuclear retention of Mlp84B does not affect its function, indicating that Mlp84B site of action is likely to be at the Z-disc. Within the Z-disc, Mlp84B is colocalized with the N-terminus of D-titin, a protein crucial for sarcomere organization and stretch mechanics. The mlp84B mutants phenotypically resemble weak D-titin mutants. Furthermore, reducing D-titin activity in the mlp84B background leads to pronounced enhancement of the mlp84B muscle defects and loss of muscle structural integrity. The genetic interactions between mlp84B and D-titin reveal a role for Mlp84B in maintaining muscle structural integrity that was not obvious from analysis of the mlp84B mutants themselves, and suggest Mlp84B and D-titin cooperate to stabilize muscle sarcomeres.

Muscarinic cholinergic receptor (M2) plays a crucial role in the development of myopia in mice

PubMed Central

Barathi, Veluchamy A.; Kwan, Jia Lin; Tan, Queenie S. W.; Weon, Sung Rhan; Seet, Li Fong; Goh, Liang Kee; Vithana, Eranga N.; Beuerman, Roger W.

2013-01-01

SUMMARY Myopia is a huge public health problem worldwide, reaching the highest incidence in Asia. Identification of susceptible genes is crucial for understanding the biological basis of myopia. In this paper, we have identified and characterized a functional myopia-associated gene using a specific mouse-knockout model. Mice lacking the muscarinic cholinergic receptor gene (M2; also known as Chrm2) were less susceptible to lens-induced myopia compared with wild-type mice, which showed significantly increased axial length and vitreous chamber depth when undergoing experimental induction of myopia. The key findings of this present study are that the sclera of M2 mutant mice has higher expression of collagen type I and lower expression of collagen type V than do wild-type mice and mice that are mutant for other muscarinic subtypes, and, therefore, M2 mutant mice were resistant to the development of experimental myopia. Pharmacological blockade of M2 muscarinic receptor proteins retarded myopia progression in the mouse. These results suggest for the first time a role of M2 in growth-related changes in extracellular matrix genes during myopia development in a mammalian model. M2 receptor antagonists might thus provide a targeted therapeutic approach to the management of this refractive error. PMID:23649821

The primary role of zebrafish nanog is in extra-embryonic tissue.

PubMed

Gagnon, James A; Obbad, Kamal; Schier, Alexander F

2018-01-09

The role of the zebrafish transcription factor Nanog has been controversial. It has been suggested that Nanog is primarily required for the proper formation of the extra-embryonic yolk syncytial layer (YSL) and only indirectly regulates gene expression in embryonic cells. In an alternative scenario, Nanog has been proposed to directly regulate transcription in embryonic cells during zygotic genome activation. To clarify the roles of Nanog, we performed a detailed analysis of zebrafish nanog mutants. Whereas zygotic nanog mutants survive to adulthood, maternal-zygotic (MZ nanog ) and maternal mutants exhibit developmental arrest at the blastula stage. In the absence of Nanog, YSL formation and epiboly are abnormal, embryonic tissue detaches from the yolk, and the expression of dozens of YSL and embryonic genes is reduced. Epiboly defects can be rescued by generating chimeric embryos of MZ nanog embryonic tissue with wild-type vegetal tissue that includes the YSL and yolk cell. Notably, cells lacking Nanog readily respond to Nodal signals and when transplanted into wild-type hosts proliferate and contribute to embryonic tissues and adult organs from all germ layers. These results indicate that zebrafish Nanog is necessary for proper YSL development but is not directly required for embryonic cell differentiation. © 2018. Published by The Company of Biologists Ltd.

Analysis of Msx1; Msx2 double mutants reveals multiple roles for Msx genes in limb development.

PubMed

Lallemand, Yvan; Nicola, Marie-Anne; Ramos, Casto; Bach, Antoine; Cloment, Cécile Saint; Robert, Benoît

2005-07-01

The homeobox-containing genes Msx1 and Msx2 are highly expressed in the limb field from the earliest stages of limb formation and, subsequently, in both the apical ectodermal ridge and underlying mesenchyme. However, mice homozygous for a null mutation in either Msx1 or Msx2 do not display abnormalities in limb development. By contrast, Msx1; Msx2 double mutants exhibit a severe limb phenotype. Our analysis indicates that these genes play a role in crucial processes during limb morphogenesis along all three axes. Double mutant limbs are shorter and lack anterior skeletal elements (radius/tibia, thumb/hallux). Gene expression analysis confirms that there is no formation of regions with anterior identity. This correlates with the absence of dorsoventral boundary specification in the anterior ectoderm, which precludes apical ectodermal ridge formation anteriorly. As a result, anterior mesenchyme is not maintained, leading to oligodactyly. Paradoxically, polydactyly is also frequent and appears to be associated with extended Fgf activity in the apical ectodermal ridge, which is maintained up to 14.5 dpc. This results in a major outgrowth of the mesenchyme anteriorly, which nevertheless maintains a posterior identity, and leads to formation of extra digits. These defects are interpreted in the context of an impairment of Bmp signalling.

Functional characterization of barley betaglucanless mutants demonstrates a unique role for CslF6 in (1,3;1,4)-β-D-glucan biosynthesis

PubMed Central

Taketa, Shin; Yuo, Takahisa; Tonooka, Takuji; Tsumuraya, Yoichi; Inagaki, Yoshiaki; Haruyama, Naoto; Larroque, Oscar; Jobling, Stephen A.

2012-01-01

(1,3;1,4)-β-D-glucans (mixed-linkage glucans) are found in tissues of members of the Poaceae (grasses), and are particularly high in barley (Hordeum vulgare) grains. The present study describes the isolation of three independent (1,3;1,4)-β-D-glucanless (betaglucanless; bgl) mutants of barley which completely lack (1,3;1,4)-β-D-glucan in all the tissues tested. The bgl phenotype cosegregates with the cellulose synthase like HvCslF6 gene on chromosome arm 7HL. Each of the bgl mutants has a single nucleotide substitution in the coding region of the HvCslF6 gene resulting in a change of a highly conserved amino acid residue of the HvCslF6 protein. Microsomal membranes isolated from developing endosperm of the bgl mutants lack detectable (1,3;1,4)-β-D-glucan synthase activity indicating that the HvCslF6 protein is inactive. This was confirmed by transient expression of the HvCslF6 cDNAs in Nicotiana benthamiana leaves. The wild-type HvCslF6 gene directed the synthesis of high levels of (1,3;1,4)-β-D-glucans, whereas the mutant HvCslF6 proteins completely lack the ability to synthesize (1,3;1,4)-β-D-glucans. The fine structure of the (1,3;1,4)-β-D-glucan produced in the tobacco leaf was also very different from that found in cereals having an extremely low DP3/DP4 ratio. These results demonstrate that, among the seven CslF and one CslH genes present in the barley genome, HvCslF6 has a unique role and is the key determinant controlling the biosynthesis of (1,3;1,4)-β-D-glucans. Natural allelic variation in the HvCslF6 gene was found predominantly within introns among 29 barley accessions studied. Genetic manipulation of the HvCslF6 gene could enable control of (1,3;1,4)-β-D-glucans in accordance with the purposes of use. PMID:21940720

Inhibition of the sodium-translocating NADH-ubiquinone oxidoreductase [Na+-NQR] decreases cholera toxin production in Vibrio cholerae O1 at the late exponential growth phase

PubMed Central

Minato, Yusuke; Fassio, Sara R.; Reddekopp, Rylan L.; Häse, Claudia C.

2014-01-01

Two virulence factors produced by Vibrio cholerae, cholera toxin (CT) and toxin-corregulated pilus (TCP), are indispensable for cholera infection. ToxT is the central regulatory protein involved in activation of CT and TCP expression. We previously reported that lack of a respiration-linked sodium-translocating NADH–ubiquinone oxidoreductase (Na+-NQR) significantly increases toxT transcription. In this study, we further characterized this link and found that Na+-NQR affects toxT expression only at the early-log growth phase, whereas lack of Na+-NQR decreases CT production after the mid-log growth phase. Such decreased CT production was independent of toxT and ctxB transcription. Supplementing a respiratory substrate, L-lactate, into the growth media restored CT production in the nqrA-F mutant, suggesting that decreased CT production in the Na+-NQR mutant is dependent on electron transport chain (ETC) activity. This notion was supported by the observations that two chemical inhibitors, a Na+-NQR specific inhibitor 2-n-Heptyl-4-hydroxyquinoline N-oxide (HQNO) and a succinate dehydrogenase (SDH) inhibitor, thenoyltrifluoroacetone (TTFA), strongly inhibited CT production in both classical and El Tor biotype strains of V. cholerae. Accordingly, we propose the main respiratory enzyme of V. cholerae, as a potential drug target to treat cholera because human mitochondria do not contain Na+-NQR orthologs. PMID:24361395

SUCROSE TRANSPORTER 5 supplies Arabidopsis embryos with biotin and affects triacylglycerol accumulation

PubMed Central

Pommerrenig, Benjamin; Popko, Jennifer; Heilmann, Mareike; Schulmeister, Sylwia; Dietel, Katharina; Schmitt, Bianca; Stadler, Ruth; Feussner, Ivo; Sauer, Norbert

2013-01-01

The Arabidopsis SUC5 protein represents a classical sucrose/H+ symporter. Functional analyses previously revealed that SUC5 also transports biotin, an essential co-factor for fatty acid synthesis. However, evidence for a dual role in transport of the structurally unrelated compounds sucrose and biotin in plants was lacking. Here we show that SUC5 localizes to the plasma membrane, and that the SUC5 gene is expressed in developing embryos, confirming the role of the SUC5 protein as substrate carrier across apoplastic barriers in seeds. We show that transport of biotin but not of sucrose across these barriers is impaired in suc5 mutant embryos. In addition, we show that SUC5 is essential for the delivery of biotin into the embryo of biotin biosynthesis-defective mutants (bio1 and bio2). We compared embryo and seedling development as well as triacylglycerol accumulation and fatty acid composition in seeds of single mutants (suc5, bio1 or bio2), double mutants (suc5 bio1 and suc5 bio2) and wild-type plants. Although suc5 mutants were like the wild-type, bio1 and bio2 mutants showed developmental defects and reduced triacylglycerol contents. In suc5 bio1 and suc5 bio2 double mutants, developmental defects were severely increased and the triacylglycerol content was reduced to a greater extent in comparison to the single mutants. Supplementation with externally applied biotin helped to reduce symptoms in both single and double mutants, but the efficacy of supplementation was significantly lower in double than in single mutants, showing that transport of biotin into the embryo is lower in the absence of SUC5. PMID:23031218

Expression of Caenorhabditis elegans PCS in the AtPCS1-deficient Arabidopsis thaliana cad1-3 mutant separates the metal tolerance and non-host resistance functions of phytochelatin synthases.

PubMed

Kühnlenz, Tanja; Westphal, Lore; Schmidt, Holger; Scheel, Dierk; Clemens, Stephan

2015-11-01

Phytochelatin synthases (PCS) play key roles in plant metal tolerance. They synthesize small metal-binding peptides, phytochelatins, under conditions of metal excess. Respective mutants are strongly cadmium and arsenic hypersensitive. However, their ubiquitous presence and constitutive expression had long suggested a more general function of PCS besides metal detoxification. Indeed, phytochelatin synthase1 from Arabidopsis thaliana (AtPCS1) was later implicated in non-host resistance. The two different physiological functions may be attributable to the two distinct catalytic activities demonstrated for AtPCS1, that is the dipeptidyl transfer onto an acceptor molecule in phytochelatin synthesis, and the proteolytic deglycylation of glutathione conjugates. In order to test this hypothesis and to possibly separate the two biological roles, we expressed a phylogenetically distant PCS from Caenorhabditis elegans in an AtPCS1 mutant. We confirmed the involvement of AtPCS1 in non-host resistance by showing that plants lacking the functional gene develop a strong cell death phenotype when inoculated with the potato pathogen Phytophthora infestans. Furthermore, we found that the C. elegans gene rescues phytochelatin synthesis and cadmium tolerance, but not the defect in non-host resistance. This strongly suggests that the second enzymatic function of AtPCS1, which remains to be defined in detail, is underlying the plant immunity function. © 2015 John Wiley & Sons Ltd.

ACA12 Is a Deregulated Isoform of Plasma Membrane Ca2+-ATPase of Arabidopsis thaliana

PubMed Central

Limonta, Margherita; Romanowsky, Shawn; Olivari, Claudio; Bonza, Maria Cristina; Luoni, Laura; Rosenberg, Alexa; Harper, Jeffrey F.; De Michelis, Maria Ida

2014-01-01

Plant auto-inhibited Ca2+-ATPases (ACA) are crucial in defining the shape of calcium transients and therefore in eliciting plant responses to various stimuli. Arabidopsis thaliana genome encodes ten ACA isoforms that can be divided into four clusters based on gene structure and sequence homology. While isoforms from clusters 1, 2 and 4 have been characterized, virtually nothing is known about members of cluster 3 (ACA12 and ACA13). Here we show that a GFP-tagged ACA12 localizes at the plasma membrane and that expression of ACA12 rescues the phenotype of partial male sterility of a null mutant of the plasma membrane isoform ACA9, thus providing genetic evidence that ACA12 is a functional plasma membrane-resident Ca2+-ATPase. By ACA12 expression in yeast and purification by CaM-affinity chromatography, we show that, unlike other ACAs, the activity of ACA12 is not stimulated by CaM. Moreover, full length ACA12 is able to rescue a yeast mutant deficient in calcium pumps. Analysis of single point ACA12 mutants suggests that ACA12 loss of auto-inhibition can be ascribed to the lack of two acidic residues - highly conserved in other ACA isoforms - localized at the cytoplasmic edge of the second and third transmembrane segments. Together, these results support a model in which the calcium pump activity of ACA12 is primarily regulated by increasing or decreasing mRNA expression and/or protein translation and degradation. PMID:24101142

Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

PubMed

Wieckowski, Yana; Schiefelbein, John

2012-07-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

Nuclear Ribosome Biogenesis Mediated by the DIM1A rRNA Dimethylase Is Required for Organized Root Growth and Epidermal Patterning in Arabidopsis[C][W

PubMed Central

Wieckowski, Yana; Schiefelbein, John

2012-01-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development. PMID:22829145

Mutations of the LIM protein AJUBA mediate sensitivity of head and neck squamous cell carcinoma to treatment with cell-cycle inhibitors.

PubMed

Zhang, Ming; Singh, Ratnakar; Peng, Shaohua; Mazumdar, Tuhina; Sambandam, Vaishnavi; Shen, Li; Tong, Pan; Li, Lerong; Kalu, Nene N; Pickering, Curtis R; Frederick, Mitchell; Myers, Jeffrey N; Wang, Jing; Johnson, Faye M

2017-04-28

The genomic alterations identified in head and neck squamous cell carcinoma (HNSCC) tumors have not resulted in any changes in clinical care, making the development of biomarker-driven targeted therapy for HNSCC a major translational gap in knowledge. To fill this gap, we used 59 molecularly characterized HNSCC cell lines and found that mutations of AJUBA, SMAD4 and RAS predicted sensitivity and resistance to treatment with inhibitors of polo-like kinase 1 (PLK1), checkpoint kinases 1 and 2, and WEE1. Inhibition or knockdown of PLK1 led to cell-cycle arrest at the G 2 /M transition and apoptosis in sensitive cell lines and decreased tumor growth in an orthotopic AJUBA-mutant HNSCC mouse model. AJUBA protein expression was undetectable in most AJUBA-mutant HNSCC cell lines, and total PLK1 and Bora protein expression were decreased. Exogenous expression of wild-type AJUBA in an AJUBA-mutant cell line partially rescued the phenotype of PLK1 inhibitor-induced apoptosis and decreased PLK1 substrate inhibition, suggesting a threshold effect in which higher drug doses are required to affect PLK1 substrate inhibition. PLK1 inhibition was an effective therapy for HNSCC in vitro and in vivo. However, biomarkers to guide such therapy are lacking. We identified AJUBA, SMAD4 and RAS mutations as potential candidate biomarkers of response of HNSCC to treatment with these mitotic inhibitors. Copyright © 2017 Elsevier B.V. All rights reserved.

Development and translational imaging of a TP53 porcine tumorigenesis model

PubMed Central

Sieren, Jessica C.; Meyerholz, David K.; Wang, Xiao-Jun; Davis, Bryan T.; Newell, John D.; Hammond, Emily; Rohret, Judy A.; Rohret, Frank A.; Struzynski, Jason T.; Goeken, J. Adam; Naumann, Paul W.; Leidinger, Mariah R.; Taghiyev, Agshin; Van Rheeden, Richard; Hagen, Jussara; Darbro, Benjamin W.; Quelle, Dawn E.; Rogers, Christopher S.

2014-01-01

Cancer is the second deadliest disease in the United States, necessitating improvements in tumor diagnosis and treatment. Current model systems of cancer are informative, but translating promising imaging approaches and therapies to clinical practice has been challenging. In particular, the lack of a large-animal model that accurately mimics human cancer has been a major barrier to the development of effective diagnostic tools along with surgical and therapeutic interventions. Here, we developed a genetically modified porcine model of cancer in which animals express a mutation in TP53 (which encodes p53) that is orthologous to one commonly found in humans (R175H in people, R167H in pigs). TP53R167H/R167H mutant pigs primarily developed lymphomas and osteogenic tumors, recapitulating the tumor types observed in mice and humans expressing orthologous TP53 mutant alleles. CT and MRI imaging data effectively detected developing tumors, which were validated by histopathological evaluation after necropsy. Molecular genetic analyses confirmed that these animals expressed the R167H mutant p53, and evaluation of tumors revealed characteristic chromosomal instability. Together, these results demonstrated that TP53R167H/R167H pigs represent a large-animal tumor model that replicates the human condition. Our data further suggest that this model will be uniquely suited for developing clinically relevant, noninvasive imaging approaches to facilitate earlier detection, diagnosis, and treatment of human cancers. PMID:25105366

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Recombinant Marburg viruses containing mutations in the IID region of VP35 prevent inhibition of Host immune responses.

PubMed

Albariño, César G; Wiggleton Guerrero, Lisa; Spengler, Jessica R; Uebelhoer, Luke S; Chakrabarti, Ayan K; Nichol, Stuart T; Towner, Jonathan S

2015-02-01

Previous in vitro studies have demonstrated that Ebola and Marburg virus (EBOV and MARV) VP35 antagonize the host cell immune response. Moreover, specific mutations in the IFN inhibitory domain (IID) of EBOV and MARV VP35 that abrogate their interaction with virus-derived dsRNA, lack the ability to inhibit the host immune response. To investigate the role of MARV VP35 in the context of infectious virus, we used our reverse genetics system to generate two recombinant MARVs carrying specific mutations in the IID region of VP35. Our data show that wild-type and mutant viruses grow to similar titers in interferon deficient cells, but exhibit attenuated growth in interferon-competent cells. Furthermore, in contrast to wild-type virus, both MARV mutants were unable to inhibit expression of various antiviral genes. The MARV VP35 mutants exhibit similar phenotypes to those previously described for EBOV, suggesting the existence of a shared immune-modulatory strategy between filoviruses. Published by Elsevier Inc.

Two Closely Related Genes of Arabidopsis Encode Plastidial Cytidinediphosphate Diacylglycerol Synthases Essential for Photoautotrophic Growth1[C

PubMed Central

Haselier, André; Akbari, Hana; Weth, Agnes; Baumgartner, Werner; Frentzen, Margrit

2010-01-01

Cytidinediphosphate diacylglycerol synthase (CDS) catalyzes the formation of cytidinediphosphate diacylglycerol, an essential precursor of anionic phosphoglycerolipids like phosphatidylglycerol or -inositol. In plant cells, CDS isozymes are located in plastids, mitochondria, and microsomes. Here, we show that these isozymes are encoded by five genes in Arabidopsis (Arabidopsis thaliana). Alternative translation initiation or alternative splicing of CDS2 and CDS4 transcripts can result in up to 10 isoforms. Most of the cDNAs encoding the various plant isoforms were functionally expressed in yeast and rescued the nonviable phenotype of the mutant strain lacking CDS activity. The closely related genes CDS4 and CDS5 were found to encode plastidial isozymes with similar catalytic properties. Inactivation of both genes was required to obtain Arabidopsis mutant lines with a visible phenotype, suggesting that the genes have redundant functions. Analysis of these Arabidopsis mutants provided further independent evidence for the importance of plastidial phosphatidylglycerol for structure and function of thylakoid membranes and, hence, for photoautotrophic growth. PMID:20442275

The novel ER membrane protein PRO41 is essential for sexual development in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Frank, Sandra; Koers, Sandra; Strauch, Peter; Weitner, Thomas; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2007-05-01

The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41-EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41-EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi.

The novel ER membrane protein PRO41 is essential for sexual development in the filamentous fungus Sordaria macrospora

PubMed Central

Nowrousian, Minou; Frank, Sandra; Koers, Sandra; Strauch, Peter; Weitner, Thomas; Ringelberg, Carol; Dunlap, Jay C.; Loros, Jennifer J.; Kück, Ulrich

2013-01-01

Summary The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41–EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41–EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi. PMID:17501918

Loss of hippocampal serine protease BSP1/neuropsin predisposes to global seizure activity.

PubMed

Davies, B; Kearns, I R; Ure, J; Davies, C H; Lathe, R

2001-09-15

Serine proteases in the adult CNS contribute both to activity-dependent structural changes accompanying learning and to the regulation of excitotoxic cell death. Brain serine protease 1 (BSP1)/neuropsin is a trypsin-like serine protease exclusively expressed, within the CNS, in the hippocampus and associated limbic structures. To explore the role of this enzyme, we have used gene targeting to disrupt this gene in mice. Mutant mice were viable and overtly normal; they displayed normal hippocampal long-term synaptic potentiation (LTP) and exhibited no deficits in spatial navigation (water maze). Nevertheless, electrophysiological studies revealed that the hippocampus of mice lacking this specifically expressed protease possessed an increased susceptibility for hyperexcitability (polyspiking) in response to repetitive afferent stimulation. Furthermore, seizure activity on kainic acid administration was markedly increased in mutant mice and was accompanied by heightened immediate early gene (c-fos) expression throughout the brain. In view of the regional selectivity of BSP1/neuropsin brain expression, the observed phenotype may selectively reflect limbic function, further implicating the hippocampus and amygdala in controlling cortical activation. Within the hippocampus, our data suggest that BSP1/neuropsin, unlike other serine proteases, has little effect on physiological synaptic remodeling and instead plays a role in limiting neuronal hyperexcitability induced by epileptogenic insult.

Circadian Stress Regimes Affect the Circadian Clock and Cause Jasmonic Acid-Dependent Cell Death in Cytokinin-Deficient Arabidopsis Plants[OPEN

PubMed Central

Nitschke, Silvia; Cortleven, Anne; Iven, Tim; Havaux, Michel; Schmülling, Thomas

2016-01-01

The circadian clock helps plants measure daylength and adapt to changes in the day-night rhythm. We found that changes in the light-dark regime triggered stress responses, eventually leading to cell death, in leaves of Arabidopsis thaliana plants with reduced cytokinin levels or defective cytokinin signaling. Prolonged light treatment followed by a dark period induced stress and cell death marker genes while reducing photosynthetic efficiency. This response, called circadian stress, is also characterized by altered expression of clock and clock output genes. In particular, this treatment strongly reduced the expression of CIRCADIAN CLOCK ASSOCIATED1 (CCA1) and LATE ELONGATED HYPOCOTYL (LHY). Intriguingly, similar changes in gene expression and cell death were observed in clock mutants lacking proper CCA1 and LHY function. Circadian stress caused strong changes in reactive oxygen species- and jasmonic acid (JA)-related gene expression. The activation of the JA pathway, involving the accumulation of JA metabolites, was crucial for the induction of cell death, since the cell death phenotype was strongly reduced in the jasmonate resistant1 mutant background. We propose that adaptation to circadian stress regimes requires a normal cytokinin status which, acting primarily through the AHK3 receptor, supports circadian clock function to guard against the detrimental effects of circadian stress. PMID:27354555

An attenuated Shigella mutant lacking the RNA-binding protein Hfq provides cross-protection against Shigella strains of broad serotype.

PubMed

Mitobe, Jiro; Sinha, Ritam; Mitra, Soma; Nag, Dhrubajyoti; Saito, Noriko; Shimuta, Ken; Koizumi, Nobuo; Koley, Hemanta

2017-07-01

Few live attenuated vaccines protect against multiple serotypes of bacterial pathogen because host serotype-specific immune responses are limited to the serotype present in the vaccine strain. Here, immunization with a mutant of Shigella flexneri 2a protected guinea pigs against subsequent infection by S. dysenteriae type 1 and S. sonnei strains. This deletion mutant lacked the RNA-binding protein Hfq leading to increased expression of the type III secretion system via loss of regulation, resulting in attenuation of cell viability through repression of stress response sigma factors. Such increased antigen production and simultaneous attenuation were expected to elicit protective immunity against Shigella strains of heterologous serotypes. Thus, the vaccine potential of this mutant was tested in two guinea pig models of shigellosis. Animals vaccinated in the left eye showed fewer symptoms upon subsequent challenge via the right eye, and even survived subsequent intestinal challenge. In addition, oral vaccination effectively induced production of immunoglobulins without severe side effects, again protecting all animals against subsequent intestinal challenge with S. dysenteriae type 1 or S. sonnei strains. Antibodies against common virulence proteins and the O-antigen of S. flexneri 2a were detected by immunofluorescence microscopy. Reaction of antibodies with various strains, including enteroinvasive Escherichia coli, suggested that common virulence proteins induced protective immunity against a range of serotypes. Therefore, vaccination is expected to cover not only the most prevalent serotypes of S. sonnei and S. flexneri 2a, but also various Shigella strains, including S. dysenteriae type 1, which produces Shiga toxin.

Mutations in the histone fold domain of the TAF12 gene show synthetic lethality with the TAF1 gene lacking the TAF N-terminal domain (TAND) by different mechanisms from those in the SPT15 gene encoding the TATA box-binding protein (TBP)

PubMed Central

Kobayashi, Akiko; Miyake, Tsuyoshi; Kawaichi, Masashi; Kokubo, Tetsuro

2003-01-01

The general transcription factor TFIID, composed of the TATA box-binding protein (TBP) and 14 TBP-associated factors (TAFs), is important for both basal and regulated transcription by RNA polymerase II. Although it is well known that the TAF N-terminal domain (TAND) at the amino-terminus of the TAF1 protein binds to TBP and thereby inhibits TBP function in vitro, the physiological role of this domain remains obscure. In our previous study, we screened for mutations that cause lethality when co-expressed with the TAF1 gene lacking TAND (taf1-ΔTAND) and identified two ΔTAND synthetic lethal (nsl) mutations as those in the SPT15 gene encoding TBP. In this study we isolated another nsl mutation in the same screen and identified it to be a mutation in the histone fold domain (HFD) of the TAF12 gene. Several other HFD mutations of this gene also exhibit nsl phenotypes, and all of them are more or less impaired in transcriptional activation in vivo. Interestingly, a set of genes affected in the taf1-ΔTAND mutant is similarly affected in the taf12 HFD mutants but not in the nsl mutants of TBP. Therefore, we discovered that the nsl mutations of these two genes cause lethality in the taf1-ΔTAND mutant by different mechanisms. PMID:12582246

Cloning and characterization of an RNase-related protein gene preferentially expressed in rice stems.

PubMed

Wei, Jun-Ya; Li, An-Ming; Li, Yin; Wang, Jing; Liu, Xiao-Bin; Liu, Liang-Shi; Xu, Zeng-Fu

2006-04-01

RNase-related proteins (RRPs) are S- and S-like RNase homologs lacking the active site required for RNase activity. Here we describe the cloning and characterization of the rice (Oryza sativa) RRP gene (OsRRP). A single copy of OsRRP occurs in the rice genome. OsRRP contains three introns and an open reading frame encoding 252 amino acids, with the replacement of two histidines involved in the active site of RNase by lysine and tyrosine respectively. OsRRP is preferentially expressed in stems of wild-type rice and is significantly down-regulated in an increased tillering dwarf mutant ext37.

Processing of N-linked oligosaccharide depends on its location in the anion exchanger, AE1, membrane glycoprotein.

PubMed

Li, J; Quilty, J; Popov, M; Reithmeier, R A

2000-07-01

The human erythrocyte anion exchanger (AE)1 (Band 3) contains a single complex N-linked oligosaccharide that is attached to Asn(642) in the fourth extracellular loop of this polytopic membrane protein, while other isoforms (AE2, AE3 and trout AE1) are N-glycosylated on the preceding extracellular loop. Human AE1 expressed in transfected human embryonic kidney (HEK)-293 or COS-7 cells contained a high-mannose oligosaccharide. The lack of oligosaccharide processing was not due to retention of AE1 in the endoplasmic reticulum since biotinylation assays showed that approx. 30% of the protein was expressed at the cell surface. Moving the N-glycosylation site to the preceding extracellular loop in an AE1 glycosylation mutant (N555) resulted in processing of the oligosaccharide and production of a complex form of AE1. A double N-glycosylation mutant (N555/N642) contained both a high-mannose and a complex oligosaccharide chain. The complex form of the N555 mutant could be biotinylated showing that this form of the glycoprotein was at the cell surface. Pulse-chase experiments showed that the N555 mutant was efficiently converted from a high-mannose to a complex oligosaccharide with a half-time of approx. 4 h, which reflected the time course of trafficking of AE1 from the endoplasmic reticulum to the plasma membrane. The turnover of the complex form of the N555 mutant occurred with a half-life of approx. 15 h. The results show that the oligosaccharide attached to the endogenous site in extracellular loop 4 in human AE1 is not processed in HEK-293 or COS-7 cells, while the oligosaccharide attached to the preceding loop is converted into the complex form.

pkc-1 regulates daf-2 insulin/IGF signalling-dependent control of dauer formation in Caenorhabditis elegans.

PubMed

Monje, José M; Brokate-Llanos, Ana M; Pérez-Jiménez, Mercedes M; Fidalgo, Manuel A; Muñoz, Manuel J

2011-12-01

In Caenorhabditis elegans, the insulin/IGF pathway participates in the decision to initiate dauer development. Dauer is a diapause stage that is triggered by environmental stresses, such as a lack of nutrients. Insulin/IGF receptor mutants arrest constitutively in dauer, an effect that can be suppressed by mutations in other elements of the insulin/IGF pathway or by a reduction in the activity of the nuclear hormone receptor daf-12. We have isolated a pkc-1 mutant that acts as a novel suppressor of the dauer phenotypes caused by insulin/IGF receptor mutations. Interactions between insulin/IGF mutants and the pkc-1 suppressor mutant are similar to those described for daf-12 or the DAF-12 coregulator din-1. Moreover, we show that the expression of the DAF-12 target daf-9, which is normally elevated upon a reduction in insulin/IGF receptor activity, is suppressed in a pkc-1 mutant background, suggesting that pkc-1 could link the daf-12 and insulin/IGF pathways. pkc-1 has been implicated in the regulation of peptide neurosecretion in C. elegans. Although we demonstrate that pkc-1 expression in the nervous system regulates dauer formation, our results suggest that the requirement for pkc-1 in neurosecretion is independent of its role in modulating insulin/IGF signalling. pkc-1 belongs to the novel protein kinase C (nPKC) family, members of which have been implicated in insulin resistance and diabetes in mammals, suggesting a conserved role for pkc-1 in the regulation of the insulin/IGF pathway. © 2011 The Authors. Aging Cell © 2011 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

Influence of acylation sites of influenza B virus hemagglutinin on fusion pore formation and dilation.

PubMed

Ujike, Makoto; Nakajima, Katsuhisa; Nobusawa, Eri

2004-11-01

The cytoplasmic tail (CT) of hemagglutinin (HA) of influenza B virus (BHA) contains at positions 578 and 581 two highly conserved cysteine residues (Cys578 and Cys581) that are modified with palmitic acid (PA) through a thioester linkage. To investigate the role of PA in the fusion activity of BHA, site-specific mutagenesis was performed with influenza B virus B/Kanagawa/73 HA cDNA. All of the HA mutants were expressed on Cos cells by an expression vector. The membrane fusion ability of the HA mutants at a low pH was quantitatively examined with lipid (octadecyl rhodamine B chloride) and aqueous (calcein) dye transfer assays and with the syncytium formation assay. Two deacylation mutants lacking a CT or carrying serine residues substituting for Cys578 and Cys581 promoted full fusion. However, one of the single-acylation-site mutants, C6, in which Cys581 is replaced with serine, promoted hemifusion but not pore formation. In contrast, four other single-acylation-site mutants that have a sole cysteine residue in the CT at position 575, 577, 579, or 581 promoted full fusion. The impaired pore-forming ability of C6 was improved by amino acid substitution between residues 578 and 582 or by deletion of the carboxy-terminal leucine at position 582. Syncytium-forming ability, however, was not adequately restored by these mutations. These facts indicated that the acylation was not significant in membrane fusion by BHA but that pore formation and pore dilation were appreciably affected by the particular amino acid sequence of the CT and the existence of a single acylation site in CT residue 578.

Select human cancer mutants of NRMT1 alter its catalytic activity and decrease N-terminal trimethylation.

PubMed

Shields, Kaitlyn M; Tooley, John G; Petkowski, Janusz J; Wilkey, Daniel W; Garbett, Nichola C; Merchant, Michael L; Cheng, Alan; Schaner Tooley, Christine E

2017-08-01

A subset of B-cell lymphoma patients have dominant mutations in the histone H3 lysine 27 (H3K27) methyltransferase EZH2, which change it from a monomethylase to a trimethylase. These mutations occur in aromatic resides surrounding the active site and increase growth and alter transcription. We study the N-terminal trimethylase NRMT1 and the N-terminal monomethylase NRMT2. They are 50% identical, but differ in key aromatic residues in their active site. Given how these residues affect EZH2 activity, we tested whether they are responsible for the distinct catalytic activities of NRMT1/2. Additionally, NRMT1 acts as a tumor suppressor in breast cancer cells. Its loss promotes oncogenic phenotypes but sensitizes cells to DNA damage. Mutations of NRMT1 naturally occur in human cancers, and we tested a select group for altered activity. While directed mutation of the aromatic residues had minimal catalytic effect, NRMT1 mutants N209I (endometrial cancer) and P211S (lung cancer) displayed decreased trimethylase and increased monomethylase/dimethylase activity. Both mutations are located in the peptide-binding channel and indicate a second structural region impacting enzyme specificity. The NRMT1 mutants demonstrated a slower rate of trimethylation and a requirement for higher substrate concentration. Expression of the mutants in wild type NRMT backgrounds showed no change in N-terminal methylation levels or growth rates, demonstrating they are not acting as dominant negatives. Expression of the mutants in cells lacking endogenous NRMT1 resulted in minimal accumulation of N-terminal trimethylation, indicating homozygosity could help drive oncogenesis or serve as a marker for sensitivity to DNA damaging chemotherapeutics or γ-irradiation. © 2017 The Protein Society.

Deletion of the distal COOH-terminus of the A2B adenosine receptor switches internalization to an arrestin- and clathrin-independent pathway and inhibits recycling.

PubMed

Mundell, S J; Matharu, A-L; Nisar, S; Palmer, T M; Benovic, J L; Kelly, E

2010-02-01

We have investigated the effect of deletions of a postsynaptic density, disc large and zo-1 protein (PDZ) motif at the end of the COOH-terminus of the rat A(2B) adenosine receptor on intracellular trafficking following long-term exposure to the agonist 5'-(N-ethylcarboxamido)-adenosine. The trafficking of the wild type A(2B) adenosine receptor and deletion mutants expressed in Chinese hamster ovary cells was studied using an enzyme-linked immunosorbent assay in combination with immunofluorescence microscopy. The wild type A(2B) adenosine receptor and deletion mutants were all extensively internalized following prolonged treatment with NECA. The intracellular compartment through which the Gln(325)-stop receptor mutant, which lacks the Type II PDZ motif found in the wild type receptor initially trafficked was not the same as the wild type receptor. Expression of dominant negative mutants of arrestin-2, dynamin or Eps-15 inhibited internalization of wild type and Leu(330)-stop receptors, whereas only dominant negative mutant dynamin inhibited agonist-induced internalization of Gln(325)-stop, Ser(326)-stop and Phe(328)-stop receptors. Following internalization, the wild type A(2B) adenosine receptor recycled rapidly to the cell surface, whereas the Gln(325)-stop receptor did not recycle. Deletion of the COOH-terminus of the A(2B) adenosine receptor beyond Leu(330) switches internalization from an arrestin- and clathrin-dependent pathway to one that is dynamin dependent but arrestin and clathrin independent. The presence of a Type II PDZ motif appears to be essential for arrestin- and clathrin-dependent internalization, as well as recycling of the A(2B) adenosine receptor following prolonged agonist addition.

Inactivation of agmatinase expressed in vegetative cells alters arginine catabolism and prevents diazotrophic growth in the heterocyst-forming cyanobacterium Anabaena.

PubMed

Burnat, Mireia; Flores, Enrique

2014-10-01

Arginine decarboxylase produces agmatine, and arginase and agmatinase are ureohydrolases that catalyze the production of ornithine and putrescine from arginine and agmatine, respectively, releasing urea. In the genome of the filamentous, heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, ORF alr2310 putatively encodes an ureohydrolase. Cells of Anabaena supplemented with [(14) C]arginine took up and catabolized this amino acid generating a set of labeled amino acids that included ornithine, proline, and glutamate. In an alr2310 deletion mutant, an agmatine spot appeared and labeled glutamate increased with respect to the wild type, suggesting that Alr2310 is an agmatinase rather than an arginase. As determined in cell-free extracts, agmatinase activity could be detected in the wild type but not in the mutant. Thus, alr2310 is the Anabaena speB gene encoding agmatinase. The ∆alr2310 mutant accumulated large amounts of cyanophycin granule polypeptide, lacked nitrogenase activity, and did not grow diazotrophically. Growth tests in solid media showed that agmatine is inhibitory for Anabaena, especially under diazotrophic conditions, suggesting that growth of the mutant is inhibited by non-metabolized agmatine. Measurements of incorporation of radioactivity from [(14) C]leucine into macromolecules showed, however, a limited inhibition of protein synthesis in the ∆alr2310 mutant. Analysis of an Anabaena strain producing an Alr2310-GFP (green fluorescent protein) fusion showed expression in vegetative cells but much less in heterocysts, implying compartmentalization of the arginine decarboxylation pathway in the diazotrophic filaments of this heterocyst-forming cyanobacterium. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Enhancement of hypermutation frequency in the chicken B cell line DT40 for efficient diversification of the antibody repertoire

DOE Office of Scientific and Technical Information (OSTI.GOV)

Magari, Masaki; Kanehiro, Yuichi; Todo, Kagefumi

Chicken B cell line DT40 continuously accumulates mutations in the immunoglobulin variable region (IgV) gene by gene conversion and point mutation, both of which are mediated by activation-induced cytidine deaminase (AID), thereby producing an antibody (Ab) library that is useful for screening monoclonal Abs (mAbs) in vitro. We previously generated an engineered DT40 line named DT40-SW, whose AID expression can be reversibly switched on or off, and developed an in vitro Ab generation system using DT40-SW cells. To efficiently create an Ab library with sufficient diversity, higher hypermutation frequency is advantageous. To this end, we generated a novel cell linemore » DT40-SW{Delta}C, which conditionally expresses a C-terminus-truncated AID mutant lacking the nuclear export signal. The transcription level of the mutant AID gene in DT40-SW{Delta}C cells was similar to that of the wild-type gene in DT40-SW cells. However, the protein level of the truncated AID mutant was less than that of the wild type. The mutant protein was enriched in the nuclei of DT40-SW{Delta}C cells, although the protein might be highly susceptible to degradation. In DT40-SW{Delta}C cells, both gene conversion and point mutation occurred in the IgV gene with over threefold higher frequency than in DT40-SW cells, suggesting that a lower level of the mutant AID protein was sufficient to increase mutation frequency. Thus, DT40-SW{Delta}C cells may be useful for constructing Ab libraries for efficient screening of mAbs in vitro.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asally, Munehiro; Yoneda, Yoshihiro

Nuclear accumulation of {beta}-catenin plays an important role in the Wnt signaling pathway. In the nucleus, {beta}-catenin acts as a transcriptional co-activator for TCF/LEF family of transcription factors. It has been shown that lef-1 contains a typical basic type nuclear localization signal (NLS) and is transported into the nucleus by the conventional import pathway. In this study, we found that a mutant lef-1 lacking the classical NLS accumulated in the nucleus of living cells, when {beta}-catenin was co-expressed. In addition, in a cell-free import assay, lef-1 migrated into the nucleus in the presence of {beta}-catenin alone without any other solublemore » factors. In contrast, another mutant lef-1 lacking the {beta}-catenin binding domain failed to migrate into the nucleus, even in the presence of {beta}-catenin. These findings indicate that {beta}-catenin alone can mediate the nuclear import of lef-1 through the direct binding. Collectively, we propose that there are two distinct pathways for the nuclear import of lef-1: importin {alpha}/{beta}-mediated and {beta}-catenin-mediated one, which provides a novel paradigm for Wnt signaling pathway.« less

Tbx6 controls left-right asymmetry through regulation of Gdf1.

PubMed

Concepcion, Daniel; Hamada, Hiroshi; Papaioannou, Virginia E

2018-05-04

The Tbx6 transcription factor plays multiple roles during gastrulation, somite formation and body axis determination. One of the notable features of the Tbx6 homozygous mutant phenotype is randomization of left/right axis determination. Cilia of the node are morphologically abnormal, leading to the hypothesis that disrupted nodal flow is the cause of the laterality defect. However, Tbx6 is expressed around but not in the node, leading to uncertainty as to the mechanism of this effect. In this study, we have examined the molecular characteristics of the node and the genetic cascade determining left/right axis determination. We found evidence that a leftward nodal flow is generated in Tbx6 homozygous mutants despite the cilia defect, establishing the initial asymmetric gene expression in Dand5 around the node, but that the transduction of the signal from the node to the left lateral plate mesoderm is disrupted due to lack of expression of the Nodal coligand Gdf1 around the node. Gdf1 was shown to be a downstream target of Tbx6 and a Gdf1 transgene partially rescues the laterality defect. © 2018. Published by The Company of Biologists Ltd.

A DNase encoded by integrated element CJIE1 inhibits natural transformation of Campylobacter jejuni.

PubMed

Gaasbeek, Esther J; Wagenaar, Jaap A; Guilhabert, Magalie R; Wösten, Marc M S M; van Putten, Jos P M; van der Graaf-van Bloois, Linda; Parker, Craig T; van der Wal, Fimme J

2009-04-01

The species Campylobacter jejuni is considered naturally competent for DNA uptake and displays strong genetic diversity. Nevertheless, nonnaturally transformable strains and several relatively stable clonal lineages exist. In the present study, the molecular mechanism responsible for the nonnatural transformability of a subset of C. jejuni strains was investigated. Comparative genome hybridization indicated that C. jejuni Mu-like prophage integrated element 1 (CJIE1) was more abundant in nonnaturally transformable C. jejuni strains than in naturally transformable strains. Analysis of CJIE1 indicated the presence of dns (CJE0256), which is annotated as a gene encoding an extracellular DNase. DNase assays using a defined dns mutant and a dns-negative strain expressing Dns from a plasmid indicated that Dns is an endogenous DNase. The DNA-hydrolyzing activity directly correlated with the natural transformability of the knockout mutant and the dns-negative strain expressing Dns from a plasmid. Analysis of a broader set of strains indicated that the majority of nonnaturally transformable strains expressed DNase activity, while all naturally competent strains lacked this activity. The inhibition of natural transformation in C. jejuni via endogenous DNase activity may contribute to the formation of stable lineages in the C. jejuni population.

The inability of Bacillus licheniformis perR mutant to grow is mainly due to the lack of PerR-mediated fur repression.

PubMed

Kim, Jung-Hoon; Yang, Yoon-Mo; Ji, Chang-Jun; Ryu, Su-Hyun; Won, Young-Bin; Ju, Shin-Yeong; Kwon, Yumi; Lee, Yeh-Eun; Youn, Hwan; Lee, Jin-Won

2017-06-01

PerR, a member of Fur family protein, is a metal-dependent H 2 O 2 sensing transcription factor that regulates genes involved in peroxide stress response. Industrially important bacterium Bacillus licheniformis contains three PerR-like proteins (PerR BL , PerR2, and PerR3) compared to its close relative Bacillus subtilis. Interestingly, unlike other bacteria including B. subtilis, no authentic perR BL null mutant could be established for B. licheniformis. Thus, we constructed a conditional perR BL mutant using a xylose-inducible promoter, and investigated the genes under the control of PerR BL . PerR BL regulon genes include katA, mrgA, ahpC, pfeT, hemA, fur, and perR as observed for PerR BS . However, there is some variation in the expression levels of fur and hemA genes between B. subtilis and B. licheniformis in the derepressed state. Furthermore, katA, mrgA, and ahpC are strongly induced, whereas the others are only weakly or not induced by H 2 O 2 treatment. In contrast to the B. subtilis perR null mutant which frequently gives rise to large colony phenotype mainly due to the loss of katA, the suppressors of B. licheniformis perR mutant, which can form colonies on LB agar, were all catalase-positive. Instead, many of the suppressors showed increased levels of siderophore production, suggesting that the suppressor mutation is linked to the fur gene. Consistent with this, perR fur double mutant could grow on LB agar without Fe supplementation, whereas perR katA double mutant could only grow on LB agar with Fe supplementation. Taken together, our data suggest that in B. licheniformis, despite the similarity in PerR BL and PerR BS regulon genes, perR is an essential gene required for growth and that the inability of perR null mutant to grow is mainly due to elevated expression of Fur.

Deletion of the N-terminal Domain (NTD) Alters the Ethanol Inhibition of NMDA Receptors in a Subunit-Dependent Manner

PubMed Central

Smothers, C. Thetford; Jin, Chun; Woodward, John J.

2013-01-01

Background Ethanol inhibition of NMDA receptors is poorly understood due in part to the organizational complexity of the receptor that provides ample locations for sites of action. Among these the N-terminal domain of NMDA receptor subunits contains binding sites for a variety of modulatory agents including zinc, protons and GluN2B selective antagonists such as ifenprodil or Ro-25–6981. Ethanol inhibition of neuronal NMDA receptors expressed in some brain areas has been reported to be occluded by the presence of ifenprodil or similar compounds suggesting that the N-terminal domain may be important in regulating the ethanol sensitivity of NMDA receptors. Methods Wild-type GluN1 and GluN2 subunits and those in which the coding sequence for the N-terminal domain was deleted were expressed in HEK293 cells. Whole-cell voltage-clamp recording was used to assess ethanol inhibition of wild-type and mutant receptors lacking the N-terminal domain. Results As compared to wild-type GluN1/GluN2A receptors, ethanol inhibition was slightly greater in cells expressing GluN2A subunits lacking the N-terminal domain. In contrast, GluN2B N-terminal deletion mutants showed normal ethanol inhibition while those lacking the N-terminal domain in both GluN1 and GluN2B subunits had decreased ethanol inhibition as compared to wild-type receptors. N-terminal domain lacking GluN2B receptors were insensitive to ifenprodil but retained normal sensitivity to ethanol. Conclusions These findings indicate that the N-terminal domain modestly influences the ethanol sensitivity of NMDA receptors in a subunit-dependent manner. They also show that ifenprodil’s actions on GluN2B containing receptors can be dissociated from those of ethanol. These results suggest that while the N-terminal domain is not a primary site of action for ethanol on NMDA receptors, it likely affects sensitivity via actions on intrinsic channel properties. PMID:23905549

Photosynthetic Electron Transport Chain of Chlamydomonas reinhardi VI. Electron Transport in Mutant Strains Lacking Either Cytochrome 553 or Plastocyanin 1

PubMed Central

Gorman, Donald S.; Levine, R. P.

1966-01-01

A mutant strain of Chlamydomonas reinhardi, ac-206, lacks cytochrome 553, at least in an active and detectable form. Chloroplast fragments of this mutant strain are inactive in the photoreduction of NADP when the source of electrons is water, but they are active when the electron source is 2,6-dichlorophenolindophenol and ascorbate. The addition of either cytochrome 553 or plastocyanin, obtained from the wild-type strain, has no effect upon the photosynthetic activities of the mutant strain. Cells of the mutant strain lack both the soluble and insoluble forms of cytochrome 553, but they possess the mitochondrial type cytochrome c. Thus, the loss of cytochrome 553 appears to be specific. Another mutant strain, ac-208, lacks plastocyanin, or possesses it in an inactive and undetectable form. Chloroplast fragments of ac-208 are inactive in the photoreduction of NADP with either water or 2,6-dichlorophenolindophenol and ascorbate as electron donors. However, these reactions are restored upon the addition of plastocyanin. The addition of cytochrome 553 has no effect. The measurement of light-induced absorbance changes with ac-208 reveal that, in the absence of plastocyanin, light fails to sensitize the oxidation of cytochrome 553, but it will sensitize its reduction. However, the addition of plastocyanin restores the light-induced cytochrome oxidation. A third mutant strain, ac-208 (sup.) carries a suppressor mutation that partially restores the wild phenotype. This mutant strain appears to possess a plastocyanin that is less stable than that of the wild-type strain. The observations with the mutant strains are discussed in terms of the sequence of electron transport System II → cytochrome 553 → plastocyanin → System I. PMID:16656453

Functional genomics of fuzzless-lintless mutant of Gossypium hirsutum L. cv. MCU5 reveal key genes and pathways involved in cotton fibre initiation and elongation

PubMed Central

2012-01-01

Background Fuzzless-lintless cotton mutants are considered to be the ideal material to understand the molecular mechanisms involved in fibre cell development. Although there are few reports on transcriptome and proteome analyses in cotton at fibre initiation and elongation stages, there is no comprehensive comparative transcriptome analysis of fibre-bearing and fuzzless-lintless cotton ovules covering fibre initiation to secondary cell wall (SCW) synthesis stages. In the present study, a comparative transcriptome analysis was carried out using G. hirsutum L. cv. MCU5 wild-type (WT) and it’s near isogenic fuzzless-lintless (fl) mutant at fibre initiation (0 dpa/days post anthesis), elongation (5, 10 and 15 dpa) and SCW synthesis (20 dpa) stages. Results Scanning electron microscopy study revealed the delay in the initiation of fibre cells and lack of any further development after 2 dpa in the fl mutant. Transcriptome analysis showed major down regulation of transcripts (90%) at fibre initiation and early elongation (5 dpa) stages in the fl mutant. Majority of the down regulated transcripts at fibre initiation stage in the fl mutant represent calcium and phytohormone mediated signal transduction pathways, biosynthesis of auxin and ethylene and stress responsive transcription factors (TFs). Further, transcripts involved in carbohydrate and lipid metabolisms, mitochondrial electron transport system (mETS) and cell wall loosening and elongation were highly down-regulated at fibre elongation stage (5–15 dpa) in the fl mutant. In addition, cellulose synthases and sucrose synthase C were down-regulated at SCW biosynthesis stage (15–20 dpa). Interestingly, some of the transcripts (~50%) involved in phytohormone signalling and stress responsive transcription factors that were up-regulated at fibre initiation stage in the WT were found to be up-regulated at much later stage (15 dpa) in fl mutant. Conclusions Comparative transcriptome analysis of WT and its near isogenic fl mutant revealed key genes and pathways involved at various stages of fibre development. Our data implicated the significant role of mitochondria mediated energy metabolism during fibre elongation process. The delayed expression of genes involved in phytohormone signalling and stress responsive TFs in the fl mutant suggests the need for a coordinated expression of regulatory mechanisms in fibre cell initiation and differentiation. PMID:23151214

Contribution of Egr1/zif268 to Activity-Dependent Arc/Arg3.1 Transcription in the Dentate Gyrus and Area CA1 of the Hippocampus

PubMed Central

Penke, Zsuzsa; Chagneau, Carine; Laroche, Serge

2011-01-01

Egr1, a member of the Egr family of transcription factors, and Arc are immediate early genes known to play major roles in synaptic plasticity and memory. Despite evidence that Egr family members can control Arc transcriptional regulation, demonstration of a selective role of Egr1 alone is lacking. We investigated the extent to which activity-dependent Arc expression is dependent on Egr1 by analyzing Arc mRNA expression using fluorescence in situ hybridization in the dorsal dentate gyrus and CA1 of wild-type (WT) and Egr1 knockout mice. Following electroconvulsive shock, we found biphasic expression of Arc in area CA1 in mice, consisting in a rapid (30 min) and transient wave followed by a second late-phase of expression (8 h), and a single but prolonged wave of expression in the dentate gyrus. Egr1 deficiency abolished the latest, but not the early wave of Arc expression in CA1, and curtailed that of the dentate gyrus. Since the early wave of Arc expression was not affected in Egr1 mutant mice, we next analyzed behaviorally induced Arc expression patterns as an index of neural ensemble activation in the dentate gyrus and area CA1 of WT and Egr1 mutant mice. Spatial exploration of novel or familiar environments induced in mice a single early and transient wave of Arc expression in the dentate gyrus and area CA1, which were not affected in Egr1 mutant mice. Analyses of Arc-expressing cells revealed that exploration recruits similar size dentate gyrus and CA1 neural ensembles in WT and Egr1 knockout mice. These findings suggest that hippocampal neural ensembles are normally activated immediately following spatial exploration in Egr1 knockout mice, indicating normal hippocampal encoding of information. They also provide evidence that in condition of strong activation Egr1 alone can control late-phases of activity-dependent Arc transcription in the dentate gyrus and area CA1 of the hippocampus. PMID:21887136

Delayed Cutaneous Wound Healing and Aberrant Expression of Hair Follicle Stem Cell Markers in Mice Selectively Lacking Ctip2 in Epidermis

PubMed Central

Bajaj, Gaurav; Guha, Gunjan; Wang, Zhixing; Jang, Hyo-Sang; Leid, Mark; Indra, Arup Kumar; Ganguli-Indra, Gitali

2012-01-01

Background COUP-TF interacting protein 2 [(Ctip2), also known as Bcl11b] is an important regulator of skin homeostasis, and is overexpressed in head and neck cancer. Ctip2ep−/− mice, selectively ablated for Ctip2 in epidermal keratinocytes, exhibited impaired terminal differentiation and delayed epidermal permeability barrier (EPB) establishment during development, similar to what was observed in Ctip2 null (Ctip2−/−) mice. Considering that as an important role of Ctip2, and the fact that molecular networks which underlie cancer progression partially overlap with those responsible for tissue remodeling, we sought to determine the role of Ctip2 during cutaneous wound healing. Methodology/Principal Findings Full thickness excisional wound healing experiments were performed on Ctip2L2/L2 and Ctip2ep−/− animals per time point and used for harvesting samples for histology, immunohistochemistry (IHC) and immunoblotting. Results demonstrated inherent defects in proliferation and migration of Ctip2 lacking keratinocytes during re-epithelialization. Mutant mice exhibited reduced epidermal proliferation, delayed keratinocyte activation, altered cell-cell adhesion and impaired ECM development. Post wounding, Ctip2ep−/− mice wounds displayed lack of E-Cadherin suppression in the migratory tongue, insufficient expression of alpha smooth muscle actin (alpha SMA) in the dermis, and robust induction of K8. Importantly, dysregulated expression of several hair follicle (HF) stem cell markers such as K15, NFATc1, CD133, CD34 and Lrig1 was observed in mutant skin during wound repair. Conclusions/Significance Results confirm a cell autonomous role of keratinocytic Ctip2 to modulate cell migration, proliferation and/or differentiation, and to maintain HF stem cells during cutaneous wounding. Furthermore, Ctip2 in a non-cell autonomous manner regulated granulation tissue formation and tissue contraction during wound closure. PMID:22383956

A WRKY Transcription Factor Regulates Fe Translocation under Fe Deficiency.

PubMed

Yan, Jing Ying; Li, Chun Xiao; Sun, Li; Ren, Jiang Yuan; Li, Gui Xin; Ding, Zhong Jie; Zheng, Shao Jian

2016-07-01

Iron (Fe) deficiency affects plant growth and development, leading to reduction of crop yields and quality. Although the regulation of Fe uptake under Fe deficiency has been well studied in the past decade, the regulatory mechanism of Fe translocation inside the plants remains unknown. Here, we show that a WRKY transcription factor WRKY46 is involved in response to Fe deficiency. Lack of WRKY46 (wrky46-1 and wrky46-2 loss-of-function mutants) significantly affects Fe translocation from root to shoot and thus causes obvious chlorosis on the new leaves under Fe deficiency. Gene expression analysis reveals that expression of a nodulin-like gene (VACUOLAR IRON TRANSPORTER1-LIKE1 [VITL1]) is dramatically increased in wrky46-1 mutant. VITL1 expression is inhibited by Fe deficiency, while the expression of WRKY46 is induced in the root stele. Moreover, down-regulation of VITL1 expression can restore the chlorosis phenotype on wrky46-1 under Fe deficiency. Further yeast one-hybrid and chromatin immunoprecipitation experiments indicate that WRKY46 is capable of binding to the specific W-boxes present in the VITL1 promoter. In summary, our results demonstrate that WRKY46 plays an important role in the control of root-to-shoot Fe translocation under Fe deficiency condition via direct regulation of VITL1 transcript levels. © 2016 American Society of Plant Biologists. All Rights Reserved.

The requirements of yeast Hsp70 of SSA family for the ubiquitin-dependent degradation of short-lived and abnormal proteins.

PubMed

Lee, Do Hee; Sherman, Michael Y; Goldberg, Alfred L

2016-06-17

Cytoplasmic Hsp70s of SSA family, especially Ssa1p, are involved in the degradation of a variety of misfolded proteins in yeast. However the importance of other Ssa proteins in this process is unclear. To clarify the role(s) of individual Ssa proteins in proteolysis, we measured the breakdown of various cell proteins in mutants lacking different Ssa proteins. In mutants lacking Ssa1p and Ssa2p, the proteasomal degradation of short-lived proteins was reduced, which was not restored fully by the over-expression of Ssa1p. By contrast, the degradation of stable cellular proteins did not require Ssa proteins. The degradation of the cytosolic model substrates (Ub-P-β-gal and R-β-gal) and their ubiquitylation were inhibited by the inactivation of Ssa proteins. In addition, Ssa1p and the co-chaperone Ydj1p are indispensable for the intracellular degradation of a mutant secretory protein, Siiyama variant of human antitrypsin. Our findings indicate that both Ssa1p and Ssa2p are essential for the ubiquitin-dependent degradation of short-lived proteins and the requirements of Ssa proteins and the co-chaperones widely vary depending on the conformations and folding status of the substrates. Copyright © 2016 Elsevier Inc. All rights reserved.

The Staphylococcus aureus Global Regulator MgrA Modulates Clumping and Virulence by Controlling Surface Protein Expression

PubMed Central

Crosby, Heidi A.; Schlievert, Patrick M.; Merriman, Joseph A.; King, Jessica M.; Salgado-Pabón, Wilmara; Horswill, Alexander R.

2016-01-01

Staphylococcus aureus is a human commensal and opportunistic pathogen that causes devastating infections in a wide range of locations within the body. One of the defining characteristics of S. aureus is its ability to form clumps in the presence of soluble fibrinogen, which likely has a protective benefit and facilitates adhesion to host tissue. We have previously shown that the ArlRS two-component regulatory system controls clumping, in part by repressing production of the large surface protein Ebh. In this work we show that ArlRS does not directly regulate Ebh, but instead ArlRS activates expression of the global regulator MgrA. Strains lacking mgrA fail to clump in the presence of fibrinogen, and clumping can be restored to an arlRS mutant by overexpressing either arlRS or mgrA, indicating that ArlRS and MgrA constitute a regulatory pathway. We used RNA-seq to show that MgrA represses ebh, as well as seven cell wall-associated proteins (SraP, Spa, FnbB, SasG, SasC, FmtB, and SdrD). EMSA analysis showed that MgrA directly represses expression of ebh and sraP. Clumping can be restored to an mgrA mutant by deleting the genes for Ebh, SraP and SasG, suggesting that increased expression of these proteins blocks clumping by steric hindrance. We show that mgrA mutants are less virulent in a rabbit model of endocarditis, and virulence can be partially restored by deleting the genes for the surface proteins ebh, sraP, and sasG. While mgrA mutants are unable to clump, they are known to have enhanced biofilm capacity. We demonstrate that this increase in biofilm formation is partially due to up-regulation of SasG, a surface protein known to promote intercellular interactions. These results confirm that ArlRS and MgrA constitute a regulatory cascade, and that they control expression of a number of genes important for virulence, including those for eight large surface proteins. PMID:27144398

Candidate genes for panhypopituitarism identified by gene expression profiling

PubMed Central

Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis

2011-01-01

Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248

Combinatorial Wnt control of zebrafish midbrain-hindbrain boundary formation.

PubMed

Buckles, Gerri R; Thorpe, Christopher J; Ramel, Marie-Christine; Lekven, Arne C

2004-05-01

Wnt signaling is known to be required for the normal development of the vertebrate midbrain and hindbrain, but genetic loss of function analyses in the mouse and zebrafish yield differing results regarding the relative importance of specific Wnt loci. In the zebrafish, Wnt1 and Wnt10b functionally overlap in their control of gene expression in the ventral midbrain-hindbrain boundary (MHB), but they are not required for the formation of the MHB constriction. Whether other wnt loci are involved in zebrafish MHB development is unclear, although the expression of at least two wnts, wnt3a and wnt8b, is maintained in wnt1/wnt10b mutants. In order to address the role of wnt3a in zebrafish, we have isolated a full length cDNA and examined its expression and function via knockdown by morpholino antisense oligonucleotide (MO)-mediated knockdown. The expression pattern of wnt3a appears to be evolutionarily conserved between zebrafish and mouse, and MO knockdown shows that Wnt3a, while not uniquely required for MHB development, is required in the absence of Wnt1 and Wnt10b for the formation of the MHB constriction. In zebrafish embryos lacking Wnt3a, Wnt1 and Wnt10b, the expression of engrailed orthologs, pax2a and fgf8 is not maintained after mid-somitogenesis. In contrast to acerebellar and no isthmus mutants, in which midbrain and hindbrain cells acquire new fates but cell number is not significantly affected until late in embryogenesis, zebrafish embryos lacking Wnt3a, Wnt1 and Wnt10b undergo extensive apoptosis in the midbrain and cerebellum anlagen beginning in mid-somitogenesis, which results in the absence of a significant portion of the midbrain and cerebellum. Thus, the requirement for Wnt signaling in forming the MHB constriction is evolutionarily conserved in vertebrates and it is possible in zebrafish to dissect the relative impact of multiple Wnt loci in midbrain and hindbrain development.

Headbobber: A Combined Morphogenetic and Cochleosaccular Mouse Model to Study 10qter Deletions in Human Deafness

PubMed Central

Buniello, Annalisa; Hardisty-Hughes, Rachel E.; Pass, Johanna C.; Bober, Eva; Smith, Richard J.; Steel, Karen P.

2013-01-01

The recessive mouse mutant headbobber (hb) displays the characteristic behavioural traits associated with vestibular defects including headbobbing, circling and deafness. This mutation was caused by the insertion of a transgene into distal chromosome 7 affecting expression of native genes. We show that the inner ear of hb/hb mutants lacks semicircular canals and cristae, and the saccule and utricle are fused together in a single utriculosaccular sac. Moreover, we detect severe abnormalities of the cochlear sensory hair cells, the stria vascularis looks severely disorganised, Reissner's membrane is collapsed and no endocochlear potential is detected. Myo7a and Kcnj10 expression analysis show a lack of the melanocyte-like intermediate cells in hb/hb stria vascularis, which can explain the absence of endocochlear potential. We use Trp2 as a marker of melanoblasts migrating from the neural crest at E12.5 and show that they do not interdigitate into the developing strial epithelium, associated with abnormal persistence of the basal lamina in the hb/hb cochlea. We perform array CGH, deep sequencing as well as an extensive expression analysis of candidate genes in the headbobber region of hb/hb and littermate controls, and conclude that the headbobber phenotype is caused by: 1) effect of a 648 kb deletion on distal Chr7, resulting in the loss of three protein coding genes (Gpr26, Cpmx2 and Chst15) with expression in the inner ear but unknown function; and 2) indirect, long range effect of the deletion on the expression of neighboring genes on Chr7, associated with downregulation of Hmx3, Hmx2 and Nkx1.2 homeobox transcription factors. Interestingly, deletions of the orthologous region in humans, affecting the same genes, have been reported in nineteen patients with common features including sensorineural hearing loss and vestibular problems. Therefore, we propose that headbobber is a useful model to gain insight into the mechanisms underlying deafness in human 10qter deletion syndrome. PMID:23457544

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Mutational analysis of the major soybean UreF paralogue involved in urease activation.

PubMed

Polacco, Joe C; Hyten, David L; Medeiros-Silva, Mônica; Sleper, David A; Bilyeu, Kristin D

2011-06-01

The soybean genome duplicated ∼14 and 45 million years ago and has many paralogous genes, including those in urease activation (emplacement of Ni and CO(2) in the active site). Activation requires the UreD and UreF proteins, each encoded by two paralogues. UreG, a third essential activation protein, is encoded by the single-copy Eu3, and eu3 mutants lack activity of both urease isozymes. eu2 has the same urease-negative phenotype, consistent with Eu2 being a single-copy gene, possibly encoding a Ni carrier. Unexpectedly, two eu2 alleles co-segregated with missense mutations in the chromosome 2 UreF paralogue (Ch02UreF), suggesting lack of expression/function of Ch14UreF. However, Ch02UreF and Ch14UreF transcripts accumulate at the same level. Further, it had been shown that expression of the Ch14UreF ORF complemented a fungal ureF mutant. A third, nonsense (Q2*) allelic mutant, eu2-c, exhibited 5- to 10-fold more residual urease activity than missense eu2-a or eu2-b, though eu2-c should lack all Ch02UreF protein. It is hypothesized that low-level activation by Ch14UreF is 'spoiled' by the altered missense Ch02UreF proteins ('epistatic dominant-negative'). In agreement with active 'spoiling' by eu2-b-encoded Ch02UreF (G31D), eu2-b/eu2-c heterozygotes had less than half the urease activity of eu2-c/eu2-c siblings. Ch02UreF (G31D) could spoil activation by Chr14UreF because of higher affinity for the activation complex, or because Ch02UreF (G31D) is more abundant than Ch14UreF. Here, the latter is favoured, consistent with a reported in-frame AUG in the 5' leader of Chr14UreF transcript. Translational inhibition could represent a form of 'functional divergence' of duplicated genes.

Mutational analysis of the major soybean UreF paralogue involved in urease activation

PubMed Central

Polacco, Joe C.; Hyten, David L.; Medeiros-Silva, Mônica; Sleper, David A.; Bilyeu, Kristin D.

2011-01-01

The soybean genome duplicated ∼14 and 45 million years ago and has many paralogous genes, including those in urease activation (emplacement of Ni and CO2 in the active site). Activation requires the UreD and UreF proteins, each encoded by two paralogues. UreG, a third essential activation protein, is encoded by the single-copy Eu3, and eu3 mutants lack activity of both urease isozymes. eu2 has the same urease-negative phenotype, consistent with Eu2 being a single-copy gene, possibly encoding a Ni carrier. Unexpectedly, two eu2 alleles co-segregated with missense mutations in the chromosome 2 UreF paralogue (Ch02UreF), suggesting lack of expression/function of Ch14UreF. However, Ch02UreF and Ch14UreF transcripts accumulate at the same level. Further, it had been shown that expression of the Ch14UreF ORF complemented a fungal ureF mutant. A third, nonsense (Q2*) allelic mutant, eu2-c, exhibited 5- to 10-fold more residual urease activity than missense eu2-a or eu2-b, though eu2-c should lack all Ch02UreF protein. It is hypothesized that low-level activation by Ch14UreF is ‘spoiled’ by the altered missense Ch02UreF proteins (‘epistatic dominant-negative’). In agreement with active ‘spoiling’ by eu2-b-encoded Ch02UreF (G31D), eu2-b/eu2-c heterozygotes had less than half the urease activity of eu2-c/eu2-c siblings. Ch02UreF (G31D) could spoil activation by Chr14UreF because of higher affinity for the activation complex, or because Ch02UreF (G31D) is more abundant than Ch14UreF. Here, the latter is favoured, consistent with a reported in-frame AUG in the 5' leader of Chr14UreF transcript. Translational inhibition could represent a form of ‘functional divergence’ of duplicated genes. PMID:21430294

Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

PubMed

Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

2017-11-01

The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and express virulence-related traits. Mutants lacking the FruR regulator or a particular phosphofructokinase, FruK, display changes in expression of a large number of genes encoding transcriptional regulators, enzymes required for energy metabolism, biofilm development, biosynthetic and degradative processes, and tolerance of a spectrum of environmental stressors. Since fructose is a major component of the modern human diet, the results have substantial significance in the context of oral health and the development of dental caries. Copyright © 2017 American Society for Microbiology.

Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu Ning; Laboratory of Neurochemistry, Graduate School of Human and Environmental Studies, Kyoto University, Kyoto; Adachi, Tetsuya

2006-08-04

Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2more » mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.« less

Channel-Opening Kinetic Mechanism of Wild-Type GluK1 Kainate Receptors and a C-Terminal Mutant

PubMed Central

Han, Yan; Wang, Congzhou; Park, Jae Seon; Niu, Li

2012-01-01

GluK1 is a kainate receptor subunit in the ionotropic glutamate receptor family and can form functional channels when expressed, for instance, in HEK-293 cells. However, the channel-opening mechanism of GluK1 is poorly understood. One major challenge to studying the GluK1 channel is its apparent low surface expression, which results in a low whole-cell current response even to a saturating concentration of agonist. The low surface expression is thought to be contributed by an endoplasmic reticulum (ER) retention signal sequence. When this sequence motif is present as in the wild-type GluK1-2b C-terminus, the receptor is significantly retained in the ER. Conversely, when this sequence is lacking, as in wild-type GluK1-2a (i.e., a different alternatively spliced isoform at the C-terminus) and in a GluK1-2b mutant (i.e., R896A, R897A, R900A and K901A) that disrupts the ER retention signal, there is higher surface expression and greater whole-cell current response. Here we characterize the channel-opening kinetic mechanism for these three GluK1 receptors expressed in HEK-293 cells by using a laser-pulse photolysis technique. Our results show that the wild-type GluK1-2a, wild-type GluK1-2b and the mutant GluK1-2b have identical channel-opening and channel-closing rate constants. These results indicate that the C-terminal ER retention signal sequence, which affects receptor trafficking/expression, does not affect channel-gating properties. Furthermore, as compared with the GluK2 kainate receptor, the GluK1 channel is faster to open, close, and desensitize by at least two-fold, yet the EC50 value of GluK1 is similar to that of GluK2. PMID:22191429

The hippocampo-amygdala control of contextual fear expression is affected in a model of intellectual disability.

PubMed

Zhang, Chun-Lei; Houbaert, Xander; Lepleux, Marilyn; Deshors, Melissa; Normand, Elisabeth; Gambino, Frédéric; Herzog, Etienne; Humeau, Yann

2015-11-01

The process of learning mainly depends on the ability to store new information, while the ability to retrieve this information and express appropriate behaviors are also crucial for the adaptation of individuals to environmental cues. Thereby, all three components contribute to the cognitive fitness of an individual. While a lack of behavioral adaptation is a recurrent trait of intellectually disabled patients, discriminating between memory formation, memory retrieval or behavioral expression deficits is not easy to establish. Here, we report some deficits in contextual fear behavior in knockout mice for the intellectual disability gene Il1rapl1. Functional in vivo experiments revealed that the lack of conditioned response resulted from a local inhibitory to excitatory (I/E) imbalance in basolateral amygdala (BLA) consecutive to a loss of excitatory drive onto BLA principal cells by caudal hippocampus axonal projections. A normalization of the fear behavior was obtained in adult mutant mice following opsin-based in vivo synaptic priming of hippocampo-BLA synapses in adult il1rapl1 knockout mice, indicating that synaptic efficacy at hippocampo-BLA projections is crucial for contextual fear memory expression. Importantly, because this restoration was obtained after the learning phase, our results suggest that some of the genetically encoded cognitive deficits in humans may originate from a lack of restitution of genuinely formed memories rather than an exclusive inability to store new memories.

A mitochondrial NADH-dependent fumarate reductase involved in the production of succinate excreted by procyclic Trypanosoma brucei.

PubMed

Coustou, Virginie; Besteiro, Sébastien; Rivière, Loïc; Biran, Marc; Biteau, Nicolas; Franconi, Jean-Michel; Boshart, Michael; Baltz, Théo; Bringaud, Frédéric

2005-04-29

Trypanosoma brucei is a parasitic protist responsible for sleeping sickness in humans. The procyclic stage of T. brucei expresses a soluble NADH-dependent fumarate reductase (FRDg) in the peroxisome-like organelles called glycosomes. This enzyme is responsible for the production of about 70% of the excreted succinate, the major end product of glucose metabolism in this form of the parasite. Here we functionally characterize a new gene encoding FRD (FRDm1) expressed in the procyclic stage. FRDm1 is a mitochondrial protein, as evidenced by immunolocalization, fractionation of digitonin-permeabilized cells, and expression of EGFP-tagged FRDm1 in the parasite. RNA interference was used to deplete FRDm1, FRDg, or both together. The analysis of the resulting mutant cell lines showed that FRDm1 is responsible for 30% of the cellular NADH-FRD activity, which solves a long standing debate regarding the existence of a mitochondrial FRD in trypanosomatids. FRDg and FRDm1 together account for the total NADH-FRD activity in procyclics, because no activity was measured in the double mutant lacking expression of both proteins. Analysis of the end products of 13C-enriched glucose excreted by these mutant cell lines showed that FRDm1 contributes to the production of between 14 and 44% of the succinate excreted by the wild type cells. In addition, depletion of one or both FRD enzymes results in up to 2-fold reduction of the rate of glucose consumption. We propose that FRDm1 is involved in the maintenance of the redox balance in the mitochondrion, as proposed for the ancestral soluble FRD presumably present in primitive anaerobic cells.

Salt stress-induced proline transporters and salt stress-repressed broad specificity amino acid permeases identified by suppression of a yeast amino acid permease-targeting mutant.

PubMed Central

Rentsch, D; Hirner, B; Schmelzer, E; Frommer, W B

1996-01-01

A yeast mutant lacking SHR3, a protein specifically required for correct targeting of plasma membrane amino acid permeases, was used to study the targeting of plant transporters and as a tool to isolate new SHR3-independent amino acid transporters. For this purpose, an shr3 mutant was transformed with an Arabidopsis cDNA library. Thirty-four clones were capable of growth under selective conditions, but none showed homology with SHR3. However, genes encoding eight different amino acid transporters belonging to three different transporter families were isolated. Five of these are members of the general amino acid permease (AAP) gene family, one is a member of the NTR family, encoding an oligopeptide transporter, and two belong to a new class of transporter genes. A functional analysis of the latter two genes revealed that they encode specific proline transporters (ProT) that are distantly related to the AAP gene family. ProT1 was found to be expressed in all organs, but highest levels were found in roots, stems, and flowers. Expression in flowers was highest in the floral stalk phloem that enters the carpels and was downregulated after fertilization, indicating a specific role in supplying the ovules with proline. ProT2 transcripts were found ubiquitously throughout the plant, but expression was strongly induced under water or salt stress, implying that ProT2 plays an important role in nitrogen distribution during water stress, unlike members of the AAP gene family whose expression was repressed under the same conditions. These results corroborate the general finding that under water stress, amino acid export is impaired whereas proline export is increased. PMID:8776904

The bHLH transcription factor, hairy, refines the terminal cell fate in the Drosophila embryonic trachea.

PubMed

Zhan, Yaoyao; Maung, Saw W; Shao, Bing; Myat, Monn Monn

2010-11-30

The pair-rule gene, hairy, encodes a basic helix-loop-helix transcription factor and is required for patterning of the early Drosophila embryo and for morphogenesis of the embryonic salivary gland. Although hairy was shown to be expressed in the tracheal primordia and in surrounding mesoderm, whether hairy plays a role in tracheal development is not known. Here, we report that hairy is required for refining the terminal cell fate in the embryonic trachea and that hairy's tracheal function is distinct from its earlier role in embryonic patterning. In hairy mutant embryos where the repressive activity of hairy is lost due to lack of its co-repressor binding site, extra terminal cells are specified in the dorsal branches. We show that hairy functions in the muscle to refine the terminal cell fate to a single cell at the tip of the dorsal branch by limiting the expression domain of branchless (bnl), encoding the FGF ligand, in surrounding muscle cells. Abnormal activation of the Bnl signaling pathway in hairy mutant tracheal cells is exemplified by increased number of dorsal branch cells expressing Bnl receptor, Breathless (Btl) and Pointed, a downstream target of the Bnl/Btl signaling pathway. We also show that hairy genetically interacts with bnl in TC fate restriction and that overexpression of bnl in a subset of the muscle surrounding tracheal cells phenocopied the hairy mutant phenotype. Our studies demonstrate a novel role for Hairy in restriction of the terminal cell fate by limiting the domain of bnl expression in surrounding muscle cells such that only a single dorsal branch cell becomes specified as a terminal cell. These studies provide the first evidence for Hairy in regulation of the FGF signaling pathway during branching morphogenesis.

Antibodies against In Vivo-Expressed Antigens Are Sufficient To Protect against Lethal Aerosol Infection with Burkholderia mallei and Burkholderia pseudomallei.

PubMed

Zimmerman, Shawn M; Dyke, Jeremy S; Jelesijevic, Tomislav P; Michel, Frank; Lafontaine, Eric R; Hogan, Robert J

2017-08-01

Burkholderia mallei , a facultative intracellular bacterium and tier 1 biothreat, causes the fatal zoonotic disease glanders. The organism possesses multiple genes encoding autotransporter proteins, which represent important virulence factors and targets for developing countermeasures in pathogenic Gram-negative bacteria. In the present study, we investigated one of these autotransporters, BatA, and demonstrate that it displays lipolytic activity, aids in intracellular survival, is expressed in vivo , elicits production of antibodies during infection, and contributes to pathogenicity in a mouse aerosol challenge model. A mutation in the batA gene of wild-type strain ATCC 23344 was found to be particularly attenuating, as BALB/c mice infected with the equivalent of 80 median lethal doses cleared the organism. This finding prompted us to test the hypothesis that vaccination with the batA mutant strain elicits protective immunity against subsequent infection with wild-type bacteria. We discovered that not only does vaccination provide high levels of protection against lethal aerosol challenge with B. mallei ATCC 23344, it also protects against infection with multiple isolates of the closely related organism and causative agent of melioidosis, Burkholderia pseudomallei Passive-transfer experiments also revealed that the protective immunity afforded by vaccination with the batA mutant strain is predominantly mediated by IgG antibodies binding to antigens expressed exclusively in vivo Collectively, our data demonstrate that BatA is a target for developing medical countermeasures and that vaccination with a mutant lacking expression of the protein provides a platform to gain insights regarding mechanisms of protective immunity against B. mallei and B. pseudomallei , including antigen discovery. Copyright © 2017 American Society for Microbiology.

Antibodies against In Vivo-Expressed Antigens Are Sufficient To Protect against Lethal Aerosol Infection with Burkholderia mallei and Burkholderia pseudomallei

PubMed Central

Zimmerman, Shawn M.; Dyke, Jeremy S.; Jelesijevic, Tomislav P.; Michel, Frank; Lafontaine, Eric R.

2017-01-01

ABSTRACT Burkholderia mallei, a facultative intracellular bacterium and tier 1 biothreat, causes the fatal zoonotic disease glanders. The organism possesses multiple genes encoding autotransporter proteins, which represent important virulence factors and targets for developing countermeasures in pathogenic Gram-negative bacteria. In the present study, we investigated one of these autotransporters, BatA, and demonstrate that it displays lipolytic activity, aids in intracellular survival, is expressed in vivo, elicits production of antibodies during infection, and contributes to pathogenicity in a mouse aerosol challenge model. A mutation in the batA gene of wild-type strain ATCC 23344 was found to be particularly attenuating, as BALB/c mice infected with the equivalent of 80 median lethal doses cleared the organism. This finding prompted us to test the hypothesis that vaccination with the batA mutant strain elicits protective immunity against subsequent infection with wild-type bacteria. We discovered that not only does vaccination provide high levels of protection against lethal aerosol challenge with B. mallei ATCC 23344, it also protects against infection with multiple isolates of the closely related organism and causative agent of melioidosis, Burkholderia pseudomallei. Passive-transfer experiments also revealed that the protective immunity afforded by vaccination with the batA mutant strain is predominantly mediated by IgG antibodies binding to antigens expressed exclusively in vivo. Collectively, our data demonstrate that BatA is a target for developing medical countermeasures and that vaccination with a mutant lacking expression of the protein provides a platform to gain insights regarding mechanisms of protective immunity against B. mallei and B. pseudomallei, including antigen discovery. PMID:28507073

Trigger factor of Streptococcus suis is involved in stress tolerance and virulence.

PubMed

Wu, Tao; Zhao, Zhanqin; Zhang, Lin; Ma, Hongwei; Lu, Ka; Ren, Wen; Liu, Zhengya; Chang, Haitao; Bei, Weicheng; Qiu, Yinsheng; Chen, Huanchun

2011-01-01

Streptococcus suis serotype 2 is an important zoonotic pathogen that causes serious diseases such as meningitis, septicemia, endocarditis, arthritis and septic shock in pigs and humans. Little is known about the regulation of virulence gene expression in S. suis serotype 2. In this study, we cloned and deleted the entire tig gene from the chromosome of S. suis serotype 2 SC21 strain, and constructed a mutant strain (Δtig) and a complementation strain (CΔtig). The results demonstrated that the tig gene, encoding trigger factor from S. suis serotype 2 SC21, affects the stress tolerance and the expression of a few virulence genes of S. suis serotype 2. Deletion of the tig gene of S. suis serotype 2 resulted in mutant strain, ΔTig, which exhibited a significant decrease in adherence to cell line HEp-2, and lacked hemolytic activity. Tig deficiency diminishes stresses tolerance of S. suis serotype 2 such as survive thermal, oxidative and acid stresses. Quantification of expression levels of known S. suis serotype 2 SC21 virulence genes by real-time polymerase chain reaction in vitro revealed that trigger factor influences the expression of epf, cps, adh, rpob, fbps, hyl, sly, mrp and hrcA virulence-associated genes. ΔTig was shown to be attenuated in a LD50 assay and bacteriology, indicating that trigger factor plays an important part in the pathogenesis and stress tolerance of. S. suis serotype 2 infection. Mutant ΔTig was 100% defective in virulence in CD1 mice at up to 107 CFU, and provided 100% protection when challenged with 107 CFU of the SC21 strain. Copyright © 2010. Published by Elsevier India Pvt Ltd.

Insights into the role of the unusual disulfide bond in copper-zinc superoxide dismutase.

PubMed

Sea, Kevin; Sohn, Se Hui; Durazo, Armando; Sheng, Yuewei; Shaw, Bryan F; Cao, Xiaohang; Taylor, Alexander B; Whitson, Lisa J; Holloway, Stephen P; Hart, P John; Cabelli, Diane E; Gralla, Edith Butler; Valentine, Joan Selverstone

2015-01-23

The functional and structural significance of the intrasubunit disulfide bond in copper-zinc superoxide dismutase (SOD1) was studied by characterizing mutant forms of human SOD1 (hSOD) and yeast SOD1 lacking the disulfide bond. We determined x-ray crystal structures of metal-bound and metal-deficient hC57S SOD1. C57S hSOD1 isolated from yeast contained four zinc ions per protein dimer and was structurally very similar to wild type. The addition of copper to this four-zinc protein gave properly reconstituted 2Cu,2Zn C57S hSOD, and its spectroscopic properties indicated that the coordination geometry of the copper was remarkably similar to that of holo wild type hSOD1. In contrast, the addition of copper and zinc ions to apo C57S human SOD1 failed to give proper reconstitution. Using pulse radiolysis, we determined SOD activities of yeast and human SOD1s lacking disulfide bonds and found that they were enzymatically active at ∼10% of the wild type rate. These results are contrary to earlier reports that the intrasubunit disulfide bonds in SOD1 are essential for SOD activity. Kinetic studies revealed further that the yeast mutant SOD1 had less ionic attraction for superoxide, possibly explaining the lower rates. Saccharomyces cerevisiae cells lacking the sod1 gene do not grow aerobically in the absence of lysine, but expression of C57S SOD1 increased growth to 30-50% of the growth of cells expressing wild type SOD1, supporting that C57S SOD1 retained a significant amount of activity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Insights into the Role of the Unusual Disulfide Bond in Copper-Zinc Superoxide Dismutase*

PubMed Central

Sea, Kevin; Sohn, Se Hui; Durazo, Armando; Sheng, Yuewei; Shaw, Bryan F.; Cao, Xiaohang; Taylor, Alexander B.; Whitson, Lisa J.; Holloway, Stephen P.; Hart, P. John; Cabelli, Diane E.; Gralla, Edith Butler; Valentine, Joan Selverstone

2015-01-01

The functional and structural significance of the intrasubunit disulfide bond in copper-zinc superoxide dismutase (SOD1) was studied by characterizing mutant forms of human SOD1 (hSOD) and yeast SOD1 lacking the disulfide bond. We determined x-ray crystal structures of metal-bound and metal-deficient hC57S SOD1. C57S hSOD1 isolated from yeast contained four zinc ions per protein dimer and was structurally very similar to wild type. The addition of copper to this four-zinc protein gave properly reconstituted 2Cu,2Zn C57S hSOD, and its spectroscopic properties indicated that the coordination geometry of the copper was remarkably similar to that of holo wild type hSOD1. In contrast, the addition of copper and zinc ions to apo C57S human SOD1 failed to give proper reconstitution. Using pulse radiolysis, we determined SOD activities of yeast and human SOD1s lacking disulfide bonds and found that they were enzymatically active at ∼10% of the wild type rate. These results are contrary to earlier reports that the intrasubunit disulfide bonds in SOD1 are essential for SOD activity. Kinetic studies revealed further that the yeast mutant SOD1 had less ionic attraction for superoxide, possibly explaining the lower rates. Saccharomyces cerevisiae cells lacking the sod1 gene do not grow aerobically in the absence of lysine, but expression of C57S SOD1 increased growth to 30–50% of the growth of cells expressing wild type SOD1, supporting that C57S SOD1 retained a significant amount of activity. PMID:25433341

Lack of complex I activity in human cells carrying a mutation in MtDNA-encoded ND4 subunit is corrected by the Saccharomyces cerevisiae NADH-quinone oxidoreductase (NDI1) gene.

PubMed

Bai, Y; Hájek, P; Chomyn, A; Chan, E; Seo, B B; Matsuno-Yagi, A; Yagi, T; Attardi, G

2001-10-19

The gene for the single subunit, rotenone-insensitive, and flavone-sensitive internal NADH-quinone oxidoreductase of Saccharomyces cerevisiae (NDI1) can completely restore the NADH dehydrogenase activity in mutant human cells that lack the essential mitochondrial DNA (mtDNA)-encoded subunit ND4. In particular, the NDI1 gene was introduced into the nuclear genome of the human 143B.TK(-) cell line derivative C4T, which carries a homoplasmic frameshift mutation in the ND4 gene. Two transformants with a low or high level of expression of the exogenous gene were chosen for a detailed analysis. In these cells the corresponding protein is localized in mitochondria, its NADH-binding site faces the matrix compartment as in yeast mitochondria, and in perfect correlation with its abundance restores partially or fully NADH-dependent respiration that is rotenone-insensitive, flavone-sensitive, and antimycin A-sensitive. Thus the yeast enzyme has become coupled to the downstream portion of the human respiratory chain. Furthermore, the P:O ratio with malate/glutamate-dependent respiration in the transformants is approximately two-thirds of that of the wild-type 143B.TK(-) cells, as expected from the lack of proton pumping activity in the yeast enzyme. Finally, whereas the original mutant cell line C4T fails to grow in medium containing galactose instead of glucose, the high NDI1-expressing transformant has a fully restored capacity to grow in galactose medium. The present observations substantially expand the potential of the yeast NDI1 gene for the therapy of mitochondrial diseases involving complex I deficiency.

Phosphorodiamidate morpholino oligomers suppress mutant huntingtin expression and attenuate neurotoxicity

PubMed Central

Sun, Xin; Marque, Leonard O.; Cordner, Zachary; Pruitt, Jennifer L.; Bhat, Manik; Li, Pan P.; Kannan, Geetha; Ladenheim, Ellen E.; Moran, Timothy H.; Margolis, Russell L.; Rudnicki, Dobrila D.

2014-01-01

Huntington's disease (HD) is a neurodegenerative disorder caused by a CAG trinucleotide repeat expansion in the huntingtin (HTT) gene. Disease pathogenesis derives, at least in part, from the long polyglutamine tract encoded by mutant HTT. Therefore, considerable effort has been dedicated to the development of therapeutic strategies that significantly reduce the expression of the mutant HTT protein. Antisense oligonucleotides (ASOs) targeted to the CAG repeat region of HTT transcripts have been of particular interest due to their potential capacity to discriminate between normal and mutant HTT transcripts. Here, we focus on phosphorodiamidate morpholino oligomers (PMOs), ASOs that are especially stable, highly soluble and non-toxic. We designed three PMOs to selectively target expanded CAG repeat tracts (CTG22, CTG25 and CTG28), and two PMOs to selectively target sequences flanking the HTT CAG repeat (HTTex1a and HTTex1b). In HD patient–derived fibroblasts with expanded alleles containing 44, 77 or 109 CAG repeats, HTTex1a and HTTex1b were effective in suppressing the expression of mutant and non-mutant transcripts. CTGn PMOs also suppressed HTT expression, with the extent of suppression and the specificity for mutant transcripts dependent on the length of the targeted CAG repeat and on the CTG repeat length and concentration of the PMO. PMO CTG25 reduced HTT-induced cytotoxicity in vitro and suppressed mutant HTT expression in vivo in the N171-82Q transgenic mouse model. Finally, CTG28 reduced mutant HTT expression and improved the phenotype of HdhQ7/Q150 knock-in HD mice. These data demonstrate the potential of PMOs as an approach to suppressing the expression of mutant HTT. PMID:25035419

Midline signals regulate retinal neurogenesis in zebrafish.

PubMed

Masai, I; Stemple, D L; Okamoto, H; Wilson, S W

2000-08-01

In zebrafish, neuronal differentiation progresses across the retina in a pattern that is reminiscent of the neurogenic wave that sweeps across the developing eye in Drosophila. We show that expression of a zebrafish homolog of Drosophila atonal, ath5, sweeps across the eye predicting the wave of neuronal differentiation. By analyzing the regulation of ath5 expression, we have elucidated the mechanisms that regulate initiation and spread of neurogenesis in the retina. ath5 expression is lost in Nodal pathway mutant embryos lacking axial tissues that include the prechordal plate. A likely role for axial tissue is to induce optic stalk cells that subsequently regulate ath5 expression. Our results suggest that a series of inductive events, initiated from the prechordal plate and progressing from the optic stalks, regulates the spread of neuronal differentiation across the zebrafish retina.

The sigma factor SigD of Mycobacterium tuberculosis putatively enhances gene expression of the septum site determining protein under stressful environments.

PubMed

Ares, Miguel A; Rios-Sarabia, Nora; De la Cruz, Miguel A; Rivera-Gutiérrez, Sandra; García-Morales, Lázaro; León-Solís, Lizbel; Espitia, Clara; Pacheco, Sabino; Cerna-Cortés, Jorge F; Helguera-Repetto, Cecilia A; García, María Jesús; González-Y-Merchand, Jorge A

2017-07-01

This work examined the expression of the septum site determining gene (ssd) of Mycobacterium tuberculosis CDC1551 and its ∆sigD mutant under different growing conditions. The results showed an up-regulation of ssd during stationary phase and starvation conditions, but not during in vitro dormancy, suggesting a putative role for SigD in the control of ssd expression mainly under lack-of-nutrients environments. Furthermore, we elucidated a putative link between ssd expression and cell elongation of bacilli at stationary phase. In addition, a -35 sigD consensus sequence was found for the ssd promoter region, reinforcing the putative regulation of ssd by SigD, and in turn, supporting this protein role during the adaptation of M. tuberculosis to some stressful environments.

Characterization of Staphylococcus aureus mutants expressing reduced susceptibility to common house-cleaners

PubMed Central

Davis, A.O.; O’Leary, J.O.; Muthaiyan, A.; Langevin, M.J.; Delgado, A.; Abalos, A.T.; Fajardo, A.R.; Marek, J.; Wilkinson, B.J.; Gustafson, J.E.

2013-01-01

Aims To characterize mutants of Staphylococcus aureus expressing reduced susceptibility to house cleaners (HC), assess the impact of the alternative sigma factor SigB on HC susceptibility, and determine the MIC of clinical methicillin-resistant S. aureus (MRSA) to a HC. Methods and Results Susceptibility to HC, HC components, H2O2, vancomycin and oxacillin and physiological parameters were determined for HC-reduced susceptibility (HCRS) mutants, parent strain COL and COLsigB::kan. HCRS mutants selected with three HC expressed reduced susceptibility to multiple HC, HC components, H2O2 and vancomycin. Two unique HCRS mutants also lost the methicillin resistance determinant. In addition, all HCRS mutants exhibited better growth at two temperatures, and one HCRS mutant expressed reduced carotenoid production. COLsigB::kan demonstrated increased susceptibility to all HC and many HC components. sigB operon mutations were not detected in one HCRS mutant background. Of 76 clinical MRSA, 20 exhibited reduced susceptibility to a HC. Conclusions HCRS mutants demonstrate altered susceptibility to multiple antimicrobials. While sigB is required for full HC resistance, one HCRS mechanism does not involve sigB operon mutations. Clinical MRSA expressing reduced susceptibility to a common HC were detected. Significance and Impact of the Study This study suggests that HCRS mutants are not protected against, nor selected by, practical HC concentrations. PMID:15659191

Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume.

PubMed

Grassini, Daniela R; Lagendijk, Anne K; De Angelis, Jessica E; Da Silva, Jason; Jeanes, Angela; Zettler, Nicole; Bower, Neil I; Hogan, Benjamin M; Smith, Kelly A

2018-05-11

Atrial natriuretic peptide ( nppa/anf ) and brain natriuretic peptide ( nppb/bnp ) form a gene cluster with expression in the chambers of the developing heart. Despite restricted expression, a function in cardiac development has not been demonstrated by mutant analysis. This is attributed to functional redundancy however their genomic location in cis has impeded formal analysis. Using genome-editing, we generated mutants for nppa and nppb and found single mutants indistinguishable from wildtype whereas nppa / nppb double mutants display heart morphogenesis defects and pericardial oedema. Analysis of atrioventricular canal (AVC) markers show expansion of bmp4 , tbx2b, has2 and versican expression into the atrium of double mutants. This expanded expression correlates with increased extracellular matrix in the atrium. Using a biosensor for Hyaluronic acid to measure the cardiac jelly (cardiac extracellular matrix), we confirm cardiac jelly expansion in nppa / nppb double mutants. Finally, bmp4 knockdown rescues the expansion of has2 expression and cardiac jelly in double mutants. This definitively shows that nppa and nppb function redundantly during cardiac development to restrict gene expression to the AVC, preventing excessive cardiac jelly synthesis in the atrial chamber. © 2018. Published by The Company of Biologists Ltd.

The C Terminus of the Large Tegument Protein pUL36 Contains Multiple Capsid Binding Sites That Function Differently during Assembly and Cell Entry of Herpes Simplex Virus

PubMed Central

Schipke, Julia; Pohlmann, Anja; Diestel, Randi; Binz, Anne; Rudolph, Kathrin; Nagel, Claus-Henning; Bauerfeind, Rudolf

2012-01-01

The largest tegument protein of herpes simplex virus type 1 (HSV1), pUL36, is a multivalent cross-linker between the viral capsids and the tegument and associated membrane proteins during assembly that upon subsequent cell entry releases the incoming capsids from the outer tegument and viral envelope. Here we show that pUL36 was recruited to cytosolic progeny capsids that later colocalized with membrane proteins of herpes simplex virus type 1 (HSV1) and the trans-Golgi network. During cell entry, pUL36 dissociated from viral membrane proteins but remained associated with cytosolic capsids until arrival at the nucleus. HSV1 UL36 mutants lacking C-terminal portions of increasing size expressed truncated pUL36 but could not form plaques. Cytosolic capsids of mutants lacking the C-terminal 735 of the 3,164 amino acid residues accumulated in the cytosol but did not recruit pUL36 or associate with membranes. In contrast, pUL36 lacking only the 167 C-terminal residues bound to cytosolic capsids and subsequently colocalized with viral and host membrane proteins. Progeny virions fused with neighboring cells, but incoming capsids did not retain pUL36, nor could they target the nucleus or initiate HSV1 gene expression. Our data suggest that residues 2430 to 2893 of HSV1 pUL36, containing one binding site for the capsid protein pUL25, are sufficient to recruit pUL36 onto cytosolic capsids during assembly for secondary envelopment, whereas the 167 residues of the very C terminus with the second pUL25 binding site are crucial to maintain pUL36 on incoming capsids during cell entry. Capsids lacking pUL36 are targeted neither to membranes for virus assembly nor to nuclear pores for genome uncoating. PMID:22258258

Regulation of onset of female mating and sex pheromone production by juvenile hormone in Drosophila melanogaster

PubMed Central

Bilen, Julide; Atallah, Jade; Azanchi, Reza; Levine, Joel D.; Riddiford, Lynn M.

2013-01-01

Juvenile hormone (JH) coordinates timing of female reproductive maturation in most insects. In Drosophila melanogaster, JH plays roles in both mating and egg maturation. However, very little is known about the molecular pathways associated with mating. Our behavioral analysis of females genetically lacking the corpora allata, the glands that produce JH, showed that they were courted less by males and mated later than control females. Application of the JH mimic, methoprene, to the allatectomized females just after eclosion rescued both the male courtship and the mating delay. Our studies of the null mutants of the JH receptors, Methoprene tolerant (Met) and germ cell-expressed (gce), showed that lack of Met in Met27 females delayed the onset of mating, whereas lack of Gce had little effect. The Met27 females were shown to be more attractive but less behaviorally receptive to copulation attempts. The behavioral but not the attractiveness phenotype was rescued by the Met genomic transgene. Analysis of the female cuticular hydrocarbon profiles showed that corpora allata ablation caused a delay in production of the major female-specific sex pheromones (the 7,11-C27 and -C29 dienes) and a change in the cuticular hydrocarbon blend. In the Met27 null mutant, by 48 h, the major C27 diene was greatly increased relative to wild type. In contrast, the gce2.5k null mutant females were courted similarly to control females despite changes in certain cuticular hydrocarbons. Our findings indicate that JH acts primarily via Met to modulate the timing of onset of female sex pheromone production and mating. PMID:24145432

Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

PubMed Central

Kim, Seong K.; Kim, Seongman; Dai, Gan; Zhang, Yunfei; Ahn, Byung C.; O'Callaghan, Dennis J.

2012-01-01

The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1,487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% of control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. PMID:21794889

Elongation factor Tu resistant to kirromycin in an Esherichia coli mutant altered in both tuf genes

PubMed Central

Fischer, Eckhard; Wolf, Heinz; Hantke, Klaus; Parmeggiani, Andrea

1977-01-01

A mutant of Escherichia coli is described that displays kirromycin resistance in a cell-free system by virtue of an altered elongation factor Tu (EF-Tu). In poly(U)-directed poly(Phe) synthesis the kirromycin resistance of the crystallized enzyme ranged between a factor of 80 and 700, depending on temperature. Similarly, kirromycin-induced EF-Tu GTPase activity uncoupled from ribosomes and aminoacyl-tRNA required correspondingly higher concentrations of the antibiotic. Resistance of EF-Tu to kirromycin is a consequence of a modified enzyme structure as indicated by its altered fingerprint pattern. P1 transduction experiments showed that the kirromycin-resistant EF-Tu is coded by an altered tufB gene (tufB1). The known existence of two genes coding for EF-Tu would interfere with the recognition of a mutant altered in only one of those genes, if the mutation were recessive. Because kirromycin blocks EF-Tu release from the ribosome, kirromycin sensitivity is dominant, as shown by the failure of a mixed EF-Tu population to express resistance in vitro. Therefore, phenotypic expression of kirromycin resistance in vivo appears to be only possible if the EF-Tu mutant lacks an active tufA gene, a property likely to be inherited from the parental D22 strain. The observations that introduction of a tufA+ region makes the resistant strain sensitive to the antibiotic and that transduction of tufB1 into a recipient other than E. coli D22 yields kirromycin-sensitive progeny support these conclusions. Images PMID:337296

Fast revascularization of the injured area is essential to support zebrafish heart regeneration

PubMed Central

Marín-Juez, Rubén; Marass, Michele; Gauvrit, Sebastien; Rossi, Andrea; Lai, Shih-Lei; Materna, Stefan C.; Black, Brian L.; Stainier, Didier Y. R.

2016-01-01

Zebrafish have a remarkable capacity to regenerate their heart. Efficient replenishment of lost tissues requires the activation of different cell types including the epicardium and endocardium. A complex set of processes is subsequently needed to support cardiomyocyte repopulation. Previous studies have identified important determinants of heart regeneration; however, to date, how revascularization of the damaged area happens remains unknown. Here, we show that angiogenic sprouting into the injured area starts as early as 15 h after injury. To analyze the role of vegfaa in heart regeneration, we used vegfaa mutants rescued to adulthood by vegfaa mRNA injections at the one-cell stage. Surprisingly, vegfaa mutants develop coronaries and revascularize after injury. As a possible explanation for these observations, we find that vegfaa mutant hearts up-regulate the expression of potentially compensating genes. Therefore, to overcome the lack of a revascularization phenotype in vegfaa mutants, we generated fish expressing inducible dominant negative Vegfaa. These fish displayed minimal revascularization of the damaged area. In the absence of fast angiogenic revascularization, cardiomyocyte proliferation did not occur, and the heart failed to regenerate, retaining a fibrotic scar. Hence, our data show that a fast endothelial invasion allows efficient revascularization of the injured area, which is necessary to support replenishment of new tissue and achieve efficient heart regeneration. These findings revisit the model where neovascularization is considered to happen concomitant with the formation of new muscle. Our work also paves the way for future studies designed to understand the molecular mechanisms that regulate fast revascularization. PMID:27647901

Rubisco activase is required for optimal photosynthesis in the green alga Chlamydomonas reinhardtii in a low-CO(2) atmosphere.

PubMed

Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V

2003-12-01

This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.

Progressive quality control of secretory proteins in the early secretory compartment by ERp44

PubMed Central

Sannino, Sara; Anelli, Tiziana; Cortini, Margherita; Masui, Shoji; Degano, Massimo; Fagioli, Claudio; Inaba, Kenji; Sitia, Roberto

2014-01-01

ERp44 is a pH-regulated chaperone of the secretory pathway. In the acidic milieu of the Golgi, its C-terminal tail changes conformation, simultaneously exposing the substrate-binding site for cargo capture and the RDEL motif for ER retrieval via interactions with cognate receptors. Protonation of cysteine 29 in the active site allows tail movements in vitro and in vivo. Here we show that also conserved histidines in the C-terminal tail regulate ERp44 in vivo. Mutants lacking these histidines are hyperactive in retaining substrates. Surprisingly, they are also O-glycosylated and partially secreted. Co-expression of client proteins prevents secretion of the histidine mutants, forcing tail opening and RDEL accessibility. Client-induced RDEL exposure allows retrieval of proteins from distinct stations along the secretory pathway, as indicated by the changes in O-glycosylation patterns upon over-expression of different partners. The ensuing gradients may help optimising folding and assembly of different cargoes. Endogenous ERp44 is O-glycosylated and secreted by human primary endometrial cells, suggesting possible pathophysiological roles of these processes. PMID:25097228

Cytosolic localization of acetohydroxyacid synthase Ilv2 and its impact on diacetyl formation during beer fermentation.

PubMed

Dasari, Suvarna; Kölling, Ralf

2011-02-01

Diacetyl (2,3-butanedione) imparts an unpleasant "butterscotch-like" flavor to alcoholic beverages such as beer, and therefore its concentration needs to be reduced below the sensory threshold before packaging. We examined the mechanisms that lead to highly elevated diacetyl formation in petite mutants of Saccharomyces cerevisiae during beer fermentations. We present evidence that elevated diacetyl formation is tightly connected to the mitochondrial import of acetohydroxyacid synthase (Ilv2), the key enzyme in the production of diacetyl. Our data suggest that accumulation of the matrix-targeted Ilv2 preprotein in the cytosol is responsible for the observed high diacetyl levels. We could show that the Ilv2 preprotein accumulates in the cytosol of petite yeasts. Furthermore, expression of an Ilv2 variant that lacks the N-terminal mitochondrial targeting sequence and thus cannot be imported into mitochondria led to highly elevated diacetyl levels comparable to a petite strain. We further show that expression of a mutant allele of the γ-subunit of the F(1)-ATPase (ATP3-5) could be an attractive way to reduce diacetyl formation by petite strains.

Glutamate Receptors within the Mesolimbic Dopamine System Mediate Alcohol Relapse Behavior.

PubMed

Eisenhardt, Manuela; Leixner, Sarah; Luján, Rafael; Spanagel, Rainer; Bilbao, Ainhoa

2015-11-25

Glutamatergic input within the mesolimbic dopamine (DA) pathway plays a critical role in the development of addictive behavior. Although this is well established for some drugs of abuse, it is not known whether glutamate receptors within the mesolimbic system are involved in mediating the addictive properties of chronic alcohol use. Here we evaluated the contribution of mesolimbic NMDARs and AMPARs in mediating alcohol-seeking responses induced by environmental stimuli and relapse behavior using four inducible mutant mouse lines lacking the glutamate receptor genes Grin1 or Gria1 in either DA transporter (DAT) or D1R-expressing neurons. We first demonstrate the lack of GluN1 or GluA1 in either DAT- or D1R-expressing neurons in our mutant mouse lines by colocalization studies. We then show that GluN1 and GluA1 receptor subunits within these neuronal subpopulations mediate the alcohol deprivation effect, while having no impact on context- plus cue-induced reinstatement of alcohol-seeking behavior. We further validated these results pharmacologically by demonstrating similar reductions in the alcohol deprivation effect after infusion of the NMDAR antagonist memantine into the nucleus accumbens and ventral tegmental area of control mice, and a rescue of the mutant phenotype via pharmacological potentiation of AMPAR activity using aniracetam. In conclusion, dopamine neurons as well as D1R-expressing medium spiny neurons and their glutamatergic inputs via NMDARs and AMPARs act in concert to influence relapse responses. These results provide a neuroanatomical and molecular substrate for relapse behavior and emphasize the importance of glutamatergic drugs in modulating relapse behavior. Here we provide genetic and pharmacological evidence that glutamate receptors within the mesolimbic dopamine system play an essential role in alcohol relapse. Using various inducible and site-specific transgenic mouse models and pharmacological validation experiments, we show that critical subunits of NMDARs and AMPARs expressed either in dopamine neurons or in dopamine receptor D1-containing neurons play an important role in the alcohol deprivation effect (the increase in alcohol intake after a period of abstinence) while having no impact on context- plus cue-induced reinstatement of alcohol-seeking responses. Medications targeting glutamatergic neurotransmission by selective inactivation of these glutamate receptors might have therapeutic efficacy. Copyright © 2015 the authors 0270-6474/15/3515523-16$15.00/0.

Inhibition of hydrogen uptake in Escherichia coli by expressing the hydrogenase from the cyanobacterium Synechocystis sp. PCC 6803

PubMed Central

Maeda, Toshinari; Vardar, Gönül; Self, William T; Wood, Thomas K

2007-01-01

Background Molecular hydrogen is an environmentally-clean fuel and the reversible (bi-directional) hydrogenase of the cyanobacterium Synechocystis sp. PCC 6803 as well as the native Escherichia coli hydrogenase 3 hold great promise for hydrogen generation. These enzymes perform the simple reaction 2H+ + 2e- ↔ H2 (g). Results Hydrogen yields were enhanced up to 41-fold by cloning the bidirectional hydrogenase (encoded by hoxEFUYH) from the cyanobacterium into E. coli. Using an optimized medium, E. coli cells expressing hoxEFUYH also produced twice as much hydrogen as the well-studied Enterobacter aerogenes HU-101, and hydrogen gas bubbles are clearly visible from the cultures. Overexpression of HoxU alone (small diaphorase subunit) accounts for 43% of the additional hydrogen produced by HoxEFUYH. In addition, hydrogen production in E. coli mutants with defects in the native formate hydrogenlyase system show that the cyanobacterial hydrogenase depends on both the native E. coli hydrogenase 3 as well as on its maturation proteins. Hydrogen absorption by cells expressing hoxEFUYH was up to 10 times lower than cells which lack the cloned cyanobacterial hydrogenase; hence, the enhanced hydrogen production in the presence of hoxEFUYH is due to inhibition of hydrogen uptake activity in E. coli. Hydrogen uptake by cells expressing hoxEFUYH was suppressed in three wild-type strains and in two hycE mutants but not in a double mutant defective in hydrogenase 1 and hydrogenase 2; hence, the active cyanobacterial locus suppresses hydrogen uptake by hydrogenase 1 and hydrogenase 2 but not by hydrogenase 3. Differential gene expression indicated that overexpression of HoxEFUYH does not alter expression of the native E. coli hydrogenase system; instead, biofilm-related genes are differentially regulated by expression of the cyanobacterial enzymes which resulted in 2-fold elevated biofilm formation. This appears to be the first enhanced hydrogen production by cloning a cyanobacterial enzyme into a heterologous host. Conclusion Enhanced hydrogen production in E. coli cells expressing the cyanobacterial HoxEFUYH is by inhibiting hydrogen uptake of both hydrogenase 1 and hydrogenase 2. PMID:17521447

ACA12 is a deregulated isoform of plasma membrane Ca²⁺-ATPase of Arabidopsis thaliana.

PubMed

Limonta, Margherita; Romanowsky, Shawn; Olivari, Claudio; Bonza, Maria Cristina; Luoni, Laura; Rosenberg, Alexa; Harper, Jeffrey F; De Michelis, Maria Ida

2014-03-01

Plant auto-inhibited Ca²⁺-ATPases (ACA) are crucial in defining the shape of calcium transients and therefore in eliciting plant responses to various stimuli. Arabidopsis thaliana genome encodes ten ACA isoforms that can be divided into four clusters based on gene structure and sequence homology. While isoforms from clusters 1, 2 and 4 have been characterized, virtually nothing is known about members of cluster 3 (ACA12 and ACA13). Here we show that a GFP-tagged ACA12 localizes at the plasma membrane and that expression of ACA12 rescues the phenotype of partial male sterility of a null mutant of the plasma membrane isoform ACA9, thus providing genetic evidence that ACA12 is a functional plasma membrane-resident Ca²⁺-ATPase. By ACA12 expression in yeast and purification by CaM-affinity chromatography, we show that, unlike other ACAs, the activity of ACA12 is not stimulated by CaM. Moreover, full length ACA12 is able to rescue a yeast mutant deficient in calcium pumps. Analysis of single point ACA12 mutants suggests that ACA12 loss of auto-inhibition can be ascribed to the lack of two acidic residues--highly conserved in other ACA isoforms--localized at the cytoplasmic edge of the second and third transmembrane segments. Together, these results support a model in which the calcium pump activity of ACA12 is primarily regulated by increasing or decreasing mRNA expression and/or protein translation and degradation.

A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

PubMed

Dhanasekar, P; Reddy, K S

2015-02-01

Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

Engineering Sialic Acid Synthesis Ability in Insect Cells.

PubMed

Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J

2015-01-01

Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

PubMed

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

Secreted aspartic proteases are not required for invasion of reconstituted human epithelia by Candida albicans.

PubMed

Lermann, Ulrich; Morschhäuser, Joachim

2008-11-01

A well-known virulence attribute of the human-pathogenic yeast Candida albicans is the secretion of aspartic proteases (Saps), which may contribute to colonization and infection of different host niches by degrading tissue barriers, destroying host defence molecules, or digesting proteins for nutrient supply. The role of individual Sap isoenzymes, which are encoded by a large gene family, for the pathogenicity of C. albicans has been investigated by assessing the virulence of mutants lacking specific SAP genes and by studying the expression pattern of the SAP genes in various models of superficial and systemic infections. We used a recombination-based genetic reporter system to detect the induction of the SAP1-SAP6 genes during infection of reconstituted human vaginal epithelium. Only SAP5, but none of the other tested SAP genes, was detectably activated in this in vitro infection model. To directly address the importance of the SAP1-SAP6 genes for invasion of reconstituted human epithelia (RHE), we constructed a set of mutants of the wild-type C. albicans model strain SC5314 in which either single or multiple SAP genes were specifically deleted. Even mutants lacking all of the SAP1-SAP3 or the SAP4-SAP6 genes displayed the same capacity to invade and damage both oral and vaginal RHE as their wild-type parental strain, in contrast to a nonfilamentous efg1Delta mutant that was avirulent under these conditions. We therefore conclude from these results that the secreted aspartic proteases Sap1p-Sap6p are not required for invasion of RHE by C. albicans.

RAF inhibitor resistance is mediated by dimerization of aberrantly spliced BRAF(V600E).

PubMed

Poulikakos, Poulikos I; Persaud, Yogindra; Janakiraman, Manickam; Kong, Xiangju; Ng, Charles; Moriceau, Gatien; Shi, Hubing; Atefi, Mohammad; Titz, Bjoern; Gabay, May Tal; Salton, Maayan; Dahlman, Kimberly B; Tadi, Madhavi; Wargo, Jennifer A; Flaherty, Keith T; Kelley, Mark C; Misteli, Tom; Chapman, Paul B; Sosman, Jeffrey A; Graeber, Thomas G; Ribas, Antoni; Lo, Roger S; Rosen, Neal; Solit, David B

2011-11-23

Activated RAS promotes dimerization of members of the RAF kinase family. ATP-competitive RAF inhibitors activate ERK signalling by transactivating RAF dimers. In melanomas with mutant BRAF(V600E), levels of RAS activation are low and these drugs bind to BRAF(V600E) monomers and inhibit their activity. This tumour-specific inhibition of ERK signalling results in a broad therapeutic index and RAF inhibitors have remarkable clinical activity in patients with melanomas that harbour mutant BRAF(V600E). However, resistance invariably develops. Here, we identify a new resistance mechanism. We find that a subset of cells resistant to vemurafenib (PLX4032, RG7204) express a 61-kDa variant form of BRAF(V600E), p61BRAF(V600E), which lacks exons 4-8, a region that encompasses the RAS-binding domain. p61BRAF(V600E) shows enhanced dimerization in cells with low levels of RAS activation, as compared to full-length BRAF(V600E). In cells in which p61BRAF(V600E) is expressed endogenously or ectopically, ERK signalling is resistant to the RAF inhibitor. Moreover, a mutation that abolishes the dimerization of p61BRAF(V600E) restores its sensitivity to vemurafenib. Finally, we identified BRAF(V600E) splicing variants lacking the RAS-binding domain in the tumours of six of nineteen patients with acquired resistance to vemurafenib. These data support the model that inhibition of ERK signalling by RAF inhibitors is dependent on levels of RAS-GTP too low to support RAF dimerization and identify a novel mechanism of acquired resistance in patients: expression of splicing isoforms of BRAF(V600E) that dimerize in a RAS-independent manner.

RAF inhibitor resistance is mediated by dimerization of aberrantly spliced BRAF(V600E)

PubMed Central

Poulikakos, Poulikos I.; Persaud, Yogindra; Janakiraman, Manickam; Kong, Xiangju; Ng, Charles; Moriceau, Gatien; Shi, Hubing; Atefi, Mohammad; Titz, Bjoern; Gabay, May Tal; Salton, Maayan; Dahlman, Kimberly B.; Tadi, Madhavi; Wargo, Jennifer A.; Flaherty, Keith T.; Kelley, Mark C.; Misteli, Tom; Chapman, Paul B.; Sosman, Jeffrey A.; Graeber, Thomas G.; Ribas, Antoni; Lo, Roger S.; Rosen, Neal; Solit, David B.

2011-01-01

Summary Activated RAS promotes dimerization of members of the RAF kinase family1-3. ATP-competitive RAF inhibitors activate ERK signaling4-7 by transactivating RAF dimers4. In melanomas with mutant BRAF(V600E), levels of RAS activation are low and these drugs bind to BRAF(V600E) monomers and inhibit their activity. This tumor-specific inhibition of ERK signaling results in a broad therapeutic index and RAF inhibitors have remarkable clinical activity in patients with melanomas that harbor mutant BRAF(V600E)8. However, resistance invariably develops. Here, we identify a novel resistance mechanism. We find that a subset of cells resistant to vemurafenib (PLX4032, RG7204) express a 61kd variant form of BRAF(V600E) that lacks exons 4-8, a region that encompasses the RAS-binding domain. p61BRAF(V600E) exhibits enhanced dimerization in cells with low levels of RAS activation, as compared to full length BRAF(V600E). In cells in which p61BRAF(V600E) is expressed endogenously or ectopically, ERK signaling is resistant to the RAF inhibitor. Moreover, a mutation that abolishes the dimerization of p61BRAF(V600E) restores its sensitivity to vemurafenib. Finally, we identified BRAF(V600E) splicing variants lacking the RAS-binding domain in the tumors of six of 19 patients with acquired resistance to vemurafenib. These data support the model that inhibition of ERK signaling by RAF inhibitors is dependent on levels of RAS-GTP too low to support RAF dimerization and identify a novel mechanism of acquired resistance in patients: expression of splicing isoforms of BRAF(V600E) that dimerize in a RAS-independent manner. PMID:22113612

Trehalose synthesis in Aspergillus niger: characterization of six homologous genes, all with conserved orthologs in related species

PubMed Central

2014-01-01

Background The disaccharide trehalose is a major component of fungal spores and is released upon germination. Moreover, the sugar is well known for is protective functions, e.g. against thermal stress and dehydration. The properties and synthesis of trehalose have been well investigated in the bakers’ yeast Saccharomyces cerevisiae. In filamentous fungi, such knowledge is limited, although several gene products have been identified. Results Using Aspergillus niger as a model fungus, the aim of this study was to provide an overview of all genes involved in trehalose synthesis. This fungus has three potential trehalose-6-phosphate synthase encoding genes, tpsA-C, and three putative trehalose phosphate phosphatase encoding genes, tppA-C, of which two have not previously been identified. Expression of all six genes was confirmed using real-time PCR, and conserved orthologs could be identified in related Aspergilli. Using a two-hybrid approach, there is a strong indication that four of the proteins physically interact, as has previously been shown in S. cerevisiae. When creating null mutants of all the six genes, three of them, ΔtpsA, ΔtppA and ΔtppB, had lower internal trehalose contents. The only mutant with a pronounced morphological difference was ΔtppA, in which sporulation was severely reduced with abnormal conidiophores. This was also the only mutant with accumulated levels of trehalose-6-phosphate, indicating that the encoded protein is the main phosphatase under normal conditions. Besides ΔtppA, the most studied deletion mutant in this work was ΔtppB. This gene encodes a protein conserved in filamentous Ascomycota. The ΔtppB mutant displayed a low, but not depleted, internal trehalose content, and conidia were more susceptible to thermal stress. Conclusion A. niger contains at least 6 genes putatively involved in trehalose synthesis. Gene expressions related to germination have been quantified and deletion mutants characterized: Mutants lacking tpsA, tppA or tppB have reduced internal trehalose contents. Furthermore, tppA, under normal conditions, encodes the functional trehalose-6-phosphate-phosphatase. PMID:24725382

Isolation and characterization of an Escherichia coli mutant lacking cytochrome d terminal oxidase.

PubMed Central

Green, G N; Gennis, R B

1983-01-01

A screening procedure was devised which permitted the isolation of a cytochrome d-deficient mutant by its failure to oxidize the artificial electron donor N,N,N',N'-tetramethyl-p-phenylenediamine. Cytochrome a1 and probably cytochrome b558 were also missing in the mutant. Growth and oxygen uptake rates were similar for both parent and mutant strains. However, the strain lacking cytochrome d had an increased sensitivity to cyanide, indicating that cytochrome d confers some resistance to this respiratory inhibitor. The gene responsible for these phenotypes has been named cyd and maps between tolA and sucB. PMID:6304009

Mutant E. coli strain with increased succinic acid production

DOEpatents

Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

1998-01-01

A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which as been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

Mutant E. coli strain with increased succinic acid production

DOEpatents

Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

2001-09-25

A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which has been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

Mutant E. coli strain with increased succinic acid production

DOEpatents

Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

2002-01-01

A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which has been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

Absence of Nrf2 or Its Selective Overexpression in Neurons and Muscle Does Not Affect Survival in ALS-Linked Mutant hSOD1 Mouse Models

PubMed Central

Vargas, Marcelo R.; Burton, Neal C.; Gan, Li; Johnson, Delinda A.; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A.

2013-01-01

The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS. PMID:23418589

Lack of Cdkl5 Disrupts the Organization of Excitatory and Inhibitory Synapses and Parvalbumin Interneurons in the Primary Visual Cortex.

PubMed

Pizzo, Riccardo; Gurgone, Antonia; Castroflorio, Enrico; Amendola, Elena; Gross, Cornelius; Sassoè-Pognetto, Marco; Giustetto, Maurizio

2016-01-01

Cyclin-dependent kinase-like 5 (CDKL5) mutations are found in severe neurodevelopmental disorders, including the Hanefeld variant of Rett syndrome (RTT; CDKL5 disorder). CDKL5 loss-of-function murine models recapitulate pathological signs of the human disease, such as visual attention deficits and reduced visual acuity. Here we investigated the cellular and synaptic substrates of visual defects by studying the organization of the primary visual cortex (V1) of Cdkl5 -/y mice. We found a severe reduction of c-Fos expression in V1 of Cdkl5 -/y mutants, suggesting circuit hypoactivity. Glutamatergic presynaptic structures were increased, but postsynaptic PSD-95 and Homer were significantly downregulated in CDKL5 mutants. Interneurons expressing parvalbumin, but not other types of interneuron, had a higher density in mutant V1, and were hyperconnected with pyramidal neurons. Finally, the developmental trajectory of pavalbumin-containing cells was also affected in Cdkl5 -/y mice, as revealed by fainter appearance perineuronal nets at the closure of the critical period (CP). The present data reveal an overall disruption of V1 cellular and synaptic organization that may cause a shift in the excitation/inhibition balance likely to underlie the visual deficits characteristic of CDKL5 disorder. Moreover, ablation of CDKL5 is likely to tamper with the mechanisms underlying experience-dependent refinement of cortical circuits during the CP of development.

Absence of Nrf2 or its selective overexpression in neurons and muscle does not affect survival in ALS-linked mutant hSOD1 mouse models.

PubMed

Vargas, Marcelo R; Burton, Neal C; Kutzke, Jennifer; Gan, Li; Johnson, Delinda A; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A

2013-01-01

The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1(G93A) mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asai, Hirohide; Hirano, Makito; Kiriyama, Takao

Intranuclear events due to mutations in the Parkin gene remain elusive in autosomal recessive juvenile parkinsonism (ARJP). We identified a mutant PARKIN protein in fibroblast cultures from a pair of siblings with ARJP who were homozygous for the exon 4-deleted Parkin gene. Disease was mild in one patient and debilitating in the other. The detected mutant, encoded by a transcript lacking exon 3 as well as exon 4, is an in-frame deletion that removes 121 aa, resulting in a 344-aa protein (PaDel3,4). Cell culture and transfection studies revealed negative correlations between expression levels of PaDel3,4 and those of cell cyclemore » proteins, including cyclin E, CDK2, ppRb, and E2F-1, and demonstrated that GFP-PaDel3,4 entered nucleus and ubiquitinated cyclin E as a part of SCF{sup hSel-10} ligase complex in the patient cells. In addition, nuclear localization signal-tagged PaDel3,4 expressed in the transfected patient cells most effectively ubiquitinated cyclin E and reduced DNA damage, protecting cells from oxidative stress. Antisense-oligonucleotide treatment promoted skipping of exon 3 and thus generated PaDel3,4, increasing cell survival. Collectively, we propose that naturally- and experimentally-induced exon skipping at least partly restores the mutant Parkin gene deficit, providing a molecular basis for the development of therapeutic exon skipping.« less

Light Regulation of Swarming Motility in Pseudomonas syringae Integrates Signaling Pathways Mediated by a Bacteriophytochrome and a LOV Protein

PubMed Central

Wu, Liang; McGrane, Regina S.; Beattie, Gwyn A.

2013-01-01

ABSTRACT The biological and regulatory roles of photosensory proteins are poorly understood for nonphotosynthetic bacteria. The foliar bacterial pathogen Pseudomonas syringae has three photosensory protein-encoding genes that are predicted to encode the blue-light-sensing LOV (light, oxygen, or voltage) histidine kinase (LOV-HK) and two red/far-red-light-sensing bacteriophytochromes, BphP1 and BphP2. We provide evidence that LOV-HK and BphP1 form an integrated network that regulates swarming motility in response to multiple light wavelengths. The swarming motility of P. syringae B728a deletion mutants indicated that LOV-HK positively regulates swarming motility in response to blue light and BphP1 negatively regulates swarming motility in response to red and far-red light. BphP2 does not detectably regulate swarming motility. The histidine kinase activity of each LOV-HK and BphP1 is required for this regulation based on the loss of complementation upon mutation of residues key to their kinase activity. Surprisingly, mutants lacking both lov and bphP1 were similar in motility to a bphP1 single mutant in blue light, indicating that the loss of bphP1 is epistatic to the loss of lov and also that BphP1 unexpectedly responds to blue light. Moreover, whereas expression of bphP1 did not alter motility under blue light in a bphP1 mutant, it reduced motility in a mutant lacking lov and bphP1, demonstrating that LOV-HK positively regulates motility by suppressing negative regulation by BphP1. These results are the first to show cross talk between the LOV protein and phytochrome signaling pathways in bacteria, and the similarity of this regulatory network to that of photoreceptors in plants suggests a possible common ancestry. PMID:23760465

RipA, a Cytoplasmic Membrane Protein Conserved among Francisella Species, Is Required for Intracellular Survival▿

PubMed Central

Fuller, James R.; Craven, Robin R.; Hall, Joshua D.; Kijek, Todd M.; Taft-Benz, Sharon; Kawula, Thomas H.

2008-01-01

Francisella tularensis is a highly virulent bacterial pathogen that invades and replicates within numerous host cell types, including macrophages and epithelial cells. In an effort to better understand this process, we screened a transposon insertion library of the F. tularensis live vaccine strain (LVS) for mutant strains that invaded but failed to replicate within alveolar epithelial cell lines. One such strain isolated from this screen contained an insertion in the gene FTL_1914, which is conserved among all sequenced Francisella species yet lacks significant homology to any gene with known function. A deletion strain lacking FTL_1914 was constructed. This strain did not replicate in either epithelial or macrophage-like cells, and intracellular replication was restored by the wild-type allele in trans. Based on the deletion mutant phenotype, FTL_1914 was termed ripA (required for intracellular proliferation, factor A). Following uptake by J774.A1 cells, F. tularensis LVS ΔripA colocalized with LAMP-1 then escaped the phagosome at the same rate and frequency as wild-type LVS-infected cells. Electron micrographs of the F. tularensis LVS ΔripA mutant demonstrated the reentry of the mutant bacteria into double membrane vacuoles characteristic of autophagosomes in a process that was not dependent on replication. The F. tularensis LVS ΔripA mutant was significantly impaired in its ability to persist in the lung and in its capacity to disseminate and colonize the liver and spleen in a mouse model of pulmonary tularemia. The RipA protein was expressed during growth in laboratory media and localized to the cytoplasmic membrane. Thus, RipA is a cytoplasmic membrane protein conserved among Francisella species that is required for intracellular replication within the host cell cytoplasm as well as disease progression, dissemination, and virulence. PMID:18765722

Succinoglycan Is Required for Initiation and Elongation of Infection Threads during Nodulation of Alfalfa by Rhizobium meliloti

PubMed Central

Cheng, Hai-Ping; Walker, Graham C.

1998-01-01

Rhizobium meliloti Rm1021 must be able to synthesize succinoglycan in order to invade successfully the nodules which it elicits on alfalfa and to establish an effective nitrogen-fixing symbiosis. Using R. meliloti cells that express green fluorescent protein (GFP), we have examined the nature of the symbiotic deficiency of exo mutants that are defective or altered in succinoglycan production. Our observations indicate that an exoY mutant, which does not produce succinoglycan, is symbiotically defective because it cannot initiate the formation of infection threads. An exoZ mutant, which produces succinoglycan without the acetyl modification, forms nitrogen-fixing nodules on plants, but it exhibits a reduced efficiency in the initiation and elongation of infection threads. An exoH mutant, which produces symbiotically nonfunctional high-molecular-weight succinoglycan that lacks the succinyl modification, cannot form extended infection threads. Infection threads initiate at a reduced rate and then abort before they reach the base of the root hairs. Overproduction of succinoglycan by the exoS96::Tn5 mutant does not reduce the efficiency of infection thread initiation and elongation, but it does significantly reduce the ability of this mutant to colonize the curled root hairs, which is the first step of the invasion process. The exoR95::Tn5 mutant, which overproduces succinoglycan to an even greater extent than the exoS96::Tn5 mutant, has completely lost its ability to colonize the curled root hairs. These new observations lead us to propose that succinoglycan is required for both the initiation and elongation of infection threads during nodule invasion and that excess production of succinoglycan interferes with the ability of the rhizobia to colonize curled root hairs. PMID:9748453

Differential Activation of Cellular DNA Damage Responses by Replication-Defective and Replication-Competent Adenovirus Mutants

PubMed Central

Prakash, Anand; Jayaram, Sumithra

2012-01-01

Adenovirus (Ad) mutants that lack early region 4 (E4) activate the phosphorylation of cellular DNA damage response proteins. In wild-type Ad type 5 (Ad5) infections, E1b and E4 proteins target the cellular DNA repair protein Mre11 for redistribution and degradation, thereby interfering with its ability to activate phosphorylation cascades important during DNA repair. The characteristics of Ad infection that activate cellular DNA repair processes are not yet well understood. We investigated the activation of DNA damage responses by a replication-defective Ad vector (AdRSVβgal) that lacks E1 and fails to produce the immediate-early E1a protein. E1a is important for activating early gene expression from the other viral early transcription units, including E4. AdRSVβgal can deliver its genome to the cell, but it is subsequently deficient for viral early gene expression and DNA replication. We studied the ability of AdRSVβgal-infected cells to induce cellular DNA damage responses. AdRSVβgal infection does activate formation of foci containing the Mdc1 protein. However, AdRSVβgal fails to activate phosphorylation of the damage response proteins Nbs1 and Chk1. We found that viral DNA replication is important for Nbs1 phosphorylation, suggesting that this step in the viral life cycle may provide an important trigger for activating at least some DNA repair proteins. PMID:23015708

Epidermal hyperproliferation in mice lacking fatty acid transport protein 4 (FATP4) involves ectopic EGF receptor and STAT3 signaling

PubMed Central

Lin, Meei-Hua; Chang, Kuo-Wei; Lin, Shu-Chun; Miner, Jeffrey H.

2010-01-01

Fatty acid transport protein (FATP) 4 is one of a family of six FATPs that facilitate long- and very long-chain fatty acid uptake. Mice lacking FATP4 are born with tight, thick skin and a defective epidermal barrier; they die neonatally due to dehydration and restricted movements. Both the skin phenotype and the lethality are rescued by transgene-driven expression of FATP4 solely in suprabasal keratinocytes. Here we show that Fatp4 mutants exhibit epidermal hyperplasia resulting from an increased number of proliferating suprabasal cells. In addition, barrier formation initiates precociously but never progresses to completion. To investigate possible mechanisms whereby Fatp4 influences skin development, we identified misregulated genes in Fatp4 mutants. Remarkably, three members of the epidermal growth factor (EGF) family (Ereg, Areg, and Epgn) showed increased expression that was associated with elevated epidermal activation of the EGF receptor (EGFR) and STAT3, a downstream effector of EGFR signaling. Both Tyrphostin AG1478, an EGFR tyrosine kinase inhibitor, and curcumin, an inhibitor of both STAT3 and EGFR, attenuated STAT3 activation/nuclear translocation, reduced skin thickening, and partially suppressed the barrier abnormalities. These data identify FATP4 activity as negatively influencing EGFR activation and the resulting STAT3 signaling during normal skin development. These findings have important implications for understanding the pathogenesis of ichthyosis prematurity syndrome, a disease recently shown to be caused by FATP4 mutations. PMID:20513444

Genetic separation of phototropism from blue light inhibition of hypocotyl elongation on Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liscum, E.; Young, J.C.; Hangarter, R.P.

1991-05-01

Phototropism and inhibition of stem elongation occur in response to blue light-induced inhibition of cell elongation. However, phototropism is a low fluence response and inhibition of hypocotyl elongation is a high irradiance response. The authors have isolated several mutant lines of Arabidopsis which lack blue light-induced inhibition of hypocotyl elongation but retain normal phototropic functions. In addition, a mutant line which completely lacks the phototropic response retains normal blue light-induced inhibition of hypocotyl elongation. F1 progeny of crosses between these two mutant classes exhibited wild-type phototropism and inhibition of hypocotyl elongation in response to blue light stimuli. In the F2more » generation, one in sixteen seedlings were double mutants lacking both phototropism and blue light-induced hypocotyl growth inhibition. These studies conclusively show that blue light-induced phototropism and hypocotyl growth inhibition function through genetically distinct signal transduction or response systems.« less

Maize ROP2 GTPase provides a competitive advantage to the male gametophyte.

PubMed

Arthur, K M; Vejlupkova, Z; Meeley, R B; Fowler, J E

2003-12-01

Rop GTPases have been implicated in the regulation of plant signal transduction and cell morphogenesis. To explore ROP2 function in maize, we isolated five Mutator transposon insertions (rop2::Mu alleles). Transmission frequency through the male gametophyte, but not the female, was lower than expected in three of the rop2::Mu mutants. These three alleles formed an allelic series on the basis of the relative transmission rate of each when crossed as trans-heterozygotes. A dramatic reduction in the level of ROP2-mRNA in pollen was associated with the three alleles causing a transmission defect, whereas a rop2::Mu allele that did not result in a defect had wild-type transcript levels, thus confirming that mutation of rop2 causes the mutant phenotype. These data strongly support a role for rop2 in male gametophyte function, perhaps surprisingly, given the expression in pollen of the nearly identical duplicate gene rop9. However, the transmission defect was apparent only when a rop2::Mu heterozygote was used as the pollen donor or when a mixture of wild-type and homozygous mutant pollen was used. Thus, mutant pollen is at a competitive disadvantage compared to wild-type pollen, although mutant pollen grains lacked an obvious cellular defect. Our data demonstrate the importance in vivo of a specific Rop, rop2, in the male gametophyte.

Circadian Stress Regimes Affect the Circadian Clock and Cause Jasmonic Acid-Dependent Cell Death in Cytokinin-Deficient Arabidopsis Plants.

PubMed

Nitschke, Silvia; Cortleven, Anne; Iven, Tim; Feussner, Ivo; Havaux, Michel; Riefler, Michael; Schmülling, Thomas

2016-07-01

The circadian clock helps plants measure daylength and adapt to changes in the day-night rhythm. We found that changes in the light-dark regime triggered stress responses, eventually leading to cell death, in leaves of Arabidopsis thaliana plants with reduced cytokinin levels or defective cytokinin signaling. Prolonged light treatment followed by a dark period induced stress and cell death marker genes while reducing photosynthetic efficiency. This response, called circadian stress, is also characterized by altered expression of clock and clock output genes. In particular, this treatment strongly reduced the expression of CIRCADIAN CLOCK ASSOCIATED1 (CCA1) and LATE ELONGATED HYPOCOTYL (LHY). Intriguingly, similar changes in gene expression and cell death were observed in clock mutants lacking proper CCA1 and LHY function. Circadian stress caused strong changes in reactive oxygen species- and jasmonic acid (JA)-related gene expression. The activation of the JA pathway, involving the accumulation of JA metabolites, was crucial for the induction of cell death, since the cell death phenotype was strongly reduced in the jasmonate resistant1 mutant background. We propose that adaptation to circadian stress regimes requires a normal cytokinin status which, acting primarily through the AHK3 receptor, supports circadian clock function to guard against the detrimental effects of circadian stress. © 2016 American Society of Plant Biologists. All rights reserved.

Enhanced susceptibility of Prnp-deficient mice to kainate-induced seizures, neuronal apoptosis, and death: Role of AMPA/kainate receptors.

PubMed

Rangel, Alejandra; Burgaya, Ferran; Gavín, Rosalina; Soriano, Eduardo; Aguzzi, Adriano; Del Río, José A

2007-09-01

Normal physiologic functions of the cellular prion protein (PrPc) are still elusive. This GPI-anchored protein exerts many functions, including roles in neuron proliferation, neuroprotection or redox homeostasis. There are, however, conflicting data concerning its role in synaptic transmission. Although several studies report that PrPc participates in NMDA-mediated neurotransmission, parallel studies describe normal behavior of PrPc-mutant mice. Abnormal axon connections have been described in the dentate gyrus of the hippocampi of PrPc-deficient mice similar to those observed in epilepsy. A study indicates increased susceptibility to kainate (KA) in these mutant mice. We extend the observation of these studies by means of several histologic and biochemical analyses of KA-treated mice. PrPc-deficient mice showed increased sensitivity to KA-induced seizures in vivo and in vitro in organotypic slices. In addition, we show that this sensitivity is cell-specific because interference experiments to abolish PrPc expression increased susceptibility to KA in PrPc-expressing cells. We indicate a correlation of susceptibility to KA in cells lacking PrPc with the differential expression of GluR6 and GluR7 KA receptor subunits using real-time RT-PCR methods. These results indicate that PrPc exerts a neuroprotective role against KA-induced neurotoxicity, probably by regulating the expression of KA receptor subunits. (c) 2007 Wiley-Liss, Inc.

Cell-specific vacuolar calcium storage mediated by CAX1 regulates apoplastic calcium concentration, gas exchange, and plant productivity in Arabidopsis.

PubMed

Conn, Simon J; Gilliham, Matthew; Athman, Asmini; Schreiber, Andreas W; Baumann, Ute; Moller, Isabel; Cheng, Ning-Hui; Stancombe, Matthew A; Hirschi, Kendal D; Webb, Alex A R; Burton, Rachel; Kaiser, Brent N; Tyerman, Stephen D; Leigh, Roger A

2011-01-01

The physiological role and mechanism of nutrient storage within vacuoles of specific cell types is poorly understood. Transcript profiles from Arabidopsis thaliana leaf cells differing in calcium concentration ([Ca], epidermis <10 mM versus mesophyll >60 mM) were compared using a microarray screen and single-cell quantitative PCR. Three tonoplast-localized Ca(2+) transporters, CAX1 (Ca(2+)/H(+)-antiporter), ACA4, and ACA11 (Ca(2+)-ATPases), were identified as preferentially expressed in Ca-rich mesophyll. Analysis of respective loss-of-function mutants demonstrated that only a mutant that lacked expression of both CAX1 and CAX3, a gene ectopically expressed in leaves upon knockout of CAX1, had reduced mesophyll [Ca]. Reduced capacity for mesophyll Ca accumulation resulted in reduced cell wall extensibility, stomatal aperture, transpiration, CO(2) assimilation, and leaf growth rate; increased transcript abundance of other Ca(2+) transporter genes; altered expression of cell wall-modifying proteins, including members of the pectinmethylesterase, expansin, cellulose synthase, and polygalacturonase families; and higher pectin concentrations and thicker cell walls. We demonstrate that these phenotypes result from altered apoplastic free [Ca(2+)], which is threefold greater in cax1/cax3 than in wild-type plants. We establish CAX1 as a key regulator of apoplastic [Ca(2+)] through compartmentation into mesophyll vacuoles, a mechanism essential for optimal plant function and productivity.

Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant

PubMed Central

Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A.; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K.; Altenbach, Christian; Hong, Yuan; Hanson, Susan M.; Palazzo, Maria C.; Chen, Jeannie; Hubbell, Wayne L.; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2013-01-01

Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. PMID:24012956

Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant.

PubMed

Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K; Altenbach, Christian; Hong, Yuan; Hanson, Susan M; Palazzo, Maria C; Chen, Jeannie; Hubbell, Wayne L; Gurevich, Eugenia V; Gurevich, Vsevolod V

2013-12-01

Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. © 2013.

CYP79F1 and CYP79F2 have distinct functions in the biosynthesis of aliphatic glucosinolates in Arabidopsis.

PubMed

Chen, Sixue; Glawischnig, Erich; Jørgensen, Kirsten; Naur, Peter; Jørgensen, Bodil; Olsen, Carl-Erik; Hansen, Carsten H; Rasmussen, Hasse; Pickett, John A; Halkier, Barbara A

2003-03-01

Cytochromes P450 of the CYP79 family catalyze the conversion of amino acids to oximes in the biosynthesis of glucosinolates, a group of natural plant products known to be involved in plant defense and as a source of flavor compounds, cancer-preventing agents and bioherbicides. We report a detailed biochemical analysis of the substrate specificity and kinetics of CYP79F1 and CYP79F2, two cytochromes P450 involved in the biosynthesis of aliphatic glucosinolates in Arabidopsis thaliana. Using recombinant CYP79F1 and CYP79F2 expressed in Escherichia coli and Saccharomyces cerevisiae, respectively, we show that CYP79F1 metabolizes mono- to hexahomomethionine, resulting in both short- and long-chain aliphatic glucosinolates. In contrast, CYP79F2 exclusively metabolizes long-chain elongated penta- and hexahomomethionines. CYP79F1 and CYP79F2 are spatially and developmentally regulated, with different gene expression patterns. CYP79F2 is highly expressed in hypocotyl and roots, whereas CYP79F1 is strongly expressed in cotyledons, rosette leaves, stems, and siliques. A transposon-tagged CYP79F1 knockout mutant completely lacks short-chain aliphatic glucosinolates, but has an increased level of long-chain aliphatic glucosinolates, especially in leaves and seeds. The level of long-chain aliphatic glucosinolates in a transposon-tagged CYP79F2 knockout mutant is substantially reduced, whereas the level of short-chain aliphatic glucosinolates is not affected. Biochemical characterization of CYP79F1 and CYP79F2, and gene expression analysis, combined with glucosinolate profiling of knockout mutants demonstrate the functional role of these enzymes. This provides valuable insights into the metabolic network leading to the biosynthesis of aliphatic glucosinolates, and into metabolic engineering of altered aliphatic glucosinolate profiles to improve nutritional value and pest resistance.

Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (α1S) expressing two complementary protein fragments

PubMed Central

Ahern, Chris A; Vallejo, Paola; Mortenson, Lindsay; Coronado, Roberto

2001-01-01

Background The L-type Ca2+ channel formed by the dihydropyridine receptor (DHPR) of skeletal muscle senses the membrane voltage and opens the ryanodine receptor (RyR1). This channel-to-channel coupling is essential for Ca2+ signaling but poorly understood. We characterized a single-base frame-shift mutant of α1S, the pore subunit of the DHPR, that has the unusual ability to function voltage sensor for excitation-contraction (EC) coupling by virtue of expressing two complementary hemi-Ca2+ channel fragments. Results Functional analysis of cDNA transfected dysgenic myotubes lacking α1S were carried out using voltage-clamp, confocal Ca2+ indicator fluoresence, epitope immunofluorescence and immunoblots of expressed proteins. The frame-shift mutant (fs-α1S) expressed the N-terminal half of α1S (M1 to L670) and the C-terminal half starting at M701 separately. The C-terminal fragment was generated by an unexpected restart of translation of the fs-α1S message at M701 and was eliminated by a M701I mutation. Protein-protein complementation between the two fragments produced recovery of skeletal-type EC coupling but not L-type Ca2+ current. Discussion A premature stop codon in the II-III loop may not necessarily cause a loss of DHPR function due to a restart of translation within the II-III loop, presumably by a mechanism involving leaky ribosomal scanning. In these cases, function is recovered by expression of complementary protein fragments from the same cDNA. DHPR-RyR1 interactions can be achieved via protein-protein complementation between hemi-Ca2+ channel proteins, hence an intact II-III loop is not essential for coupling the DHPR voltage sensor to the opening of RyR1 channel. PMID:11806762

Dissecting the role of NtrC and RpoN in the expression of assimilatory nitrate and nitrite reductases in Bradyrhizobium diazoefficiens.

PubMed

López, María F; Cabrera, Juan J; Salas, Ana; Delgado, María J; López-García, Silvina L

2017-04-01

Bradyrhizobium diazoefficiens, a nitrogen-fixing endosymbiont of soybeans, is a model strain for studying rhizobial denitrification. This bacterium can also use nitrate as the sole nitrogen (N) source during aerobic growth by inducing an assimilatory nitrate reductase encoded by nasC located within the narK-bjgb-flp-nasC operon along with a nitrite reductase encoded by nirA at a different chromosomal locus. The global nitrogen two-component regulatory system NtrBC has been reported to coordinate the expression of key enzymes in nitrogen metabolism in several bacteria. In this study, we demonstrate that disruption of ntrC caused a growth defect in B. diazoefficiens cells in the presence of nitrate or nitrite as the sole N source and a decreased activity of the nitrate and nitrite reductase enzymes. Furthermore, the expression of narK-lacZ or nirA-lacZ transcriptional fusions was significantly reduced in the ntrC mutant after incubation under nitrate assimilation conditions. A B. diazoefficiens rpoN 1/2 mutant, lacking both copies of the gene encoding the alternative sigma factor σ 54 , was also defective in aerobic growth with nitrate as the N source as well as in nitrate and nitrite reductase expression. These results demonstrate that the NtrC regulator is required for expression of the B. diazoefficiens nasC and nirA genes and that the sigma factor RpoN is also involved in this regulation.

The Human 343delT HSPB5 Chaperone Associated with Early-onset Skeletal Myopathy Causes Defects in Protein Solubility*

PubMed Central

Mitzelfelt, Katie A.; Limphong, Pattraranee; Choi, Melinda J.; Kondrat, Frances D. L.; Lai, Shuping; Kolander, Kurt D.; Kwok, Wai-Meng; Dai, Qiang; Grzybowski, Michael N.; Zhang, Huali; Taylor, Graydon M.; Lui, Qiang; Thao, Mai T.; Hudson, Judith A.; Barresi, Rita; Bushby, Kate; Jungbluth, Heinz; Wraige, Elizabeth; Geurts, Aron M.; Benesch, Justin L. P.; Riedel, Michael; Christians, Elisabeth S.; Minella, Alex C.; Benjamin, Ivor J.

2016-01-01

Mutations of HSPB5 (also known as CRYAB or αB-crystallin), a bona fide heat shock protein and molecular chaperone encoded by the HSPB5 (crystallin, alpha B) gene, are linked to multisystem disorders featuring variable combinations of cataracts, cardiomyopathy, and skeletal myopathy. This study aimed to investigate the pathological mechanisms involved in an early-onset myofibrillar myopathy manifesting in a child harboring a homozygous recessive mutation in HSPB5, 343delT. To study HSPB5 343delT protein dynamics, we utilize model cell culture systems including induced pluripotent stem cells derived from the 343delT patient (343delT/343delT) along with isogenic, heterozygous, gene-corrected control cells (WT KI/343delT) and BHK21 cells, a cell line lacking endogenous HSPB5 expression. 343delT/343delT and WT KI/343delT-induced pluripotent stem cell-derived skeletal myotubes and cardiomyocytes did not express detectable levels of 343delT protein, contributable to the extreme insolubility of the mutant protein. Overexpression of HSPB5 343delT resulted in insoluble mutant protein aggregates and induction of a cellular stress response. Co-expression of 343delT with WT prevented visible aggregation of 343delT and improved its solubility. Additionally, in vitro refolding of 343delT in the presence of WT rescued its solubility. We demonstrate an interaction between WT and 343delT both in vitro and within cells. These data support a loss-of-function model for the myopathy observed in the patient because the insoluble mutant would be unavailable to perform normal functions of HSPB5, although additional gain-of-function effects of the mutant protein cannot be excluded. Additionally, our data highlight the solubilization of 343delT by WT, concordant with the recessive inheritance of the disease and absence of symptoms in carrier individuals. PMID:27226619

Evidence-Based Annotation of Gene Function in Shewanella oneidensis MR-1 Using Genome-Wide Fitness Profiling across 121 Conditions

PubMed Central

Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.; Shao, Wenjun; Baumohl, Jason K.; Xu, Zhuchen; Nguyen, Michelle; Tamse, Raquel; Davis, Ronald W.; Arkin, Adam P.

2011-01-01

Most genes in bacteria are experimentally uncharacterized and cannot be annotated with a specific function. Given the great diversity of bacteria and the ease of genome sequencing, high-throughput approaches to identify gene function experimentally are needed. Here, we use pools of tagged transposon mutants in the metal-reducing bacterium Shewanella oneidensis MR-1 to probe the mutant fitness of 3,355 genes in 121 diverse conditions including different growth substrates, alternative electron acceptors, stresses, and motility. We find that 2,350 genes have a pattern of fitness that is significantly different from random and 1,230 of these genes (37% of our total assayed genes) have enough signal to show strong biological correlations. We find that genes in all functional categories have phenotypes, including hundreds of hypotheticals, and that potentially redundant genes (over 50% amino acid identity to another gene in the genome) are also likely to have distinct phenotypes. Using fitness patterns, we were able to propose specific molecular functions for 40 genes or operons that lacked specific annotations or had incomplete annotations. In one example, we demonstrate that the previously hypothetical gene SO_3749 encodes a functional acetylornithine deacetylase, thus filling a missing step in S. oneidensis metabolism. Additionally, we demonstrate that the orphan histidine kinase SO_2742 and orphan response regulator SO_2648 form a signal transduction pathway that activates expression of acetyl-CoA synthase and is required for S. oneidensis to grow on acetate as a carbon source. Lastly, we demonstrate that gene expression and mutant fitness are poorly correlated and that mutant fitness generates more confident predictions of gene function than does gene expression. The approach described here can be applied generally to create large-scale gene-phenotype maps for evidence-based annotation of gene function in prokaryotes. PMID:22125499

Opc expression, LPS immunotype switch and pilin conversion contribute to serum resistance of unencapsulated meningococci.

PubMed

Hubert, Kerstin; Pawlik, Marie-Christin; Claus, Heike; Jarva, Hanna; Meri, Seppo; Vogel, Ulrich

2012-01-01

Neisseria meningitidis employs polysaccharides and outer membrane proteins to cope with human serum complement attack. To screen for factors influencing serum resistance, an assay was developed based on a colorimetric serum bactericidal assay. The screening used a genetically modified sequence type (ST)-41/44 clonal complex (cc) strain lacking LPS sialylation, polysaccharide capsule, the factor H binding protein (fHbp) and MutS, a protein of the DNA repair mechanism. After killing of >99.9% of the bacterial cells by serum treatment, the colorimetric assay was used to screen 1000 colonies, of which 35 showed enhanced serum resistance. Three mutant classes were identified. In the first class of mutants, enhanced expression of Opc was identified. Opc expression was associated with vitronectin binding and reduced membrane attack complex deposition confirming recent observations. Lipopolysaccharide (LPS) immunotype switch from immunotype L3 to L8/L1 by lgtA and lgtC phase variation represented the second class. Isogenic mutant analysis demonstrated that in ST-41/44 cc strains the L8/L1 immunotype was more serum resistant than the L3 immunotype. Consecutive analysis revealed that the immunotypes L8 and L1 were frequently observed in ST-41/44 cc isolates from both carriage and disease. Immunotype switch to L8/L1 is therefore suggested to contribute to the adaptive capacity of this meningococcal lineage. The third mutant class displayed a pilE allelic exchange associated with enhanced autoaggregation. The mutation of the C terminal hypervariable region D of PilE included a residue previously associated with increased pilus bundle formation. We suggest that autoaggregation reduced the surface area accessible to serum complement and protected from killing. The study highlights the ability of meningococci to adapt to environmental stress by phase variation and intrachromosomal recombination affecting subcapsular antigens.

Opc Expression, LPS Immunotype Switch and Pilin Conversion Contribute to Serum Resistance of Unencapsulated Meningococci

PubMed Central

Hubert, Kerstin; Pawlik, Marie-Christin; Claus, Heike; Jarva, Hanna; Meri, Seppo; Vogel, Ulrich

2012-01-01

Neisseria meningitidis employs polysaccharides and outer membrane proteins to cope with human serum complement attack. To screen for factors influencing serum resistance, an assay was developed based on a colorimetric serum bactericidal assay. The screening used a genetically modified sequence type (ST)-41/44 clonal complex (cc) strain lacking LPS sialylation, polysaccharide capsule, the factor H binding protein (fHbp) and MutS, a protein of the DNA repair mechanism. After killing of >99.9% of the bacterial cells by serum treatment, the colorimetric assay was used to screen 1000 colonies, of which 35 showed enhanced serum resistance. Three mutant classes were identified. In the first class of mutants, enhanced expression of Opc was identified. Opc expression was associated with vitronectin binding and reduced membrane attack complex deposition confirming recent observations. Lipopolysaccharide (LPS) immunotype switch from immunotype L3 to L8/L1 by lgtA and lgtC phase variation represented the second class. Isogenic mutant analysis demonstrated that in ST-41/44 cc strains the L8/L1 immunotype was more serum resistant than the L3 immunotype. Consecutive analysis revealed that the immunotypes L8 and L1 were frequently observed in ST-41/44 cc isolates from both carriage and disease. Immunotype switch to L8/L1 is therefore suggested to contribute to the adaptive capacity of this meningococcal lineage. The third mutant class displayed a pilE allelic exchange associated with enhanced autoaggregation. The mutation of the C terminal hypervariable region D of PilE included a residue previously associated with increased pilus bundle formation. We suggest that autoaggregation reduced the surface area accessible to serum complement and protected from killing. The study highlights the ability of meningococci to adapt to environmental stress by phase variation and intrachromosomal recombination affecting subcapsular antigens. PMID:23028802

Alcohol dehydrogenase AdhA plays a role in ethanol tolerance in model cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Vidal, Rebeca

2017-04-01

The protein AdhA from the cyanobacterium Synechocystis sp. PCC 6803 (hereafter Synechocystis) has been previously reported to show alcohol dehydrogenase activity towards ethanol and both NAD and NADP. This protein is currently being used in genetically modified strains of Synechocystis capable of synthesizing ethanol showing the highest ethanol productivities. In the present work, mutant strains of Synechocystis lacking AdhA have been constructed and tested for tolerance to ethanol. The lack of AdhA in the wild-type strain reduces survival to externally added ethanol at lethal concentration of 4% (v/v). On the other hand, the lack of AdhA in an ethanologenic strain diminishes tolerance of cells to internally produced ethanol. It is also shown that light-activated heterotrophic growth (LAHG) of the wild-type strain is impaired in the mutant strain lacking AdhA (∆adhA strain). Photoautotrophic, mixotrophic, and photoheterotrophic growth are not affected in the mutant strain. Based on phenotypic characterization of ∆adhA mutants, the possible physiological function of AdhA in Synechocystis is discussed.

Mutant Huntingtin Causes a Selective Decrease in the Expression of Synaptic Vesicle Protein 2C.

PubMed

Peng, Chaohua; Zhu, Gaochun; Liu, Xiangqian; Li, He

2018-04-30

Huntington's disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion in the huntingtin (Htt) protein. Mutant Htt causes synaptic transmission dysfunctions by interfering in the expression of synaptic proteins, leading to early HD symptoms. Synaptic vesicle proteins 2 (SV2s), a family of synaptic vesicle proteins including 3 members, SV2A, SV2B, and SV2C, plays important roles in synaptic physiology. Here, we investigated whether the expression of SV2s is affected by mutant Htt in the brains of HD transgenic (TG) mice and Neuro2a mouse neuroblastoma cells (N2a cells) expressing mutant Htt. Western blot analysis showed that the protein levels of SV2A and SV2B were not significantly changed in the brains of HD TG mice expressing mutant Htt with 82 glutamine repeats. However, in the TG mouse brain there was a dramatic decrease in the protein level of SV2C, which has a restricted distribution pattern in regions particularly vulnerable in HD. Immunostaining revealed that the immunoreactivity of SV2C was progressively weakened in the basal ganglia and hippocampus of TG mice. RT-PCR demonstrated that the mRNA level of SV2C progressively declined in the TG mouse brain without detectable changes in the mRNA levels of SV2A and SV2B, indicating that mutant Htt selectively inhibits the transcriptional expression of SV2C. Furthermore, we found that only SV2C expression was progressively inhibited in N2a cells expressing a mutant Htt containing 120 glutamine repeats. These findings suggest that the synaptic dysfunction in HD results from the mutant Htt-mediated inhibition of SV2C transcriptional expression. These data also imply that the restricted distribution and decreased expression of SV2C contribute to the brain region-selective pathology of HD.

ClpXP-Dependent RpoS Degradation Enables Full Activation of Type III Secretion System, Amylovoran Production, and Motility in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Zhao, Youfu

2017-11-01

Erwinia amylovora, the causal agent of fire blight disease of apple and pear, employs intracellular proteases, including Lon and ClpXP, for posttranslational regulation of various cellular proteins. It has been shown that Lon plays a critical role in E. amylovora virulence by directly targeting type III secretion system (T3SS) proteins and the Rcs phosphorelay system. In this study, we genetically examined the role of ClpXP and its potential interaction with Lon in E. amylovora. Mutation in clpXP diminished the expression of the T3SS, reduced exopolysaccharide amylovoran production and motility, and resulted in delayed disease progress. Western blot analyses showed highly accumulated RpoS proteins in the clpXP mutant. Moreover, mutation of rpoS in the clpXP mutant background rescued the expression of the T3SS and amylovoran production, suggesting that ClpXP-dependent RpoS degradation positively affects virulence traits. Interestingly, lack of both ClpXP and Lon resulted in significantly reduced virulence but increased expression of the T3SS and amylovoran production. However, this phenomenon was independent of RpoS accumulation, suggesting that ClpXP and Lon are indispensable for full virulence in E. amylovora.

Enhancing Nanos expression via the bacterial TomO protein is a conserved strategy used by the symbiont Wolbachia to fuel germ stem cell maintenance in infected Drosophila females.

PubMed

Ote, Manabu; Yamamoto, Daisuke

2018-04-27

The toxic manipulator of oogenesis (TomO) protein has been identified in the wMel strain of Wolbachia that symbioses with the vinegar fly Drosophila melanogaster, as a protein that affects host reproduction. TomO protects germ stem cells (GSCs) from degeneration, which otherwise occurs in ovaries of host females that are mutant for the gene Sex-lethal (Sxl). We isolated the TomO homologs from wPip, a Wolbachia strain from the mosquito Culex quinquefasciatus. One of the homologs, TomO w Pip 1, exerted the GSC rescue activity in fly Sxl mutants when lacking its hydrophobic stretches. The GSC-rescuing action of the TomO w Pip 1 variant was ascribable to its abilities to associate with Nanos (nos) mRNA and to enhance Nos protein expression. The analysis of structure-activity relationships with TomO homologs and TomO deletion variants revealed distinct modules in the protein that are each dedicated to different functions, i.e., subcellular localization, nos mRNA binding or Nos expression enhancement. We propose that modular reshuffling is the basis for structural and functional diversification of TomO protein members. © 2018 Wiley Periodicals, Inc.

Reduced chondrocyte proliferation and chondrodysplasia in mice lacking the integrin-linked kinase in chondrocytes.

PubMed

Terpstra, Leonieke; Prud'homme, Josée; Arabian, Alice; Takeda, Shu; Karsenty, Gérard; Dedhar, Shoukat; St-Arnaud, René

2003-07-07

Chondrocyte proliferation and differentiation requires their attachment to the collagen type II-rich matrix of developing bone. This interaction is mediated by integrins and their cytoplasmic effectors, such as the integrin-linked kinase (ILK). To elucidate the molecular mechanisms whereby integrins control these processes, we have specifically inactivated the ILK gene in growth plate chondrocytes using the Cre-lox methodology. Mice carrying an ILK allele flanked by loxP sites (ILK-fl) were crossed to transgenic mice expressing the Cre recombinase under the control of the collagen type II promoter. Inactivation of both copies of the ILK-fl allele lead to a chondrodysplasia characterized by a disorganized growth plate and to dwarfism. Expression of chondrocyte differentiation markers such as collagen type II, collagen type X, Indian hedgehog and the PTH-PTHrP receptor was normal in ILK-deficient growth plates. In contrast, chondrocyte proliferation, assessed by BrdU or proliferating cell nuclear antigen labeling, was markedly reduced in the mutant growth plates. Cell-based assays showed that integrin-mediated adhesion of primary cultures of chondrocytes from mutant animals to collagen type II was impaired. ILK inactivation in chondrocytes resulted in reduced cyclin D1 expression, and this most likely explains the defect in chondrocyte proliferation observed when ILK is inactivated in growth plate cells.

The Small GTP-Binding Protein Rhes Influences Nigrostriatal-Dependent Motor Behavior During Aging.

PubMed

Pinna, Annalisa; Napolitano, Francesco; Pelosi, Barbara; Di Maio, Anna; Wardas, Jadwiga; Casu, Maria Antonietta; Costa, Giulia; Migliarini, Sara; Calabresi, Paolo; Pasqualetti, Massimo; Morelli, Micaela; Usiello, Alessandro

2016-04-01

Here we aimed to evaluate: (1) Rhes mRNA expression in mouse midbrain, (2) the effect of Rhes deletion on the number of dopamine neurons, (3) nigrostriatal-sensitive behavior during aging in knockout mice. Radioactive in situ hybridization was assessed in adult mice. The beam-walking test was executed in 3-, 6- and 12-month-old mice. Immunohistochemistry of midbrain tyrosine hydroxylase (TH)-positive neurons was performed in 6- and 12-month-old mice. Rhes mRNA is expressed in TH-positive neurons of SNpc and the ventral tegmental area. Moreover, lack of Rhes leads to roughly a 20% loss of nigral TH-positive neurons in both 6- and 12-month-old mutants, when compared with their age-matched controls. Finally, lack of Rhes triggers subtle alterations in motor performance and coordination during aging. Our findings indicate a fine-tuning role of Rhes in regulating the number of TH-positive neurons of the substantia nigra and nigrostriatal-sensitive motor behavior during aging. © 2016 International Parkinson and Movement Disorder Society.

A highly conserved metalloprotease effector enhances virulence in the maize anthracnose fungus Colletotrichum graminicola.

PubMed

Sanz-Martín, José M; Pacheco-Arjona, José Ramón; Bello-Rico, Víctor; Vargas, Walter A; Monod, Michel; Díaz-Mínguez, José M; Thon, Michael R; Sukno, Serenella A

2016-09-01

Colletotrichum graminicola causes maize anthracnose, an agronomically important disease with a worldwide distribution. We have identified a fungalysin metalloprotease (Cgfl) with a role in virulence. Transcriptional profiling experiments and live cell imaging show that Cgfl is specifically expressed during the biotrophic stage of infection. To determine whether Cgfl has a role in virulence, we obtained null mutants lacking Cgfl and performed pathogenicity and live microscopy assays. The appressorium morphology of the null mutants is normal, but they exhibit delayed development during the infection process on maize leaves and roots, showing that Cgfl has a role in virulence. In vitro chitinase activity assays of leaves infected with wild-type and null mutant strains show that, in the absence of Cgfl, maize leaves exhibit increased chitinase activity. Phylogenetic analyses show that Cgfl is highly conserved in fungi. Similarity searches, phylogenetic analysis and transcriptional profiling show that C. graminicola encodes two LysM domain-containing homologues of Ecp6, suggesting that this fungus employs both Cgfl-mediated and LysM protein-mediated strategies to control chitin signalling. © 2015 BSPP and John Wiley & Sons Ltd.

Gamma motor neurons survive and exacerbate alpha motor neuron degeneration in ALS.

PubMed

Lalancette-Hebert, Melanie; Sharma, Aarti; Lyashchenko, Alexander K; Shneider, Neil A

2016-12-20

The molecular and cellular basis of selective motor neuron (MN) vulnerability in amyotrophic lateral sclerosis (ALS) is not known. In genetically distinct mouse models of familial ALS expressing mutant superoxide dismutase-1 (SOD1), TAR DNA-binding protein 43 (TDP-43), and fused in sarcoma (FUS), we demonstrate selective degeneration of alpha MNs (α-MNs) and complete sparing of gamma MNs (γ-MNs), which selectively innervate muscle spindles. Resistant γ-MNs are distinct from vulnerable α-MNs in that they lack synaptic contacts from primary afferent (I A ) fibers. Elimination of these synapses protects α-MNs in the SOD1 mutant, implicating this excitatory input in MN degeneration. Moreover, reduced I A activation by targeted reduction of γ-MNs in SOD1 G93A mutants delays symptom onset and prolongs lifespan, demonstrating a pathogenic role of surviving γ-MNs in ALS. This study establishes the resistance of γ-MNs as a general feature of ALS mouse models and demonstrates that synaptic excitation of MNs within a complex circuit is an important determinant of relative vulnerability in ALS.

Molecular mechanism of mast cell–mediated innate defense against endothelin and snake venom sarafotoxin

PubMed Central

Schneider, Lars A.; Schlenner, Susan M.; Feyerabend, Thorsten B.; Wunderlin, Markus; Rodewald, Hans-Reimer

2007-01-01

Mast cells are protective against snake venom sarafotoxins that belong to the endothelin (ET) peptide family. The molecular mechanism underlying this recently recognized innate defense pathway is unknown, but secretory granule proteases have been invoked. To specifically disrupt a single protease function without affecting expression of other proteases, we have generated a mouse mutant selectively lacking mast cell carboxypeptidase A (Mc-cpa) activity. Using this mutant, we have now identified Mc-cpa as the essential protective mast cell enzyme. Mass spectrometry of peptide substrates after cleavage by normal or mutant mast cells showed that removal of a single amino acid, the C-terminal tryptophan, from ET and sarafotoxin by Mc-cpa is the principle molecular mechanism underlying this very rapid mast cell response. Mast cell proteases can also cleave ET and sarafotoxin internally, but such “nicking” is not protective because intramolecular disulfide bridges maintain peptide function. We conclude that mast cells attack ET and sarafotoxin exactly at the structure required for toxicity, and hence sarafotoxins could not “evade” Mc-cpa's substrate specificity without loss of toxicity. PMID:17923505

Use of an otolith-deficient mutant in studies of fish behavior under microgravity

NASA Astrophysics Data System (ADS)

Ijiri, K.; Mizuno, R.; Eguchi, H.

In Medaka (Oryzias latipes ), fish of a mutant strain (ha strain) had a malfunction in otolith-vestibular system. The phenotype is expressed when the fish have this recessive gene h a) in a homozygous fashion, and the gene is autosomal. Their( difference from the normal fish was first recognizable in their embryonic stages, with abnormally larger ear vesicles and absence of otoliths called Lapillus inside the vesicles. The time-course study was carried out for the subsequent development of their otoliths. X ray phot ographs of the fish revealed that some adult fish of ha- strain still lack a pair of Lapillus, which mainly serve in sensing the direction of gravity, while others have formed the otoliths partially or completely. Changing the light direction within each day, the ha mutant fish were reared from hatching to young fish. The fish treated showed less dependence on gravity even at the age of 50 days or more. Parabolic flight experiments were carried out to observe the fish behavior under microgravity for ha strain.

Functional analysis of human foamy virus accessory reading frames.

PubMed Central

Baunach, G; Maurer, B; Hahn, H; Kranz, M; Rethwilm, A

1993-01-01

Foamy viruses belong to the retroviruses which possess a complex genome structure. The human foamy virus (HFV) isolate bears three open reading frames (the so-called bel genes) in the 3' region of the genome which have been reported to give rise to possibly six different proteins via alternative splicing (W. Muranyi and R. M. Flügel, J. Virol. 65:727-735, 1991). In order to analyze the requirements of these proteins for HFV replication in vitro, we constructed a set of single and combinatory bel gene mutants of an infectious molecular clone of HFV. The mutant which lacked the transacting activator, bel-1, was found to be replication incompetent. All other mutants replicated equally well and gave rise to comparable titers of infectious cell-free virus. When HFV proviruses were put under the control of a heterologous promoter (simian virus 40), none of the accessory gene products was found to be required for expression of structural (gag) proteins. There was no evidence for a posttranscriptional regulatory protein that is present in other complex retroviruses. Images PMID:8394455

Salmonella Enteritidis flagellar mutants have a colonization benefit in the chicken oviduct.

PubMed

Kilroy, Sofie; Raspoet, Ruth; Martel, An; Bosseler, Leslie; Appia-Ayme, Corinne; Thompson, Arthur; Haesebrouck, Freddy; Ducatelle, Richard; Van Immerseel, Filip

2017-02-01

Egg borne Salmonella Enteritidis is still a major cause of human food poisoning. Eggs can become internally contaminated following colonization of the hen's oviduct. In this paper we aimed to analyze the role of flagella of Salmonella Enteritidis in colonization of the hen's oviduct. Using a transposon library screen we showed that mutants lacking functional flagella are significantly more efficient in colonizing the hen's oviduct in vivo. A micro-array analysis proved that transcription of a number of flagellar genes is down-regulated inside chicken oviduct cells. Flagella contain flagellin, a pathogen associated molecular pattern known to bind to Toll-like receptor 5, activating a pro-inflammatory cascade. In vitro tests using primary oviduct cells showed that flagellin is not involved in invasion. Using a ligated loop model, a diminished inflammatory reaction was seen in the oviduct resulting from injection of an aflagellated mutant compared to the wild-type. It is hypothesized that Salmonella Enteritidis downregulates flagellar gene expression in the oviduct and consequently prevents a flagellin-induced inflammatory response, thereby increasing its oviduct colonization efficiency. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gamma motor neurons survive and exacerbate alpha motor neuron degeneration in ALS

PubMed Central

Lalancette-Hebert, Melanie; Sharma, Aarti; Lyashchenko, Alexander K.; Shneider, Neil A.

2016-01-01

The molecular and cellular basis of selective motor neuron (MN) vulnerability in amyotrophic lateral sclerosis (ALS) is not known. In genetically distinct mouse models of familial ALS expressing mutant superoxide dismutase-1 (SOD1), TAR DNA-binding protein 43 (TDP-43), and fused in sarcoma (FUS), we demonstrate selective degeneration of alpha MNs (α-MNs) and complete sparing of gamma MNs (γ-MNs), which selectively innervate muscle spindles. Resistant γ-MNs are distinct from vulnerable α-MNs in that they lack synaptic contacts from primary afferent (IA) fibers. Elimination of these synapses protects α-MNs in the SOD1 mutant, implicating this excitatory input in MN degeneration. Moreover, reduced IA activation by targeted reduction of γ-MNs in SOD1G93A mutants delays symptom onset and prolongs lifespan, demonstrating a pathogenic role of surviving γ-MNs in ALS. This study establishes the resistance of γ-MNs as a general feature of ALS mouse models and demonstrates that synaptic excitation of MNs within a complex circuit is an important determinant of relative vulnerability in ALS. PMID:27930290

Loss of LCAT activity in the golden Syrian hamster elicits pro-atherogenic dyslipidemia and enhanced atherosclerosis.

PubMed

Dong, Zhao; Shi, Haozhe; Zhao, Mingming; Zhang, Xin; Huang, Wei; Wang, Yuhui; Zheng, Lemin; Xian, Xunde; Liu, George

2018-06-01

Lecithin cholesterol acyltransferase (LCAT) plays a pivotal role in HDL metabolism but its influence on atherosclerosis remains controversial for decades both in animal and clinical studies. Because lack of cholesteryl ester transfer protein (CETP) is a major difference between murine and humans in lipoprotein metabolism, we aimed to create a novel Syrian Golden hamster model deficient in LCAT activity, which expresses endogenous CETP, to explore its metabolic features and particularly the influence of LCAT on the development of atherosclerosis. CRISPR/CAS9 gene editing system was employed to generate mutant LCAT hamsters. The characteristics of lipid metabolism and the development of atherosclerosis in the mutant hamsters were investigated using various conventional methods in comparison with wild type control animals. Hamsters lacking LCAT activity exhibited pro-atherogenic dyslipidemia as diminished high density lipoprotein (HDL) and ApoAI, hypertriglyceridemia, Chylomicron/VLDL accumulation and significantly increased ApoB100/48. Mechanistic study for hypertriglyceridemia revealed impaired LPL-mediated lipolysis and increased very low density lipoprotein (VLDL) secretion, with upregulation of hepatic genes involved in lipid synthesis and transport. The pro-atherogenic dyslipidemia in mutant hamsters was exacerbated after high fat diet feeding, ultimately leading to near a 3- and 5-fold increase in atherosclerotic lesions by aortic en face and sinus lesion quantitation, respectively. Our findings demonstrate that LCAT deficiency in hamsters develops pro-atherogenic dyslipidemia and promotes atherosclerotic lesion formation. Published by Elsevier Inc.

Mutational analysis of the MS2 lysis protein L

PubMed Central

Chamakura, Karthik R.; Edwards, Garrett B.

2017-01-01

Small single-stranded nucleic acid phages effect lysis by expressing a single protein, the amurin, lacking muralytic enzymatic activity. Three amurins have been shown to act like ‘protein antibiotics’ by inhibiting cell-wall biosynthesis. However, the L lysis protein of the canonical ssRNA phage MS2, a 75 aa polypeptide, causes lysis by an unknown mechanism without affecting net peptidoglycan synthesis. To identify residues important for lytic function, randomly mutagenized alleles of L were generated, cloned into an inducible plasmid and the transformants were selected on agar containing the inducer. From a total of 396 clones, 67 were unique single base-pair changes that rendered L non-functional, of which 44 were missense mutants and 23 were nonsense mutants. Most of the non-functional missense alleles that accumulated in levels comparable to the wild-type allele are localized in the C-terminal half of L, clustered in and around an LS dipeptide sequence. The LS motif was used to align L genes from ssRNA phages lacking any sequence similarity to MS2 or to each other. This alignment revealed a conserved domain structure, in terms of charge, hydrophobic character and predicted helical content. None of the missense mutants affected membrane-association of L. Several of the L mutations in the central domains were highly conservative and recessive, suggesting a defect in a heterotypic protein–protein interaction, rather than in direct disruption of the bilayer structure, as had been previously proposed for L. PMID:28691656

Identification of Bacillus subtilis men mutants which lack O-succinylbenzoyl-coenzyme A synthetase and dihydroxynaphthoate synthase.

PubMed Central

Meganathan, R; Bentley, R; Taber, H

1981-01-01

Menaquinone (vitamin K2)-deficient mutants of Bacillus subtilis, whose growth requirement is satisfied by 1,4-dihydroxy-2-naphthoic acid but not by o-succinylbenzoic acid (OSB), have been analyzed for enzymatic defects. Complementation analysis of cell-free extracts of the mutants revealed that there are two groups, as already indicated by genetic analysis. The missing enzyme in each group was identified by complementation of the cell-free extracts with o-succinylbenzoyl-coenzyme A (CoA) synthetase and dihydroxynaphthoate synthase extracted from Mycobacterium phlei. Mutants found to lack dihydroxynaphthoate synthase, and which therefore complement with dihydroxynaphthoate synthase of M. phlei, were designated as menB; those lacking o-succinylbenzoyl-CoA synthetase, and therefore complementing with o-succinylbenzoyl-CoA synthetase, were designated as menE. The menB mutants RB413 (men-325) and RB415 (men-329), when incubated with [2,3-14C2]OSB, produced only the spirodilactone form of OSB in a reaction that was CoA and adenosine 5'-triphosphate dependent. PMID:6780515

Lack of centrioles and primary cilia in STIL−/− mouse embryos

PubMed Central

David, Ahuvit; Liu, Fengying; Tibelius, Alexandra; Vulprecht, Julia; Wald, Diana; Rothermel, Ulrike; Ohana, Reut; Seitel, Alexander; Metzger, Jasmin; Ashery-Padan, Ruth; Meinzer, Hans-Peter; Gröne, Hermann-Josef; Izraeli, Shai; Krämer, Alwin

2014-01-01

Although most animal cells contain centrosomes, consisting of a pair of centrioles, their precise contribution to cell division and embryonic development is unclear. Genetic ablation of STIL, an essential component of the centriole replication machinery in mammalian cells, causes embryonic lethality in mice around mid gestation associated with defective Hedgehog signaling. Here, we describe, by focused ion beam scanning electron microscopy, that STIL−/− mouse embryos do not contain centrioles or primary cilia, suggesting that these organelles are not essential for mammalian development until mid gestation. We further show that the lack of primary cilia explains the absence of Hedgehog signaling in STIL−/− cells. Exogenous re-expression of STIL or STIL microcephaly mutants compatible with human survival, induced non-templated, de novo generation of centrioles in STIL−/− cells. Thus, while the abscence of centrioles is compatible with mammalian gastrulation, lack of centrioles and primary cilia impairs Hedgehog signaling and further embryonic development. PMID:25486474

Lack of centrioles and primary cilia in STIL(-/-) mouse embryos.

PubMed

David, Ahuvit; Liu, Fengying; Tibelius, Alexandra; Vulprecht, Julia; Wald, Diana; Rothermel, Ulrike; Ohana, Reut; Seitel, Alexander; Metzger, Jasmin; Ashery-Padan, Ruth; Meinzer, Hans-Peter; Gröne, Hermann-Josef; Izraeli, Shai; Krämer, Alwin

2014-01-01

Although most animal cells contain centrosomes, consisting of a pair of centrioles, their precise contribution to cell division and embryonic development is unclear. Genetic ablation of STIL, an essential component of the centriole replication machinery in mammalian cells, causes embryonic lethality in mice around mid gestation associated with defective Hedgehog signaling. Here, we describe, by focused ion beam scanning electron microscopy, that STIL(-/-) mouse embryos do not contain centrioles or primary cilia, suggesting that these organelles are not essential for mammalian development until mid gestation. We further show that the lack of primary cilia explains the absence of Hedgehog signaling in STIL(-/-) cells. Exogenous re-expression of STIL or STIL microcephaly mutants compatible with human survival, induced non-templated, de novo generation of centrioles in STIL(-/-) cells. Thus, while the abscence of centrioles is compatible with mammalian gastrulation, lack of centrioles and primary cilia impairs Hedgehog signaling and further embryonic development.

Secreted bacterial effectors that inhibit host protein synthesis are critical for induction of the innate immune response to virulent Legionella pneumophila.

PubMed

Fontana, Mary F; Banga, Simran; Barry, Kevin C; Shen, Xihui; Tan, Yunhao; Luo, Zhao-Qing; Vance, Russell E

2011-02-01

The intracellular bacterial pathogen Legionella pneumophila causes an inflammatory pneumonia called Legionnaires' Disease. For virulence, L. pneumophila requires a Dot/Icm type IV secretion system that translocates bacterial effectors to the host cytosol. L. pneumophila lacking the Dot/Icm system is recognized by Toll-like receptors (TLRs), leading to a canonical NF-κB-dependent transcriptional response. In addition, L. pneumophila expressing a functional Dot/Icm system potently induces unique transcriptional targets, including proinflammatory genes such as Il23a and Csf2. Here we demonstrate that this Dot/Icm-dependent response, which we term the effector-triggered response (ETR), requires five translocated bacterial effectors that inhibit host protein synthesis. Upon infection of macrophages with virulent L. pneumophila, these five effectors caused a global decrease in host translation, thereby preventing synthesis of IκB, an inhibitor of the NF-κB transcription factor. Thus, macrophages infected with wildtype L. pneumophila exhibited prolonged activation of NF-κB, which was associated with transcription of ETR target genes such as Il23a and Csf2. L. pneumophila mutants lacking the five effectors still activated TLRs and NF-κB, but because the mutants permitted normal IκB synthesis, NF-κB activation was more transient and was not sufficient to fully induce the ETR. L. pneumophila mutants expressing enzymatically inactive effectors were also unable to fully induce the ETR, whereas multiple compounds or bacterial toxins that inhibit host protein synthesis via distinct mechanisms recapitulated the ETR when administered with TLR ligands. Previous studies have demonstrated that the host response to bacterial infection is induced primarily by specific microbial molecules that activate TLRs or cytosolic pattern recognition receptors. Our results add to this model by providing a striking illustration of how the host immune response to a virulent pathogen can also be shaped by pathogen-encoded activities, such as inhibition of host protein synthesis.

Reduced starch granule number per chloroplast in the dpe2/phs1 mutant is dependent on initiation of starch degradation

PubMed Central

Malinova, Irina

2017-01-01

An Arabidopsis double knock-out mutant lacking cytosolic disproportionating enzyme 2 (DPE2) and the plastidial phosphorylase (PHS1) revealed a dwarf-growth phenotype, reduced starch content, an uneven distribution of starch within the plant rosette, and a reduced number of starch granules per chloroplast under standard growth conditions. In contrast, the wild type contained 5–7 starch granules per chloroplast. Mature and old leaves of the double mutant were essentially starch free and showed plastidial disintegration. Several analyses revealed that the number of starch granules per chloroplast was affected by the dark phase. So far, it was unclear if it was the dark phase per se or starch degradation in the dark that was connected to the observed decrease in the number of starch granules per chloroplast. Therefore, in the background of the double mutant dpe2/phs1, a triple mutant was generated lacking the initial starch degrading enzyme glucan, water dikinase (GWD). The triple mutant showed improved plant growth, a starch-excess phenotype, and a homogeneous starch distribution. Furthermore, the number of starch granules per chloroplast was increased and was similar to wild type. However, starch granule morphology was only slightly affected by the lack of GWD as in the triple mutant and, like in dpe2/phs1, more spherical starch granules were observed. The characterized triple mutant was discussed in the context of the generation of starch granules and the formation of starch granule morphology. PMID:29155859

Reduced starch granule number per chloroplast in the dpe2/phs1 mutant is dependent on initiation of starch degradation.

PubMed

Malinova, Irina; Fettke, Joerg

2017-01-01

An Arabidopsis double knock-out mutant lacking cytosolic disproportionating enzyme 2 (DPE2) and the plastidial phosphorylase (PHS1) revealed a dwarf-growth phenotype, reduced starch content, an uneven distribution of starch within the plant rosette, and a reduced number of starch granules per chloroplast under standard growth conditions. In contrast, the wild type contained 5-7 starch granules per chloroplast. Mature and old leaves of the double mutant were essentially starch free and showed plastidial disintegration. Several analyses revealed that the number of starch granules per chloroplast was affected by the dark phase. So far, it was unclear if it was the dark phase per se or starch degradation in the dark that was connected to the observed decrease in the number of starch granules per chloroplast. Therefore, in the background of the double mutant dpe2/phs1, a triple mutant was generated lacking the initial starch degrading enzyme glucan, water dikinase (GWD). The triple mutant showed improved plant growth, a starch-excess phenotype, and a homogeneous starch distribution. Furthermore, the number of starch granules per chloroplast was increased and was similar to wild type. However, starch granule morphology was only slightly affected by the lack of GWD as in the triple mutant and, like in dpe2/phs1, more spherical starch granules were observed. The characterized triple mutant was discussed in the context of the generation of starch granules and the formation of starch granule morphology.

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

PubMed

Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

2015-03-25

RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.

Conditional abrogation of Atm in osteoclasts extends osteoclast lifespan and results in reduced bone mass.

PubMed

Hirozane, Toru; Tohmonda, Takahide; Yoda, Masaki; Shimoda, Masayuki; Kanai, Yae; Matsumoto, Morio; Morioka, Hideo; Nakamura, Masaya; Horiuchi, Keisuke

2016-09-28

Ataxia-telangiectasia mutated (ATM) kinase is a central component involved in the signal transduction of the DNA damage response (DDR) and thus plays a critical role in the maintenance of genomic integrity. Although the primary functions of ATM are associated with the DDR, emerging data suggest that ATM has many additional roles that are not directly related to the DDR, including the regulation of oxidative stress signaling, insulin sensitivity, mitochondrial homeostasis, and lymphocyte development. Patients and mice lacking ATM exhibit growth retardation and lower bone mass; however, the mechanisms underlying the skeletal defects are not fully understood. In the present study, we generated mutant mice in which ATM is specifically inactivated in osteoclasts. The mutant mice did not exhibit apparent developmental defects but showed reduced bone mass due to increased osteoclastic bone resorption. Osteoclasts lacking ATM were more resistant to apoptosis and showed a prolonged lifespan compared to the controls. Notably, the inactivation of ATM in osteoclasts resulted in enhanced NF-κB signaling and an increase in the expression of NF-κB-targeted genes. The present study reveals a novel function for ATM in regulating bone metabolism by suppressing the lifespan of osteoclasts and osteoclast-mediated bone resorption.

Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.

PubMed

Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y

2016-10-07

CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

Differential splicing and glycosylation of Apoer2 alters synaptic plasticity and fear learning.

PubMed

Wasser, Catherine R; Masiulis, Irene; Durakoglugil, Murat S; Lane-Donovan, Courtney; Xian, Xunde; Beffert, Uwe; Agarwala, Anandita; Hammer, Robert E; Herz, Joachim

2014-11-25

Apoer2 is an essential receptor in the central nervous system that binds to the apolipoprotein ApoE. Various splice variants of Apoer2 are produced. We showed that Apoer2 lacking exon 16, which encodes the O-linked sugar (OLS) domain, altered the proteolytic processing and abundance of Apoer2 in cells and synapse number and function in mice. In cultured cells expressing this splice variant, extracellular cleavage of OLS-deficient Apoer2 was reduced, consequently preventing γ-secretase-dependent release of the intracellular domain of Apoer2. Mice expressing Apoer2 lacking the OLS domain had increased Apoer2 abundance in the brain, hippocampal spine density, and glutamate receptor abundance, but decreased synaptic efficacy. Mice expressing a form of Apoer2 lacking the OLS domain and containing an alternatively spliced cytoplasmic tail region that promotes glutamate receptor signaling showed enhanced hippocampal long-term potentiation (LTP), a phenomenon associated with learning and memory. However, these mice did not display enhanced spatial learning in the Morris water maze, and cued fear conditioning was reduced. Reducing the expression of the mutant Apoer2 allele so that the abundance of the protein was similar to that of Apoer2 in wild-type mice normalized spine density, hippocampal LTP, and cued fear learning. These findings demonstrated a role for ApoE receptors as regulators of synaptic glutamate receptor activity and established differential receptor glycosylation as a potential regulator of synaptic function and memory. Copyright © 2014, American Association for the Advancement of Science.

Differential splicing and glycosylation of Apoer2 alters synaptic plasticity and fear learning

PubMed Central

Wasser, Catherine R.; Masiulis, Irene; Durakoglugil, Murat S.; Lane-Donovan, Courtney; Xian, Xunde; Beffert, Uwe; Agarwala, Anandita; Hammer, Robert E.; Herz, Joachim

2015-01-01

Apoer2 is an essential receptor in the central nervous system that binds to the apolipoprotein ApoE. Various splice variants of Apoer2 are produced. We showed that Apoer2 lacking exon 16, which encodes the O-linked sugar (OLS) domain, altered the proteolytic processing and abundance of Apoer2 in cells and synapse number and function in mice. In cultured cells expressing this splice variant, extracellular cleavage of OLS-deficient Apoer2 was reduced, consequently preventing γ-secretase-dependent release of the intracellular domain of Apoer2. Mice expressing Apoer2 lacking the OLS domain had increased Apoer2 abundance in the brain, hippocampal spine density, and glutamate receptor abundance, but decreased synaptic efficacy. Mice expressing a form of Apoer2 lacking the OLS domain and containing an alternatively spliced cytoplasmic tail region that promotes glutamate receptor signaling showed enhanced hippocampal long-term potentiation (LTP), a phenomenon associated with learning and memory. However, these mice did not display enhanced spatial learning in the Morris water maze, and cued fear conditioning was reduced. Reducing the expression of the mutant Apoer2 allele so that the abundance of the protein was similar to that of Apoer2 in wild-type mice normalized spine density, hippocampal LTP, and cued fear learning. These findings demonstrated a role for ApoE receptors as regulators of synaptic glutamate receptor activity and established differential receptor glycosylation as a potential regulator of synaptic function and memory. PMID:25429077

CYP77A19 and CYP77A20 characterized from Solanum tuberosum oxidize fatty acids in vitro and partially restore the wild phenotype in an Arabidopsis thaliana cutin mutant.

PubMed

Grausem, B; Widemann, E; Verdier, G; Nosbüsch, D; Aubert, Y; Beisson, F; Schreiber, L; Franke, R; Pinot, F

2014-09-01

Cutin and suberin represent lipophilic polymers forming plant/environment interfaces in leaves and roots. Despite recent progress in Arabidopsis, there is still a lack on information concerning cutin and suberin synthesis, especially in crops. Based on sequence homology, we isolated two cDNA clones of new cytochrome P450s, CYP77A19 and CYP77A20 from potato tubers (Solanum tuberosum). Both enzymes hydroxylated lauric acid (C12:0) on position ω-1 to ω-5. They oxidized fatty acids with chain length ranging from C12 to C18 and catalysed hydroxylation of 16-hydroxypalmitic acid leading to dihydroxypalmitic (DHP) acids, the major C16 cutin and suberin monomers. CYP77A19 also produced epoxides from linoleic acid (C18:2). Exploration of expression pattern in potato by RT-qPCR revealed the presence of transcripts in all tissues tested with the highest expression in the seed compared with leaves. Water stress enhanced their expression level in roots but not in leaves. Application of methyl jasmonate specifically induced CYP77A19 expression. Expression of either gene in the Arabidopsis null mutant cyp77a6-1 defective in flower cutin restored petal cuticular impermeability. Nanoridges were also observed in CYP77A20-expressing lines. However, only very low levels of the major flower cutin monomer 10,16-dihydroxypalmitate and no C18 epoxy monomers were found in the cutin of the complemented lines. © 2014 John Wiley & Sons Ltd.

Embryonic expression of shuttle craft, a Drosophila gene involved in neuron development, is associated with adult lifespan.

PubMed

Roshina, Natalia V; Symonenko, Alexander V; Krementsova, Anna V; Trostnikov, Mikhail V; Pasyukova, Elena G

2014-12-01

Despite the progress in aging research that highlights the role of the nervous system in longevity, whether genes that control development and consequently structure of the nervous system affect lifespan is unclear. We demonstrated that a mutation inshuttle craft, a gene involved in the nervous system development, increased the lifespan of unmated females and decreased the lifespan of mated females, without affecting males. Precise reversions of the mutation lead to the restoration of the lifespan specific to control females. In mutant unmated females, increased lifespan was associated with elevated locomotion at older ages, indicating slowed aging. In mutant mated females, reproduction was decreased compared to controls, indicating a lack of tradeoff between this trait and lifespan. No differences in shuttle craft transcription were observed between whole bodies, ovaries, and brains of mutant and control females of different ages, either unmated or mated. The amount of shuttle craft transcript appeared to be substantially decreased in mutant embryos. Our results demonstrated that a gene that regulates development of the nervous system might also influence longevity, and thus expanded the spectrum of genes involved in lifespan control. We hypothesize that this "carry-over" effect might be the result of transcription regulation in embryos.

The ADAR RNA editing enzyme controls neuronal excitability in Drosophila melanogaster

PubMed Central

Li, Xianghua; Overton, Ian M.; Baines, Richard A.; Keegan, Liam P.; O’Connell, Mary A.

2014-01-01

RNA editing by deamination of specific adenosine bases to inosines during pre-mRNA processing generates edited isoforms of proteins. Recoding RNA editing is more widespread in Drosophila than in vertebrates. Editing levels rise strongly at metamorphosis, and Adar5G1 null mutant flies lack editing events in hundreds of CNS transcripts; mutant flies have reduced viability, severely defective locomotion and age-dependent neurodegeneration. On the other hand, overexpressing an adult dADAR isoform with high enzymatic activity ubiquitously during larval and pupal stages is lethal. Advantage was taken of this to screen for genetic modifiers; Adar overexpression lethality is rescued by reduced dosage of the Rdl (Resistant to dieldrin), gene encoding a subunit of inhibitory GABA receptors. Reduced dosage of the Gad1 gene encoding the GABA synthetase also rescues Adar overexpression lethality. Drosophila Adar5G1 mutant phenotypes are ameliorated by feeding GABA modulators. We demonstrate that neuronal excitability is linked to dADAR expression levels in individual neurons; Adar-overexpressing larval motor neurons show reduced excitability whereas Adar5G1 null mutant or targeted Adar knockdown motor neurons exhibit increased excitability. GABA inhibitory signalling is impaired in human epileptic and autistic conditions, and vertebrate ADARs may have a relevant evolutionarily conserved control over neuronal excitability. PMID:24137011

Mutant with diphtheria toxin receptor and acidification function but defective in entry of toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kohno, Kenji; Hayes, H.; Mekada, Eisuke

1987-09-01

A mutant of Chinese hamster ovary cells, GE1, that is highly resistant to diphtheria toxin was isolated. The mutant contains 50% ADP-ribosylatable elongation factor 2, but its protein synthesis was not inhibited by the toxin even at concentrations above 100 {mu}g/ml. {sup 125}I-labeled diphtheria toxin was associated with GE1 cells as well as with the parent cells but did not block protein synthesis of GE1 cells even when the cells were exposed to low pH in the presence or absence of NH{sub 4}Cl. The infections of GE1 cells and the parent cells by vesicular stomatitis virus were similar. GE1 cellsmore » were cross-resistant to Pseudomonas aeruginosa exotoxin A and so were about 1,000 times more resistant to this toxin than the parent cells. Hybrids of GE1 cells and the parent cells or mutant cells lacking a functional receptor were more sensitive to diphtheria toxin than GE1 cells. These results suggest that entry of diphtheria toxin into cells requires a cellular factor(s) in addition to those involved in receptor function and acidification of endosomes and that GE1 cells do not express this cellular factor. This character is recessive in GE1 cells.« less

Sortase anchored proteins of Streptococcus uberis play major roles in the pathogenesis of bovine mastitis in dairy cattle

PubMed Central

Leigh, James A.; Egan, Sharon A.; Ward, Philip N.; Field, Terence R.; Coffey, Tracey J.

2010-01-01

Streptococcus uberis, strain 0140J, contains a single copy sortase A (srtA), encoding a transamidase capable of covalently anchoring specific proteins to peptidoglycan. Unlike the wild-type, an isogenic mutant carrying an inactivating ISS1 insertion within srtA was only able to infect the bovine mammary gland in a transient fashion. For the first 24 h post challenge, the srtA mutant colonised at a similar rate and number to the wild type strain, but unlike the wild type did not subsequently colonise in higher numbers. Similar levels of host cell infiltration were detected in response to infection with both strains, but only in those mammary quarters infected with the wild type strain were clinical signs of disease evident. Mutants that failed to express individual sortase substrate proteins (sub0135, sub0145, sub0207, sub0241, sub0826, sub0888, sub1095, sub1154, sub1370, and sub1730) were isolated and their virulence determined in the same challenge model. This revealed that mutants lacking sub0145, sub1095 and sub1154 were attenuated in cattle. These data demonstrate that a number of sortase anchored proteins each play a distinct, non-redundant and important role in pathogenesis of S. uberis infection within the lactating bovine mammary gland. PMID:20519112

Mutant E. coli strain with increased succinic acid production

DOEpatents

Donnelly, M.; Millard, C.S.; Stols, L.

1998-06-23

A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which as been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria. 2 figs.

Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice

PubMed Central

Yamanaka, Koji; Boillee, Severine; Roberts, Elizabeth A.; Garcia, Michael L.; McAlonis-Downes, Melissa; Mikse, Oliver R.; Cleveland, Don W.; Goldstein, Lawrence S. B.

2008-01-01

Dominant mutations in ubiquitously expressed superoxide dismutase (SOD1) cause familial ALS by provoking premature death of adult motor neurons. To test whether mutant damage to cell types beyond motor neurons is required for the onset of motor neuron disease, we generated chimeric mice in which all motor neurons and oligodendrocytes expressed mutant SOD1 at a level sufficient to cause fatal, early-onset motor neuron disease when expressed ubiquitously, but did so in a cellular environment containing variable numbers of non-mutant, non-motor neurons. Despite high-level mutant expression within 100% of motor neurons and oligodendrocytes, in most of these chimeras, the presence of WT non-motor neurons substantially delayed onset of motor neuron degeneration, increasing disease-free life by 50%. Disease onset is therefore non-cell autonomous, and mutant SOD1 damage within cell types other than motor neurons and oligodendrocytes is a central contributor to initiation of motor neuron degeneration. PMID:18492803

Light-dependent gravitropism and negative phototropism of inflorescence stems in a dominant Aux/IAA mutant of Arabidopsis thaliana, axr2.

PubMed

Sato, Atsuko; Sasaki, Shu; Matsuzaki, Jun; Yamamoto, Kotaro T

2014-09-01

Gravitropism and phototropism of the primary inflorescence stems were examined in a dominant Aux/IAA mutant of Arabidopsis, axr2/iaa7, which did not display either tropism in hypocotyls. axr2-1 stems completely lacked gravitropism in the dark but slowly regained it in light condition. Though wild-type stems showed positive phototropism, axr2 stems displayed negative phototropism with essentially the same light fluence-response curve as the wild type (WT). Application of 1-naphthaleneacetic acid-containing lanolin to the stem tips enhanced the positive phototropism of WT, and reduced the negative phototropism of axr2. Decapitation of stems caused a small negative phototropism in WT, but did not affect the negative phototropism of axr2. p-glycoprotein 1 (pgp1) pgp19 double mutants showed no phototropism, while decapitated double mutants exhibited negative phototropism. Expression of auxin-responsive IAA14/SLR, IAA19/MSG2 and SAUR50 genes was reduced in axr2 and pgp1 pgp19 stems relative to that of WT. These suggest that the phototropic response of stem is proportional to the auxin supply from the shoot apex, and that negative phototropism may be a basal response to unilateral blue-light irradiation when the levels of auxin or auxin signaling are reduced to the minimal level in the primary stems. In contrast, all of these treatments reduced or did not affect gravitropism in wild-type or axr2 stems. Tropic responses of the transgenic lines that expressed axr2-1 protein by the endodermis-specific promoter suggest that AXR2-dependent auxin response in the endodermis plays a more crucial role in gravitropism than in phototropism in stems but no significant roles in either tropism in hypocotyls.

Loss- and Gain-of-Function Mutations in the F1-HAMP Region of the Escherichia coli Aerotaxis Transducer Aer

PubMed Central

del Carmen Burón-Barral, Maria; Gosink, Khoosheh K.; Parkinson, John S.

2006-01-01

The Escherichia coli Aer protein contains an N-terminal PAS domain that binds flavin adenine dinucleotide (FAD), senses aerotactic stimuli, and communicates with the output signaling domain. To explore the roles of the intervening F1 and HAMP segments in Aer signaling, we isolated plasmid-borne aerotaxis-defective mutations in a host strain lacking all chemoreceptors of the methyl-accepting chemotaxis protein (MCP) family. Under these conditions, Aer alone established the cell's run/tumble swimming pattern and modulated that behavior in response to oxygen gradients. We found two classes of Aer mutants: null and clockwise (CW) biased. Most mutant proteins exhibited the null phenotype: failure to elicit CW flagellar rotation, no aerosensing behavior in MCP-containing hosts, and no apparent FAD-binding ability. However, null mutants had low Aer expression levels caused by rapid degradation of apparently nonnative subunits. Their functional defects probably reflect the absence of a protein product. In contrast, CW-biased mutant proteins exhibited normal expression levels, wild-type FAD binding, and robust aerosensing behavior in MCP-containing hosts. The CW lesions evidently shift unstimulated Aer output to the CW signaling state but do not block the Aer input-output pathway. The distribution and properties of null and CW-biased mutations suggest that the Aer PAS domain may engage in two different interactions with HAMP and the HAMP-proximal signaling domain: one needed for Aer maturation and another for promoting CW output from the Aer signaling domain. Most aerotaxis-defective null mutations in these regions seemed to affect maturation only, indicating that these two interactions involve structurally distinct determinants. PMID:16672601

A germ cell determinant reveals parallel pathways for germ line development in Caenorhabditis elegans.

PubMed

Mainpal, Rana; Nance, Jeremy; Yanowitz, Judith L

2015-10-15

Despite the central importance of germ cells for transmission of genetic material, our understanding of the molecular programs that control primordial germ cell (PGC) specification and differentiation are limited. Here, we present findings that X chromosome NonDisjunction factor-1 (XND-1), known for its role in regulating meiotic crossover formation, is an early determinant of germ cell fates in Caenorhabditis elegans. xnd-1 mutant embryos display a novel 'one PGC' phenotype as a result of G2 cell cycle arrest of the P4 blastomere. Larvae and adults display smaller germ lines and reduced brood size consistent with a role for XND-1 in germ cell proliferation. Maternal XND-1 proteins are found in the P4 lineage and are exclusively localized to the nucleus in PGCs, Z2 and Z3. Zygotic XND-1 turns on shortly thereafter, at the ∼300-cell stage, making XND-1 the earliest zygotically expressed gene in worm PGCs. Strikingly, a subset of xnd-1 mutants lack germ cells, a phenotype shared with nos-2, a member of the conserved Nanos family of germline determinants. We generated a nos-2 null allele and show that nos-2; xnd-1 double mutants display synthetic sterility. Further removal of nos-1 leads to almost complete sterility, with the vast majority of animals without germ cells. Sterility in xnd-1 mutants is correlated with an increase in transcriptional activation-associated histone modification and aberrant expression of somatic transgenes. Together, these data strongly suggest that xnd-1 defines a new branch for PGC development that functions redundantly with nos-2 and nos-1 to promote germline fates by maintaining transcriptional quiescence and regulating germ cell proliferation. © 2015. Published by The Company of Biologists Ltd.

Wee-1 Kinase Inhibition Overcomes Cisplatin Resistance Associated with High-Risk TP53 Mutations in Head and Neck Cancer through Mitotic Arrest Followed by Senescence

PubMed Central

Osman, Abdullah A.; Monroe, Marcus M.; Ortega Alves, Marcus V.; Patel, Ameeta A.; Katsonis, Panagiotis; Fitzgerald, Alison L.; Neskey, David M.; Frederick, Mitchell J.; Woo, Sang Hyeok; Caulin, Carlos; Hsu, Teng-Kuei; McDonald, Thomas O.; Kimmel, Marek; Meyn, Raymond E.; Lichtarge, Olivier; Myers, Jeffrey N.

2015-01-01

Although cisplatin has played a role in “standard-of-care” multimodality therapy for patients with advanced squamous cell carcinoma of the head and neck (HNSCC), the rate of treatment failure remains particularly high for patients receiving cisplatin whose tumors have mutations in the TP53 gene. We found that cisplatin treatment of HNSCC cells with mutant TP53 leads to arrest of cells in the G2 phase of the cell cycle, leading us to hypothesize that the wee-1 kinase inhibitor MK-1775 would abrogate the cisplatin-induced G2 block and thereby sensitize isogenic HNSCC cells with mutant TP53 or lacking p53 expression to cisplatin. We tested this hypothesis using clonogenic survival assays, flow cytometry, and in vivo tumor growth delay experiments with an orthotopic nude mouse model of oral tongue cancer. We also used a novel TP53 mutation classification scheme to identify which TP53 mutations are associated with limited tumor responses to cisplatin treatment. Clonogenic survival analyses indicate that nanomolar concentration of MK-1775 sensitizes HNSCC cells with high-risk mutant p53 to cisplatin. Consistent with its ability to chemosensitize, MK-1775 abrogated the cisplatin-induced G2 block in p53-defective cells leading to mitotic arrest associated with a senescence-like phenotype. Furthermore, MK-1775 enhanced the efficacy of cisplatin in vivo in tumors harboring TP53 mutations. These results indicate that HNSCC cells expressing high-risk p53 mutations are significantly sensitized to cisplatin therapy by the selective wee-1 kinase inhibitor, supporting the clinical evaluation of MK-1775 in combination with cisplatin for the treatment of patients with TP53 mutant HNSCC. PMID:25504633

Binding-, intracellular transport-, and biosynthesis-defective mutants of vasopressin type 2 receptor in patients with X-linked nephrogenic diabetes insipidus.

PubMed Central

Tsukaguchi, H; Matsubara, H; Taketani, S; Mori, Y; Seido, T; Inada, M

1995-01-01

Nephrogenic diabetes insipidus (NDI) is most often an X-linked disorder in which urine is not concentrated due to renal resistance to arginine vasopressin. We recently identified four vasopressin type 2 receptor gene mutations in unrelated X-linked NDI families, including R143P, delta V278, R202C, and 804insG. All these mutations reduced ligand binding activity to < 10% of the normal without affecting mRNA accumulation. To elucidate whether the receptors are expressed on the cell surface, we analyzed biosynthesis and localization of tagged or untagged receptors stably expressed in Chinese hamster ovary (CHO) cells, using two antibodies directed against distinct termini. Whole-cell and surface labeling studies revealed that the R202C clone had both surface-localized (50-55 kD) and intracellular proteins (40 and 75 kD), similar to the wild-type AVPR2 clone, whereas the R143P and delta V278 clones lacked the surface receptors, despite relatively increased intracellular components. The 804insG mutant cell produced no proteins despite an adequate mRNA level. Immunofluorescence staining confirmed that the R202C mutant reaches the cell surface, whereas the R143P and delta V278 mutants are retained within the cytoplasmic compartment. Thus, R202C, R143P/delta V278, and 804insG result in three distinct phenotypes, that is, a simple binding impairment at the cell surface, blocked intracellular transport, and ineffective biosynthesis or/and accelerated degradation of the receptor, respectively, and therefore are responsible for NDI. This phenotypic classification will help understanding of molecular pathophysiology of this disorder. Images PMID:7560098

Proteomic analysis of proteins related to rice grain chalkiness using iTRAQ and a novel comparison system based on a notched-belly mutant with white-belly

PubMed Central

2014-01-01

Background Grain chalkiness is a complex trait adversely affecting appearance and milling quality, and therefore has been one of principal targets for rice improvement. Eliminating chalkiness from rice has been a daunting task due to the complex interaction between genotype and environment and the lack of molecular markers. In addition, the molecular mechanisms underlying grain chalkiness formation are still imperfectly understood. Results We identified a notched-belly mutant (DY1102) with high percentage of white-belly, which only occurs in the bottom part proximal to the embryo. Using this mutant, a novel comparison system that can minimize the effect of genetic background and growing environment was developed. An iTRAQ-based comparative display of the proteins between the bottom chalky part and the upper translucent part of grains of DY1102 was performed. A total of 113 proteins responsible for chalkiness formation was identified. Among them, 70 proteins are up-regulated and 43 down-regulated. Approximately half of these differentially expressed proteins involved in central metabolic or regulatory pathways including carbohydrate metabolism (especially cell wall synthesis) and protein synthesis, folding and degradation, providing proteomic confirmation of the notion that chalkiness formation involves diverse but delicately regulated pathways. Protein metabolism was the most abundant category, accounting for 27.4% of the total differentially expressed proteins. In addition, down regulation of PDIL 2–3 and BiP was detected in the chalky tissue, indicating the important role of protein metabolism in grain chalkiness formation. Conclusions Using this novel comparison system, our comprehensive survey of endosperm proteomics in the notched-belly mutant provides a valuable proteomic resource for the characterization of pathways contributing to chalkiness formation at molecular and biochemical levels. PMID:24924297

P01.29 Mutant (R132H) IDH1-driven cellular transformation makes cells dependent on continued wild type IDH1 expression in a model of in vitro gliomagenesis

PubMed Central

Johannessen, T.; Mukherjee, J.; Wood, M.; Viswanath, P.; Ohba, S.; Ronen, S.; Berkvig, R.; Pieper, R.

2017-01-01

Abstract Introduction: Missense R132H mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. We recently showed (Mol Cancer Res 14: 976–983, 2016) that although mutant IDH1 expression in hTERT-immortalized, p53/pRb-deficient astrocytes can drive cellular transformation and gliomagenesis, selective pharmacologic inhibition and elimination of 2-HG by the mutant IDH1 inhibitor AGI-5198 has little effect on the growth or clonagenicity of these transformed cells. To address the possible role of WT IDH1 in the growth of mutant IDH-driven tumor cells, we used a slightly different gliomagenesis model in which the transformation of TERT-deficient, p53/pRb-deficient astrocytes (pre-crisis cells) occurs only after prolonged expression of mutant IDH and passage through cellular crisis (post-crisis cells, Cancer Res 76:6680–6689, 2016). METHODS AND MATERIALS: Using this system we introduced AGI-5198, or siRNA targeting both WT and mutant forms of IDH1 into p53/pRb-deficient, mutant IDH1-expressing human astrocytes prior to or following their transformation, and compared the effects on cell growth and clonagenicity. Results: AGI-5198 exposure decreased levels of 2HG by greater than 90%, and as previously reported had no effect on the growth of either the pre-or post-crisis cell populations. A one-day exposure to a pan IDH1 siRNA resulted in a similar, prolonged (greater than 6 day), 80% inhibition of both WT and mutant IDH1 protein levels and 2HG in both cell groups. While the growth of the mutant IDH-expressing, non-transformed cells was similar to that of scramble siRNA controls, the growth of the mutant IDH-transformed cells was significantly reduced. This growth suppression was also accompanied by a four-fold increase in annexin V-positive apoptotic cells. Furthermore, the growth suppression in the cells transformed by mutant IDH1 expression could not be reversed by addition of a cell-permeable form of 2-HG. Conclusions: These results show that the in vitro transformative events driven by expression of mutant IDH1 make cells dependent not on continued mutant IDH1 expression, but rather on continued WT IDH1 expression. The data also support the development and testing of agents that can inhibit both the WT and mutant forms of IDH1.

The HCM-linked W792R mutation in cardiac myosin-binding protein C reduces C6 FnIII domain stability.

PubMed

Smelter, Dan F; de Lange, Willem J; Cai, Wenxuan; Ge, Ying; Ralphe, J Carter

2018-06-01

Cardiac myosin-binding protein C (cMyBP-C) is a functional sarcomeric protein that regulates contractility in response to contractile demand, and many mutations in cMyBP-C lead to hypertrophic cardiomyopathy (HCM). To gain insight into the effects of disease-causing cMyBP-C missense mutations on contractile function, we expressed the pathogenic W792R mutation (substitution of a highly conserved tryptophan residue by an arginine residue at position 792) in mouse cardiomyocytes lacking endogenous cMyBP-C and studied the functional effects using three-dimensional engineered cardiac tissue constructs (mECTs). Based on complete conservation of tryptophan at this location in fibronectin type II (FnIII) domains, we hypothesized that the W792R mutation affects folding of the C6 FnIII domain, destabilizing the mutant protein. Adenoviral transduction of wild-type (WT) and W792R cDNA achieved equivalent mRNA transcript abundance, but not equivalent protein levels, with W792R compared with WT controls. mECTs expressing W792R demonstrated abnormal contractile kinetics compared with WT mECTs that were nearly identical to cMyBP-C-deficient mECTs. We studied whether common pathways of protein degradation were responsible for the rapid degradation of W792R cMyBP-C. Inhibition of both ubiquitin-proteasome and lysosomal degradation pathways failed to increase full-length mutant protein abundance to WT equivalence, suggesting rapid cytosolic degradation. Bacterial expression of WT and W792R protein fragments demonstrated decreased mutant stability with altered thermal denaturation and increased susceptibility to trypsin digestion. These data suggest that the W792R mutation destabilizes the C6 FnIII domain of cMyBP-C, resulting in decreased full-length protein expression. This study highlights the vulnerability of FnIII-like domains to mutations that alter domain stability and further indicates that missense mutations in cMyBP-C can cause disease through a mechanism of haploinsufficiency. NEW & NOTEWORTHY This study is one of the first to describe a disease mechanism for a missense mutation in cardiac myosin-binding protein C linked to hypertrophic cardiomyopathy. The mutation decreases stability of the fibronectin type III domain and results in substantially reduced mutant protein expression dissonant to transcript abundance.

p21, an important mediator of quiescence during pituitary tumor formation, is dispensable for normal pituitary development during embryogenesis.

PubMed Central

Monahan, Pamela; Himes, Ashley D.; Parfieniuk, Agata; Raetzman, Lori T.

2011-01-01

A delicate balance between proliferation and differentiation must be maintained in the developing pituitary to ensure the formation of the appropriate number of hormone producing cells. In the adult, proliferation is actively restrained to prevent tumor formation. The cyclin dependent kinase inhibitors (CDKIs) of the CIP/KIP family, p21, p27 and p57, mediate cell cycle inhibition. Although p21 is induced in the pituitary upon loss of Notch signaling or initiation of tumor formation to halt cell cycle progression, its role in normal pituitary organogenesis has not been explored. In wildtype pituitaries, expression of p21 is limited to a subset of cells embryonically as well as during the postnatal proliferative phase. Mice lacking p21 do not have altered cell proliferation during early embryogenesis, but do show a slight delay in separation of proliferating progenitors from the oral ectoderm. By embryonic day 16.5, p21 mutants have an alteration in the spatial distribution of proliferating pituitary progenitors, however there is no overall change in proliferation. At postnatal day 21, there appears to be no change in proliferation, as assessed by cells expressing Ki67 protein. However, p21 mutant pituitaries have significantly less mRNA of Myc and the cyclins Ccnb1, Ccnd1, Ccnd2 and Ccne1 than wildtype pituitaries. Interestingly, unlike the redundant role in cell cycle inhibition uncovered in p27/p57 double mutants, the pituitary of p21/p27 double mutants has a similar proliferation profile to p27 single mutants at the time points examined. Taken together, these studies demonstrate that unlike p27 or p57, p21 does not play a major role in control of progenitor proliferation in the developing pituitary. However, p21 may be required to maintain normal levels of cell cycle components. PMID:22154697

Acidithiobacillus caldus Sulfur Oxidation Model Based on Transcriptome Analysis between the Wild Type and Sulfur Oxygenase Reductase Defective Mutant

PubMed Central

Chen, Linxu; Ren, Yilin; Lin, Jianqun; Liu, Xiangmei; Pang, Xin; Lin, Jianqiang

2012-01-01

Background Acidithiobacillus caldus (A. caldus) is widely used in bio-leaching. It gains energy and electrons from oxidation of elemental sulfur and reduced inorganic sulfur compounds (RISCs) for carbon dioxide fixation and growth. Genomic analyses suggest that its sulfur oxidation system involves a truncated sulfur oxidation (Sox) system (omitting SoxCD), non-Sox sulfur oxidation system similar to the sulfur oxidation in A. ferrooxidans, and sulfur oxygenase reductase (SOR). The complexity of the sulfur oxidation system of A. caldus generates a big obstacle on the research of its sulfur oxidation mechanism. However, the development of genetic manipulation method for A. caldus in recent years provides powerful tools for constructing genetic mutants to study the sulfur oxidation system. Results An A. caldus mutant lacking the sulfur oxygenase reductase gene (sor) was created and its growth abilities were measured in media using elemental sulfur (S0) and tetrathionate (K2S4O6) as the substrates, respectively. Then, comparative transcriptome analysis (microarrays and real-time quantitative PCR) of the wild type and the Δsor mutant in S0 and K2S4O6 media were employed to detect the differentially expressed genes involved in sulfur oxidation. SOR was concluded to oxidize the cytoplasmic elemental sulfur, but could not couple the sulfur oxidation with the electron transfer chain or substrate-level phosphorylation. Other elemental sulfur oxidation pathways including sulfur diooxygenase (SDO) and heterodisulfide reductase (HDR), the truncated Sox pathway, and the S4I pathway for hydrolysis of tetrathionate and oxidation of thiosulfate in A. caldus are proposed according to expression patterns of sulfur oxidation genes and growth abilities of the wild type and the mutant in different substrates media. Conclusion An integrated sulfur oxidation model with various sulfur oxidation pathways of A. caldus is proposed and the features of this model are summarized. PMID:22984393

Mutations in the Cytoplasmic Domain of the Newcastle Disease Virus Fusion Protein Confer Hyperfusogenic Phenotypes Modulating Viral Replication and Pathogenicity

PubMed Central

Samal, Sweety; Khattar, Sunil K.; Paldurai, Anandan; Palaniyandi, Senthilkumar; Zhu, Xiaoping; Collins, Peter L.

2013-01-01

The Newcastle disease virus (NDV) fusion protein (F) mediates fusion of viral and host cell membranes and is a major determinant of NDV pathogenicity. In the present study, we demonstrate the effects of functional properties of F cytoplasmic tail (CT) amino acids on virus replication and pathogenesis. Out of a series of C-terminal deletions in the CT, we were able to rescue mutant viruses lacking two or four residues (rΔ2 and rΔ4). We further rescued viral mutants with individual amino acid substitutions at each of these four terminal residues (rM553A, rK552A, rT551A, and rT550A). In addition, the NDV F CT has two conserved tyrosine residues (Y524 and Y527) and a dileucine motif (LL536-537). In other paramyxoviruses, these residues were shown to affect fusion activity and are central elements in basolateral targeting. The deletion of 2 and 4 CT amino acids and single tyrosine substitution resulted in hyperfusogenic phenotypes and increased viral replication and pathogenesis. We further found that in rY524A and rY527A viruses, disruption of the targeting signals did not reduce the expression on the apical or basolateral surface in polarized Madin-Darby canine kidney cells, whereas in double tyrosine mutant, it was reduced on both the apical and basolateral surfaces. Interestingly, in rL536A and rL537A mutants, the F protein expression was more on the apical than on the basolateral surface, and this effect was more pronounced in the rL537A mutant. We conclude that these wild-type residues in the NDV F CT have an effect on regulating F protein biological functions and thus modulating viral replication and pathogenesis. PMID:23843643

Mutations in the cytoplasmic domain of the Newcastle disease virus fusion protein confer hyperfusogenic phenotypes modulating viral replication and pathogenicity.

PubMed

Samal, Sweety; Khattar, Sunil K; Paldurai, Anandan; Palaniyandi, Senthilkumar; Zhu, Xiaoping; Collins, Peter L; Samal, Siba K

2013-09-01

The Newcastle disease virus (NDV) fusion protein (F) mediates fusion of viral and host cell membranes and is a major determinant of NDV pathogenicity. In the present study, we demonstrate the effects of functional properties of F cytoplasmic tail (CT) amino acids on virus replication and pathogenesis. Out of a series of C-terminal deletions in the CT, we were able to rescue mutant viruses lacking two or four residues (rΔ2 and rΔ4). We further rescued viral mutants with individual amino acid substitutions at each of these four terminal residues (rM553A, rK552A, rT551A, and rT550A). In addition, the NDV F CT has two conserved tyrosine residues (Y524 and Y527) and a dileucine motif (LL536-537). In other paramyxoviruses, these residues were shown to affect fusion activity and are central elements in basolateral targeting. The deletion of 2 and 4 CT amino acids and single tyrosine substitution resulted in hyperfusogenic phenotypes and increased viral replication and pathogenesis. We further found that in rY524A and rY527A viruses, disruption of the targeting signals did not reduce the expression on the apical or basolateral surface in polarized Madin-Darby canine kidney cells, whereas in double tyrosine mutant, it was reduced on both the apical and basolateral surfaces. Interestingly, in rL536A and rL537A mutants, the F protein expression was more on the apical than on the basolateral surface, and this effect was more pronounced in the rL537A mutant. We conclude that these wild-type residues in the NDV F CT have an effect on regulating F protein biological functions and thus modulating viral replication and pathogenesis.

The NosX and NirX Proteins of Paracoccus denitrificans Are Functional Homologues: Their Role in Maturation of Nitrous Oxide Reductase

PubMed Central

Saunders, Neil F. W.; Hornberg, Jorrit J.; Reijnders, Willem N. M.; Westerhoff, Hans V.; de Vries, Simon; van Spanning, Rob J. M.

2000-01-01

The nos (nitrous oxide reductase) operon of Paracoccus denitrificans contains a nosX gene homologous to those found in the nos operons of other denitrifiers. NosX is also homologous to NirX, which is so far unique to P. denitrificans. Single mutations of these genes did not result in any apparent phenotype, but a double nosX nirX mutant was unable to reduce nitrous oxide. Promoter-lacZ assays and immunoblotting against nitrous oxide reductase showed that the defect was not due to failure of expression of nosZ, the structural gene for nitrous oxide reductase. Electron paramagnetic resonance spectroscopy showed that nitrous oxide reductase in cells of the double mutant lacked the CuA center. A twin-arginine motif in both NosX and NirX suggests that the NosX proteins are exported to the periplasm via the TAT translocon. PMID:10960107

Cysteine Catabolism and Cysteine Desulfhydrase (CdsH/STM0458) in Salmonella enterica Serovar Typhimurium

PubMed Central

Oguri, Tamiko; Schneider, Barbara

2012-01-01

Cysteine is potentially toxic and can affect diverse functions such as oxidative stress, antibiotic resistance, and swarming motility. The contribution of cysteine catabolism in modulating responses to cysteine has not been examined, in part because the genes have not been identified and mutants lacking these genes have not been isolated or characterized. We identified the gene for a previously described cysteine desulfhydrase, which we designated cdsH (formerly STM0458). We also identified a divergently transcribed gene that regulates cdsH expression, which we designated cutR (formerly ybaO, or STM0459). CdsH appears to be the major cysteine-degrading and sulfide-producing enzyme aerobically but not anaerobically. Mutants with deletions of cdsH and ybaO exhibited increased sensitivity to cysteine toxicity and altered swarming motility but unaltered cysteine-enhanced antibiotic resistance and survival in macrophages. PMID:22685283

Dictyostelium RasG Is Required for Normal Motility and Cytokinesis, But Not Growth

PubMed Central

Tuxworth, Richard I.; Cheetham, Janet L.; Machesky, Laura M.; Spiegelmann, George B.; Weeks, Gerald; Insall, Robert H.

1997-01-01

RasG is the most abundant Ras protein in growing Dictyostelium cells and the closest relative of mammalian Ras proteins. We have generated null mutants in which expression of RasG is completely abolished. Unexpectedly, RasG − cells are able to grow at nearly wild-type rates. However, they exhibit defective cell movement and a wide range of defects in the control of the actin cytoskeleton, including a loss of cell polarity, absence of normal lamellipodia, formation of unusual small, punctate polymerized actin structures, and a large number of abnormally long filopodia. Despite their lack of polarity and abnormal cytoskeleton, mutant cells perform normal chemotaxis. However, rasG − cells are unable to perform normal cytokinesis, becoming multinucleate when grown in suspension culture. Taken together, these data suggest a principal role for RasG in coordination of cell movement and control of the cytoskeleton. PMID:9245789

Assessment of Mycobacterium bovis deleted in p27-p55 virulence operon as candidate vaccine against tuberculosis in animal models.

PubMed

Bianco, María V; Clark, Simon; Blanco, Federico C; Garbaccio, Sergio; García, Elizabeth; Cataldi, Angel A; Williams, Ann; Bigi, Fabiana

2014-01-01

A Mycobacterium bovis knockout in p27-p55 operon was tested as an antituberculosis experimental vaccine in animal models. The mutant MbΔp27-p55 was significantly more attenuated in nude mice than its parental strain but more virulent than BCG Pasteur. Challenge experiments in mice and guinea pigs using M. bovis or M. tuberculosis strains showed similar protection conferred by MbΔp27-p55 mutant than BCG in terms of pathology and bacterial loads in spleen but lower protection than BCG in lungs. When tested in cattle, MbΔp27-p55 did not induce IL-2 expression and induced a very low production of IFNγ, suggesting that the lack of P27/P55 reduces the capacity of M. bovis of triggering an adequate Th1 response.

Bile system morphogenesis defects and liver dysfunction upon targeted deletion of HNF1beta.

PubMed

Coffinier, Catherine; Gresh, Lionel; Fiette, Laurence; Tronche, François; Schütz, Günther; Babinet, Charles; Pontoglio, Marco; Yaniv, Moshe; Barra, Jacqueline

2002-04-01

The inactivation of the Hnf1beta gene identified an essential role in epithelial differentiation of the visceral endoderm and resulted in early embryonic death. In the present study, we have specifically inactivated this gene in hepatocytes and bile duct cells using the Cre/loxP system. Mutant animals exhibited severe jaundice caused by abnormalities of the gallbladder and intrahepatic bile ducts (IHBD). The paucity of small IHBD was linked to a failure in the organization of duct structures during liver organogenesis, suggesting an essential function of Hnf1b in bile duct morphogenesis. Mutant mice also lacked interlobular arteries. As HNF1beta is not expressed in these cells, it further emphasizes the link between arterial and biliary formation. Hepatocyte metabolism was also affected and we identified hepatocyte-specific HNF1beta target genes involved in bile acids sensing and in fatty acid oxidation.

Corrector VX-809 stabilizes the first transmembrane domain of CFTR.

PubMed

Loo, Tip W; Bartlett, M Claire; Clarke, David M

2013-09-01

Processing mutations that inhibit folding and trafficking of CFTR are the main cause of cystic fibrosis (CF). A potential CF therapy would be to repair CFTR processing mutants. It has been demonstrated that processing mutants of P-glycoprotein (P-gp), CFTR's sister protein, can be efficiently repaired by a drug-rescue mechanism. Many arginine suppressors that mimic drug-rescue have been identified in the P-gp transmembrane (TM) domains (TMDs) that rescue by forming hydrogen bonds with residues in adjacent helices to promote packing of the TM segments. To test if CFTR mutants could be repaired by a drug-rescue mechanism, we used truncation mutants to test if corrector VX-809 interacted with the TMDs. VX-809 was selected for study because it is specific for CFTR, it is the most effective corrector identified to date, but it has limited clinical benefit. Identification of the VX-809 target domain will help to develop correctors with improved clinical benefits. It was found that VX-809 rescued truncation mutants lacking the NBD2 and R domains. When the remaining domains (TMD1, NBD1, TMD2) were expressed as separate polypeptides, VX-809 only increased the stability of TMD1. We then performed arginine mutagenesis on TM6 in TMD1. Although the results showed that TM6 had distinct lipid and aqueous faces, CFTR was different from P-gp as no arginine promoted maturation of CFTR processing mutants. The results suggest that TMD1 contains a VX-809 binding site, but its mechanism differed from P-gp drug-rescue. We also report that V510D acts as a universal suppressor to rescue CFTR processing mutants. Copyright © 2013 Elsevier Inc. All rights reserved.

The PHOTOSYNTHESIS AFFECTED MUTANT68–LIKE Protein Evolved from a PSII Assembly Factor to Mediate Assembly of the Chloroplast NAD(P)H Dehydrogenase Complex in Arabidopsis[W

PubMed Central

Armbruster, Ute; Rühle, Thilo; Kreller, Renate; Strotbek, Christoph; Zühlke, Jessica; Tadini, Luca; Blunder, Thomas; Hertle, Alexander P.; Qi, Yafei; Rengstl, Birgit; Nickelsen, Jörg; Frank, Wolfgang; Leister, Dario

2013-01-01

In vascular plants, the chloroplast NAD(P)H dehydrogenase complex (NDH-C) is assembled from five distinct subcomplexes, the membrane-spanning (subM) and the luminal (subL) subcomplexes, as well as subA, subB, and subE. The assembly process itself is poorly understood. Vascular plant genomes code for two related intrinsic thylakoid proteins, PHOTOSYNTHESIS-AFFECTED MUTANT68 (PAM68), a photosystem II assembly factor, and PHOTOSYNTHESIS-AFFECTED MUTANT68-LIKE (PAM68L). As we show here, inactivation of Arabidopsis thaliana PAM68L in the pam68l-1 mutant identifies PAM68L as an NDH-C assembly factor. The mutant lacks functional NDH holocomplexes and accumulates three distinct NDH-C assembly intermediates (subB, subM, and subA+L), which are also found in mutants defective in subB assembly (ndf5) or subM expression (CHLORORESPIRATORY REDUCTION4-3 mutant). NDH-C assembly in the cyanobacterium Synechocystis sp PCC 6803 and the moss Physcomitrella patens does not require PAM68 proteins, as demonstrated by the analysis of knockout lines for the single-copy PAM68 genes in these species. We conclude that PAM68L mediates the attachment of subB- and subM-containing intermediates to a complex that contains subA and subL. The evolutionary appearance of subL and PAM68L during the transition from mosses like P. patens to flowering plants suggests that the associated increase in the complexity of the NDH-C might have been facilitated by the recruitment of evolutionarily novel assembly factors like PAM68L. PMID:24096342

RovA, a global regulator of Yersinia pestis, specifically required for bubonic plague.

PubMed

Cathelyn, Jason S; Crosby, Seth D; Lathem, Wyndham W; Goldman, William E; Miller, Virginia L

2006-09-05

The pathogenic species of Yersinia contain the transcriptional regulator RovA. In Yersinia pseudotuberculosis and Yersinia enterocolitica, RovA regulates expression of the invasion factor invasin (inv), which mediates translocation across the intestinal epithelium. A Y. enterocolitica rovA mutant has a significant decrease in virulence by LD(50) analysis and an altered rate of dissemination compared with either wild type or an inv mutant, suggesting that RovA regulates multiple virulence factors. Here, we show the involvement of RovA in the virulence of Yersinia pestis, which naturally lacks a functional inv gene. A Y. pestis DeltarovA mutant is attenuated approximately 80-fold by LD(50) and is defective in dissemination/colonization of spleens and lungs after s.c. inoculation. However, the DeltarovA mutant is only slightly attenuated when given via an intranasal or i.p. route, indicating a more important role for RovA in bubonic plague than pneumonic plague or systemic infection. Microarray analysis was used to define the RovA regulon. The psa locus was among the most highly down-regulated loci in the DeltarovA mutant. A DeltapsaA mutant had a significant dissemination defect after s.c. infection but only slight attenuation by the pneumonic-disease model, closely mimicking the virulence defect seen with the DeltarovA mutant. DNA-binding studies revealed that RovA specifically interacts with the psaE and psaA promoter regions, indicating a direct role for RovA in regulating this locus. Thus, RovA appears to be a global transcription factor in Y. pestis and, through its regulatory influence on genes such as psaEFABC, contributes to the virulence of Y. pestis.

Arabidopsis Fructokinases Are Important for Seed Oil Accumulation and Vascular Development.

PubMed

Stein, Ofer; Avin-Wittenberg, Tamar; Krahnert, Ina; Zemach, Hanita; Bogol, Vlada; Daron, Oksana; Aloni, Roni; Fernie, Alisdair R; Granot, David

2016-01-01

Sucrose (a disaccharide made of glucose and fructose) is the primary carbon source transported to sink organs in many plants. Since fructose accounts for half of the hexoses used for metabolism in sink tissues, plant fructokinases (FRKs), the main fructose-phosphorylating enzymes, are likely to play a central role in plant development. However, to date, their specific functions have been the subject of only limited study. The Arabidopsis genome contains seven genes encoding six cytosolic FRKs and a single plastidic FRK. T-DNA knockout mutants for five of the seven FRKs were identified and used in this study. Single knockouts of the FRK mutants did not exhibit any unusual phenotype. Double-mutants of AtFRK6 (plastidic) and AtFRK7 showed normal growth in soil, but yielded dark, distorted seeds. The seed distortion could be complemented by expression of the well-characterized tomato SlFRK1 , confirming that a lack of FRK activity was the primary cause of the seed phenotype. Seeds of the double-mutant germinated, but failed to establish on 1/2 MS plates. Seed establishment was made possible by the addition of glucose or sucrose, indicating reduced seed storage reserves. Metabolic profiling of the double-mutant seeds revealed decreased TCA cycle metabolites and reduced fatty acid metabolism. Examination of the mutant embryo cells revealed smaller oil bodies, the primary storage reserve in Arabidopsis seeds. Quadruple and penta FRK mutants showed growth inhibition and leaf wilting. Anatomical analysis revealed smaller trachea elements and smaller xylem area, accompanied by necrosis around the cambium and the phloem. These results demonstrate overlapping and complementary roles of the plastidic AtFRK6 and the cytosolic AtFRK7 in seed storage accumulation, and the importance of AtFRKs for vascular development.

notch3 is essential for oligodendrocyte development and vascular integrity in zebrafish

PubMed Central

Zaucker, Andreas; Mercurio, Sara; Sternheim, Nitzan; Talbot, William S.; Marlow, Florence L.

2013-01-01

SUMMARY Mutations in the human NOTCH3 gene cause CADASIL syndrome (cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy). CADASIL is an inherited small vessel disease characterized by diverse clinical manifestations including vasculopathy, neurodegeneration and dementia. Here we report two mutations in the zebrafish notch3 gene, one identified in a previous screen for mutations with reduced expression of myelin basic protein (mbp) and another caused by a retroviral insertion. Reduced mbp expression in notch3 mutant embryos is associated with fewer oligodendrocyte precursor cells (OPCs). Despite an early neurogenic phenotype, mbp expression recovered at later developmental stages and some notch3 homozygous mutants survived to adulthood. These mutants, as well as adult zebrafish carrying both mutant alleles together, displayed a striking stress-associated accumulation of blood in the head and fins. Histological analysis of mutant vessels revealed vasculopathy, including: an enlargement (dilation) of vessels in the telencephalon and fin, disorganization of the normal stereotyped arrangement of vessels in the fin, and an apparent loss of arterial morphological structure. Expression of hey1, a well-known transcriptional target of Notch signaling, was greatly reduced in notch3 mutant fins, suggesting that Notch3 acts via a canonical Notch signaling pathway to promote normal vessel structure. Ultrastructural analysis confirmed the presence of dilated vessels in notch3 mutant fins and revealed that the vessel walls of presumed arteries showed signs of deterioration. Gaps in the arterial wall and the presence of blood cells outside of vessels in mutants indicated that compromised vessel structure led to hemorrhage. In notch3 heterozygotes, we found elevated expression of both notch3 itself and target genes, indicating that specific alterations in gene expression due to partial loss of Notch3 function might contribute to the abnormalities observed in heterozygous larvae and adults. Our analysis of zebrafish notch3 mutants indicates that Notch3 regulates OPC development and mbp gene expression in larvae, and maintains vascular integrity in adults. PMID:23720232

A basic peptide within the juxtamembrane region is required for EGF receptor dimerization.

PubMed

Aifa, Sami; Aydin, Jan; Nordvall, Gunnar; Lundström, Ingemar; Svensson, Samuel P S; Hermanson, Ola

2005-01-01

The epidermal growth factor receptor (EGFR) is fundamental for normal cell growth and organ development, but has also been implicated in various pathologies, notably tumors of epithelial origin. We have previously shown that the initial 13 amino acids (P13) within the intracellular juxtamembrane region (R645-R657) are involved in the interaction with calmodulin, thus indicating an important role for this region in EGFR function. Here we show that P13 is required for proper dimerization of the receptor. We expressed either the intracellular domain of EGFR (TKJM) or the intracellular domain lacking P13 (DeltaTKJM) in COS-7 cells that express endogenous EGFR. Only TKJM was immunoprecipitated with an antibody directed against the extracellular part of EGFR, and only TKJM was tyrosine phosphorylated by endogenous EGFR. Using SK-N-MC cells, which do not express endogenous EGFR, that were stably transfected with either wild-type EGFR or recombinant full-length EGFR lacking P13 demonstrated that P13 is required for appropriate receptor dimerization. Furthermore, mutant EGFR lacking P13 failed to be autophosphorylated. P13 is rich in basic amino acids and in silico modeling of the EGFR in conjunction with our results suggests a novel role for the juxtamembrane domain (JM) of EGFR in mediating intracellular dimerization and thus receptor kinase activation and function.

Distinct physiological roles for the two L-asparaginase isozymes of Escherichia coli.

PubMed

Srikhanta, Yogitha N; Atack, John M; Beacham, Ifor R; Jennings, Michael P

2013-07-05

Escherichia coli expresses two L-asparaginase (EC 3.5.1.1) isozymes: L-asparaginse I, which is a low affinity, cytoplasmic enzyme that is expressed constitutively, and L-asparaginase II, a high affinity periplasmic enzyme that is under complex co-transcriptional regulation by both Fnr and Crp. The distinct localisation and regulation of these enzymes suggest different roles. To define these roles, a set of isogenic mutants was constructed that lacked either or both enzymes. Evidence is provided that L-asparaginase II, in contrast to L-asparaginase I, can be used in the provision of an anaerobic electron acceptor when using a non-fermentable carbon source in the presence of excess nitrogen. Copyright © 2013. Published by Elsevier Inc.

VIP1 and Its Homologs Are Not Required for Agrobacterium-Mediated Transformation, but Play a Role in Botrytis and Salt Stress Responses

PubMed Central

Lapham, Rachelle; Lee, Lan-Ying; Tsugama, Daisuke; Lee, Sanghun; Mengiste, Tesfaye; Gelvin, Stanton B.

2018-01-01

The bZIP transcription factor VIP1 interacts with the Agrobacterium virulence protein VirE2, but the role of VIP1 in Agrobacterium-mediated transformation remains controversial. Previously tested vip1-1 mutant plants produce a truncated protein containing the crucial bZIP DNA-binding domain. We generated the CRISPR/Cas mutant vip1-2 that lacks this domain. The transformation susceptibility of vip1-2 and wild-type plants is similar. Because of potential functional redundancy among VIP1 homologs, we tested transgenic lines expressing VIP1 fused to a SRDX repression domain. All VIP1-SRDX transgenic lines showed wild-type levels of transformation, indicating that neither VIP1 nor its homologs are required for Agrobacterium-mediated transformation. Because VIP1 is involved in innate immune response signaling, we tested the susceptibility of vip1 mutant and VIP1-SRDX plants to Pseudomonas syringae and Botrytis cinerea. vip1 mutant and VIP1-SRDX plants show increased susceptibility to B. cinerea but not to P. syringae infection, suggesting a role for VIP1 in B. cinerea, but not in P. syringae, defense signaling. B. cinerea susceptibility is dependent on abscisic acid (ABA) which is also important for abiotic stress responses. The germination of vip1 mutant and VIP1-SRDX seeds is sensitive to exogenous ABA, suggesting a role for VIP1 in response to ABA. vip1 mutant and VIP1-SRDX plants show increased tolerance to growth in salt, indicating a role for VIP1 in response to salt stress. PMID:29946325

Acquired Substrate Preference for GAB1 Protein Bestows Transforming Activity to ERBB2 Kinase Lung Cancer Mutants

PubMed Central

Fan, Ying-Xin; Wong, Lily; Marino, Michael P.; Ou, Wu; Shen, Yi; Wu, Wen Jin; Wong, Kwok-Kin; Reiser, Jakob; Johnson, Gibbes R.

2013-01-01

Activating mutations in the αC-β4 loop of the ERBB2 kinase domain, such as ERBB2YVMA and ERBB2G776VC, have been identified in human lung cancers and found to drive tumor formation. Here we observe that the docking protein GAB1 is hyper-phosphorylated in carcinomas from transgenic mice and in cell lines expressing these ERBB2 cancer mutants. Using dominant negative GAB1 mutants lacking canonical tyrosine residues for SHP2 and PI3K interactions or lentiviral shRNA that targets GAB1, we demonstrate that GAB1 phosphorylation is required for ERBB2 mutant-induced cell signaling, cell transformation, and tumorigenesis. An enzyme kinetic analysis comparing ERBB2YVMA to wild type using physiologically relevant peptide substrates reveals that ERBB2YVMA kinase adopts a striking preference for GAB1 phosphorylation sites as evidenced by ∼150-fold increases in the specificity constants (kcat/Km) for several GAB1 peptides, and this change in substrate selectivity was predominantly attributed to the peptide binding affinities as reflected by the apparent Km values. Furthermore, we demonstrate that ERBB2YVMA phosphorylates GAB1 protein ∼70-fold faster than wild type ERBB2 in vitro. Notably, the mutation does not significantly alter the Km for ATP or sensitivity to lapatinib, suggesting that, unlike EGFR lung cancer mutants, the ATP binding cleft of the kinase is not significantly changed. Taken together, our results indicate that the acquired substrate preference for GAB1 is critical for the ERBB2 mutant-induced oncogenesis. PMID:23612964

A post-transcriptional compensatory pathway in heterozygous ventricular myosin light chain 2-deficient mice results in lack of gene dosage effect during normal cardiac growth or hypertrophy.

PubMed

Minamisawa, S; Gu, Y; Ross, J; Chien, K R; Chen, J

1999-04-09

Our previous study of homozygous mutants of the ventricular specific isoform of myosin light chain 2 (mlc-2v) demonstrated that mlc-2v plays an essential role in murine heart development (Chen, J., Kubalak, S. W., Minamisawa, S., Price, R. L., Becker, K. D., Hickey, R., Ross, J., Jr., and Chien, K. R. (1998) J. Biol. Chem. 273, 1252-1256). As gene dosage of some myofibrillar proteins can affect muscle function, we have analyzed heterozygous mutants in depth. Ventricles of heterozygous mutants displayed a 50% reduction in mlc-2v mRNA, yet expressed normal levels of protein both under basal conditions and following induction of cardiac hypertrophy by aortic constriction. Heterozygous mutants exhibited cardiac function comparable to that of wild-type littermate controls both prior to and following aortic constriction. There were no significant differences in contractility and responses to calcium between wild-type and heterozygous unloaded cardiomyocytes. We conclude that heterozygous mutants show neither a molecular nor a physiological cardiac phenotype either at base line or following hypertrophic stimuli. These results suggest that post-transcriptional compensatory mechanisms play a major role in maintaining the level of MLC-2v protein in murine hearts. In addition, as our mlc-2v knockout mutants were created by a knock-in of Cre recombinase into the endogenous mlc-2v locus, this study demonstrates that heterozygous mlc-2v cre knock-in mice are appropriate for ventricular specific gene targeting.

Endothelial sirtuin 1 inactivation enhances capillary rarefaction and fibrosis following kidney injury through Notch activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kida, Yujiro; Zullo, Joseph A.; Renal Research Institute, Department of Physiology, New York Medical College, Valhalla, NY

Peritubular capillary (PTC) rarefaction along with tissue fibrosis is a hallmark of chronic kidney disease (CKD). However, molecular mechanisms of PTC loss have been poorly understood. Previous studies have demonstrated that functional loss of endothelial sirtuin 1 (SIRT1) impairs angiogenesis during development and tissue damage. Here, we found that endothelial SIRT1 dysfunction causes activation of endothelial Notch1 signaling, which leads to PTC rarefaction and fibrosis following kidney injury. In mice lacking functional SIRT1 in the endothelium (Sirt1 mutant), kidney injury enhanced apoptosis and senescence of PTC endothelial cells with impaired endothelial proliferation and expanded myofibroblast population and collagen deposition. Comparedmore » to wild-type kidneys, Sirt1 mutant kidneys up-regulated expression of Delta-like 4 (DLL4, a potent Notch1 ligand), Hey1 and Hes1 (Notch target genes), and Notch intracellular domain-1 (NICD1, active form of Notch1) in microvascular endothelial cells (MVECs) post-injury. Sirt1 mutant primary kidney MVECs reduced motility and vascular assembly and enhanced senescence compared to wild-type kidney MVECs. This difference in the phenotype was negated with Notch inhibition. Concurrent stimulation of DLL4 and transforming growth factor (TGF)-β1 increased trans-differentiation of primary kidney pericytes into myofibroblast more than TGF-β1 treatment alone. Collectively, these results indicate that endothelial SIRT1 counteracts PTC rarefaction by repression of Notch1 signaling and antagonizes fibrosis via suppression of endothelial DLL4 expression. - Highlights: • SIRT1 represses Notch1 signaling in capillary endothelial cells in the kidney. • Endothelial SIRT1 is depleted in the kidney following injury. • Activation of endothelial Notch impairs angiogenesis in the kidney. • Increased expression of endothelial DLL4 enhances renal fibrosis.« less

Transgenic C. elegans dauer larvae expressing hookworm phospho null DAF-16/FoxO exit dauer.

PubMed

Gelmedin, Verena; Brodigan, Thomas; Gao, Xin; Krause, Michael; Wang, Zhu; Hawdon, John M

2011-01-01

Parasitic hookworms and the free-living model nematode Caenorhabtidis elegans share a developmental arrested stage, called the dauer stage in C. elegans and the infective third-stage larva (L3) in hookworms. One of the key transcription factors that regulate entrance to and exit from developmental arrest is the forkhead transcription factor DAF-16/FoxO. During the dauer stage, DAF-16 is activated and localized in the nucleus. DAF-16 is negatively regulated by phosphorylation by the upstream kinase AKT, which causes DAF-16 to localize out of the nucleus and the worm to exit from dauer. DAF-16 is conserved in hookworms, and hypothesized to control recovery from L3 arrest during infection. Lacking reverse genetic techniques for use in hookworms, we used C. elegans complementation assays to investigate the function of Ancylostoma caninum DAF-16 during entrance and exit from L3 developmental arrest. We performed dauer switching assays and observed the restoration of the dauer phenotype when Ac-DAF-16 was expressed in temperature-sensitive dauer defective C. elegans daf-2(e1370);daf-16(mu86) mutants. AKT phosphorylation site mutants of Ac-DAF-16 were also able to restore the dauer phenotype, but surprisingly allowed dauer exit when temperatures were lowered. We used fluorescence microscopy to localize DAF-16 during dauer and exit from dauer in C. elegans DAF-16 mutant worms expressing Ac-DAF-16, and found that Ac-DAF-16 exited the nucleus during dauer exit. Surprisingly, Ac-DAF-16 with mutated AKT phosphorylation sites also exited the nucleus during dauer exit. Our results suggest that another mechanism may be involved in the regulation DAF-16 nuclear localization during recovery from developmental arrest.

A Novel Zn2-Cys6 Transcription Factor AtrR Plays a Key Role in an Azole Resistance Mechanism of Aspergillus fumigatus by Co-regulating cyp51A and cdr1B Expressions

PubMed Central

Shimizu, Kiminori; Paul, Sanjoy; Ohba, Ayumi; Gonoi, Tohru; Watanabe, Akira; Gomi, Katsuya

2017-01-01

Successful treatment of aspergillosis caused by Aspergillus fumigatus is threatened by an increasing incidence of drug resistance. This situation is further complicated by the finding that strains resistant to azoles, the major antifungal drugs for aspergillosis, have been widely disseminated across the globe. To elucidate mechanisms underlying azole resistance, we identified a novel transcription factor that is required for normal azole resistance in Aspergillus fungi including A. fumigatus, Aspergillus oryzae, and Aspergillus nidulans. This fungal-specific Zn2-Cys6 type transcription factor AtrR was found to regulate expression of the genes related to ergosterol biosynthesis, including cyp51A that encodes a target protein of azoles. The atrR deletion mutant showed impaired growth under hypoxic conditions and attenuation of virulence in murine infection model for aspergillosis. These results were similar to the phenotypes for a mutant strain lacking SrbA that is also a direct regulator for the cyp51A gene. Notably, AtrR was responsible for the expression of cdr1B that encodes an ABC transporter related to azole resistance, whereas SrbA was not involved in the regulation. Chromatin immunoprecipitation assays indicated that AtrR directly bound both the cyp51A and cdr1B promoters. In the clinically isolated itraconazole resistant strain that harbors a mutant Cyp51A (G54E), deletion of the atrR gene resulted in a hypersensitivity to the azole drugs. Together, our results revealed that AtrR plays a pivotal role in a novel azole resistance mechanism by co-regulating the drug target (Cyp51A) and putative drug efflux pump (Cdr1B). PMID:28052140

Conjugated Fatty Acid Synthesis

PubMed Central

Rawat, Richa; Yu, Xiao-Hong; Sweet, Marie; Shanklin, John

2012-01-01

Conjugated linolenic acids (CLNs), 18:3 Δ9,11,13, lack the methylene groups found between the double bonds of linolenic acid (18:3 Δ9,12,15). CLNs are produced by conjugase enzymes that are homologs of the oleate desaturases FAD2. The goal of this study was to map the domain(s) within the Momordica charantia conjugase (FADX) responsible for CLN formation. To achieve this, a series of Momordica FADX-Arabidopsis FAD2 chimeras were expressed in the Arabidopsis fad3fae1 mutant, and the transformed seeds were analyzed for the accumulation of CLN. These experiments identified helix 2 and the first histidine box as a determinant of conjugase product partitioning into punicic acid (18:3 Δ9cis,11trans,13cis) or α-eleostearic acid (18:3 Δ9cis,11trans,13trans). This was confirmed by analysis of a FADX mutant containing six substitutions in which the sequence of helix 2 and first histidine box was converted to that of FAD2. Each of the six FAD2 substitutions was individually converted back to the FADX equivalent identifying residues 111 and 115, adjacent to the first histidine box, as key determinants of conjugase product partitioning. Additionally, expression of FADX G111V and FADX G111V/D115E resulted in an approximate doubling of eleostearic acid accumulation to 20.4% and 21.2%, respectively, compared with 9.9% upon expression of the native Momordica FADX. Like the Momordica conjugase, FADX G111V and FADX D115E produced predominantly α-eleostearic acid and little punicic acid, but the FADX G111V/D115E double mutant produced approximately equal amounts of α-eleostearic acid and its isomer, punicic acid, implicating an interactive effect of residues 111 and 115 in punicic acid formation. PMID:22451660

A modified acetylcholine receptor δ-subunit enables a null mutant to survive beyond sexual maturation

PubMed Central

Epley, Kimberly E.; Urban, Jason M.; Ikenaga, Takanori; Ono, Fumihito

2008-01-01

The contraction of skeletal muscle is dependent upon synaptic transmission through acetylcholine receptors (AChRs) at the neuromuscular junction (NMJ). The lack of an AChR subunit causes a fetal akinesia in humans, leading to death in the first trimester and characteristic features of Fetal Akinesia Deformation Sequences (FADS). A corresponding null mutation of the δ-subunit in zebrafish (sofa potato; sop−/−) leads to the death of embryos around 5 days post-fertilization (dpf). In sop−/− mutants, we expressed modified δ-subunits, with one (δ1YFP) or two yellow fluorescent protein (δ2YFP) molecules fused at the intracellular loop, under the control of an α-actin promoter. AChRs containing these fusion proteins are fluorescent, assemble on the plasma membrane, make clusters under motor neuron endings, and generate synaptic current. We screened for germ-line transmission of the transgene and established a line of sop−/− fish stably expressing the δ2YFP. These δ2YFP/sop−/− embryos can mount escape behavior close to that of their wild type siblings. Synaptic currents in these embryos had a smaller amplitude, slower rise time, and slower decay when compared to wild type fish. Remarkably, these embryos grow to adulthood and display complex behaviors such as feeding and breeding. To the best of our knowledge, this is the first case of a mutant animal corresponding to first trimester lethality in human that has been rescued by a transgene and survived to adulthood. In the rescued fish, a foreign promoter drove the transgene expression and the NMJ had altered synaptic strength. The survival of the transgenic animal delineates requirements for gene therapies of NMJ. PMID:19052214

The effect of NGATHA altered activity on auxin signaling pathways within the Arabidopsis gynoecium

PubMed Central

Martínez-Fernández, Irene; Sanchís, Sofía; Marini, Naciele; Balanzá, Vicente; Ballester, Patricia; Navarrete-Gómez, Marisa; Oliveira, Antonio C.; Colombo, Lucia; Ferrándiz, Cristina

2014-01-01

The four NGATHA genes (NGA) form a small subfamily within the large family of B3-domain transcription factors of Arabidopsis thaliana. NGA genes act redundantly to direct the development of the apical tissues of the gynoecium, the style, and the stigma. Previous studies indicate that NGA genes could exert this function at least partially by directing the synthesis of auxin at the distal end of the developing gynoecium through the upregulation of two different YUCCA genes, which encode flavin monooxygenases involved in auxin biosynthesis. We have compared three developing pistil transcriptome data sets from wildtype, nga quadruple mutants, and a 35S::NGA3 line. The differentially expressed genes showed a significant enrichment for auxin-related genes, supporting the idea of NGA genes as major regulators of auxin accumulation and distribution within the developing gynoecium. We have introduced reporter lines for several of these differentially expressed genes involved in synthesis, transport and response to auxin in NGA gain- and loss-of-function backgrounds. We present here a detailed map of the response of these reporters to NGA misregulation that could help to clarify the role of NGA in auxin-mediated gynoecium morphogenesis. Our data point to a very reduced auxin synthesis in the developing apical gynoecium of nga mutants, likely responsible for the lack of DR5rev::GFP reporter activity observed in these mutants. In addition, NGA altered activity affects the expression of protein kinases that regulate the cellular localization of auxin efflux regulators, and thus likely impact auxin transport. Finally, protein accumulation in pistils of several ARFs was differentially affected by nga mutations or NGA overexpression, suggesting that these accumulation patterns depend not only on auxin distribution but could be also regulated by transcriptional networks involving NGA factors. PMID:24904608

General anesthetic octanol and related compounds activate wild-type and delF508 cystic fibrosis chloride channels

PubMed Central

Marcet, Brice; Becq, Frédéric; Norez, Caroline; Delmas, Patrick; Verrier, Bernard

2004-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) Cl− channel is defective during cystic fibrosis (CF). Activators of the CFTR Cl− channel may be useful for therapy of CF. Here, we demonstrate that a range of general anesthetics like normal-alkanols (n-alkanols) and related compounds can stimulate the Cl− channel activity of wild-type CFTR and delF508-CFTR mutant. The effects of n-alkanols like octanol on CFTR activity were measured by iodide (125I) efflux and patch-clamp techniques on three distinct cellular models: (1) CFTR-expressing Chinese hamster ovary cells, (2) human airway Calu-3 epithelial cells and (3) human airway JME/CF15 epithelial cells which express the delF508-CFTR mutant. Our data show for the first time that n-alkanols activate both wild-type CFTR and delF508-CFTR mutant. Octanol stimulated 125I efflux in a dose-dependent manner in CFTR-expressing cells (wild-type and delF508) but not in cell lines lacking CFTR. 125I efflux and Cl− currents induced by octanol were blocked by glibenclamide but insensitive to 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, as expected for a CFTR Cl− current. CFTR activation by octanol was neither due to cell-to-cell uncoupling properties of octanol nor to an intracellular cAMP increase. CFTR activation by octanol requires phosphorylation by protein kinase-A (PKA) since it was prevented by H-89, a PKA inhibitor. n-Alkanols chain length was an important determinant for channel activation, with rank order of potencies: 1-heptanol<1-octanol<2-octanol<1-decanol. Our findings may be of valuable interest for developing novel therapeutic strategies for CF. PMID:14967738

General anesthetic octanol and related compounds activate wild-type and delF508 cystic fibrosis chloride channels.

PubMed

Marcet, Brice; Becq, Frédéric; Norez, Caroline; Delmas, Patrick; Verrier, Bernard

2004-03-01

1. Cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel is defective during cystic fibrosis (CF). Activators of the CFTR Cl(-) channel may be useful for therapy of CF. Here, we demonstrate that a range of general anesthetics like normal-alkanols (n-alkanols) and related compounds can stimulate the Cl(-) channel activity of wild-type CFTR and delF508-CFTR mutant. 2. The effects of n-alkanols like octanol on CFTR activity were measured by iodide ((125)I) efflux and patch-clamp techniques on three distinct cellular models: (1). CFTR-expressing Chinese hamster ovary cells, (2). human airway Calu-3 epithelial cells and (3). human airway JME/CF15 epithelial cells which express the delF508-CFTR mutant. 3. Our data show for the first time that n-alkanols activate both wild-type CFTR and delF508-CFTR mutant. Octanol stimulated (125)I efflux in a dose-dependent manner in CFTR-expressing cells (wild-type and delF508) but not in cell lines lacking CFTR. (125)I efflux and Cl(-) currents induced by octanol were blocked by glibenclamide but insensitive to 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid, as expected for a CFTR Cl(-) current. 4. CFTR activation by octanol was neither due to cell-to-cell uncoupling properties of octanol nor to an intracellular cAMP increase. CFTR activation by octanol requires phosphorylation by protein kinase-A (PKA) since it was prevented by H-89, a PKA inhibitor. 5. n-Alkanols chain length was an important determinant for channel activation, with rank order of potencies: 1-heptanol<1-octanol<2-octanol<1-decanol. Our findings may be of valuable interest for developing novel therapeutic strategies for CF.

Dexamethasone protection from TNF-alpha-induced cell death in MCF-7 cells requires NF-kappaB and is independent from AKT.

PubMed

Machuca, Catalina; Mendoza-Milla, Criselda; Córdova, Emilio; Mejía, Salvador; Covarrubias, Luis; Ventura, José; Zentella, Alejandro

2006-02-21

The biochemical bases for hormone dependence in breast cancer have been recognized as an important element in tumor resistance, proliferation and metastasis. On this respect, dexamethasone (Dex) dependent protection against TNF-alpha-mediated cell death in the MCF-7 cell line has been demonstrated to be a useful model for the study of this type of cancer. Recently, cytoplasmic signaling induced by steroid receptors has been described, such as the activation of the PI3K/Akt and NF-kappaB pathways. We evaluated their possible participation in the Dex-dependent protection against TNF-alpha-mediated cell death. Cellular cultures of the MCF-7 cell line were exposed to either, TNF-alpha or TNF-alpha and Dex, and cell viability was evaluated. Next, negative dominants of PI3K and IkappaB-alpha, designed to block the PI3K/Akt and NF-kappaB pathways, respectively, were transfected and selection and evaluation of several clones overexpressing the mutants were examined. Also, correlation with inhibitor of apoptosis proteins (IAPs) expression was examined. Independent inhibition of these two pathways allowed us to test their participation in Dex-dependent protection against TNF-alpha-cytotoxicity in MCF-7 cells. Expression of the PI3K dominant negative mutant did not alter the protection conferred by Dex against TNF-alpha mediated cell death. Contrariwise, clones expressing the IkappaB-alpha dominant negative mutant lost the Dex-conferred protection against TNF-alpha. In these clones degradation of c-IAP was accelerated, while that of XIAP was remained unaffected. NF-kappaB, but not PI3K/Akt activation, is required for the Dex protective effect against TNF-alpha-mediated cell death, and correlates with lack of degradation of the anti-apoptotic protein c-IAP1.

Enhanced oxygen consumption in Herbaspirillum seropedicae fnr mutants leads to increased NifA mediated transcriptional activation.

PubMed

Batista, Marcelo Bueno; Wassem, Roseli; Pedrosa, Fábio de Oliveira; de Souza, Emanuel Maltempi; Dixon, Ray; Monteiro, Rose Adele

2015-05-07

Orthologous proteins of the Crp/Fnr family have been previously implicated in controlling expression and/or activity of the NifA transcriptional activator in some diazotrophs. This study aimed to address the role of three Fnr-like proteins from H. seropedicae SmR1 in controlling NifA activity and consequent NifA-mediated transcription activation. The activity of NifA-dependent transcriptional fusions (nifA::lacZ and nifB::lacZ) was analysed in a series of H. seropedicae fnr deletion mutant backgrounds. We found that combined deletions in both the fnr1 and fnr3 genes lead to higher expression of both the nifA and nifB genes and also an increased level of nifH transcripts. Expression profiles of nifB under different oxygen concentrations, together with oxygen consumption measurements suggest that the triple fnr mutant has higher respiratory activity when compared to the wild type, which we believe to be responsible for greater stability of the oxygen sensitive NifA protein. This conclusion was further substantiated by measuring the levels of NifA protein and its activity in fnr deletion strains in comparison with the wild-type. Fnr proteins are indirectly involved in controlling the activity of NifA in H. seropedicae, probably as a consequence of their influence on respiratory activity in relation to oxygen availability. Additionally we can suggest that there is some redundancy in the physiological function of the three Fnr paralogs in this organism, since altered respiration and effects on NifA activity are only observed in deletion strains lacking both fnr1 and fnr3.

FlaA proteins in Leptospira interrogans are essential for motility and virulence but are not required for formation of the flagellum sheath.

PubMed

Lambert, Ambroise; Picardeau, Mathieu; Haake, David A; Sermswan, Rasana W; Srikram, Amporn; Adler, Ben; Murray, Gerald A

2012-06-01

Spirochetes have periplasmic flagella composed of a core surrounded by a sheath. The pathogen Leptospira interrogans has four flaB (proposed core subunit) and two flaA (proposed sheath subunit) genes. The flaA genes are organized in a locus with flaA2 immediately upstream of flaA1. In this study, flaA1 and flaA2 mutants were constructed by transposon mutagenesis. Both mutants still produced periplasmic flagella. The flaA1 mutant did not produce FlaA1 but continued to produce FlaA2 and retained normal morphology and virulence in a hamster model of infection but had reduced motility. The flaA2 mutant did not produce either the FlaA1 or the FlaA2 protein. Cells of the flaA2 mutant lacked the distinctive hook-shaped ends associated with L. interrogans and lacked translational motility in liquid and semisolid media. These observations were confirmed with a second, independent flaA2 mutant. The flaA2 mutant failed to cause disease in animal models of acute infection. Despite lacking FlaA proteins, the flagella of the flaA2 mutant were of the same thickness as wild-type flagella, as measured by electron microscopy, and exhibited a normal flagellum sheath, indicating that FlaA proteins are not essential for the synthesis of the flagellum sheath, as observed for other spirochetes. This study shows that FlaA subunits contribute to leptospiral translational motility, cellular shape, and virulence.

Identification of nuclear genes controlling chlorophyll synthesis in barley by RNA-seq.

PubMed

Shmakov, Nickolay A; Vasiliev, Gennadiy V; Shatskaya, Natalya V; Doroshkov, Alexey V; Gordeeva, Elena I; Afonnikov, Dmitry A; Khlestkina, Elena K

2016-11-16

Albinism in plants is characterized by lack of chlorophyll and results in photosynthesis impairment, abnormal plant development and premature death. These abnormalities are frequently encountered in interspecific crosses and tissue culture experiments. Analysis of albino mutant phenotypes with full or partial chlorophyll deficiency can shed light on genetic determinants and molecular mechanisms of albinism. Here we report analysis of RNA-seq transcription profiling of barley (Hordeum vulgare L.) near-isogenic lines, one of which is a carrier of mutant allele of the Alm gene for albino lemma and pericarp phenotype (line i:BwAlm). 1221 genome fragments have statistically significant changes in expression levels between lines i:BwAlm and Bowman, with 148 fragments having increased expression levels in line i:BwAlm, and 1073 genome fragments, including 42 plastid operons, having decreased levels of expression in line i:BwAlm. We detected functional dissimilarity between genes with higher and lower levels of expression in i:BwAlm line. Genes with lower level of expression in the i:BwAlm line are mostly associated with photosynthesis and chlorophyll synthesis, while genes with higher expression level are functionally associated with vesicle transport. Differentially expressed genes are shown to be involved in several metabolic pathways; the largest fraction of such genes was observed for the Calvin-Benson-Bassham cycle. Finally, de novo assembly of transcriptome contains several transcripts, not annotated in current H. vulgare genome version. Our results provide the new information about genes which could be involved in formation of albino lemma and pericarp phenotype. They demonstrate the interplay between nuclear and chloroplast genomes in this physiological process.

Studies of thermostability in Camelus bactrianus (Bactrian camel) single-domain antibody specific for the mutant epidermal-growth-factor receptor expressed by Pichia.

PubMed

Omidfar, Kobra; Rasaee, Mohhamad Javad; Kashanian, Soheila; Paknejad, Malieheh; Bathaie, Zahra

2007-01-01

Camelids have a unique immune system capable of producing heavy-chain antibodies lacking the light chains and CH1 (constant heavy-chain domain 1). It has been shown that, in contrast with conventional antibody fragments, the variable domains of these heavy-chain antibodies are functional at or after exposure to high temperatures. In the present study, the VHH (variable domain of heavy-chain antibody) camel antibody was subcloned into vector Ppiczc and expressed in Pichia pastoris. ORB1-83 VHH antibody recognizes the external domain of the mutant EGFR [EGF (epidermal growth factor) receptor], EGFR VIII. This tumour-specific antigen is ligand-independent, contains a constitutively active tyrosine kinase domain and has been shown to be present in a number of human malignancies. We report here that, although expression from P. pastoris resulted in a significantly increased level of expression of the anti-EGFR VIII VHH antibodies compared with Escherichia coli [Omidfar, Rasaee, Modjtahedi, Forouzandeh, Taghikhani, Bakhtiari, Paknejad and Kashanian (2004) Tumor Biol. 25, 179-187; Omidfar, Rasaee, Modjtahedi, Forouzandeh, Taghikhani and Golmakany (2004) Tumor Biol. 25, 296-305], this antibody selectively bound to the EGFR VIII peptide and reacted specifically with the immunoaffinity-purified antigen from non-small-cell lung cancer. Furthermore, thermal denaturation stability and CD spectra analysis of the Camelus bactrianus (Bactrian camel) VHH and heavy-chain antibodies at different temperature proved reversibility and binding activity after heat denaturation. Our results indicate that the P. pastoris expression system may be useful for the expression of camel single domain antibody and the ability of the expressed protein to reversibly melt without aggregation, allowing it to regain binding activity after heat denaturation.

Reconstitution of a secondary cell wall in a secondary cell wall-deficient Arabidopsis mutant.

PubMed

Sakamoto, Shingo; Mitsuda, Nobutaka

2015-02-01

The secondary cell wall constitutes a rigid frame of cells in plant tissues where rigidity is required. Deposition of the secondary cell wall in fiber cells contributes to the production of wood in woody plants. The secondary cell wall is assembled through co-operative activities of many enzymes, and their gene expression is precisely regulated by a pyramidal cascade of transcription factors. Deposition of a transmuted secondary cell wall in empty fiber cells by expressing selected gene(s) in this cascade has not been attempted previously. In this proof-of-concept study, we expressed chimeric activators of 24 transcription factors that are preferentially expressed in the stem, in empty fiber cells of the Arabidopsis nst1-1 nst3-1 double mutant, which lacks a secondary cell wall in fiber cells, under the control of the NST3 promoter. The chimeric activators of MYB46, SND2 and ANAC075, as well as NST3, reconstituted a secondary cell wall with different characteristics from those of the wild type in terms of its composition. The transgenic lines expressing the SND2 or ANAC075 chimeric activator showed increased glucose and xylose, and lower lignin content, whereas the transgenic line expressing the MYB46 chimeric activator showed increased mannose content. The expression profile of downstream genes in each transgenic line was also different from that of the wild type. This study proposed a new screening strategy to identify factors of secondary wall formation and also suggested the potential of the artificially reconstituted secondary cell walls as a novel raw material for production of bioethanol and other chemicals. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

Roles of brca2 (fancd1) in oocyte nuclear architecture, gametogenesis, gonad tumors, and genome stability in zebrafish.

PubMed

Rodríguez-Marí, Adriana; Wilson, Catherine; Titus, Tom A; Cañestro, Cristian; BreMiller, Ruth A; Yan, Yi-Lin; Nanda, Indrajit; Johnston, Adam; Kanki, John P; Gray, Erin M; He, Xinjun; Spitsbergen, Jan; Schindler, Detlev; Postlethwait, John H

2011-03-01

Mild mutations in BRCA2 (FANCD1) cause Fanconi anemia (FA) when homozygous, while severe mutations cause common cancers including breast, ovarian, and prostate cancers when heterozygous. Here we report a zebrafish brca2 insertional mutant that shares phenotypes with human patients and identifies a novel brca2 function in oogenesis. Experiments showed that mutant embryos and mutant cells in culture experienced genome instability, as do cells in FA patients. In wild-type zebrafish, meiotic cells expressed brca2; and, unexpectedly, transcripts in oocytes localized asymmetrically to the animal pole. In juvenile brca2 mutants, oocytes failed to progress through meiosis, leading to female-to-male sex reversal. Adult mutants became sterile males due to the meiotic arrest of spermatocytes, which then died by apoptosis, followed by neoplastic proliferation of gonad somatic cells that was similar to neoplasia observed in ageing dead end (dnd)-knockdown males, which lack germ cells. The construction of animals doubly mutant for brca2 and the apoptotic gene tp53 (p53) rescued brca2-dependent sex reversal. Double mutants developed oocytes and became sterile females that produced only aberrant embryos and showed elevated risk for invasive ovarian tumors. Oocytes in double-mutant females showed normal localization of brca2 and pou5f1 transcripts to the animal pole and vasa transcripts to the vegetal pole, but had a polarized rather than symmetrical nucleus with the distribution of nucleoli and chromosomes to opposite nuclear poles; this result revealed a novel role for Brca2 in establishing or maintaining oocyte nuclear architecture. Mutating tp53 did not rescue the infertility phenotype in brca2 mutant males, suggesting that brca2 plays an essential role in zebrafish spermatogenesis. Overall, this work verified zebrafish as a model for the role of Brca2 in human disease and uncovered a novel function of Brca2 in vertebrate oocyte nuclear architecture.

Roles of brca2 (fancd1) in Oocyte Nuclear Architecture, Gametogenesis, Gonad Tumors, and Genome Stability in Zebrafish

PubMed Central

Rodríguez-Marí, Adriana; Wilson, Catherine; Titus, Tom A.; Cañestro, Cristian; BreMiller, Ruth A.; Yan, Yi-Lin; Nanda, Indrajit; Johnston, Adam; Kanki, John P.; Gray, Erin M.; He, Xinjun; Spitsbergen, Jan; Schindler, Detlev; Postlethwait, John H.

2011-01-01

Mild mutations in BRCA2 (FANCD1) cause Fanconi anemia (FA) when homozygous, while severe mutations cause common cancers including breast, ovarian, and prostate cancers when heterozygous. Here we report a zebrafish brca2 insertional mutant that shares phenotypes with human patients and identifies a novel brca2 function in oogenesis. Experiments showed that mutant embryos and mutant cells in culture experienced genome instability, as do cells in FA patients. In wild-type zebrafish, meiotic cells expressed brca2; and, unexpectedly, transcripts in oocytes localized asymmetrically to the animal pole. In juvenile brca2 mutants, oocytes failed to progress through meiosis, leading to female-to-male sex reversal. Adult mutants became sterile males due to the meiotic arrest of spermatocytes, which then died by apoptosis, followed by neoplastic proliferation of gonad somatic cells that was similar to neoplasia observed in ageing dead end (dnd)-knockdown males, which lack germ cells. The construction of animals doubly mutant for brca2 and the apoptotic gene tp53 (p53) rescued brca2-dependent sex reversal. Double mutants developed oocytes and became sterile females that produced only aberrant embryos and showed elevated risk for invasive ovarian tumors. Oocytes in double-mutant females showed normal localization of brca2 and pou5f1 transcripts to the animal pole and vasa transcripts to the vegetal pole, but had a polarized rather than symmetrical nucleus with the distribution of nucleoli and chromosomes to opposite nuclear poles; this result revealed a novel role for Brca2 in establishing or maintaining oocyte nuclear architecture. Mutating tp53 did not rescue the infertility phenotype in brca2 mutant males, suggesting that brca2 plays an essential role in zebrafish spermatogenesis. Overall, this work verified zebrafish as a model for the role of Brca2 in human disease and uncovered a novel function of Brca2 in vertebrate oocyte nuclear architecture. PMID:21483806

Three alpha-subunits of heterotrimeric G proteins and an adenylyl cyclase have distinct roles in fruiting body development in the homothallic fungus Sordaria macrospora.

PubMed

Kamerewerd, Jens; Jansson, Malin; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

2008-09-01

Sordaria macrospora, a self-fertile filamentous ascomycete, carries genes encoding three different alpha-subunits of heterotrimeric G proteins (gsa, G protein Sordaria alpha subunit). We generated knockout strains for all three gsa genes (Deltagsa1, Deltagsa2, and Deltagsa3) as well as all combinations of double mutants. Phenotypic analysis of single and double mutants showed that the genes for Galpha-subunits have distinct roles in the sexual life cycle. While single mutants show some reduction of fertility, double mutants Deltagsa1Deltagsa2 and Deltagsa1Deltagsa3 are completely sterile. To test whether the pheromone receptors PRE1 and PRE2 mediate signaling via distinct Galpha-subunits, two recently generated Deltapre strains were crossed with all Deltagsa strains. Analyses of the corresponding double mutants revealed that compared to GSA2, GSA1 is a more predominant regulator of a signal transduction cascade downstream of the pheromone receptors and that GSA3 is involved in another signaling pathway that also contributes to fruiting body development and fertility. We further isolated the gene encoding adenylyl cyclase (AC) (sac1) for construction of a knockout strain. Analyses of the three DeltagsaDeltasac1 double mutants and one Deltagsa2Deltagsa3Deltasac1 triple mutant indicate that SAC1 acts downstream of GSA3, parallel to a GSA1-GSA2-mediated signaling pathway. In addition, the function of STE12 and PRO41, two presumptive signaling components, was investigated in diverse double mutants lacking those developmental genes in combination with the gsa genes. This analysis was further completed by expression studies of the ste12 and pro41 transcripts in wild-type and mutant strains. From the sum of all our data, we propose a model for how different Galpha-subunits interact with pheromone receptors, adenylyl cyclase, and STE12 and thus cooperatively regulate sexual development in S. macrospora.

Control of lens development by Lhx2-regulated neuroretinal FGFs

PubMed Central

Thein, Thuzar; de Melo, Jimmy; Zibetti, Cristina; Clark, Brian S.; Juarez, Felicia

2016-01-01

Fibroblast growth factor (FGF) signaling is an essential regulator of lens epithelial cell proliferation and survival, as well as lens fiber cell differentiation. However, the identities of these FGF factors, their source tissue and the genes that regulate their synthesis are unknown. We have found that Chx10-Cre;Lhx2lox/lox mice, which selectively lack Lhx2 expression in neuroretina from E10.5, showed an early arrest in lens fiber development along with severe microphthalmia. These mutant animals showed reduced expression of multiple neuroretina-expressed FGFs and canonical FGF-regulated genes in neuroretina. When FGF expression was genetically restored in Lhx2-deficient neuroretina of Chx10-Cre;Lhx2lox/lox mice, we observed a partial but nonetheless substantial rescue of the defects in lens cell proliferation, survival and fiber differentiation. These data demonstrate that neuroretinal expression of Lhx2 and neuroretina-derived FGF factors are crucial for lens fiber development in vivo. PMID:27633990

The C. elegans neural editome reveals an ADAR target mRNA required for proper chemotaxis

PubMed Central

Deffit, Sarah N; Yee, Brian A; Manning, Aidan C; Rajendren, Suba; Vadlamani, Pranathi; Wheeler, Emily C; Domissy, Alain; Washburn, Michael C

2017-01-01

ADAR proteins alter gene expression both by catalyzing adenosine (A) to inosine (I) RNA editing and binding to regulatory elements in target RNAs. Loss of ADARs affects neuronal function in all animals studied to date. Caenorhabditis elegans lacking ADARs exhibit reduced chemotaxis, but the targets responsible for this phenotype remain unknown. To identify critical neural ADAR targets in C. elegans, we performed an unbiased assessment of the effects of ADR-2, the only A-to-I editing enzyme in C. elegans, on the neural transcriptome. Development and implementation of publicly available software, SAILOR, identified 7361 A-to-I editing events across the neural transcriptome. Intersecting the neural editome with adr-2 associated gene expression changes, revealed an edited mRNA, clec-41, whose neural expression is dependent on deamination. Restoring clec-41 expression in adr-2 deficient neural cells rescued the chemotaxis defect, providing the first evidence that neuronal phenotypes of ADAR mutants can be caused by altered gene expression. PMID:28925356

Genetically engineered mutant of the cyanobacterium Synechocystis 6803 lacks the photosystem II chlorophyll-binding protein CP-47

PubMed Central

Vermaas, Wim F. J.; Williams, John G. K.; Rutherford, A. William; Mathis, Paul; Arntzen, Charles J.

1986-01-01

CP-47 is absent in a genetically engineered mutant of cyanobacterium Synechocystis 6803, in which the psbB gene [encoding the chlorophyll-binding photosystem II (PSII) protein CP-47] was interrupted. Another chlorophyll-binding PSII protein, CP-43, is present in the mutant, and functionally inactive PSII-enriched particles can be isolated from mutant thylakoids. We interpret these data as indicating that the PSII core complex of the mutant still assembles in the absence of CP-47. The mutant lacks a 77 K fluorescence emission maximum at 695 nm, suggesting that the PSII reaction center is not functional. The absence of primary photochemistry was indicated by EPR and optical measurements: no chlorophyll triplet originating from charge recombination between P680+ and Pheo- was observed in the mutant, and there were no flash-induced absorption changes at 820 nm attributable to chlorophyll P680 oxidation. These observations lead us to conclude that CP-47 plays an essential role in the activity of the PSII reaction center. Images PMID:16593788

Genetic separation of phototropism and blue light inhibition of stem elongation

NASA Technical Reports Server (NTRS)

Liscum, E.; Young, J. C.; Poff, K. L.; Hangarter, R. P.

1992-01-01

Blue light-induced regulation of cell elongation is a component of the signal response pathway for both phototropic curvature and inhibition of stem elongation in higher plants. To determine if blue light regulates cell elongation in these responses through shared or discrete pathways, phototropism and hypocotyl elongation were investigated in several blue light response mutants in Arabidopsis thaliana. Specifically, the blu mutants that lack blue light-dependent inhibition of hypocotyl elongation were found to exhibit a normal phototropic response. In contrast, a phototropic null mutant (JK218) and a mutant that has a 20- to 30-fold shift in the fluence dependence for first positive phototropism (JK224) showed normal inhibition of hypocotyl elongation in blue light. F1 progeny of crosses between the blu mutants and JK218 showed normal phototropism and inhibition of hypocotyl elongation, and approximately 1 in 16 F2 progeny were double mutants lacking both responses. Thus, blue light-dependent inhibition of hypocotyl elongation and phototropism operate through at least some genetically distinct components.

A gain-of-function mutation of plastidic invertase alters nuclear gene expression with sucrose treatment partially via GENOMES UNCOUPLED1-mediated signaling.

PubMed

Maruta, Takanori; Miyazaki, Nozomi; Nosaka, Ryota; Tanaka, Hiroyuki; Padilla-Chacon, Daniel; Otori, Kumi; Kimura, Ayako; Tanabe, Noriaki; Yoshimura, Kazuya; Tamoi, Masahiro; Shigeoka, Shigeru

2015-05-01

Plastid gene expression (PGE) is one of the signals that regulate the expression of photosynthesis-associated nuclear genes (PhANGs) via GENOMES UNCOUPLED1 (GUN1)-dependent retrograde signaling. We recently isolated Arabidopsis sugar-inducible cotyledon yellow-192 (sicy-192), a gain-of-function mutant of plastidic invertase, and showed that following the treatment of this mutant with sucrose, the expression of PhANGs as well as PGE decreased, suggesting that the sicy-192 mutation activates a PGE-evoked and GUN1-mediated retrograde pathway. To clarify the relationship between the sicy-192 mutation, PGE, and GUN1-mediated pathway, plastid and nuclear gene expression in a double mutant of sicy-192 and gun1-101, a null mutant of GUN1 was studied. Plastid-encoded RNA polymerase (PEP)-dependent PGE was markedly suppressed in the sicy-192 mutant by the sucrose treatment, but the suppression as well as cotyledon yellow phenotype was not mitigated by GUN1 disruption. Microarray analysis revealed that the altered expression of nuclear genes such as PhANG in the sucrose-treated sicy-192 mutant was largely dependent on GUN1. The present findings demonstrated that the sicy-192 mutation alters nuclear gene expression with sucrose treatment via GUN1, which is possibly followed by inhibiting PEP-dependent PGE, providing a new insight into the role of plastid sugar metabolism in nuclear gene expression. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Bcl-2 Blocks a Caspase-Dependent Pathway of Apoptosis Activated by Herpes Simplex Virus 1 Infection in HEp-2 Cells

PubMed Central

Galvan, Veronica; Brandimarti, Renato; Munger, Joshua; Roizman, Bernard

2000-01-01

Earlier reports have shown that herpes simplex virus 1 (HSV-1) mutants induce programmed cell death and that wild-type virus blocks the execution of the cell death program triggered by expression of viral genes, by the Fas and tumor necrosis factor pathways, or by nonspecific stress agents. In particular, an earlier report from this laboratory showed that the mutant virus d120 lacking the genes encoding infected cell protein 4 (ICP4), the major regulatory protein of the virus, induces a caspase-3-independent pathway of apoptosis in human SK-N-SH cells. Here we report that the pathway of apoptosis induced by the d120 mutant in human HEp-2 cells is caspase dependent. Specifically, in HEp-2 cells infected with d120, (i) a broad-range inhibitor of caspase activity, z-vad-FMK, efficiently blocked DNA fragmentation, (ii) cytochrome c was released into the cytoplasm, (iii) caspase-3 was activated inasmuch as poly(ADP-ribose) polymerase was cleaved, and (iv) chromatin condensation and fragmentation of cellular DNA were observed. In parallel studies, HEp-2 cells were transfected with a plasmid encoding human Bcl-2 and a clone (VAX-3) expressing high levels of Bcl-2 was selected. This report shows that Bcl-2 blocked all of the manifestations associated with programmed cell death caused by infection with the d120 mutant. Consistent with their resistance to programmed cell death, VAX-3 cells overproduced infected cell protein 0 (ICP0). An unexpected observation was that ICP0 encoded by the d120 mutant accumulated late in infection in small, quasi-uniform vesicle-like structures in all cell lines tested. Immunofluorescence-based colocalization studies indicated that these structures were not mitochondria or components of the endoplasmic reticulum or the late endosomal compartment. These studies affirm the conclusion that HSV can induce programmed cell death at multiple steps in the course of its replication, that the d120 mutant can induce both caspase-dependent and -independent pathways of programmed cell death, and that virus-induced stimuli of programmed cell death may differ with respect to the pathway that they activate. PMID:10644366

Evaluation of the effects of sdiA, a luxR homologue, on adherence and motility of Escherichia coli O157 : H7.

PubMed

Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L

2010-05-01

Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.

The Phosphorylated Pathway of Serine Biosynthesis Is Essential Both for Male Gametophyte and Embryo Development and for Root Growth in Arabidopsis[W

PubMed Central

Cascales-Miñana, Borja; Muñoz-Bertomeu, Jesús; Flores-Tornero, María; Anoman, Armand Djoro; Pertusa, José; Alaiz, Manuel; Osorio, Sonia; Fernie, Alisdair R.; Segura, Juan; Ros, Roc

2013-01-01

This study characterizes the phosphorylated pathway of Ser biosynthesis (PPSB) in Arabidopsis thaliana by targeting phosphoserine phosphatase (PSP1), the last enzyme of the pathway. Lack of PSP1 activity delayed embryo development, leading to aborted embryos that could be classified as early curled cotyledons. The embryo-lethal phenotype of psp1 mutants could be complemented with PSP1 cDNA under the control of Pro35S (Pro35S:PSP1). However, this construct, which was poorly expressed in the anther tapetum, did not complement mutant fertility. Microspore development in psp1.1/psp1.1 Pro35S:PSP1 arrested at the polarized stage. The tapetum from these lines displayed delayed and irregular development. The expression of PSP1 in the tapetum at critical stages of microspore development suggests that PSP1 activity in this cell layer is essential in pollen development. In addition to embryo death and male sterility, conditional psp1 mutants displayed a short-root phenotype, which was reverted in the presence of Ser. A metabolomic study demonstrated that the PPSB plays a crucial role in plant metabolism by affecting glycolysis, the tricarboxylic acid cycle, and the biosynthesis of amino acids. We provide evidence of the crucial role of the PPSB in embryo, pollen, and root development and suggest that this pathway is an important link connecting primary metabolism with development. PMID:23771893

Thymidine kinases share a conserved function for nucleotide salvage and play an essential role in Arabidopsis thaliana growth and development.

PubMed

Xu, Jing; Zhang, Lin; Yang, Dong-Lei; Li, Qun; He, Zuhua

2015-12-01

Thymidine kinases (TKs) are important components in the nucleotide salvage pathway. However, knowledge about plant TKs is quite limited. In this study, the molecular function of TKs in Arabidopsis thaliana was investigated. Two TKs were identified and named AtTK1 and AtTK2. Expression of both genes was ubiquitous, but AtTK1 was strongly expressed in high-proliferation tissues. AtTK1 was localized to the cytosol, whereas AtTK2 was localized to the mitochondria. Mutant analysis indicated that the two genes function coordinately to sustain normal plant development. Enzymatic assays showed that the two TK proteins shared similar catalytic specificity for pyrimidine nucleosides. They were able to complement an Escherichia coli strain lacking TK activity. 5'-Fluorodeoxyuridine (FdU) resistance and 5-ethynyl 2'-deoxyuridine (EdU) incorporation assays confirmed their activity in vivo. Furthermore, the tk mutant phenotype could be alleviated by nucleotide feeding, establishing that the biosynthesis of pyrimidine nucleotides was disrupted by the TK deficiency. Finally, both human and rice (Oryza sativa) TKs were able to rescue the tk mutants, demonstrating the functional conservation of TKs across organisms. Taken together, our findings clarify the specialized function of two TKs in A. thaliana and establish that the salvage pathway mediated by the kinases is essential for plant growth and development. © 2015 Institute of Plant Physiology and Ecology, SIBS, CAS New Phytologist © 2015 New Phytologist Trust.

The intracellular carboxyl tail of the PAR-2 receptor controls intracellular signaling and cell death.

PubMed

Zhu, Zhihui; Stricker, Rolf; Li, Rong yu; Zündorf, Gregor; Reiser, Georg

2015-03-01

The protease-activated receptors are a group of unique G protein-coupled receptors, including PAR-1, PAR-2, PAR-3 and PAR-4. PAR-2 is activated by multiple trypsin-like serine proteases, including trypsin, tryptase and coagulation proteases. The clusters of phosphorylation sites in the PAR-2 carboxyl tail are suggested to be important for the binding of adaptor proteins to initiate intracellular signaling to Ca(2+) and mitogen-activated protein kinases. To explore the functional role of PAR-2 carboxyl tail in controlling intracellular Ca(2+), ERK and AKT signaling, a series of truncated mutants containing different clusters of serines/threonines were generated and expressed in HEK293 cells. Firstly, we observed that lack of the complete C-terminus of PAR-2 in a mutated receptor gave a relatively low level of localization on the cell plasma membrane. Secondly, the shortened carboxyl tail containing 13 amino acids was sufficient for receptor internalization. Thirdly, the cells expressing truncation mutants showed deficits in their capacity to couple to intracellular Ca(2+) and ERK and AKT signaling upon trypsin challenge. In addition, HEK293 cells carrying different PAR-2 truncation mutants displayed decreased levels of cell survival after long-lasting trypsin stimulation. In summary, the PAR-2 carboxyl tail was found to control the receptor localization, internalization, intracellular Ca(2+) responses and signaling to ERK and AKT. The latter can be considered to be important for cell death control.

Inactivation of thyA in Staphylococcus aureus Attenuates Virulence and Has a Strong Impact on Metabolism and Virulence Gene Expression

PubMed Central

Kriegeskorte, Andre; Block, Desiree; Drescher, Mike; Windmüller, Nadine; Mellmann, Alexander; Baum, Cathrin; Neumann, Claudia; Lorè, Nicola Ivan; Bragonzi, Alessandra; Liebau, Eva; Hertel, Patrick; Seggewiss, Jochen; Becker, Karsten; Proctor, Richard A.; Peters, Georg

2014-01-01

ABSTRACT Staphylococcus aureus thymidine-dependent small-colony variants (TD-SCVs) are frequently isolated from patients with chronic S. aureus infections after long-term treatment with trimethoprim-sulfamethoxazole (TMP-SMX). While it has been shown that TD-SCVs were associated with mutations in thymidylate synthase (TS; thyA), the impact of such mutations on protein function is lacking. In this study, we showed that mutations in thyA were leading to inactivity of TS proteins, and TS inactivity led to tremendous impact on S. aureus physiology and virulence. Whole DNA microarray analysis of the constructed ΔthyA mutant identified severe alterations compared to the wild type. Important virulence regulators (agr, arlRS, sarA) and major virulence determinants (hla, hlb, sspAB, and geh) were downregulated, while genes important for colonization (fnbA, fnbB, spa, clfB, sdrC, and sdrD) were upregulated. The expression of genes involved in pyrimidine and purine metabolism and nucleotide interconversion changed significantly. NupC was identified as a major nucleoside transporter, which supported growth of the mutant during TMP-SMX exposure by uptake of extracellular thymidine. The ΔthyA mutant was strongly attenuated in virulence models, including a Caenorhabditis elegans killing model and an acute pneumonia mouse model. This study identified inactivation of TS as the molecular basis of clinical TD-SCV and showed that thyA activity has a major role for S. aureus virulence and physiology. PMID:25073642

Lack of Cdkl5 Disrupts the Organization of Excitatory and Inhibitory Synapses and Parvalbumin Interneurons in the Primary Visual Cortex

PubMed Central

Pizzo, Riccardo; Gurgone, Antonia; Castroflorio, Enrico; Amendola, Elena; Gross, Cornelius; Sassoè-Pognetto, Marco; Giustetto, Maurizio

2016-01-01

Cyclin-dependent kinase-like 5 (CDKL5) mutations are found in severe neurodevelopmental disorders, including the Hanefeld variant of Rett syndrome (RTT; CDKL5 disorder). CDKL5 loss-of-function murine models recapitulate pathological signs of the human disease, such as visual attention deficits and reduced visual acuity. Here we investigated the cellular and synaptic substrates of visual defects by studying the organization of the primary visual cortex (V1) of Cdkl5−/y mice. We found a severe reduction of c-Fos expression in V1 of Cdkl5−/y mutants, suggesting circuit hypoactivity. Glutamatergic presynaptic structures were increased, but postsynaptic PSD-95 and Homer were significantly downregulated in CDKL5 mutants. Interneurons expressing parvalbumin, but not other types of interneuron, had a higher density in mutant V1, and were hyperconnected with pyramidal neurons. Finally, the developmental trajectory of pavalbumin-containing cells was also affected in Cdkl5−/y mice, as revealed by fainter appearance perineuronal nets at the closure of the critical period (CP). The present data reveal an overall disruption of V1 cellular and synaptic organization that may cause a shift in the excitation/inhibition balance likely to underlie the visual deficits characteristic of CDKL5 disorder. Moreover, ablation of CDKL5 is likely to tamper with the mechanisms underlying experience-dependent refinement of cortical circuits during the CP of development. PMID:27965538

Glutathione oxidation in response to intracellular H2O2: Key but overlapping roles for dehydroascorbate reductases.

PubMed

Rahantaniaina, Marie-Sylviane; Li, Shengchun; Chatel-Innocenti, Gilles; Tuzet, Andrée; Mhamdi, Amna; Vanacker, Hélène; Noctor, Graham

2017-08-03

Glutathione is a pivotal molecule in oxidative stress, during which it is potentially oxidized by several pathways linked to H 2 O 2 detoxification. We have investigated the response and functional importance of 3 potential routes for glutathione oxidation pathways mediated by glutathione S-transferases (GST), glutaredoxin-dependent peroxiredoxins (PRXII), and dehydroascorbate reductases (DHAR) in Arabidopsis during oxidative stress. Loss-of-function gstU8, gstU24, gstF8, prxIIE and prxIIF mutants as well as double gstU8 gstU24, gstU8 gstF8, gstU24 gstF8, prxIIE prxIIF mutants were obtained. No mutant lines showed marked changes in their phenotype and glutathione profiles in comparison to the wild-type plants in either optimal conditions or oxidative stress triggered by catalase inhibition. By contrast, multiple loss of DHAR functions markedly decreased glutathione oxidation triggered by catalase deficiency. To assess whether this effect was mediated directly by loss of DHAR enzyme activity, or more indirectly by upregulation of other enzymes involved in glutathione and ascorbate recycling, we measured expression of glutathione reductase (GR) and expression and activity of monodehydroascorbate reductases (MDHAR). No evidence was obtained that either GRs or MDHARs were upregulated in plants lacking DHAR function. Hence, interplay between different DHARs appears to be necessary to couple ascorbate and glutathione pools and to allow glutathione-related signaling during enhanced H 2 O 2 metabolism.

N-Glycans on the Rift Valley Fever Virus Envelope Glycoproteins Gn and Gc Redundantly Support Viral Infection via DC-SIGN.

PubMed

Phoenix, Inaia; Nishiyama, Shoko; Lokugamage, Nandadeva; Hill, Terence E; Huante, Matthew B; Slack, Olga A L; Carpio, Victor H; Freiberg, Alexander N; Ikegami, Tetsuro

2016-05-23

Rift Valley fever is a mosquito-transmitted, zoonotic disease that infects humans and ruminants. Dendritic cell specific intercellular adhesion molecule 3 (ICAM-3) grabbing non-integrin (DC-SIGN) acts as a receptor for members of the phlebovirus genus. The Rift Valley fever virus (RVFV) glycoproteins (Gn/Gc) encode five putative N-glycan sequons (asparagine (N)-any amino acid (X)-serine (S)/threonine (T)) at positions: N438 (Gn), and N794, N829, N1035, and N1077 (Gc). The N-glycosylation profile and significance in viral infection via DC-SIGN have not been elucidated. Gc N-glycosylation was first evaluated by using Gc asparagine (N) to glutamine (Q) mutants. Subsequently, we generated a series of recombinant RVFV MP-12 strain mutants, which encode N-to-Q mutations, and the infectivity of each mutant in Jurkat cells stably expressing DC-SIGN was evaluated. Results showed that Gc N794, N1035, and N1077 were N-glycosylated but N829 was not. Gc N1077 was heterogeneously N-glycosylated. RVFV Gc made two distinct N-glycoforms: "Gc-large" and "Gc-small", and N1077 was responsible for "Gc-large" band. RVFV showed increased infection of cells expressing DC-SIGN compared to cells lacking DC-SIGN. Infection via DC-SIGN was increased in the presence of either Gn N438 or Gc N1077. Our study showed that N-glycans on the Gc and Gn surface glycoproteins redundantly support RVFV infection via DC-SIGN.