Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

PubMed

van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

1997-05-01

We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

Structural and genetic analysis of a mutant of Rhodobacter sphaeroides WS8 deficient in hook length control.

PubMed Central

González-Pedrajo, B; Ballado, T; Campos, A; Sockett, R E; Camarena, L; Dreyfus, G

1997-01-01

Motility in the photosynthetic bacterium Rhodobacter sphaeroides is achieved by the unidirectional rotation of a single subpolar flagellum. In this study, transposon mutagenesis was used to obtain nonmotile flagellar mutants from this bacterium. We report here the isolation and characterization of a mutant that shows a polyhook phenotype. Morphological characterization of the mutant was done by electron microscopy. Polyhooks were obtained by shearing and were used to purify the hook protein monomer (FlgE). The apparent molecular mass of the hook protein was 50 kDa. N-terminal amino acid sequencing and comparisons with the hook proteins of other flagellated bacteria indicated that the Rhodobacter hook protein has consensus sequences common to axial flagellar components. A 25-kb fragment from an R. sphaeroides WS8 cosmid library restored wild-type flagellation and motility to the mutant. Using DNA adjacent to the inserted transposon as a probe, we identified a 4.6-kb SalI restriction fragment that contained the gene responsible for the polyhook phenotype. Nucleotide sequence analysis of this region revealed an open reading frame with a deduced amino acid sequence that was 23.4% identical to that of FliK of Salmonella typhimurium, the polypeptide responsible for hook length control in that enteric bacterium. The relevance of a gene homologous to fliK in the uniflagellated bacterium R. sphaeroides is discussed. PMID:9352903

Prevalence of precore-defective mutant of hepatitis B virus in HBV carriers.

PubMed

Niitsuma, H; Ishii, M; Saito, Y; Miura, M; Kobayashi, K; Ohori, H; Toyota, T

1995-08-01

Two hundred and seventy-three serum specimens from hepatitis B virus (HBV) carriers were examined for the presence of a characteristic one point mutation at nucleotide (nt) 1896 from the EcoRI site of the HBV genome in the precore region (the preC mutant) using restriction fragment length polymorphism (RFLP) analysis. This assay approach could detect preC mutants or wild-type sequences when either form constituted more than 10% of the total sample. Overall, 65.5% (76/116) of HBeAg-positive carriers had only the preC wild-type. All HBeAg-positive asymptomatic carriers (n = 14) had only the preC wild-type. In patients with chronic hepatitis B and in anti-HBe-positive asymptomatic carriers, increased prevalence of the preC mutant was associated with the development of anti-HBe antibodies and normalization of the serum alanine aminotransferase concentration. Furthermore, 27 (29.0%) of 93 HBeAg-negative carriers had unexpectedly preC wild-type sequences only. Direct sequencing of the HBV precore region of HBV specimens from 24 patients revealed no mutation at nt 1896, supporting the specificity of the RFLP analysis. These results suggest that RFLP analysis was accurate for the detection of the preC mutation and that the absence of serum HBeAg cannot be explained solely by the dominance of the preC mutant.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Guotian; Jain, Rashmi; Chern, Mawsheng

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportionmore » of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. In conclusion, this work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations.« less

Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto.

PubMed

Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

2017-01-01

Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.

Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto

PubMed Central

Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

2017-01-01

Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3’UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3’UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3’UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo. PMID:28253363

Transcriptome Sequencing of Gracilariopsis lemaneiformis to Analyze the Genes Related to Optically Active Phycoerythrin Synthesis.

PubMed

Huang, Xiaoyun; Zang, Xiaonan; Wu, Fei; Jin, Yuming; Wang, Haitao; Liu, Chang; Ding, Yating; He, Bangxiang; Xiao, Dongfang; Song, Xinwei; Liu, Zhu

2017-01-01

Gracilariopsis lemaneiformis (aka Gracilaria lemaneiformis) is a red macroalga rich in phycoerythrin, which can capture light efficiently and transfer it to photosystemⅡ. However, little is known about the synthesis of optically active phycoerythrinin in G. lemaneiformis at the molecular level. With the advent of high-throughput sequencing technology, analysis of genetic information for G. lemaneiformis by transcriptome sequencing is an effective means to get a deeper insight into the molecular mechanism of phycoerythrin synthesis. Illumina technology was employed to sequence the transcriptome of two strains of G. lemaneiformis- the wild type and a green-pigmented mutant. We obtained a total of 86915 assembled unigenes as a reference gene set, and 42884 unigenes were annotated in at least one public database. Taking the above transcriptome sequencing as a reference gene set, 4041 differentially expressed genes were screened to analyze and compare the gene expression profiles of the wild type and green mutant. By GO and KEGG pathway analysis, we concluded that three factors, including a reduction in the expression level of apo-phycoerythrin, an increase of chlorophyll light-harvesting complex synthesis, and reduction of phycoerythrobilin by competitive inhibition, caused the reduction of optically active phycoerythrin in the green-pigmented mutant.

Ultrasensitive Quantification of Hepatitis B Virus A1762T/G1764A Mutant by a SimpleProbe PCR Using a Wild-Type-Selective PCR Blocker and a Primer-Blocker-Probe Partial-Overlap Approach ▿

PubMed Central

Nie, Hui; Evans, Alison A.; London, W. Thomas; Block, Timothy M.; Ren, Xiangdong David

2011-01-01

Hepatitis B virus (HBV) carrying the A1762T/G1764A double mutation in the basal core promoter (BCP) region is associated with HBe antigen seroconversion and increased risk of liver cirrhosis and hepatocellular carcinoma (HCC). Quantification of the mutant viruses may help in predicting the risk of HCC. However, the viral genome tends to have nucleotide polymorphism, which makes it difficult to design hybridization-based assays including real-time PCR. Ultrasensitive quantification of the mutant viruses at the early developmental stage is even more challenging, as the mutant is masked by excessive amounts of the wild-type (WT) viruses. In this study, we developed a selective inhibitory PCR (siPCR) using a locked nucleic acid-based PCR blocker to selectively inhibit the amplification of the WT viral DNA but not the mutant DNA. At the end of siPCR, the proportion of the mutant could be increased by about 10,000-fold, making the mutant more readily detectable by downstream applications such as real-time PCR and DNA sequencing. We also describe a primer-probe partial overlap approach which significantly simplified the melting curve patterns and minimized the influence of viral genome polymorphism on assay accuracy. Analysis of 62 patient samples showed a complete match of the melting curve patterns with the sequencing results. More than 97% of HBV BCP sequences in the GenBank database can be correctly identified by the melting curve analysis. The combination of siPCR and the SimpleProbe real-time PCR enabled mutant quantification in the presence of a 100,000-fold excess of the WT DNA. PMID:21562108

Transcription analysis of peloric mutants of Phalaenopsis orchids derived from tissue culture.

PubMed

Chen, Ya Huei; Tsai, Yi Jung; Huang, Jian Zhi; Chen, Fure Chyi

2005-08-01

Tissue culture has been widely used for mass propagation of Phalaenopsis. However, somaclonal variation occurred during micropropagation process posed a severe problem by affecting product quality. In this study, wild type and peloric flower buds of Phalaenopsis hybrids derived from flower stalk nodal culture were used for cDNA-RAPD and cDNA suppression subtractive hybridization analyses in order to study their genetic difference in terms of expressed sequence tags. A total of 209 ESTs from normal flower buds and 230 from mutants were sequenced. These ESTs sequences can be grouped into several functional categories involved in different cellular processes including metabolism, signal transduction, transcription, cell growth and division, protein synthesis, and protein localization, and into a subcategory of proteins with unknown function. Cymbidium mosaic virus transcript was surprisingly found expressed frequently in the peloric mutant of P. Little Mary. Real-time RT-PCR analysis on selected ESTs showed that in mutant flower buds, a bZIP transcription factor (TGA1a-like protein) was down-regulated, while up-regulated genes include auxin-regulated protein kinase, cyclophilin, and TCP-like genes. A retroelement clone was also preferentially expressed in the peloric mutant flowers. On the other hand, ESTs involved in DNA methylation, chromatin remodeling and post-transcriptional regulation, such as DNA methyltransferase, histone acetyltransferase, ERECTA, and DEAD/DEAH RNA helicase, were enriched in normal flower buds than the mutants. The enriched transcripts in the wild type indicate the down regulation of these transcripts in the mutants, and vice versa. The potential roles of the analyzed transcripts in the development of Phalaenopsis flowers are discussed.

Isolation and molecular characterization of dTnp1, a mobile and defective transposable element of Nicotiana plumbaginifolia.

PubMed

Meyer, C; Pouteau, S; Rouzé, P; Caboche, M

1994-01-01

By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.

The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2003-02-01

The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

A method for probing the mutational landscape of amyloid structure.

PubMed

O'Donnell, Charles W; Waldispühl, Jérôme; Lis, Mieszko; Halfmann, Randal; Devadas, Srinivas; Lindquist, Susan; Berger, Bonnie

2011-07-01

Proteins of all kinds can self-assemble into highly ordered β-sheet aggregates known as amyloid fibrils, important both biologically and clinically. However, the specific molecular structure of a fibril can vary dramatically depending on sequence and environmental conditions, and mutations can drastically alter amyloid function and pathogenicity. Experimental structure determination has proven extremely difficult with only a handful of NMR-based models proposed, suggesting a need for computational methods. We present AmyloidMutants, a statistical mechanics approach for de novo prediction and analysis of wild-type and mutant amyloid structures. Based on the premise of protein mutational landscapes, AmyloidMutants energetically quantifies the effects of sequence mutation on fibril conformation and stability. Tested on non-mutant, full-length amyloid structures with known chemical shift data, AmyloidMutants offers roughly 2-fold improvement in prediction accuracy over existing tools. Moreover, AmyloidMutants is the only method to predict complete super-secondary structures, enabling accurate discrimination of topologically dissimilar amyloid conformations that correspond to the same sequence locations. Applied to mutant prediction, AmyloidMutants identifies a global conformational switch between Aβ and its highly-toxic 'Iowa' mutant in agreement with a recent experimental model based on partial chemical shift data. Predictions on mutant, yeast-toxic strains of HET-s suggest similar alternate folds. When applied to HET-s and a HET-s mutant with core asparagines replaced by glutamines (both highly amyloidogenic chemically similar residues abundant in many amyloids), AmyloidMutants surprisingly predicts a greatly reduced capacity of the glutamine mutant to form amyloid. We confirm this finding by conducting mutagenesis experiments. Our tool is publically available on the web at http://amyloid.csail.mit.edu/. lindquist_admin@wi.mit.edu; bab@csail.mit.edu.

Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

NASA Astrophysics Data System (ADS)

Wang, Hua; Zhang, Jian; Yang, Fan; Wang, Kai; Shen, Si-Le; Liu, Bing-Bing; Zou, Bo; Zou, Guang-Tian

2011-01-01

The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively.

Evidence for a Role of rpoE in Stressed and Unstressed Cells of Marine Vibrio angustum Strain S14

PubMed Central

Hild, Erika; Takayama, Kathy; Olsson, Rose-Marie; Kjelleberg, Staffan

2000-01-01

We report the cloning, sequencing, and characterization of the rpoE homolog in Vibrio angustum S14. The rpoE gene encodes a protein with a predicted molecular mass of 19.4 kDa and has been demonstrated to be present as a single-copy gene by Southern blot analysis. The deduced amino acid sequence of RpoE is most similar to that of the RpoE homolog of Sphingomonas aromaticivorans, ς24, displaying sequence similarity and identity of 63 and 43%, respectively. Northern blot analysis demonstrated the induction of rpoE 6, 12, and 40 min after a temperature shift to 40°C. An rpoE mutant was constructed by gene disruption. There was no difference in viability during logarithmic growth, stationary phase, or carbon starvation between the wild type and the rpoE mutant strain. In contrast, survival of the mutant was impaired following heat shock during exponential growth, as well as after oxidative stress at 24 h of carbon starvation. The mutant exhibited microcolony formation during optimal growth temperatures (22 to 30°C), and cell area measurements revealed an increase in cell volume of the mutant during growth at 30°C, compared to the wild-type strain. Moreover, outer membrane and periplasmic space protein analysis demonstrated many alterations in the protein profiles for the mutant during growth and carbon starvation, as well as following oxidative stress, in comparison with the wild-type strain. It is thereby concluded that RpoE has an extracytoplasmic function and mediates a range of specific responses in stressed as well as unstressed cells of V. angustum S14. PMID:11092857

Translational genomics for analysis of complex traits in peanut and sorghum

USDA-ARS?s Scientific Manuscript database

The integration of sequencing and genotype data from natural variation studies (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) facilitated the development of DNA markers in the form of single nucleotide polymorphic (SNP)...

Integrated translational genomics for analysis of complex traits in sorghum

USDA-ARS?s Scientific Manuscript database

We will report on the integration of sequencing and genotype data from natural variation (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) with the goal of identifying genes controlling important agronomic traits and tran...

A cataract-causing connexin 50 mutant is mislocalized to the ER due to loss of the fourth transmembrane domain and cytoplasmic domain.

PubMed

Somaraju Chalasani, Madhavi Latha; Muppirala, Madhavi; G Ponnam, Surya Prakash; Kannabiran, Chitra; Swarup, Ghanshyam

2013-01-01

Mutations in the eye lens gap junction protein connexin 50 cause cataract. Earlier we identified a frameshift mutant of connexin 50 (c.670insA; p.Thr203AsnfsX47) in a family with autosomal recessive cataract. The mutant protein is smaller and contains 46 aberrant amino acids at the C-terminus after amino acid 202. Here, we have analysed this frameshift mutant and observed that it localized to the endoplasmic reticulum (ER) but not in the plasma membrane. Moreover, overexpression of the mutant resulted in disintegration of the ER-Golgi intermediate compartment (ERGIC), reduction in the level of ERGIC-53 protein and breakdown of the Golgi in many cells. Overexpression of the frameshift mutant partially inhibited the transport of wild type connexin 50 to the plasma membrane. A deletion mutant lacking the aberrant sequence showed predominant localization in the ER and inhibited anterograde protein transport suggesting, therefore, that the aberrant sequence is not responsible for improper localization of the frameshift mutant. Further deletion analysis showed that the fourth transmembrane domain and a membrane proximal region (231-294 amino acids) of the cytoplasmic domain are needed for transport from the ER and localization to the plasma membrane. Our results show that a frameshift mutant of connexin 50 mislocalizes to the ER and causes disintegration of the ERGIC and Golgi. We have also identified a sequence of connexin 50 crucial for transport from the ER and localization to the plasma membrane.

The novel ER membrane protein PRO41 is essential for sexual development in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Frank, Sandra; Koers, Sandra; Strauch, Peter; Weitner, Thomas; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2007-05-01

The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41-EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41-EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi.

The novel ER membrane protein PRO41 is essential for sexual development in the filamentous fungus Sordaria macrospora

PubMed Central

Nowrousian, Minou; Frank, Sandra; Koers, Sandra; Strauch, Peter; Weitner, Thomas; Ringelberg, Carol; Dunlap, Jay C.; Loros, Jennifer J.; Kück, Ulrich

2013-01-01

Summary The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41–EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41–EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi. PMID:17501918

Integrated and translational genomics for analysis of complex traits in crops

USDA-ARS?s Scientific Manuscript database

We report here on integration of sequencing and genotype data from natural variation (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) with the goal of translating gems from these resources into useable DNA markers in the ...

The Glycerol-3-Phosphate Acyltransferase GPAT6 from Tomato Plays a Central Role in Fruit Cutin Biosynthesis1[OPEN

PubMed Central

Petit, Johann; Mauxion, Jean-Philippe; Tai, Fabienne Wong Jun; Fich, Eric A.; Joubès, Jérôme; Rothan, Christophe

2016-01-01

The thick cuticle covering and embedding the epidermal cells of tomato (Solanum lycopersicum) fruit acts not only as a protective barrier against pathogens and water loss but also influences quality traits such as brightness and postharvest shelf-life. In a recent study, we screened a mutant collection of the miniature tomato cultivar Micro-Tom and isolated several glossy fruit mutants in which the abundance of cutin, the polyester component of the cuticle, was strongly reduced. We employed a newly developed mapping-by-sequencing strategy to identify the causal mutation underlying the cutin deficiency in a mutant thereafter named gpat6-a (for glycerol-3-phosphate acyltransferase6). To this end, a backcross population (BC1F2) segregating for the glossy trait was phenotyped. Individuals displaying either a wild-type or a glossy fruit trait were then pooled into bulked populations and submitted to whole-genome sequencing prior to mutation frequency analysis. This revealed that the causal point mutation in the gpat6-a mutant introduces a charged amino acid adjacent to the active site of a GPAT6 enzyme. We further showed that this mutation completely abolished the GPAT activity of the recombinant protein. The gpat6-a mutant showed perturbed pollen formation but, unlike a gpat6 mutant of Arabidopsis (Arabidopsis thaliana), was not male sterile. The most striking phenotype was observed in the mutant fruit, where cuticle thickness, composition, and properties were altered. RNA sequencing analysis highlighted the main processes and pathways that were affected by the mutation at the transcriptional level, which included those associated with lipid, secondary metabolite, and cell wall biosynthesis. PMID:27208295

The Glycerol-3-Phosphate Acyltransferase GPAT6 from Tomato Plays a Central Role in Fruit Cutin Biosynthesis.

PubMed

Petit, Johann; Bres, Cécile; Mauxion, Jean-Philippe; Tai, Fabienne Wong Jun; Martin, Laetitia B B; Fich, Eric A; Joubès, Jérôme; Rose, Jocelyn K C; Domergue, Frédéric; Rothan, Christophe

2016-06-01

The thick cuticle covering and embedding the epidermal cells of tomato (Solanum lycopersicum) fruit acts not only as a protective barrier against pathogens and water loss but also influences quality traits such as brightness and postharvest shelf-life. In a recent study, we screened a mutant collection of the miniature tomato cultivar Micro-Tom and isolated several glossy fruit mutants in which the abundance of cutin, the polyester component of the cuticle, was strongly reduced. We employed a newly developed mapping-by-sequencing strategy to identify the causal mutation underlying the cutin deficiency in a mutant thereafter named gpat6-a (for glycerol-3-phosphate acyltransferase6). To this end, a backcross population (BC1F2) segregating for the glossy trait was phenotyped. Individuals displaying either a wild-type or a glossy fruit trait were then pooled into bulked populations and submitted to whole-genome sequencing prior to mutation frequency analysis. This revealed that the causal point mutation in the gpat6-a mutant introduces a charged amino acid adjacent to the active site of a GPAT6 enzyme. We further showed that this mutation completely abolished the GPAT activity of the recombinant protein. The gpat6-a mutant showed perturbed pollen formation but, unlike a gpat6 mutant of Arabidopsis (Arabidopsis thaliana), was not male sterile. The most striking phenotype was observed in the mutant fruit, where cuticle thickness, composition, and properties were altered. RNA sequencing analysis highlighted the main processes and pathways that were affected by the mutation at the transcriptional level, which included those associated with lipid, secondary metabolite, and cell wall biosynthesis. © 2016 American Society of Plant Biologists. All Rights Reserved.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

PubMed

Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

2012-05-03

Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

[Mutation Analysis of 19 STR Loci in 20 723 Cases of Paternity Testing].

PubMed

Bi, J; Chang, J J; Li, M X; Yu, C Y

2017-06-01

To observe and analyze the confirmed cases of paternity testing, and to explore the mutation rules of STR loci. The mutant STR loci were screened from 20 723 confirmed cases of paternity testing by Goldeneye 20A system．The mutation rates, and the sources, fragment length, steps and increased or decreased repeat sequences of mutant alleles were counted for the analysis of the characteristics of mutation-related factors. A total of 548 mutations were found on 19 STR loci, and 557 mutation events were observed. The loci mutation rate was 0.07‰-2.23‰. The ratio of paternal to maternal mutant events was 3.06:1. One step mutation was the main mutation, and the number of the increased repeat sequences was almost the same as the decreased repeat sequences. The repeat sequences were more likely to decrease in two steps mutation and above. Mutation mainly occurred in the medium allele, and the number of the increased repeat sequences was almost the same as the decreased repeat sequences. In long allele mutations, the decreased repeat sequences were significantly more than the increased repeat sequences. The number of the increased repeat sequences was almost the same as the decreased repeat sequences in paternal mutation, while the decreased repeat sequences were more than the increased in maternal mutation. There are significant differences in the mutation rate of each locus. When one or two loci do not conform to the genetic law, other detection system should be added, and PI value should be calculated combined with the information of the mutate STR loci in order to further clarify the identification opinions. Copyright© by the Editorial Department of Journal of Forensic Medicine

Fast neutron induced structural rearrangements at a soybean NAP1 locus result in gnarled trichomes

USDA-ARS?s Scientific Manuscript database

A soybean (Glycine max (L.) Merr.) gnarled trichome mutant, exhibiting stunted trichomes compared to wild-type, was identified in a fast neutron mutant population. Genetic mapping using whole genome sequence-based bulked segregant analysis identified a 26.6 megabase interval on chromosome 20 that ...

Deep Sequencing of Random Mutant Libraries Reveals the Active Site of the Narrow Specificity CphA Metallo-β-Lactamase is Fragile to Mutations.

PubMed

Sun, Zhizeng; Mehta, Shrenik C; Adamski, Carolyn J; Gibbs, Richard A; Palzkill, Timothy

2016-09-12

CphA is a Zn(2+)-dependent metallo-β-lactamase that efficiently hydrolyzes only carbapenem antibiotics. To understand the sequence requirements for CphA function, single codon random mutant libraries were constructed for residues in and near the active site and mutants were selected for E. coli growth on increasing concentrations of imipenem, a carbapenem antibiotic. At high concentrations of imipenem that select for phenotypically wild-type mutants, the active-site residues exhibit stringent sequence requirements in that nearly all residues in positions that contact zinc, the substrate, or the catalytic water do not tolerate amino acid substitutions. In addition, at high imipenem concentrations a number of residues that do not directly contact zinc or substrate are also essential and do not tolerate substitutions. Biochemical analysis confirmed that amino acid substitutions at essential positions decreased the stability or catalytic activity of the CphA enzyme. Therefore, the CphA active - site is fragile to substitutions, suggesting active-site residues are optimized for imipenem hydrolysis. These results also suggest that resistance to inhibitors targeted to the CphA active site would be slow to develop because of the strong sequence constraints on function.

Rapid identification of causal mutations in tomato EMS populations via mapping-by-sequencing.

PubMed

Garcia, Virginie; Bres, Cécile; Just, Daniel; Fernandez, Lucie; Tai, Fabienne Wong Jun; Mauxion, Jean-Philippe; Le Paslier, Marie-Christine; Bérard, Aurélie; Brunel, Dominique; Aoki, Koh; Alseekh, Saleh; Fernie, Alisdair R; Fraser, Paul D; Rothan, Christophe

2016-12-01

The tomato is the model species of choice for fleshy fruit development and for the Solanaceae family. Ethyl methanesulfonate (EMS) mutants of tomato have already proven their utility for analysis of gene function in plants, leading to improved breeding stocks and superior tomato varieties. However, until recently, the identification of causal mutations that underlie particular phenotypes has been a very lengthy task that many laboratories could not afford because of spatial and technical limitations. Here, we describe a simple protocol for identifying causal mutations in tomato using a mapping-by-sequencing strategy. Plants displaying phenotypes of interest are first isolated by screening an EMS mutant collection generated in the miniature cultivar Micro-Tom. A recombinant F 2 population is then produced by crossing the mutant with a wild-type (WT; non-mutagenized) genotype, and F 2 segregants displaying the same phenotype are subsequently pooled. Finally, whole-genome sequencing and analysis of allele distributions in the pools allow for the identification of the causal mutation. The whole process, from the isolation of the tomato mutant to the identification of the causal mutation, takes 6-12 months. This strategy overcomes many previous limitations, is simple to use and can be applied in most laboratories with limited facilities for plant culture and genotyping.

Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

PubMed

Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

2014-10-01

This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

Genome-Wide Mutagenesis in Borrelia burgdorferi.

PubMed

Lin, Tao; Gao, Lihui

2018-01-01

Signature-tagged mutagenesis (STM) is a functional genomics approach to identify bacterial virulence determinants and virulence factors by simultaneously screening multiple mutants in a single host animal, and has been utilized extensively for the study of bacterial pathogenesis, host-pathogen interactions, and spirochete and tick biology. The signature-tagged transposon mutagenesis has been developed to investigate virulence determinants and pathogenesis of Borrelia burgdorferi. Mutants in genes important in virulence are identified by negative selection in which the mutants fail to colonize or disseminate in the animal host and tick vector. STM procedure combined with Luminex Flex ® Map™ technology and next-generation sequencing (e.g., Tn-seq) are the powerful high-throughput tools for the determination of Borrelia burgdorferi virulence determinants. The assessment of multiple tissue sites and two DNA resources at two different time points using Luminex Flex ® Map™ technology provides a robust data set. B. burgdorferi transposon mutant screening indicates that a high proportion of genes are the novel virulence determinants that are required for mouse and tick infection. In this protocol, an effective signature-tagged Himar1-based transposon suicide vector was developed and used to generate a sequence-defined library of nearly 4800 mutants in the infectious B. burgdorferi B31 clone. In STM, signature-tagged suicide vectors are constructed by inserting unique DNA sequences (tags) into the transposable elements. The signature-tagged transposon mutants are generated when transposon suicide vectors are transformed into an infectious B. burgdorferi clone, and the transposable element is transposed into the 5'-TA-3' sequence in the B. burgdorferi genome with the signature tag. The transposon library is created and consists of many sub-libraries, each sub-library has several hundreds of mutants with same tags. A group of mice or ticks are infected with a mixed population of mutants with different tags, after recovered from different tissues of infected mice and ticks, mutants from output pool and input pool are detected using high-throughput, semi-quantitative Luminex ® FLEXMAP™ or next-generation sequencing (Tn-seq) technologies. Thus far, we have created a high-density, sequence-defined transposon library of over 6600 STM mutants for the efficient genome-wide investigation of genes and gene products required for wild-type pathogenesis, host-pathogen interactions, in vitro growth, in vivo survival, physiology, morphology, chemotaxis, motility, structure, metabolism, gene regulation, plasmid maintenance and replication, etc. The insertion sites of 4480 transposon mutants have been determined. About 800 predicted protein-encoding genes in the genome were disrupted in the STM transposon library. The infectivity and some functions of 800 mutants in 500 genes have been determined. Analysis of these transposon mutants has yielded valuable information regarding the genes and gene products important in the pathogenesis and biology of B. burgdorferi and its tick vectors.

Mutational analysis of the gag-pol junction of Moloney murine leukemia virus: requirements for expression of the gag-pol fusion protein.

PubMed Central

Felsenstein, K M; Goff, S P

1992-01-01

The gag-pol polyprotein of the murine and feline leukemia viruses is expressed by translational readthrough of a UAG terminator codon at the 3' end of the gag gene. To explore the cis-acting sequence requirements for the readthrough event in vivo, we generated a library of mutants of the Moloney murine leukemia virus with point mutations near the terminator codon and tested the mutant viral DNAs for the ability to direct synthesis of the gag-pol fusion protein and formation of infectious virus. The analysis showed that sequences 3' to the terminator are necessary and sufficient for the process. The results do not support a role for one proposed stem-loop structure that includes the terminator but are consistent with the involvement of another stem-loop 3' to the terminator. One mutant, containing two compensatory changes in this stem structure, was temperature sensitive for replication and for formation of the gag-pol protein. The results suggest that RNA sequence and structure are critical determinants of translational readthrough in vivo. Images PMID:1404606

[Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

PubMed

Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

2008-10-01

To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

Pathogenesis, Molecular Genetics, and Genomics of Mycobacterium avium subsp. paratuberculosis, the Etiologic Agent of Johne’s Disease

PubMed Central

Rathnaiah, Govardhan; Zinniel, Denise K.; Bannantine, John P.; Stabel, Judith R.; Gröhn, Yrjö T.; Collins, Michael T.; Barletta, Raúl G.

2017-01-01

Mycobacterium avium subsp. paratuberculosis (MAP) is the etiologic agent of Johne’s disease in ruminants causing chronic diarrhea, malnutrition, and muscular wasting. Neonates and young animals are infected primarily by the fecal–oral route. MAP attaches to, translocates via the intestinal mucosa, and is phagocytosed by macrophages. The ensuing host cellular immune response leads to granulomatous enteritis characterized by a thick and corrugated intestinal wall. We review various tissue culture systems, ileal loops, and mice, goats, and cattle used to study MAP pathogenesis. MAP can be detected in clinical samples by microscopy, culturing, PCR, and an enzyme-linked immunosorbent assay. There are commercial vaccines that reduce clinical disease and shedding, unfortunately, their efficacies are limited and may not engender long-term protective immunity. Moreover, the potential linkage with Crohn’s disease and other human diseases makes MAP a concern as a zoonotic pathogen. Potential therapies with anti-mycobacterial agents are also discussed. The completion of the MAP K-10 genome sequence has greatly improved our understanding of MAP pathogenesis. The analysis of this sequence has identified a wide range of gene functions involved in virulence, lipid metabolism, transcriptional regulation, and main metabolic pathways. We also review the transposons utilized to generate random transposon mutant libraries and the recent advances in the post-genomic era. This includes the generation and characterization of allelic exchange mutants, transcriptomic analysis, transposon mutant banks analysis, new efforts to generate comprehensive mutant libraries, and the application of transposon site hybridization mutagenesis and transposon sequencing for global analysis of the MAP genome. Further analysis of candidate vaccine strains development is also provided with critical discussions on their benefits and shortcomings, and strategies to develop a highly efficacious live-attenuated vaccine capable of differentiating infected from vaccinated animals. PMID:29164142

Fast Homozygosity Mapping and Identification of a Zebrafish ENU-Induced Mutation by Whole-Genome Sequencing

PubMed Central

Voz, Marianne L.; Coppieters, Wouter; Manfroid, Isabelle; Baudhuin, Ariane; Von Berg, Virginie; Charlier, Carole; Meyer, Dirk; Driever, Wolfgang; Martial, Joseph A.; Peers, Bernard

2012-01-01

Forward genetics using zebrafish is a powerful tool for studying vertebrate development through large-scale mutagenesis. Nonetheless, the identification of the molecular lesion is still laborious and involves time-consuming genetic mapping. Here, we show that high-throughput sequencing of the whole zebrafish genome can directly locate the interval carrying the causative mutation and at the same time pinpoint the molecular lesion. The feasibility of this approach was validated by sequencing the m1045 mutant line that displays a severe hypoplasia of the exocrine pancreas. We generated 13 Gb of sequence, equivalent to an eightfold genomic coverage, from a pool of 50 mutant embryos obtained from a map-cross between the AB mutant carrier and the WIK polymorphic strain. The chromosomal region carrying the causal mutation was localized based on its unique property to display high levels of homozygosity among sequence reads as it derives exclusively from the initial AB mutated allele. We developed an algorithm identifying such a region by calculating a homozygosity score along all chromosomes. This highlighted an 8-Mb window on chromosome 5 with a score close to 1 in the m1045 mutants. The sequence analysis of all genes within this interval revealed a nonsense mutation in the snapc4 gene. Knockdown experiments confirmed the assertion that snapc4 is the gene whose mutation leads to exocrine pancreas hypoplasia. In conclusion, this study constitutes a proof-of-concept that whole-genome sequencing is a fast and effective alternative to the classical positional cloning strategies in zebrafish. PMID:22496837

Cohort analysis of a single nucleotide polymorphism on DNA chips.

PubMed

Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F

2004-11-15

A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

PubMed Central

2012-01-01

Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

Structure-Function Analysis of Chloroplast Proteins via Random Mutagenesis Using Error-Prone PCR.

PubMed

Dumas, Louis; Zito, Francesca; Auroy, Pascaline; Johnson, Xenie; Peltier, Gilles; Alric, Jean

2018-06-01

Site-directed mutagenesis of chloroplast genes was developed three decades ago and has greatly advanced the field of photosynthesis research. Here, we describe a new approach for generating random chloroplast gene mutants that combines error-prone polymerase chain reaction of a gene of interest with chloroplast complementation of the knockout Chlamydomonas reinhardtii mutant. As a proof of concept, we targeted a 300-bp sequence of the petD gene that encodes subunit IV of the thylakoid membrane-bound cytochrome b 6 f complex. By sequencing chloroplast transformants, we revealed 149 mutations in the 300-bp target petD sequence that resulted in 92 amino acid substitutions in the 100-residue target subunit IV sequence. Our results show that this method is suited to the study of highly hydrophobic, multisubunit, and chloroplast-encoded proteins containing cofactors such as hemes, iron-sulfur clusters, and chlorophyll pigments. Moreover, we show that mutant screening and sequencing can be used to study photosynthetic mechanisms or to probe the mutational robustness of chloroplast-encoded proteins, and we propose that this method is a valuable tool for the directed evolution of enzymes in the chloroplast. © 2018 American Society of Plant Biologists. All rights reserved.

Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

PubMed Central

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

Acute hepatitis B caused by a vaccine-escape HBV strain in vaccinated subject: sequence analysis and therapeutic strategy.

PubMed

Luongo, Monica; Critelli, Rosina; Grottola, Antonella; Gitto, Stefano; Bernabucci, Veronica; Bevini, Mirco; Vecchi, Chiara; Montagnani, Giuliano; Villa, Erica

2015-01-01

HBV vaccine contains the 'a' determinant region, the major immune-target of antibodies (anti-HBs). Failure of immunization may be caused by vaccine-induced or spontaneous 'a' determinant surface gene mutants. Here, we evaluate the possible lack of protection by HBV vaccine, describing the case of an acute hepatitis B diagnosed in a 55-year-old Caucasian male unpaid blood donor, vaccinated against HBV. Sequencing data for preS-S region revealed multiple point mutations. Of all the substitutions found, Q129H, located in the "a" determinant region of HBsAg, can alter antigenicity, leading to mutants. This mutant may cause vaccine failure especially when associated with high viremia of infecting source. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and Characterization of an Outer Membrane Protein of Vibrio vulnificus Required for Heme Utilization: Regulation of Expression and Determination of the Gene Sequence

PubMed Central

Litwin, Christine M.; Byrne, Burke L.

1998-01-01

Vibrio vulnificus is a halophilic, marine pathogen that has been associated with septicemia and serious wound infections in patients with iron overload and preexisting liver disease. For V. vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. V. vulnificus is able to use host iron sources such as hemoglobin and heme. We previously constructed a fur mutant of V. vulnificus which constitutively expresses at least two iron-regulated outer membrane proteins, of 72 and 77 kDa. The N-terminal amino acid sequence of the 77-kDa protein purified from the V. vulnificus fur mutant had 67% homology with the first 15 amino acids of the mature protein of the Vibrio cholerae heme receptor, HutA. In this report, we describe the cloning, DNA sequence, mutagenesis, and analysis of transcriptional regulation of the structural gene for HupA, the heme receptor of V. vulnificus. DNA sequencing of hupA demonstrated a single open reading frame of 712 amino acids that was 50% identical and 66% similar to the sequence of V. cholerae HutA and similar to those of other TonB-dependent outer membrane receptors. Primer extension analysis localized one promoter for the V. vulnificus hupA gene. Analysis of the promoter region of V. vulnificus hupA showed a sequence homologous to the consensus Fur box. Northern blot analysis showed that the transcript was strongly regulated by iron. An internal deletion in the V. vulnificus hupA gene, done by using marker exchange, resulted in the loss of expression of the 77-kDa protein and the loss of the ability to use hemin or hemoglobin as a source of iron. The hupA deletion mutant of V. vulnificus will be helpful in future studies of the role of heme iron in V. vulnificus pathogenesis. PMID:9632577

GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

1994-09-01

GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

The rpoE operon regulates heat stress response in Burkholderia pseudomallei.

PubMed

Vanaporn, Muthita; Vattanaviboon, Paiboon; Thongboonkerd, Visith; Korbsrisate, Sunee

2008-07-01

Burkholderia pseudomallei is a gram-negative bacterium and the causative agent of melioidosis, one of the important lethal diseases in tropical regions. In this article, we demonstrate the crucial role of the B. pseudomallei rpoE locus in the response to heat stress. The rpoE operon knockout mutant exhibited growth retardation and reduced survival when exposed to a high temperature. Expression analysis using rpoH promoter-lacZ fusion revealed that heat stress induction of rpoH, which encodes heat shock sigma factor (sigma(H)), was abolished in the B. pseudomallei rpoE mutant. Analysis of the rpoH promoter region revealed sequences sharing high homology to the consensus sequence of sigma(E)-dependent promoters. Moreover, the putative heat-induced sigma(H)-regulated heat shock proteins (i.e. GroEL and HtpG) were also absent in the rpoE operon mutant. Altogether, our data suggest that the rpoE operon regulates B. pseudomallei heat stress response through the function of rpoH.

Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development.

PubMed

Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang

2014-02-10

Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

PubMed

Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

2016-11-01

Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

A rapid, highly accurate method for quantifying CALR mutant allele burden in persons with myeloproliferative neoplasms.

PubMed

Yao, Qiu-Mei; Zhou, Jiao; Gale, Robert Peter; Li, Jin-Lan; Li, Ling-Di; Li, Ning; Chen, Shan-Shan; Ruan, Guo-Rui

2015-10-01

Calreticulin (CALR) mutations were recently identified in a substantial proportion of persons with essential thrombocythemia (ET) and with primary myelofibrosis (PMF) without JAK2(V617F). Consequently rapid, sensitive, and specific methods to detect and quantify these mutations are needed. We studied samples from 1088 persons with myeloproliferative neoplasms (MPNs) including 421 JAK2(V617F) negative subjects with ET, PMF, polycythemia vera (PV), chronic myeloid leukemia (CML) and hyper-eosinophilic syndrome (HES). Detection of CALR exon 9 mutations was done by PCR amplification followed by fragment length analysis and direct sequencing. Dilution assays were used to determine CALR mutant allele burden. We detected CALR mutations in blood and bone marrow samples from 152 subjects with ET and with PMF but not in samples from normal or persons with PV, CML, or HES. CALR mutant peaks were distinct from wild-type peaks and dilution experiments indicated a sensitivity level of 0.5-5% for a CALR mutant allele in a wild-type background. Diverse types of mutations were detected including deletions, insertions, and complex indels. All mutations were confirmed by direct sequencing. We also used dilution experiments to quantify mutant allele burden. We were able to reproducibly detect mutant allele levels as low 5% (0.5-5%) in a wild-type background. PCR amplification followed by fragment length analysis is a rapid, sensitive, and specific method for screening persons with MPNs for CALR mutations, especially those with ET and PMF and for estimating mutant allele burden.

Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡

PubMed Central

Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu

2009-01-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402

Genome-wide transposon mutagenesis in pathogenic Leptospira species.

PubMed

Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu

2009-02-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.

Reverse genetics: Its origins and prospects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, P.

1991-04-01

The nucleotide sequence of a gene and its flanking segments alone will not tell us how its expression is regulated during development and differentiation, or in response to environmental changes. To comprehend the physiological significance of the molecular details requires biological analysis. Recombinant DNA techniques provide a powerful experimental approach. A strategy termed reverse genetics' utilizes the analysis of the activities of mutant and normal genes and experimentally constructed mutants to explore the relationship between gene structure and function thereby helping elucidate the relationship between genotype and phenotype.

Elucidating the genomic architecture of Asian EGFR-mutant lung adenocarcinoma through multi-region exome sequencing.

PubMed

Nahar, Rahul; Zhai, Weiwei; Zhang, Tong; Takano, Angela; Khng, Alexis J; Lee, Yin Yeng; Liu, Xingliang; Lim, Chong Hee; Koh, Tina P T; Aung, Zaw Win; Lim, Tony Kiat Hon; Veeravalli, Lavanya; Yuan, Ju; Teo, Audrey S M; Chan, Cheryl X; Poh, Huay Mei; Chua, Ivan M L; Liew, Audrey Ann; Lau, Dawn Ping Xi; Kwang, Xue Lin; Toh, Chee Keong; Lim, Wan-Teck; Lim, Bing; Tam, Wai Leong; Tan, Eng-Huat; Hillmer, Axel M; Tan, Daniel S W

2018-01-15

EGFR-mutant lung adenocarcinomas (LUAD) display diverse clinical trajectories and are characterized by rapid but short-lived responses to EGFR tyrosine kinase inhibitors (TKIs). Through sequencing of 79 spatially distinct regions from 16 early stage tumors, we show that despite low mutation burdens, EGFR-mutant Asian LUADs unexpectedly exhibit a complex genomic landscape with frequent and early whole-genome doubling, aneuploidy, and high clonal diversity. Multiple truncal alterations, including TP53 mutations and loss of CDKN2A and RB1, converge on cell cycle dysregulation, with late sector-specific high-amplitude amplifications and deletions that potentially beget drug resistant clones. We highlight the association between genomic architecture and clinical phenotypes, such as co-occurring truncal drivers and primary TKI resistance. Through comparative analysis with published smoking-related LUAD, we postulate that the high intra-tumor heterogeneity observed in Asian EGFR-mutant LUAD may be contributed by an early dominant driver, genomic instability, and low background mutation rates.

Specific Detection of Naturally Occurring Hepatitis C Virus Mutants with Resistance to Telaprevir and Boceprevir (Protease Inhibitors) among Treatment-Naïve Infected Individuals

PubMed Central

Fonseca-Coronado, Salvador; Escobar-Gutiérrez, Alejandro; Ruiz-Tovar, Karina; Cruz-Rivera, Mayra Yolanda; Rivera-Osorio, Pilar; Vazquez-Pichardo, Mauricio; Carpio-Pedroza, Juan Carlos; Ruíz-Pacheco, Juan Alberto; Cazares, Fernando

2012-01-01

The use of telaprevir and boceprevir, both protease inhibitors (PI), as part of the specifically targeted antiviral therapy for hepatitis C (STAT-C) has significantly improved sustained virologic response (SVR) rates. However, different clinical studies have also identified several mutations associated with viral resistance to both PIs. In the absence of selective pressure, drug-resistant hepatitis C virus (HCV) mutants are generally present at low frequency, making mutation detection challenging. Here, we describe a mismatch amplification mutation assay (MAMA) PCR method for the specific detection of naturally occurring drug-resistant HCV mutants. MAMA PCR successfully identified the corresponding HCV variants, while conventional methods such as direct sequencing, endpoint limiting dilution (EPLD), and bacterial cloning were not sensitive enough to detect circulating drug-resistant mutants in clinical specimens. Ultradeep pyrosequencing was used to confirm the presence of the corresponding HCV mutants. In treatment-naïve patients, the frequency of all resistant variants was below 1%. Deep amplicon sequencing allowed a detailed analysis of the structure of the viral population among these patients, showing that the evolution of the NS3 is limited to a rather small sequence space. Monitoring of HCV drug resistance before and during treatment is likely to provide important information for management of patients undergoing anti-HCV therapy. PMID:22116161

Sequence analysis of laci mutations obtained from lung cells of radon-exposed big blue{trademark} transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Layton, A.D.; Cross, F.T.; Steigler, G.L.

1994-12-31

We have exposed Big Blue{trademark} transgenic mice by inhalation to 320, 640 and 960 Working Level Months (WLM) of radon progeny. Mice were sacrificed after 3, 6 and 9 days; the time periods required to obtain the exposures. Control mice were also sacrificed at each time interval. In each case all tissues were excised, flash frozen in liquid nitrogen, and stored at -80{degrees}C for further analysis. Twelve lacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM exposure group; the lacI genes from these mutants have been sequenced. Sequence data indicate that three of themore » mutants have a C;G deletion at BP 978 and are possibly clonal in origin. Two mutants have multiple events within the gene: one has a an A:T to C:G transversion and a C:G insertion separated by 291 BPs; the second has a G:C to A:T transition as well as an A:T deletion followed by 6 base pairs downstream by a T:A insertion. Other mutations include a single G:C to A:T transition, a two base pair deletion, and a C:G to T:A transition. Mutant plaques are being evaluated from individual mice at other dose levels. Time course experiments are also planned. These studies will help define the molecular fine structure of mutations induced by high-LET radiation exposure.« less

Division-induced DNA double strand breaks in the chromosome terminus region of Escherichia coli lacking RecBCD DNA repair enzyme

PubMed Central

Durand, Adeline; Desfontaines, Jean-Michel; Iurchenko, Ielyzaveta; Auger, Hélène; Leach, David R. F.

2017-01-01

Marker frequency analysis of the Escherichia coli recB mutant chromosome has revealed a deficit of DNA in a specific zone of the terminus, centred on the dif/TerC region. Using fluorescence microscopy of a marked chromosomal site, we show that the dif region is lost after replication completion, at the time of cell division, in one daughter cell only, and that the phenomenon is transmitted to progeny. Analysis by marker frequency and microscopy shows that the position of DNA loss is not defined by the replication fork merging point since it still occurs in the dif/TerC region when the replication fork trap is displaced in strains harbouring ectopic Ter sites. Terminus DNA loss in the recB mutant is also independent of dimer resolution by XerCD at dif and of Topo IV action close to dif. It occurs in the terminus region, at the point of inversion of the GC skew, which is also the point of convergence of specific sequence motifs like KOPS and Chi sites, regardless of whether the convergence of GC skew is at dif (wild-type) or a newly created sequence. In the absence of FtsK-driven DNA translocation, terminus DNA loss is less precisely targeted to the KOPS convergence sequence, but occurs at a similar frequency and follows the same pattern as in FtsK+ cells. Importantly, using ftsIts, ftsAts division mutants and cephalexin treated cells, we show that DNA loss of the dif region in the recB mutant is decreased by the inactivation of cell division. We propose that it results from septum-induced chromosome breakage, and largely contributes to the low viability of the recB mutant. PMID:28968392

Characterization of the yrbA Gene of Bacillus subtilis, Involved in Resistance and Germination of Spores

PubMed Central

Takamatsu, Hiromu; Kodama, Takeko; Nakayama, Tatsuo; Watabe, Kazuhito

1999-01-01

Insertional inactivation of the yrbA gene of Bacillus subtilis reduced the resistance of the mutant spores to lysozyme. The yrbA mutant spores lost their optical density at the same rate as the wild-type spores upon incubation with l-alanine but became only phase gray and did not swell. The response of the mutant spores to a combination of asparagine, glucose, fructose, and KCl was also extremely poor; in this medium yrbA spores exhibited only a small loss in optical density and gave a mixture of phase-bright, -gray, and -dark spores. Northern blot analysis of yrbA transcripts in various sig mutants indicated that yrbA was transcribed by RNA polymerase with ςE beginning at 2 h after the start of sporulation. The yrbA promoter was localized by primer extension analysis, and the sequences of the −35 (TCATAAC) and −10 (CATATGT) regions were similar to the consensus sequences of genes recognized by ςE. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of proteins solubilized from intact yrbA mutant spores showed an alteration in the protein profile, as 31- and 36-kDa proteins, identified as YrbA and CotG, respectively, were absent, along with some other minor changes. Electron microscopic examination of yrbA spores revealed changes in the spore coat, including a reduction in the density and thickness of the outer layer and the appearance of an inner coat layer-like structure around the outside of the coat. This abnormal coat structure was also observed on the outside of the developing forespores of the yrbA mutant. These results suggest that YrbA is involved in assembly of some coat proteins which have roles in both spore lysozyme resistance and germination. PMID:10438771

Comparative genomic analysis identified a mutation related to enhanced heterologous protein production in the filamentous fungus Aspergillus oryzae.

PubMed

Jin, Feng-Jie; Katayama, Takuya; Maruyama, Jun-Ichi; Kitamoto, Katsuhiko

2016-11-01

Genomic mapping of mutations using next-generation sequencing technologies has facilitated the identification of genes contributing to fundamental biological processes, including human diseases. However, few studies have used this approach to identify mutations contributing to heterologous protein production in industrial strains of filamentous fungi, such as Aspergillus oryzae. In a screening of A. oryzae strains that hyper-produce human lysozyme (HLY), we previously isolated an AUT1 mutant that showed higher production of various heterologous proteins; however, the underlying factors contributing to the increased heterologous protein production remained unclear. Here, using a comparative genomic approach performed with whole-genome sequences, we attempted to identify the genes responsible for the high-level production of heterologous proteins in the AUT1 mutant. The comparative sequence analysis led to the detection of a gene (AO090120000003), designated autA, which was predicted to encode an unknown cytoplasmic protein containing an alpha/beta-hydrolase fold domain. Mutation or deletion of autA was associated with higher production levels of HLY. Specifically, the HLY yields of the autA mutant and deletion strains were twofold higher than that of the control strain during the early stages of cultivation. Taken together, these results indicate that combining classical mutagenesis approaches with comparative genomic analysis facilitates the identification of novel genes involved in heterologous protein production in filamentous fungi.

Analysis of isoniazid-resistant transposon mutants of Mycobacterium smegmatis.

PubMed

Billman-Jacobe, H; Sloan, J; Coppel, R L

1996-10-15

The emergence of multidrug-resistant tuberculosis has renewed interest in the study of drug resistance in mycobacteria with the objective of improved chemotherapy. The genetic basis of isoniazid resistance in a model mycobacterium was studied. Eleven isoniazid-resistant mutants of Mycobacterium smegmatis were created using transposon mutagenesis. Genetic and enzymatic characterisation of the mutants showed that katG, encoding T-catalase, was inactivated. The nucleotide sequence of M. smegmatis katG was determined and the mutation sites mapped demonstrating that both the amino and carboxyl halves of T-catalase are important for enzymatic activity.

High-Throughput Parallel Sequencing to Measure Fitness of Leptospira interrogans Transposon Insertion Mutants during Acute Infection

PubMed Central

Matsunaga, James; Haake, David A.

2016-01-01

Pathogenic species of Leptospira are the causative agents of leptospirosis, a zoonotic disease that causes mortality and morbidity worldwide. The understanding of the virulence mechanisms of Leptospira spp is still at an early stage due to the limited number of genetic tools available for this microorganism. The development of random transposon mutagenesis in pathogenic strains a decade ago has contributed to the identification of several virulence factors. In this study, we used the transposon sequencing (Tn-Seq) technique, which combines transposon mutagenesis with massive parallel sequencing, to study the in vivo fitness of a pool of Leptospira interrogans mutants. We infected hamsters with a pool of 42 mutants (input pool), which included control mutants with insertions in four genes previously analyzed by virulence testing (loa22, ligB, flaA1, and lic20111) and 23 mutants with disrupted signal transduction genes. We quantified the mutants in different tissues (blood, kidney and liver) at 4 days post-challenge by high-throughput sequencing and compared the frequencies of mutants recovered from tissues to their frequencies in the input pool. Control mutants that were less fit in the Tn-Seq experiment were attenuated for virulence when tested separately in the hamster model of lethal leptospirosis. Control mutants with unaltered fitness were as virulent as the wild-type strain. We identified two mutants with the transposon inserted in the same putative adenylate/guanylate cyclase gene (lic12327) that had reduced in vivo fitness in blood, kidney and liver. Both lic12327 mutants were attenuated for virulence when tested individually in hamsters. Growth of the control mutants and lic12327 mutants in culture medium were similar to that of the wild-type strain. These results demonstrate the feasibility of screening large pools of L. interrogans transposon mutants for those with altered fitness, and potentially attenuated virulence, by transposon sequencing. PMID:27824878

High Throughput Sequencing Identifies Misregulated Genes in the Drosophila Polypyrimidine Tract-Binding Protein (hephaestus) Mutant Defective in Spermatogenesis.

PubMed

Sridharan, Vinod; Heimiller, Joseph; Robida, Mark D; Singh, Ravinder

2016-01-01

The Drosophila polypyrimidine tract-binding protein (dmPTB or hephaestus) plays an important role during spermatogenesis. The heph2 mutation in this gene results in a specific defect in spermatogenesis, causing aberrant spermatid individualization and male sterility. However, the array of molecular defects in the mutant remains uncharacterized. Using an unbiased high throughput sequencing approach, we have identified transcripts that are misregulated in this mutant. Aberrant transcripts show altered expression levels, exon skipping, and alternative 5' ends. We independently verified these findings by reverse-transcription and polymerase chain reaction (RT-PCR) analysis. Our analysis shows misregulation of transcripts that have been connected to spermatogenesis, including components of the actomyosin cytoskeletal apparatus. We show, for example, that the Myosin light chain 1 (Mlc1) transcript is aberrantly spliced. Furthermore, bioinformatics analysis reveals that Mlc1 contains a high affinity binding site(s) for dmPTB and that the site is conserved in many Drosophila species. We discuss that Mlc1 and other components of the actomyosin cytoskeletal apparatus offer important molecular links between the loss of dmPTB function and the observed developmental defect in spermatogenesis. This study provides the first comprehensive list of genes misregulated in vivo in the heph2 mutant in Drosophila and offers insight into the role of dmPTB during spermatogenesis.

New VMD2 gene mutations identified in patients affected by Best vitelliform macular dystrophy

PubMed Central

Marchant, D; Yu, K; Bigot, K; Roche, O; Germain, A; Bonneau, D; Drouin‐Garraud, V; Schorderet, D F; Munier, F; Schmidt, D; Neindre, P Le; Marsac, C; Menasche, M; Dufier, J L; Fischmeister, R; Hartzell, C; Abitbol, M

2007-01-01

Purpose The mutations responsible for Best vitelliform macular dystrophy (BVMD) are found in a gene called VMD2. The VMD2 gene encodes a transmembrane protein named bestrophin‐1 (hBest1) which is a Ca2+‐sensitive chloride channel. This study was performed to identify disease‐specific mutations in 27 patients with BVMD. Because this disease is characterised by an alteration in Cl− channel function, patch clamp analysis was used to test the hypothesis that one of the VMD2 mutated variants causes the disease. Methods Direct sequencing analysis of the 11 VMD2 exons was performed to detect new abnormal sequences. The mutant of hBest1 was expressed in HEK‐293 cells and the associated Cl− current was examined using whole‐cell patch clamp analysis. Results Six new VMD2 mutations were identified, located exclusively in exons four, six and eight. One of these mutations (Q293H) was particularly severe. Patch clamp analysis of human embryonic kidney cells expressing the Q293H mutant showed that this mutant channel is non‐functional. Furthermore, the Q293H mutant inhibited the function of wild‐type bestrophin‐1 channels in a dominant negative manner. Conclusions This study provides further support for the idea that mutations in VMD2 are a necessary factor for Best disease. However, because variable expressivity of VMD2 was observed in a family with the Q293H mutation, it is also clear that a disease‐linked mutation in VMD2 is not sufficient to produce BVMD. The finding that the Q293H mutant does not form functional channels in the membrane could be explained either by disruption of channel conductance or gating mechanisms or by improper trafficking of the protein to the plasma membrane. PMID:17287362

Cloning and Sequencing of a Candida albicans Catalase Gene and Effects of Disruption of This Gene†

PubMed Central

Wysong, Deborah R.; Christin, Laurent; Sugar, Alan M.; Robbins, Phillips W.; Diamond, Richard D.

1998-01-01

Catalase plays a key role as an antioxidant, protecting aerobic organisms from the toxic effects of hydrogen peroxide, and in some cases has been postulated to be a virulence factor. To help elucidate the function of catalase in Candida albicans, a single C. albicans-derived catalase gene, designated CAT1, was isolated and cloned. Degenerate PCR primers based on highly conserved areas of other fungal catalase genes were used to amplify a 411-bp product from genomic DNA of C. albicans ATCC 10261. By using this product as a probe, catalase clones were isolated from genomic libraries of C. albicans. Nucleotide sequence analysis revealed an open reading frame encoding a protein of 487 amino acid residues. Construction of a CAT1-deficient mutant was achieved by using the Ura-blaster technique for sequential disruption of multiple alleles by integrative transformation using URA3 as a selectable marker. Resulting mutants exhibited normal morphology and comparable growth rates of both yeast and mycelial forms. Enzymatic analysis revealed an abundance of catalase in the wild-type strain but decreasing catalase activity in heterozygous mutants and no detectable catalase in a homozygous null mutant. In vitro assays showed the mutant strains to be more sensitive to damage by both neutrophils and concentrations of exogenous peroxide that were sublethal for the parental strain. Compared to the parental strain, the homozygous null mutant strain was far less virulent for mice in an intravenous infection model of disseminated candidiasis. Definitive linkage of CAT1 with virulence would require restoration of activity by reintroduction of the gene into mutants. However, initial results in mice, taken together with the enhanced susceptibility of catalase-deficient hyphae to damage by human neutrophils, suggest that catalase may enhance the pathogenicity of C. albicans. PMID:9573075

Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata.

PubMed

Fan, Lili; Fu, Kehe; Yu, Chuanjin; Ma, Jia; Li, Yaqian; Chen, Jie

2014-01-01

Agrobacterium tumefaciens-mediated transformation (ATMT) was used to generate an insertional mutant library of the mycelial fungus Trichoderma harzianum. From a total of 450 mutants, six mutants that showed significant influence on maize resistance to C. lunata were analyzed in detail. Maize coated with these mutants was more susceptible to C. lunata compared with those coated with a wild-type (WT) strain. Similar to other fungal ATMT libraries, all six mutants were single copy integrations, which occurred preferentially in noncoding regions (except two mutants) and were frequently accompanied by the loss of border sequences. Two mutants (T66 and T312) that were linked to resistance were characterized further. Maize seeds coated with T66 and T312 were more susceptible to C. lunata than those treated with WT. Moreover, the mutants affected the resistance of maize to C. lunata by enhancing jasmonate-responsive gene expression. T66 and T312 induced maize resistance to C. lunata infection through a jasmonic acid-dependent pathway.

Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes

PubMed Central

Sliva, Anna; Kuang, Zheng; Meluh, Pamela B.; Boeke, Jef D.

2016-01-01

The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954

RAS testing of liquid biopsy correlates with the outcome of metastatic colorectal cancer patients treated with first-line FOLFIRI plus cetuximab in the CAPRI-GOIM trial.

PubMed

Normanno, N; Esposito Abate, R; Lambiase, M; Forgione, L; Cardone, C; Iannaccone, A; Sacco, A; Rachiglio, A M; Martinelli, E; Rizzi, D; Pisconti, S; Biglietto, M; Bordonaro, R; Troiani, T; Latiano, T P; Giuliani, F; Leo, S; Rinaldi, A; Maiello, E; Ciardiello, F

2018-01-01

Liquid biopsy is an alternative to tissue for RAS testing in metastatic colorectal carcinoma (mCRC) patients. Little information is available on the predictive role of liquid biopsy RAS testing in patients treated with first-line anti-EGFR monoclonal antibody-based therapy. In the CAPRI-GOIM trial, 340 KRAS exon-2 wild-type mCRC patients received first-line cetuximab plus FOLFIRI. Tumor samples were retrospectively assessed by next generation sequencing (NGS). Baseline plasma samples were analyzed for KRAS and NRAS mutations using beads, emulsion, amplification, and magnetics digital PCR (BEAMing). Discordant cases were solved by droplet digital PCR (ddPCR) or deep-sequencing. A subgroup of 92 patients with available both NGS data on tumor samples and baseline plasma samples were included in this study. Both NGS analysis of tumor tissue and plasma testing with BEAMing identified RAS mutations in 33/92 patients (35.9%). However, 10 cases were RAS tissue mutant and plasma wild-type, and additional 10 cases were tissue wild-type and plasma mutant, resulting in a concordance rate of 78.3%. Analysis of plasma samples with ddPCR detected RAS mutations in 2/10 tissue mutant, plasma wild-type patients. In contrast, in all tissue wild-type and plasma mutant cases, ddPCR or deep-sequencing analysis of tumor tissue confirmed the presence of RAS mutations at allelic frequencies ranging between 0.15% and 1.15%. The median progression-free survival of RAS mutant and wild-type patients according to tissue (7.9 versus 12.6 months; P = 0.004) and liquid biopsy testing (7.8 versus 13.8 moths; P < 0.001) were comparable. Similar findings were observed for the median overall survival of RAS mutant and wild-type patients based on tissue (22.1 versus 35.8 months; P = 0.016) and plasma (19.9 versus 35.8 months; P = 0.013) analysis. This study indicates that RAS testing of liquid biopsy results in a similar outcome when compared with tissue testing in mCRC patients receiving first-line anti-EGFR monoclonal antibodies. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

PubMed

Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

2017-12-01

We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

Enzymatic synthesis of random sequences of RNA and RNA analogues by DNA polymerase theta mutants for the generation of aptamer libraries.

PubMed

Randrianjatovo-Gbalou, Irina; Rosario, Sandrine; Sismeiro, Odile; Varet, Hugo; Legendre, Rachel; Coppée, Jean-Yves; Huteau, Valérie; Pochet, Sylvie; Delarue, Marc

2018-05-21

Nucleic acid aptamers, especially RNA, exhibit valuable advantages compared to protein therapeutics in terms of size, affinity and specificity. However, the synthesis of libraries of large random RNAs is still difficult and expensive. The engineering of polymerases able to directly generate these libraries has the potential to replace the chemical synthesis approach. Here, we start with a DNA polymerase that already displays a significant template-free nucleotidyltransferase activity, human DNA polymerase theta, and we mutate it based on the knowledge of its three-dimensional structure as well as previous mutational studies on members of the same polA family. One mutant exhibited a high tolerance towards ribonucleotides (NTPs) and displayed an efficient ribonucleotidyltransferase activity that resulted in the assembly of long RNA polymers. HPLC analysis and RNA sequencing of the products were used to quantify the incorporation of the four NTPs as a function of initial NTP concentrations and established the randomness of each generated nucleic acid sequence. The same mutant revealed a propensity to accept other modified nucleotides and to extend them in long fragments. Hence, this mutant can deliver random natural and modified RNA polymers libraries ready to use for SELEX, with custom lengths and balanced or unbalanced ratios.

A GA-insensitive dwarf mutant of Brassica napus L. correlated with mutation in pyrimidine box in the promoter of GID1.

PubMed

Li, Huapeng; Wang, Yun; Li, Xiaocheng; Gao, Yong; Wang, Zhijun; Zhao, Yun; Wang, Maolin

2011-01-01

A dwarf mutant from Brassica napus, namely NDF-1, which was derived from a high doubled haploid (DH) line '3529'(Brassica napus L.) of which seeds were jointly treated with chemical inducers and fast neutron bombardment, was revealed that dwarfism is under the control of a major gene(designated as ndf1) with a mainly additive effect and non-significant dominance effect. The germination and hypocotyls elongation response of dwarf mutants after exogenous GA and uniconazol application showed NDF-1 was a gibberellin insensitive dwarf. We cloned the Brassica napus GID1 gene, named BnGID1, and found it was the ortholog of AtGID1a. The sequence blasting of the BnGID1 genes from NDF-1 and wild type showed there was no mutant in the gene. But the quantitative RT-PCR analysis of GID1 EST pointed out the mutation was caused by the low-level expression of BnGID1 gene. After sequenced the BnGID1 gene's upstream, we found three bases mutated in the pyrimidine box (P-box) of the BnGID1 promoter, which is linkage with the dwarf mutant.

Comparative analysis of seven viral nuclear export signals (NESs) reveals the crucial role of nuclear export mediated by the third NES consensus sequence of nucleoprotein (NP) in influenza A virus replication.

PubMed

Chutiwitoonchai, Nopporn; Kakisaka, Michinori; Yamada, Kazunori; Aida, Yoko

2014-01-01

The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES) consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ) residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4) was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues) within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function during viral replication.

Search for methylation-sensitive amplification polymorphisms in mutant figs.

PubMed

Rodrigues, M G F; Martins, A B G; Bertoni, B W; Figueira, A; Giuliatti, S

2013-07-08

Fig (Ficus carica) breeding programs that use conventional approaches to develop new cultivars are rare, owing to limited genetic variability and the difficulty in obtaining plants via gamete fusion. Cytosine methylation in plants leads to gene repression, thereby affecting transcription without changing the DNA sequence. Previous studies using random amplification of polymorphic DNA and amplified fragment length polymorphism markers revealed no polymorphisms among select fig mutants that originated from gamma-irradiated buds. Therefore, we conducted methylation-sensitive amplified polymorphism analysis to verify the existence of variability due to epigenetic DNA methylation among these mutant selections compared to the main cultivar 'Roxo-de-Valinhos'. Samples of genomic DNA were double-digested with either HpaII (methylation sensitive) or MspI (methylation insensitive) and with EcoRI. Fourteen primer combinations were tested, and on an average, non-methylated CCGG, symmetrically methylated CmCGG, and hemimethylated hmCCGG sites accounted for 87.9, 10.1, and 2.0%, respectively. MSAP analysis was effective in detecting differentially methylated sites in the genomic DNA of fig mutants, and methylation may be responsible for the phenotypic variation between treatments. Further analyses such as polymorphic DNA sequencing are necessary to validate these differences, standardize the regions of methylation, and analyze reads using bioinformatic tools.

Molecular typing of a novel canine parvovirus type 2a mutant circulating in Italy.

PubMed

Mira, Francesco; Dowgier, Giulia; Purpari, Giuseppa; Vicari, Domenico; Di Bella, Santina; Macaluso, Giusi; Gucciardi, Francesca; Randazzo, Vincenzo; Decaro, Nicola; Guercio, Annalisa

2018-07-01

Canine parvovirus (CPV) is the etiological agent of a severe viral disease of dogs. After its emergence in late 1970s, the CPV original type (CPV-2) was rapidly and totally replaced by three antigenic variants named CPV-2a, CPV-2b and CPV-2c. CPV has an evolutionary rate nearest to those of RNA viruses, with consequences on disease diagnosis and epidemiology. This paper reports the molecular characterization of eight CPV-2a strains collected from dogs in Italy in 2016-2017. Genetic analysis was conducted on a CPV genomic region encompassing both open reading frames (ORFs) encoding for nonstructural (NS1-NS2) and structural proteins (VP1-VP2). Sequence analysis indicates new and unreported sequence changes, mainly affecting the VP2 gene, which included the mutation Tyr324Leu. This study represents the first evidence of a new CPV-2a mutant (VP2 324Leu) and illustrates the importance of a continuous molecular survey in order to obtain more information on effective spread of new CPV mutants. Copyright © 2018 Elsevier B.V. All rights reserved.

Characterizing visible and invisible cell wall mutant phenotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carpita, Nicholas C.; McCann, Maureen C.

2015-04-06

About 10% of a plant's genome is devoted to generating the protein machinery to synthesize, remodel, and deconstruct the cell wall. High-throughput genome sequencing technologies have enabled a reasonably complete inventory of wall-related genes that can be assembled into families of common evolutionary origin. Assigning function to each gene family member has been aided immensely by identification of mutants with visible phenotypes or by chemical and spectroscopic analysis of mutants with ‘invisible’ phenotypes of modified cell wall composition and architecture that do not otherwise affect plant growth or development. This review connects the inference of gene function on the basismore » of deviation from the wild type in genetic functional analyses to insights provided by modern analytical techniques that have brought us ever closer to elucidating the sequence structures of the major polysaccharide components of the plant cell wall.« less

Enhanced cellulase producing mutants developed from heterokaryotic Aspergillus strain.

PubMed

Kaur, Baljit; Oberoi, H S; Chadha, B S

2014-03-01

A heterokaryon 28, derived through protoplast fusion between Aspergillus nidulans and Aspergillus tubingensis (Dal8), was subjected cyclic mutagenesis followed by selection on increasing levels of 2-deoxy glucose (2-DG) as selection marker. The derived deregulated cellulase hyper producing mutant '64', when compared to fusant 28, produced 9.83, 7.8, 3.2, 4.2 and 19.74 folds higher endoglucanase, β-glucosidase, cellobiohydrolase, FPase and xylanase, respectively, under shake cultures. The sequence analysis of PCR amplified β-glucosidase gene from wild and mutant showed nucleotide deletion/substitution. The mutants showed highly catalytic efficient β-glucosidase as evident from low Km and high Vmax values. The expression profiling through zymogram analysis also indicated towards over-expression of cellulases. The up/down regulated expressed proteins observed through SDS-PAGE were identified by Peptide mass fingerprinting The cellulase produced by mutants in conjunction with cellulase free xylanase derived from Thermomyces lanuginosus was used for efficient utilization of alkali treated rice straw for obtaining xylo-oligosaccharides and ethanol. Copyright © 2014 Elsevier Ltd. All rights reserved.

Fine-Mapping and Analysis of Cgl1, a Gene Conferring Glossy Trait in Cabbage (Brassica oleracea L. var. capitata)

PubMed Central

Liu, Zezhou; Fang, Zhiyuan; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Liu, Yumei; Li, Zhansheng; Sun, Peitian; Tang, Jun; Liu, Dongming; Zhang, Zhenxian; Yang, Limei

2017-01-01

Cuticular waxes covering the outer plant surface impart a whitish appearance. Wax-less cabbage mutant shows glossy in leaf surface and plays important roles in riching cabbage germplasm resources and breeding brilliant green cabbage. This is the first report describing the characterization and fine-mapping of a wax biosynthesis gene using a novel glossy Brassica oleracea mutant. In the present paper, we identified a glossy cabbage mutant (line10Q-961) with a brilliant green phenotype. Genetic analyses indicated that the glossy trait was controlled by a single recessive gene. Preliminary mapping results using an F2 population containing 189 recessive individuals revealed that the Cgl1 gene was located at the end of chromosome C08. Several new markers closely linked to the target gene were designed according to the cabbage reference genome sequence. Another population of 1,172 recessive F2 individuals was used to fine-map the Cgl1 gene to a 188.7-kb interval between the C08SSR61 simple sequence repeat marker and the end of chromosome C08. There were 33 genes located in this region. According to gene annotation and homology analyses, the Bol018504 gene, which is a homolog of CER1 in Arabidopsis thaliana, was the most likely candidate for the Cgl1 gene. Its coding and promoter regions were sequenced, which indicated that the RNA splice site was altered because of a 2,722-bp insertion in the first intron of Bol018504 in the glossy mutant. Based on the FGENESH 2.6 prediction and sequence alignments, the PLN02869 domain, which controls fatty aldehyde decarbonylase activity, was absent from the Bol018504 gene of the 10Q-961 glossy mutant. We inferred that the inserted sequence in Bol018504 may result in the glossy cabbage mutant. This study represents the first step toward the characterization of cuticular wax biosynthesis in B. oleracea, and may contribute to the breeding of new cabbage varieties exhibiting a brilliant green phenotype. PMID:28265282

The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses.

PubMed

Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G

2002-07-01

Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants.

A novel NOTCH3 mutation identified in patients with oral cancer by whole exome sequencing.

PubMed

Yi, Yanjun; Tian, Zhuowei; Ju, Houyu; Ren, Guoxin; Hu, Jingzhou

2017-06-01

Oral cancer is a serious disease caused by environmental factors and/or susceptible genes. In the present study, in order to identify useful genetic biomarkers for cancer prediction and prevention, and for personalized treatment, we detected somatic mutations in 5 pairs of oral cancer tissues and blood samples using whole exome sequencing (WES). Finally, we confirmed a novel nonsense single-nucleotide polymorphism (SNP; chr19:15288426A>C) in the NOTCH3 gene with sanger sequencing, which resulted in a N1438T mutation in the protein sequence. Using multiple in silico analyses, this variant was found to mildly damaging effects on the NOTCH3 gene, which was supported by the results from analyses using PANTHER, SNAP and SNPs&GO. However, further analysis using Mutation Taster revealed that this SNP had a probability of 0.9997 to be 'disease causing'. In addition, we performed 3D structure simulation analysis and the results suggested that this variant had little effect on the solubility and hydrophobicity of the protein and thus on its function; however, it decreased the stability of the protein by increasing the total energy following minimization (-1,051.39 kcal/mol for the mutant and -1,229.84 kcal/mol for the native) and decreasing one stabilizing residue of the protein. Less stability of the N1438T mutant was also supported by analysis using I-Mutant with a DDG value of -1.67. Overall, the present study identified and confirmed a novel mutation in the NOTCH3 gene, which may decrease the stability of NOTCH3, and may thus prove to be helpful in cancer prognosis.

Analysis of consequences of non-synonymous SNP in feed conversion ratio associated TGF-β receptor type 3 gene in chicken.

PubMed

Rasal, Kiran D; Shah, Tejas M; Vaidya, Megha; Jakhesara, Subhash J; Joshi, Chaitanya G

2015-06-01

The recent advances in high throughput sequencing technology accelerate possible ways for the study of genome wide variation in several organisms and associated consequences. In the present study, mutations in TGFBR3 showing significant association with FCR trait in chicken during exome sequencing were further analyzed. Out of four SNPs, one nsSNP p.Val451Leu was found in the coding region of TGFBR3. In silico tools such as SnpSift and PANTHER predicted it as deleterious (0.04) and to be tolerated, respectively, while I-Mutant revealed that protein stability decreased. The TGFBR3 I-TASSER model has a C-score of 0.85, which was validated using PROCHECK. Based on MD simulation, mutant protein structure deviated from native with RMSD 0.08 Å due to change in the H-bonding distances of mutant residue. The docking of TGFBR3 with interacting TGFBR2 inferred that mutant required more global energy. Therefore, the present study will provide useful information about functional SNPs that have an impact on FCR traits.

Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

PubMed

Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

2010-04-01

The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

Structural analysis of key gap junction domains--Lessons from genome data and disease-linked mutants.

PubMed

Bai, Donglin

2016-02-01

A gap junction (GJ) channel is formed by docking of two GJ hemichannels and each of these hemichannels is a hexamer of connexins. All connexin genes have been identified in human, mouse, and rat genomes and their homologous genes in many other vertebrates are available in public databases. The protein sequences of these connexins align well with high sequence identity in the same connexin across different species. Domains in closely related connexins and several residues in all known connexins are also well-conserved. These conserved residues form signatures (also known as sequence logos) in these domains and are likely to play important biological functions. In this review, the sequence logos of individual connexins, groups of connexins with common ancestors, and all connexins are analyzed to visualize natural evolutionary variations and the hot spots for human disease-linked mutations. Several gap junction domains are homologous, likely forming similar structures essential for their function. The availability of a high resolution Cx26 GJ structure and the subsequently-derived homology structure models for other connexin GJ channels elevated our understanding of sequence logos at the three-dimensional GJ structure level, thus facilitating the understanding of how disease-linked connexin mutants might impair GJ structure and function. This knowledge will enable the design of complementary variants to rescue disease-linked mutants. Copyright © 2015 Elsevier Ltd. All rights reserved.

Imperfect duplicate insertions type of mutations in plasmepsin V modulates binding properties of PEXEL motifs of export proteins in Indian Plasmodium vivax.

PubMed

Rawat, Manmeet; Vijay, Sonam; Gupta, Yash; Tiwari, Pramod Kumar; Sharma, Arun

2013-01-01

Plasmepsin V (PM-V) have functionally conserved orthologues across the Plasmodium genus who's binding and antigenic processing at the PEXEL motifs for export about 200-300 essential proteins is important for the virulence and viability of the causative Plasmodium species. This study was undertaken to determine P. vivax plasmepsin V Ind (PvPM-V-Ind) PEXEL motif export pathway for pathogenicity-related proteins/antigens export thereby altering plasmodium exportome during erythrocytic stages. We identify and characterize Plasmodium vivax plasmepsin-V-Ind (mutant) gene by cloning, sequence analysis, in silico bioinformatic protocols and structural modeling predictions based on docking studies on binding capacity with PEXEL motifs processing in terms of binding and accessibility of export proteins. Cloning and sequence analysis for genetic diversity demonstrates PvPM-V-Ind (mutant) gene is highly conserved among all isolates from different geographical regions of India. Imperfect duplicate insertion types of mutations (SVSE from 246-249 AA and SLSE from 266-269 AA) were identified among all Indian isolates in comparison to P.vivax Sal-1 (PvPM-V-Sal 1) isolate. In silico bioinformatics interaction studies of PEXEL peptide and active enzyme reveal that PvPM-V-Ind (mutant) is only active in endoplasmic reticulum lumen and membrane embedding is essential for activation of plasmepsin V. Structural modeling predictions based on docking studies with PEXEL motif show significant variation in substrate protein binding of these imperfect mutations with data mined PEXEL sequences. The predicted variation in the docking score and interacting amino acids of PvPM-V-Ind (mutant) proteins with PEXEL and lopinavir suggests a modulation in the activity of PvPM-V in terms of binding and accessibility at these sites. Our functional modeled validation of PvPM-V-Ind (mutant) imperfect duplicate insertions with data mined PEXEL sequences leading to altered binding and substrate accessibility of the enzyme makes it a plausible target to investigate export mechanisms for in silico virtual screening and novel pharmacophore designing.

Imperfect Duplicate Insertions Type of Mutations in Plasmepsin V Modulates Binding Properties of PEXEL Motifs of Export Proteins in Indian Plasmodium vivax

PubMed Central

Rawat, Manmeet; Vijay, Sonam; Gupta, Yash; Tiwari, Pramod Kumar; Sharma, Arun

2013-01-01

Introduction Plasmepsin V (PM-V) have functionally conserved orthologues across the Plasmodium genus who's binding and antigenic processing at the PEXEL motifs for export about 200–300 essential proteins is important for the virulence and viability of the causative Plasmodium species. This study was undertaken to determine P. vivax plasmepsin V Ind (PvPM-V-Ind) PEXEL motif export pathway for pathogenicity-related proteins/antigens export thereby altering plasmodium exportome during erythrocytic stages. Method We identify and characterize Plasmodium vivax plasmepsin-V-Ind (mutant) gene by cloning, sequence analysis, in silico bioinformatic protocols and structural modeling predictions based on docking studies on binding capacity with PEXEL motifs processing in terms of binding and accessibility of export proteins. Results Cloning and sequence analysis for genetic diversity demonstrates PvPM-V-Ind (mutant) gene is highly conserved among all isolates from different geographical regions of India. Imperfect duplicate insertion types of mutations (SVSE from 246–249 AA and SLSE from 266–269 AA) were identified among all Indian isolates in comparison to P.vivax Sal-1 (PvPM-V-Sal 1) isolate. In silico bioinformatics interaction studies of PEXEL peptide and active enzyme reveal that PvPM-V-Ind (mutant) is only active in endoplasmic reticulum lumen and membrane embedding is essential for activation of plasmepsin V. Structural modeling predictions based on docking studies with PEXEL motif show significant variation in substrate protein binding of these imperfect mutations with data mined PEXEL sequences. The predicted variation in the docking score and interacting amino acids of PvPM-V-Ind (mutant) proteins with PEXEL and lopinavir suggests a modulation in the activity of PvPM-V in terms of binding and accessibility at these sites. Conclusion/Significance Our functional modeled validation of PvPM-V-Ind (mutant) imperfect duplicate insertions with data mined PEXEL sequences leading to altered binding and substrate accessibility of the enzyme makes it a plausible target to investigate export mechanisms for in silico virtual screening and novel pharmacophore designing. PMID:23555891

Fine mapping and candidate gene analysis of the virescent gene v 1 in Upland cotton (Gossypium hirsutum).

PubMed

Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun

2018-02-01

The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the associations of CHLI protein function and the chlorophyll biosynthesis pathway but also has implications for cotton breeding.

Caenorhabditis elegans syndecan (SDN-1) is required for normal egg laying and associates with the nervous system and the vulva.

PubMed

Minniti, Alicia N; Labarca, Mariana; Hurtado, Claudia; Brandan, Enrique

2004-10-01

In Caenorhabditis elegans, the identification of many enzymes involved in the synthesis and modification of glycosaminoglycans (GAGs), essential components of proteoglycans, has attained special attention in recent years. Mutations in all the genes that encode for GAG biosynthetic enzymes show defects in the development of the vulva, specifically in the invagination of the vulval epithelium. Mutants for certain heparan sulfate modifying enzymes present axonal and cellular guidance defects in specific neuronal classes. Although most of the enzymes involved in the biosynthesis and modification of heparan sulfate have been characterized in C. elegans, little is known regarding the core proteins to which these GAGs covalently bind in proteoglycans. A single syndecan homologue (sdn-1) has been identified in the C. elegans genome through sequence analysis. In the present study, we show that C. elegans synthesizes sulfated proteoglycans, seen as three distinct species in western blot analysis. In the sdn-1 (ok449) deletion mutant allele we observed the lack of one species, which corresponds to a 50 kDa product after heparitinase treatment. The expression of sdn-1 mRNA and sequencing revealed that sdn-1 (ok449) deletion mutants lack two glycosylation sites. Hence, the missing protein in the western blot analysis probably corresponds to SDN-1. In addition, we show that SDN-1 localizes to the C. elegans nerve ring, nerve cords and to the vulva. SDN-1 is found specifically phosphorylated in nerve ring neurons and in the vulva, in both wild-type worms and sdn-1 (ok449) deletion mutants. These mutants show a defective egg-laying phenotype. Our results show for the first time, the identification, localization and some functional aspects of syndecan in the nematode C. elegans.

Deep sequencing analysis of viral infection and evolution allows rapid and detailed characterization of viral mutant spectrum.

PubMed

Isakov, Ofer; Bordería, Antonio V; Golan, David; Hamenahem, Amir; Celniker, Gershon; Yoffe, Liron; Blanc, Hervé; Vignuzzi, Marco; Shomron, Noam

2015-07-01

The study of RNA virus populations is a challenging task. Each population of RNA virus is composed of a collection of different, yet related genomes often referred to as mutant spectra or quasispecies. Virologists using deep sequencing technologies face major obstacles when studying virus population dynamics, both experimentally and in natural settings due to the relatively high error rates of these technologies and the lack of high performance pipelines. In order to overcome these hurdles we developed a computational pipeline, termed ViVan (Viral Variance Analysis). ViVan is a complete pipeline facilitating the identification, characterization and comparison of sequence variance in deep sequenced virus populations. Applying ViVan on deep sequenced data obtained from samples that were previously characterized by more classical approaches, we uncovered novel and potentially crucial aspects of virus populations. With our experimental work, we illustrate how ViVan can be used for studies ranging from the more practical, detection of resistant mutations and effects of antiviral treatments, to the more theoretical temporal characterization of the population in evolutionary studies. Freely available on the web at http://www.vivanbioinfo.org : nshomron@post.tau.ac.il Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Structural analysis of α1,3-linked galactose-containing oligosaccharides in Schizosaccharomyces pombe mutants harboring single and multiple α-galactosyltransferase genes disruptions.

PubMed

Ohashi, Takao; Nakakita, Shin-ichi; Sumiyoshi, Wataru; Yamada, Naotaka; Ikeda, Yuka; Tanaka, Naotaka; Takegawa, Kaoru

2011-03-01

In the fission yeast Schizosaccharomyces pombe, galactose (Gal) residues are transferred to N- and O-linked oligosaccharides of glycoproteins by galactosyltransferases in the lumen of the Golgi apparatus. In S. pombe, the major in vitro α1,2-galactosyltransferase activity has been purified, the gma12(+) gene has been cloned, and three α-galactosyltransferase genes (gmh1(+)-gmh3(+)) have also been partially characterized. In this study, we found three additional uncharacterized genes with homology to gmh1(+) (gmh4(+)-gmh6(+)) in the fission yeast genome sequence. All possible single disruption mutants and the septuple disruption strain were constructed and characterized. The electrophoretic mobility of acid phosphatase prepared from gma12Δ, gmh2Δ, gmh3Δ and gmh6Δ mutants was higher than that from wild type, indicating that Gma12p, Gmh2p, Gmh3p and Gmh6p are required for the galactosylation of N-linked oligosaccharides. High-performance liquid chromatography (HPLC) analysis of pyridylaminated O-linked oligosaccharides from each single mutant showed that Gma12p, Gmh2p and Gmh6p are involved in galactosylation of O-linked oligosaccharides. The septuple mutant exhibited similar drug and temperature sensitivity as a gms1Δ mutant that is incapable of galactosylation. Oligosaccharide structural analysis based on HPLC and methylation analysis revealed that the septuple mutant still contained oligosaccharides consisting of α1,3-linked Gal residues, indicating that an unknown α1,3-galactosyltransferase activity was still present in the septuple mutant.

Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams

PubMed Central

Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N.; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun

2013-01-01

UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar ‘Sasanishiki’) that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined. PMID:23381954

Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams.

PubMed

Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun

2013-07-01

UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar 'Sasanishiki') that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined.

Functional census of mutation sequence spaces: The example of p53 cancer rescue mutants

PubMed Central

Danziger, Samuel A.; Swamidass, S. Joshua; Zeng, Jue; Dearth, Lawrence R.; Lu, Qiang; Chen, Jonathan H.; Cheng, Jainlin; Hoang, Vinh P.; Saigo, Hiroto; Luo, Ray; Baldi, Pierre; Brachmann, Rainer K.; Lathrop, Richard H.

2009-01-01

Many biomedical problems relate to mutant functional properties across a sequence space of interest, e.g., flu, cancer, and HIV. Detailed knowledge of mutant properties and function improves medical treatment and prevention. A functional census of p53 cancer rescue mutants would aid the search for cancer treatments from p53 rescue. We devised a general methodology for conducting a functional census of a mutation sequence space, and conducted a double-blind predictive test on the functional rescue property of 71 novel putative p53 cancer rescue mutants iteratively predicted in sets of 3. Double-blind predictive accuracy (15-point moving window) rose from 47% to 86% over the trial (r = 0.74). Code and data are available upon request1. PMID:17048398

Distinct cellular properties of oncogenic KIT receptor tyrosine kinase mutants enable alternative courses of cancer cell inhibition

PubMed Central

Shi, Xiarong; Sousa, Leiliane P.; Mandel-Bausch, Elizabeth M.; Tome, Francisco; Reshetnyak, Andrey V.; Hadari, Yaron; Schlessinger, Joseph; Lax, Irit

2016-01-01

Large genomic sequencing analysis as part of precision medicine efforts revealed numerous activating mutations in receptor tyrosine kinases, including KIT. Unfortunately, a single approach is not effective for inhibiting cancer cells or treating cancers driven by all known oncogenic KIT mutants. Here, we show that each of the six major KIT oncogenic mutants exhibits different enzymatic, cellular, and dynamic properties and responds distinctly to different KIT inhibitors. One class of KIT mutants responded well to anti-KIT antibody treatment alone or in combination with a low dose of tyrosine kinase inhibitors (TKIs). A second class of KIT mutants, including a mutant resistant to imatinib treatment, responded well to a combination of TKI with anti-KIT antibodies or to anti-KIT toxin conjugates, respectively. We conclude that the preferred choice of precision medicine treatments for cancers driven by activated KIT and other RTKs may rely on clear understanding of the dynamic properties of oncogenic mutants. PMID:27482095

A dual selection based, targeted gene replacement tool for Magnaporthe grisea and Fusarium oxysporum.

PubMed

Khang, Chang Hyun; Park, Sook-Young; Lee, Yong-Hwan; Kang, Seogchan

2005-06-01

Rapid progress in fungal genome sequencing presents many new opportunities for functional genomic analysis of fungal biology through the systematic mutagenesis of the genes identified through sequencing. However, the lack of efficient tools for targeted gene replacement is a limiting factor for fungal functional genomics, as it often necessitates the screening of a large number of transformants to identify the desired mutant. We developed an efficient method of gene replacement and evaluated factors affecting the efficiency of this method using two plant pathogenic fungi, Magnaporthe grisea and Fusarium oxysporum. This method is based on Agrobacterium tumefaciens-mediated transformation with a mutant allele of the target gene flanked by the herpes simplex virus thymidine kinase (HSVtk) gene as a conditional negative selection marker against ectopic transformants. The HSVtk gene product converts 5-fluoro-2'-deoxyuridine to a compound toxic to diverse fungi. Because ectopic transformants express HSVtk, while gene replacement mutants lack HSVtk, growing transformants on a medium amended with 5-fluoro-2'-deoxyuridine facilitates the identification of targeted mutants by counter-selecting against ectopic transformants. In addition to M. grisea and F. oxysporum, the method and associated vectors are likely to be applicable to manipulating genes in a broad spectrum of fungi, thus potentially serving as an efficient, universal functional genomic tool for harnessing the growing body of fungal genome sequence data to study fungal biology.

Analysis of mutational spectra by denaturant capillary electrophoresis

PubMed Central

Ekstrøm, Per O.; Khrapko, Konstantin; Li-Sucholeiki, Xiao-Cheng; Hunter, Ian W.; Thilly, William G.

2009-01-01

Numbers and kinds of point mutant within DNA from cells, tissues and human population may be discovered for nearly any 75–250bp DNA sequence. High fidelity DNA amplification incorporating a thermally stable DNA “clamp” is followed by separation by denaturing capillary electrophoresis (DCE). DCE allows for peak collection and verification sequencing. DCE in a mode of cycling temperature, e.g.+/− 5°C, CyDCE, permits high resolution of mutant sequences using computer defined analytes without preliminary optimization experiments. DNA sequencers have been modified to permit higher throughput CyDCE and a massively parallel,~25,000 capillary system, has been designed for pangenomic scans in large human populations. DCE has been used to define quantitative point mutational spectra for study a wide variety of genetic phenomena: errors of DNA polymerases, mutations induced in human cells by chemicals and irradiation, testing of human gene-common disease associations and the discovery of origins of point mutations in human development and carcinogenesis. PMID:18600220

Highly Efficient Targeted Mutagenesis in Mice Using TALENs

PubMed Central

Panda, Sudeepta Kumar; Wefers, Benedikt; Ortiz, Oskar; Floss, Thomas; Schmid, Bettina; Haass, Christian; Wurst, Wolfgang; Kühn, Ralf

2013-01-01

Targeted mouse mutants are instrumental for the analysis of gene function in health and disease. We recently provided proof-of-principle for the fast-track mutagenesis of the mouse genome, using transcription activator-like effector nucleases (TALENs) in one-cell embryos. Here we report a routine procedure for the efficient production of disease-related knockin and knockout mutants, using improved TALEN mRNAs that include a plasmid-coded poly(A) tail (TALEN-95A), circumventing the problematic in vitro polyadenylation step. To knock out the C9orf72 gene as a model of frontotemporal lobar degeneration, TALEN-95A mutagenesis induced sequence deletions in 41% of pups derived from microinjected embryos. Using TALENs together with mutagenic oligodeoxynucleotides, we introduced amyotrophic lateral sclerosis patient-derived missense mutations in the fused in sarcoma (Fus) gene at a rate of 6.8%. For the simple identification of TALEN-induced mutants and their progeny we validate high-resolution melt analysis (HRMA) of PCR products as a sensitive and universal genotyping tool. Furthermore, HRMA of off-target sites in mutant founder mice revealed no evidence for undesired TALEN-mediated processing of related genomic sequences. The combination of TALEN-95A mRNAs for enhanced mutagenesis and of HRMA for simplified genotyping enables the accelerated, routine production of new mouse models for the study of genetic disease mechanisms. PMID:23979585

Sequenced sorghum mutant library- an efficient platform for discovery of causal gene mutations

USDA-ARS?s Scientific Manuscript database

Ethyl methanesulfonate (EMS) efficiently generates high-density mutations in genomes. We applied whole-genome sequencing to 256 phenotyped mutant lines of sorghum (Sorghum bicolor L. Moench) to 16x coverage. Comparisons with the reference sequence revealed >1.8 million canonical EMS-induced G/C to A...

Detection of BRAF mutations from solid tumors using Tumorplex™ technology

PubMed Central

Yo, Jacob; Hay, Katie S.L.; Vinayagamoorthy, Dilanthi; Maryanski, Danielle; Carter, Mark; Wiegel, Joseph; Vinayagamoorthy, Thuraiayah

2015-01-01

Allele specific multiplex sequencing (Tumorplex™) is a new molecular platform for the detection of single base mutation in tumor biopsies with high sensitivity for clinical testing. Tumorplex™ is a novel modification of Sanger sequencing technology that generates both mutant and wild type nucleotide sequences simultaneously in the same electropherogram. The molecular weight of the two sequencing primers are different such that the two sequences generated are separated, thus eliminating possible suppression of mutant signal by the more abundant wild type signal. Tumorplex™ platform technology was tested using BRAF mutation V600E. These studies were performed with cloned BRAF mutations and genomic DNA extracted from tumor cells carrying 50% mutant allele. The lower limit of detection for BRAF V600E was found to be 20 genome equivalents (GE) using genomic DNA extracted from mutation specific cell lines. Sensitivity of the assay was tested by challenging the mutant allele with wild type allele at 20 GE, and was able to detect BRAF mutant signal at a GE ration of 20:1 × 107 (mutant to wild-type). This level of sensitivity can detect low abundance of clonal mutations in tumor biopsies and eliminate the need for cell enrichment. • Tumorplex™ is a single tube assay that permits the recognition of mutant allele without suppression by wildtype signal. • Tumorplex™ provides a high level of sensitivity. • Tumorplex™ can be used with small sample size with mixed population of cells carrying heterogeneous gDNA. PMID:26258049

Culture adaptation of malaria parasites selects for convergent loss-of-function mutants.

PubMed

Claessens, Antoine; Affara, Muna; Assefa, Samuel A; Kwiatkowski, Dominic P; Conway, David J

2017-01-24

Cultured human pathogens may differ significantly from source populations. To investigate the genetic basis of laboratory adaptation in malaria parasites, clinical Plasmodium falciparum isolates were sampled from patients and cultured in vitro for up to three months. Genome sequence analysis was performed on multiple culture time point samples from six monoclonal isolates, and single nucleotide polymorphism (SNP) variants emerging over time were detected. Out of a total of five positively selected SNPs, four represented nonsense mutations resulting in stop codons, three of these in a single ApiAP2 transcription factor gene, and one in SRPK1. To survey further for nonsense mutants associated with culture, genome sequences of eleven long-term laboratory-adapted parasite strains were examined, revealing four independently acquired nonsense mutations in two other ApiAP2 genes, and five in Epac. No mutants of these genes exist in a large database of parasite sequences from uncultured clinical samples. This implicates putative master regulator genes in which multiple independent stop codon mutations have convergently led to culture adaptation, affecting most laboratory lines of P. falciparum. Understanding the adaptive processes should guide development of experimental models, which could include targeted gene disruption to adapt fastidious malaria parasite species to culture.

Identification of Novel Virulence Determinants in Mycobacterium paratuberculosis by Screening a Library of Insertional Mutants†

PubMed Central

Shin, Sung Jae; Wu, Chia-wei; Steinberg, Howard; Talaat, Adel M.

2006-01-01

Johne's disease, caused by Mycobacterium paratuberculosis infection, is a worldwide problem for the dairy industry and has a possible involvement in Crohn's disease in humans. To identify virulence determinants of this economically important pathogen, a library of 5,060 transposon mutants was constructed using Tn5367 insertion mutagenesis, followed by large-scale sequencing to identify disrupted genes. In this report, 1,150 mutants were analyzed and 970 unique insertion sites were identified. Sequence analysis of the disrupted genes indicated that the insertion of Tn5367 was more prevalent in genomic regions with G+C content (50.5 to 60.5%) lower than the average G+C content (69.3%) of the rest of the genome. Phenotypic screening of the library identified disruptions of genes involved in iron, tryptophan, or mycolic acid metabolic pathways that displayed unique growth characteristics. Bioinformatic analysis of disrupted genes identified a list of potential virulence determinants for further testing with animals. Mouse infection studies showed a significant decrease in tissue colonization by mutants with a disruption in the gcpE, pstA, kdpC, papA2, impA, umaA1, or fabG2_2 gene. Attenuation phenotypes were tissue specific (e.g., for the umaA1 mutant) as well as time specific (e.g., for the impA mutant), suggesting that those genes may be involved in different virulence mechanisms. The identified potential virulence determinants represent novel functional classes that could be necessary for mycobacterial survival during infection and could provide suitable targets for vaccine and drug development against Johne's and Crohn's diseases. PMID:16790754

Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

1994-04-01

The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

Analysis of Induced Pluripotent Stem Cells from a BRCA1 Mutant Family

PubMed Central

Soyombo, Abigail A.; Wu, Yipin; Kolski, Lauren; Rios, Jonathan J.; Rakheja, Dinesh; Chen, Alice; Kehler, James; Hampel, Heather; Coughran, Alanna; Ross, Theodora S.

2013-01-01

Summary Understanding BRCA1 mutant cancers is hampered by difficulties in obtaining primary cells from patients. We therefore generated and characterized 24 induced pluripotent stem cell (iPSC) lines from fibroblasts of eight individuals from a BRCA1 5382insC mutant family. All BRCA1 5382insC heterozygous fibroblasts, iPSCs, and teratomas maintained equivalent expression of both wild-type and mutant BRCA1 transcripts. Although no difference in differentiation capacity was observed between BRCA1 wild-type and mutant iPSCs, there was elevated protein kinase C-theta (PKC-theta) in BRCA1 mutant iPSCs. Cancer cell lines with BRCA1 mutations and hormone-receptor-negative breast cancers also displayed elevated PKC-theta. Genome sequencing of the 24 iPSC lines showed a similar frequency of reprogramming-associated de novo mutations in BRCA1 mutant and wild-type iPSCs. These data indicate that iPSC lines can be derived from BRCA1 mutant fibroblasts to study the effects of the mutation on gene expression and genome stability. PMID:24319668

Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

PubMed Central

Robson, Nicole D.; Telesnitsky, Alice

2000-01-01

Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

Mutations in the profilin 1 gene cause familial amyotrophic lateral sclerosis.

PubMed

Wu, Chi-Hong; Fallini, Claudia; Ticozzi, Nicola; Keagle, Pamela J; Sapp, Peter C; Piotrowska, Katarzyna; Lowe, Patrick; Koppers, Max; McKenna-Yasek, Diane; Baron, Desiree M; Kost, Jason E; Gonzalez-Perez, Paloma; Fox, Andrew D; Adams, Jenni; Taroni, Franco; Tiloca, Cinzia; Leclerc, Ashley Lyn; Chafe, Shawn C; Mangroo, Dev; Moore, Melissa J; Zitzewitz, Jill A; Xu, Zuo-Shang; van den Berg, Leonard H; Glass, Jonathan D; Siciliano, Gabriele; Cirulli, Elizabeth T; Goldstein, David B; Salachas, Francois; Meininger, Vincent; Rossoll, Wilfried; Ratti, Antonia; Gellera, Cinzia; Bosco, Daryl A; Bassell, Gary J; Silani, Vincenzo; Drory, Vivian E; Brown, Robert H; Landers, John E

2012-08-23

Amyotrophic lateral sclerosis (ALS) is a late-onset neurodegenerative disorder resulting from motor neuron death. Approximately 10% of cases are familial (FALS), typically with a dominant inheritance mode. Despite numerous advances in recent years, nearly 50% of FALS cases have unknown genetic aetiology. Here we show that mutations within the profilin 1 (PFN1) gene can cause FALS. PFN1 is crucial for the conversion of monomeric (G)-actin to filamentous (F)-actin. Exome sequencing of two large ALS families showed different mutations within the PFN1 gene. Further sequence analysis identified 4 mutations in 7 out of 274 FALS cases. Cells expressing PFN1 mutants contain ubiquitinated, insoluble aggregates that in many cases contain the ALS-associated protein TDP-43. PFN1 mutants also display decreased bound actin levels and can inhibit axon outgrowth. Furthermore, primary motor neurons expressing mutant PFN1 display smaller growth cones with a reduced F/G-actin ratio. These observations further document that cytoskeletal pathway alterations contribute to ALS pathogenesis.

Characterizing visible and invisible cell wall mutant phenotypes.

PubMed

Carpita, Nicholas C; McCann, Maureen C

2015-07-01

About 10% of a plant's genome is devoted to generating the protein machinery to synthesize, remodel, and deconstruct the cell wall. High-throughput genome sequencing technologies have enabled a reasonably complete inventory of wall-related genes that can be assembled into families of common evolutionary origin. Assigning function to each gene family member has been aided immensely by identification of mutants with visible phenotypes or by chemical and spectroscopic analysis of mutants with 'invisible' phenotypes of modified cell wall composition and architecture that do not otherwise affect plant growth or development. This review connects the inference of gene function on the basis of deviation from the wild type in genetic functional analyses to insights provided by modern analytical techniques that have brought us ever closer to elucidating the sequence structures of the major polysaccharide components of the plant cell wall. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Identification of an EMS-induced causal mutation in a gene required for boron-mediated root development by low-coverage genome re-sequencing in Arabidopsis

PubMed Central

Tabata, Ryo; Kamiya, Takehiro; Shigenobu, Shuji; Yamaguchi, Katsushi; Yamada, Masashi; Hasebe, Mitsuyasu; Fujiwara, Toru; Sawa, Shinichiro

2013-01-01

Next-generation sequencing (NGS) technologies enable the rapid production of an enormous quantity of sequence data. These powerful new technologies allow the identification of mutations by whole-genome sequencing. However, most reported NGS-based mapping methods, which are based on bulked segregant analysis, are costly and laborious. To address these limitations, we designed a versatile NGS-based mapping method that consists of a combination of low- to medium-coverage multiplex SOLiD (Sequencing by Oligonucleotide Ligation and Detection) and classical genetic rough mapping. Using only low to medium coverage reduces the SOLiD sequencing costs and, since just 10 to 20 mutant F2 plants are required for rough mapping, the operation is simple enough to handle in a laboratory with limited space and funding. As a proof of principle, we successfully applied this method to identify the CTR1, which is involved in boron-mediated root development, from among a population of high boron requiring Arabidopsis thaliana mutants. Our work demonstrates that this NGS-based mapping method is a moderately priced and versatile method that can readily be applied to other model organisms. PMID:23104114

A Reverse-Genetics Mutational Analysis of the Barley HvDWARF Gene Results in Identification of a Series of Alleles and Mutants with Short Stature of Various Degree and Disturbance in BR Biosynthesis Allowing a New Insight into the Process.

PubMed

Gruszka, Damian; Gorniak, Malgorzata; Glodowska, Ewelina; Wierus, Ewa; Oklestkova, Jana; Janeczko, Anna; Maluszynski, Miroslaw; Szarejko, Iwona

2016-04-22

Brassinosteroids (BRs) are plant steroid hormones, regulating a broad range of physiological processes. The largest amount of data related with BR biosynthesis has been gathered in Arabidopsis thaliana, however understanding of this process is far less elucidated in monocot crops. Up to now, only four barley genes implicated in BR biosynthesis have been identified. Two of them, HvDWARF and HvBRD, encode BR-6-oxidases catalyzing biosynthesis of castasterone, but their relation is not yet understood. In the present study, the identification of the HvDWARF genomic sequence, its mutational and functional analysis and characterization of new mutants are reported. Various types of mutations located in different positions within functional domains were identified and characterized. Analysis of their impact on phenotype of the mutants was performed. The identified homozygous mutants show reduced height of various degree and disrupted skotomorphogenesis. Mutational analysis of the HvDWARF gene with the "reverse genetics" approach allowed for its detailed functional analysis at the level of protein functional domains. The HvDWARF gene function and mutants' phenotypes were also validated by measurement of endogenous BR concentration. These results allowed a new insight into the BR biosynthesis in barley.

An exploration of the sequence of a 2.9-Mb region of the genome of Drosophila melanogaster: the Adh region.

PubMed Central

Ashburner, M; Misra, S; Roote, J; Lewis, S E; Blazej, R; Davis, T; Doyle, C; Galle, R; George, R; Harris, N; Hartzell, G; Harvey, D; Hong, L; Houston, K; Hoskins, R; Johnson, G; Martin, C; Moshrefi, A; Palazzolo, M; Reese, M G; Spradling, A; Tsang, G; Wan, K; Whitelaw, K; Celniker, S

1999-01-01

A contiguous sequence of nearly 3 Mb from the genome of Drosophila melanogaster has been sequenced from a series of overlapping P1 and BAC clones. This region covers 69 chromosome polytene bands on chromosome arm 2L, including the genetically well-characterized "Adh region." A computational analysis of the sequence predicts 218 protein-coding genes, 11 tRNAs, and 17 transposable element sequences. At least 38 of the protein-coding genes are arranged in clusters of from 2 to 6 closely related genes, suggesting extensive tandem duplication. The gene density is one protein-coding gene every 13 kb; the transposable element density is one element every 171 kb. Of 73 genes in this region identified by genetic analysis, 49 have been located on the sequence; P-element insertions have been mapped to 43 genes. Ninety-five (44%) of the known and predicted genes match a Drosophila EST, and 144 (66%) have clear similarities to proteins in other organisms. Genes known to have mutant phenotypes are more likely to be represented in cDNA libraries, and far more likely to have products similar to proteins of other organisms, than are genes with no known mutant phenotype. Over 650 chromosome aberration breakpoints map to this chromosome region, and their nonrandom distribution on the genetic map reflects variation in gene spacing on the DNA. This is the first large-scale analysis of the genome of D. melanogaster at the sequence level. In addition to the direct results obtained, this analysis has allowed us to develop and test methods that will be needed to interpret the complete sequence of the genome of this species.Before beginning a Hunt, it is wise to ask someone what you are looking for before you begin looking for it. Milne 1926 PMID:10471707

Mapping the neutralizing epitopes on the glycoprotein of infectious haematopoietic necrosis virus, a fish rhabdovirus

USGS Publications Warehouse

Huang, C.; Chien, M.S.; Landolt, M.L.; Batts, W.; Winton, J.

1996-01-01

Twelve neutralizing monoclonal antibodies (MAbs) against the fish rhabdovirus, infectious haematopoietic necrosis virus (IHNV), were used to select 20 MAb escape mutants. The nucleotide sequence of the entire glycoprotein (G) gene was determined for six mutants representing differing cross-neutralization patterns and each had a single nucleotide change leading to a single amino acid substitution within one of three regions of the protein. These data were used to design nested PCR primers to amplify portions of the G gene of the 14 remaining mutants. When the PCR products from these mutants were sequenced, they also had single nucleotide substitutions coding for amino acid substitutions at the same, or nearby, locations. Of the 20 mutants for which all or part of the glycoprotein gene was sequenced, two MAbs selected mutants with substitutions at amino acids 230-231 (antigenic site I) and the remaining MAbs selected mutants with substitutions at amino acids 272-276 (antigenic site II). Two MAbs that selected mutants mapping to amino acids 272-276, selected other mutants that mapped to amino acids 78-81, raising the possibility that this portion of the N terminus of the protein was part of a discontinuous epitope defining antigenic site II. CLUSTAL alignment of the glycoproteins of rabies virus, vesicular stomatitis virus and IHNV revealed similarities in the location of the neutralizing epitopes and a high degree of conservation among cysteine residues, indicating that the glycoproteins of three different genera of animal rhabdoviruses may share a similar three-dimensional structure in spite of extensive sequence divergence.

A Spore Coat Protein, CotS, of Bacillus subtilis Is Synthesized under the Regulation of ςK and GerE during Development and Is Located in the Inner Coat Layer of Spores

PubMed Central

Takamatsu, Hiromu; Chikahiro, Yukari; Kodama, Takeko; Koide, Hidekatsu; Kozuka, Satoshi; Tochikubo, Kunio; Watabe, Kazuhito

1998-01-01

The spore coat of Bacillus subtilis has a unique morphology and consists of polypeptides of different sizes, whose synthesis and assembly are precisely regulated by a cascade of transcription factors and regulatory proteins. We examined the factors that regulate cotS gene expression and CotS assembly into the coat layer of B. subtilis by Northern blot and Western blot analysis. Transcription of cotS mRNA was not detected in sporulating cells of ςK and gerE mutants by Northern blot analysis. By Western blot analysis using anti-CotS antibody, CotS was first detected in protein samples solubilized from wild-type cells at 5 h after the start of sporulation. CotS was not detected in the vegetative cells and spores of a gerE mutant or in the spores of mutants deficient in ςE, ςF, ςG, or ςK. CotS was detected in the sporangium but not in the spores of a cotE mutant. The sequence of the promoter region of cotS was similar to the consensus sequences for binding of ςK and GerE. These results demonstrate that ςK and GerE are required for cotS expression and that CotE is essential for the assembly of CotS in the coat. Immunoelectron microscopic observation using anti-CotS antibody revealed that CotS is located within the spore coat, in particular in the inner coats of dormant spores. PMID:9603889

Amino acid substitutions in subunit 9 of the mitochondrial ATPase complex of Saccharomyces cerevisiae. Sequence analysis of a series of revertants of an oli1 mit- mutant carrying an amino acid substitution in the hydrophilic loop of subunit 9.

PubMed

Willson, T A; Nagley, P

1987-09-01

This work concerns a biochemical genetic study of subunit 9 of the mitochondrial ATPase complex of Saccharomyces cerevisiae. Subunit 9, encoded by the mitochondrial oli1 gene, contains a hydrophilic loop connecting two transmembrane stems. In one particular oli1 mit- mutant 2422, the substitution of a positively charged amino acid in this loop (Arg39----Met) renders the ATPase complex non-functional. A series of 20 revertants, selected for their ability to grow on nonfermentable substrates, has been isolated from mutant 2422. The results of DNA sequence analysis of the oli1 gene in each revertant have led to the recognition of three groups of revertants. Class I revertants have undergone a same-site reversion event: the mutant Met39 is replaced either by arginine (as in wild-type) or lysine. Class II revertants maintain the mutant Met39 residue, but have undergone a second-site reversion event (Asn35----Lys). Two revertants showing an oligomycin-resistant phenotype carry this same second-site reversion in the loop region together with a further amino acid substitution in either of the two membrane-spanning segments of subunit 9 (either Gly23----Ser or Leu53----Phe). Class III revertants contain subunit 9 with the original mutant 2422 sequence, and additionally carry a recessive nuclear suppressor, demonstrated to represent a single gene. The results on the revertants in classes I and II indicate that there is a strict requirement for a positively charged residue in the hydrophilic loop close to the boundary of the lipid bilayer. The precise location of this positive charge is less stringent; in functional ATPase complexes it can be found at either residue 39 or 35. This charged residue is possibly required to interact with some other component of the mitochondrial ATPase complex. These findings, together with hydropathy plots of subunit 9 polypeptides from normal, mutant and revertant strains, led to the conclusion that the hydrophilic loop in normal subunit 9 extends further than previously suggested, with the boundary of the N-terminal membrane-embedded stem lying at residue 34. The possibility is raised that the observed suppression of the 2422 mutant phenotype in class III revertants is manifested through an accommodating change in a nuclear-encoded subunit of the ATPase complex.

Molecular analysis of rice plant mutated after space flight

NASA Astrophysics Data System (ADS)

Cheng, Z.; Li, C.; Wei, L.; Xu, D.; Gu, D.; Guan, S.; Zhao, H.; Xin, P.; Sun, Y.

We have obtained several rice mutants planted from seeds flown on recoverable satellites. Some new traits, such as good yields, diseases resistances and higher nutrient values, have been identified, putatively as consequences of the space environment. Radiation inside the Chinese recoverable satellite was composed of low flux of high energy particles (>40 Mev/u). To study the mechanisms of plant mutations induced by the space environment, we used dry rice seeds as a model to identify the phenotype of mutations, and used the wealth of the rice genome to identify the mutated genes in the mutants. The research included collecting rice plant mutants in the seeds flown on the satellites, identifying the nature of genomic and proteomic alterations, modifications and identifying the functional changes of the specific genes. The study showed that the rice seeds are a good model for exploring biological effect of space environment since 1) it is easy fly the seeds without specific hardware and crew work, 2) it is easy to obtain pure mutant breed lines for cloning DNA sequence in order to compare with the sequence in the wild type, and 3) it is easy to quantitatively analyze genetics using advanced molecular techniques.

Identification of a Pantoea Biosynthetic Cluster That Directs the Synthesis of an Antimicrobial Natural Product

PubMed Central

Walterson, Alyssa M.; Smith, Derek D. N.; Stavrinides, John

2014-01-01

Fire Blight is a destructive disease of apple and pear caused by the enteric bacterial pathogen, Erwinia amylovora. E. amylovora initiates infection by colonizing the stigmata of apple and pear trees, and entering the plants through natural openings. Epiphytic populations of the related enteric bacterium, Pantoea, reduce the incidence of disease through competition and antibiotic production. In this study, we identify an antibiotic from Pantoea ananatis BRT175, which is effective against E. amylovora and select species of Pantoea. We used transposon mutagenesis to create a mutant library, screened approximately 5,000 mutants for loss of antibiotic production, and recovered 29 mutants. Sequencing of the transposon insertion sites of these mutants revealed multiple independent disruptions of an 8.2 kb cluster consisting of seven genes, which appear to be coregulated. An analysis of the distribution of this cluster revealed that it was not present in any other of our 115 Pantoea isolates, or in any of the fully sequenced Pantoea genomes, and is most closely related to antibiotic biosynthetic clusters found in three different species of Pseudomonas. This identification of this biosynthetic cluster highlights the diversity of natural products produced by Pantoea. PMID:24796857

A single base change in the acceptor stem of tRNA(3Leu) confers resistance upon Escherichia coli to the calmodulin inhibitor, 48/80.

PubMed Central

Chen, M X; Bouquin, N; Norris, V; Casarégola, S; Séror, S J; Holland, I B

1991-01-01

We have isolated several classes of spontaneous mutants resistant to the calmodulin inhibitor 48/80 which inhibits cell division in Escherichia coli K12. Several mutants were also temperature sensitive for growth and this property was exploited to clone a DNA fragment from an E. coli gene library restoring growth at 42 degrees C and drug sensitivity at 30 degrees C in one such mutant. Physical and genetic mapping confirmed that both the mutation and the cloned DNA were located at 15.5 min on the E. coli chromosome at a locus designated feeB. By subcloning, complementation analysis and sequencing, the feeB locus was identified as identical to the tRNA(CUALEU) gene. When the mutant locus was isolated and sequenced, the mutation was confirmed as a single base change, C to A, at position 77 in the acceptor stem of this rare Leu tRNA. In other studies we obtained evidence that this mutant tRNA, recognizing the rare Leu codon, CUA, was defective in translation at both permissive and non-permissive temperatures. The feeB1 mutant is defective in division and shows a reduced growth rate at non-permissive temperature. We discuss the possibility that the mutant tRNA(3Leu) is limiting for the synthesis of a polypeptide(s), requiring several CUA codons for translation which in turn regulates in some way the level or activity of the drug target, a putative cell cycle protein. Images PMID:1915285

Map-based cloning and characterization of the novel yellow-green leaf gene ys83 in rice (Oryza sativa).

PubMed

Ma, Xiaozhi; Sun, Xiaoqiu; Li, Chunmei; Huan, Rui; Sun, Changhui; Wang, Yang; Xiao, Fuliang; Wang, Qian; Chen, Purui; Ma, Furong; Zhang, Kuan; Wang, Pingrong; Deng, Xiaojian

2017-02-01

Leaf-color mutants have been extensively studied in rice, and many corresponding genes have been identified up to now. However, leaf-color mutation mechanisms are diverse and still need further research through identification of novel genes. In the present paper, we isolated a leaf-color mutant, ys83, in rice (Oryza sativa). The mutant displayed a yellow-green leaf phenotype at seedling stage, and then slowly turned into light-green leaf from late tillering stage. In its yellow leaves, photosynthetic pigment contents significantly decreased and the chloroplast development was retarded. The mutant phenotype was controlled by a recessive mutation in a nuclear gene on the short arm of rice chromosome 2. Map-based cloning and sequencing analysis suggested that the candidate gene was YS83 (LOC_Os02g05890) encoding a protein containing 165 amino acid residues. Gene YS83 was expressed in a wide range of tissues, and its encoded protein was targeted to the chloroplast. In the mutant, a T-to-A substitution occurred in coding sequence of gene YS83, which caused a premature translation of its encoded product. By introduction of the wild-type gene, the ys83 mutant recovered to normal green-leaf phenotype. Taken together, we successfully identified a novel yellow-green leaf gene YS83. In addition, number of productive panicles per plant and number of spikelets per panicle only reduced by 6.7% and 7.6%, respectively, meanwhile its seed setting rate and 1000-grain weight (seed size) were not significantly affected in the mutant, so leaf-color mutant gene ys83 could be used as a trait marker gene in commercial hybrid rice production. Copyright © 2016. Published by Elsevier Masson SAS.

Screening of whole genome sequences identified high-impact variants for stallion fertility.

PubMed

Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar

2016-04-14

Stallion fertility is an economically important trait due to the increase of artificial insemination in horses. The availability of whole genome sequence data facilitates identification of rare high-impact variants contributing to stallion fertility. The aim of our study was to genotype rare high-impact variants retrieved from next-generation sequencing (NGS)-data of 11 horses in order to unravel harmful genetic variants in large samples of stallions. Gene ontology (GO) terms and search results from public databases were used to obtain a comprehensive list of human und mice genes predicted to participate in the regulation of male reproduction. The corresponding equine orthologous genes were searched in whole genome sequence data of seven stallions and four mares and filtered for high-impact genetic variants using SnpEFF, SIFT and Polyphen 2 software. All genetic variants with the missing homozygous mutant genotype were genotyped on 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. Mixed linear model analysis was employed for an association analysis with de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). We screened next generation sequenced data of whole genomes from 11 horses for equine genetic variants in 1194 human and mice genes involved in male fertility and linked through common gene ontology (GO) with male reproductive processes. Variants were filtered for high-impact on protein structure and validated through SIFT and Polyphen 2. Only those genetic variants were followed up when the homozygote mutant genotype was missing in the detection sample comprising 11 horses. After this filtering process, 17 single nucleotide polymorphism (SNPs) were left. These SNPs were genotyped in 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. An association analysis in 216 Hanoverian stallions revealed a significant association of the splice-site disruption variant g.37455302G>A in NOTCH1 with the de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). For 9 high-impact variants within the genes CFTR, OVGP1, FBXO43, TSSK6, PKD1, FOXP1, TCP11, SPATA31E1 and NOTCH1 (g.37453246G>C) absence of the homozygous mutant genotype in the validation sample of all 337 fertile stallions was obvious. Therefore, these variants were considered as potentially deleterious factors for stallion fertility. In conclusion, this study revealed 17 genetic variants with a predicted high damaging effect on protein structure and missing homozygous mutant genotype. The g.37455302G>A NOTCH1 variant was identified as a significant stallion fertility locus in Hanoverian stallions and further 9 candidate fertility loci with missing homozygous mutant genotypes were validated in a panel including 19 horse breeds. To our knowledge this is the first study in horses using next generation sequencing data to uncover strong candidate factors for stallion fertility.

The Arabidopsis Mutant cev1 Links Cell Wall Signaling to Jasmonate and Ethylene Responses

PubMed Central

Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G.

2002-01-01

Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants. PMID:12119374

Variant Amino Acid Residues Alter the Enzyme Activity of Peanut Type 2 Diacylglycerol Acyltransferases

PubMed Central

Zheng, Ling; Shockey, Jay; Bian, Fei; Chen, Gao; Shan, Lei; Li, Xinguo; Wan, Shubo; Peng, Zhenying

2017-01-01

Diacylglycerol acyltransferase (DGAT) catalyzes the final step in triacylglycerol (TAG) biosynthesis via the acyl-CoA-dependent acylation of diacylglycerol. This reaction is a major control point in the Kennedy pathway for biosynthesis of TAG, which is the most important form of stored metabolic energy in most oil-producing plants. In this study, Arachis hypogaea type 2 DGAT (AhDGAT2) genes were cloned from the peanut cultivar ‘Luhua 14.’ Sequence analysis of 11 different peanut cultivars revealed a gene family of 8 peanut DGAT2 genes (designated AhDGAT2a-h). Sequence alignments revealed 21 nucleotide differences between the eight ORFs, but only six differences result in changes to the predicted amino acid (AA) sequences. A representative full-length cDNA clone (AhDGAT2a) was characterized in detail. The biochemical effects of altering the AhDGAT2a sequence to include single variable AA residues were tested by mutagenesis and functional complementation assays in transgenic yeast systems. All six mutant variants retained enzyme activity and produced lipid droplets in vivo. The N6D and A26P mutants also displayed increased enzyme activity and/or total cellular fatty acid (FA) content. N6D mutant mainly increased the content of palmitoleic acid, and A26P mutant mainly increased the content of palmitic acid. The A26P mutant grew well both in the presence of oleic and C18:2, but the other mutants grew better in the presence of C18:2. AhDGAT2 is expressed in all peanut organs analyzed, with high transcript levels in leaves and flowers. These levels are comparable to that found in immature seeds, where DGAT2 expression is most abundant in other plants. Over-expression of AhDGAT2a in tobacco substantially increased the FA content of transformed tobacco seeds. Expression of AhDGAT2a also altered transcription levels of endogenous tobacco lipid metabolic genes in transgenic tobacco, apparently creating a larger carbon ‘sink’ that supports increased FA levels. PMID:29085382

Chromosomal Translocations in the Parasite Leishmania by a MRE11/RAD50-Independent Microhomology-Mediated End Joining Mechanism

PubMed Central

Laffitte, Marie-Claude N.; Leprohon, Philippe; Hainse, Maripier; Légaré, Danielle; Masson, Jean-Yves; Ouellette, Marc

2016-01-01

The parasite Leishmania often relies on gene rearrangements to survive stressful environments. However, safeguarding a minimum level of genome integrity is important for cell survival. We hypothesized that maintenance of genomic integrity in Leishmania would imply a leading role of the MRE11 and RAD50 proteins considering their role in DNA repair, chromosomal organization and protection of chromosomes ends in other organisms. Attempts to generate RAD50 null mutants in a wild-type background failed and we provide evidence that this gene is essential. Remarkably, inactivation of RAD50 was possible in a MRE11 null mutant that we had previously generated, providing good evidence that RAD50 may be dispensable in the absence of MRE11. Inactivation of the MRE11 and RAD50 genes led to a decreased frequency of homologous recombination and analysis of the null mutants by whole genome sequencing revealed several chromosomal translocations. Sequencing of the junction between translocated chromosomes highlighted microhomology sequences at the level of breakpoint regions. Sequencing data also showed a decreased coverage at subtelomeric locations in many chromosomes in the MRE11-/-RAD50-/- parasites. This study demonstrates an MRE11-independent microhomology-mediated end-joining mechanism and a prominent role for MRE11 and RAD50 in the maintenance of genomic integrity. Moreover, we suggest the possible involvement of RAD50 in subtelomeric regions stability. PMID:27314941

Mannosyltransferase is required for cell wall biosynthesis, morphology and control of asexual development in Neurospora crassa.

PubMed

Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J

2005-01-01

Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.

Rapid Quantification of Mutant Fitness in Diverse Bacteria by Sequencing Randomly Bar-Coded Transposons

PubMed Central

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth

2015-01-01

ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644

A re-sequencing based assessment of genomic heterogeneity and fast neutron-induced deletions in a common bean cultivar

USDA-ARS?s Scientific Manuscript database

A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants wi...

Evidence of triple mutant Pfdhps ISGNGA haplotype in Plasmodium falciparum isolates from North-east India: An analysis of sulfadoxine resistant haplotype selection.

PubMed

Das, Manuj K; Chetry, Sumi; Kalita, Mohan C; Dutta, Prafulla

2016-12-01

North-east region of India has consistent role in the spread of multi drug resistant Plasmodium (P.) falciparum to other parts of Southeast Asia. After rapid clinical treatment failure of Artemisinin based combination therapy-Sulphadoxine/Pyrimethamine (ACT-SP) chemoprophylaxis, Artemether-Lumefantrine (ACT-AL) combination therapy was introduced in the year 2012 in this region for the treatment of uncomplicated P. falciparum malaria. In a DNA sequencing based polymorphism analysis, seven codons of P. falciparum dihydropteroate synthetase ( Pf dhps) gene were screened in a total of 127 P. falciparum isolates collected from Assam, Arunachal Pradesh and Tripura of North-east India during the year 2014 and 2015 to document current sulfadoxine resistant haplotypes. Sequences were analyzed to rearrange both nucleotide and protein haplotypes. Molecular diversity indices were analyzed in DNA Sequence Polymorphism software (DnaSP) on the basis of Pf dhps gene sequences. Disappearance from selective neutrality was assessed based on the ratio of non-synonomous to synonomous nucleotide substitutions [dN/dS ratio]. Moreover, two-tailed Z test was performed in search of the significance for probability of rejecting null hypothesis of strict neutrality [dN = dS]. Presence of mutant P. falciparum multidrug resistance protein1 ( Pf mdr1) was also checked in those isolates that were present with new Pf dhps haplotypes. Phylogenetic relationship based on Pf dhps gene was reconstructed in Molecular Evolutionary Genetics Analysis (MEGA). Among eight different sulfadoxine resistant haplotypes found, IS GNG A haplotype was documented in a total of five isolates from Tripura with association of a new mutant M538 R allele. Sequence analysis of Pf mdr1 gene in these five isolates came to notice that not all but only one isolate was mutant at codon 86 (N86 Y ; Y YSND) in the multidrug resistance protein. Molecular diversity based on Pf dhps haplotypes revealed that P. falciparum populations in Assam and Tripura were under balancing selection for sulfadoxine resistant haplotypes but population from Arunachal Pradesh was under positive selection with comparatively high haplotype diversity ( h  = 0.870). In reconstructed phylogenetic analysis, isolates having IS GNG A haplotype were grouped into two separate sub-clusters from the other isolates based on their genetic distances and diversities. This study suggests that sulfadoxine resistant isolates are still migrating from its epicenter to the other parts of Southeast Asia and hence control and elimination of the drug resistant isolates have become impedimental. Moreover, P. falciparum populations in different areas may undergo selection of particular sulfadoxine resistant haplotypes either in the presence of drug or after its removal to maintain their plasticity.

Organization and characterization of genetic regions in Bacillus subtilis subsp. krictiensis ATCC55079 associated with the biosynthesis of iturin and surfactin compounds

PubMed Central

Kim, Sung Eun; Lee, Won Jung; Moon, Jae Sun; Cho, Min Seop; Park, Ho-Yong; Hwang, Ingyu

2017-01-01

Bacillus subtilis subsp. krictiensis ATCC55079 produces the cyclic lipopeptide antibiotics iturin A–F as well as several surfactins. Here, we analyzed and characterized the biosynthetic genes associated with iturin and surfactin production in this strain. We aligned the sequences of each iturin and surfactin synthetase ORF obtained from a genomic library screen and next generation sequencing. The resulting 37,249-bp and 37,645-bp sequences associated with iturin and surfactin production, respectively, contained several ORFs that are predicted to encode proteins involved in iturin and surfactin biosynthesis. These ORFs showed higher sequence homologies with the respective iturin and surfactin synthetase genes of B. methylotrophicus CAU B946 than with those of B. subtilis RB14 and B. subtilis ATCC6633. Moreover, comparative analysis of the secondary metabolites produced by the wild-type and surfactin-less mutant (with a spectinomycin resistance cassette inserted into the srfAB gene within the putative surfactin gene region) strains demonstrated that the mutant strain showed significantly higher antifungal activity against Fusarium oxysporum than the wild-type strain. In addition, the wild-type strain-specific surfactin high performance liquid chromatography (HPLC) peaks were not observed in the surfactin-less mutant strain. In contrast, the iturin A peak detected by HPLC and liquid chromatography-mass spectrometry (LC/MS) in the surfactin-less mutant strain was 30% greater than that in the wild-type strain. These results suggested that the gene cluster we identified is involved in surfactin biosynthesis, and the biosynthetic pathways for iturin and surfactin in Bacillus strains producing both iturin and surfactin may utilize a common pathway. PMID:29267290

Pyrin gene and mutants thereof, which cause familial Mediterranean fever

DOEpatents

Kastner, Daniel L [Bethesda, MD; Aksentijevichh, Ivona [Bethesda, MD; Centola, Michael [Tacoma Park, MD; Deng, Zuoming [Gaithersburg, MD; Sood, Ramen [Rockville, MD; Collins, Francis S [Rockville, MD; Blake, Trevor [Laytonsville, MD; Liu, P Paul [Ellicott City, MD; Fischel-Ghodsian, Nathan [Los Angeles, CA; Gumucio, Deborah L [Ann Arbor, MI; Richards, Robert I [North Adelaide, AU; Ricke, Darrell O [San Diego, CA; Doggett, Norman A [Santa Cruz, NM; Pras, Mordechai [Tel-Hashomer, IL

2003-09-30

The invention provides the nucleic acid sequence encoding the protein associated with familial Mediterranean fever (FMF). The cDNA sequence is designated as MEFV. The invention is also directed towards fragments of the DNA sequence, as well as the corresponding sequence for the RNA transcript and fragments thereof. Another aspect of the invention provides the amino acid sequence for a protein (pyrin) associated with FMF. The invention is directed towards both the full length amino acid sequence, fusion proteins containing the amino acid sequence and fragments thereof. The invention is also directed towards mutants of the nucleic acid and amino acid sequences associated with FMF. In particular, the invention discloses three missense mutations, clustered in within about 40 to 50 amino acids, in the highly conserved rfp (B30.2) domain at the C-terminal of the protein. These mutants include M6801, M694V, K695R, and V726A. Additionally, the invention includes methods for diagnosing a patient at risk for having FMF and kits therefor.

Characterization of multilocus lesions in human cells exposed to X radiation and radon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chaudhry, M.A.; Jiang, Q.; Ricanati, M.

Human TK6 lymphoblasts were exposed to X radiation or radon, and thymidine kinase negative (TK{sup -/-}) mutants were selected, isolated and harvested for analysis of structural changes in the TK gene. A large majority (82%) of the radon-induced mutants, 74% of the X-radiation-induced mutants and 45% of the spontaneous mutants lost the entire active TK allele. To analyze these mutants further we measured the loss of heterozygosity at several loci neighboring the TK locus on chromosome 17q. A greater proportion (61%) of the radon-induced mutants than X-radiation-induced or spontaneous mutants harbored the smaller lesions involving the TK allele alone ormore » extending from the TK locus to one or both of the closest neighboring sequences tested. Further, 21% of the X-radiation-induced mutants but only 5% of the radon-induced mutants lost heterozygosity at the col1A1 locus, 31 Mb from the TK gene. These results are in agreement with a recent analysis of radon- and X-radiation-induced lesions inactivating the HPRT gene of TK6 cells, in which we reported that a lower percentage of radon- than X-radiation-induced mutants showed lesions extending to markers 800 kb or more from the HPRT gene on the X chromosome. In the present study, we observed that the percentage of slowly growing and very slowly growing TK{sup -/-} mutants was greater after treatment with radon than after treatment with X radiation, regardless of the type of lesion present. It is possible, therefore, that the radon-induced lesions are complex and/or less easily repaired, leading to slow growth in a large proportion of the surviving mutant cells. 36 refs., 6 figs., 2 tabs.« less

Identification of Proteus mirabilis Mutants with Increased Sensitivity to Antimicrobial Peptides

PubMed Central

McCoy, Andrea J.; Liu, Hongjian; Falla, Timothy J.; Gunn, John S.

2001-01-01

Antimicrobial peptides (APs) are important components of the innate defenses of animals, plants, and microorganisms. However, some bacterial pathogens are resistant to the action of APs. For example, Proteus mirabilis is highly resistant to the action of APs, such as polymyxin B (PM), protegrin, and the synthetic protegrin analog IB-367. To better understand this resistance, a transposon mutagenesis approach was used to generate P. mirabilis mutants sensitive to APs. Four unique PM-sensitive mutants of P. mirabilis were identified (these mutants were >2 to >128 times more sensitive than the wild type). Two of these mutants were also sensitive to IB-367 (16 and 128 times more sensitive than the wild type). Lipopolysaccharide (LPS) profiles of the PM- and protegrin-sensitive mutants demonstrated marked differences in both the lipid A and O-antigen regions, while the PM-sensitive mutants appeared to have alterations of either lipid A or O antigen. Matrix-assisted laser desorption ionization–time of flight mass spectrometry analysis of the wild-type and PM-sensitive mutant lipid A showed species with one or two aminoarabinose groups, while lipid A from the PM- and protegrin-sensitive mutants was devoid of aminoarabinose. When the mutants were streaked on an agar-containing medium, the swarming motility of the PM- and protegrin-sensitive mutants was completely inhibited and the swarming motility of the mutants sensitive to only PM was markedly decreased. DNA sequence analysis of the mutagenized loci revealed similarities to an O-acetyltransferase (PM and protegrin sensitive) and ATP synthase and sap loci (PM sensitive). These data further support the role of LPS modifications as an elaborate mechanism in the resistance of certain bacterial species to APs and suggest that LPS surface charge alterations may play a role in P. mirabilis swarming motility. PMID:11408219

Cgl2 plays an essential role in cuticular wax biosynthesis in cabbage (Brassica oleracea L. var. capitata).

PubMed

Liu, Dongming; Tang, Jun; Liu, Zezhou; Dong, Xin; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Sun, Peitian; Liu, Yumei; Li, Zhansheng; Ye, Zhibiao; Fang, Zhiyuan; Yang, Limei

2017-11-28

The aerial parts of most land plants are covered with cuticular wax which is important for plants to avoid harmful factors. There is still no cloning study about wax synthesis gene of the alcohol-forming pathway in Brassica species. Scanning electron microscopy (SEM) showed that, compared with wild type (WT), wax crystal are severely reduced in both the adaxial and abaxial sides of cabbage (Brassica oleracea L. var. capitata L.) leaves from the LD10GL mutant. Genetic analysis results revealed that the glossy trait of LD10GL is controlled by a single recessive gene, and fine mapping results revealed that the target gene Cgl2 (Cabbage glossy 2) is located within a physical region of 170 kb on chromosome 1. Based on sequence analysis of the genes in the mapped region, the gene designated Bol013612 was speculated to be the candidate gene. Gene Bol013612 is homologous to Arabidopsis CER4, which encodes fatty acyl-coenzyme A reductase. Sequencing identified a single nucleotide substitution at an intron/exon boundary that results in an insertion of six nucleotides in the cDNA of Bol013612 in LD10GL. The phenotypic defect of LD10GL was confirmed by a functional complementation test with Arabidopsis mutant cer4. Our results indicated that wax crystals of cabbage mutant LD10GL are severely reduced and mutation of gene Bol013612 causes a glossy phenotype in the LD10GL mutant.

Identification of genes and gene clusters involved in mycotoxin synthesis

USDA-ARS?s Scientific Manuscript database

Research methods to identify and characterize genes involved in mycotoxin biosynthetic pathways have evolved considerably over the years. Before whole genome sequences were available (e.g. pre-genomics), work focused primarily on chemistry, biosynthetic mutant strains and molecular analysis of sing...

Transformation of apple (Malus × domestica) using mutants of apple acetolactate synthase as a selectable marker and analysis of the T-DNA integration sites.

PubMed

Yao, Jia-Long; Tomes, Sumathi; Gleave, Andrew P

2013-05-01

Apple acetolactate synthase mutants were generated by site-specific mutagenesis and successfully used as selection marker in tobacco and apple transformation. T-DNA/Apple genome junctions were analysed using genome-walking PCR and sequencing. An Agrobacterium-mediated genetic transformation system was developed for apple (Malus × domestica), using mutants of apple acetolactate synthase (ALS) as a selectable marker. Four apple ALS mutants were generated by site-specific mutagenesis and subsequently cloned under the transcriptional control of the CaMV 35S promoter and ocs 3' terminator, in a pART27-derived plant transformation vector. Three of the four mutations were found to confer resistance to the herbicide Glean(®), containing the active agent chlorsulfuron, in tobacco (Nicotiana tabacum) transformation. In apple transformation, leaf explants infected with Agrobacterium tumefaciens EHA105 containing one of the three ALS mutants resulted in the production of shoots on medium containing 2-8 μg L(-1) Glean(®), whilst uninfected wild-type explants failed to regenerate shoots or survive on medium containing 1 and 3 μg L(-1) Glean(®), respectively. Glean(®)-resistant, regenerated shoots were further multiplied and rooted on medium containing 10 μg L(-1) Glean(®). The T-DNA and apple genome-DNA junctions from eight rooted transgenic apple plants were analysed using genome-walking PCR amplification and sequencing. This analysis confirmed T-DNA integration into the apple genome, identified the genome integration sites and revealed the extent of any vector backbone integration, T-DNA rearrangements and deletions of apple genome DNA at the sites of integration.

Analysis of genes involved in biosynthesis of the lantibiotic subtilin.

PubMed Central

Klein, C; Kaletta, C; Schnell, N; Entian, K D

1992-01-01

Lantibiotics are peptide-derived antibiotics with high antimicrobial activity against pathogenic gram-positive bacteria. They are ribosomally synthesized and posttranslationally modified (N. Schnell, K.-D. Entian, U. Schneider, F. Götz, H. Zähner, R. Kellner, and G. Jung, Nature [London] 333:276-278, 1988). The most important lantibiotics are subtilin and the food preservative nisin, which both have a very similar structure. By using a hybridization probe specific for the structural gene of subtilin, spaS, the DNA region adjacent to spaS was isolated from Bacillus subtilis. Sequence analysis of a 4.9-kb fragment revealed several open reading frames with the same orientation as spaS. Downstream of spaS, no reading frames were present on the isolated XbaI fragment. Upstream of spaS, three reading frames, spaB, spaC, and spaT, were identified which showed strong homology to genes identified near the structural gene of the lantibiotic epidermin. The SpaT protein derived from the spaT sequence was homologous to hemolysin B of Escherichia coli, which indicated its possible function in subtilin transport. Gene deletions within spaB and spaC revealed subtilin-negative mutants, whereas spaT gene disruption mutants still produced subtilin. Remarkably, the spaT mutant colonies revealed a clumpy surface morphology on solid media. After growth on liquid media, spaT mutant cells agglutinated in the mid-logarithmic growth phase, forming longitudinal 3- to 10-fold-enlarged cells which aggregated. Aggregate formation preceded subtilin production and cells lost their viability, possibly as a result of intracellular subtilin accumulation. Our results clearly proved that reading frames spaB and spaC are essential for subtilin biosynthesis whereas spaT mutants are probably deficient in subtilin transport. Images PMID:1539969

Development of a high-frequency in vivo transposon mutagenesis system for Synechocystis sp. PCC 6803 and Synechococcus elongatus PCC 7942.

PubMed

Watabe, Kazuyuki; Mimuro, Mamoru; Tsuchiya, Tohru

2014-11-01

Synechocystis sp. PCC 6803 (Synechocystis) is the first sequenced photosynthetic organism and has two advantages: natural transformation and light-activated heterotrophic growth. Such characteristics have mainly promoted reverse genetic analysis in this organism, however, to date approximately 50% of genes are still annotated as 'unknown protein' or 'hypothetical protein'. Therefore, forward genetic analysis is required for the identification of significant genes responsible for photosynthesis and other physiological phenomena among the genes of unknown function. The in vivo transposon mutagenesis system is one of the major methods for random mutagenesis. However, present in vivo transposon mutagenesis systems for cyanobacteria face problems such as relatively low frequency of transposition and repeated transposition in the host cells. In this study, we constructed vectors based on a mini-Tn5-derived vector that was designed to prevent repeated transposition. Our vectors carry a hyperactive transposase and optimized recognition sequence of transposase, which were reported to enhance frequency of transposition. Using the vector, we succeeded in highly frequent transposition (9×10(-3) per recipient cell) in Synechocystis. Transposon insertion sites of 10 randomly selected mutants indicated that the insertion sites spread throughout the genome with low sequence dependency. Furthermore, one of the 10 mutants exhibited the slow-growing phenotype, and the mutant was functionally complemented by using our expression vector. Our system also worked with another model cyanobacterium, Synechococcus elongatus PCC 7942, with high frequency. These results indicate that the developed system can be applied to the forward genetic analysis of a broad range of cyanobacteria. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Understanding protein lids: kinetic analysis of active hinge mutants in triosephosphate isomerase.

PubMed

Sun, J; Sampson, N S

1999-08-31

In previous work we tested what three amino acid sequences could serve as a protein hinge in triosephosphate isomerase [Sun, J., and Sampson, N. S. (1998) Protein Sci. 7, 1495-1505]. We generated a genetic library encoding all 8000 possible 3 amino acid combinations at the C-terminal hinge and selected for those combinations of amino acids that formed active mutants. These mutants were classified into six phylogenetic families. Two families resembled wild-type hinges, and four families represented new types of hinges. In this work, the kinetic characteristics and thermal stabilities of mutants representing each of these families were determined in order to understand what properties make an efficient protein hinge, and why all of the families are not observed in nature. From a steady-state kinetic analysis of our mutants, it is clear that the partitioning between protonation of intermediate to form product and intermediate release from the enzyme surface to form methylglyoxal (a decomposition product) is not affected. The two most impaired mutants undergo a change in rate-limiting step from enediol formation to dihydroxyacetone phosphate binding. Thus, it appears that k(cat)/K(m)'s are reduced relative to wild type as a result of slower Michaelis complex formation and dissociation, rather than increased loop opening speed.

Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

PubMed

Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

1995-04-01

Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.

Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

PubMed Central

Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

1995-01-01

Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694

Prototype foamy virus envelope glycoprotein leader peptide processing is mediated by a furin-like cellular protease, but cleavage is not essential for viral infectivity.

PubMed

Duda, Anja; Stange, Annett; Lüftenegger, Daniel; Stanke, Nicole; Westphal, Dana; Pietschmann, Thomas; Eastman, Scott W; Linial, Maxine L; Rethwilm, Axel; Lindemann, Dirk

2004-12-01

Analogous to cellular glycoproteins, viral envelope proteins contain N-terminal signal sequences responsible for targeting them to the secretory pathway. The prototype foamy virus (PFV) envelope (Env) shows a highly unusual biosynthesis. Its precursor protein has a type III membrane topology with both the N and C terminus located in the cytoplasm. Coexpression of FV glycoprotein and interaction of its leader peptide (LP) with the viral capsid is essential for viral particle budding and egress. Processing of PFV Env into the particle-associated LP, surface (SU), and transmembrane (TM) subunits occur posttranslationally during transport to the cell surface by yet-unidentified cellular proteases. Here we provide strong evidence that furin itself or a furin-like protease and not the signal peptidase complex is responsible for both processing events. N-terminal protein sequencing of the SU and TM subunits of purified PFV Env-immunoglobulin G immunoadhesin identified furin consensus sequences upstream of both cleavage sites. Mutagenesis analysis of two overlapping furin consensus sequences at the PFV LP/SU cleavage site in the wild-type protein confirmed the sequencing data and demonstrated utilization of only the first site. Fully processed SU was almost completely absent in viral particles of mutants having conserved arginine residues replaced by alanines in the first furin consensus sequence, but normal processing was observed upon mutation of the second motif. Although these mutants displayed a significant loss in infectivity as a result of reduced particle release, no correlation to processing inhibition was observed, since another mutant having normal LP/SU processing had a similar defect.

Revealing impaired pathways in the an11 mutant by high-throughput characterization of Petunia axillaris and Petunia inflata transcriptomes.

PubMed

Zenoni, Sara; D'Agostino, Nunzio; Tornielli, Giovanni B; Quattrocchio, Francesca; Chiusano, Maria L; Koes, Ronald; Zethof, Jan; Guzzo, Flavia; Delledonne, Massimo; Frusciante, Luigi; Gerats, Tom; Pezzotti, Mario

2011-10-01

Petunia is an excellent model system, especially for genetic, physiological and molecular studies. Thus far, however, genome-wide expression analysis has been applied rarely because of the lack of sequence information. We applied next-generation sequencing to generate, through de novo read assembly, a large catalogue of transcripts for Petunia axillaris and Petunia inflata. On the basis of both transcriptomes, comprehensive microarray chips for gene expression analysis were established and used for the analysis of global- and organ-specific gene expression in Petunia axillaris and Petunia inflata and to explore the molecular basis of the seed coat defects in a Petunia hybrida mutant, anthocyanin 11 (an11), lacking a WD40-repeat (WDR) transcription regulator. Among the transcripts differentially expressed in an11 seeds compared with wild type, many expected targets of AN11 were found but also several interesting new candidates that might play a role in morphogenesis of the seed coat. Our results validate the combination of next-generation sequencing with microarray analyses strategies to identify the transcriptome of two petunia species without previous knowledge of their genome, and to develop comprehensive chips as useful tools for the analysis of gene expression in P. axillaris, P. inflata and P. hybrida. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes.

PubMed

Burger, Alexa; Lindsay, Helen; Felker, Anastasia; Hess, Christopher; Anders, Carolin; Chiavacci, Elena; Zaugg, Jonas; Weber, Lukas M; Catena, Raul; Jinek, Martin; Robinson, Mark D; Mosimann, Christian

2016-06-01

CRISPR-Cas9 enables efficient sequence-specific mutagenesis for creating somatic or germline mutants of model organisms. Key constraints in vivo remain the expression and delivery of active Cas9-sgRNA ribonucleoprotein complexes (RNPs) with minimal toxicity, variable mutagenesis efficiencies depending on targeting sequence, and high mutation mosaicism. Here, we apply in vitro assembled, fluorescent Cas9-sgRNA RNPs in solubilizing salt solution to achieve maximal mutagenesis efficiency in zebrafish embryos. MiSeq-based sequence analysis of targeted loci in individual embryos using CrispRVariants, a customized software tool for mutagenesis quantification and visualization, reveals efficient bi-allelic mutagenesis that reaches saturation at several tested gene loci. Such virtually complete mutagenesis exposes loss-of-function phenotypes for candidate genes in somatic mutant embryos for subsequent generation of stable germline mutants. We further show that targeting of non-coding elements in gene regulatory regions using saturating mutagenesis uncovers functional control elements in transgenic reporters and endogenous genes in injected embryos. Our results establish that optimally solubilized, in vitro assembled fluorescent Cas9-sgRNA RNPs provide a reproducible reagent for direct and scalable loss-of-function studies and applications beyond zebrafish experiments that require maximal DNA cutting efficiency in vivo. © 2016. Published by The Company of Biologists Ltd.

Engineering disease resistance with pectate lyase-like genes

DOEpatents

Vogel, John; Somerville, Shauna

2005-03-08

A mutant gene coding for pectate lyase and homologs thereof is provided, which when incorporated in transgenic plants effect an increased level disease resistance in such plants. Also is provided the polypeptide sequence for the pectate lyase of the present invention. Methods of obtaining the mutant gene, producing transgenic plants which include the nucleotide sequence for the mutant gene and producing improved disease resistance in a crop of such transgenic plants are also provided.

Next generation sequencing analysis reveals that the ribonucleases RNase II, RNase R and PNPase affect bacterial motility and biofilm formation in E. coli.

PubMed

Pobre, Vânia; Arraiano, Cecília M

2015-02-14

The RNA steady-state levels in the cell are a balance between synthesis and degradation rates. Although transcription is important, RNA processing and turnover are also key factors in the regulation of gene expression. In Escherichia coli there are three main exoribonucleases (RNase II, RNase R and PNPase) involved in RNA degradation. Although there are many studies about these exoribonucleases not much is known about their global effect in the transcriptome. In order to study the effects of the exoribonucleases on the transcriptome, we sequenced the total RNA (RNA-Seq) from wild-type cells and from mutants for each of the exoribonucleases (∆rnb, ∆rnr and ∆pnp). We compared each of the mutant transcriptome with the wild-type to determine the global effects of the deletion of each exoribonucleases in exponential phase. We determined that the deletion of RNase II significantly affected 187 transcripts, while deletion of RNase R affects 202 transcripts and deletion of PNPase affected 226 transcripts. Surprisingly, many of the transcripts are actually down-regulated in the exoribonuclease mutants when compared to the wild-type control. The results obtained from the transcriptomic analysis pointed to the fact that these enzymes were changing the expression of genes related with flagellum assembly, motility and biofilm formation. The three exoribonucleases affected some stable RNAs, but PNPase was the main exoribonuclease affecting this class of RNAs. We confirmed by qPCR some fold-change values obtained from the RNA-Seq data, we also observed that all the exoribonuclease mutants were significantly less motile than the wild-type cells. Additionally, RNase II and RNase R mutants were shown to produce more biofilm than the wild-type control while the PNPase mutant did not form biofilms. In this work we demonstrate how deep sequencing can be used to discover new and relevant functions of the exoribonucleases. We were able to obtain valuable information about the transcripts affected by each of the exoribonucleases and compare the roles of the three enzymes. Our results show that the three exoribonucleases affect cell motility and biofilm formation that are two very important factors for cell survival, especially for pathogenic cells.

Determining mutation density using Restriction Enzyme Sequence Comparative Analysis (RESCAN)

USDA-ARS?s Scientific Manuscript database

The average mutation density of a mutant population is a major consideration when developing resources for the efficient, cost-effective implementation of reverse genetics methods such as Targeting of Induced Local Lesions in Genomes (TILLING). Reliable estimates of mutation density can be achieved ...

Role of a Ferredoxin Gene Cotranscribed with the nifHDK Operon in N2 Fixation and Nitrogenase “Switch-Off” of Azoarcus sp. Strain BH72

PubMed Central

Egener, Tanja; Martin, Dietmar E.; Sarkar, Abhijit; Reinhold-Hurek, Barbara

2001-01-01

The endophytic diazotroph Azoarcus sp. strain BH72 is capable of infecting rice roots and of expressing the nitrogenase (nif) genes there. In order to study the genetic background for nitrogen fixation in strain BH72, the structural genes of nitrogenase (nifHDK) were cloned and sequenced. The sequence analysis revealed an unusual gene organization: downstream of nifHDK, a ferredoxin gene (fdxN; 59% amino acid sequence identity to R. capsulatus FdxN) and open reading frames showing 52 and 36% amino acid sequence identity to nifY of Pseudomonas stutzeri A15 and ORF1 of Azotobacter vinelandii were located. Northern blot analysis, reverse transcriptase PCR and primer extension analysis revealed that these six genes are located on one transcript transcribed from a ς54-type promoter. Shorter transcripts sequentially missing genes of the 3′ part of the full-length mRNA were more abundantly detected. Mutational analyses suggested that FdxN is an important but not the essential electron donor for dinitrogenase reductase. An in-frame deletion of fdxN resulted in reduced growth rates (59% ± 9%) and nitrogenase activities (81%) in nitrogen-fixing pure cultures in comparison to the wild type. Nitrogenase activity was fully complemented in an fdxN mutant which carried a nifH promoter-driven fdxN gene in trans. Also, in coculture with the ascomycete Acremonium alternatum, where strain BH72 develops intracytoplasmic membrane stacks, the nitrogenase activity in the fdxN deletion mutant was decreased to 56% of the wild-type level. Surprisingly, the fdxN deletion also had an effect on the rapid “switch-off” of nitrogenase activity in response to ammonium. Wild-type strain BH72 and the deletion mutant complemented with fdxN in trans showed a rapid reversible inactivation of acetylene reduction, while the deletion mutant did not cease to reduce acetylene. In concordance with the hypothesis that changes in the redox state of NifH or electron flux towards nitrogenase may be involved in the mechanism of physiological nitrogenase switch-off, our results suggest that the ferredoxin may be a component involved in this process. PMID:11371540

In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction

PubMed Central

Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt

2018-01-01

Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023

A large inversion in the linear chromosome of Streptomyces griseus caused by replicative transposition of a new Tn3 family transposon.

PubMed

Murata, M; Uchida, T; Yang, Y; Lezhava, A; Kinashi, H

2011-04-01

We have comprehensively analyzed the linear chromosomes of Streptomyces griseus mutants constructed and kept in our laboratory. During this study, macrorestriction analysis of AseI and DraI fragments of mutant 402-2 suggested a large chromosomal inversion. The junctions of chromosomal inversion were cloned and sequenced and compared with the corresponding target sequences in the parent strain 2247. Consequently, a transposon-involved mechanism was revealed. Namely, a transposon originally located at the left target site was replicatively transposed to the right target site in an inverted direction, which generated a second copy and at the same time caused a 2.5-Mb chromosomal inversion. The involved transposon named TnSGR was grouped into a new subfamily of the resolvase-encoding Tn3 family transposons based on its gene organization. At the end, terminal diversity of S. griseus chromosomes is discussed by comparing the sequences of strains 2247 and IFO13350.

The mutant vasopressin gene from diabetes insipidus (Brattleboro) rats is transcribed but the message is not efficiently translated.

PubMed Central

Schmale, H; Ivell, R; Breindl, M; Darmer, D; Richter, D

1984-01-01

The vasopressin gene from normal and diabetes insipidus (Brattleboro) rats has been isolated and sequenced. Except for a single deletion of a G residue in region coding for the neurophysin carrier protein the approximately 2300 nucleotides of both genes are identical. Blot analysis of hypothalamic RNA as well as transfection and microinjection experiments indicate that the mutant gene is correctly transcribed and spliced, however the resulting mRNA is not efficiently translated. Images Fig. 2. Fig. 3. PMID:6526016

DHS Student Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

. Wynne, E K

Throughout this project I have been involved in every step of the protocol. After proper training, I was introduced to the necessary lab techniques for the project. From then on it has been my responsibility to perform the necessary tasks to identify and isolate the mutants. This includes carrying out a detailed protocol of mixing reagents, streaking and incubating plates, inoculating cultures and evaluating any results in order to guide my actions for the next antibiotic concentration level. Simultaneously, I have been running PCR and sequencing reactions on all mutants in order to obtain the genetic sequence of the genesmore » of interest for comparison. Once I have the gene sequences of interest I am able, with the aid of a sequencing program (Sequencher 4.2.2), to analyze the sequences of the mutants against that of a wild type strain. This entails aligning the DNA sequences of a given gene for each of the mutants and locating any base changes from the wild types bacteria's genes. These polymorphisms allow me to identify the QRDR for that particular gene. Depending on whether the polymorphism occurred at a low antibiotic concentration level or high concentration level, we can evaluate whether that change is necessary for low or high-level quinolone resistance. Finally, I will compare the polymorphisms of each mutant at a given antibiotic selection level and evaluate whether B. anthracis consistently acquires resistance through the same polymorphisms or whether the resistance mechanism varies with each new mutant strain. Currently, I am analyzing the sequence data for stage one mutants, while simultaneously continuing the lab work necessary to select for stage two mutants. After I have left, the personnel at the lab that I've been working with at LLNL will continue this project. By the end of this experiment, we hope to corroborate the suggested mechanisms of resistance typically employed by B. anthracis Sterne at different resistance levels. Furthermore, if the mechanism is determined by one of the following genes: gyrA, gyrB, parC, parE we will be able to pinpoint which base pair changes are necessary for acquiring a given resistance level. Hopefully from these data researchers will be better able to determine an appropriate action should quinolone resistant strains of B. anthracis arise in either by natural evolution or selection in a laboratory.« less

Rapid construction of a whole-genome transposon insertion collection for Shewanella oneidensis by Knockout Sudoku.

PubMed

Baym, Michael; Shaket, Lev; Anzai, Isao A; Adesina, Oluwakemi; Barstow, Buz

2016-11-10

Whole-genome knockout collections are invaluable for connecting gene sequence to function, yet traditionally, their construction has required an extraordinary technical effort. Here we report a method for the construction and purification of a curated whole-genome collection of single-gene transposon disruption mutants termed Knockout Sudoku. Using simple combinatorial pooling, a highly oversampled collection of mutants is condensed into a next-generation sequencing library in a single day, a 30- to 100-fold improvement over prior methods. The identities of the mutants in the collection are then solved by a probabilistic algorithm that uses internal self-consistency within the sequencing data set, followed by rapid algorithmically guided condensation to a minimal representative set of mutants, validation, and curation. Starting from a progenitor collection of 39,918 mutants, we compile a quality-controlled knockout collection of the electroactive microbe Shewanella oneidensis MR-1 containing representatives for 3,667 genes that is functionally validated by high-throughput kinetic measurements of quinone reduction.

GALT protein database, a bioinformatics resource for the management and analysis of structural features of a galactosemia-related protein and its mutants.

PubMed

d'Acierno, Antonio; Facchiano, Angelo; Marabotti, Anna

2009-06-01

We describe the GALT-Prot database and its related web-based application that have been developed to collect information about the structural and functional effects of mutations on the human enzyme galactose-1-phosphate uridyltransferase (GALT) involved in the genetic disease named galactosemia type I. Besides a list of missense mutations at gene and protein sequence levels, GALT-Prot reports the analysis results of mutant GALT structures. In addition to the structural information about the wild-type enzyme, the database also includes structures of over 100 single point mutants simulated by means of a computational procedure, and the analysis to each mutant was made with several bioinformatics programs in order to investigate the effect of the mutations. The web-based interface allows querying of the database, and several links are also provided in order to guarantee a high integration with other resources already present on the web. Moreover, the architecture of the database and the web application is flexible and can be easily adapted to store data related to other proteins with point mutations. GALT-Prot is freely available at http://bioinformatica.isa.cnr.it/GALT/.

BEAMing and Droplet Digital PCR Analysis of Mutant IDH1 mRNA in Glioma Patient Serum and Cerebrospinal Fluid Extracellular Vesicles

PubMed Central

Chen, Walter W; Balaj, Leonora; Liau, Linda M; Samuels, Michael L; Kotsopoulos, Steve K; Maguire, Casey A; LoGuidice, Lori; Soto, Horacio; Garrett, Matthew; Zhu, Lin Dan; Sivaraman, Sarada; Chen, Clark; Wong, Eric T; Carter, Bob S; Hochberg, Fred H; Breakefield, Xandra O; Skog, Johan

2013-01-01

Development of biofluid-based molecular diagnostic tests for cancer is an important step towards tumor characterization and real-time monitoring in a minimally invasive fashion. Extracellular vesicles (EVs) are released from tumor cells into body fluids and can provide a powerful platform for tumor biomarkers because they carry tumor proteins and nucleic acids. Detecting rare point mutations in the background of wild-type sequences in biofluids such as blood and cerebrospinal fluid (CSF) remains a major challenge. Techniques such as BEAMing (beads, emulsion, amplification, magnetics) PCR and droplet digital PCR (ddPCR) are substantially more sensitive than many other assays for mutant sequence detection. Here, we describe a novel approach that combines biofluid EV RNA and BEAMing RT-PCR (EV-BEAMing), as well droplet digital PCR to interrogate mutations from glioma tumors. EVs from CSF of patients with glioma were shown to contain mutant IDH1 transcripts, and we were able to reliably detect and quantify mutant and wild-type IDH1 RNA transcripts in CSF of patients with gliomas. EV-BEAMing and EV-ddPCR represent a valuable new strategy for cancer diagnostics, which can be applied to a variety of biofluids and neoplasms. PMID:23881452

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE PAGES

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...

2015-05-12

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

Time-Resolved Transposon Insertion Sequencing Reveals Genome-Wide Fitness Dynamics during Infection.

PubMed

Yang, Guanhua; Billings, Gabriel; Hubbard, Troy P; Park, Joseph S; Yin Leung, Ka; Liu, Qin; Davis, Brigid M; Zhang, Yuanxing; Wang, Qiyao; Waldor, Matthew K

2017-10-03

Transposon insertion sequencing (TIS) is a powerful high-throughput genetic technique that is transforming functional genomics in prokaryotes, because it enables genome-wide mapping of the determinants of fitness. However, current approaches for analyzing TIS data assume that selective pressures are constant over time and thus do not yield information regarding changes in the genetic requirements for growth in dynamic environments (e.g., during infection). Here, we describe structured analysis of TIS data collected as a time series, termed pattern analysis of conditional essentiality (PACE). From a temporal series of TIS data, PACE derives a quantitative assessment of each mutant's fitness over the course of an experiment and identifies mutants with related fitness profiles. In so doing, PACE circumvents major limitations of existing methodologies, specifically the need for artificial effect size thresholds and enumeration of bacterial population expansion. We used PACE to analyze TIS samples of Edwardsiella piscicida (a fish pathogen) collected over a 2-week infection period from a natural host (the flatfish turbot). PACE uncovered more genes that affect E. piscicida 's fitness in vivo than were detected using a cutoff at a terminal sampling point, and it identified subpopulations of mutants with distinct fitness profiles, one of which informed the design of new live vaccine candidates. Overall, PACE enables efficient mining of time series TIS data and enhances the power and sensitivity of TIS-based analyses. IMPORTANCE Transposon insertion sequencing (TIS) enables genome-wide mapping of the genetic determinants of fitness, typically based on observations at a single sampling point. Here, we move beyond analysis of endpoint TIS data to create a framework for analysis of time series TIS data, termed pattern analysis of conditional essentiality (PACE). We applied PACE to identify genes that contribute to colonization of a natural host by the fish pathogen Edwardsiella piscicida. PACE uncovered more genes that affect E. piscicida 's fitness in vivo than were detected using a terminal sampling point, and its clustering of mutants with related fitness profiles informed design of new live vaccine candidates. PACE yields insights into patterns of fitness dynamics and circumvents major limitations of existing methodologies. Finally, the PACE method should be applicable to additional "omic" time series data, including screens based on clustered regularly interspaced short palindromic repeats with Cas9 (CRISPR/Cas9). Copyright © 2017 Yang et al.

Initial cloning and sequencing of hydHG, an operon homologous to ntrBC and regulating the labile hydrogenase activity in Escherichia coli K-12.

PubMed Central

Stoker, K; Reijnders, W N; Oltmann, L F; Stouthamer, A H

1989-01-01

To isolate genes from Escherichia coli which regulate the labile hydrogenase activity, a plasmid library was used to transform hydL mutants lacking the labile hydrogenase. A single type of gene, designated hydG, was isolated. This gene also partially restored the hydrogenase activity in hydF mutants (which are defective in all hydrogenase isoenzymes), although the low hydrogenase 1 and 2 levels were not induced. Therefore, hydG apparently regulates, specifically, the labile hydrogenase activity. Restoration of this latter activity in hydF mutants was accompanied by a proportional increase of the H2 uptake activity, suggesting a functional relationship. H2:fumarate oxidoreductase activity was not restored in complemented hydL mutants. These latter strains may therefore lack, in addition to the labile hydrogenase, a second component (provisionally designated component R), possibly an electron carrier coupling H2 oxidation to the anerobic respiratory chain. Sequence analysis showed an open reading frame of 1,314 base pairs for hydG. It was preceded by a ribosome-binding site but apparently lacked a promoter. Minicell experiments revealed a single polypeptide of approximately 50 kilodaltons. Comparison of the predicted amino acid sequence with a protein sequence data base revealed strong homology to NtrC from Klebsiella pneumoniae, a DNA-binding transcriptional activator. The 411 base pairs upstream from pHG40 contained a second open reading frame overlapping hydG by four bases. The deduced amino acid sequence showed considerable homology with the C-terminal part of NtrB. This sequence was therefore assumed to be part of a second gene, encoding the NtrB-like component, and was designated hydH. The labile hydrogenase activity in E. coli is apparently regulated by a multicomponent system analogous to the NtrB-NtrC system. This conclusion is in agreement with the results of Birkmann et al. (A. Birkmann, R. G. Sawers, and A. Böck, Mol. Gen. Genet. 210:535-542, 1987), who demonstrated ntrA dependence for the labile hydrogenase activity. Images PMID:2666400

Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

PubMed Central

Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

2013-01-01

Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

Insertion Mutation of the Form I cbbL Gene Encoding Ribulose Bisphosphate Carboxylase/Oxygenase (RuBisCO) in Thiobacillus neapolitanus Results in Expression of Form II RuBisCO, Loss of Carboxysomes, and an Increased CO2 Requirement for Growth

PubMed Central

Baker, Stefanie H.; Jin, Songmu; Aldrich, Henry C.; Howard, Gary T.; Shively, Jessup M.

1998-01-01

It has been previously established that Thiobacillus neapolitanus fixes CO2 by using a form I ribulose bisphosphate carboxylase/oxygenase (RuBisCO), that much of the enzyme is sequestered into carboxysomes, and that the genes for the enzyme, cbbL and cbbS, are part of a putative carboxysome operon. In the present study, cbbL and cbbS were cloned and sequenced. Analysis of RNA showed that cbbL and cbbS are cotranscribed on a message approximately 2,000 nucleotides in size. The insertion of a kanamycin resistance cartridge into cbbL resulted in a premature termination of transcription; a polar mutant was generated. The mutant is able to fix CO2, but requires a CO2 supplement for growth. Separation of cellular proteins from both the wild type and the mutant on sucrose gradients and subsequent analysis of the RuBisCO activity in the collected fractions showed that the mutant assimilates CO2 by using a form II RuBisCO. This was confirmed by immunoblot analysis using antibodies raised against form I and form II RuBisCOs. The mutant does not possess carboxysomes. Smaller, empty inclusions are present, but biochemical analysis indicates that if they are carboxysome related, they are not functional, i.e., do not contain RuBisCO. Northern analysis showed that some of the shell components of the carboxysome are produced, which may explain the presence of these inclusions in the mutant. PMID:9696760

Gene Amplification and Point Mutations in Pyrimidine Metabolic Genes in 5-Fluorouracil Resistant Leishmania infantum

PubMed Central

Ritt, Jean-François; Raymond, Frédéric; Leprohon, Philippe; Légaré, Danielle; Corbeil, Jacques; Ouellette, Marc

2013-01-01

Background The human protozoan parasites Leishmania are prototrophic for pyrimidines with the ability of both de novo biosynthesis and uptake of pyrimidines. Methodology/Principal Findings Five independent L. infantum mutants were selected for resistance to the pyrimidine analogue 5-fluorouracil (5-FU) in the hope to better understand the metabolism of pyrimidine in Leishmania. Analysis of the 5-FU mutants by comparative genomic hybridization and whole genome sequencing revealed in selected mutants the amplification of DHFR-TS and a deletion of part of chromosome 10. Point mutations in uracil phosphorybosyl transferase (UPRT), thymidine kinase (TK) and uridine phosphorylase (UP) were also observed in three individual resistant mutants. Transfection experiments confirmed that these point mutations were responsible for 5-FU resistance. Transport studies revealed that one resistant mutant was defective for uracil and 5-FU import. Conclusion/Significance This study provided further insights in pyrimidine metabolism in Leishmania and confirmed that multiple mutations can co-exist and lead to resistance in Leishmania. PMID:24278495

Efficient genome-wide detection and cataloging of EMS-induced mutations using exome capture and next-generation sequencing

USDA-ARS?s Scientific Manuscript database

Chemical mutagenesis efficiently generates phenotypic variation in otherwise homogeneous genetic backgrounds, enabling functional analysis of genes. Advances in mutation detection have brought the utility of induced mutant populations on par with those produced by insertional mutagenesis, but system...

Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

2016-06-01

The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

Characterization of grape Gibberellin Insensitive 1 mutant alleles in transgenic Arabidopsis

USDA-ARS?s Scientific Manuscript database

We generated a dozen of different mutations in the grape Gibberellin Insensitive or GAI sequence, transformed them into Arabidopsis under the control of 35S, Arabidopsis or grape GAI promoter, and evaluated the impact of these mutant alleles on plant growth and development. These GAI sequence varian...

Genetic control of anastomosis in Podospora anserina.

PubMed

Tong, Laetitia Chan Ho; Silar, Philippe; Lalucque, Hervé

2014-09-01

We developed a new microscopy procedure to study anastomoses in the model ascomycete Podospora anserina and compared it with the previous method involving the formation of balanced heterokaryons. Both methods showed a good correlation. Heterokaryon formation was less quantifiable, but enabled to observe very rare events. Microscopic analysis evidenced that anastomoses were greatly influence by growth conditions and were severely impaired in the IDC mutants of the PaMpk1, PaMpk2, IDC1 and PaNox1 pathways. Yet some mutants readily formed heterokaryons, albeit with a delay when compared to the wild type. We also identified IDC(821), a new mutant presenting a phenotype similar to the other IDC mutants, including lack of anastomosis. Complete genome sequencing revealed that IDC(821) was affected in the orthologue of the Neurospora crassa So gene known to control anastomosis in several other ascomycetes. Copyright © 2014 Elsevier Inc. All rights reserved.

Scapula development is governed by genetic interactions of Pbx1 with its family members and with Emx2 via their cooperative control of Alx1

PubMed Central

Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo

2010-01-01

The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baraibar, Martin A.; Muhoberac, Barry B.; Garringer, Holly J.

Mutations in the coding sequence of the ferritin light chain (FTL) gene cause a neurodegenerative disease known as neuroferritinopathy or hereditary ferritinopathy, which is characterized by the presence of intracellular inclusion bodies containing the mutant FTL polypeptide and by abnormal accumulation of iron in the brain. Here, we describe the x-ray crystallographic structure and report functional studies of ferritin homopolymers formed from the mutant FTL polypeptide p.Phe167SerfsX26, which has a C terminus that is altered in amino acid sequence and length. The structure was determined and refined to 2.85 {angstrom} resolution and was very similar to the wild type betweenmore » residues Ile-5 and Arg-154. However, instead of the E-helices normally present in wild type ferritin, the C-terminal sequences of all 24 mutant subunits showed substantial amounts of disorder, leading to multiple C-terminal polypeptide conformations and a large disruption of the normally tiny 4-fold axis pores. Functional studies underscored the importance of the mutant C-terminal sequence in iron-induced precipitation and revealed iron mishandling by soluble mutant FTL homopolymers in that only wild type incorporated iron when in direct competition in solution with mutant ferritin. Even without competition, the amount of iron incorporation over the first few minutes differed severalfold. Our data suggest that disruption at the 4-fold pores may lead to direct iron mishandling through attenuated iron incorporation by the soluble form of mutant ferritin and that the disordered C-terminal polypeptides may play a major role in iron-induced precipitation and formation of ferritin inclusion bodies in hereditary ferritinopathy.« less

Identification of a peroxisomal-targeted aldolase involved in chlorophyll biosynthesis and sugar metabolism in rice.

PubMed

Zhang, Fei; Zhang, Pan; Zhang, Yu; Wang, Shouchuang; Qu, Lianghuan; Liu, Xianqing; Luo, Jie

2016-09-01

Chlorophyll plays remarkable and critical roles in photosynthetic light-harvesting, energy transduction and plant development. In this study, we identified a rice Chl-deficient mutant, ygdl-1 (yellow green and droopy leaf-1), which showed yellow-green leaves throughout plant development with decreased content of Chls and carotene and an increased Chl a/b ratio. The ygdl-1 mutant also exhibited severe defects in chloroplast development, including disorganized grana stacks. Sequence analysis revealed that the mutant contained a T-DNA insertion within the promoter of a fructose-1,6-bisphosphate aldolase (OsAld-Y), which dramatically reduced the OsAld-Y mRNA level, and its identity was verified by transgenic complementation. Real-time PCR analysis showed that the expression levels of genes associated with chlorophyll biosynthesis and chloroplast development were concurrently altered in the ygdl-1 mutant. The expression of OsAld-Y-GFP fusion protein in tobacco epidermal cells showed that OsAld-Y was localized to the peroxisome. In addition, the analysis of primary carbon metabolites revealed the significantly reduced levels of sucrose and fructose in the mutant leaves, while the glucose content was similar to wild-type plants. Our results suggest that the OsAld-Y participates in Chl accumulation, chloroplast development and plant growth by influencing the photosynthetic rate of leaves and the sugar metabolism of rice. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Misfolded Polyglutamine, Polyalanine, and Superoxide Dismutase 1 Aggregate via Distinct Pathways in the Cell*

PubMed Central

Polling, Saskia; Mok, Yee-Foong; Ramdzan, Yasmin M.; Turner, Bradley J.; Yerbury, Justin J.; Hill, Andrew F.; Hatters, Danny M.

2014-01-01

Protein aggregation into intracellular inclusions is a key feature of many neurodegenerative disorders. A common theme has emerged that inappropriate self-aggregation of misfolded or mutant polypeptide sequences is detrimental to cell health. Yet protein quality control mechanisms may also deliberately cluster them together into distinct inclusion subtypes, including the insoluble protein deposit (IPOD) and the juxtanuclear quality control (JUNQ). Here we investigated how the intrinsic oligomeric state of three model systems of disease-relevant mutant protein and peptide sequences relates to the IPOD and JUNQ patterns of aggregation using sedimentation velocity analysis. Two of the models (polyalanine (37A) and superoxide dismutase 1 (SOD1) mutants A4V and G85R) accumulated into the same JUNQ-like inclusion whereas the other, polyglutamine (72Q), formed spatially distinct IPOD-like inclusions. Using flow cytometry pulse shape analysis (PulSA) to separate cells with inclusions from those without revealed the SOD1 mutants and 37A to have abruptly altered oligomeric states with respect to the nonaggregating forms, regardless of whether cells had inclusions or not, whereas 72Q was almost exclusively monomeric until inclusions formed. We propose that mutations leading to JUNQ inclusions induce a constitutively “misfolded” state exposing hydrophobic side chains that attract and ultimately overextend protein quality capacity, which leads to aggregation into JUNQ inclusions. Poly(Q) is not misfolded in this same sense due to universal polar side chains, but is highly prone to forming amyloid fibrils that we propose invoke a different engagement mechanism with quality control. PMID:24425868

Misfolded polyglutamine, polyalanine, and superoxide dismutase 1 aggregate via distinct pathways in the cell.

PubMed

Polling, Saskia; Mok, Yee-Foong; Ramdzan, Yasmin M; Turner, Bradley J; Yerbury, Justin J; Hill, Andrew F; Hatters, Danny M

2014-03-07

Protein aggregation into intracellular inclusions is a key feature of many neurodegenerative disorders. A common theme has emerged that inappropriate self-aggregation of misfolded or mutant polypeptide sequences is detrimental to cell health. Yet protein quality control mechanisms may also deliberately cluster them together into distinct inclusion subtypes, including the insoluble protein deposit (IPOD) and the juxtanuclear quality control (JUNQ). Here we investigated how the intrinsic oligomeric state of three model systems of disease-relevant mutant protein and peptide sequences relates to the IPOD and JUNQ patterns of aggregation using sedimentation velocity analysis. Two of the models (polyalanine (37A) and superoxide dismutase 1 (SOD1) mutants A4V and G85R) accumulated into the same JUNQ-like inclusion whereas the other, polyglutamine (72Q), formed spatially distinct IPOD-like inclusions. Using flow cytometry pulse shape analysis (PulSA) to separate cells with inclusions from those without revealed the SOD1 mutants and 37A to have abruptly altered oligomeric states with respect to the nonaggregating forms, regardless of whether cells had inclusions or not, whereas 72Q was almost exclusively monomeric until inclusions formed. We propose that mutations leading to JUNQ inclusions induce a constitutively "misfolded" state exposing hydrophobic side chains that attract and ultimately overextend protein quality capacity, which leads to aggregation into JUNQ inclusions. Poly(Q) is not misfolded in this same sense due to universal polar side chains, but is highly prone to forming amyloid fibrils that we propose invoke a different engagement mechanism with quality control.

Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.

PubMed

Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario

2011-04-01

Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.

Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

NASA Astrophysics Data System (ADS)

Shi, Jinming

In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

PubMed

Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

1995-04-11

SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

Value of bilirubin oxidase and its mutants in the diagnosis of hyperbilirubinemia.

PubMed

Zhang, Lei; Zhang, Xiao; Luo, Zhi-Ying

2005-11-01

To elucidate the significance of the coordination amino acid residues in bilirubin oxidase (BO) and their kinetic characteristics, and evaluate whether BO mutants may serve as better diagnostic agent for hyperbilirubinemia. The BO mutants I402G and C457S were obtained by site-directed mutagenesis and confirmed by amino acid sequence analysis. Ru-incorporated C457S mutant was obtained by direct incubation of ruthenium compounds with the mutant. The electron paramagnetic resonance (EPR) spectra of the recombinant BO and the mutants were investigated, and the enzyme kinetics of the recombinant BO and I402G mutant were measured with bilirubin as the substrate at 25 degrees C. The BO mutants were expressed and purified successfully. The mutant I402G showed low enzyme activity, and had C457S virtually no enzyme activity. Nevertheless Ru-incorporation conferred higher enzyme activity to C457S mutant. The enzyme kinetic investigations revealed that the kinetic parameter k(cat) of the recombinant BO and I402G mutant was 235.8 min(-1) and 6.9 min(-1), respectively, suggesting higher enzyme activity of the recombinant BO. The coordinating amino acids have important significance in maintaining the integrity of active centers and enzyme activities of recombinant BO and its mutants. The enzyme activities of the mutants I402G and C457S are much lower than those of recombinant BO, therefore they are not appropriate for diagnostic purpose. Ru-incorporation facilitates the formation of a new intact active center in C457S mutant, which therefore acquires enzyme activity.

Fast neutron mutants database and web displays at SoyBase

USDA-ARS?s Scientific Manuscript database

SoyBase, the USDA-ARS soybean genetics and genomics database, has been expanded to include data for the fast neutron mutants produced by Bolon, Vance, et al. In addition to the expected text and sequence homology searches and visualization of the indels in the context of the genome sequence viewer, ...

Evidence for the role of basic amino acids in the coat protein arm region of Cucumber necrosis virus in particle assembly and selective encapsidation of viral RNA.

PubMed

Alam, Syed Benazir; Reade, Ron; Theilmann, Jane; Rochon, D'Ann

2017-12-01

Cucumber necrosis virus (CNV) is a T = 3 icosahedral virus with a (+)ssRNA genome. The N-terminal CNV coat protein arm contains a conserved, highly basic sequence ("KGRKPR"), which we postulate is involved in RNA encapsidation during virion assembly. Seven mutants were constructed by altering the CNV "KGRKPR" sequence; the four basic residues were mutated to alanine individually, in pairs, or in total. Virion accumulation and vRNA encapsidation were significantly reduced in mutants containing two or four substitutions and virion morphology was also affected, where both T = 1 and intermediate-sized particles were produced. Mutants with two or four substitutions encapsidated significantly greater levels of truncated RNA than that of WT, suggesting that basic residues in the "KGRKPR" sequence are important for encapsidation of full-length CNV RNA. Interestingly, "KGRKPR" mutants also encapsidated relatively higher levels of host RNA, suggesting that the "KGRKPR" sequence also contributes to selective encapsidation of CNV RNA. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

A Molecular Genetics Laboratory Course Applying Bioinformatics and Cell Biology in the Context of Original Research

PubMed Central

Pruitt, Wendy M.; Robinson, Lucy C.

2008-01-01

Research based laboratory courses have been shown to stimulate student interest in science and to improve scientific skills. We describe here a project developed for a semester-long research-based laboratory course that accompanies a genetics lecture course. The project was designed to allow students to become familiar with the use of bioinformatics tools and molecular biology and genetic approaches while carrying out original research. Students were required to present their hypotheses, experiments, and results in a comprehensive lab report. The lab project concerned the yeast casein kinase 1 (CK1) protein kinase Yck2. CK1 protein kinases are present in all organisms and are well conserved in primary structure. These enzymes display sequence features that differ from other protein kinase subfamilies. Students identified such sequences within the CK1 subfamily, chose a sequence to analyze, used available structural data to determine possible functions for their sequences, and designed mutations within the sequences. After generating the mutant alleles, these were expressed in yeast and tested for function by using two growth assays. The student response to the project was positive, both in terms of knowledge and skills increases and interest in research, and several students are continuing the analysis of mutant alleles as summer projects. PMID:19047427

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

In vitro resolution of the dimer bridge of the minute virus of mice (MVM) genome supports the modified rolling hairpin model for MVM replication.

PubMed

Liu, Q; Yong, C B; Astell, C R

1994-06-01

Previous characterization of the terminal sequences of the minute virus of mice (MVM) genome demonstrated that the right hand palindrome contains two sequences, each the inverted complement of the other. However, the left hand palindrome was shown to exist as a unique sequence [Astell et al., J. Virol. 54: 179-185 (1985)]. The modified rolling hairpin (MRH) model for MVM replication provided an explanation of how the right hand palindrome could undergo hairpin transfer to generate two sequences, while the left end palindrome within the dimer bridge could undergo asymmetric resolution and retain the unique left end sequence. This report describes in vitro resolution of the wild-type dimer bridge sequence of MVM using recombinant (baculovirus) expressed NS-1 and a replication extract from LA9 cells. The resolution products are consistent with those predicted by the MRH model, providing support for this replication mechanism. In addition, mutant dimer bridge clones were constructed and used in the resolution assay. The mutant structures included removal of the asymmetry in the hairpin stem, inversion of the sequence at the initiating nick site, and a 2-bp deletion within one stem of the dimer bridge. In all cases, the mutant dimer bridge structures are resolved; however, the resolution pattern observed with the mutant dimer bridge compared with the wild-type dimer bridge is shifted toward symmetrical resolution. These results suggest that sequences within the left hand hairpin (and hence dimer bridge sequence) are responsible for asymmetric resolution and conservation of the unique sequence within the left hand palindrome of the MVM genome.

High-Throughput Sequencing of Campylobacter jejuni Insertion Mutant Libraries Reveals mapA as a Fitness Factor for Chicken Colonization

PubMed Central

Johnson, Jeremiah G.; Livny, Jonathan

2014-01-01

Campylobacter jejuni is a leading cause of gastrointestinal infections worldwide, due primarily to its ability to asymptomatically colonize the gastrointestinal tracts of agriculturally relevant animals, including chickens. Infection often occurs following consumption of meat that was contaminated by C. jejuni during harvest. Because of this, much interest lies in understanding the mechanisms that allow C. jejuni to colonize the chicken gastrointestinal tract. To address this, we generated a C. jejuni transposon mutant library that is amenable to insertion sequencing and introduced this mutant pool into day-of-hatch chicks. Following deep sequencing of C. jejuni mutants in the cecal outputs, several novel factors required for efficient colonization of the chicken gastrointestinal tract were identified, including the predicted outer membrane protein MapA. A mutant strain lacking mapA was constructed and found to be significantly reduced for chicken colonization in both competitive infections and monoinfections. Further, we found that mapA is required for in vitro competition with wild-type C. jejuni but is dispensable for growth in monoculture. PMID:24633877

High-throughput sequencing of Campylobacter jejuni insertion mutant libraries reveals mapA as a fitness factor for chicken colonization.

PubMed

Johnson, Jeremiah G; Livny, Jonathan; Dirita, Victor J

2014-06-01

Campylobacter jejuni is a leading cause of gastrointestinal infections worldwide, due primarily to its ability to asymptomatically colonize the gastrointestinal tracts of agriculturally relevant animals, including chickens. Infection often occurs following consumption of meat that was contaminated by C. jejuni during harvest. Because of this, much interest lies in understanding the mechanisms that allow C. jejuni to colonize the chicken gastrointestinal tract. To address this, we generated a C. jejuni transposon mutant library that is amenable to insertion sequencing and introduced this mutant pool into day-of-hatch chicks. Following deep sequencing of C. jejuni mutants in the cecal outputs, several novel factors required for efficient colonization of the chicken gastrointestinal tract were identified, including the predicted outer membrane protein MapA. A mutant strain lacking mapA was constructed and found to be significantly reduced for chicken colonization in both competitive infections and monoinfections. Further, we found that mapA is required for in vitro competition with wild-type C. jejuni but is dispensable for growth in monoculture.

Cloning and sequence analysis of the LEU2 homologue gene from Pichia anomala.

PubMed

De la Rosa, J M; Pérez, J A; Gutiérrez, F; González, J M; Ruiz, T; Rodríguez, L

2001-11-01

The Pichia anomala LEU2 gene (PaLEU2) was isolated by complementation of a leu2 Saccharomyces cerevisiae mutant. The cloned gene also allowed growth of a Escherichia coli leuB mutant in leucine-lacking medium, indicating that it encodes a product able to complement the beta-isopropylmalate dehydrogenase deficiency of the mutants. The sequenced DNA fragment contains a complete ORF of 1092 bp, and the deduced polypeptide shares significant homologies with the products of the LEU2 genes from S. cerevisiae (84% identity) and other yeast species. A sequence resembling the GC-rich palindrome motif identified in the 5' region of S. cerevisiae LEU2 gene as the binding site for the transcription activating factor encoded by the LEU3 gene was found at the promoter region. In addition, upstream of the PaLEU2 the 3'-terminal half of a gene of the same orientation, encoding a homologue of the S. cerevisiae NFS1/SPL1 gene that encodes a mitochondrial cysteine desulphurase involved in both tRNA processing and mitochondrial metabolism, was found. The genomic organization of the PaNFS1-PaLEU2 gene pair is similar to that found in several other yeast species, including S. cerevisiae and Candida albicans, except that in some of them the LEU2 gene appears in the reverse orientation. Copyright 2001 John Wiley & Sons, Ltd.

Ion-beam irradiation, gene identification, and marker-assisted breeding in the development of low-cadmium rice.

PubMed

Ishikawa, Satoru; Ishimaru, Yasuhiro; Igura, Masato; Kuramata, Masato; Abe, Tadashi; Senoura, Takeshi; Hase, Yoshihiro; Arao, Tomohito; Nishizawa, Naoko K; Nakanishi, Hiromi

2012-11-20

Rice (Oryza sativa L.) grain is a major dietary source of cadmium (Cd), which is toxic to humans, but no practical technique exists to substantially reduce Cd contamination. Carbon ion-beam irradiation produced three rice mutants with <0.05 mg Cd⋅kg(-1) in the grain compared with a mean of 1.73 mg Cd⋅kg(-1) in the parent, Koshihikari. We identified the gene responsible for reduced Cd uptake and developed a strategy for marker-assisted selection of low-Cd cultivars. Sequence analysis revealed that these mutants have different mutations of the same gene (OsNRAMP5), which encodes a natural resistance-associated macrophage protein. Functional analysis revealed that the defective transporter protein encoded by the mutant osnramp5 greatly decreases Cd uptake by roots, resulting in decreased Cd in the straw and grain. In addition, we developed DNA markers to facilitate marker-assisted selection of cultivars carrying osnramp5. When grown in Cd-contaminated paddy fields, the mutants have nearly undetectable Cd in their grains and exhibit no agriculturally or economically adverse traits. Because mutants produced by ion-beam radiation are not transgenic plants, they are likely to be accepted by consumers and thus represent a practical choice for rice production worldwide.

Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

PubMed

Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

1996-02-01

A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

Functional Angucycline-Like Antibiotic Gene Cluster in the Terminal Inverted Repeats of the Streptomyces ambofaciens Linear Chromosome

PubMed Central

Pang, Xiuhua; Aigle, Bertrand; Girardet, Jean-Michel; Mangenot, Sophie; Pernodet, Jean-Luc; Decaris, Bernard; Leblond, Pierre

2004-01-01

Streptomyces ambofaciens has an 8-Mb linear chromosome ending in 200-kb terminal inverted repeats. Analysis of the F6 cosmid overlapping the terminal inverted repeats revealed a locus similar to type II polyketide synthase (PKS) gene clusters. Sequence analysis identified 26 open reading frames, including genes encoding the β-ketoacyl synthase (KS), chain length factor (CLF), and acyl carrier protein (ACP) that make up the minimal PKS. These KS, CLF, and ACP subunits are highly homologous to minimal PKS subunits involved in the biosynthesis of angucycline antibiotics. The genes encoding the KS and ACP subunits are transcribed constitutively but show a remarkable increase in expression after entering transition phase. Five genes, including those encoding the minimal PKS, were replaced by resistance markers to generate single and double mutants (replacement in one and both terminal inverted repeats). Double mutants were unable to produce either diffusible orange pigment or antibacterial activity against Bacillus subtilis. Single mutants showed an intermediate phenotype, suggesting that each copy of the cluster was functional. Transformation of double mutants with a conjugative and integrative form of F6 partially restored both phenotypes. The pigmented and antibacterial compounds were shown to be two distinct molecules produced from the same biosynthetic pathway. High-pressure liquid chromatography analysis of culture extracts from wild-type and double mutants revealed a peak with an associated bioactivity that was absent from the mutants. Two additional genes encoding KS and CLF were present in the cluster. However, disruption of the second KS gene had no effect on either pigment or antibiotic production. PMID:14742212

Mutations in type 3 reovirus that determine binding to sialic acid are contained in the fibrous tail domain of viral attachment protein sigma1.

PubMed

Chappell, J D; Gunn, V L; Wetzel, J D; Baer, G S; Dermody, T S

1997-03-01

The reovirus attachment protein, sigma1, determines numerous aspects of reovirus-induced disease, including viral virulence, pathways of spread, and tropism for certain types of cells in the central nervous system. The sigma1 protein projects from the virion surface and consists of two distinct morphologic domains, a virion-distal globular domain known as the head and an elongated fibrous domain, termed the tail, which is anchored into the virion capsid. To better understand structure-function relationships of sigma1 protein, we conducted experiments to identify sequences in sigma1 important for viral binding to sialic acid, a component of the receptor for type 3 reovirus. Three serotype 3 reovirus strains incapable of binding sialylated receptors were adapted to growth in murine erythroleukemia (MEL) cells, in which sialic acid is essential for reovirus infectivity. MEL-adapted (MA) mutant viruses isolated by serial passage in MEL cells acquired the capacity to bind sialic acid-containing receptors and demonstrated a dependence on sialic acid for infection of MEL cells. Analysis of reassortant viruses isolated from crosses of an MA mutant virus and a reovirus strain that does not bind sialic acid indicated that the sigma1 protein is solely responsible for efficient growth of MA mutant viruses in MEL cells. The deduced sigma1 amino acid sequences of the MA mutant viruses revealed that each strain contains a substitution within a short region of sequence in the sigma1 tail predicted to form beta-sheet. These studies identify specific sequences that determine the capacity of reovirus to bind sialylated receptors and suggest a location for a sialic acid-binding domain. Furthermore, the results support a model in which type 3 sigma1 protein contains discrete receptor binding domains, one in the head and another in the tail that binds sialic acid.

Identification and Characterization of an Acinetobacter baumannii Biofilm-Associated Protein▿

PubMed Central

Loehfelm, Thomas W.; Luke, Nicole R.; Campagnari, Anthony A.

2008-01-01

We have identified a homologue to the staphylococcal biofilm-associated protein (Bap) in a bloodstream isolate of Acinetobacter baumannii. The fully sequenced open reading frame is 25,863 bp and encodes a protein with a predicted molecular mass of 854 kDa. Analysis of the nucleotide sequence reveals a repetitive structure consistent with bacterial cell surface adhesins. Bap-specific monoclonal antibody (MAb) 6E3 was generated to an epitope conserved among 41% of A. baumannii strains isolated during a recent outbreak in the U.S. military health care system. Flow cytometry confirms that the MAb 6E3 epitope is surface exposed. Random transposon mutagenesis was used to generate A. baumannii bap1302::EZ-Tn5, a mutant negative for surface reactivity to MAb 6E3 in which the transposon disrupts the coding sequence of bap. Time course confocal laser scanning microscopy and three-dimensional image analysis of actively growing biofilms demonstrates that this mutant is unable to sustain biofilm thickness and volume, suggesting a role for Bap in supporting the development of the mature biofilm structure. This is the first identification of a specific cell surface protein directly involved in biofilm formation by A. baumannii and suggests that Bap is involved in intercellular adhesion within the mature biofilm. PMID:18024522

BEAMing and Droplet Digital PCR Analysis of Mutant IDH1 mRNA in Glioma Patient Serum and Cerebrospinal Fluid Extracellular Vesicles.

PubMed

Chen, Walter W; Balaj, Leonora; Liau, Linda M; Samuels, Michael L; Kotsopoulos, Steve K; Maguire, Casey A; Loguidice, Lori; Soto, Horacio; Garrett, Matthew; Zhu, Lin Dan; Sivaraman, Sarada; Chen, Clark; Wong, Eric T; Carter, Bob S; Hochberg, Fred H; Breakefield, Xandra O; Skog, Johan

2013-07-23

Development of biofluid-based molecular diagnostic tests for cancer is an important step towards tumor characterization and real-time monitoring in a minimally invasive fashion. Extracellular vesicles (EVs) are released from tumor cells into body fluids and can provide a powerful platform for tumor biomarkers because they carry tumor proteins and nucleic acids. Detecting rare point mutations in the background of wild-type sequences in biofluids such as blood and cerebrospinal fluid (CSF) remains a major challenge. Techniques such as BEAMing (beads, emulsion, amplification, magnetics) PCR and droplet digital PCR (ddPCR) are substantially more sensitive than many other assays for mutant sequence detection. Here, we describe a novel approach that combines biofluid EV RNA and BEAMing RT-PCR (EV-BEAMing), as well droplet digital PCR to interrogate mutations from glioma tumors. EVs from CSF of patients with glioma were shown to contain mutant IDH1 transcripts, and we were able to reliably detect and quantify mutant and wild-type IDH1 RNA transcripts in CSF of patients with gliomas. EV-BEAMing and EV-ddPCR represent a valuable new strategy for cancer diagnostics, which can be applied to a variety of biofluids and neoplasms.Molecular Therapy-Nucleic Acids (2013) 2, e109; doi:10.1038/mtna.2013.28; published online 23 July 2013.

Interactions between the two surface proteins of rotavirus may alter the receptor-binding specificity of the virus.

PubMed Central

Méndez, E; Arias, C F; López, S

1996-01-01

The infection of target cells by most animal rotavirus strains requires the presence of sialic acids (SAs) on the cell surface. We recently isolated variants from simian rotavirus RRV whose infectivity is no longer dependent on SAs and showed that the mutant phenotype segregates with the gene coding for VP4, one of the two surface proteins of rotaviruses (the other one being VP7). The nucleotide sequence of the VP4 gene of four independently isolated variants showed three amino acid changes, at positions 37 (Leu to Pro), 187 (Lys to Arg), and 267 (Tyr to Cys), in all mutant VP4 proteins compared with RRV VP4. The characterization of revertant viruses from two independent mutants showed that the arginine residue at position 187 changed back to lysine, indicating that this amino acid is involved in the determination of the mutant phenotype. Surprisingly, sequence analysis of reassortant virus DS1XRRV, which depends on SAs to infect the cell, showed that its VP4 gene is identical to the VP4 gene of the variants. Since the only difference between DS1XRRV and the RRV variants is the parental origin of the VP7 gene (human rotavirus DS1 in the reassortant), these findings suggest that the receptor-binding specificity of rotaviruses, via VP4, may be influenced by the associated VP7 protein. PMID:8551583

'PACLIMS': a component LIM system for high-throughput functional genomic analysis.

PubMed

Donofrio, Nicole; Rajagopalon, Ravi; Brown, Douglas; Diener, Stephen; Windham, Donald; Nolin, Shelly; Floyd, Anna; Mitchell, Thomas; Galadima, Natalia; Tucker, Sara; Orbach, Marc J; Patel, Gayatri; Farman, Mark; Pampanwar, Vishal; Soderlund, Cari; Lee, Yong-Hwan; Dean, Ralph A

2005-04-12

Recent advances in sequencing techniques leading to cost reduction have resulted in the generation of a growing number of sequenced eukaryotic genomes. Computational tools greatly assist in defining open reading frames and assigning tentative annotations. However, gene functions cannot be asserted without biological support through, among other things, mutational analysis. In taking a genome-wide approach to functionally annotate an entire organism, in this application the approximately 11,000 predicted genes in the rice blast fungus (Magnaporthe grisea), an effective platform for tracking and storing both the biological materials created and the data produced across several participating institutions was required. The platform designed, named PACLIMS, was built to support our high throughput pipeline for generating 50,000 random insertion mutants of Magnaporthe grisea. To be a useful tool for materials and data tracking and storage, PACLIMS was designed to be simple to use, modifiable to accommodate refinement of research protocols, and cost-efficient. Data entry into PACLIMS was simplified through the use of barcodes and scanners, thus reducing the potential human error, time constraints, and labor. This platform was designed in concert with our experimental protocol so that it leads the researchers through each step of the process from mutant generation through phenotypic assays, thus ensuring that every mutant produced is handled in an identical manner and all necessary data is captured. Many sequenced eukaryotes have reached the point where computational analyses are no longer sufficient and require biological support for their predicted genes. Consequently, there is an increasing need for platforms that support high throughput genome-wide mutational analyses. While PACLIMS was designed specifically for this project, the source and ideas present in its implementation can be used as a model for other high throughput mutational endeavors.

'PACLIMS': A component LIM system for high-throughput functional genomic analysis

PubMed Central

Donofrio, Nicole; Rajagopalon, Ravi; Brown, Douglas; Diener, Stephen; Windham, Donald; Nolin, Shelly; Floyd, Anna; Mitchell, Thomas; Galadima, Natalia; Tucker, Sara; Orbach, Marc J; Patel, Gayatri; Farman, Mark; Pampanwar, Vishal; Soderlund, Cari; Lee, Yong-Hwan; Dean, Ralph A

2005-01-01

Background Recent advances in sequencing techniques leading to cost reduction have resulted in the generation of a growing number of sequenced eukaryotic genomes. Computational tools greatly assist in defining open reading frames and assigning tentative annotations. However, gene functions cannot be asserted without biological support through, among other things, mutational analysis. In taking a genome-wide approach to functionally annotate an entire organism, in this application the ~11,000 predicted genes in the rice blast fungus (Magnaporthe grisea), an effective platform for tracking and storing both the biological materials created and the data produced across several participating institutions was required. Results The platform designed, named PACLIMS, was built to support our high throughput pipeline for generating 50,000 random insertion mutants of Magnaporthe grisea. To be a useful tool for materials and data tracking and storage, PACLIMS was designed to be simple to use, modifiable to accommodate refinement of research protocols, and cost-efficient. Data entry into PACLIMS was simplified through the use of barcodes and scanners, thus reducing the potential human error, time constraints, and labor. This platform was designed in concert with our experimental protocol so that it leads the researchers through each step of the process from mutant generation through phenotypic assays, thus ensuring that every mutant produced is handled in an identical manner and all necessary data is captured. Conclusion Many sequenced eukaryotes have reached the point where computational analyses are no longer sufficient and require biological support for their predicted genes. Consequently, there is an increasing need for platforms that support high throughput genome-wide mutational analyses. While PACLIMS was designed specifically for this project, the source and ideas present in its implementation can be used as a model for other high throughput mutational endeavors. PMID:15826298

Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from precursor tRNAs.

PubMed

Hopper, A K; Schultz, L D; Shapiro, R A

1980-03-01

By using conditional loss of suppression an an assay, we have been successful in screening for a yeast mutant which is defective in tRNA processing. The los1-1 mutation causes an accumulation of a subset of precursor tRNAs at the nonpermissive temperature. These pre-tRNAs are like those which accumulate in the yeast mutant ts 136 (rna1) in that they have transcribed intervening sequences. The mutations at los1-1 and rna1 complement and segregate independently of each other. The los1-1 mutation affects the expression of all 8 tyrosine-inserting suppressor loci, but does not seem to affect rRNA or mRNA synthesis.

VH mutant rabbits lacking the VH1a2 gene develop a2+ B cells in the appendix by gene conversion-like alteration of a rearranged VH4 gene.

PubMed

Sehgal, D; Mage, R G; Schiaffella, E

1998-02-01

We investigated the molecular basis for the appearance of V(H)a2 allotype-bearing B cells in mutant Alicia rabbits. The mutation arose in an a2 rabbit; mutants exhibit altered expression of V(H) genes because of a small deletion encompassing V(H)1a2, the 3'-most gene in the V(H) locus. The V(H)1 gene is the major source of V(H)a allotype because this gene is preferentially rearranged in normal rabbits. In young homozygous ali/ali animals, the levels of a2 molecules found in the serum increase with age. In adult ali/ali rabbits, 20 to 50% of serum Igs and B cells bear a2 allotypic determinants. Previous studies suggested that positive selection results in expansion of a2 allotype-bearing B cells in the appendix of young mutant ali/ali rabbits. We separated appendix cells from a 6-wk-old Alicia rabbit by FACS based on the expression of surface IgM and a2 allotype. The VDJ portion of the expressed Ig mRNA was amplified from the IgM+ a2+ and IgM+ a2- populations by reverse transcriptase-PCR. The cDNAs from both populations were cloned and sequenced. Analysis of these sequences suggested that, in a2+ B cells, the first D proximal functional gene in Alicia rabbits, V(H)4a2, rearranged and was altered further by a gene conversion-like mechanism. Upstream V(H) genes were identified as potential gene sequence donors; V(H)9 was found to be the most frequently used gene donor. Among the a2- B cells, y33 was the most frequently rearranged gene.

The Role of the Regulator Fur in Gene Regulation and Virulence of Riemerella anatipestifer Assessed Using an Unmarked Gene Deletion System

PubMed Central

Guo, Yunqing; Hu, Di; Guo, Jie; Li, Xiaowen; Guo, Jinyue; Wang, Xiliang; Xiao, Yuncai; Jin, Hui; Liu, Mei; Li, Zili; Bi, Dingren; Zhou, Zutao

2017-01-01

Riemerella anatipestifer, an avian pathogen, has resulted in enormous economic losses to the duck industry globally. Notwithstanding, little is known regarding the physiological, pathogenic and virulence mechanisms of Riemerella anatipestifer (RA) infection. However, the role of Ferric uptake regulator (Fur) in the virulence of R. anatipestifer has not, to date, been demonstrated. Using a genetic approach, unmarked gene deletion system, we evaluated the function of fur gene in the virulence of R. anatipestifer. For this purpose, we constructed a suicide vector containing pheS as a counter selectable marker for unmarked deletion of fur gene to investigate its role in the virulence. After successful transformation of the newly constructed vector, a mutant strain was characterized for genes regulated by iron and Fur using RNA-sequencing and a comparison was made between wild type and mutant strains in both iron restricted and enriched conditions. RNA-seq analysis of the mutant strain in a restricted iron environment showed the downregulation and upregulation of genes which were involved in either important metabolic pathways, transport processes, growth or cell membrane synthesis. Electrophoretic mobility shift assay was performed to identify the putative sequences recognized by Fur. The putative Fur-box sequence was 5′-GATAATGATAATCATTATC-3′. Lastly, the median lethal dose and histopathological investigations of animal tissues also illustrated mild pathological lesions produced by the mutant strain as compared to the wild type RA strain, hence showing declined virulence. Conclusively, an unmarked gene deletion system was successfully developed for RA and the role of the fur gene in virulence was explored comprehensively. PMID:28971067

Regulation of ecmF gene expression and genetic hierarchy among STATa, CudA, and MybC on several prestalk A-specific gene expressions in Dictyostelium.

PubMed

Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi

2016-05-01

STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa. © 2016 Japanese Society of Developmental Biologists.

Genetic Perturbation of the Maize Methylome[W

PubMed Central

Li, Qing; Hermanson, Peter J.; Zaunbrecher, Virginia M.; Song, Jawon; Wendt, Jennifer; Rosenbaum, Heidi; Madzima, Thelma F.; Sloan, Amy E.; Huang, Ji; Burgess, Daniel L.; Richmond, Todd A.; McGinnis, Karen M.; Meeley, Robert B.; Danilevskaya, Olga N.; Vaughn, Matthew W.; Kaeppler, Shawn M.; Jeddeloh, Jeffrey A.

2014-01-01

DNA methylation can play important roles in the regulation of transposable elements and genes. A collection of mutant alleles for 11 maize (Zea mays) genes predicted to play roles in controlling DNA methylation were isolated through forward- or reverse-genetic approaches. Low-coverage whole-genome bisulfite sequencing and high-coverage sequence-capture bisulfite sequencing were applied to mutant lines to determine context- and locus-specific effects of these mutations on DNA methylation profiles. Plants containing mutant alleles for components of the RNA-directed DNA methylation pathway exhibit loss of CHH methylation at many loci as well as CG and CHG methylation at a small number of loci. Plants containing loss-of-function alleles for chromomethylase (CMT) genes exhibit strong genome-wide reductions in CHG methylation and some locus-specific loss of CHH methylation. In an attempt to identify stocks with stronger reductions in DNA methylation levels than provided by single gene mutations, we performed crosses to create double mutants for the maize CMT3 orthologs, Zmet2 and Zmet5, and for the maize DDM1 orthologs, Chr101 and Chr106. While loss-of-function alleles are viable as single gene mutants, the double mutants were not recovered, suggesting that severe perturbations of the maize methylome may have stronger deleterious phenotypic effects than in Arabidopsis thaliana. PMID:25527708

Insights into the Enhanced in vivo Fitness of Neisseria gonorrhoeae Driven by a Fluoroquinolone Resistance-Conferring Mutant DNA Gyrase

DTIC Science & Technology

2015-02-05

enhancement in fitness relative to its parent strain was also more resistant to human and bacterial antimicrobial peptides , including the cathelicidins...32 Deep sequencing data analysis.............................................................................. 33 Antimicrobial peptide ...Sensitivity to cationic antimicrobial peptides ....................................................... 57 In vivo competitive infection in wild-type and

Multivariate sequence analysis reveals additional function impacting residues in the SDR superfamily.

PubMed

Tiwari, Pratibha; Singh, Noopur; Dixit, Aparna; Choudhury, Devapriya

2014-10-01

The "extended" type of short chain dehydrogenases/reductases (SDR), share a remarkable similarity in their tertiary structures inspite of being highly divergent in their functions and sequences. We have carried out principal component analysis (PCA) on structurally equivalent residue positions of 10 SDR families using information theoretic measures like Jensen-Shannon divergence and average shannon entropy as variables. The results classify residue positions in the SDR fold into six groups, one of which is characterized by low Shannon entropies but high Jensen-Shannon divergence against the reference family SDR1E, suggesting that these positions are responsible for the specific functional identities of individual SDR families, distinguishing them from the reference family SDR1E. Site directed mutagenesis of three residues from this group in the enzyme UDP-Galactose 4-epimerase belonging to SDR1E shows that the mutants promote the formation of NADH containing abortive complexes. Finally, molecular dynamics simulations have been used to suggest a mechanism by which the mutants interfere with the re-oxidation of NADH leading to the formation of abortive complexes. © 2014 Wiley Periodicals, Inc.

Dissecting hematopoietic and renal cell heterogeneity in adult zebrafish at single-cell resolution using RNA sequencing.

PubMed

Tang, Qin; Iyer, Sowmya; Lobbardi, Riadh; Moore, John C; Chen, Huidong; Lareau, Caleb; Hebert, Christine; Shaw, McKenzie L; Neftel, Cyril; Suva, Mario L; Ceol, Craig J; Bernards, Andre; Aryee, Martin; Pinello, Luca; Drummond, Iain A; Langenau, David M

2017-10-02

Recent advances in single-cell, transcriptomic profiling have provided unprecedented access to investigate cell heterogeneity during tissue and organ development. In this study, we used massively parallel, single-cell RNA sequencing to define cell heterogeneity within the zebrafish kidney marrow, constructing a comprehensive molecular atlas of definitive hematopoiesis and functionally distinct renal cells found in adult zebrafish. Because our method analyzed blood and kidney cells in an unbiased manner, our approach was useful in characterizing immune-cell deficiencies within DNA-protein kinase catalytic subunit ( prkdc ), interleukin-2 receptor γ a ( il2rga ), and double-homozygous-mutant fish, identifying blood cell losses in T, B, and natural killer cells within specific genetic mutants. Our analysis also uncovered novel cell types, including two classes of natural killer immune cells, classically defined and erythroid-primed hematopoietic stem and progenitor cells, mucin-secreting kidney cells, and kidney stem/progenitor cells. In total, our work provides the first, comprehensive, single-cell, transcriptomic analysis of kidney and marrow cells in the adult zebrafish. © 2017 Tang et al.

Dissecting hematopoietic and renal cell heterogeneity in adult zebrafish at single-cell resolution using RNA sequencing

PubMed Central

Iyer, Sowmya; Lobbardi, Riadh; Chen, Huidong; Hebert, Christine; Shaw, McKenzie L.; Neftel, Cyril; Suva, Mario L.; Bernards, Andre; Aryee, Martin; Drummond, Iain A.

2017-01-01

Recent advances in single-cell, transcriptomic profiling have provided unprecedented access to investigate cell heterogeneity during tissue and organ development. In this study, we used massively parallel, single-cell RNA sequencing to define cell heterogeneity within the zebrafish kidney marrow, constructing a comprehensive molecular atlas of definitive hematopoiesis and functionally distinct renal cells found in adult zebrafish. Because our method analyzed blood and kidney cells in an unbiased manner, our approach was useful in characterizing immune-cell deficiencies within DNA–protein kinase catalytic subunit (prkdc), interleukin-2 receptor γ a (il2rga), and double-homozygous–mutant fish, identifying blood cell losses in T, B, and natural killer cells within specific genetic mutants. Our analysis also uncovered novel cell types, including two classes of natural killer immune cells, classically defined and erythroid-primed hematopoietic stem and progenitor cells, mucin-secreting kidney cells, and kidney stem/progenitor cells. In total, our work provides the first, comprehensive, single-cell, transcriptomic analysis of kidney and marrow cells in the adult zebrafish. PMID:28878000

A CheR/CheB fusion protein is involved in cyst cell development and chemotaxis in Azospirillum brasilense Sp7.

PubMed

Wu, Lixian; Cui, Yanhua; Hong, Yuanyuan; Chen, Sanfeng

2011-12-20

We here report the sequence and functional analysis of cstB of Azospirillum brasilense Sp7. The predicted cstB contains C-terminal two PAS domains and N-terminal part which has similarity with CheB-CheR fusion protein. cstB mutants had reduced swarming ability compared to that of A. brasilense wild-type strain, implying that cstB was involved in chemotaxis in A. brasilense. A microscopic analysis revealed that cstB mutants developed mature cyst cells more quickly than wild type, indicating that cstB is involved in cyst formation. cstB mutants were affected in colony morphology and the production of exopolysaccharides (EPS) which are essential for A. brasilense cells to differentiate into cyst-like forms. These observations suggested that cstB was a multi-effector involved in cyst development and chemotaxis in A. brasilense. Copyright © 2010 Elsevier GmbH. All rights reserved.

Mutational analysis of the transcriptional activator VirG of Agrobacterium tumefaciens.

PubMed Central

Scheeren-Groot, E P; Rodenburg, K W; den Dulk-Ras, A; Turk, S C; Hooykaas, P J

1994-01-01

To find VirG proteins with altered properties, the virG gene was mutagenized. Random chemical mutagenesis of single-stranded DNA containing the Agrobacterium tumefaciens virG gene led with high frequency to the inactivation of the gene. Sequence analysis showed that 29% of the mutants contained a virG gene with one single-base-pair substitution somewhere in the open reading frame. Thirty-nine different mutations that rendered the VirG protein inactive were mapped. Besides these inactive mutants, two mutants in which the vir genes were active even in the absence of acetosyringone were found on indicator plates. A VirG protein with an N54D substitution turned out to be able to induce a virB-lacZ reporter gene to a high level even in the absence of the inducer acetosyringone. A VirG protein with an I77V substitution exhibited almost no induction in the absence of acetosyringone but showed a maximum induction level already at low concentrations of acetosyringone. Images PMID:7961391

The gene for a lectin-like protein is transcriptionally activated during sexual development, but is not essential for fruiting body formation in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Cebula, Patricia

2005-11-03

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development), a gene encoding a putative lectin homolog. Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Deltatap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora.

The gene for a lectin-like protein is transcriptionally activated during sexual development, but is not essential for fruiting body formation in the filamentous fungus Sordaria macrospora

PubMed Central

Nowrousian, Minou; Cebula, Patricia

2005-01-01

Background The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development), a gene encoding a putative lectin homolog. Results Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Δtap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. Conclusion The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora. PMID:16266439

Genome-wide survey of artificial mutations induced by ethyl methanesulfonate and gamma rays in tomato.

PubMed

Shirasawa, Kenta; Hirakawa, Hideki; Nunome, Tsukasa; Tabata, Satoshi; Isobe, Sachiko

2016-01-01

Genome-wide mutations induced by ethyl methanesulfonate (EMS) and gamma irradiation in the tomato Micro-Tom genome were identified by a whole-genome shotgun sequencing analysis to estimate the spectrum and distribution of whole-genome DNA mutations and the frequency of deleterious mutations. A total of ~370 Gb of paired-end reads for four EMS-induced mutants and three gamma-ray-irradiated lines as well as a wild-type line were obtained by next-generation sequencing technology. Using bioinformatics analyses, we identified 5920 induced single nucleotide variations and insertion/deletion (indel) mutations. The predominant mutations in the EMS mutants were C/G to T/A transitions, while in the gamma-ray mutants, C/G to T/A transitions, A/T to T/A transversions, A/T to G/C transitions and deletion mutations were equally common. Biases in the base composition flanking mutations differed between the mutagenesis types. Regarding the effects of the mutations on gene function, >90% of the mutations were located in intergenic regions, and only 0.2% were deleterious. In addition, we detected 1,140,687 spontaneous single nucleotide polymorphisms and indel polymorphisms in wild-type Micro-Tom lines. We also found copy number variation, deletions and insertions of chromosomal segments in both the mutant and wild-type lines. The results provide helpful information not only for mutation research, but also for mutant screening methodology with reverse-genetic approaches. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Development of a novel pink-eyed dilution mouse model showing progressive darkening of the eyes and coat hair with aging

PubMed Central

ISHIKAWA, Akira; SUGIYAMA, Makoto; HONDO, Eiichi; KINOSHITA, Keiji; YAMAGISHI, Yuki

2015-01-01

Oca2p-cas (oculocutaneous albinism II; pink-eyed dilution castaneus) is a coat color mutant gene on mouse chromosome 7 that arose spontaneously in wild Mus musculus castaneus mice. Mice homozygous for Oca2p-cas usually exhibit pink eyes and gray coat hair on the non-agouti genetic background, and this ordinary phenotype remains unchanged throughout life. During breeding of a mixed strain carrying this gene on the C57BL/6J background, we discovered a novel spontaneous mutation that causes darkening of the eyes and coat hair with aging. In this study, we developed a novel mouse model showing this unique phenotype. Gross observations revealed that the pink eyes and gray coat hair of the novel mutant young mice became progressively darker in color by approximately 3 months after birth. Light and transmission-electron microscopic observations revealed a marked increase in melanin pigmentation of coat hair shafts and choroid of the eye in the novel mice compared to that in the ordinary mice. Sequence analysis of Oca2p-cas revealed a 4.1-kb deletion involving exons 15 and 16 of its wild-type gene. However, there was no sequence difference between the two types of mutant mice. Mating experiments suggested that the novel mutant phenotype was not inherited in a simple fashion, due to incomplete penetrance. The novel spontaneous mutant mouse is the first example of progressive hair darkening animals and is an essential animal model for understanding of the regulation mechanisms of melanin biosynthesis with aging. PMID:25739360

Development of a novel pink-eyed dilution mouse model showing progressive darkening of the eyes and coat hair with aging.

PubMed

Ishikawa, Akira; Sugiyama, Makoto; Hondo, Eiichi; Kinoshita, Keiji; Yamagishi, Yuki

2015-01-01

Oca2(p-cas) (oculocutaneous albinism II; pink-eyed dilution castaneus) is a coat color mutant gene on mouse chromosome 7 that arose spontaneously in wild Mus musculus castaneus mice. Mice homozygous for Oca2(p-cas) usually exhibit pink eyes and gray coat hair on the non-agouti genetic background, and this ordinary phenotype remains unchanged throughout life. During breeding of a mixed strain carrying this gene on the C57BL/6J background, we discovered a novel spontaneous mutation that causes darkening of the eyes and coat hair with aging. In this study, we developed a novel mouse model showing this unique phenotype. Gross observations revealed that the pink eyes and gray coat hair of the novel mutant young mice became progressively darker in color by approximately 3 months after birth. Light and transmission-electron microscopic observations revealed a marked increase in melanin pigmentation of coat hair shafts and choroid of the eye in the novel mice compared to that in the ordinary mice. Sequence analysis of Oca2(p-cas) revealed a 4.1-kb deletion involving exons 15 and 16 of its wild-type gene. However, there was no sequence difference between the two types of mutant mice. Mating experiments suggested that the novel mutant phenotype was not inherited in a simple fashion, due to incomplete penetrance. The novel spontaneous mutant mouse is the first example of progressive hair darkening animals and is an essential animal model for understanding of the regulation mechanisms of melanin biosynthesis with aging.

Whole-transcriptome RNA-seq, gene set enrichment pathway analysis, and exon coverage analysis of two plastid RNA editing mutants.

PubMed

Hackett, Justin B; Lu, Yan

2017-05-04

In land plants, plastid and mitochondrial RNAs are subject to post-transcriptional C-to-U RNA editing. T-DNA insertions in the ORGANELLE RNA RECOGNITION MOTIF PROTEIN6 gene resulted in reduced photosystem II (PSII) activity and smaller plant and leaf sizes. Exon coverage analysis of the ORRM6 gene showed that orrm6-1 and orrm6-2 are loss-of-function mutants. Compared to other ORRM proteins, ORRM6 affects a relative small number of RNA editing sites. Sanger sequencing of reverse transcription-PCR products of plastid transcripts revealed 2 plastid RNA editing sites that are substantially affected in the orrm6 mutants: psbF-C77 and accD-C794. The psbF gene encodes the β subunit of cytochrome b 559 , an essential component of PSII. The accD gene encodes the β subunit of acetyl-CoA carboxylase, a protein required in plastid fatty acid biosynthesis. Whole-transcriptome RNA-seq demonstrated that editing at psbF-C77 is nearly absent and the editing extent at accD-C794 was significantly reduced. Gene set enrichment pathway analysis showed that expression of multiple gene sets involved in photosynthesis, especially photosynthetic electron transport, is significantly upregulated in both orrm6 mutants. The upregulation could be a mechanism to compensate for the reduced PSII electron transport rate in the orrm6 mutants. These results further demonstrated that Organelle RNA Recognition Motif protein ORRM6 is required in editing of specific RNAs in the Arabidopsis (Arabidopsis thaliana) plastid.

Terminal sequence importance of de novo proteins from binary-patterned library: stable artificial proteins with 11- or 12-amino acid alphabet.

PubMed

Okura, Hiromichi; Takahashi, Tsuyoshi; Mihara, Hisakazu

2012-06-01

Successful approaches of de novo protein design suggest a great potential to create novel structural folds and to understand natural rules of protein folding. For these purposes, smaller and simpler de novo proteins have been developed. Here, we constructed smaller proteins by removing the terminal sequences from stable de novo vTAJ proteins and compared stabilities between mutant and original proteins. vTAJ proteins were screened from an α3β3 binary-patterned library which was designed with polar/ nonpolar periodicities of α-helix and β-sheet. vTAJ proteins have the additional terminal sequences due to the method of constructing the genetically repeated library sequences. By removing the parts of the sequences, we successfully obtained the stable smaller de novo protein mutants with fewer amino acid alphabets than the originals. However, these mutants showed the differences on ANS binding properties and stabilities against denaturant and pH change. The terminal sequences, which were designed just as flexible linkers not as secondary structure units, sufficiently affected these physicochemical details. This study showed implications for adjusting protein stabilities by designing N- and C-terminal sequences.

Isolation of a novel mutant gene for soil-surface rooting in rice (Oryza sativa L.)

PubMed Central

2013-01-01

Background Root system architecture is an important trait affecting the uptake of nutrients and water by crops. Shallower root systems preferentially take up nutrients from the topsoil and help avoid unfavorable environments in deeper soil layers. We have found a soil-surface rooting mutant from an M2 population that was regenerated from seed calli of a japonica rice cultivar, Nipponbare. In this study, we examined the genetic and physiological characteristics of this mutant. Results The primary roots of the mutant showed no gravitropic response from the seedling stage on, whereas the gravitropic response of the shoots was normal. Segregation analyses by using an F2 population derived from a cross between the soil-surface rooting mutant and wild-type Nipponbare indicated that the trait was controlled by a single recessive gene, designated as sor1. Fine mapping by using an F2 population derived from a cross between the mutant and an indica rice cultivar, Kasalath, revealed that sor1 was located within a 136-kb region between the simple sequence repeat markers RM16254 and 2935-6 on the terminal region of the short arm of chromosome 4, where 13 putative open reading frames (ORFs) were found. We sequenced these ORFs and detected a 33-bp deletion in one of them, Os04g0101800. Transgenic plants of the mutant transformed with the genomic fragment carrying the Os04g0101800 sequence from Nipponbare showed normal gravitropic responses and no soil-surface rooting. Conclusion These results suggest that sor1, a rice mutant causing soil-surface rooting and altered root gravitropic response, is allelic to Os04g0101800, and that a 33-bp deletion in the coding region of this gene causes the mutant phenotypes. PMID:24280269

Isolation of a novel mutant gene for soil-surface rooting in rice (Oryza sativa L.).

PubMed

Hanzawa, Eiko; Sasaki, Kazuhiro; Nagai, Shinsei; Obara, Mitsuhiro; Fukuta, Yoshimichi; Uga, Yusaku; Miyao, Akio; Hirochika, Hirohiko; Higashitani, Atsushi; Maekawa, Masahiko; Sato, Tadashi

2013-11-20

Root system architecture is an important trait affecting the uptake of nutrients and water by crops. Shallower root systems preferentially take up nutrients from the topsoil and help avoid unfavorable environments in deeper soil layers. We have found a soil-surface rooting mutant from an M2 population that was regenerated from seed calli of a japonica rice cultivar, Nipponbare. In this study, we examined the genetic and physiological characteristics of this mutant. The primary roots of the mutant showed no gravitropic response from the seedling stage on, whereas the gravitropic response of the shoots was normal. Segregation analyses by using an F2 population derived from a cross between the soil-surface rooting mutant and wild-type Nipponbare indicated that the trait was controlled by a single recessive gene, designated as sor1. Fine mapping by using an F2 population derived from a cross between the mutant and an indica rice cultivar, Kasalath, revealed that sor1 was located within a 136-kb region between the simple sequence repeat markers RM16254 and 2935-6 on the terminal region of the short arm of chromosome 4, where 13 putative open reading frames (ORFs) were found. We sequenced these ORFs and detected a 33-bp deletion in one of them, Os04g0101800. Transgenic plants of the mutant transformed with the genomic fragment carrying the Os04g0101800 sequence from Nipponbare showed normal gravitropic responses and no soil-surface rooting. These results suggest that sor1, a rice mutant causing soil-surface rooting and altered root gravitropic response, is allelic to Os04g0101800, and that a 33-bp deletion in the coding region of this gene causes the mutant phenotypes.

Bacteriophage-derived CHAP domain protein, P128, kills Staphylococcus cells by cleaving interpeptide cross-bridge of peptidoglycan.

PubMed

Sundarrajan, Sudarson; Raghupatil, Junjappa; Vipra, Aradhana; Narasimhaswamy, Nagalakshmi; Saravanan, Sanjeev; Appaiah, Chemira; Poonacha, Nethravathi; Desai, Srividya; Nair, Sandhya; Bhatt, Rajagopala Narayana; Roy, Panchali; Chikkamadaiah, Ravisha; Durgaiah, Murali; Sriram, Bharathi; Padmanabhan, Sriram; Sharma, Umender

2014-10-01

P128 is an anti-staphylococcal protein consisting of the Staphylococcus aureus phage-K-derived tail-associated muralytic enzyme (TAME) catalytic domain (Lys16) fused with the cell-wall-binding SH3b domain of lysostaphin. In order to understand the mechanism of action and emergence of resistance to P128, we isolated mutants of Staphylococcus spp., including meticillin-resistant Staphylococcus aureus (MRSA), resistant to P128. In addition to P128, the mutants also showed resistance to Lys16, the catalytic domain of P128. The mutants showed loss of fitness as shown by reduced rate of growth in vitro. One of the mutants tested was found to show reduced virulence in animal models of S. aureus septicaemia suggesting loss of fitness in vivo as well. Analysis of the antibiotic sensitivity pattern showed that the mutants derived from MRSA strains had become sensitive to meticillin and other β-lactams. Interestingly, the mutant cells were resistant to the lytic action of phage K, although the phage was able to adsorb to these cells. Sequencing of the femA gene of three P128-resistant mutants showed either a truncation or deletion in femA, suggesting that improper cross-bridge formation in S. aureus could be causing resistance to P128. Using glutathione S-transferase (GST) fusion peptides as substrates it was found that both P128 and Lys16 were capable of cleaving a pentaglycine sequence, suggesting that P128 might be killing S. aureus by cleaving the pentaglycine cross-bridge of peptidoglycan. Moreover, peptides corresponding to the reported cross-bridge of Staphylococcus haemolyticus (GGSGG, AGSGG), which were not cleaved by lysostaphin, were cleaved efficiently by P128. This was also reflected in high sensitivity of S. haemolyticus to P128. This showed that in spite of sharing a common mechanism of action with lysostaphin, P128 has unique properties, which allow it to act on certain lysostaphin-resistant Staphylococcus strains. © 2014 The Authors.

Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III.

PubMed

Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok

2011-02-01

RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

[Role of phosphorylation of MARCKS-PSD in the secretion of MUC5AC induced by cold temperatures in human airway epithelial cells].

PubMed

Li, Minchao; Perelman, Juliy M; Zhou, Xiangdong

2012-05-01

To construct phosphorylation sites domain (PSD) mutant of myristoylated alaninerich C kinase substrate (MARCKS) and explore the role of transient receptor potential melastatin 8 cation channels (TRPM8) and MARCKS in cold-induced synthesis and exocytosis of mucin (MUC) 5AC. Human placental cDNA was used as a template to amplify the full coding region of MARCKS cDNA by PCR. Ser159, Ser 163, Ser 167, Ser 170 in the PSD were mutated to aspartic acids by an overlap PCR method. The resultant PSD mutant cDNA and the wild-type MARCKS cDNA were each subcloned into a mammalian expression vector pcDNA3.0. Recombinant constructs were confirmed by restriction enzyme digestion analysis and DNA sequencing. In intervention experiments, cells were pretreated with the TRPM8 channel antagonist BCTC and transfected with MARCKS-PSD mutant cDNA, and thereafter cold stimulation was applied. The levels of MUC5AC were measured by immunofluorescence and ELISA to clarify the roles of TRPM8 and PSD mutant on the synthesis and secretion of MUC5AC induced by cold, respectively. Restriction enzyme digestion analysis and DNA sequencing revealed that the pcDNA3.0- MARCKS and pcDNA3.0-MARCKS-PSD mutants were successfully constructed. The levels of intracellular and secreted MUC5AC of cold treated group were significantly higher than those of control group (P<0.05). BCTC attenuated the cold-induced synthesis and secretion of MUC5AC when compared with cold treated group (P<0.05). Transfection of 16HBE cells with the MARCKS-PSD mutant cDNA resulted in significant inhibition of mucin secretion in response to cold, and significantly higher level of intracellular MUC5AC than that of control group (P<0.01), whereas transfection with the vector DNA or the wild-type MARCKS cDNA had no effect on the mucin synthesis and secretion in response to cold (P>0.05). TRPM8 and phosphorylation of MARCKS-PSD mediates the cold-induced exocytosis of MUC5AC by airway epithelial cells.

The Bacillus subtilis yaaH Gene Is Transcribed by SigE RNA Polymerase during Sporulation, and Its Product Is Involved in Germination of Spores

PubMed Central

Kodama, Takeko; Takamatsu, Hiromu; Asai, Kei; Kobayashi, Kazuo; Ogasawara, Naotake; Watabe, Kazuhito

1999-01-01

The expression of 21 novel genes located in the region from dnaA to abrB of the Bacillus subtilis chromosome was analyzed. One of the genes, yaaH, had a predicted promoter sequence conserved among SigE-dependent genes. Northern blot analysis revealed that yaaH mRNA was first detected from 2 h after the cessation of logarithmic growth (T2) of sporulation in wild-type cells and in spoIIIG (SigG−) and spoIVCB (SigK−) mutants but not in spoIIAC (SigF−) and spoIIGAB (SigE−) mutants. The transcription start point was determined by primer extension analysis; the −10 and −35 regions are very similar to the consensus sequences recognized by SigE-containing RNA polymerase. A YaaH-His tag fusion encoded by a plasmid with a predicted promoter for the yaaH gene was produced from T2 of sporulation in a B. subtilis transformant and extracted from mature spores, indicating that the yaaH gene product is a spore protein. Inactivation of the yaaH gene by insertion of an erythromycin resistance gene did not affect vegetative growth or spore resistance to heat, chloroform, and lysozyme. The germination of yaaH mutant spores in a mixture of l-asparagine, d-glucose, d-fructose, and potassium chloride was almost the same as that of wild-type spores, but the mutant spores were defective in l-alanine-stimulated germination. These results suggest that yaaH is a novel gene encoding a spore protein produced in the mother cell compartment from T2 of sporulation and that it is required for the l-alanine-stimulated germination pathway. PMID:10419957

Isolation of New Gravitropic Mutants under Hypergravity Conditions.

PubMed

Mori, Akiko; Toyota, Masatsugu; Shimada, Masayoshi; Mekata, Mika; Kurata, Tetsuya; Tasaka, Masao; Morita, Miyo T

2016-01-01

Forward genetics is a powerful approach used to link genotypes and phenotypes, and mutant screening/analysis has provided deep insights into many aspects of plant physiology. Gravitropism is a tropistic response in plants, in which hypocotyls and stems sense the direction of gravity and grow upward. Previous studies of gravitropic mutants have suggested that shoot endodermal cells in Arabidopsis stems and hypocotyls are capable of sensing gravity (i.e., statocytes). In the present study, we report a new screening system using hypergravity conditions to isolate enhancers of gravitropism mutants, and we also describe a rapid and efficient genome mapping method, using next-generation sequencing (NGS) and single nucleotide polymorphism (SNP)-based markers. Using the endodermal-amyloplast less 1 ( eal1 ) mutant, which exhibits defective development of endodermal cells and gravitropism, we found that hypergravity (10 g) restored the reduced gravity responsiveness in eal1 hypocotyls and could, therefore, be used to obtain mutants with further reduction in gravitropism in the eal1 background. Using the new screening system, we successfully isolated six ene ( enhancer of eal1 ) mutants that exhibited little or no gravitropism under hypergravity conditions, and using NGS and map-based cloning with SNP markers, we narrowed down the potential causative genes, which revealed a new genetic network for shoot gravitropism in Arabidopsis .

Isolation of New Gravitropic Mutants under Hypergravity Conditions

PubMed Central

Mori, Akiko; Toyota, Masatsugu; Shimada, Masayoshi; Mekata, Mika; Kurata, Tetsuya; Tasaka, Masao; Morita, Miyo T.

2016-01-01

Forward genetics is a powerful approach used to link genotypes and phenotypes, and mutant screening/analysis has provided deep insights into many aspects of plant physiology. Gravitropism is a tropistic response in plants, in which hypocotyls and stems sense the direction of gravity and grow upward. Previous studies of gravitropic mutants have suggested that shoot endodermal cells in Arabidopsis stems and hypocotyls are capable of sensing gravity (i.e., statocytes). In the present study, we report a new screening system using hypergravity conditions to isolate enhancers of gravitropism mutants, and we also describe a rapid and efficient genome mapping method, using next-generation sequencing (NGS) and single nucleotide polymorphism (SNP)-based markers. Using the endodermal-amyloplast less 1 (eal1) mutant, which exhibits defective development of endodermal cells and gravitropism, we found that hypergravity (10 g) restored the reduced gravity responsiveness in eal1 hypocotyls and could, therefore, be used to obtain mutants with further reduction in gravitropism in the eal1 background. Using the new screening system, we successfully isolated six ene (enhancer of eal1) mutants that exhibited little or no gravitropism under hypergravity conditions, and using NGS and map-based cloning with SNP markers, we narrowed down the potential causative genes, which revealed a new genetic network for shoot gravitropism in Arabidopsis. PMID:27746791

MIP-MAP: High-Throughput Mapping of Caenorhabditis elegans Temperature-Sensitive Mutants via Molecular Inversion Probes.

PubMed

Mok, Calvin A; Au, Vinci; Thompson, Owen A; Edgley, Mark L; Gevirtzman, Louis; Yochem, John; Lowry, Joshua; Memar, Nadin; Wallenfang, Matthew R; Rasoloson, Dominique; Bowerman, Bruce; Schnabel, Ralf; Seydoux, Geraldine; Moerman, Donald G; Waterston, Robert H

2017-10-01

Mutants remain a powerful means for dissecting gene function in model organisms such as Caenorhabditis elegans Massively parallel sequencing has simplified the detection of variants after mutagenesis but determining precisely which change is responsible for phenotypic perturbation remains a key step. Genetic mapping paradigms in C . elegans rely on bulk segregant populations produced by crosses with the problematic Hawaiian wild isolate and an excess of redundant information from whole-genome sequencing (WGS). To increase the repertoire of available mutants and to simplify identification of the causal change, we performed WGS on 173 temperature-sensitive (TS) lethal mutants and devised a novel mapping method. The mapping method uses molecular inversion probes (MIP-MAP) in a targeted sequencing approach to genetic mapping, and replaces the Hawaiian strain with a Million Mutation Project strain with high genomic and phenotypic similarity to the laboratory wild-type strain N2 We validated MIP-MAP on a subset of the TS mutants using a competitive selection approach to produce TS candidate mapping intervals with a mean size < 3 Mb. MIP-MAP successfully uses a non-Hawaiian mapping strain and multiplexed libraries are sequenced at a fraction of the cost of WGS mapping approaches. Our mapping results suggest that the collection of TS mutants contains a diverse library of TS alleles for genes essential to development and reproduction. MIP-MAP is a robust method to genetically map mutations in both viable and essential genes and should be adaptable to other organisms. It may also simplify tracking of individual genotypes within population mixtures. Copyright © 2017 by the Genetics Society of America.

MIP-MAP: High-Throughput Mapping of Caenorhabditis elegans Temperature-Sensitive Mutants via Molecular Inversion Probes

PubMed Central

Mok, Calvin A.; Au, Vinci; Thompson, Owen A.; Edgley, Mark L.; Gevirtzman, Louis; Yochem, John; Lowry, Joshua; Memar, Nadin; Wallenfang, Matthew R.; Rasoloson, Dominique; Bowerman, Bruce; Schnabel, Ralf; Seydoux, Geraldine; Moerman, Donald G.; Waterston, Robert H.

2017-01-01

Mutants remain a powerful means for dissecting gene function in model organisms such as Caenorhabditis elegans. Massively parallel sequencing has simplified the detection of variants after mutagenesis but determining precisely which change is responsible for phenotypic perturbation remains a key step. Genetic mapping paradigms in C. elegans rely on bulk segregant populations produced by crosses with the problematic Hawaiian wild isolate and an excess of redundant information from whole-genome sequencing (WGS). To increase the repertoire of available mutants and to simplify identification of the causal change, we performed WGS on 173 temperature-sensitive (TS) lethal mutants and devised a novel mapping method. The mapping method uses molecular inversion probes (MIP-MAP) in a targeted sequencing approach to genetic mapping, and replaces the Hawaiian strain with a Million Mutation Project strain with high genomic and phenotypic similarity to the laboratory wild-type strain N2. We validated MIP-MAP on a subset of the TS mutants using a competitive selection approach to produce TS candidate mapping intervals with a mean size < 3 Mb. MIP-MAP successfully uses a non-Hawaiian mapping strain and multiplexed libraries are sequenced at a fraction of the cost of WGS mapping approaches. Our mapping results suggest that the collection of TS mutants contains a diverse library of TS alleles for genes essential to development and reproduction. MIP-MAP is a robust method to genetically map mutations in both viable and essential genes and should be adaptable to other organisms. It may also simplify tracking of individual genotypes within population mixtures. PMID:28827289

Isolation and characterisation of a dwarf rice mutant exhibiting defective gibberellins biosynthesis.

PubMed

Ji, S H; Gururani, M A; Lee, J W; Ahn, B-O; Chun, S-C

2014-03-01

We have isolated a severe dwarf mutant derived from a Ds (Dissociation) insertion mutant rice (Oryza sativa var. japonica c.v. Dongjin). This severe dwarf phenotype, has short and dark green leaves, reduced shoot growth early in the seedling stage, and later severe dwarfism with failure to initiate flowering. When treated with bioactive GA3 , mutants are restored to the normal wild-type phenotype. Reverse transcription PCR analyses of 22 candidate genes related to the gibberellin (GA) biosynthesis pathway revealed that among 22 candidate genes tested, a dwarf mutant transcript was not expressed only in one OsKS2 gene. Genetic analysis revealed that the severe dwarf phenotype was controlled by recessive mutation of a single nuclear gene. The putative OsKS2 gene was a chromosome 4-located ent-kaurene synthase (KS), encoding the enzyme that catalyses an early step of the GA biosynthesis pathway. Sequence analysis revealed that osks2 carried a 1-bp deletion in the ORF region of OsKS2, which led to a loss-of-function mutation. The expression pattern of OsKS2 in wild-type cv Dongjin, showed that it is expressed in all organs, most prominently in the stem and floral organs. Morphological characteristics of the dwarf mutant showed dramatic modifications in internal structure and external morphology. We propose that dwarfism in this mutant is caused by a point mutation in OsKS2, which plays a significant role in growth and development of higher plants. Further investigation on OsKS2 and other OsKS-like proteins is underway and may yield better understanding of the putative role of OsKS in severe dwarf mutants. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing

PubMed Central

Rosconi, Federico; de Vries, Stefan P. W.; Baig, Abiyad; Fabiano, Elena

2016-01-01

ABSTRACT The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. IMPORTANCE A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. PMID:27590816

Functional domains of the poliovirus receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koike, Satoshi; Ise, Iku; Nomoto, Akio

1991-05-15

A number of mutant cDNAs of the human poliovirus receptor were constructed to identify essential regions of the molecule as the receptor. All mutant cDNAs carrying the sequence coding for the entire N-terminal immunoglobulin-like domain (domain I) confer permissiveness for poliovirus to mouse L cells, but a mutant cDNA lacking the sequence for domain I does not. The transformants permissive for poliovirus were able to bind the virus and were also recognized by monoclonal antibody D171, which competes with poliovirus for the cellular receptor. These results strongly suggest that the poliovirus binding site resides in domain I of the receptor.more » Mutant cDNAs for the sequence encoding the intracellular peptide were also constructed and expressed in mouse L cells. Susceptibility of these cells to poliovirus revealed that the entire putative cytoplasmic domain is not essential for virus infection. Thus, the cytoplasmic domain of the molecule appears not to play a role in the penetration of poliovirus.« less

Transcriptome sequencing and metabolic pathways of astaxanthin accumulated in Haematococcus pluvialis mutant under 15% CO2.

PubMed

Cheng, Jun; Li, Ke; Zhu, Yanxia; Yang, Weijuan; Zhou, Junhu; Cen, Kefa

2017-03-01

Transcriptome sequencing and annotation was performed on Haematococcus pluvialis mutant red cells induced with high light under 15% CO 2 to demonstrate why astaxanthin yield of the mutant was 1.7 times higher than that of a wild strain. It was found that 56% of 1947 differentially expressed genes were upregulated in mutant cells. Most significant differences were found in unigenes related to photosynthesis, carotenoid biosynthesis and fatty acid biosynthesis pathways. The pyruvate kinase increased by 3.5-fold in mutant cells. Thus, more pyruvate, which was beneficial to carotenoids and fatty acid biosynthesis, was generated. Phytoene synthase, zeta-carotene desaturase, lycopene beta-cyclase involved in β-carotene biosynthesis in mutant cells were upregulated by 10.4-, 4.4-, and 5.8-fold, respectively. Beta-carotene 3-hydroxylase catalyzing conversion of β-carotene into astaxanthin was upregulated by 18.4-fold. The fatty acid biosynthesis was promoted because of the upregulation of acetyl-CoA synthetase and acetyl-CoA carboxylase, thus increasing astaxanthin esterification and accumulation in mutant cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

Using genic sequence capture in combination with a syntenic pseudo genome to map a deletion mutant in a wheat species.

PubMed

Gardiner, Laura-Jayne; Gawroński, Piotr; Olohan, Lisa; Schnurbusch, Thorsten; Hall, Neil; Hall, Anthony

2014-12-01

Mapping-by-sequencing analyses have largely required a complete reference sequence and employed whole genome re-sequencing. In species such as wheat, no finished genome reference sequence is available. Additionally, because of its large genome size (17 Gb), re-sequencing at sufficient depth of coverage is not practical. Here, we extend the utility of mapping by sequencing, developing a bespoke pipeline and algorithm to map an early-flowering locus in einkorn wheat (Triticum monococcum L.) that is closely related to the bread wheat genome A progenitor. We have developed a genomic enrichment approach using the gene-rich regions of hexaploid bread wheat to design a 110-Mbp NimbleGen SeqCap EZ in solution capture probe set, representing the majority of genes in wheat. Here, we use the capture probe set to enrich and sequence an F2 mapping population of the mutant. The mutant locus was identified in T. monococcum, which lacks a complete genome reference sequence, by mapping the enriched data set onto pseudo-chromosomes derived from the capture probe target sequence, with a long-range order of genes based on synteny of wheat with Brachypodium distachyon. Using this approach we are able to map the region and identify a set of deleted genes within the interval. © 2014 The Authors.The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

Comparative RNA-Seq profiling of berry development between table grape ‘Kyoho’ and its early-ripening mutant ’Fengzao’

USDA-ARS?s Scientific Manuscript database

About 447 millions of RNA-Seq sequences were generated from 40 RNA libraries covering 8 different berry developmental stages of table grape ‘Kyoho’ and its early ripening bud mutant ‘Fengzao’. These sequences were mapped to 23,178 and 22,982 genes in the flesh and peel tissues, respectively. While m...

Mycoplasma pneumoniae Protein P30 Is Required for Cytadherence and Associated with Proper Cell Development

PubMed Central

Romero-Arroyo, Cynthia E.; Jordan, Jarrat; Peacock, Susan J.; Willby, Melisa J.; Farmer, Mark A.; Krause, Duncan C.

1999-01-01

The attachment organelle of Mycoplasma pneumoniae is a polar, tapered cell extension containing an intracytoplasmic, electron-dense core. This terminal structure is the leading end in gliding motility, and its duplication is thought to precede cell division, raising the possibility that mutations affecting cytadherence also confer a defect in motility or cell development. Mycoplasma surface protein P30 is associated with the attachment organelle, and P30 mutants II-3 and II-7 do not cytadhere. In this study, the recombinant wild-type but not the mutant II-3 p30 allele restored cytadherence when transformed into P30 mutants by recombinant transposon delivery. The mutations associated with loss of P30 in mutant II-3 and reacquisition of P30 in cytadhering revertants thereof were identified by nucleotide sequencing of the p30 gene. Morphological abnormalities that included ovoid or multilobed cells having a poorly defined tip structure were associated with loss of P30. Digital image analysis confirmed quantitatively the morphological differences noted visually. Transformation of the P30 mutants with the wild-type p30 allele restored a normal morphology, as determined both visually and by digital image analysis, suggesting that P30 plays a role in mycoplasma cell development. Finally, the P30 mutants localized the adhesin protein P1 to the terminal organelle, indicating that P30 is not involved in P1 trafficking but may be required for its receptor-binding function. PMID:9973332

Effects of point mutations on the thermostability of B. subtilis lipase: investigating nonadditivity

NASA Astrophysics Data System (ADS)

Singh, Bipin; Bulusu, Gopalakrishnan; Mitra, Abhijit

2016-10-01

Molecular level understanding of mutational effects on stability and activity of enzymes is challenging particularly when several point mutations are incorporated during the directed evolution experiments. In our earlier study, we have suggested the lack of consistency in the effect of point mutations incorporated during the initial generations of directed evolution experiments, towards conformational stabilization of B. subtilis lipase mutants of later generations. Here, we report that the cumulative point mutations incorporated in mutants 2M (with two point mutations) to 6M (with six point mutations) possibly do not retain their original stabilizing nature in the most thermostable 12M mutant (with 12 point mutations). We have carried out MD simulations using structures incorporating reversal of different sets of point mutations to assess their effect on the conformational stability and activity of 12M. Our analysis has revealed that reversal of certain point mutations in 12M had little effect on its conformational stability, suggesting that these mutations were probably inconsequential towards the thermostability of the 12M mutant. Interestingly these mutations involved evolutionarily conserved residues. On the other hand, some of the other point mutations incorporated in nonconserved regions, appeared to contribute significantly towards the conformational stability and/or activity of 12M. Based on the analysis of dynamics of in silico mutants generated using the consensus sequence, we identified experimentally verifiable residue positions to further increase the conformational stability and activity of the 12M mutant.

Effects of point mutations on the thermostability of B. subtilis lipase: investigating nonadditivity.

PubMed

Singh, Bipin; Bulusu, Gopalakrishnan; Mitra, Abhijit

2016-10-01

Molecular level understanding of mutational effects on stability and activity of enzymes is challenging particularly when several point mutations are incorporated during the directed evolution experiments. In our earlier study, we have suggested the lack of consistency in the effect of point mutations incorporated during the initial generations of directed evolution experiments, towards conformational stabilization of B. subtilis lipase mutants of later generations. Here, we report that the cumulative point mutations incorporated in mutants 2M (with two point mutations) to 6M (with six point mutations) possibly do not retain their original stabilizing nature in the most thermostable 12M mutant (with 12 point mutations). We have carried out MD simulations using structures incorporating reversal of different sets of point mutations to assess their effect on the conformational stability and activity of 12M. Our analysis has revealed that reversal of certain point mutations in 12M had little effect on its conformational stability, suggesting that these mutations were probably inconsequential towards the thermostability of the 12M mutant. Interestingly these mutations involved evolutionarily conserved residues. On the other hand, some of the other point mutations incorporated in nonconserved regions, appeared to contribute significantly towards the conformational stability and/or activity of 12M. Based on the analysis of dynamics of in silico mutants generated using the consensus sequence, we identified experimentally verifiable residue positions to further increase the conformational stability and activity of the 12M mutant.

Characterization of a dam Mutant of Serratia marcescens and Nucleotide Sequence of the dam Region

PubMed Central

Ostendorf, Tammo; Cherepanov, Peter; de Vries, Johann; Wackernagel, Wilfried

1999-01-01

The DNA of Serratia marcescens has N6-adenine methylation in GATC sequences. Among 2-aminopurine-sensitive mutants isolated from S. marcescens Sr41, one was identified which lacked GATC methylation. The mutant showed up to 30-fold increased spontaneous mutability and enhanced mutability after treatment with 2-aminopurine, ethyl methanesulfonate, or UV light. The gene (dam) coding for the adenine methyltransferase (Dam enzyme) of S. marcescens was identified on a gene bank plasmid which alleviated the 2-aminopurine sensitivity and the higher mutability of a dam-13::Tn9 mutant of Escherichia coli. Nucleotide sequencing revealed that the deduced amino acid sequence of Dam (270 amino acids; molecular mass, 31.3 kDa) has 72% identity to the Dam enzyme of E. coli. The dam gene is located between flanking genes which are similar to those found to the sides of the E. coli dam gene. The results of complementation studies indicated that like Dam of E. coli and unlike Dam of Vibrio cholerae, the Dam enzyme of S. marcescens plays an important role in mutation avoidance by allowing the mismatch repair enzymes to discriminate between the parental and newly synthesized strands during correction of replication errors. PMID:10383952

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

A Novel Point Mutation at Position 156 of Reverse Transcriptase from Feline Immunodeficiency Virus Confers Resistance to the Combination of (−)-β-2′,3′-Dideoxy-3′-Thiacytidine and 3′-Azido-3′-Deoxythymidine

PubMed Central

Smith, Robert A.; Remington, Kathryn M.; Preston, Bradley D.; Schinazi, Raymond F.; North, Thomas W.

1998-01-01

Mutants of feline immunodeficiency virus (FIV) resistant to (−)-β-2′,3′-dideoxy-3′-thiacytidine (3TC) were selected by culturing virus in the presence of increasing stepwise concentrations of 3TC. Two plaque-purified variants were isolated from the original mutant population, and both of these mutants were resistant to 3TC. Surprisingly, these mutants were also phenotypically resistant to 3′-azido-3′-deoxythymidine (AZT) and to the combination of 3TC and AZT. Purified reverse transcriptase (RT) from one of these plaque-purified mutants was resistant to the 5′-triphosphates of 3TC and AZT. DNA sequence analysis of the RT-encoding region of the pol gene amplified from the plaque-purified mutants revealed a Pro-to-Ser mutation at position 156 of RT. A site-directed mutant of FIV engineered to contain this Pro-156-Ser mutation was resistant to 3TC, AZT, and the combination of 3TC and AZT, confirming the role of the Pro-156-Ser mutation in the resistance of FIV to these two nucleoside analogs. This represents the first report of a lentiviral mutant resistant to the combination of AZT and 3TC due to a single, unique point mutation. PMID:9499094

Mutation of Hip’s Carboxy-Terminal Region Inhibits a Transitional Stage of Progesterone Receptor Assembly

PubMed Central

Prapapanich, Viravan; Chen, Shiying; Smith, David F.

1998-01-01

Steroid receptor complexes are assembled through an ordered, multistep pathway involving multiple components of the cytoplasmic chaperone machinery. Two of these components are Hsp70-binding proteins, Hip and Hop, that have some limited homology in their C-terminal regions, outside the sequences mapped for Hsp70 binding. Within this region of Hip is a DPEV sequence that occurs twice; in Hop, one DPEV sequence plus a partial second sequence occurs. In an effort to better understand Hip function as it relates to assembly of progesterone receptor complexes, the DPEV region of Hip was targeted for mutations. Each DPEV sequence was mutated to an APAV sequence, singly or in combination. The combined mutation, APAV2, was further combined with a deletion of Hip’s tetratricopeptide repeat region that is required for Hsp70 binding or with a deletion of Hip’s GGMP repeat. An additional mutant was prepared by truncation of Hip’s DPEV-containing C terminus. By comparing interactions of various Hip forms with Hsp70, it was determined that mutation of the DPEV sequences created a dominant inhibitory form of Hip. The mutant Hip-Hsp70 complex was not prevented from interacting with progesterone receptor, but the mutant caused a dose-dependent inhibition of receptor assembly with Hsp90. The behavior of the Hip mutant is consistent with a model in which Hip and Hop are required to facilitate the transition from an early receptor complex with Hsp70 into later complexes containing Hsp90. PMID:9447991

Selection of HLA-B57-associated Gag A146P mutant by HLA-B∗48:01-restricted Gag140-147-specific CTLs in chronically HIV-1-infected Japanese.

PubMed

Naruto, Takuya; Murakoshi, Hayato; Chikata, Takayuki; Koyanagi, Madoka; Kawashima, Yuka; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi

2011-08-01

We previously showed the possibility that Gag A146P, which is an escape mutant from HLA-B∗57-restricted CTLs, was selected by HLA-B∗48:01-restricted Gag138-147(LI10)-specific CTLs in a Japanese cohort in which HLA-B∗57 individuals were not detected. We herein demonstrated Gag140-147(GI8) to be the optimal epitope rather than LI10 and that GI8-specific T cells failed to recognize the A146P mutant virus-infected cells. The sequence analysis of Gag146 in 261 chronically HIV-1-infected Japanese showed the accumulation of the A146P mutation in HLA-B∗48:01(+) individuals. These findings together indicate that the A146P mutant is accumulating in Japanese by selection by GI8-specific CTLs. Copyright © 2011 Institut Pasteur. Published by Elsevier SAS. All rights reserved.

Characterization of alanine to valine sequence variants in the Fc region of nivolumab biosimilar produced in Chinese hamster ovary cells.

PubMed

Li, Yantao; Fu, Tuo; Liu, Tao; Guo, Huaizu; Guo, Qingcheng; Xu, Jin; Zhang, Dapeng; Qian, Weizhu; Dai, Jianxin; Li, Bohua; Guo, Yajun; Hou, Sheng; Wang, Hao

2016-07-01

Nivolumab is a therapeutic fully human IgG4 antibody to programmed death 1 (PD-1). In this study, a nivolumab biosimilar, which was produced in our laboratory, was analyzed and characterized. Sequence variants that contain undesired amino acid sequences may cause concern during biosimilar bioprocess development. We found that low levels of sequence variants were detected in the heavy chain of the nivolumab biosimilar by ultra performance liquid chromatography (UPLC) and tandem mass spectrometry. It was further identified with UPLC-MS/MS by IdeS or trypsin digestion. The sequence variant was confirmed through addition of synthetic mutant peptide. Subsequently, the mixing base signal of normal and mutant sequence was detected through DNA sequencing. The relative levels of mutant A424V in the Fc region of the heavy chain have been detected and demonstrated to be 12.25% and 13.54%, via base peak intensity (BPI) and UV chromatography of the tryptic peptide mapping, respectively. A424V variant was also quantified by real-time PCR (RT-PCR) at the DNA and RNA level, which was 19.2% and 16.8%, respectively. The relative content of the mutant was consistent at the DNA, RNA and protein level, indicating that the A424V mutation may have little influence at transcriptional or translational levels. These results demonstrate that orthogonal state-of-the-art techniques such as LC- UV- MS and RT-PCR should be implemented to characterize recombinant proteins and cell lines for development of biosimilars. Our study suggests that it is important to establish an integrated and effective analytical method to monitor and characterize sequence variants during antibody drug development, especially for antibody biosimilar products.

Improvement of erythrose reductase activity, deletion of by-products and statistical media optimization for enhanced erythritol production from Yarrowia lipolytica mutant 49.

PubMed

Ghezelbash, Gholam Reza; Nahvi, Iraj; Emamzadeh, Rahman

2014-08-01

The purpose of the present investigation was to produce erythritol by Yarrowia lipolytica mutant without any by-products. Mutants of Y. lipolytica were generated by ultra-violet for enhancing erythrose reductase (ER) activity and erythritol production. The mutants showing the highest ER activity were screened by triphenyl tetrazolium chloride agar plate assay. Productivity of samples was analyzed by thin-layer chromatography and high-performance liquid chromatography equipped with the refractive index detector. One of the mutants named as mutant 49 gave maximum erythritol production without any other by-products (particularly glycerol). Erythritol production and specific ER activity in mutant 49 increased to 1.65 and 1.47 times, respectively, in comparison with wild-type strain. The ER gene of wild and mutant strains was sequenced and analyzed. A general comparison of wild and mutant gene sequences showed the replacement of Asp(270) with Glu(270) in ER protein. In order to enhance erythritol production, we used a three component-three level-one response Box-Behnken of response surface methodology model. The optimum medium composition for erythritol production was found to be (g/l) glucose 279.49, ammonium sulfate 9.28, and pH 5.41 with 39.76 erythritol production.

Molecular and Biochemical Analysis of Chalcone Synthase from Freesia hybrid in Flavonoid Biosynthetic Pathway

PubMed Central

Sun, Wei; Meng, Xiangyu; Liang, Lingjie; Jiang, Wangshu; Huang, Yafei; He, Jing; Hu, Haiyan; Almqvist, Jonas; Gao, Xiang; Wang, Li

2015-01-01

Chalcone synthase (CHS) catalyzes the first committed step in the flavonoid biosynthetic pathway. In this study, the cDNA (FhCHS1) encoding CHS from Freesia hybrida was successfully isolated and analyzed. Multiple sequence alignments showed that both the conserved CHS active site residues and CHS signature sequence were found in the deduced amino acid sequence of FhCHS1. Meanwhile, crystallographic analysis revealed that protein structure of FhCHS1 is highly similar to that of alfalfa CHS2, and the biochemical analysis results indicated that it has an enzymatic role in naringenin biosynthesis. Moreover, quantitative real-time PCR was performed to detect the transcript levels of FhCHS1 in flowers and different tissues, and patterns of FhCHS1 expression in flowers showed significant correlation to the accumulation patterns of anthocyanin during flower development. To further characterize the functionality of FhCHS1, its ectopic expression in Arabidopsis thaliana tt4 mutants and Petunia hybrida was performed. The results showed that overexpression of FhCHS1 in tt4 mutants fully restored the pigmentation phenotype of the seed coats, cotyledons and hypocotyls, while transgenic petunia expressing FhCHS1 showed flower color alteration from white to pink. In summary, these results suggest that FhCHS1 plays an essential role in the biosynthesis of flavonoid in Freesia hybrida and may be used to modify the components of flavonoids in other plants. PMID:25742495

Molecular and Biochemical Analysis of Chalcone Synthase from Freesia hybrid in flavonoid biosynthetic pathway.

PubMed

Sun, Wei; Meng, Xiangyu; Liang, Lingjie; Jiang, Wangshu; Huang, Yafei; He, Jing; Hu, Haiyan; Almqvist, Jonas; Gao, Xiang; Wang, Li

2015-01-01

Chalcone synthase (CHS) catalyzes the first committed step in the flavonoid biosynthetic pathway. In this study, the cDNA (FhCHS1) encoding CHS from Freesia hybrida was successfully isolated and analyzed. Multiple sequence alignments showed that both the conserved CHS active site residues and CHS signature sequence were found in the deduced amino acid sequence of FhCHS1. Meanwhile, crystallographic analysis revealed that protein structure of FhCHS1 is highly similar to that of alfalfa CHS2, and the biochemical analysis results indicated that it has an enzymatic role in naringenin biosynthesis. Moreover, quantitative real-time PCR was performed to detect the transcript levels of FhCHS1 in flowers and different tissues, and patterns of FhCHS1 expression in flowers showed significant correlation to the accumulation patterns of anthocyanin during flower development. To further characterize the functionality of FhCHS1, its ectopic expression in Arabidopsis thaliana tt4 mutants and Petunia hybrida was performed. The results showed that overexpression of FhCHS1 in tt4 mutants fully restored the pigmentation phenotype of the seed coats, cotyledons and hypocotyls, while transgenic petunia expressing FhCHS1 showed flower color alteration from white to pink. In summary, these results suggest that FhCHS1 plays an essential role in the biosynthesis of flavonoid in Freesia hybrida and may be used to modify the components of flavonoids in other plants.

The histidine permease gene (HIP1) of Saccharomyces cerevisiae.

PubMed

Tanaka, J; Fink, G R

1985-01-01

The histidine-specific permease gene (HIP1) of Saccharomyces cerevisiae has been mapped, cloned, and sequenced. The HIP1 gene maps to the right arm of chromosome VII, approx. 11 cM distal to the ADE3 gene. The gene was isolated as an 8.6-kb BamHI-Sau3A fragment by complementation of the histidine-specific permease deficiency in recipient yeast cells. We sequenced a 2.4-kb subfragment of this BamHI-Sau3A fragment containing the HIP1 gene and identified a 1596-bp open reading frame (ORF). We confirmed the assignment of the 1596-bp ORF as the HIP1 coding sequence by sequencing a hip1 nonsense mutation. Analysis of the amino acid (aa) sequence of the HIP1 gene reveals several hydrophobic stretches, but shows no obvious N-terminal signal peptide. We have constructed a deletion of the HIP1 gene in vitro and replaced the wild-type copy of the gene with this deletion. The hip1 deletion mutant can grow when it is supplemented with 30 mM histidine, 50 times the amount required for the growth of HIP1 cells. Revertants of this deletion mutant able to grow on a normal level of histidine arise by mutation in unlinked genes. Both these observations suggest that there are additional, low-affinity pathways for histidine uptake.

[Observation and analysis on mutation of routine STR locus].

PubMed

Li, Qiu-yang; Feng, Wei-jun; Yang, Qin-gen

2005-05-01

To observe and analyze the characteristic of mutation at STR locus. 27 mutant genes observed in 1211 paternity testing cases were checked by PAGE-silver stained and PowerPlex 16 System Kit and validated by sequencing. Mutant genes locate on 15 loci. The pattern of mutation was accord with stepwise mutation model. The mutation ratio of male-to-female was 8:1 and correlated to the age of father. Mutation rate is correlated to the geometric mean of the number of homogeneous repeats of locus. The higher the mean, the higher the mutation rate. These loci are not so appropriate for use in paternity testing.

Molecular analysis of hyperoxaluria type 1 in Italian patients reveals eight new mutations in the alanine: glyoxylate aminotransferase gene.

PubMed

Pirulli, D; Puzzer, D; Ferri, L; Crovella, S; Amoroso, A; Ferrettini, C; Marangella, M; Mazzola, G; Florian, F

1999-06-01

Systematic screening using the SSCP technique followed by sequencing of bands with abnormal mobility derived from the AGXT exons of 15 unrelated Italian patients with primary hyperoxaluria type 1 (PH1) allowed us to characterize both the mutant alleles in each individual. Eight new mutations were identified: C155del, C156ins, G244T, C252T, GAG408ins, G468A, G588A and G1098del. This study demonstrates both the effectiveness of the screening strategy chosen to identify all the mutant alleles and the high degree of allelic heterogeneity in PH1.

Mrp--a new auxiliary gene essential for optimal expression of methicillin resistance in Staphylococcus aureus.

PubMed

Wu, S W; De Lencastre, H

1999-01-01

Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.

Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2010-01-01

Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

Molecular identification of an ABC transporter complex for manganese: analysis of a cyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process.

PubMed Central

Bartsevich, V V; Pakrasi, H B

1995-01-01

During photosynthesis, the photosystem II (PSII) pigment-protein complex catalyzes oxygen evolution, a reaction in which a four-manganese ensemble plays a crucial role. Using a newly developed selection scheme, we have isolated BP13, a random photosynthesis-deficient mutant strain of the cyanobacterium, Synechocystis 6803. This mutant grew slowly under photoautotrophic conditions, and had a low oxygen evolution activity. Biochemical analysis revealed that the lesion in this mutant strain had specifically affected the Mn ensemble in PSII. Interestingly, incubation of BP13 cells with micromolar levels of added Mn induced rapid recovery of oxygen evolution activity. The mutant could be complemented with a fragment of wild-type chromosomal DNA containing three closely linked genes, mntA, mntB and mntC. These gene products showed significant sequence similarities with polypeptide components of bacterial permeases that are members of the 'ABC (ATP binding cassette) superfamily' of transporter proteins. We determined that in the BP13 strain, a single nucleotide change had resulted in the replacement of an alanine by an aspartic acid residue in MntA, a soluble protein containing ATP binding motifs. These results suggest that the mntCAB gene cluster encodes polypeptide components of a Mn transporter, the first such protein complex identified in any organism. PMID:7743991

Fine Mapping of CsVYL, Conferring Virescent Leaf Through the Regulation of Chloroplast Development in Cucumber

PubMed Central

Song, Mengfei; Wei, Qingzhen; Wang, Jing; Fu, Wenyuan; Qin, Xiaodong; Lu, Xiumei; Cheng, Feng; Yang, Kang; Zhang, Lu; Yu, Xiaqing; Li, Ji; Chen, Jinfeng; Lou, Qunfeng

2018-01-01

Leaf color mutants in higher plants are ideal materials for investigating the structure and function of photosynthetic system. In this study, we identified a cucumber vyl (virescent-yellow leaf) mutant in the mutant library, which exhibited reduced pigment contents and delayed chloroplast development process. F2 and BC1 populations were constructed from the cross between vyl mutant and cucumber inbred line ‘Hazerd’ to identify that the vyl trait is controlled by a simply recessive gene designated as CsVYL. The CsVYL gene was mapped to a 3.8 cM interval on chromosome 4 using these 80 F2 individuals and BSA (bulked segregation analysis) approach. Fine genetic map was conducted with 1542 F2 plants and narrowed down the vyl locus to an 86.3 kb genomic region, which contains a total of 11 genes. Sequence alignment between the wild type (WT) and vyl only identified one single nucleotide mutation (C→T) in the first exon of gene Csa4G637110, which encodes a DnaJ-like zinc finger protein. Gene Expression analysis confirmed the differences in transcription level of Csa4G637110 between wild type and mutant plants. Map-based cloning of the CsVYL gene could accelerate the study of chloroplast development and chlorophyll synthesis of cucumber. PMID:29681911

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

Efficient gene-driven germ-line point mutagenesis of C57BL/6J mice

PubMed Central

Michaud, Edward J; Culiat, Cymbeline T; Klebig, Mitchell L; Barker, Paul E; Cain, KT; Carpenter, Debra J; Easter, Lori L; Foster, Carmen M; Gardner, Alysyn W; Guo, ZY; Houser, Kay J; Hughes, Lori A; Kerley, Marilyn K; Liu, Zhaowei; Olszewski, Robert E; Pinn, Irina; Shaw, Ginger D; Shinpock, Sarah G; Wymore, Ann M; Rinchik, Eugene M; Johnson, Dabney K

2005-01-01

Background Analysis of an allelic series of point mutations in a gene, generated by N-ethyl-N-nitrosourea (ENU) mutagenesis, is a valuable method for discovering the full scope of its biological function. Here we present an efficient gene-driven approach for identifying ENU-induced point mutations in any gene in C57BL/6J mice. The advantage of such an approach is that it allows one to select any gene of interest in the mouse genome and to go directly from DNA sequence to mutant mice. Results We produced the Cryopreserved Mutant Mouse Bank (CMMB), which is an archive of DNA, cDNA, tissues, and sperm from 4,000 G1 male offspring of ENU-treated C57BL/6J males mated to untreated C57BL/6J females. Each mouse in the CMMB carries a large number of random heterozygous point mutations throughout the genome. High-throughput Temperature Gradient Capillary Electrophoresis (TGCE) was employed to perform a 32-Mbp sequence-driven screen for mutations in 38 PCR amplicons from 11 genes in DNA and/or cDNA from the CMMB mice. DNA sequence analysis of heteroduplex-forming amplicons identified by TGCE revealed 22 mutations in 10 genes for an overall mutation frequency of 1 in 1.45 Mbp. All 22 mutations are single base pair substitutions, and nine of them (41%) result in nonconservative amino acid substitutions. Intracytoplasmic sperm injection (ICSI) of cryopreserved spermatozoa into B6D2F1 or C57BL/6J ova was used to recover mutant mice for nine of the mutations to date. Conclusions The inbred C57BL/6J CMMB, together with TGCE mutation screening and ICSI for the recovery of mutant mice, represents a valuable gene-driven approach for the functional annotation of the mammalian genome and for the generation of mouse models of human genetic diseases. The ability of ENU to induce mutations that cause various types of changes in proteins will provide additional insights into the functions of mammalian proteins that may not be detectable by knockout mutations. PMID:16300676

The carbohydrate-binding module (CBM)-like sequence is crucial for rice CWA1/BC1 function in proper assembly of secondary cell wall materials.

PubMed

Sato, Kanna; Ito, Sachiko; Fujii, Takeo; Suzuki, Ryu; Takenouchi, Sachi; Nakaba, Satoshi; Funada, Ryo; Sano, Yuzou; Kajita, Shinya; Kitano, Hidemi; Katayama, Yoshihiro

2010-11-01

We recently reported that the cwa1 mutation disturbed the deposition and assembly of secondary cell wall materials in the cortical fiber of rice internodes. Genetic analysis revealed that cwa1 is allelic to bc1, which encodes glycosylphosphatidylinositol (GPI)-anchored COBRA-like protein with the highest homology to Arabidopsis COBRA-like 4 (COBL4) and maize Brittle Stalk 2 (Bk2). Our results suggested that CWA1/BC1 plays a role in assembling secondary cell wall materials at appropriate sites, enabling synthesis of highly ordered secondary cell wall structure with solid and flexible internodes in rice. The N-terminal amino acid sequence of CWA1/BC1, as well as its orthologs (COBL4, Bk2) and other BC1-like proteins in rice, shows weak similarity to a family II carbohydrate-binding module (CBM2) of several bacterial cellulases. To investigate the importance of the CBM-like sequence of CWA1/BC1 in the assembly of secondary cell wall materials, Trp residues in the CBM-like sequence, which is important for carbohydrate binding, were substituted for Val residues and introduced into the cwa1 mutant. CWA1/BC1 with the mutated sequence did not complement the abnormal secondary cell walls seen in the cwa1 mutant, indicating that the CBM-like sequence is essential for the proper function of CWA1/BC1, including assembly of secondary cell wall materials.

Transcript map of the Ovum mutant (Om) locus: isolation by exon trapping of new candidate genes for the DDK syndrome.

PubMed

Le Bras, Stéphanie; Cohen-Tannoudji, Michel; Guyot, Valérie; Vandormael-Pournin, Sandrine; Coumailleau, Franck; Babinet, Charles; Baldacci, Patricia

2002-08-21

The DDK syndrome is defined as the embryonic lethality of F1 mouse embryos from crosses between DDK females and males from other strains (named hereafter as non-DDK strains). Genetically controlled by the Ovum mutant (Om) locus, it is due to a deleterious interaction between a maternal factor present in DDK oocytes and the non-DDK paternal pronucleus. Therefore, the DDK syndrome constitutes a unique genetic tool to study the crucial interactions that take place between the parental genomes and the egg cytoplasm during mammalian development. In this paper, we present an extensive analysis performed by exon trapping on the Om region. Twenty-seven trapped sequences were from genes in the databases: beta-adaptin, CCT zeta2, DNA LigaseIII, Notchless, Rad51l3 and Scya1. Twenty-eight other sequences presented similarities with expressed sequence tags and genomic sequences whereas 57 did not. The pattern of expression of 37 of these markers was established. Importantly, five of them are expressed in DDK oocytes and are candidate genes for the maternal factor, and 20 are candidate genes for the paternal factor since they are expressed in testis. This data is an important step towards identifying the genes responsible for the DDK syndrome.

The toxR Gene of Vibrio (Listonella) anguillarum Controls Expression of the Major Outer Membrane Proteins but Not Virulence in a Natural Host Model

PubMed Central

Okuda, Jun; Nakai, Toshihiro; Chang, Park Se; Oh, Takanori; Nishino, Takeshi; Koitabashi, Tsutomu; Nishibuchi, Mitsuaki

2001-01-01

To examine the hypothesis that the ancestral role of the toxR gene in the family Vibrionaceae is control of the expression of outer membrane protein (OMP)-encoding genes for adaptation to environmental change, we investigated the role of the toxR gene in Vibrio anguillarum, an important fish pathogen. The toxR gene of V. angullarum (Va-toxR) was cloned from strain PT-87050 isolated from diseased ayu (Plecoglossus altivelis), and the sequence was analyzed. The toxR sequence was 63 to 51% identical to those reported for other species of the family Vibrionaceae. Distribution of the Va-toxR gene sequence in V. anguillarum strains of various serotypes was confirmed by using DNA probe and PCR methods. An isogenic toxR mutant of V. anguillarum PT-24, isolated from diseased ayu, was constructed by using an allelic exchange method. The wild-type strain and the toxR mutant did not differ in the ability to produce a protease(s) and a hemolysin(s) or in pathogenicity for ayu when examined by the intramuscular injection and immersion methods. A 35-kDa major OMP was not produced by the toxR mutant. However, a 46-kDa OMP was hardly detected in the wild-type strain but was produced as the major OMP by the toxR mutant. For the toxR mutant, the MICs of two β-lactam antibiotics were higher and the minimum bactericidal concentration of sodium dodecyl sulfate was lower than for the wild-type strain. Analysis of the N-terminal amino acid sequences of the 35- and 46-kDa OMPs indicated that these proteins are the porin-like OMPs and are related to the toxR-regulated major OMPs of the family Vibrionaceae. The results indicate that the toxR gene is not involved in virulence expression in V. anguillarum PT-24 and that toxR regulation of major OMPs is universal in the family Vibrionaceae. These results support the hypothesis that the ancestral role of the toxR gene is regulation of OMP gene expression and that only in some Vibrio species has ToxR been appropriated for the regulation of a virulence gene(s). PMID:11553547

The alpha subunit of the Saccharomyces cerevisiae oligosaccharyltransferase complex is essential for vegetative growth of yeast and is homologous to mammalian ribophorin I

PubMed Central

1995-01-01

Oligosaccharyltransferase mediates the transfer of a preassembled high mannose oligosaccharide from a lipid-linked oligosaccharide donor to consensus glycosylation acceptor sites in newly synthesized proteins in the lumen of the rough endoplasmic reticulum. The Saccharomyces cerevisiae oligosaccharyltransferase is an oligomeric complex composed of six nonidentical subunits (alpha-zeta), two of which are glycoproteins (alpha and beta). The beta and delta subunits of the oligosaccharyltransferase are encoded by the WBP1 and SWP1 genes. Here we describe the functional characterization of the OST1 gene that encodes the alpha subunit of the oligosaccharyltransferase. Protein sequence analysis revealed a significant sequence identity between the Saccharomyces cerevisiae Ost1 protein and ribophorin I, a previously identified subunit of the mammalian oligosaccharyltransferase. A disruption of the OST1 locus was not tolerated in haploid yeast showing that expression of the Ost1 protein is essential for vegetative growth of yeast. An analysis of a series of conditional ost1 mutants demonstrated that defects in the Ost1 protein cause pleiotropic underglycosylation of soluble and membrane-bound glycoproteins at both the permissive and restrictive growth temperatures. Microsomal membranes isolated from ost1 mutant yeast showed marked reductions in the in vitro transfer of high mannose oligosaccharide from exogenous lipid-linked oligosaccharide to a glycosylation site acceptor tripeptide. Microsomal membranes isolated from the ost1 mutants contained elevated amounts of the Kar2 stress-response protein. PMID:7860628

Identification and fine mapping of a stay-green gene (Brnye1) in pakchoi (Brassica campestris L. ssp. chinensis).

PubMed

Wang, Nan; Liu, Zhiyong; Zhang, Yun; Li, Chengyu; Feng, Hui

2018-03-01

Using bulked segregant analysis combined with next-generation sequencing, we delimited the Brnye1 gene responsible for the stay-green trait of nye in pakchoi. Sequence analysis identified Bra019346 as the candidate gene. "Stay-green" refers to a plant trait whereby leaves remain green during senescence. This trait is useful in the cultivation of pakchoi (Brassica campestris L. ssp. chinensis), which is marketed as a green leaf product. This study aimed to identify the gene responsible for the stay-green trait in pakchoi. We identified a stay-green mutant in pakchoi, which we termed "nye". Genetic analysis revealed that the stay-green trait is controlled by a single recessive gene, Brnye1. Using the BSA-seq method, a 3.0-Mb candidate region was mapped on chromosome A03, which helped us localize Brnye1 to an 81.01-kb interval between SSR markers SSRWN27 and SSRWN30 via linkage analysis in an F 2 population. We identified 12 genes in this region, 11 of which were annotated based on the Brassica rapa annotation database, and one was a functionally unknown gene. An orthologous gene of the Arabidopsis gene AtNYE1, Bra019346, was identified as the potential candidate for Brnye1. Sequence analysis revealed a 40-bp insertion in the second exon of Bra019346 in nye, which generated the TAA stop codon. A candidate gene-specific Indel marker in 1561 F 2 individuals showed perfect cosegregation with Brnye1 in the nye mutant. These results provide a foundation for uncovering the molecular mechanism of the stay-green trait in pakchoi.

Improving the neutral phytase activity from Bacillus amyloliquefaciens DSM 1061 by site-directed mutagenesis.

PubMed

Xu, Wei; Shao, Rong; Wang, Zupeng; Yan, Xiuhua

2015-03-01

Neutral phytase is used as a feed additive for degradation of anti-nutritional phytate in aquatic feed industry. Site-directed mutagenesis of Bacillus amyloliquefaciens DSM 1061 phytase was performed with an aim to increase its activity. Mutation residues were chosen based on multiple sequence alignments and structure analysis of neutral phytsaes from different microorganisms. The mutation sites on surface (D148E, S197E and N156E) and around the active site (D52E) of phytase were selected. Analysis of the phytase variants showed that the specific activities of mutants D148E and S197E remarkably increased by about 35 and 13% over a temperature range of 40-75 °C at pH 7.0, respectively. The k cat of mutants D148E and S197E were 1.50 and 1.25 times than that of the wild-type phytase, respectively. Both D148E and S197E showed much higher thermostability than that of the wild-type phytase. However, mutants N156E and D52E led to significant loss of specific activity of the enzyme. Structural analysis revealed that these mutations may affect conformation of the active site of phytase. The present mutant phytases D148E and S197E with increased activities and thermostabilities have application potential as additives in aquaculture feed.

The Bordetella bhu Locus Is Required for Heme Iron Utilization

PubMed Central

Vanderpool, Carin K.; Armstrong, Sandra K.

2001-01-01

Bordetella pertussis and Bordetella bronchiseptica are capable of obtaining iron from hemin and hemoglobin. Genes encoding a putative bacterial heme iron acquisition system (bhu, for Bordetella heme utilization) were identified in a B. pertussis genomic sequence database, and the corresponding DNA was isolated from a virulent strain of B. pertussis. A B. pertussis bhuR mutant, predicted to lack the heme outer membrane receptor, was generated by allelic exchange. In contrast to the wild-type strain, bhuR mutant PM5 was incapable of acquiring iron from hemin and hemoglobin; genetic complementation of PM5 with the cloned bhuRSTUV genes restored heme utilization to wild-type levels. In parallel studies, B. bronchiseptica bhu sequences were also identified and a B. bronchiseptica bhuR mutant was constructed and confirmed to be defective in heme iron acquisition. The wild-type B. bronchiseptica parent strain grown under low-iron conditions produced the presumptive BhuR protein, which was absent in the bhuR mutant. Furthermore, production of BhuR by iron-starved B. bronchiseptica was markedly enhanced by culture in hemin-supplemented medium, suggesting that these organisms sense and respond to heme in the environment. Analysis of the genetic region upstream of the bhu cluster identified open reading frames predicted to encode homologs of the Escherichia coli ferric citrate uptake regulators FecI and FecR. These putative Bordetella regulators may mediate heme-responsive positive transcriptional control of the bhu genes. PMID:11418569

Identification and functional characterization of a novel bipartite nuclear localization sequence in ARID1A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, Nicholas W.; The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD; Shoji, Yutaka

2016-01-01

AT-rich interactive domain-containing protein 1A (ARID1A) is a recently identified nuclear tumor suppressor frequently altered in solid tumor malignancies. We have identified a bipartite-like nuclear localization sequence (NLS) that contributes to nuclear import of ARID1A not previously described. We functionally confirm activity using GFP constructs fused with wild-type or mutant NLS sequences. We further show that cyto-nuclear localized, bipartite NLS mutant ARID1A exhibits greater stability than nuclear-localized, wild-type ARID1A. Identification of this undescribed functional NLS within ARID1A contributes vital insights to rationalize the impact of ARID1A missense mutations observed in patient tumors. - Highlights: • We have identified a bipartitemore » nuclear localization sequence (NLS) in ARID1A. • Confirmation of the NLS was performed using GFP constructs. • NLS mutant ARID1A exhibits greater stability than wild-type ARID1A.« less

Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

PubMed

Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

2010-07-01

More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

Mapping-by-sequencing of Ligon-lintless-1 (Li 1 ) reveals a cluster of neighboring genes with correlated expression in developing fibers of Upland cotton (Gossypium hirsutum L.).

PubMed

Thyssen, Gregory N; Fang, David D; Turley, Rickie B; Florane, Christopher; Li, Ping; Naoumkina, Marina

2015-09-01

Mapping-by-sequencing and SNP marker analysis were used to fine map the Ligon-lintless-1 ( Li 1 ) short fiber mutation in tetraploid cotton to a 255-kb region that contains 16 annotated proteins. The Ligon-lintless-1 (Li 1 ) mutant of cotton (Gossypium hirsutum L.) has been studied as a model for cotton fiber development since its identification in 1929; however, the causative mutation has not been identified yet. Here we report the fine genetic mapping of the mutation to a 255-kb region that contains only 16 annotated genes in the reference Gossypium raimondii genome. We took advantage of the incompletely dominant dwarf vegetative phenotype to identify 100 mutants (Li 1 /Li 1 ) and 100 wild-type (li 1 /li 1 ) homozygotes from a mapping population of 2567 F2 plants, which we bulked and deep sequenced. Since only homozygotes were sequenced, we were able to use a high stringency in SNP calling to rapidly narrow down the region harboring the Li 1 locus, and designed subgenome-specific SNP markers to test the population. We characterized the expression of all sixteen genes in the region by RNA sequencing of elongating fibers and by RT-qPCR at seven time points spanning fiber development. One of the most highly expressed genes found in this interval in wild-type fiber cells is 40-fold under-expressed at the day of anthesis (DOA) in the mutant fiber cells.  This gene is a major facilitator superfamily protein, part of the large family of proteins that includes auxin and sugar transporters. Interestingly, nearly all genes in this region were most highly expressed at DOA and showed a high degree of co-expression. Further characterization is required to determine if transport of hormones or carbohydrates is involved in both the dwarf and lintless phenotypes of Li 1 plants.

Formin homology 1 (OsFH1) regulates root-hair elongation in rice (Oryza sativa).

PubMed

Huang, Jin; Kim, Chul Min; Xuan, Yuan-hu; Liu, Jingmiao; Kim, Tae Ho; Kim, Bo-Kyeong; Han, Chang-deok

2013-05-01

The outgrowth of root hairs from the epidermal cell layer is regulated by a strict genetic regulatory system and external growth conditions. Rice plants cultivated in water-logged paddy land are exposed to a soil ecology that differs from the environment surrounding upland plants, such as Arabidopsis and maize. To identify genes that play important roles in root-hair growth, a forward genetics approach was used to screen for short-root-hair mutants. A short-root-hair mutant was identified, and the gene was isolated using map-based cloning and sequencing. The mutant harbored a point mutation at a splicing acceptor site, which led to truncation of OsFH1 (rice formin homology 1). Subsequent analysis of two additional T-DNA mutants verified that OsFH1 is important for root-hair elongation. Further studies revealed that the action of OsFH1 on root-hair growth is dependent on growth conditions. The mutant Osfh1 exhibited root-hair defects when roots were grown submerged in solution, and mutant roots produced normal root hairs in the air. However, root-hair phenotypes of mutants were not influenced by the external supply of hormones or carbohydrates, a deficiency of nutrients, such as Fe or P i , or aeration. This study shows that OsFH1 plays a significant role in root-hair elongation in a growth condition-dependent manner.

Mycothiol-Deficient Mycobacterium smegmatis Mutants Are Hypersensitive to Alkylating Agents, Free Radicals, and Antibiotics

PubMed Central

Rawat, Mamta; Newton, Gerald L.; Ko, Mary; Martinez, Gladys J.; Fahey, Robert C.; Av-Gay, Yossef

2002-01-01

Mycothiol (MSH; 1d-myo-inosityl 2-[N-acetyl-l-cysteinyl]amido-2-deoxy-α-d-glucopyranoside) is the major low-molecular-weight thiol produced by mycobacteria. Mutants of Mycobacterium smegmatis mc2155 deficient in MSH production were produced by chemical mutagenesis as well as by transposon mutagenesis. One chemical mutant (mutant I64) and two transposon mutants (mutants Tn1 and Tn2) stably deficient in MSH production were isolated by screening for reduced levels of MSH content. The MSH contents of transposon mutants Tn1 and Tn2 were found to be less than 0.1% that of the parent strain, and the MSH content of I64 was found to be 1 to 5% that of the parent strain. All three strains accumulated 1d-myo-inosityl 2-deoxy-α-d-glucopyranoside to levels 20- to 25-fold the level found in the parent strain. The cysteine:1d-myo-inosityl 2-amino-2-deoxy-α-d-glucopyranoside ligase (MshC) activities of the three mutant strains were ≤2% that of the parent strain. Phenotypic analysis revealed that these MSH-deficient mutants possess increased susceptibilities to free radicals and alkylating agents and to a wide range of antibiotics including erythromycin, azithromycin, vancomycin, penicillin G, rifamycin, and rifampin. Conversely, the mutants possess at least 200-fold higher levels of resistance to isoniazid than the wild type. We mapped the mutation in the chemical mutant by sequencing the mshC gene and showed that a single amino acid substitution (L205P) is responsible for reduced MSH production and its associated phenotype. Our results demonstrate that there is a direct correlation between MSH depletion and enhanced sensitivity to toxins and antibiotics. PMID:12384335

Evolutionary Influenced Interaction Pattern as Indicator for the Investigation of Natural Variants Causing Nephrogenic Diabetes Insipidus

PubMed Central

Labudde, Dirk

2015-01-01

The importance of short membrane sequence motifs has been shown in many works and emphasizes the related sequence motif analysis. Together with specific transmembrane helix-helix interactions, the analysis of interacting sequence parts is helpful for understanding the process during membrane protein folding and in retaining the three-dimensional fold. Here we present a simple high-throughput analysis method for deriving mutational information of interacting sequence parts. Applied on aquaporin water channel proteins, our approach supports the analysis of mutational variants within different interacting subsequences and finally the investigation of natural variants which cause diseases like, for example, nephrogenic diabetes insipidus. In this work we demonstrate a simple method for massive membrane protein data analysis. As shown, the presented in silico analyses provide information about interacting sequence parts which are constrained by protein evolution. We present a simple graphical visualization medium for the representation of evolutionary influenced interaction pattern pairs (EIPPs) adapted to mutagen investigations of aquaporin-2, a protein whose mutants are involved in the rare endocrine disorder known as nephrogenic diabetes insipidus, and membrane proteins in general. Furthermore, we present a new method to derive new evolutionary variations within EIPPs which can be used for further mutagen laboratory investigations. PMID:26180540

Evolutionary Influenced Interaction Pattern as Indicator for the Investigation of Natural Variants Causing Nephrogenic Diabetes Insipidus.

PubMed

Grunert, Steffen; Labudde, Dirk

2015-01-01

The importance of short membrane sequence motifs has been shown in many works and emphasizes the related sequence motif analysis. Together with specific transmembrane helix-helix interactions, the analysis of interacting sequence parts is helpful for understanding the process during membrane protein folding and in retaining the three-dimensional fold. Here we present a simple high-throughput analysis method for deriving mutational information of interacting sequence parts. Applied on aquaporin water channel proteins, our approach supports the analysis of mutational variants within different interacting subsequences and finally the investigation of natural variants which cause diseases like, for example, nephrogenic diabetes insipidus. In this work we demonstrate a simple method for massive membrane protein data analysis. As shown, the presented in silico analyses provide information about interacting sequence parts which are constrained by protein evolution. We present a simple graphical visualization medium for the representation of evolutionary influenced interaction pattern pairs (EIPPs) adapted to mutagen investigations of aquaporin-2, a protein whose mutants are involved in the rare endocrine disorder known as nephrogenic diabetes insipidus, and membrane proteins in general. Furthermore, we present a new method to derive new evolutionary variations within EIPPs which can be used for further mutagen laboratory investigations.

Effects of GSH1 and GSH2 Gene Mutation on Glutathione Synthetases Activity of Saccharomyces cerevisiae.

PubMed

Xu, Wen; Jia, Haiyan; Zhang, Longmei; Wang, Haiyan; Tang, Hui; Zhang, Liping

2017-08-01

In this paper, three mutants from wild Saccharomyces cerevisiae HBU2.558, called U2.558, UN2.558, and UNA2.558, were screened by UV, sodium nitrite, Atmospheric and room temperature plasma, respectively. Glutathione production of the three mutants increased by 41.86, 72.09 and 56.76%, respectively. We detected the activity of glutathione synthetases and found that its activity was improved. Amino acid sequences of three mutant colonies were compared with HBU2.558. Four mutants: Leu51→Pro51 (L51P), Glu62→Val62 (E62V), Ala332→Glu332 (A332E) and Ser653→Gly653 (S653G) were found in the analysis of γ-glutamylcysteine ligase. L51 is located adjacently to the two active sites of GCL/E/Mg 2+ /ADP complex in the overall GCL structure. L51P mutant spread distortion on the β-sheet due to the fact that the φ was changed from -50.4° to -40.2°. A mutant Leu54→Pro54 (L54P) was found in the analysis of glutathione synthetase, and L54 was an amino acid located between an α-helix and a β-sheet. The results confirm that introduction of proline located at the middle of the β-sheet or at the N- or C-terminal between α-helix and β-sheet or, i.e., L51P and L54P, changed the φ, rigidity, hydrophobicity and conformational entropy, thus increased protein stability and improved the enzyme activity.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.

PubMed

Paik, Sehmi; Senty, Lauren; Das, Sankar; Noe, Jody C; Munro, Cindy L; Kitten, Todd

2005-09-01

Streptococcus sanguinis is a gram-positive, facultative anaerobe and a normal inhabitant of the human oral cavity. It is also one of the most common agents of infective endocarditis, a serious endovascular infection. To identify virulence factors for infective endocarditis, signature-tagged mutagenesis (STM) was applied to the SK36 strain of S. sanguinis, whose genome is being sequenced. STM allows the large-scale creation, in vivo screening, and recovery of a series of mutants with altered virulence. Screening of 800 mutants by STM identified 38 putative avirulent and 5 putative hypervirulent mutants. Subsequent molecular analysis of a subset of these mutants identified genes encoding undecaprenol kinase, homoserine kinase, anaerobic ribonucleotide reductase, adenylosuccinate lyase, and a hypothetical protein. Virulence reductions ranging from 2-to 150-fold were confirmed by competitive index assays. One putatively hypervirulent strain with a transposon insertion in an intergenic region was identified, though increased virulence was not confirmed in competitive index assays. All mutants grew comparably to SK36 in aerobic broth culture except for the homoserine kinase mutant. Growth of this mutant was restored by the addition of threonine to the medium. Mutants containing an insertion or in-frame deletion in the anaerobic ribonucleotide reductase gene failed to grow under strictly anaerobic conditions. The results suggest that housekeeping functions such as cell wall synthesis, amino acid and nucleic acid synthesis, and the ability to survive under anaerobic conditions are important virulence factors in S. sanguinis endocarditis.

Identification of Virulence Determinants for Endocarditis in Streptococcus sanguinis by Signature-Tagged Mutagenesis†

PubMed Central

Paik, Sehmi; Senty, Lauren; Das, Sankar; Noe, Jody C.; Munro, Cindy L.; Kitten, Todd

2005-01-01

Streptococcus sanguinis is a gram-positive, facultative anaerobe and a normal inhabitant of the human oral cavity. It is also one of the most common agents of infective endocarditis, a serious endovascular infection. To identify virulence factors for infective endocarditis, signature-tagged mutagenesis (STM) was applied to the SK36 strain of S. sanguinis, whose genome is being sequenced. STM allows the large-scale creation, in vivo screening, and recovery of a series of mutants with altered virulence. Screening of 800 mutants by STM identified 38 putative avirulent and 5 putative hypervirulent mutants. Subsequent molecular analysis of a subset of these mutants identified genes encoding undecaprenol kinase, homoserine kinase, anaerobic ribonucleotide reductase, adenylosuccinate lyase, and a hypothetical protein. Virulence reductions ranging from 2-to 150-fold were confirmed by competitive index assays. One putatively hypervirulent strain with a transposon insertion in an intergenic region was identified, though increased virulence was not confirmed in competitive index assays. All mutants grew comparably to SK36 in aerobic broth culture except for the homoserine kinase mutant. Growth of this mutant was restored by the addition of threonine to the medium. Mutants containing an insertion or in-frame deletion in the anaerobic ribonucleotide reductase gene failed to grow under strictly anaerobic conditions. The results suggest that housekeeping functions such as cell wall synthesis, amino acid and nucleic acid synthesis, and the ability to survive under anaerobic conditions are important virulence factors in S. sanguinis endocarditis. PMID:16113327

Lactose carrier mutants of Escherichia coli with changes in sugar recognition (lactose versus melibiose).

PubMed

Varela, M F; Brooker, R J; Wilson, T H

1997-09-01

The purpose of this research was to identify amino acid residues that mediate substrate recognition in the lactose carrier of Escherichia coli. The lactose carrier transports the alpha-galactoside sugar melibiose as well as the beta-galactoside sugar lactose. Mutants from cells containing the lac genes on an F factor were selected by the ability to grow on succinate in the presence of the toxic galactoside beta-thio-o-nitrophenylgalactoside. Mutants that grew on melibiose minimal plates but failed to grow on lactose minimal plates were picked. In sugar transport assays, mutant cells showed the striking result of having low levels of lactose downhill transport but high levels of melibiose downhill transport. Accumulation (uphill) of melibiose was completely defective in all of the mutants. Kinetic analysis of melibiose transport in the mutants showed either no change or a greater than normal apparent affinity for melibiose. PCR was used to amplify the lacY DNA of each mutant, which was then sequenced by the Sanger method. The following six mutations were found in the lacY structural genes of individual mutants: Tyr-26-->Asp, Phe-27-->Tyr, Phe-29-->Leu, Asp-240-->Val, Leu-321-->Gln, and His-322-->Tyr. We conclude from these experiments that Tyr-26, Phe-27, Phe-29 (helix 1), Asp-240 (helix 7), Leu-321, and His-322 (helix 10) either directly or indirectly mediate sugar recognition in the lactose carrier of E. coli.

Transposon mutagenesis reveals differential pathogenesis of Ralstonia solanacearum on tomato and Arabidopsis.

PubMed

Lin, Yu-Mei; Chou, I-Chun; Wang, Jaw-Fen; Ho, Fang-I; Chu, Yu-Ju; Huang, Pei-Cheng; Lu, Der-Kang; Shen, Hwei-Ling; Elbaz, Mounira; Huang, Shu-Mei; Cheng, Chiu-Ping

2008-09-01

Ralstonia solanacearum causes a deadly wilting disease on a wide range of crops. To elucidate pathogenesis of this bacterium in different host plants, we set out to identify R. solanacearum genes involved in pathogenesis by screening random transposon insertion mutants of a highly virulent strain, Pss190, on tomato and Arabidopsis thaliana. Mutants exhibiting various decreased virulence levels on these two hosts were identified. Sequence analysis showed that most, but not all, of the identified pathogenesis genes are conserved among distinct R. solanacearum strains. A few of the disrupted loci were not reported previously as being involved in R. solanacearum pathogenesis. Notably, a group of mutants exhibited differential pathogenesis on tomato and Arabidopsis. These results were confirmed by characterizing allelic mutants in one other R. solanacearum strain of the same phylotype. The significantly decreased mutants' colonization in Arabidopsis was found to be correlated with differential pathogenesis on these two plants. Differential requirement of virulence genes suggests adaptation of this bacterium in different host environments. Together, this study reveals commonalities and differences of R. solanacearum pathogenesis on single solanaceous and nonsolanaceous hosts, and provides important new insights into interactions between R. solanacearum and different host plants.

Selection of a platinum-binding sequence in a loop of a four-helix bundle protein.

PubMed

Yagi, Sota; Akanuma, Satoshi; Kaji, Asumi; Niiro, Hiroya; Akiyama, Hayato; Uchida, Tatsuya; Yamagishi, Akihiko

2018-02-01

Protein-metal hybrids are functional materials with various industrial applications. For example, a redox enzyme immobilized on a platinum electrode is a key component of some biofuel cells and biosensors. To create these hybrid materials, protein molecules are bound to metal surfaces. Here, we report the selection of a novel platinum-binding sequence in a loop of a four-helix bundle protein, the Lac repressor four-helix protein (LARFH), an artificial protein in which four identical α-helices are connected via three identical loops. We created a genetic library in which the Ser-Gly-Gln-Gly-Gly-Ser sequence within the first inter-helical loop of LARFH was semi-randomly mutated. The library was then subjected to selection for platinum-binding affinity by using the T7 phage display method. The majority of the selected variants contained the Tyr-Lys-Arg-Gly-Tyr-Lys (YKRGYK) sequence in their randomized segment. We characterized the platinum-binding properties of mutant LARFH by using quartz crystal microbalance analysis. Mutant LARFH seemed to interact with platinum through its loop containing the YKRGYK sequence, as judged by the estimated exclusive area occupied by a single molecule. Furthermore, a 10-residue peptide containing the YKRGYK sequence bound to platinum with reasonably high affinity and basic side chains in the peptide were crucial in mediating this interaction. In conclusion, we have identified an amino acid sequence, YKRGYK, in the loop of a helix-loop-helix motif that shows high platinum-binding affinity. This sequence could be grafted into loops of other polypeptides as an approach to immobilize proteins on platinum electrodes for use as biosensors among other applications. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Sequence-specific sup 1 H NMR resonance assignments of Bacillus subtilis HPr: Use of spectra obtained from mutants to resolve spectral overlap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wittekind, M.; Klevit, R.E.; Reizer, J.

1990-08-07

On the basis of an analysis of two-dimensional {sup 1}H NMR spectra, the complete sequence-specific {sup 1}H NMR assignments are presented for the phosphocarrier protein HPr from the Gram-positive bacterium Bacillus subtilis. During the assignment procedure, extensive use was made of spectra obtained from point mutants of HPr in order to resolve spectral overlap and to provide verification of assignments. Regions of regular secondary structure were identified by characteristic patterns of sequential backbone proton NOEs and slowly exchanging amide protons. B subtilis HPr contains four {beta}-strands that form a single antiparallel {beta}-sheet and two well-defined {alpha}-helices. There are two stretchesmore » of extended backbone structure, one of which contains the active site His{sub 15}. The overall fold of the protein is very similar to that of Escherichia coli HPr determined by NMR studies.« less

Plasmid-Encoded MCP Is Involved in Virulence, Motility, and Biofilm Formation of Cronobacter sakazakii ATCC 29544

PubMed Central

Choi, Younho; Kim, Seongok; Hwang, Hyelyeon; Kim, Kwang-Pyo; Kang, Dong-Hyun

2014-01-01

The aim of this study was to elucidate the function of the plasmid-borne mcp (methyl-accepting chemotaxis protein) gene, which plays pleiotropic roles in Cronobacter sakazakii ATCC 29544. By searching for virulence factors using a random transposon insertion mutant library, we identified and sequenced a new plasmid, pCSA2, in C. sakazakii ATCC 29544. An in silico analysis of pCSA2 revealed that it included six putative open reading frames, and one of them was mcp. The mcp mutant was defective for invasion into and adhesion to epithelial cells, and the virulence of the mcp mutant was attenuated in rat pups. In addition, we demonstrated that putative MCP regulates the motility of C. sakazakii, and the expression of the flagellar genes was enhanced in the absence of a functional mcp gene. Furthermore, a lack of the mcp gene also impaired the ability of C. sakazakii to form a biofilm. Our results demonstrate a regulatory role for MCP in diverse biological processes, including the virulence of C. sakazakii ATCC 29544. To the best of our knowledge, this study is the first to elucidate a potential function of a plasmid-encoded MCP homolog in the C. sakazakii sequence type 8 (ST8) lineage. PMID:25332122

Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

PubMed

Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

2017-07-01

The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

Plasmid-encoded MCP is involved in virulence, motility, and biofilm formation of Cronobacter sakazakii ATCC 29544.

PubMed

Choi, Younho; Kim, Seongok; Hwang, Hyelyeon; Kim, Kwang-Pyo; Kang, Dong-Hyun; Ryu, Sangryeol

2015-01-01

The aim of this study was to elucidate the function of the plasmid-borne mcp (methyl-accepting chemotaxis protein) gene, which plays pleiotropic roles in Cronobacter sakazakii ATCC 29544. By searching for virulence factors using a random transposon insertion mutant library, we identified and sequenced a new plasmid, pCSA2, in C. sakazakii ATCC 29544. An in silico analysis of pCSA2 revealed that it included six putative open reading frames, and one of them was mcp. The mcp mutant was defective for invasion into and adhesion to epithelial cells, and the virulence of the mcp mutant was attenuated in rat pups. In addition, we demonstrated that putative MCP regulates the motility of C. sakazakii, and the expression of the flagellar genes was enhanced in the absence of a functional mcp gene. Furthermore, a lack of the mcp gene also impaired the ability of C. sakazakii to form a biofilm. Our results demonstrate a regulatory role for MCP in diverse biological processes, including the virulence of C. sakazakii ATCC 29544. To the best of our knowledge, this study is the first to elucidate a potential function of a plasmid-encoded MCP homolog in the C. sakazakii sequence type 8 (ST8) lineage. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A Genetic Locus Necessary for Rhamnose Uptake and Catabolism in Rhizobium leguminosarum bv. trifolii

PubMed Central

Richardson, Jason S.; Hynes, Michael F.; Oresnik, Ivan J.

2004-01-01

Rhizobium leguminosarum bv. trifolii mutants unable to catabolize the methyl-pentose rhamnose are unable to compete effectively for nodule occupancy. In this work we show that the locus responsible for the transport and catabolism of rhamnose spans 10,959 bp. Mutations in this region were generated by transposon mutagenesis, and representative mutants were characterized. The locus contains genes coding for an ABC-type transporter, a putative dehydrogenase, a probable isomerase, and a sugar kinase necessary for the transport and subsequent catabolism of rhamnose. The regulation of these genes, which are inducible by rhamnose, is carried out in part by a DeoR-type negative regulator (RhaR) that is encoded within the same transcript as the ABC-type transporter but is separated from the structural genes encoding the transporter by a terminator-like sequence. RNA dot blot analysis demonstrated that this terminator-like sequence is correlated with transcript attenuation only under noninducing conditions. Transport assays utilizing tritiated rhamnose demonstrated that uptake of rhamnose was inducible and dependent upon the presence of the ABC transporter at this locus. Phenotypic analyses of representative mutants from this locus provide genetic evidence that the catabolism of rhamnose differs from previously described methyl-pentose catabolic pathways. PMID:15576793

A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus.

PubMed

Reeves, Emer P; Reiber, Kathrin; Neville, Claire; Scheibner, Olaf; Kavanagh, Kevin; Doyle, Sean

2006-07-01

Aspergillus fumigatus is an important human fungal pathogen. The Aspergillus fumigatus genome contains 14 nonribosomal peptide synthetase genes, potentially responsible for generating metabolites that contribute to organismal virulence. Differential expression of the nonribosomal peptide synthetase gene, pes1, in four strains of Aspergillus fumigatus was observed. The pattern of pes1 expression differed from that of a putative siderophore synthetase gene, sidD, and so is unlikely to be involved in iron acquisition. The Pes1 protein (expected molecular mass 698 kDa) was partially purified and identified by immunoreactivity, peptide mass fingerprinting (36% sequence coverage) and MALDI LIFT-TOF/TOF MS (four internal peptides sequenced). A pes1 disruption mutant (delta pes1) of Aspergillus fumigatus strain 293.1 was generated and confirmed by Southern and western analysis, in addition to RT-PCR. The delta pes1 mutant also showed significantly reduced virulence in the Galleria mellonella model system (P < 0.001) and increased sensitivity to oxidative stress (P = 0.002) in culture and during neutrophil-mediated phagocytosis. In addition, the mutant exhibited altered conidial surface morphology and hydrophilicity, compared to Aspergillus fumigatus 293.1. It is concluded that pes1 contributes to improved fungal tolerance against oxidative stress, mediated by the conidial phenotype, during the infection process.

Connecting Active-Site Loop Conformations and Catalysis in Triosephosphate Isomerase: Insights from a Rare Variation at Residue 96 in the Plasmodial Enzyme.

PubMed

Pareek, Vidhi; Samanta, Moumita; Joshi, Niranjan V; Balaram, Hemalatha; Murthy, Mathur R N; Balaram, Padmanabhan

2016-04-01

Despite extensive research into triosephosphate isomerases (TIMs), there exists a gap in understanding of the remarkable conjunction between catalytic loop-6 (residues 166-176) movement and the conformational flip of Glu165 (catalytic base) upon substrate binding that primes the active site for efficient catalysis. The overwhelming occurrence of serine at position 96 (98% of the 6277 unique TIM sequences), spatially proximal to E165 and the loop-6 residues, raises questions about its role in catalysis. Notably, Plasmodium falciparum TIM has an extremely rare residue--phenylalanine--at this position whereas, curiously, the mutant F96S was catalytically defective. We have obtained insights into the influence of residue 96 on the loop-6 conformational flip and E165 positioning by combining kinetic and structural studies on the PfTIM F96 mutants F96Y, F96A, F96S/S73A, and F96S/L167V with sequence conservation analysis and comparative analysis of the available apo and holo structures of the enzyme from diverse organisms. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of residues in ABCG2 affecting protein trafficking and drug transport, using co-evolutionary analysis of ABCG sequences.

PubMed

Haider, Ameena J; Cox, Megan H; Jones, Natalie; Goode, Alice J; Bridge, Katherine S; Wong, Kelvin; Briggs, Deborah; Kerr, Ian D

2015-07-17

ABCG2 is an ABC (ATP-binding cassette) transporter with a physiological role in urate transport in the kidney and is also implicated in multi-drug efflux from a number of organs in the body. The trafficking of the protein and the mechanism by which it recognizes and transports diverse drugs are important areas of research. In the current study, we have made a series of single amino acid mutations in ABCG2 on the basis of sequence analysis. Mutant isoforms were characterized for cell surface expression and function. One mutant (I573A) showed disrupted glycosylation and reduced trafficking kinetics. In contrast with many ABC transporter folding mutations which appear to be 'rescued' by chemical chaperones or low temperature incubation, the I573A mutation was not enriched at the cell surface by either treatment, with the majority of the protein being retained in the endoplasmic reticulum (ER). Two other mutations (P485A and M549A) showed distinct effects on transport of ABCG2 substrates reinforcing the role of TM helix 3 in drug recognition and transport and indicating the presence of intracellular coupling regions in ABCG2. © 2015 Authors.

Compound Heterozygosity for Y Box Proteins Causes Sterility Due to Loss of Translational Repression

PubMed Central

Sharma, Manju; Dearth, Andrea; Smith, Benjamin; Braun, Robert E.

2015-01-01

The Y-box proteins YBX2 and YBX3 bind RNA and DNA and are required for metazoan development and fertility. However, possible functional redundancy between YBX2 and YBX3 has prevented elucidation of their molecular function as RNA masking proteins and identification of their target RNAs. To investigate possible functional redundancy between YBX2 and YBX3, we attempted to construct Ybx2 -/- ;Ybx3 -/- double mutants using a previously reported Ybx2 -/- model and a newly generated global Ybx3 -/- model. Loss of YBX3 resulted in reduced male fertility and defects in spermatid differentiation. However, homozygous double mutants could not be generated as haploinsufficiency of both Ybx2 and Ybx3 caused sterility characterized by extensive defects in spermatid differentiation. RNA sequence analysis of mRNP and polysome occupancy in single and compound Ybx2/3 heterozygotes revealed loss of translational repression almost exclusively in the compound Ybx2/3 heterozygotes. RNAseq analysis also demonstrated that Y-box protein dose-dependent loss of translational regulation was inversely correlated with the presence of a Y box recognition target sequence, suggesting that Y box proteins bind RNA hierarchically to modulate translation in a range of targets. PMID:26646932

Overexpression of OsSAP16 Regulates Photosynthesis and the Expression of a Broad Range of Stress Response Genes in Rice (Oryza sativa L.).

PubMed

Wang, Fei; Coe, Robert A; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul

2016-01-01

This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes.

Overexpression of OsSAP16 Regulates Photosynthesis and the Expression of a Broad Range of Stress Response Genes in Rice (Oryza sativa L.)

PubMed Central

Wang, Fei; Coe, Robert A.; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul

2016-01-01

This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes. PMID:27303811

Structure and Temporal Dynamics of Populations within Wheat Streak Mosaic Virus Isolates

PubMed Central

Hall, Jeffrey S.; French, Roy; Morris, T. Jack; Stenger, Drake C.

2001-01-01

Variation within the Type and Sidney 81 strains of wheat streak mosaic virus was assessed by single-strand conformation polymorphism (SSCP) analysis and confirmed by nucleotide sequencing. Limiting-dilution subisolates (LDSIs) of each strain were evaluated for polymorphism in the P1, P3, NIa, and CP cistrons. Different SSCP patterns among LDSIs of a strain were associated with single-nucleotide substitutions. Sidney 81 LDSI-S10 was used as founding inoculum to establish three lineages each in wheat, corn, and barley. The P1, HC-Pro, P3, CI, NIa, NIb, and CP cistrons of LDSI-S10 and each lineage at passages 1, 3, 6, and 9 were evaluated for polymorphism. By passage 9, each lineage differed in consensus sequence from LDSI-S10. The majority of substitutions occurred within NIa and CP, although at least one change occurred in each cistron except HC-Pro and P3. Most consensus sequence changes among lineages were independent, with substitutions accumulating over time. However, LDSI-S10 bore a variant nucleotide (G6016) in NIa that was restored to A6016 in eight of nine lineages by passage 6. This near-global reversion is most easily explained by selection. Examination of nonconsensus variation revealed a pool of unique substitutions (singletons) that remained constant in frequency during passage, regardless of the host species examined. These results suggest that mutations arising by viral polymerase error are generated at a constant rate but that most newly generated mutants are sequestered in virions and do not serve as replication templates. Thus, a substantial fraction of variation generated is static and has yet to be tested for relative fitness. In contrast, nonsingleton variation increased upon passage, suggesting that some mutants do serve as replication templates and may become established in a population. Replicated mutants may or may not rise to prominence to become the consensus sequence in a lineage, with the fate of any particular mutant subject to selection and stochastic processes such as genetic drift and population growth factors. PMID:11581391

Genetic analysis of mouse embryonic stem cells bearing Msh3 and Msh2 single and compound mutations.

PubMed

Abuin, A; Zhang, H; Bradley, A

2000-01-01

We have previously described the use of homologous recombination and CRE-loxP-mediated marker recycling to generate mouse embryonic stem (ES) cell lines homozygous for mutations at the Msh3, Msh2, and both Msh3 and Msh2 loci (2). In this study, we describe the analysis of these ES cells with respect to processes known to be affected by DNA mismatch repair. ES cells homozygous for the Msh2 mutation displayed increased resistance to killing by the cytotoxic drug 6-thioguanine (6TG), indicating that the 6TG cytotoxic mechanism is mediated by Msh2. The mutation rate of the herpes simplex virus thymidine kinase 1 (HSV-tk1) gene was unchanged in Msh3-deficient ES cell lines but markedly elevated in Msh2-deficient and Msh3 Msh2 double-mutant cells. Notably, the HSV-tk1 mutation rate was 11-fold higher, on average, than that of the hypoxanthine-guanine phosphoribosyl transferase (Hprt) locus in Msh2-deficient cells. Sequence analysis of HSV-tk1 mutants from these cells indicated the presence of a frameshift hotspot within the HSV-tk1 coding region. Msh3-deficient cells displayed a modest (16-fold) elevation in the instability of a dinucleotide repeat, whereas Msh2-deficient and Msh2 Msh3 double-mutant cells displayed markedly increased levels of repeat instability. Targeting frequencies of nonisogenic vectors were elevated in Msh2-deficient ES cell lines, confirming the role of Msh2 in blocking recombination between diverged sequences (homeologous recombination) in mammalian cells. These results are consistent with accumulating data from other laboratories and support the current model of DNA mismatch repair in mammalian cells.

Genetic Analysis of Mouse Embryonic Stem Cells Bearing Msh3 and Msh2 Single and Compound Mutations

PubMed Central

Abuin, Alejandro; Zhang, HeJu; Bradley, Allan

2000-01-01

We have previously described the use of homologous recombination and CRE-loxP-mediated marker recycling to generate mouse embryonic stem (ES) cell lines homozygous for mutations at the Msh3, Msh2, and both Msh3 and Msh2 loci (2). In this study, we describe the analysis of these ES cells with respect to processes known to be affected by DNA mismatch repair. ES cells homozygous for the Msh2 mutation displayed increased resistance to killing by the cytotoxic drug 6-thioguanine (6TG), indicating that the 6TG cytotoxic mechanism is mediated by Msh2. The mutation rate of the herpes simplex virus thymidine kinase 1 (HSV-tk1) gene was unchanged in Msh3-deficient ES cell lines but markedly elevated in Msh2-deficient and Msh3 Msh2 double-mutant cells. Notably, the HSV-tk1 mutation rate was 11-fold higher, on average, than that of the hypoxanthine-guanine phosphoribosyl transferase (Hprt) locus in Msh2-deficient cells. Sequence analysis of HSV-tk1 mutants from these cells indicated the presence of a frameshift hotspot within the HSV-tk1 coding region. Msh3-deficient cells displayed a modest (16-fold) elevation in the instability of a dinucleotide repeat, whereas Msh2-deficient and Msh2 Msh3 double-mutant cells displayed markedly increased levels of repeat instability. Targeting frequencies of nonisogenic vectors were elevated in Msh2-deficient ES cell lines, confirming the role of Msh2 in blocking recombination between diverged sequences (homeologous recombination) in mammalian cells. These results are consistent with accumulating data from other laboratories and support the current model of DNA mismatch repair in mammalian cells. PMID:10594017

Quantification of simian immunodeficiency virus cytotoxic T lymphocyte escape mutant viruses.

PubMed

Loh, Liyen; Kent, Stephen J

2008-08-01

Escape from cytotoxic T-lymphocyte (CTL) pressure is common in HIV-1 infection of humans and simian immunodeficiency virus (SIV) infections of macaques. CTL escape typically incurs a fitness cost as reversion back to wild-type can occur upon transmission. We utilized sequence-specific primers and DNA probes with real-time polymerase chain reaction (PCR) to sensitively and specifically track wild-type and escape mutant viremia at the Mane-A*17-restricted SIV Gag(371379) epitope AF9 in pigtail macaques. The generation of minor escape mutant populations is detected by the real-time PCR 2 weeks earlier than observed using standard sequencing techniques. We passaged the AF9 CTL escape mutant virus into two naïve Mane-A*17-negative pigtail macaques and showed that reversion to wild-type was rapid during acute infection and then slowed considerably at later stages of the infection. These data help refine our understanding of how CTL escape mutant viruses evolve.

Generation of a glucose de-repressed mutant of Trichoderma reesei using disparity mutagenesis.

PubMed

Iwakuma, Hidekazu; Koyama, Yoshiyuki; Miyachi, Ayako; Nasukawa, Masashi; Matsumoto, Hitoshi; Yano, Shuntaro; Ogihara, Jun; Kasumi, Takafumi

2016-01-01

We obtained a novel glucose de-repressed mutant of Trichoderma reesei using disparity mutagenesis. A plasmid containing DNA polymerase δ lacking proofreading activity, and AMAI, an autonomously replicating sequence was introduced into T. reesei ATCC66589. The rate of mutation evaluated with 5-fluoroorotic acid resistance was approximately 30-fold higher than that obtained by UV irradiation. The transformants harboring incompetent DNA polymerase δ were then selected on 2-deoxyglucose agar plates with hygromycin B. The pNP-lactoside hydrolyzing activities of mutants were 2 to 5-fold higher than the parent in liquid medium containing glucose. Notably, the amino acid sequence of cre1, a key gene involved in glucose repression, was identical in the mutant and parent strains, and further, the cre1 expression levels was not abolished in the mutant. Taken together, these results demonstrate that the strains of T. reesei generated by disparity mutagenesis are glucose de-repressed variants that contain mutations in yet-unidentified factors other than cre1.

A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

PubMed

Dhanasekar, P; Reddy, K S

2015-02-01

Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs.

PubMed

Chen-Harris, Haiyin; Borucki, Monica K; Torres, Clinton; Slezak, Tom R; Allen, Jonathan E

2013-02-12

High throughput sequencing is beginning to make a transformative impact in the area of viral evolution. Deep sequencing has the potential to reveal the mutant spectrum within a viral sample at high resolution, thus enabling the close examination of viral mutational dynamics both within- and between-hosts. The challenge however, is to accurately model the errors in the sequencing data and differentiate real viral mutations, particularly those that exist at low frequencies, from sequencing errors. We demonstrate that overlapping read pairs (ORP) -- generated by combining short fragment sequencing libraries and longer sequencing reads -- significantly reduce sequencing error rates and improve rare variant detection accuracy. Using this sequencing protocol and an error model optimized for variant detection, we are able to capture a large number of genetic mutations present within a viral population at ultra-low frequency levels (<0.05%). Our rare variant detection strategies have important implications beyond viral evolution and can be applied to any basic and clinical research area that requires the identification of rare mutations.

Benomyl-resistant mutant strain of Trichoderma sp. with increased mycoparasitic activity.

PubMed

Olejníková, P; Ondrusová, Z; Krystofová, S; Hudecová, D

2010-01-01

Application of UV radiation to the strain Trichoderma sp. T-bt (isolated from lignite) resulted in the T-brm mutant which was resistant to the systemic fungicide benomyl. The tub2 gene sequence in the T-brm mutant differed from the parent as well as the collection strain (replacing tyrosine with histidine in the TUB2 protein). Under in vitro conditions this mutant exhibited a higher mycoparasitic activity toward phytopathogenic fungi.

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Experimental investigation of an RNA sequence space

NASA Technical Reports Server (NTRS)

Lee, Youn-Hyung; Dsouza, Lisa; Fox, George E.

1993-01-01

Modern rRNAs are the historic consequence of an ongoing evolutionary exploration of a sequence space. These extant sequences belong to a special subset of the sequence space that is comprised only of those primary sequences that can validly perform the biological function(s) required of the particular RNA. If it were possible to readily identify all such valid sequences, stochastic predictions could be made about the relative likelihood of various evolutionary pathways available to an RNA. Herein an experimental system which can assess whether a particular sequence is likely to have validity as a eubacterial 5S rRNA is described. A total of ten naturally occurring, and hence known to be valid, sequences and two point mutants of unknown validity were used to test the usefulness of the approach. Nine of the ten valid sequences tested positive whereas both mutants tested as clearly defective. The tenth valid sequence gave results that would be interpreted as reflecting a borderline status were the answer not known. These results demonstrate that it is possible to experimentally determine which sequences in local regions of the sequence space are potentially valid 5S rRNAs.

Identification of feline polycystic kidney disease mutation using fret probes and melting curve analysis.

PubMed

Criado-Fornelio, A; Buling, A; Barba-Carretero, J C

2009-02-01

We developed and validated a real-time polymerase chain reaction (PCR) assay using fluorescent hybridization probes and melting curve analysis to identify the PKD1 exon 29 (C-->A) mutation, which is implicated in polycystic kidney disease of cats. DNA was isolated from peripheral blood of 20 Persian cats. The employ of the new real-time PCR and melting curve analysis in these samples indicated that 13 cats (65%) were wild type homozygotes and seven cats (35%) were heterozygotes. Both PCR-RFLP and sequencing procedures were in full agreement with real-time PCR test results. Sequence analysis showed that the mutant gene had the expected base change compared to the wild type gene. The new procedure is not only very reliable but also faster than the techniques currently applied for diagnosis of the mutation.

Mutant type glutathione S-transferase theta 1 gene homologue to mTOR in myelodysplastic syndrome: possible clinical application of rapamycin.

PubMed

Maeda, Yasuhiro; Yamaguchi, Terufumi; Ueda, Satomi; Matsuo, Koki; Morita, Yasuyoshi; Naiki, Yoshito; Miyazato, Hajime; Shimada, Takahiro; Miyatake, Jun-Ichi; Matsuda, Mitsuhiro; Kanamaru, Akihisa

2003-07-01

In this study, we observed the expression of the GSTT-1 gene in patients with myelodysplastic syndrome (MDS) at the messenger RNA level. Reverse transcription-polymerase chain reaction (RT-PCR) for GSTT-1 was performed with a pair of primers complementary to the 5' coding section and the 3' coding section of the GSTT-1 cDNA for amplifying the 623-bp band. Among 20 patients with MDS, 8 patients showed the expected 623-bp band on RT-PCR, and 12 patients showed a 500-bp band on RT-PCR, indicating that a 123-bp sequence was deleted as a mutant of the GSTT-1 gene. Furthermore, a BLAST DNA search showed that the deletion of a 123 bp sequence creates a sequence that is 63% homologous to human FKBP-rapamycin associated protein (FRAP); this protein has been termed a mammalian target of rapamycin (mTOR). We respectively transfected the wild type and the mutant type GSTT-1 gene in an expression vector to two cell lines (K562 and HL-60). The stable transformants for the wild type and the mutant type GSTT-1 genes were made by G418 selection. Interestingly, rapamycin could induce significant growth inhibition of the stable transformants for mutant type GSTT-1, which was indicative of apoptosis, but not that of those for wild type GSTT-1. These results suggest that rapamycin could be included in the therapeutic modality for the patients with MDS who have the mTOR sequences in GSTT-1 gene.

Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

2017-01-01

SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

A rare complex DNA rearrangement in the murine Steel gene results in exon duplication and a lethal phenotype.

PubMed

Chandra, Saurabh; Kapur, Reuben; Chuzhanova, Nadia; Summey, Victoria; Prentice, David; Barker, Jane; Cooper, David N; Williams, David A

2003-11-15

Kit ligand (Kitl), encoded by the Steel (Sl) locus, plays an essential role in hematopoiesis, gametogenesis, and melanogenesis during both embryonic and adult life. We have characterized a new spontaneous mutant of the Sl locus in mice designated KitlSl-20J that arose in the breeding colony at Jackson Laboratories. Heterozygous KitlSl-20J mice display a white belly spot and intercrossing results in an embryonic lethal phenotype in the homozygous state. Analysis of homozygous embryos demonstrated a significant reduction in fetal liver cellularity, colony forming unit-erythroid (CFU-E) progenitors, and a total absence of germ cells. Although expressed in vivo, recombinant mutant protein demonstrated loss of bioactivity that was correlated with lack of receptor binding. Analysis of the Sl gene transcripts in heterozygous KitlSl-20J mice revealed an in-frame tandem duplication of exon 3. A long-range polymerase chain reaction (PCR) strategy using overlapping primers in exon 3 amplified an approximately 7-kilobase (kb) product from DNA isolated from heterozygous KitlSl-20J mice but not from wild-type DNA that contained sequences from both introns 2 and 3 and an inverted intron 2 sequence, suggesting a complex rearrangement as the mechanism of the mutation. "Complexity analysis" of the sequence of the amplified product strongly suggests that local DNA motifs may have contributed to the generation of this spontaneous KitlSl-20J allele, likely mediated by a 2-step process. The KitlSl-20J mutation is a unique KitlSl allele and represents an unusual mechanism of mutation.

Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.

PubMed

Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M

1997-10-01

We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.

Analysis of Natural and Induced Variation in Tomato Glandular Trichome Flavonoids Identifies a Gene Not Present in the Reference Genome[W][OPEN

PubMed Central

Kim, Jeongwoon; Matsuba, Yuki; Ning, Jing; Schilmiller, Anthony L.; Hammar, Dagan; Jones, A. Daniel; Pichersky, Eran; Last, Robert L.

2014-01-01

Flavonoids are ubiquitous plant aromatic specialized metabolites found in a variety of cell types and organs. Methylated flavonoids are detected in secreting glandular trichomes of various Solanum species, including the cultivated tomato (Solanum lycopersicum). Inspection of the sequenced S. lycopersicum Heinz 1706 reference genome revealed a close homolog of Solanum habrochaites MOMT1 3′/5′ myricetin O-methyltransferase gene, but this gene (Solyc06g083450) is missing the first exon, raising the question of whether cultivated tomato has a distinct 3′ or 3′/5′ O-methyltransferase. A combination of mining genome and cDNA sequences from wild tomato species and S. lycopersicum cultivar M82 led to the identification of Sl-MOMT4 as a 3′ O-methyltransferase. In parallel, three independent ethyl methanesulfonate mutants in the S. lycopersicum cultivar M82 background were identified as having reduced amounts of di- and trimethylated myricetins and increased monomethylated myricetin. Consistent with the hypothesis that Sl-MOMT4 is a 3′ O-methyltransferase gene, all three myricetin methylation defective mutants were found to have defects in MOMT4 sequence, transcript accumulation, or 3′-O-methyltransferase enzyme activity. Surprisingly, no MOMT4 sequence is found in the Heinz 1706 reference genome sequence, and this cultivar accumulates 3-methyl myricetin and is deficient in 3′-methyl myricetins, demonstrating variation in this gene among cultivated tomato varieties. PMID:25128240

Quantitative Analysis of Mutant Subclones in Chronic Myeloid Leukemia: Comparison of Different Methodological Approaches

PubMed Central

Preuner, Sandra; Barna, Agnes; Frommlet, Florian; Czurda, Stefan; Konstantin, Byrgazov; Alikian, Mary; Machova Polakova, Katerina; Sacha, Tomasz; Richter, Johan; Lion, Thomas; Gabriel, Christian

2016-01-01

Identification and quantitative monitoring of mutant BCR-ABL1 subclones displaying resistance to tyrosine kinase inhibitors (TKIs) have become important tasks in patients with Ph-positive leukemias. Different technologies have been established for patient screening. Various next-generation sequencing (NGS) platforms facilitating sensitive detection and quantitative monitoring of mutations in the ABL1-kinase domain (KD) have been introduced recently, and are expected to become the preferred technology in the future. However, broad clinical implementation of NGS methods has been hampered by the limited accessibility at different centers and the current costs of analysis which may not be regarded as readily affordable for routine diagnostic monitoring. It is therefore of interest to determine whether NGS platforms can be adequately substituted by other methodological approaches. We have tested three different techniques including pyrosequencing, LD (ligation-dependent)-PCR and NGS in a series of peripheral blood specimens from chronic myeloid leukemia (CML) patients carrying single or multiple mutations in the BCR-ABL1 KD. The proliferation kinetics of mutant subclones in serial specimens obtained during the course of TKI-treatment revealed similar profiles via all technical approaches, but individual specimens showed statistically significant differences between NGS and the other methods tested. The observations indicate that different approaches to detection and quantification of mutant subclones may be applicable for the monitoring of clonal kinetics, but careful calibration of each method is required for accurate size assessment of mutant subclones at individual time points. PMID:27136541

Quantitative Analysis of Mutant Subclones in Chronic Myeloid Leukemia: Comparison of Different Methodological Approaches.

PubMed

Preuner, Sandra; Barna, Agnes; Frommlet, Florian; Czurda, Stefan; Konstantin, Byrgazov; Alikian, Mary; Machova Polakova, Katerina; Sacha, Tomasz; Richter, Johan; Lion, Thomas; Gabriel, Christian

2016-04-29

Identification and quantitative monitoring of mutant BCR-ABL1 subclones displaying resistance to tyrosine kinase inhibitors (TKIs) have become important tasks in patients with Ph-positive leukemias. Different technologies have been established for patient screening. Various next-generation sequencing (NGS) platforms facilitating sensitive detection and quantitative monitoring of mutations in the ABL1-kinase domain (KD) have been introduced recently, and are expected to become the preferred technology in the future. However, broad clinical implementation of NGS methods has been hampered by the limited accessibility at different centers and the current costs of analysis which may not be regarded as readily affordable for routine diagnostic monitoring. It is therefore of interest to determine whether NGS platforms can be adequately substituted by other methodological approaches. We have tested three different techniques including pyrosequencing, LD (ligation-dependent)-PCR and NGS in a series of peripheral blood specimens from chronic myeloid leukemia (CML) patients carrying single or multiple mutations in the BCR-ABL1 KD. The proliferation kinetics of mutant subclones in serial specimens obtained during the course of TKI-treatment revealed similar profiles via all technical approaches, but individual specimens showed statistically significant differences between NGS and the other methods tested. The observations indicate that different approaches to detection and quantification of mutant subclones may be applicable for the monitoring of clonal kinetics, but careful calibration of each method is required for accurate size assessment of mutant subclones at individual time points.

Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift

PubMed Central

Cingolani, Pablo; Patel, Viral M.; Coon, Melissa; Nguyen, Tung; Land, Susan J.; Ruden, Douglas M.; Lu, Xiangyi

2012-01-01

This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, and deletions (InDels) in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of polymerase chain reaction-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate pre-mature stop codon mutation in each of the two allelic mutants whereas the other four candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic chemicals. PMID:22435069

Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

PubMed Central

Yasuno, Rie; Wada, Hajime

1998-01-01

Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

PubMed Central

Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

2016-01-01

The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

Natural non-homologous recombination led to the emergence of a duplicated V3-NS5A region in HCV-1b strains associated with hepatocellular carcinoma.

PubMed

Le Guillou-Guillemette, Hélène; Pivert, Adeline; Bouthry, Elise; Henquell, Cécile; Petsaris, Odile; Ducancelle, Alexandra; Veillon, Pascal; Vallet, Sophie; Alain, Sophie; Thibault, Vincent; Abravanel, Florence; Rosenberg, Arielle A; André-Garnier, Elisabeth; Bour, Jean-Baptiste; Baazia, Yazid; Trimoulet, Pascale; André, Patrice; Gaudy-Graffin, Catherine; Bettinger, Dominique; Larrat, Sylvie; Signori-Schmuck, Anne; Saoudin, Hénia; Pozzetto, Bruno; Lagathu, Gisèle; Minjolle-Cha, Sophie; Stoll-Keller, Françoise; Pawlotsky, Jean-Michel; Izopet, Jacques; Payan, Christopher; Lunel-Fabiani, Françoise; Lemaire, Christophe

2017-01-01

The emergence of new strains in RNA viruses is mainly due to mutations or intra and inter-genotype homologous recombination. Non-homologous recombinations may be deleterious and are rarely detected. In previous studies, we identified HCV-1b strains bearing two tandemly repeated V3 regions in the NS5A gene without ORF disruption. This polymorphism may be associated with an unfavorable course of liver disease and possibly involved in liver carcinogenesis. Here we aimed at characterizing the origin of these mutant strains and identifying the evolutionary mechanism on which the V3 duplication relies. Direct sequencing of the entire NS5A and E1 genes was performed on 27 mutant strains. Quasispecies analyses in consecutive samples were also performed by cloning and sequencing the NS5A gene for all mutant and wild strains. We analyzed the mutant and wild-type sequence polymorphisms using Bayesian methods to infer the evolutionary history of and the molecular mechanism leading to the duplication-like event. Quasispecies were entirely composed of exclusively mutant or wild-type strains respectively. Mutant quasispecies were found to have been present since contamination and had persisted for at least 10 years. This V3 duplication-like event appears to have resulted from non-homologous recombination between HCV-1b wild-type strains around 100 years ago. The association between increased liver disease severity and these HCV-1b mutants may explain their persistence in chronically infected patients. These results emphasize the possible consequences of non-homologous recombination in the emergence and severity of new viral diseases.

Aspartate decarboxylase (PanD) as a new target of pyrazinamide in Mycobacterium tuberculosis.

PubMed

Shi, Wanliang; Chen, Jiazhen; Feng, Jie; Cui, Peng; Zhang, Shuo; Weng, Xinhua; Zhang, Wenhong; Zhang, Ying

2014-08-01

Pyrazinamide (PZA) is a frontline anti-tuberculosis drug that plays a crucial role in the treatment of both drug-susceptible and multidrug-resistant tuberculosis (MDR-TB). PZA is a prodrug that is converted to its active form, pyrazinoic acid (POA), by a nicotinamidase/pyrazinamidase encoded by the pncA gene, the mutation of which is the major cause of PZA resistance. Although RpsA (ribosomal protein S1, involved in trans-translation) has recently been shown to be a target of POA/PZA, whole-genome sequencing has identified mutations in the panD gene encoding aspartate decarboxylase in PZA-resistant strains lacking pncA and rpsA mutations. To gain more insight into a possible new target of PZA, we isolated 30 POA-resistant mutants lacking mutations in pncA and rpsA from M. tuberculosis in vitro, and whole-genome sequencing of 3 mutants identified various mutations in the panD gene. Additionally, sequencing analysis revealed that the remaining 27 POA-resistant mutants all harbored panD mutations affecting the C-terminus of the PanD protein, with PanD M117I being the most frequent mutation (24/30, 80%). Conditional overexpression of panD from M. tuberculosis, M. smegmatis or E. coli, or of M. tuberculosis mutant PanD M117I, all conferred resistance to POA and PZA in M. tuberculosis. β-alanine and pantothenate, which are downstream products of PanD, were found to antagonize the antituberculosis activity of POA. In addition, the activity of the M. tuberculosis PanD enzyme was inhibited by POA at therapeutically relevant concentrations in a concentration-dependent manner but was not inhibited by the prodrug PZA or the control compound nicotinamide. These findings suggest that PanD represents a new target of PZA/POA. These results have implications for a better understanding of this peculiar persister drug and for the design of new drugs targeting M. tuberculosis persisters for improved treatment.

Selection and characterization of a mutant of feline immunodeficiency virus resistant to 2',3'-dideoxycytidine.

PubMed Central

Medlin, H K; Zhu, Y Q; Remington, K M; Phillips, T R; North, T W

1996-01-01

We have selected and plaque purified a mutant of feline immunodeficiency virus (FIV) that is resistant to 2',3'-dideoxycytidine (ddC). This mutant was selected in cultured cells in the continuous presence of 25 microM ddC. The mutant, designated DCR-5c, was fourfold resistant to ddC, threefold resistant to 2',3'-dideoxyinosine, and more than fourfold resistant to phosphonoformic acid. DCR-5c displayed little or no resistance to (-)-beta-2',3'-dideoxy-3'-thiacytidine, 3'-azido-3'-deoxythymidine, or 9-(2-phosphonylmethoxyethyl) adenine. Reverse transcriptase purified from DCR-5c was less susceptible to inhibition by ddCTP, phosphonoformic acid, ddATP, or azido-dTTP than the wild-type FIV reverse transcriptase. Sequence analysis of DCR-5c revealed a single base change (G to C at nucleotide 2342) in the reverse transcriptase-encoding region of FIV. This mutation results in substitution of His for Asp at codon 3 of FIV reverse transcriptase. The role of this mutation in ddC resistance was confirmed by site-directed mutagenesis. PMID:8849258

A novel Met-to-Thr mutation in the YMDD motif of reverse transcriptase from feline immunodeficiency virus confers resistance to oxathiolane nucleosides.

PubMed Central

Smith, R A; Remington, K M; Lloyd, R M; Schinazi, R F; North, T W

1997-01-01

Variants of feline immunodeficiency virus (FIV) that possess a unique methionine-to-threonine mutation within the YMDD motif of reverse transcriptase (RT) were selected by culturing virus in the presence of inhibitory concentrations of (-)-beta-L-2',3'-dideoxy-5-fluoro-3'-thiacytidine [(-)-FTC]. The mutants were resistant to (-)-FTC and (-)-beta-L-2',3'-dideoxy-3'-thiacytidine (3TC) and additionally exhibited low-level resistance to 2',3'-dideoxycytidine (ddC). DNA sequence analysis of the RT-encoding region of the pol gene amplified from resistant viruses consistently identified a Met-to-Thr mutation in the YMDD motif. Purified RT from the mutants was also resistant to the 5'-triphosphate forms of 3TC, (-)-FTC, and ddC. Site-directed mutants of FIV were engineered which contain either the novel Met-to-Thr mutation or the Met-to-Val mutation seen in oxathiolane nucleoside-resistant HIV-1. Both site-directed mutants displayed resistance to 3TC, thus confirming the role of these mutations in the resistance of FIV to beta-L-3'-thianucleosides. PMID:9032372

Genetic Correction of SOD1 Mutant iPSCs Reveals ERK and JNK Activated AP1 as a Driver of Neurodegeneration in Amyotrophic Lateral Sclerosis.

PubMed

Bhinge, Akshay; Namboori, Seema C; Zhang, Xiaoyu; VanDongen, Antonius M J; Stanton, Lawrence W

2017-04-11

Although mutations in several genes with diverse functions have been known to cause amyotrophic lateral sclerosis (ALS), it is unknown to what extent causal mutations impinge on common pathways that drive motor neuron (MN)-specific neurodegeneration. In this study, we combined induced pluripotent stem cells-based disease modeling with genome engineering and deep RNA sequencing to identify pathways dysregulated by mutant SOD1 in human MNs. Gene expression profiling and pathway analysis followed by pharmacological screening identified activated ERK and JNK signaling as key drivers of neurodegeneration in mutant SOD1 MNs. The AP1 complex member JUN, an ERK/JNK downstream target, was observed to be highly expressed in MNs compared with non-MNs, providing a mechanistic insight into the specific degeneration of MNs. Importantly, investigations of mutant FUS MNs identified activated p38 and ERK, indicating that network perturbations induced by ALS-causing mutations converge partly on a few specific pathways that are drug responsive and provide immense therapeutic potential. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Point mutation of H3/H4 histones affects acetic acid tolerance in Saccharomyces cerevisiae.

PubMed

Liu, Xiangyong; Zhang, Xiaohua; Zhang, Zhaojie

2014-10-10

The molecular mechanism of acetic acid tolerance in yeast remains unclear despite of its importance for efficient cellulosic ethanol production. In this study, we examined the effects of histone H3/H4 point mutations on yeast acetic acid tolerance by comprehensively screening a histone H3/H4 mutant library. A total of 24 histone H3/H4 mutants (six acetic acid resistant and 18 sensitive) were identified. Compared to the wild-type strain, the histone acetic acid-resistant mutants exhibited improved ethanol fermentation performance under acetic acid stress. Genome-wide transcriptome analysis revealed that changes in the gene expression in the acetic acid-resistant mutants H3 K37A and H4 K16Q were mainly related to energy production, antioxidative stress. Our results provide novel insights into yeast acetic acid tolerance on the basis of histone, and suggest a novel approach to improve ethanol production by altering the histone H3/H4 sequences. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of the UDP-glucose-4-epimerase required for galactofuranose biosynthesis and galactose metabolism in A. niger.

PubMed

Park, Joohae; Tefsen, Boris; Arentshorst, Mark; Lagendijk, Ellen; van den Hondel, Cees Amjj; van Die, Irma; Ram, Arthur Fj

2014-01-01

Galactofuranose (Gal f )-containing glycoconjugates are important to secure the integrity of the cell wall of filamentous fungi. Mutations that prevent the biosynthesis of Gal f -containing molecules compromise cell wall integrity. In response to cell wall weakening, the cell wall integrity (CWI)-pathway is activated to reinforce the strength of the cell wall. Activation of CWI-pathway in Aspergillus niger is characterized by the specific induction of the agsA gene, which encodes a cell wall α-glucan synthase. In this study, we screened a collection of cell wall mutants with an induced expression of agsA for defects in Gal f biosynthesis using a with anti-Gal f antibody (L10). From this collection of mutants, we previously identified mutants in the UDP-galactopyranose mutase encoding gene ( ugmA ). Here, we have identified six additional UDP-galactopyranose mutase ( ugmA ) mutants and one mutant (named mutant #41) in an additional complementation group that displayed strongly reduced Gal f -levels in the cell wall. By using a whole genome sequencing approach, 21 SNPs in coding regions were identified between mutant #41 and its parental strain which changed the amino acid sequence of the encoded proteins. One of these mutations was in gene An14g03820, which codes for a putative UDP-glucose-4-epimerase (UgeA). The A to G mutation in this gene causes an amino acid change of Asn to Asp at position 191 in the UgeA protein. Targeted deletion of ugeA resulted in an even more severe reduction of Gal f in N-linked glucans, indicating that the UgeA protein in mutant #41 is partially active. The ugeA gene is also required for growth on galactose despite the presence of two UgeA homologs in the A. niger genome. By using a classical mutant screen and whole genome sequencing of a new Gal f -deficient mutant, the UDP-glucose-4-epimerase gene ( ugeA ) has been identified. UgeA is required for the biosynthesis of Gal f as well as for galactose metabolism in Aspergillus niger .

Generation and characterization of tribenuron-methyl herbicide-resistant rapeseed (Brasscia napus) for hybrid seed production using chemically induced male sterility.

PubMed

Li, Haitao; Li, Juanjuan; Zhao, Bo; Wang, Jing; Yi, Licong; Liu, Chao; Wu, Jiangsheng; King, Graham J; Liu, Kede

2015-01-01

Identification and molecular analysis of four tribenuron-methyl resistant mutants in Brassica napus , which would be very useful in hybrid production using a Chemically induced male sterility system. Chemically induced male sterility (CIMS) systems dependent on chemical hybridization agents (CHAs) like tribenuron-methyl (TBM) represent an important approach for practical utilization of heterosis in rapeseed. However, when spraying the female parents with TBM to induce male sterility the male parents must be protected with a shield to avoid injury to the stamens, which would otherwise complicate the seed production protocol and increase the cost of hybrid seed production. Here we report the first proposed application of a herbicide-resistant cultivar in hybrid production, using a CIMS system based on identifying four TBM-resistant mutants in Brassica napus. Genetic analysis indicated that the TBM resistance was controlled by a single dominant nuclear gene. An in vitro enzyme activity assay for acetohydroxyacid synthase (AHAS) suggested that the herbicide resistance is caused by a gain-of-function mutation in a copy of AHAS genes. Comparative sequencing of the mutants and wild type BnaA.AHAS.a coding sequences identified a C-to-T transition at either position 535 or 536 from the translation start site, which resulted in a substitution of proline with serine or leucine at position 197 according to the Arabidopsis thaliana protein sequence. An allele-specific dCAPS marker developed from the C536T variation co-segregated with the herbicide resistance. Transgenic A. thaliana plants expressing BnaA.ahas3.a conferred herbicide resistance, which confirmed that the P197 substitution in BnaA.AHAS.a was responsible for the herbicide resistance. Moreover, the TBM-resistant lines maintain normal male fertility under TBM treatment and can be of practical value in hybrid seed production using CIMS.

The Bacillus subtilis yabG Gene Is Transcribed by SigK RNA Polymerase during Sporulation, and yabG Mutant Spores Have Altered Coat Protein Composition

PubMed Central

Takamatsu, Hiromu; Kodama, Takeko; Imamura, Atsuo; Asai, Kei; Kobayashi, Kazuo; Nakayama, Tatsuo; Ogasawara, Naotake; Watabe, Kazuhito

2000-01-01

The expression of six novel genes located in the region from abrB to spoVC of the Bacillus subtilis chromosome was analyzed, and one of the genes, yabG, had a predicted promoter sequence conserved among SigK-dependent genes. Northern blot analysis revealed that yabG mRNA was first detected from 4 h after the cessation of logarithmic growth (T4) in wild-type cells and in a gerE36 (GerE−) mutant but not in spoIIAC (SigF−), spoIIGAB (SigE−), spoIIIG (SigG−), and spoIVCB (SigK−) mutants. The transcription start point was determined by primer extension analysis; the −10 and −35 regions are very similar to the consensus sequences recognized by SigK-containing RNA polymerase. Inactivation of the yabG gene by insertion of an erythromycin resistance gene did not affect vegetative growth or spore resistance to heat, chloroform, and lysozyme. The germination of yabG spores in l-alanine and in a mixture of l-asparagine, d-glucose, d-fructose, and potassium chloride was also the same as that of wild-type spores. On the other hand, the protein preparation from yabG spores included 15-, 18-, 21-, 23-, 31-, 45-, and 55-kDa polypeptides which were low in or not extracted from wild-type spores under the same conditions. We determined their N-terminal amino acid sequence and found that these polypeptides were CotT, YeeK, YxeE, CotF, YrbA (31 and 45 kDa), and SpoIVA, respectively. The fluorescence of YabG-green fluorescent protein fusion produced in sporulating cells was detectable in the forespores but not in the mother cell compartment under fluorescence microscopy. These results indicate that yabG encodes a sporulation-specific protein which is involved in coat protein composition in B. subtilis. PMID:10714992

BRAF mutation testing in solid tumors: a methodological comparison.

PubMed

Weyant, Grace W; Wisotzkey, Jeffrey D; Benko, Floyd A; Donaldson, Keri J

2014-09-01

Solid tumor genotyping has become standard of care for the characterization of proto-oncogene mutational status, which has traditionally been accomplished with Sanger sequencing. However, companion diagnostic assays and comparable laboratory-developed tests are becoming increasingly popular, such as the cobas 4800 BRAF V600 Mutation Test and the INFINITI KRAS-BRAF assay, respectively. This study evaluates and validates the analytical performance of the INFINITI KRAS-BRAF assay and compares concordance of BRAF status with two reference assays, the cobas test and Sanger sequencing. DNA extraction from FFPE tissue specimens was performed followed by multiplex PCR amplification and fluorescent label incorporation using allele-specific primer extension. Hybridization to a microarray, signal detection, and analysis were then performed. The limits of detection were determined by testing dilutions of mutant BRAF alleles within wild-type background DNA, and accuracy was calculated based on these results. The INFINITI KRAS-BRAF assay produced 100% concordance with the cobas test and Sanger sequencing and had sensitivity equivalent to the cobas assay. The INFINITI assay is repeatable with at least 95% accuracy in the detection of mutant and wild-type BRAF alleles. These results confirm that the INFINITI KRAS-BRAF assay is comparable to traditional sequencing and the Food and Drug Administration-approved companion diagnostic assay for the detection of BRAF mutations. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Gene Deletion in Barley Mediated by LTR-retrotransposon BARE

PubMed Central

Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao

2017-01-01

A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053

Pla2g12b and Hpn Are Genes Identified by Mouse ENU Mutagenesis That Affect HDL Cholesterol

PubMed Central

Aljakna, Aleksandra; Choi, Seungbum; Savage, Holly; Hageman Blair, Rachael; Gu, Tongjun; Svenson, Karen L.; Churchill, Gary A.; Hibbs, Matt; Korstanje, Ron

2012-01-01

Despite considerable progress understanding genes that affect the HDL particle, its function, and cholesterol content, genes identified to date explain only a small percentage of the genetic variation. We used N-ethyl-N-nitrosourea mutagenesis in mice to discover novel genes that affect HDL cholesterol levels. Two mutant lines (Hlb218 and Hlb320) with low HDL cholesterol levels were established. Causal mutations in these lines were mapped using linkage analysis: for line Hlb218 within a 12 Mbp region on Chr 10; and for line Hlb320 within a 21 Mbp region on Chr 7. High-throughput sequencing of Hlb218 liver RNA identified a mutation in Pla2g12b. The transition of G to A leads to a cysteine to tyrosine change and most likely causes a loss of a disulfide bridge. Microarray analysis of Hlb320 liver RNA showed a 7-fold downregulation of Hpn; sequencing identified a mutation in the 3′ splice site of exon 8. Northern blot confirmed lower mRNA expression level in Hlb320 and did not show a difference in splicing, suggesting that the mutation only affects the splicing rate. In addition to affecting HDL cholesterol, the mutated genes also lead to reduction in serum non-HDL cholesterol and triglyceride levels. Despite low HDL cholesterol levels, the mice from both mutant lines show similar atherosclerotic lesion sizes compared to control mice. These new mutant mouse models are valuable tools to further study the role of these genes, their affect on HDL cholesterol levels, and metabolism. PMID:22912808

Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

Stress-induced rearrangement of Fusarium retrotransposon sequences.

PubMed

Anaya, N; Roncero, M I

1996-11-27

Rearrangement of fusarium oxysporum retrotransposon skippy was induced by growth in the presence of potassium chlorate. Three fungal strains, one sensitive to chlorate (Co60) and two resistant to chlorate and deficient for nitrate reductase (Co65 and Co94), were studied by Southern analysis of their genomic DNA. Polymorphism was detected in their hybridization banding pattern, relative to the wild type grown in the absence of chlorate, using various enzymes with or without restriction sites within the retrotransposon. Results were consistent with the assumption that three different events had occurred in strain Co60: genomic amplification of skippy yielding tandem arrays of the element, generation of new skippy sequences, and deletion of skippy sequences. Amplification of Co60 genomic DNA using the polymerase chain reaction and divergent primers derived from the retrotransposon generated a new band, corresponding to one long terminal repeat plus flanking sequences, that was not present in the wild-type strain. Molecular analysis of nitrate reductase-deficient mutants showed that generation and deletion of skippy sequences, but not genomic amplification in tandem repeats, had occurred in their genomes.

Mutants of Saccharomyces cerevisiae defective in the farnesylation of Ras proteins.

PubMed Central

Goodman, L E; Judd, S R; Farnsworth, C C; Powers, S; Gelb, M H; Glomset, J A; Tamanoi, F

1990-01-01

Ras proteins are post-translationally modified by farnesylation. In the present investigation, we identified an activity in crude soluble extracts of yeast cells that catalyzes the transfer of a farnesyl moiety from farnesyl pyrophosphate to yeast RAS2 protein. RAS2 proteins having a C-terminal Cys-Ali-Ali-Xaa sequence (where Ali is an aliphatic amino acid and Xaa is the unspecified C-terminal amino acid) served as substrates for this reaction, whereas RAS2 proteins with an altered or deleted Cys-Ali-Ali-Xaa sequence did not. A yeast mutant, dpr1/ram1, originally isolated as a Ras-processing mutant was shown to be defective in farnesyltransferase activity. In addition, another mutant, ram2, also was defective in the transferase activity. These results demonstrate that at least two genes, DPR1/RAM1 and RAM2, are required for the farnesyltransferase activity in yeast. Images PMID:2124698

Spatial constraints govern competition of mutant clones in human epidermis.

PubMed

Lynch, M D; Lynch, C N S; Craythorne, E; Liakath-Ali, K; Mallipeddi, R; Barker, J N; Watt, F M

2017-10-24

Deep sequencing can detect somatic DNA mutations in tissues permitting inference of clonal relationships. This has been applied to human epidermis, where sun exposure leads to the accumulation of mutations and an increased risk of skin cancer. However, previous studies have yielded conflicting conclusions about the relative importance of positive selection and neutral drift in clonal evolution. Here, we sequenced larger areas of skin than previously, focusing on cancer-prone skin spanning five decades of life. The mutant clones identified were too large to be accounted for solely by neutral drift. Rather, using mathematical modelling and computational lattice-based simulations, we show that observed clone size distributions can be explained by a combination of neutral drift and stochastic nucleation of mutations at the boundary of expanding mutant clones that have a competitive advantage. These findings demonstrate that spatial context and cell competition cooperate to determine the fate of a mutant stem cell.

Identification and comparative profiling of miRNAs in an early flowering mutant of trifoliate orange and its wild type by genome-wide deep sequencing.

PubMed

Sun, Lei-Ming; Ai, Xiao-Yan; Li, Wen-Yang; Guo, Wen-Wu; Deng, Xiu-Xin; Hu, Chun-Gen; Zhang, Jin-Zhi

2012-01-01

MicroRNAs (miRNAs) are a new class of small, endogenous RNAs that play a regulatory role in various biological and metabolic processes by negatively affecting gene expression at the post-transcriptional level. While the number of known Arabidopsis and rice miRNAs is continuously increasing, information regarding miRNAs from woody plants such as citrus remains limited. Solexa sequencing was performed at different developmental stages on both an early flowering mutant of trifoliate orange (precocious trifoliate orange, Poncirus trifoliata L. Raf.) and its wild-type in this study, resulting in the obtainment of 141 known miRNAs belonging to 99 families and 75 novel miRNAs in four libraries. A total of 317 potential target genes were predicted based on the 51 novel miRNAs families, GO and KEGG annotation revealed that high ranked miRNA-target genes are those implicated in diverse cellular processes in plants, including development, transcription, protein degradation and cross adaptation. To characterize those miRNAs expressed at the juvenile and adult development stages of the mutant and its wild-type, further analysis on the expression profiles of several miRNAs through real-time PCR was performed. The results revealed that most miRNAs were down-regulated at adult stage compared with juvenile stage for both the mutant and its wild-type. These results indicate that both conserved and novel miRNAs may play important roles in citrus growth and development, stress responses and other physiological processes.

DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

PubMed

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

PubMed Central

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

A novel tomato mutant, Solanum lycopersicum elongated fruit1 (Slelf1), exhibits an elongated fruit shape caused by increased cell layers in the proximal region of the ovary.

PubMed

Chusreeaeom, Katarut; Ariizumi, Tohru; Asamizu, Erika; Okabe, Yoshihiro; Shirasawa, Kenta; Ezura, Hiroshi

2014-06-01

Genes controlling fruit morphology offer important insights into patterns and mechanisms determining organ shape and size. In cultivated tomato (Solanum lycopersicum L.), a variety of fruit shapes are displayed, including round-, bell pepper-, pear-, and elongate-shaped forms. In this study, we characterized a tomato mutant possessing elongated fruit morphology by histologically analyzing its fruit structure and genetically analyzing and mapping the genetic locus. The mutant line, Solanum lycopersicum elongated fruit 1 (Slelf1), was selected in a previous study from an ethylmethane sulfonate-mutagenized population generated in the background of Micro-Tom, a dwarf and rapid-growth variety. Histological analysis of the Slelf1 mutant revealed dramatically increased elongation of ovary and fruit. Until 6 days before flowering, ovaries were round and they began to elongate afterward. We also determined pericarp thickness and the number of cell layers in three designated fruit regions. We found that mesocarp thickness, as well as the number of cell layers, was increased in the proximal region of immature green fruits, making this the key sector of fruit elongation. Using 262 F2 individuals derived from a cross between Slelf1 and the cultivar Ailsa Craig, we constructed a genetic map, simple sequence repeat (SSR), cleaved amplified polymorphism sequence (CAPS), and derived CAPS (dCAPS) markers and mapped to the 12 tomato chromosomes. Genetic mapping placed the candidate gene locus within a 0.2 Mbp interval on the long arm of chromosome 8 and was likely different from previously known loci affecting fruit shape.

Comparative transcriptomic analysis of key genes involved in flavonoid biosynthetic pathway and identification of a flavonol synthase from Artemisia annua L.

PubMed

Liu, S; Liu, L; Tang, Y; Xiong, S; Long, J; Liu, Z; Tian, N

2017-07-01

The regulatory mechanism of flavonoids, which synergise anti-malarial and anti-cancer compounds in Artemisia annua, is still unclear. In this study, an anthocyanidin-accumulating mutant callus was induced from A. annua and comparative transcriptomic analysis of wild-type and mutant calli performed, based on the next-generation Illumina/Solexa sequencing platform and de novo assembly. A total of 82,393 unigenes were obtained and 34,764 unigenes were annotated in the public database. Among these, 87 unigenes were assigned to 14 structural genes involved in the flavonoid biosynthetic pathway and 37 unigenes were assigned to 17 structural genes related to metabolism of flavonoids. More than 30 unigenes were assigned to regulatory genes, including R2R3-MYB, bHLH and WD40, which might regulate flavonoid biosynthesis. A further 29 unigenes encoding flavonoid biosynthetic enzymes or transcription factors were up-regulated in the mutant, while 19 unigenes were down-regulated, compared with the wild type. Expression levels of nine genes involved in the flavonoid pathway were compared using semi-quantitative RT-PCR, and results were consistent with comparative transcriptomic analysis. Finally, a putative flavonol synthase gene (AaFLS1) was identified from enzyme assay in vitro and in vivo through heterogeneous expression, and confirmed comparative transcriptomic analysis of wild-type and mutant callus. The present work has provided important target genes for the regulation of flavonoid biosynthesis in A. annua. © 2017 German Botanical Society and The Royal Botanical Society of the Netherlands.

Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing.

PubMed

Rosconi, Federico; de Vries, Stefan P W; Baig, Abiyad; Fabiano, Elena; Grant, Andrew J

2016-11-15

The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. Copyright © 2016 Rosconi et al.

Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin.

PubMed

Roy, M; Lee, R W; Kaarsholm, N C; Thøgersen, H; Brange, J; Dunn, M F

1990-06-12

The aromatic region of the 1H-FT-NMR spectrum of the biologically fully-potent, monomeric human insulin mutant, B9 Ser----Asp, B27 Thr----Glu has been investigated in D2O. At 1 to 5 mM concentrations, this mutant insulin is monomeric above pH 7.5. Coupling and amino acid classification of all aromatic signals is established via a combination of homonuclear one- and two-dimensional methods, including COSY, multiple quantum filters, selective spin decoupling and pH titrations. By comparisons with other insulin mutants and with chemically modified native insulins, all resonances in the aromatic region are given sequence-specific assignments without any reliance on the various crystal structures reported for insulin. These comparisons also give the sequence-specific assignments of most of the aromatic resonances of the mutant insulins B16 Tyr----Glu, B27 Thr----Glu and B25 Phe----Asp and the chemically modified species des-(B23-B30) insulin and monoiodo-Tyr A14 insulin. Chemical dispersion of the assigned resonances, ring current perturbations and comparisons at high pH have made possible the assignment of the aromatic resonances of human insulin, and these studies indicate that the major structural features of the human insulin monomer (including those critical to biological function) are also present in the monomeric mutant.

Detection of three-base deletion by exciplex formation with perylene derivatives.

PubMed

Kashida, Hiromu; Kondo, Nobuyo; Sekiguchi, Koji; Asanuma, Hiroyuki

2011-06-14

Here, we synthesized fluorescent DNA probes labeled with two perylene derivatives for the detection of a three-base deletion mutant. One such probe discriminated the three-base deletion mutant from the wild-type sequence by exciplex emission, and the deletion mutant was identifiable even by the naked eye. This journal is © The Royal Society of Chemistry 2011

HrpW of Erwinia amylovora, a New Harpin That Contains a Domain Homologous to Pectate Lyases of a Distinct Class

PubMed Central

Kim, Jihyun F.; Beer, Steven V.

1998-01-01

Harpins, such as HrpN of Erwinia amylovora, are extracellular glycine-rich proteins that elicit the hypersensitive reaction (HR). We identified hrpW of E. amylovora, which encodes a protein similar to known harpins in that it is acidic, rich in glycine and serine, and lacks cysteine. A putative HrpL-dependent promoter was identified upstream of hrpW, and Western blot analysis of hrpL mutants indicated that the production of HrpW is regulated by hrpL. HrpW is secreted via the Hrp (type III) pathway based on analysis of wild-type strains and hrp secretion mutants. When infiltrated into plants, HrpW induced rapid tissue collapse, which required active plant metabolism. The HR-eliciting activity was heat stable and protease sensitive. Thus, we concluded that HrpW is a new harpin. HrpW of E. amylovora consists of two domains connected by a Pro and Ser-rich sequence. A fragment containing the N-terminal domain was sufficient to elicit the HR. Although no pectate lyase activity was detected, the C-terminal region of HrpW is homologous to pectate lyases of a unique class, suggesting that HrpW may be targeted to the plant cell wall. Southern analysis indicated that hrpW is conserved among several Erwinia species, and hrpW, provided in trans, enhanced the HR-inducing ability of a hrpN mutant. However, HrpW did not increase the virulence of a hrpN mutant in host tissue, and hrpW mutants retained the wild-type ability to elicit the HR in nonhosts and to cause disease in hosts. PMID:9748455

The Analysis of Pendolino (peo) Mutants Reveals Differences in the Fusigenic Potential among Drosophila Telomeres

PubMed Central

Marzullo, Marta; Raffa, Grazia D.; Morciano, Patrizia; Raimondo, Domenico; Burla, Romina; Saggio, Isabella; Gatti, Maurizio

2015-01-01

Drosophila telomeres are sequence-independent structures that are maintained by transposition to chromosome ends of three specialized retroelements (HeT-A, TART and TAHRE; collectively designated as HTT) rather than telomerase activity. Fly telomeres are protected by the terminin complex (HOAP-HipHop-Moi-Ver) that localizes and functions exclusively at telomeres and by non-terminin proteins that do not serve telomere-specific functions. Although all Drosophila telomeres terminate with HTT arrays and are capped by terminin, they differ in the type of subtelomeric chromatin; the Y, XR, and 4L HTT are juxtaposed to constitutive heterochromatin, while the XL, 2L, 2R, 3L and 3R HTT are linked to the TAS repetitive sequences; the 4R HTT is associated with a chromatin that has features common to both euchromatin and heterochromatin. Here we show that mutations in pendolino (peo) cause telomeric fusions (TFs). The analysis of several peo mutant combinations showed that these TFs preferentially involve the Y, XR and 4th chromosome telomeres, a TF pattern never observed in the other 10 telomere-capping mutants so far characterized. peo encodes a non-terminin protein homologous to the E2 variant ubiquitin-conjugating enzymes. The Peo protein directly interacts with the terminin components, but peo mutations do not affect telomeric localization of HOAP, Moi, Ver and HP1a, suggesting that the peo-dependent telomere fusion phenotype is not due to loss of terminin from chromosome ends. peo mutants are also defective in DNA replication and PCNA recruitment. However, our results suggest that general defects in DNA replication are unable to induce TFs in Drosophila cells. We thus hypothesize that DNA replication in Peo-depleted cells results in specific fusigenic lesions concentrated in heterochromatin-associated telomeres. Alternatively, it is possible that Peo plays a dual function being independently required for DNA replication and telomere capping. PMID:26110638

The conserved CAAGAAAGA spacer sequence is an essential element for the formation of 3' termini of the sea urchin H3 histone mRNA by RNA processing.

PubMed Central

Georgiev, O; Birnstiel, M L

1985-01-01

Analysis of cDNA sequences obtained from the small nuclear RNA U7 has previously suggested specific contacts, by base pairing, between the conserved stem-loop structure and CAAGAAAGA sequence of the histone pre-mRNA and the 5'-terminal sequence of the U7 RNA during RNA processing. In order to test some aspects of the model we have created a series of linker scan, deletion and insertion mutants of the 3' terminus of a sea urchin H3 histone gene and have injected mutant DNAs or in vitro synthesized precursors into frog oocyte nuclei for interpretation. We find that, in addition to the stem-loop structure of the mRNA, the CAAGAAAGA spacer transcript within the histone pre-mRNA is required absolutely for RNA processing, as predicted from our model. Spacer sequences immediately downstream of the CAAGAAAGA motif are not complementary to U7 RNA. Nevertheless, they are necessary for obtaining a maximal rate of RNA processing, as is the ACCA sequence coding for the 3' terminus of the mature mRNA. An increase of distance between the mRNA palindrome and the CAAGAAAGA by as little as six nucleotides abolishes all processing. It may, therefore, be useful to regard both these sequence motifs as part of one and the same RNA processing signal with narrowly defined topologies. Interestingly, U7 RNA-dependent 3' processing of histone pre-mRNA can occur in RNA injection experiments only when the in vitro synthesized pre-mRNA contains sequence extensions well beyond the region of sequence complementarities to the U7 RNA. In addition to directing 3' processing the terminal mRNA sequences may have a role in histone mRNA stabilization in the cytoplasmic compartment. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2410259

Differential effects of the mismatch repair genes MSH2 and MSH3 on homeologous recombination in Saccharomyces cerevisiae.

PubMed

Selva, E M; Maderazo, A B; Lahue, R S

1997-12-01

The products of the yeast mismatch repair genes MSH2 and MSH3 participate in the inhibition of genetic recombination between homeologous (divergent) DNA sequences. In strains deficient for these genes, homeologous recombination rates between repeated elements are elevated due to the loss of this inhibition. In this study, the effects of these mutations were further analyzed by quantitation of mitotic homeologous recombinants as crossovers, gene conversions or exceptional events in wild-type, msh2, msh3 and msh2 msh3 mutant strains. When homeologous sequences were present as a direct repeat in one orientation, crossovers and gene conversions were elevated in msh2, msh3 and msh2 msh3 strains. The increases were greater in the msh2 msh3 double mutant than in either single mutant. When the order of the homeologous sequences was reversed, the msh2 mutation again yielded increased rates of crossovers and gene conversions. However, in an msh3 strain, gene conversions occurred at higher levels but interchromosomal crossovers were not increased and intrachromosomal crossovers were reduced relative to wild type. The msh2 msh3 double mutant behaved like the msh2 single mutant in this orientation. Control strains harboring homologous duplications were largely but not entirely unaffected in mutant strains, suggesting specificity for the mismatched intermediates of homeologous recombination. In all strains, very few (< 10%) recombinants could be attributed to exceptional events. These results suggest that MSH2 and MSH3 can function differentially to control homeologous exchanges.

Competitive Genomic Screens of Barcoded Yeast Libraries

PubMed Central

Urbanus, Malene; Proctor, Michael; Heisler, Lawrence E.; Giaever, Guri; Nislow, Corey

2011-01-01

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode assays to newly sequenced, but poorly characterized microbes. To illustrate this approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000 - 1,000,000 gene-gene and drug-gene interactions in a single experiment. PMID:21860376

The MET13 Methylenetetrahydrofolate Reductase Gene Is Essential for Infection-Related Morphogenesis in the Rice Blast Fungus Magnaporthe oryzae

PubMed Central

Wang, Hong; Wang, Congcong; Li, Ya; Yue, Xiaofeng; Ma, Zhonghua; Talbot, Nicholas J.; Wang, Zhengyi

2013-01-01

Methylenetetrahydrofolate reductases (MTHFRs) play a key role in the biosynthesis of methionine in both prokaryotic and eukaryotic organisms. In this study, we report the identification of a novel T-DNA-tagged mutant WH672 in the rice blast fungus Magnaporthe oryzae, which was defective in vegetative growth, conidiation and pathogenicity. Analysis of the mutation confirmed a single T-DNA insertion upstream of MET13, which encodes a 626-amino-acid protein encoding a MTHFR. Targeted gene deletion of MET13 resulted in mutants that were non-pathogenic and significantly impaired in aerial growth and melanin pigmentation. All phenotypes associated with Δmet13 mutants could be overcome by addition of exogenous methionine. The M. oryzae genome contains a second predicted MTHFR-encoding gene, MET12. The deduced amino acid sequences of Met13 and Met12 share 32% identity. Interestingly, Δmet12 mutants produced significantly less conidia compared with the isogenic wild-type strain and grew very poorly in the absence of methionine, but were fully pathogenic. Deletion of both genes resulted in Δmet13Δmet12 mutants that showed similar phenotypes to single Δmet13 mutants. Taken together, we conclude that the MTHFR gene, MET13, is essential for infection-related morphogenesis by the rice blast fungus M. oryzae. PMID:24116181

A Pseudomonas putida double mutant deficient in butanol assimilation: a promising step for engineering a biological biofuel production platform.

PubMed

Cuenca, María Del Sol; Molina-Santiago, Carlos; Gómez-García, María R; Ramos, Juan L

2016-03-01

Biological production in heterologous hosts is of interest for the production of the C4 alcohol (butanol) and other chemicals. However, some hurdles need to be overcome in order to achieve an economically viable process; these include avoiding the consumption of butanol and maintaining tolerance to this solvent during production. Pseudomonas putida is a potential host for solvent production; in order to further adapt P. putida to this role, we generated mini-Tn5 mutant libraries in strain BIRD-1 that do not consume butanol. We analyzed the insertion site of the mini-Tn5 in a mutant that was deficient in assimilation of butanol using arbitrary PCR followed by Sanger sequencing and found that the transposon was inserted in the malate synthase B gene. Here, we show that in a second round of mutagenesis a double mutant unable to take up butanol had an insertion in a gene coding for a multisensor hybrid histidine kinase. The genetic context of the histidine kinase sensor revealed the presence of a set of genes potentially involved in butanol assimilation; qRT-PCR analysis showed induction of this set of genes in the wild type and the malate synthase mutant but not in the double mutant. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Enterococcus faecalis Constitutes an Unusual Bacterial Model in Lysozyme Resistance▿

PubMed Central

Hébert, Laurent; Courtin, Pascal; Torelli, Riccardo; Sanguinetti, Maurizio; Chapot-Chartier, Marie-Pierre; Auffray, Yanick; Benachour, Abdellah

2007-01-01

Lysozyme is an important and widespread compound of the host constitutive defense system, and it is assumed that Enterococcus faecalis is one of the few bacteria that are almost completely lysozyme resistant. On the basis of the sequence analysis of the whole genome of E. faecalis V583 strain, we identified two genes that are potentially involved in lysozyme resistance, EF_0783 and EF_1843. Protein products of these two genes share significant homology with Staphylococcus aureus peptidoglycan O-acetyltransferase (OatA) and Streptococcus pneumoniae N-acetylglucosamine deacetylase (PgdA), respectively. In order to determine whether EF_0783 and EF_1843 are involved in lysozyme resistance, we constructed their corresponding mutants and a double mutant. The ΔEF_0783 mutant and ΔEF_0783 ΔEF_1843 double mutant were shown to be more sensitive to lysozyme than the parental E. faecalis JH2-2 strain and ΔEF_1843 mutant were. However, compared to other bacteria, such as Listeria monocytogenes or S. pneumoniae, the tolerance of ΔEF_0783 and ΔEF_0783 ΔEF_1843 mutants towards lysozyme remains very high. Peptidoglycan structure analysis showed that EF_0783 modifies the peptidoglycan by O acetylation of N-acetyl muramic acid, while the EF_1843 deletion has no obvious effect on peptidoglycan structure under the same conditions. Moreover, the EF_0783 and EF_1843 deletions seem to significantly affect the ability of E. faecalis to survive within murine macrophages. In all, while EF_0783 is currently involved in the lysozyme resistance of E. faecalis, peptidoglycan O acetylation and de-N-acetylation are not the main mechanisms conferring high levels of lysozyme resistance to E. faecalis. PMID:17785473

ECB deacylase mutants

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Zhao, Huimin; Giver, Lorraine J.

2002-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Digital PCR for Detection and Quantification of Fluoroquinolone Resistance in Legionella pneumophila.

PubMed

Hennebique, Aurélie; Bidart, Marie; Jarraud, Sophie; Beraud, Laëtitia; Schwebel, Carole; Maurin, Max; Boisset, Sandrine

2017-09-01

The emergence of fluoroquinolone (FQ)-resistant mutants of Legionella pneumophila in infected humans was previously reported using a next-generation DNA sequencing (NGS) approach. This finding could explain part of the therapeutic failures observed in legionellosis patients treated with these antibiotics. The aim of this study was to develop digital PCR (dPCR) assays allowing rapid and accurate detection and quantification of these resistant mutants in respiratory samples, especially when the proportion of mutants in a wild-type background is low. We designed three dPCRgyrA assays to detect and differentiate the wild-type and one of the three gyrA mutations previously described as associated with FQ resistance in L. pneumophila : at positions 248C→T (T83I), 259G→A (D87N), and 259G→C (D87H). To assess the performance of these assays, mixtures of FQ-resistant and -susceptible strains of L. pneumophila were analyzed, and the results were compared with those obtained with Sanger DNA sequencing and real-time quantitative PCR (qPCR) technologies. The dPCRgyrA assays were able to detect mutated gyrA sequences in the presence of wild-type sequences at up to 1:1,000 resistant/susceptible allele ratios. By comparison, Sanger DNA sequencing and qPCR were less sensitive, allowing the detection of gyrA mutants at up to 1:1 and 1:10 ratios, respectively. When testing 38 respiratory samples from 23 legionellosis patients (69.6% treated with an FQ), dPCRgyrA detected small amounts of gyrA mutants in four (10.5%) samples from three (13.0%) patients. These results demonstrate that dPCR is a highly sensitive alternative to quantify FQ resistance in L. pneumophila , and it could be used in clinical practice to detect patients that could be at higher risk of therapeutic failure. Copyright © 2017 American Society for Microbiology.

Genetic analysis of biodegradation of tetralin by a Sphingomonas strain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hernaez, M.J.; Santero, E.; Reineke, W.

Tetralin (1,2,3,4-tetrahydronaphthalene) is produced for industrial purposes from naphthalene by catalytic hydrogenation or from anthracene by cracking. A strain designated TFA which very efficiently utilizes tetralin has been isolated from the Rhine river. The strain has been identified as Sphingomonas macrogoltabidus, based on 16S rDNA sequence similarity. Genetic analysis of tetralin biodegradation has been performed by insertion mutagenesis and by physical analysis and analysis of complementation between the mutants. The genes involved in tetralin utilization are clustered in a region of 9 kb, comprising at least five genes grouped in two divergently transcribed operons.

Identification and analysis of novel genes involved in gravitropism of Arabidopsis thaliana.

NASA Astrophysics Data System (ADS)

Morita, Miyo T.; Tasaka, Masao; Masatoshi Taniguchi, .

2012-07-01

Gravitropism is a continuous control with regard to the orientation and juxtaposition of the various parts of the plant body in response to gravity. In higher plants, the relative directional change of gravity is mainly suscepted in specialized cells called statocytes, followed by signal conversion from physical information into physiological information within the statocytes. We have studied the early process of shoot gravitropism, gravity sensing and signaling process, mainly by molecular genetic approach. In Arabidopsis shoot, statocytes are the endodermal cells. sgr1/scarcrow (scr) and sgr7/short-root (shr) mutants fail to form the endodermis and to respond to gravity in their inflorescence stems. Since both SGR1/SCR and SGR7/SHR are transcriptional factors, at least a subset of their downstream genes can be expected to be involved in gravitropism. In addition, eal1 (endodermal-amyloplast less 1), which exhibits no gravitropism in inflorescence stem but retains ability to form endodermis, is a hypomorphic allele of sgr7/shr. Take advantage of these mutants, we performed DNA microarray analysis and compared gene expression profiles between wild type and the mutants. We found that approx. 40 genes were commonly down-regulated in these mutants and termed them DGE (DOWN-REGULATED GENE IN EAL1) genes. DGE1 has sequence similarity to Oryza sativa LAZY1 that is involved in shoot gravitropism of rice. DGE2 has a short region homologous to DGE1. DTL (DGE TWO-LIKE}) that has 54% identity to DGE2 is found in Arabidopsis genome. All three genes are conserved in angiosperm but have no known functional domains or motifs. We analyzed T-DNA insertion for these genes in single or multiple combinations. In dge1 dge2 dtl triple mutant, gravitropic response of shoot, hypocotyl and root dramatically reduced. Now we are carrying out further physiological and molecular genetic analysis of the triple mutant.

Directed Evolution and Structural Analysis of Alkaline Pectate Lyase from the Alkaliphilic Bacterium Bacillus sp. Strain N16-5 To Improve Its Thermostability for Efficient Ramie Degumming.

PubMed

Zhou, Cheng; Ye, Jintong; Xue, Yanfen; Ma, Yanhe

2015-09-01

Thermostable alkaline pectate lyases have potential applications in the textile industry as an alternative to chemical-based ramie degumming processes. In particular, the alkaline pectate lyase from Bacillus sp. strain N16-5 (BspPelA) has potential for enzymatic ramie degumming because of its high specific activity under extremely alkaline conditions without the requirement for additional Ca(2+). However, BspPelA displays poor thermostability and is inactive after incubation at 50°C for only 30 min. Here, directed evolution was used to improve the thermostability of BspPelA for efficient and stable degumming. After two rounds of error-prone PCR and screening of >12,000 mutants, 10 mutants with improved thermostability were obtained. Sequence analysis and site-directed mutagenesis revealed that single E124I, T178A, and S271G substitutions were responsible for improving thermostability. Structural and molecular dynamic simulation analysis indicated that the formation of a hydrophobic cluster and new H-bond networks was the key factor contributing to the improvement in thermostability with these three substitutions. The most thermostable combined mutant, EAET, exhibited a 140-fold increase in the t50 (time at which the enzyme loses 50% of its initial activity) value at 50°C, accompanied by an 84.3% decrease in activity compared with that of wild-type BspPelA, while the most advantageous combined mutant, EA, exhibited a 24-fold increase in the t50 value at 50°C, with a 23.3% increase in activity. Ramie degumming with the EA mutant was more efficient than that with wild-type BspPelA. Collectively, our results suggest that the EA mutant, exhibiting remarkable improvements in thermostability and activity, has the potential for applications in ramie degumming in the textile industry. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Directed Evolution and Structural Analysis of Alkaline Pectate Lyase from the Alkaliphilic Bacterium Bacillus sp. Strain N16-5 To Improve Its Thermostability for Efficient Ramie Degumming

PubMed Central

Zhou, Cheng; Ye, Jintong; Xue, Yanfen

2015-01-01

Thermostable alkaline pectate lyases have potential applications in the textile industry as an alternative to chemical-based ramie degumming processes. In particular, the alkaline pectate lyase from Bacillus sp. strain N16-5 (BspPelA) has potential for enzymatic ramie degumming because of its high specific activity under extremely alkaline conditions without the requirement for additional Ca2+. However, BspPelA displays poor thermostability and is inactive after incubation at 50°C for only 30 min. Here, directed evolution was used to improve the thermostability of BspPelA for efficient and stable degumming. After two rounds of error-prone PCR and screening of >12,000 mutants, 10 mutants with improved thermostability were obtained. Sequence analysis and site-directed mutagenesis revealed that single E124I, T178A, and S271G substitutions were responsible for improving thermostability. Structural and molecular dynamic simulation analysis indicated that the formation of a hydrophobic cluster and new H-bond networks was the key factor contributing to the improvement in thermostability with these three substitutions. The most thermostable combined mutant, EAET, exhibited a 140-fold increase in the t50 (time at which the enzyme loses 50% of its initial activity) value at 50°C, accompanied by an 84.3% decrease in activity compared with that of wild-type BspPelA, while the most advantageous combined mutant, EA, exhibited a 24-fold increase in the t50 value at 50°C, with a 23.3% increase in activity. Ramie degumming with the EA mutant was more efficient than that with wild-type BspPelA. Collectively, our results suggest that the EA mutant, exhibiting remarkable improvements in thermostability and activity, has the potential for applications in ramie degumming in the textile industry. PMID:26070675

Cloning, Sequencing, and Characterization of the cgmB Gene of Sinorhizobium meliloti Involved in Cyclic β-Glucan Biosynthesis

PubMed Central

Wang, Ping; Ingram-Smith, Cheryl; Hadley, Jill A.; Miller, Karen J.

1999-01-01

Periplasmic cyclic β-glucans of Rhizobium species provide important functions during plant infection and hypo-osmotic adaptation. In Sinorhizobium meliloti (also known as Rhizobium meliloti), these molecules are highly modified with phosphoglycerol and succinyl substituents. We have previously identified an S. meliloti Tn5 insertion mutant, S9, which is specifically impaired in its ability to transfer phosphoglycerol substituents to the cyclic β-glucan backbone (M. W. Breedveld, J. A. Hadley, and K. J. Miller, J. Bacteriol. 177:6346–6351, 1995). In the present study, we have cloned, sequenced, and characterized this mutation at the molecular level. By using the Tn5 flanking sequences (amplified by inverse PCR) as a probe, an S. meliloti genomic library was screened, and two overlapping cosmid clones which functionally complement S9 were isolated. A 3.1-kb HindIII-EcoRI fragment found in both cosmids was shown to fully complement mutant S9. Furthermore, when a plasmid containing this 3.1-kb fragment was used to transform Rhizobium leguminosarum bv. trifolii TA-1JH, a strain which normally synthesizes only neutral cyclic β-glucans, anionic glucans containing phosphoglycerol substituents were produced, consistent with the functional expression of an S. meliloti phosphoglycerol transferase gene. Sequence analysis revealed the presence of two major, overlapping open reading frames within the 3.1-kb fragment. Primer extension analysis revealed that one of these open reading frames, ORF1, was transcribed and its transcription was osmotically regulated. This novel locus of S. meliloti is designated the cgm (cyclic glucan modification) locus, and the product encoded by ORF1 is referred to as CgmB. PMID:10419956

Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

PubMed

Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

2017-12-01

Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Characterization of a New Pink-Fruited Tomato Mutant Results in the Identification of a Null Allele of the SlMYB12 Transcription Factor.

PubMed

Fernandez-Moreno, Josefina-Patricia; Tzfadia, Oren; Forment, Javier; Presa, Silvia; Rogachev, Ilana; Meir, Sagit; Orzaez, Diego; Aharoni, Aspah; Granell, Antonio

2016-07-01

The identification and characterization of new tomato (Solanum lycopersicum) mutants affected in fruit pigmentation and nutritional content can provide valuable insights into the underlying biology, as well as a source of new alleles for breeding programs. To date, all characterized pink-pigmented tomato fruit mutants appear to result from low SlMYB12 transcript levels in the fruit skin. Two new mutant lines displaying a pink fruit phenotype (pf1 and pf2) were characterized in this study. In the pf mutants, SlMYB12 transcripts accumulated to wild-type levels but exhibited the same truncation, which resulted in the absence of the essential MYB activation domain coding region. Allelism and complementation tests revealed that both pf mutants were allelic to the y locus and showed the same recessive null allele in homozygosis: Δy A set of molecular and metabolic effects, reminiscent of those observed in the Arabidopsis (Arabidopsis thaliana) myb11 myb12 myb111 triple mutant, were found in the tomato Δy mutants. To our knowledge, these have not been described previously, and our data support the idea of their being null mutants, in contrast to previously described transcriptional hypomorphic pink fruit lines. We detected a reduction in the expression of several flavonol glycosides and some associated glycosyl transferases. Transcriptome analysis further revealed that the effects of the pf mutations extended beyond the flavonoid pathway into the interface between primary and secondary metabolism. Finally, screening for Myb-binding sites in the candidate gene promoter sequences revealed that 141 of the 152 co-down-regulated genes may be direct targets of SlMYB12 regulation. © 2016 American Society of Plant Biologists. All Rights Reserved.

Mutant fatty acid desaturase

DOEpatents

Shanklin, John; Cahoon, Edgar B.

2004-02-03

The present invention relates to a method for producing mutants of a fatty acid desaturase having a substantially increased activity towards fatty acid substrates with chains containing fewer than 18 carbons relative to an unmutagenized precursor desaturase having an 18 carbon atom chain length substrate specificity. The method involves inducing one or more mutations in the nucleic acid sequence encoding the precursor desaturase, transforming the mutated sequence into an unsaturated fatty acid auxotroph cell such as MH13 E. coli, culturing the cells in the absence of supplemental unsaturated fatty acids, thereby selecting for recipient cells which have received and which express a mutant fatty acid desaturase with an elevated specificity for fatty acid substrates having chain lengths of less than 18 carbon atoms. A variety of mutants having 16 or fewer carbon atom chain length substrate specificities are produced by this method. Mutant desaturases produced by this method can be introduced via expression vectors into prokaryotic and eukaryotic cells and can also be used in the production of transgenic plants which may be used to produce specific fatty acid products.

Bypassing bacterial infection in phage display by sequencing DNA released from phage particles.

PubMed

Villequey, Camille; Kong, Xu-Dong; Heinis, Christian

2017-11-01

Phage display relies on a bacterial infection step in which the phage particles are replicated to perform multiple affinity selection rounds and to enable the identification of isolated clones by DNA sequencing. While this process is efficient for wild-type phage, the bacterial infection rate of phage with mutant or chemically modified coat proteins can be low. For example, a phage mutant with a disulfide-free p3 coat protein, used for the selection of bicyclic peptides, has a more than 100-fold reduced infection rate compared to the wild-type. A potential strategy for bypassing the bacterial infection step is to directly sequence DNA extracted from phage particles after a single round of phage panning using high-throughput sequencing. In this work, we have quantified the fraction of phage clones that can be identified by directly sequencing DNA from phage particles. The results show that the DNA of essentially all of the phage particles can be 'decoded', and that the sequence coverage for mutants equals that of amplified DNA extracted from cells infected with wild-type phage. This procedure is particularly attractive for selections with phage that have a compromised infection capacity, and it may allow phage display to be performed with particles that are not infective at all. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Characterization and genetic mapping of a Photoperiod-sensitive dwarf 1 locus in rice (Oryza sativa L.).

PubMed

Li, Riqing; Xia, Jixing; Xu, Yiwei; Zhao, Xiucai; Liu, Yao-Guang; Chen, Yuanling

2014-01-01

Plant height is an important agronomic trait for crop architecture and yield. Most known factors determining plant height function in gibberellin or brassinosteroid biosynthesis or signal transduction. Here, we report a japonica rice (Oryza sativa ssp. japonica) dominant dwarf mutant, Photoperiod-sensitive dwarf 1 (Psd1). The Psd1 mutant showed impaired cell division and elongation, and a severe dwarf phenotype under long-day conditions, but nearly normal growth in short-day. The plant height of Psd1 mutant could not be rescued by gibberellin or brassinosteroid treatment. Genetic analysis with R1 and F2 populations determined that Psd1 phenotype was controlled by a single dominant locus. Linkage analysis with 101 tall F2 plants grown in a long-day season, which were derived from a cross between Psd1 and an indica cultivar, located Psd1 locus on chromosome 1. Further fine-mapping with 1017 tall F2 plants determined this locus on an 11.5-kb region. Sequencing analysis of this region detected a mutation site in a gene encoding a putative lipid transfer protein; the mutation produces a truncated C-terminus of the protein. This study establishes the genetic foundation for understanding the molecular mechanisms regulating plant cell division and elongation mediated by interaction between genetic and environmental factors.

Transcriptome profiling of a Saccharomyces cerevisiae mutant with a constitutively activated Ras/cAMP pathway.

PubMed

Jones, D L; Petty, J; Hoyle, D C; Hayes, A; Ragni, E; Popolo, L; Oliver, S G; Stateva, L I

2003-12-16

Often changes in gene expression levels have been considered significant only when above/below some arbitrarily chosen threshold. We investigated the effect of applying a purely statistical approach to microarray analysis and demonstrated that small changes in gene expression have biological significance. Whole genome microarray analysis of a pde2Delta mutant, constructed in the Saccharomyces cerevisiae reference strain FY23, revealed altered expression of approximately 11% of protein encoding genes. The mutant, characterized by constitutive activation of the Ras/cAMP pathway, has increased sensitivity to stress, reduced ability to assimilate nonfermentable carbon sources, and some cell wall integrity defects. Applying the Munich Information Centre for Protein Sequences (MIPS) functional categories revealed increased expression of genes related to ribosome biogenesis and downregulation of genes in the cell rescue, defense, cell death and aging category, suggesting a decreased response to stress conditions. A reduced level of gene expression in the unfolded protein response pathway (UPR) was observed. Cell wall genes whose expression was affected by this mutation were also identified. Several of the cAMP-responsive orphan genes, upon further investigation, revealed cell wall functions; others had previously unidentified phenotypes assigned to them. This investigation provides a statistical global transcriptome analysis of the cellular response to constitutive activation of the Ras/cAMP pathway.

Gaussian decomposition of high-resolution melt curve derivatives for measuring genome-editing efficiency

PubMed Central

Zaboikin, Michail; Freter, Carl

2018-01-01

We describe a method for measuring genome editing efficiency from in silico analysis of high-resolution melt curve data. The melt curve data derived from amplicons of genome-edited or unmodified target sites were processed to remove the background fluorescent signal emanating from free fluorophore and then corrected for temperature-dependent quenching of fluorescence of double-stranded DNA-bound fluorophore. Corrected data were normalized and numerically differentiated to obtain the first derivatives of the melt curves. These were then mathematically modeled as a sum or superposition of minimal number of Gaussian components. Using Gaussian parameters determined by modeling of melt curve derivatives of unedited samples, we were able to model melt curve derivatives from genetically altered target sites where the mutant population could be accommodated using an additional Gaussian component. From this, the proportion contributed by the mutant component in the target region amplicon could be accurately determined. Mutant component computations compared well with the mutant frequency determination from next generation sequencing data. The results were also consistent with our earlier studies that used difference curve areas from high-resolution melt curves for determining the efficiency of genome-editing reagents. The advantage of the described method is that it does not require calibration curves to estimate proportion of mutants in amplicons of genome-edited target sites. PMID:29300734

Sdt97: A Point Mutation in the 5′ Untranslated Region Confers Semidwarfism in Rice

PubMed Central

Tong, Jiping; Han, Zhengshu; Han, Aonan; Liu, Xuejun; Zhang, Shiyong; Fu, Binying; Hu, Jun; Su, Jingping; Li, Shaoqing; Wang, Shengjun; Zhu, Yingguo

2016-01-01

Semidwarfism is an important agronomic trait in rice breeding programs. The semidwarf mutant gene Sdt97 was previously described. However, the molecular mechanism underlying the mutant is yet to be elucidated. In this study, we identified the mutant gene by a map-based cloning method. Using a residual heterozygous line (RHL) population, Sdt97 was mapped to the long arm of chromosome 6 in the interval of nearly 60 kb between STS marker N6 and SNP marker N16 within the PAC clone P0453H04. Sequencing of the candidate genes in the target region revealed that a base transversion from G to C occurred in the 5′ untranslated region of Sdt97. qRT-PCR results confirmed that the transversion induced an obvious change in the expression pattern of Sdt97 at different growth and developmental stages. Plants transgenic for Sdt97 resulted in the restoration of semidwarfism of the mutant phenotype, or displayed a greater dwarf phenotype than the mutant. Our results indicate that a point mutation in the 5′ untranslated region of Sdt97 confers semidwarfism in rice. Functional analysis of Sdt97 will open a new field of study for rice semidwarfism, and also expand our knowledge of the molecular mechanism of semidwarfism in rice. PMID:27172200

Identification and characterization of a prevalent hepatitis B virus X protein mutant in Taiwanese patients with hepatocellular carcinoma.

PubMed

Yeh, C T; Shen, C H; Tai, D I; Chu, C M; Liaw, Y F

2000-11-02

The aim of this study was to investigate whether there was a particular hepatitis B virus (HBV) X protein (HBx) mutant associated with Taiwanese patients with hepatocellular carcinoma (HCC). Initially, the entire coding region of HBx gene from the serum samples of 14 Taiwanese patients were sequenced. A novel mutant, HBx-A31, was preferentially found in patients with HCC. Sera from 67 patients with HCC and 100 patients with chronic hepatitis B were thus subjected for codon 31 analysis using a dual amplification created restriction site method. HBx-A31 was detected more frequently in patients with HCC (52% versus 12%; P<0.001) and in patients with liver cirrhosis (44% versus 6%; P<0.001). Site directed mutagenesis experiment revealed that HBx-A31 was less effective in transactivating HBV enhancer I-X promoter complex, less efficient in supporting HBV replication, and less potent in enhancing TNF-alpha induced increment of CPP32/caspase 3 activities in HepG2 cells. In conclusion, a prevalent HBx mutant was identified in Taiwanese patients with hepatocellular carcinoma. Development of this mutant might represent a strategy of the virus to escape immune surveillance and thus contribute to the process of multiple-step hepatocarcinogenesis.

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

1991-02-15

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

An unbiased adaptive sampling algorithm for the exploration of RNA mutational landscapes under evolutionary pressure.

PubMed

Waldispühl, Jérôme; Ponty, Yann

2011-11-01

The analysis of the relationship between sequences and structures (i.e., how mutations affect structures and reciprocally how structures influence mutations) is essential to decipher the principles driving molecular evolution, to infer the origins of genetic diseases, and to develop bioengineering applications such as the design of artificial molecules. Because their structures can be predicted from the sequence data only, RNA molecules provide a good framework to study this sequence-structure relationship. We recently introduced a suite of algorithms called RNAmutants which allows a complete exploration of RNA sequence-structure maps in polynomial time and space. Formally, RNAmutants takes an input sequence (or seed) to compute the Boltzmann-weighted ensembles of mutants with exactly k mutations, and sample mutations from these ensembles. However, this approach suffers from major limitations. Indeed, since the Boltzmann probabilities of the mutations depend of the free energy of the structures, RNAmutants has difficulties to sample mutant sequences with low G+C-contents. In this article, we introduce an unbiased adaptive sampling algorithm that enables RNAmutants to sample regions of the mutational landscape poorly covered by classical algorithms. We applied these methods to sample mutations with low G+C-contents. These adaptive sampling techniques can be easily adapted to explore other regions of the sequence and structural landscapes which are difficult to sample. Importantly, these algorithms come at a minimal computational cost. We demonstrate the insights offered by these techniques on studies of complete RNA sequence structures maps of sizes up to 40 nucleotides. Our results indicate that the G+C-content has a strong influence on the size and shape of the evolutionary accessible sequence and structural spaces. In particular, we show that low G+C-contents favor the apparition of internal loops and thus possibly the synthesis of tertiary structure motifs. On the other hand, high G+C-contents significantly reduce the size of the evolutionary accessible mutational landscapes.

A novel mutation in HESX1 causes combined pituitary hormone deficiency without septo optic dysplasia phenotypes.

PubMed

Takagi, Masaki; Takahashi, Mai; Ohtsu, Yoshiaki; Sato, Takeshi; Narumi, Satoshi; Arakawa, Hirokazu; Hasegawa, Tomonobu

2016-04-25

Heterozygous and/or homozygous HESX1 mutations have been reported to cause isolated growth hormone deficiency (IGHD) or combined pituitary hormone deficiency (CPHD), in association with septo optic dysplasia (SOD). We report a novel heterozygous HESX1 mutation in a CPHD patient without SOD phenotypes. The propositus was a one-year-old Japanese girl. Shortly after birth, she was found to be hypoglycemic. She was diagnosed with central adrenal insufficiency based on low cortisol and ACTH at a time of severe hypoglycemia. Further endocrine studies indicated that the patient also had central hypothyroidism and growth hormone deficiency. Using a next-generation sequencing strategy, we identified a novel heterozygous HESX1 mutation, c.326G>A (p.Arg109Gln). Western blotting and subcellular localization revealed no significant difference between wild type and mutant HESX1. Electrophoretic mobility shift assays showed that the mutant HESX1 abrogated DNA-binding ability. Mutant HESX1 was unable to repress PROP1-mediated activation. In conclusion, this study identified Arg109 as a critical residue in the HESX1 protein and extends our understanding of the phenotypic features, molecular mechanism, and developmental course associated with mutations in HESX1. When multiple genes need to be analyzed for mutations simultaneously, targeted sequence analysis of interesting genomic regions is an attractive approach.

DNA analysis of herbarium Specimens of the grass weed Alopecurus myosuroides reveals herbicide resistance pre-dated herbicides.

PubMed

Délye, Christophe; Deulvot, Chrystel; Chauvel, Bruno

2013-01-01

Acetyl-CoA carboxylase (ACCase) alleles carrying one point mutation that confers resistance to herbicides have been identified in arable grass weed populations where resistance has evolved under the selective pressure of herbicides. In an effort to determine whether herbicide resistance evolves from newly arisen mutations or from standing genetic variation in weed populations, we used herbarium specimens of the grass weed Alopecurus myosuroides to seek mutant ACCase alleles carrying an isoleucine-to-leucine substitution at codon 1781 that endows herbicide resistance. These specimens had been collected between 1788 and 1975, i.e., prior to the commercial release of herbicides inhibiting ACCase. Among the 734 specimens investigated, 685 yielded DNA suitable for PCR. Genotyping the ACCase locus using the derived Cleaved Amplified Polymorphic Sequence (dCAPS) technique identified one heterozygous mutant specimen that had been collected in 1888. Occurrence of a mutant codon encoding a leucine residue at codon 1781 at the heterozygous state was confirmed in this specimen by sequencing, clearly demonstrating that resistance to herbicides can pre-date herbicides in weeds. We conclude that point mutations endowing resistance to herbicides without having associated deleterious pleiotropic effects can be present in weed populations as part of their standing genetic variation, in frequencies higher than the mutation frequency, thereby facilitating their subsequent selection by herbicide applications.

The AWA1 Gene Is Required for the Foam-Forming Phenotype and Cell Surface Hydrophobicity of Sake Yeast

PubMed Central

Shimoi, Hitoshi; Sakamoto, Kazutoshi; Okuda, Masaki; Atthi, Ratchanee; Iwashita, Kazuhiro; Ito, Kiyoshi

2002-01-01

Sake, a traditional alcoholic beverage in Japan, is brewed with sake yeasts, which are classified as Saccharomyces cerevisiae. Almost all sake yeasts form a thick foam layer on sake mash during the fermentation process because of their cell surface hydrophobicity, which increases the cells' affinity for bubbles. To reduce the amount of foam, nonfoaming mutants were bred from foaming sake yeasts. Nonfoaming mutants have hydrophilic cell surfaces and no affinity for bubbles. We have cloned a gene from a foam-forming sake yeast that confers foaming ability to a nonfoaming mutant. This gene was named AWA1 and structures of the gene and its product were analyzed. The N- and C-terminal regions of Awa1p have the characteristic sequences of a glycosylphosphatidylinositol anchor protein. The entire protein is rich in serine and threonine residues and has a lot of repetitive sequences. These results suggest that Awa1p is localized in the cell wall. This was confirmed by immunofluorescence microscopy and Western blotting analysis using hemagglutinin-tagged Awa1p. Moreover, an awa1 disruptant of sake yeast was hydrophilic and showed a nonfoaming phenotype in sake mash. We conclude that Awa1p is a cell wall protein and is required for the foam-forming phenotype and the cell surface hydrophobicity of sake yeast. PMID:11916725

Conformational analysis of the N-terminal sequence Met1 Val60 of the tyrosine hydroxylase

NASA Astrophysics Data System (ADS)

Alieva, Irada N.; Mustafayeva, Narmina N.; Gojayev, Niftali M.

2006-03-01

Molecular mechanics method and molecular dynamics (MD) simulation techniques are used to study the behavior and the effect of the amino acids substitution on structure and molecular dynamics of the specific portion of Met1-Val60 amino acid residues from N-terminal regulatory domain of the tyrosine hydroxylase (TH) and its mutants in which the positively charged arginine residues at positions 37 and 38 were replaced by electrically neutral Gly and negatively charged Glu, and serine residue at position 40 was replaced by Ala or Asp residue. Our study allowed us to make the following conclusions: (i) the higher conformational flexibility of the Met1-Arg16 sequence is revealed in comparision to other part of the N-terminus; (ii) the stretch of amino acid residues Met30-Ser40 within the N-terminus forms β-turn so that two α-helices (residues 16-29 and residues 41-60) are paralel one another; (ii) the significant differences that are observed for the Arg37→Gly37, Arg37-Arg38→Glu37-Glu38 mutant segments indicates that the positive charge of the Arg37 and Arg38 residues is one of the main factor that maintains the characteristic of the turn; (ii) no major conformational changes are observed between Ser40→Ala40, and Ser40→Asp40 mutant segments.

Quasispecies characters of hepatitis B virus in immunoprophylaxis failure infants.

PubMed

Wang, Xin; Deng, Wanyan; Qian, Keli; Deng, Haijun; Huang, Yong; Tu, Zeng; Huang, Ailong; Long, Quanxin

2018-06-01

Hepatitis B vaccination prevents 80-95% of transmission and reduces the incidence of HBV in children. The variations in the a determinant of HBV surface antigen (HBsAg) have been reported to be the most prevalent cause for vaccine or antibody escape. There is a conflicting evidence on as to whether escape mutants arise de novo in infected infants or whether the mutants, that have preexisted maternally, subsequently undergo selective replication in the infant under immune pressure. Here, we report that nearly 65% (55 of 85) vaccination failure in child patients has no amino acid substitution in a determinant as seen by Sanger sequencing. We further employed an Illumina sequencing platform-based method to detect HBV quasispecies in four immunoprophylaxis failure infants and their mothers. In our data, the substitution rate of amino acid located at a determinant is relatively low (< 10%), I/T126A, C124S, F134Y, K141Q, Q129H, D144A, G145V, and N146K, which showed no statistical difference to their mothers, proving that these vaccine escape mutants preexist maternally as minor variants. Besides that, bioinformatical analysis showed that the binding affinity of high variation epitopes (amino acid divergence in mother and their infants > 20%) to related HLA molecules was generally decreased, these traces of immune escape suggesting that immune pressure was present and was effective in all samples.

Functional display of platelet-binding VWF fragments on filamentous bacteriophage.

PubMed

Yee, Andrew; Tan, Fen-Lai; Ginsburg, David

2013-01-01

von Willebrand factor (VWF) tethers platelets to sites of vascular injury via interaction with the platelet surface receptor, GPIb. To further define the VWF sequences required for VWF-platelet interaction, a phage library displaying random VWF protein fragments was screened against formalin-fixed platelets. After 3 rounds of affinity selection, DNA sequencing of platelet-bound clones identified VWF peptides mapping exclusively to the A1 domain. Aligning these sequences defined a minimal, overlapping segment spanning P1254-A1461, which encompasses the C1272-C1458 cystine loop. Analysis of phage carrying a mutated A1 segment (C1272/1458A) confirmed the requirement of the cystine loop for optimal binding. Four rounds of affinity maturation of a randomly mutagenized A1 phage library identified 10 and 14 unique mutants associated with enhanced platelet binding in the presence and absence of botrocetin, respectively, with 2 mutants (S1370G and I1372V) common to both conditions. These results demonstrate the utility of filamentous phage for studying VWF protein structure-function and identify a minimal, contiguous peptide that bind to formalin-fixed platelets, confirming the importance of the VWF A1 domain with no evidence for another independently platelet-binding segment within VWF. These findings also point to key structural elements within the A1 domain that regulate VWF-platelet adhesion.

A zebra-band phenotype in maize can be suppressed in constant light, and results from mutation of a PPOXlike gene (protophorphyrinogen oxidase IX-like) for porphyrin biosynthesis

USDA-ARS?s Scientific Manuscript database

A zebra-band phenotype was identified in a maize population of transposon-tagged mutants (UniformMu, searchable by sequence at MaizeGDB.org). Genotype-phenotype analysis of an F2 family showed that the zebra stripes co-segregated with a single Mu insertion in the second exon of a Protoporphyrinogen ...

Leptin gene promoter DNA methylation in WNIN obese mutant rats

PubMed Central

2014-01-01

Background Obesity has become an epidemic in worldwide population. Leptin gene defect could be one of the causes for obesity. Two mutant obese rats WNIN/Ob and WNIN/GROb, isolated at National Centre for Laboratory Animal Sciences (NCLAS), Hyderabad, India, were found to be leptin resistant. The present study aims to understand the regulatory mechanisms underlying the resistance by promoter DNA methylation of leptin gene in these mutant obese rats. Methods Male obese mutant homozygous, carrier and heterozygous rats of WNIN/Ob and WNIN/GROb strain of 6 months old were studied to check the leptin gene expression (RT-PCR) and promoter DNA methylation (MassARRAY Compact system, SEQUENOM) of leptin gene by invivo and insilico approach. Results Homozygous WNIN/Ob and WNIN/GROb showed significantly higher leptin gene expression compared to carrier and lean counterparts. Leptin gene promoter DNA sequence region was analyzed ranging from transcription start site (TSS) to-550 bp length and found four CpGs in this sequence among them only three CpG loci (-309, -481, -502) were methylated in these WNIN mutant rat phenotypes. Conclusion The increased percentage of methylation in WNIN mutant lean and carrier phenotypes is positively correlated with transcription levels. Thus genetic variation may have effect on methylation percentages and subsequently on the regulation of leptin gene expression which may lead to obesity in these obese mutant rat strains. PMID:24495350

Limits of transforming competence of SV40 nuclear and cytoplasmic large T mutants with altered Rb binding sequences.

PubMed

Tedesco, D; Fischer-Fantuzzi, L; Vesco, C

1993-03-01

Multiple amino acid substitutions were introduced into the SV40 large T region that harbors the retinoblastoma protein (Rb) binding site and the nuclear transport signal, changing either one or both of these determinants. Mutant activities were examined in a set of assays allowing different levels of transforming potential to be distinguished; phenotypic changes in established and pre-crisis rat embryo fibroblasts (REFs) were detected under isogenic cell conditions, and comparisons made with other established rodent cells. The limit of the transforming ability of mutants with important substitutions in the Rb binding site fell between two transformation levels of the same established rat cells. Such cells could be induced to form dense foci but not agar colonies (their parental pre-crises REFs, as expected, were untransformed either way). Nonetheless, agar colony induction was possible in other cell lines, such as mouse NIH3T3 and (for one of the mutants) rat F2408. All these mutants efficiently immortalized pre-crisis REFs. The transforming ability of cytoplasmic mutants appeared to depend on the integrity of the Rb-binding sequence to approximately the same extent as that of the wild-type large T, although evidence of in vivo Rb-cytoplasmic large T complexes was not found. The presence or absence of small t was critical when the transforming task of mutants was near the limit of their abilities.

Complementation of a red-light-indifferent cyanobacterial mutant.

PubMed Central

Chiang, G G; Schaefer, M R; Grossman, A R

1992-01-01

Many cyanobacteria alter their phycobilisome composition in response to changes in light wavelength in a process termed complementary chromatic adaptation. Mutant strains FdR1 and FdR2 of the filamentous cyanobacterium Fremyella diplosiphon are characterized by aberrant chromatic adaptation. Instead of adjusting to different wavelengths of light, FdR1 and FdR2 behave as if they are always in green light; they do not respond to red light. We have previously reported complementation of FdR1 by conjugal transfer of a wild-type genomic library. The complementing DNA has now been localized by genetic analysis to a region on the rescued genomic subclone that contains a gene designated rcaC. This region of DNA is also able to complement FdR2. Southern blot analysis of genomic DNA from FdR1 and FdR2 indicates that these strains harbor DNA insertions within the rcaC sequence that may have resulted from the activity of transposable genetic elements. The predicted amino acid sequence of RcaC shares strong identity to response regulators of bacterial two-component regulatory systems. This relationship is discussed in the context of the signal-transduction pathway mediating regulation of genes encoding phycobilisome polypeptides during chromatic adaptation. Images PMID:1409650

Whole Genome Re-Sequencing Identifies a Quantitative Trait Locus Repressing Carbon Reserve Accumulation during Optimal Growth in Chlamydomonas reinhardtii

PubMed Central

Goold, Hugh Douglas; Nguyen, Hoa Mai; Kong, Fantao; Beyly-Adriano, Audrey; Légeret, Bertrand; Billon, Emmanuelle; Cuiné, Stéphan; Beisson, Fred; Peltier, Gilles; Li-Beisson, Yonghua

2016-01-01

Microalgae have emerged as a promising source for biofuel production. Massive oil and starch accumulation in microalgae is possible, but occurs mostly when biomass growth is impaired. The molecular networks underlying the negative correlation between growth and reserve formation are not known. Thus isolation of strains capable of accumulating carbon reserves during optimal growth would be highly desirable. To this end, we screened an insertional mutant library of Chlamydomonas reinhardtii for alterations in oil content. A mutant accumulating five times more oil and twice more starch than wild-type during optimal growth was isolated and named constitutive oil accumulator 1 (coa1). Growth in photobioreactors under highly controlled conditions revealed that the increase in oil and starch content in coa1 was dependent on light intensity. Genetic analysis and DNA hybridization pointed to a single insertional event responsible for the phenotype. Whole genome re-sequencing identified in coa1 a >200 kb deletion on chromosome 14 containing 41 genes. This study demonstrates that, 1), the generation of algal strains accumulating higher reserve amount without compromising biomass accumulation is feasible; 2), light is an important parameter in phenotypic analysis; and 3), a chromosomal region (Quantitative Trait Locus) acts as suppressor of carbon reserve accumulation during optimal growth. PMID:27141848

Transposon mutagenesis of Xylella fastidiosa by electroporation of Tn5 synaptic complexes.

PubMed

Guilhabert, M R; Hoffman, L M; Mills, D A; Kirkpatrick, B C

2001-06-01

Pierce's disease, a lethal disease of grapevine, is caused by Xylella fastidiosa, a gram-negative, xylem-limited bacterium that is transmitted from plant to plant by xylem-feeding insects. Strains of X. fastidiosa also have been associated with diseases that cause tremendous losses in many other economically important plants, including citrus. Although the complete genome sequence of X. fastidiosa has recently been determined, the inability to transform or produce transposon mutants of X. fastidiosa has been a major impediment to understanding pathogen-, plant-, and insect-vector interactions. We evaluated the ability of four different suicide vectors carrying either Tn5 or Tn10 transposons as well as a preformed Tn5 transposase-transposon synaptic complex (transposome) to transpose X. fastidiosa. The four suicide vectors failed to produce any detectable transposition events. Electroporation of transposomes, however, yielded 6 x 10(3) and 4 x 10(3) Tn5 mutants per microg of DNA in two different grapevine strains of X. fastidiosa. Molecular analysis showed that the transposition insertions were single, independent, stable events. Sequence analysis of the Tn5 insertion sites indicated that the transpositions occur randomly in the X. fastidiosa genome. Transposome-mediated mutagenesis should facilitate the identification of X. fastidiosa genes that mediate plant pathogenicity and insect transmission.

Surface gene variants of hepatitis B Virus in Saudi Patients.

PubMed

Al-Qudari, Ahmed Y; Amer, Haitham M; Abdo, Ayman A; Hussain, Zahid; Al-Hamoudi, Waleed; Alswat, Khalid; Almajhdi, Fahad N

2016-01-01

Hepatitis B virus (HBV) continues to be one of the most important viral pathogens in humans. Surface (S) protein is the major HBV antigen that mediates virus attachment and entry and determines the virus subtype. Mutations in S gene, particularly in the "a" determinant, can influence virus detection by ELISA and may generate escape mutants. Since no records have documented the S gene mutations in HBV strains circulating in Saudi Arabia, the current study was designed to study sequence variation of S gene in strains circulating in Saudi Arabia and its correlation with clinical and risk factors. A total of 123 HBV-infected patients were recruited for this study. Clinical and biochemical parameters, serological markers, and viral load were determined in all patients. The entire S gene sequence of samples with viral load exceeding 2000 IU/mL was retrieved and exploited in sequence and phylogenetic analysis. A total of 48 mutations (21 unique) were recorded in viral strains in Saudi Arabia, among which 24 (11 unique) changed their respective amino acids. Two amino acid changes were recorded in "a" determinant, including F130L and S135F with no evidence of the vaccine escape mutant G145R in any of the samples. No specific relationship was recognized between the mutation/amino acid change record of HBsAg in strains in Saudi Arabia and clinical or laboratory data. Phylogenetic analysis categorized HBV viral strains in Saudi Arabia as members of subgenotypes D1 and D3. The present report is the first that describes mutation analysis of HBsAg in strains in Saudi Arabia on both nucleotide and amino acid levels. Different substitutions, particularly in major hydrophilic region, may have a potential influence on disease diagnosis, vaccination strategy, and antiviral chemotherapy.

tassel-less1 encodes a boron channel protein required for inflorescence development in maize.

PubMed

Leonard, April; Holloway, Beth; Guo, Mei; Rupe, Mary; Yu, GongXin; Beatty, Mary; Zastrow-Hayes, Gina; Meeley, Robert; Llaca, Victor; Butler, Karlene; Stefani, Tony; Jaqueth, Jennifer; Li, Bailin

2014-06-01

tassel-less1 (tls1) is a classical maize (Zea mays) inflorescence mutant. Homozygous mutant plants have no tassels or very small tassels, and ear development is also impaired. Using a positional cloning approach, ZmNIP3;1 (a NOD26-like intrinsic protein) was identified as the candidate gene for tls1. The ZmNIP3;1 gene is completely deleted in the tls1 mutant genome. Two Mutator-insertional TUSC alleles of ZmNIP3;1 exhibited tls1-like phenotypes, and allelism tests confirmed that the tls1 gene encodes ZmNIP3;1. Transgenic plants with an RNA interference (RNAi) construct to down-regulate ZmNIP3;1 also showed tls1-like phenotypes, further demonstrating that TLS1 is ZmNIP3;1. Sequence analysis suggests that ZmNIP3;1 is a boron channel protein. Foliar application of boron could rescue the tls1 phenotypes and restore the normal tassel and ear development. Gene expression analysis indicated that in comparison with that of the wild type or tls1 plants treated with boron, the transition from the vegetative to reproductive phase or the development of the floral meristem is impaired in the shoot apical meristem of the tls1 mutant plants. It is concluded that the tls1 mutant phenotypes are caused by impaired boron transport, and boron is essential for inflorescence development in maize. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

A molecular mechanism of azoxystrobin resistance in Penicillium digitatum UV mutants and a PCR-based assay for detection of azoxystrobin-resistant strains in packing- or store-house isolates.

PubMed

Zhang, Zhifang; Zhu, Zengrong; Ma, Zhonghua; Li, Hongye

2009-05-31

Sixty-five isolates of Pencillium digitatum (Pers.:Fr) Sacc., a causative agent of green mold of postharvest citrus, were collected from various locations in Zhejiang province in 2000, 2005 and 2006, and assayed for their sensitivity to the quinone outside inhibitor (QoI) fungicide azoxystrobin. The results showed that azoxystrobin is highly effective against P. digitatum, in vitro, and that the effective concentrations resulting in reduction of conidial germination and mycelial growth by 50% (EC(50)) averaged 0.0426 microg/ml and 0.0250 microg/ml, respectively. Twenty-eight azoxystrobin-resistant mutants were obtained by UV mutagenesis and subsequent selection on medium amended with azoxystrobin (12 microg/ml) and salicylhydroxamic acid. All obtained mutants were highly resistant to azoxystrobin and their resistance was genetically stable. Analysis of the cytochrome b gene structure of P. digitatum (Pdcyt b) showed the absence of type I intron in the first hot spot region of mutation. These results indicate that P. digitatum is likely to evolve high levels of resistance to azoxystrobin after its application. Analysis of partial sequences of Pdcyt b from both the azoxystrobin-sensitive parental isolate and the 28 azoxystrobin-resistant mutants revealed that a point mutation, which leads to the substitution at code 143 of alanine for glycine (G143A), is responsible for the observed azoxystrobin resistance in the laboratory mutants. Based on this point mutation, two allele-specific PCR primers were designed and optimized for allele-specific PCR detection of azoxystrobin-resistant isolates of P. digitatum.

Molybdenum cofactor deficiency causes translucent integument, male-biased lethality, and flaccid paralysis in the silkworm Bombyx mori.

PubMed

Fujii, Tsuguru; Yamamoto, Kimiko; Banno, Yutaka

2016-06-01

Uric acid accumulates in the epidermis of Bombyx mori larvae and renders the larval integument opaque and white. Yamamoto translucent (oya) is a novel spontaneous mutant with a translucent larval integument and unique phenotypic characteristics, such as male-biased lethality and flaccid larval paralysis. Xanthine dehydrogenase (XDH) that requires a molybdenum cofactor (MoCo) for its activity is a key enzyme for uric acid synthesis. It has been observed that injection of a bovine xanthine oxidase, which corresponds functionally to XDH and contains its own MoCo activity, changes the integuments of oya mutants from translucent to opaque and white. This finding suggests that XDH/MoCo activity might be defective in oya mutants. Our linkage analysis identified an association between the oya locus and chromosome 23. Because XDH is not linked to chromosome 23 in B. mori, MoCo appears to be defective in oya mutants. In eukaryotes, MoCo is synthesized by a conserved biosynthesis pathway governed by four loci (MOCS1, MOCS2, MOCS3, and GEPH). Through a candidate gene approach followed by sequence analysis, a 6-bp deletion was detected in an exon of the B. mori molybdenum cofactor synthesis-step 1 gene (BmMOCS1) in the oya strain. Moreover, recombination was not observed between the oya and BmMOCS1 loci. These results indicate that the BmMOCS1 locus is responsible for the oya locus. Finally, we discuss the potential cause of male-biased lethality and flaccid paralysis observed in the oya mutants. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mutants of the lactose carrier of Escherichia coli which show altered sugar recognition plus a severe defect in sugar accumulation.

PubMed

Varela, M F; Wilson, T H; Rodon-Rivera, V; Shepherd, S; Dehne, T A; Rector, A C

2000-04-01

Lactose and melibiose are actively accumulated by the wild-type Escherichia coli lactose carrier, which is an integral membrane protein energized by the proton motive force. Mutants of the E. coli lactose carrier were isolated by their ability to grow on minimal plates with succinate plus IPTG in the presence of the toxic lactose analog beta-thio-o-nitrophenylgalactoside (TONPG). TONPG-resistant mutants were streaked on melibiose MacConkey indicator plates, and red clones were picked. These melibiose positive mutants were then streaked on lactose MacConkey plates, and white clones were picked. Transport assays indicated that the mutants had altered sugar recognition and a defect in sugar accumulation. The mutants had a poor apparent K(m) for both lactose and melibiose in transport. One mutant had almost no ability to take up lactose, but melibiose downhill transport was 58% (V(max)) of normal. All of the mutants accumulated methyl-alpha-d-galactopyranoside (TMG) to only 8% or less of normal, and two failed to accumulate. Immunoblot analysis of the mutant lactose carrier proteins indicated that loss of sugar transport activity was not due to loss of expression in the membrane. Nucleotide sequencing of the lacY gene from the mutants revealed changes in the following amino acids of the lactose carrier: M23I, W151L, G257D, A295D and G377V. Two of the mutants (G257D and G377V) are novel in that they represent the first amino acids in periplasmic loops to be implicated with changes in sugar recognition. We conclude that the amino acids M23, W151, G257, A295 and G377 of the E. coli lactose carrier play either a direct or an indirect role in sugar recognition and accumulation.

Congenital amegakaryocytic thrombocytopenia in three siblings: molecular analysis of atypical clinical presentation.

PubMed

Gandhi, Manish J; Pendergrass, Thomas W; Cummings, Carrie C; Ihara, Kenji; Blau, C Anthony; Drachman, Jonathan G

2005-10-01

An 11-year-old girl, presenting with fatigue and bruising, was found to be profoundly pancytopenic. Bone marrow exam and clinical evaluation were consistent with aplastic anemia. Family members were studied as potential stem cell donors, revealing that both younger siblings displayed significant thrombocytopenia, whereas both parents had normal blood counts. We evaluated this pedigree to understand the unusually late presentation of congenital amegakaryocytic thrombocytopenia (CAMT). The coding region and the intron/exon junctions of MPL were sequenced from each family member. Vectors representing each of the mutations were constructed and tested for the ability to support growth of Baf3/Mpl(mutant) cells. All three siblings had elevated thrombopoietin levels. Analysis of genomic DNA demonstrated that each parent had mutations/polymorphisms in a single MPL allele and that each child was a compound heterozygote, having inherited both abnormal alleles. The maternal allele encoded a mutation of the donor splice-junction at the exon-3/intron-3 boundary. A mini-gene construct encoding normal vs mutant versions of the intron-3 donor-site demonstrated that physiologic splicing was significantly reduced in the mutant construct. Mutations that incompletely eliminate Mpl expression/function may result in delayed diagnosis of CAMT and confusion with aplastic anemia.

Effect of Gamma Rays on Sophora davidii and Detection of DNA Polymorphism through ISSR Marker

PubMed Central

Wang, Puchang; Mo, Bentian; Luo, Tianqiong

2017-01-01

Sophora davidii (Franch.) Kom. ex Pavol is an important medicinal plant and a feeding scrub with ecological value. The effects of different gamma irradiation doses (20–140 Kr) on seed germination and seedling morphology were investigated in S. davidii, and intersimple sequence repeat (ISSR) markers were used to identify the DNA polymorphism among mutants. Significant variations were observed for seed germination, stem diameter, and number of branches per plant. The improved agronomic traits, such as stem diameter and number of branches per plant, were recorded at 80 Kr dose and 20 Kr dose for seed germination. ISSR analysis generated in total 183 scorable fragments, of which 94 (51.37%) were polymorphic. The percentage of polymorphism ranged from 14.29 to 93.33 with an average of 45.69%. Jaccard's coefficients of dissimilarity varied from 0.6885 to 1.000, indicative of the level of genetic variation among the mutants. The constructed dendrogram grouped the entities into five clusters. Consequently, it was concluded that gamma rays irradiation of seeds generates a sufficient number of induced mutations and that ISSR analysis offered a useful molecular marker for the identification of mutants. PMID:28612030

Nucleotide sequence and further characterization of the Synechococcus sp. strain PCC 7002 recA gene: complementation of a cyanobacterial recA mutation by the Escherichia coli recA gene.

PubMed Central

Murphy, R C; Gasparich, G E; Bryant, D A; Porter, R D

1990-01-01

The nucleotide sequence and transcript initiation site of the Synechococcus sp. strain PCC 7002 recA gene have been determined. The deduced amino acid sequence of the RecA protein of this cyanobacterium is 56% identical and 73% similar to the Escherichia coli RecA protein. Northern (RNA) blot analysis indicates that the Synechococcus strain PCC 7002 recA gene is transcribed as a monocistronic transcript 1,200 bases in length. The 5' endpoint of the recA mRNA was mapped by primer extension by using synthetic oligonucleotides of 17 and 27 nucleotides as primers. The nucleotide sequence 5' to the mapped endpoint contained sequence motifs bearing a striking resemblance to the heat shock (sigma 32-specific) promoters of E. coli but did not contain sequences similar to the E. coli SOS operator recognized by the LexA repressor. An insertion mutation introduced into the recA locus of Synechococcus strain PCC 7002 via homologous recombination resulted in the formation of diploids carrying both mutant and wild-type recA alleles. A variety of growth regimens and transformation procedures failed to produce a recA Synechococcus strain PCC 7002 mutant. However, introduction into these diploid cells of the E. coli recA gene in trans on a biphasic shuttle vector resulted in segregation of the cyanobacterial recA alleles, indicating that the E. coli recA gene was able to provide a function required for growth of recA Synechococcus strain PCC 7002 cells. This interpretation is supported by the observation that the E. coli recA gene is maintained in these cells when antibiotic selection for the shuttle vector is removed. Images FIG. 3 FIG. 4 FIG. 6 PMID:2105307

Single-molecule detection of epidermal growth factor receptor mutations in plasma by microfluidics digital PCR in non-small cell lung cancer patients.

PubMed

Yung, Tony K F; Chan, K C Allen; Mok, Tony S K; Tong, Joanna; To, Ka-Fai; Lo, Y M Dennis

2009-03-15

We aim to develop a digital PCR-based method for the quantitative detection of the two common epidermal growth factor receptor (EGFR) mutations (in-frame deletion at exon 19 and L858R at exon 21) in the plasma and tumor tissues of patients suffering from non-small cell lung cancers. These two mutations account for >85% of clinically important EGFR mutations associated with responsiveness to tyrosine kinase inhibitors. DNA samples were analyzed using a microfluidics system that simultaneously performed 9,180 PCRs at nanoliter scale. A single-mutant DNA molecule in a clinical specimen could be detected and the quantities of mutant and wild-type sequences were precisely determined. Exon 19 deletion and L858R mutation were detectable in 6 (17%) and 9 (26%) of 35 pretreatment plasma samples, respectively. When compared with the sequencing results of the tumor samples, the sensitivity and specificity of plasma EGFR mutation analysis were 92% and 100%, respectively. The plasma concentration of the mutant sequences correlated well with the clinical response. Decreased concentration was observed in all patients with partial or complete clinical remission, whereas persistence of mutation was observed in a patient with cancer progression. In one patient, tyrosine kinase inhibitor was stopped after an initial response and the tumor-associated EGFR mutation reemerged 4 weeks after stopping treatment. The sensitive detection and accurate quantification of low abundance EGFR mutations in tumor tissues and plasma by microfluidics digital PCR would be useful for predicting treatment response, monitoring disease progression and early detection of treatment failure associated with acquired drug resistance.

Using a minigene approach to characterize a novel splice site mutation in human F7 gene causing inherited factor VII deficiency in a Chinese pedigree.

PubMed

Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H

2009-11-01

Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.

DNA-Demethylase Regulated Genes Show Methylation-Independent Spatiotemporal Expression Patterns

PubMed Central

Schumann, Ulrike; Lee, Joanne; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo

2017-01-01

Recent research has indicated that a subset of defense-related genes is downregulated in the Arabidopsis DNA demethylase triple mutant rdd (ros1 dml2 dml3) resulting in increased susceptibility to the fungal pathogen Fusarium oxysporum. In rdd plants these downregulated genes contain hypermethylated transposable element sequences (TE) in their promoters, suggesting that this methylation represses gene expression in the mutant and that these sequences are actively demethylated in wild-type plants to maintain gene expression. In this study, the tissue-specific and pathogen-inducible expression patterns of rdd-downregulated genes were investigated and the individual role of ROS1, DML2, and DML3 demethylases in these spatiotemporal regulation patterns was determined. Large differences in defense gene expression were observed between pathogen-infected and uninfected tissues and between root and shoot tissues in both WT and rdd plants, however, only subtle changes in promoter TE methylation patterns occurred. Therefore, while TE hypermethylation caused decreased gene expression in rdd plants it did not dramatically effect spatiotemporal gene regulation, suggesting that this latter regulation is largely methylation independent. Analysis of ros1-3, dml2-1, and dml3-1 single gene mutant lines showed that promoter TE hypermethylation and defense-related gene repression was predominantly, but not exclusively, due to loss of ROS1 activity. These data demonstrate that DNA demethylation of TE sequences, largely by ROS1, promotes defense-related gene expression but does not control spatiotemporal expression in Arabidopsis. Summary: Ros1-mediated DNA demethylation of promoter transposable elements is essential for activation of defense-related gene expression in response to fungal infection in Arabidopsis thaliana. PMID:28894455

Development and Validation of an Ultradeep Next-Generation Sequencing Assay for Testing of Plasma Cell-Free DNA from Patients with Advanced Cancer.

PubMed

Janku, Filip; Zhang, Shile; Waters, Jill; Liu, Li; Huang, Helen J; Subbiah, Vivek; Hong, David S; Karp, Daniel D; Fu, Siqing; Cai, Xuyu; Ramzanali, Nishma M; Madwani, Kiran; Cabrilo, Goran; Andrews, Debra L; Zhao, Yue; Javle, Milind; Kopetz, E Scott; Luthra, Rajyalakshmi; Kim, Hyunsung J; Gnerre, Sante; Satya, Ravi Vijaya; Chuang, Han-Yu; Kruglyak, Kristina M; Toung, Jonathan; Zhao, Chen; Shen, Richard; Heymach, John V; Meric-Bernstam, Funda; Mills, Gordon B; Fan, Jian-Bing; Salathia, Neeraj S

2017-09-15

Purpose: Tumor-derived cell-free DNA (cfDNA) in plasma can be used for molecular testing and provide an attractive alternative to tumor tissue. Commonly used PCR-based technologies can test for limited number of alterations at the time. Therefore, novel ultrasensitive technologies capable of testing for a broad spectrum of molecular alterations are needed to further personalized cancer therapy. Experimental Design: We developed a highly sensitive ultradeep next-generation sequencing (NGS) assay using reagents from TruSeqNano library preparation and NexteraRapid Capture target enrichment kits to generate plasma cfDNA sequencing libraries for mutational analysis in 61 cancer-related genes using common bioinformatics tools. The results were retrospectively compared with molecular testing of archival primary or metastatic tumor tissue obtained at different points of clinical care. Results: In a study of 55 patients with advanced cancer, the ultradeep NGS assay detected 82% (complete detection) to 87% (complete and partial detection) of the aberrations identified in discordantly collected corresponding archival tumor tissue. Patients with a low variant allele frequency (VAF) of mutant cfDNA survived longer than those with a high VAF did ( P = 0.018). In patients undergoing systemic therapy, radiological response was positively associated with changes in cfDNA VAF ( P = 0.02), and compared with unchanged/increased mutant cfDNA VAF, decreased cfDNA VAF was associated with longer time to treatment failure (TTF; P = 0.03). Conclusions: Ultradeep NGS assay has good sensitivity compared with conventional clinical mutation testing of archival specimens. A high VAF in mutant cfDNA corresponded with shorter survival. Changes in VAF of mutated cfDNA were associated with TTF. Clin Cancer Res; 23(18); 5648-56. ©2017 AACR . ©2017 American Association for Cancer Research.

Vitellogenin Receptor Mutation Leads to the Oogenesis Mutant Phenotype “scanty vitellin” of the Silkworm, Bombyx mori*

PubMed Central

Lin, Ying; Meng, Yan; Wang, Yan-Xia; Luo, Juan; Katsuma, Susumu; Yang, Cong-Wen; Banno, Yutaka; Kusakabe, Takahiro; Shimada, Toru; Xia, Qing-You

2013-01-01

In insects, the vitellogenin receptor (VgR) mediates the uptake of vitellogenin (Vg) from the hemolymph by developing oocytes. The oogenesis mutant scanty vitellin (vit) of Bombyx mori (Bm) lacks vitellin and 30-kDa proteins, but B. mori egg-specific protein and BmVg are normal. The vit eggs are white and smaller compared with the pale yellow eggs of the wild type and are embryonic lethal. This study found that a mutation in the B. mori VgR gene (BmVgR) is responsible for the vit phenotype. We cloned the cDNA sequences encoding WT and vit BmVgR. The functional domains of BmVgR are similar to those of other low-density lipoprotein receptors. When compared with the wild type, a 235-bp genomic sequence in vit BmVgR is substituted for a 7-bp sequence. This mutation has resulted in a 50-amino acid deletion in the third Class B region of the first epidermal growth factor (EGF1) domain. BmVgR is expressed specifically in oocytes, and the transcriptional level is changed dramatically and consistently with maturation of oocytes during the previtellogenic periods. Linkage analysis confirmed that BmVgR is mutated in the vit mutant. The coimmunoprecipitation assay confirmed that mutated BmVgR is able to bind BmVg but that BmVg cannot be dissociated under acidic conditions. The WT phenotype determined by RNA interference was similar to that of the vit phenotype for nutritional deficiency, such as BmVg and 30-kDa proteins. These results showed that BmVgR has an important role in transporting proteins for egg formation and embryonic development in B. mori. PMID:23515308

delta. -aminolevulinic acid dehydratase deficiency can cause. delta. -aminolevulinate auxotrophy in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Neill, G.P.; Michelsen, U.; Soll, D.

Ethylmethane sulfonate-induced mutants of several Escherichia coli strains that required {delta}-aminolevulinic acid (ALA) for growth were isolated by penicillin enrichment or by selection for respiratory-defective strains resistant to the aminoglycoside antibiotic kanamycin. Three classes of mutants were obtained. Two-thirds of the strains were mutants in hemA. Representative of a third of the mutations was the hem-201 mutation. This mutation was mapped to min 8.6 to 8.7. Complementation of the auxotrophic phenotype by wild-type DNA from the corresponding phage 8F10 allowed the isolation of the gene. DNA sequence analysis revealed that the hem-201 gene encoded ALA dehydratase and was similar tomore » a known hemB gene of E. coli. Complementation studies of hem-201 and hemB1 mutant strains with various hem-201 gene subfragments showed that hem-201 and the previously reported hemB1 mutation are in the same gene and that no other gene is required to complement the hem-201 mutant. ALA-forming activity from glutamate could not be detected by in vitro or in vivo assays. Extracts of hem-201 cells had drastically reduce ALA dehydratase levels, while cells transformed with the plasmid-encoded wild-type gene possessed highly elevated enzyme levels. The ALA requirement for growth, the lack of any ALA-forming enzymatic activity, and greatly reduced ALA dehydratase activity of the hem-201 strain suggest that a diffusible product of an enzyme in the heme biosynthetic pathway after ALA formation is involved in positive regulation of ALA biosynthesis. Analysis of another class of ALA-requiring mutants showed that the auxotrophy of the hem-205 mutant could be relieved by either methionine or cysteine and that the mutation maps in the cysG gene, which encodes uroporphyrinogen III methylase. The properties of these nonleaky ALA-requiring strains suggest that ALA is involved more extensively in E. coli intermediary metabolism than has been appreciated to date.« less

Stock culture heterogeneity rather than new mutational variation complicates short-term cell physiology studies of Escherichia coli K-12 MG1655 in continuous culture.

PubMed

Nahku, Ranno; Peebo, Karl; Valgepea, Kaspar; Barrick, Jeffrey E; Adamberg, Kaarel; Vilu, Raivo

2011-09-01

Nutrient-limited continuous cultures in chemostats have been used to study microbial cell physiology for over 60 years. Genome instability and genetic heterogeneity are possible uncontrolled factors in continuous cultivation experiments. We investigated these issues by using high-throughput (HT) DNA sequencing to characterize samples from different phases of a glucose-limited accelerostat (A-stat) experiment with Escherichia coli K-12 MG1655 and a duration regularly used in cell physiology studies (20 generations of continuous cultivation). Seven consensus mutations from the reference sequence and five subpopulations characterized by different mutations were detected in the HT-sequenced samples. This genetic heterogeneity was confirmed to result from the stock culture by Sanger sequencing. All the subpopulations in which allele frequencies increased (betA, cspG/cspH, glyA) during the experiment were also present at the end of replicate A-stats, indicating that no new subpopulations emerged during our experiments. The fact that ~31 % of the cells in our initial cultures obtained directly from a culture stock centre were mutants raises concerns that even if cultivations are started from single colonies, there is a significant chance of picking a mutant clone with an altered phenotype. Our results show that current HT DNA sequencing technology allows accurate subpopulation analysis and demonstrates that a glucose-limited E. coli K-12 MG1655 A-stat experiment with a duration of tens of generations is suitable for studying cell physiology and collecting quantitative data for metabolic modelling without interference from new mutations.

Stock culture heterogeneity rather than new mutational variation complicates short-term cell physiology studies of Escherichia coli K-12 MG1655 in continuous culture

PubMed Central

Nahku, Ranno; Peebo, Karl; Valgepea, Kaspar; Barrick, Jeffrey E.; Adamberg, Kaarel

2011-01-01

Nutrient-limited continuous cultures in chemostats have been used to study microbial cell physiology for over 60 years. Genome instability and genetic heterogeneity are possible uncontrolled factors in continuous cultivation experiments. We investigated these issues by using high-throughput (HT) DNA sequencing to characterize samples from different phases of a glucose-limited accelerostat (A-stat) experiment with Escherichia coli K-12 MG1655 and a duration regularly used in cell physiology studies (20 generations of continuous cultivation). Seven consensus mutations from the reference sequence and five subpopulations characterized by different mutations were detected in the HT-sequenced samples. This genetic heterogeneity was confirmed to result from the stock culture by Sanger sequencing. All the subpopulations in which allele frequencies increased (betA, cspG/cspH, glyA) during the experiment were also present at the end of replicate A-stats, indicating that no new subpopulations emerged during our experiments. The fact that ~31 % of the cells in our initial cultures obtained directly from a culture stock centre were mutants raises concerns that even if cultivations are started from single colonies, there is a significant chance of picking a mutant clone with an altered phenotype. Our results show that current HT DNA sequencing technology allows accurate subpopulation analysis and demonstrates that a glucose-limited E. coli K-12 MG1655 A-stat experiment with a duration of tens of generations is suitable for studying cell physiology and collecting quantitative data for metabolic modelling without interference from new mutations. PMID:21700661

Sequence, molecular properties, and chromosomal mapping of mouse lumican

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1995-01-01

PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Phenotypic mutant library: potential for gene discovery

USDA-ARS?s Scientific Manuscript database

The rapid development of high throughput and affordable Next- Generation Sequencing (NGS) techniques has renewed interest in gene discovery using forward genetics. The conventional forward genetic approach starts with isolation of mutants with a phenotype of interest, mapping the mutation within a s...

Genotyping-by-sequencing of glossy mutants

USDA-ARS?s Scientific Manuscript database

Glossy mutants are a common occurrence in Brassica oleracea L. and they have been documented in most crop varieties of the species including cabbage, kale, broccoli, and collard. Glossy phenotypes have been of particular interest to researchers due to observations that they influence insect behavior...

A combined de novo protein sequencing and cDNA library approach to the venomic analysis of Chinese spider Araneus ventricosus.

PubMed

Duan, Zhigui; Cao, Rui; Jiang, Liping; Liang, Songping

2013-01-14

In past years, spider venoms have attracted increasing attention due to their extraordinary chemical and pharmacological diversity. The recently popularized proteomic method highly improved our ability to analyze the proteins in the venom. However, the lack of information about isolated venom proteins sequences dramatically limits the ability to confidently identify venom proteins. In the present paper, the venom from Araneus ventricosus was analyzed using two complementary approaches: 2-DE/Shotgun-LC-MS/MS coupled to MASCOT search and 2-DE/Shotgun-LC-MS/MS coupled to manual de novo sequencing followed by local venom protein database (LVPD) search. The LVPD was constructed with toxin-like protein sequences obtained from the analysis of cDNA library from A. ventricosus venom glands. Our results indicate that a total of 130 toxin-like protein sequences were unambiguously identified by manual de novo sequencing coupled to LVPD search, accounting for 86.67% of all toxin-like proteins in LVPD. Thus manual de novo sequencing coupled to LVPD search was proved an extremely effective approach for the analysis of venom proteins. In addition, the approach displays impeccable advantage in validating mutant positions of isoforms from the same toxin-like family. Intriguingly, methyl esterifcation of glutamic acid was discovered for the first time in animal venom proteins by manual de novo sequencing. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

Immune response to synthetic peptides representing antigenic sites on the glycoprotein of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Emmenegger, Eveline J.; Huang, C.; LaPatra, S.; Winton, James R.

1995-01-01

Summary ― Monoclonal antibodies against infectious hematopoietic necrosis virus have been used to react with recombinant expression products in immunoblots and to select neutralization-resistant mutants for sequence analysis. These strategies identified neutralizing and non-neutralizing antigenic sites on the viral glycoprotein. Synthetic peptides based upon the amino acid sequences of these antigenic sites were synthesized and were injected together with an adjuvant into rainbow trout. The constructs generally failed to stimulate neutralizing antibodies in the fish. These results indicate that we need to understand more about the ability of peptide antigens to stimulate fish immune systems.

Length and sequence dependence in the association of Huntingtin protein with lipid membranes

NASA Astrophysics Data System (ADS)

Jawahery, Sudi; Nagarajan, Anu; Matysiak, Silvina

2013-03-01

There is a fundamental gap in our understanding of how aggregates of mutant Huntingtin protein (htt) with overextended polyglutamine (polyQ) sequences gain the toxic properties that cause Huntington's disease (HD). Experimental studies have shown that the most important step associated with toxicity is the binding of mutant htt aggregates to lipid membranes. Studies have also shown that flanking amino acid sequences around the polyQ sequence directly affect interactions with the lipid bilayer, and that polyQ sequences of greater than 35 glutamine repeats in htt are a characteristic of HD. The key steps that determine how flanking sequences and polyQ length affect the structure of lipid bilayers remain unknown. In this study, we use atomistic molecular dynamics simulations to study the interactions between lipid membranes of varying compositions and polyQ peptides of varying lengths and flanking sequences. We find that overextended polyQ interactions do cause deformation in model membranes, and that the flanking sequences do play a role in intensifying this deformation by altering the shape of the affected regions.

Catabolite repression in Lactobacillus casei ATCC 393 is mediated by CcpA.

PubMed Central

Monedero, V; Gosalbes, M J; Pérez-Martínez, G

1997-01-01

The chromosomal ccpA gene from Lactobacillus casei ATCC 393 has been cloned and sequenced. It encodes the CcpA protein, a central catabolite regulator belonging to the LacI-GalR family of bacterial repressors, and shows 54% identity with CcpA proteins from Bacillus subtilis and Bacillus megaterium. The L. casei ccpA gene was able to complement a B. subtilis ccpA mutant. An L. casei ccpA mutant showed increased doubling times and a relief of the catabolite repression of some enzymatic activities, such as N-acetylglucosaminidase and phospho-beta-galactosidase. Detailed analysis of CcpA activity was performed by using the promoter region of the L. casei chromosomal lacTEGF operon which is subject to catabolite repression and contains a catabolite responsive element (cre) consensus sequence. Deletion of this cre site or the presence of the ccpA mutation abolished the catabolite repression of a lacp::gusA fusion. These data support the role of CcpA as a common regulatory element mediating catabolite repression in low-GC-content gram-positive bacteria. PMID:9352913

A speculated ribozyme site in the herpes simplex virus type 1 latency-associated transcript gene is not essential for a wild-type reactivation phenotype

PubMed Central

Carpenter, Dale; Singh, Sukhpreet; Osorio, Nelson; Hsiang, Chinhui; Jiang, Xianzhi; Jin, Ling; Jones, Clinton; Wechsler, Steven L

2010-01-01

During herpes simplex virus-1 (HSV-1) latency in sensory neurons, LAT (latency-associated transcript) is the only abundantly expressed viral gene. LAT plays an important role in the HSV-1 latency-reactivation cycle, because LAT deletion mutants have a significantly decreased reactivation phenotype. Based solely on sequence analysis, it was speculated that LAT encodes a ribozyme that plays an important role in how LAT enhances the virus’ reactivation phenotype. Because LAT ribozyme activity has never been reported, we decided to test the converse hypothesis, namely, that this region of LAT does not encode a ribozyme function important for LAT’s ability to enhance the reactivation phenotype. We constructed a viral mutant (LAT-Rz) in which the speculated ribozyme consensus sequence was altered such that no ribozyme was encoded. We report here that LAT-Rz had a wild-type reactivation phenotype in mice, confirming the hypothesis that the speculated LAT ribozyme is not a dominant factor in stimulating the latency-reactivation cycle in mice. PMID:18982533

Improvement of uridine production of Bacillus subtilis by atmospheric and room temperature plasma mutagenesis and high-throughput screening

PubMed Central

Li, Guoliang; Yuan, Hui; Zhang, Hongchao; Li, Yanjun; Xie, Xixian; Chen, Ning

2017-01-01

In the present study, a novel breeding strategy of atmospheric and room temperature plasma (ARTP) mutagenesis was used to improve the uridine production of engineered Bacillus subtilis TD12np. A high-throughput screening method was established using both resistant plates and 96-well microplates to select the ideal mutants with diverse phenotypes. Mutant F126 accumulated 5.7 and 30.3 g/L uridine after 30 h in shake-flask and 48 h in fed-batch fermentation, respectively, which represented a 4.4- and 8.7-fold increase over the parent strain. Sequence analysis of the pyrimidine nucleotide biosynthetic operon in the representative mutants showed that proline 1016 and glutamate 949 in the large subunit of B. subtilis carbamoyl phosphate synthetase were of importance for the allosteric regulation caused by uridine 5′-monophosphate. The proposed mutation method with efficient high-throughput screening assay was proved to be an appropriate strategy to obtain uridine-overproducing strain. PMID:28472077

Improvement of uridine production of Bacillus subtilis by atmospheric and room temperature plasma mutagenesis and high-throughput screening.

PubMed

Fan, Xiaoguang; Wu, Heyun; Li, Guoliang; Yuan, Hui; Zhang, Hongchao; Li, Yanjun; Xie, Xixian; Chen, Ning

2017-01-01

In the present study, a novel breeding strategy of atmospheric and room temperature plasma (ARTP) mutagenesis was used to improve the uridine production of engineered Bacillus subtilis TD12np. A high-throughput screening method was established using both resistant plates and 96-well microplates to select the ideal mutants with diverse phenotypes. Mutant F126 accumulated 5.7 and 30.3 g/L uridine after 30 h in shake-flask and 48 h in fed-batch fermentation, respectively, which represented a 4.4- and 8.7-fold increase over the parent strain. Sequence analysis of the pyrimidine nucleotide biosynthetic operon in the representative mutants showed that proline 1016 and glutamate 949 in the large subunit of B. subtilis carbamoyl phosphate synthetase were of importance for the allosteric regulation caused by uridine 5'-monophosphate. The proposed mutation method with efficient high-throughput screening assay was proved to be an appropriate strategy to obtain uridine-overproducing strain.

Infectious mutants of cassava latent virus generated in vivo from intact recombinant DNA clones containing single copies of the genome.

PubMed Central

Stanley, J; Townsend, R

1986-01-01

Intact recombinant DNAs containing single copies of either component of the cassava latent virus genome can elicit infection when mechanically inoculated to host plants in the presence of the appropriate second component. Characterisation of infectious mutant progeny viruses, by analysis of virus-specific supercoiled DNA intermediates, indicates that most if not all of the cloning vector has been deleted, achieved at least in some cases by intermolecular recombination in vivo between DNAs 1 and 2. Significant rearrangements within the intergenic region of DNA 2, predominantly external to the common region, can be tolerated without loss of infectivity suggesting a somewhat passive role in virus multiplication for the sequences in question. Although packaging constraints might impose limits on the amount of DNA within geminate particles, isolation of an infectious coat protein mutant defective in virion production suggests that packaging is not essential for systemic spread of the viral DNA. Images PMID:2875435

The Lon protease homologue LonA, not LonC, contributes to the stress tolerance and biofilm formation of Actinobacillus pleuropneumoniae.

PubMed

Xie, Fang; Li, Gang; Zhang, Yanhe; Zhou, Long; Liu, Shuanghong; Liu, Siguo; Wang, Chunlai

2016-04-01

Lon proteases are a family of ATP-dependent proteases that are involved in the degradation of abnormal proteins in bacteria exposed to adverse environmental stress. An analysis of the genome sequence of Actinobacillus pleuropneumoniae revealed the unusual presence of two putative ATP-dependent Lon homologues, LonA and LonC. Sequence comparisons indicated that LonA has the classical domain organization of the LonA subfamily, which includes the N-terminal domain, central ATPase (AAA) domain, and C-terminal proteolytic (P) domain. LonC belongs to the recently classified LonC subfamily, which includes Lon proteases that contain neither the N-terminal domain of LonA nor the transmembrane region that is present only in LonB subfamily members. To investigate the roles of LonA and LonC in A. pleuropneumoniae, mutants with deletions in the lonA and lonC genes were constructed. The impaired growth of the △lonA mutant exposed to low and high temperatures and osmotic and oxidative stress conditions indicates that the LonA protease is required for the stress tolerance of A. pleuropneumoniae. Furthermore, the △lonA mutant exhibited significantly reduced biofilm formation compared to the wild-type strain. However, no significant differences in stress responses or biofilm formation were observed between the △lonC mutant and the wild-type strain. The △lonA mutant exhibited reduced colonization ability and attenuated virulence of A. pleuropneumoniae in the BALB/c mouse model compared to the wild-type strain. Disruption of lonC gene did not significantly influence the colonization and virulence of A. pleuropneumoniae. The data presented in this study illustrate that the LonA protease, but not the LonC protease, is required for the stress tolerance, biofilm formation and pathogenicity of A. pleuropneumoniae. Copyright © 2016 Elsevier Ltd. All rights reserved.

Characterization of hepatitis B virus in Amerindian children and mothers from Amazonas State, Colombia

PubMed Central

Jaramillo, Carlos Mario; de La Hoz, Fernando; Porras, Alexandra; di Filippo, Diana; Choconta-Piraquive, Luz Angela; Payares, Edra; Montes, Neyla

2017-01-01

Background Hepatitis B Virus (HBV) infection is a worldwide public health problem. In the 1980’s a highly effective and safe vaccine against HBV was developed, although breakthrough infection still occasionally occurs because of the emergence of escape mutants. The aim of this study was to identify HBV genotypes and escape mutants in children and their mothers in Amerindian communities of the Amazonas State, Southern Colombia. Methods Blood specimens collected from children and mothers belonging to 37 Amerindian communities in Amazonas state, were screened for HBsAg and anti-HBc using ELISA. The partial region containing the S ORF was amplified by nested PCR, and amplicons were sequenced. The phylogenetic analysis was performed using the MEGA 5.05 software. Results Forty-six children (46/1275, 3.6%) and one hundred and seventy-seven mothers (177/572, 30.9%) were tested positive for the anti-HBc serological marker. Among them, 190 samples were tested for viral genome detection; 8.3% (2/31) serum samples obtained from children and 3.1% (5/159) from mothers were positive for the ORF S PCR. The predominant HBV genotype in the study population was F, subgenotype F1b; in addition, subgenotype F1a and genotype A were also characterized. Two HBV escape mutants were identified, G145R, reported worldwide, and W156*; this stop codon was identified in a child with occult HBV infection. Other mutations were found, L109R and G130E, located in critical positions of the HBsAg sequence. Conclusions This study aimed to characterize the HBV genotype F, subgenotypes F1b and F1a, and genotype A in Amerindian communities and for the first time escape mutants in Colombia. Further investigations are necessary to elucidate the frequency and the epidemiological impact of the escape mutants in the country. PMID:29016603

Bm-muted, orthologous to mouse muted and encoding a subunit of the BLOC-1 complex, is responsible for the otm translucent mutation of the silkworm Bombyx mori.

PubMed

Zhang, Haokun; Kiuchi, Takashi; Wang, Lingyan; Kawamoto, Munetaka; Suzuki, Yutaka; Sugano, Sumio; Banno, Yutaka; Katsuma, Susumu; Shimada, Toru

2017-09-20

"Tanaka's mottled translucent" (otm) is a mutation of the silkworm Bombyx mori that exhibits translucent skin during larval stages. We performed positional cloning of the gene responsible for otm and mapped it to a 364-kb region on chromosome 5 that contains 22 hypothetical protein-coding genes. We performed RNA-seq analysis of the epidermis and fat body of otm larvae and determined that the gene BGIBMGA002619 may be responsible for the otm mutation. BGIBMGA002619 encodes the biosynthesis of lysosome-related organelles complex 1 (BLOC-1) subunit 5, whose ortholog is responsible for the Muted mutant in mouse. Accordingly, we named this gene Bm-muted. We discovered that the expression of Bm-muted in the epidermis and fat body of otm mutants was dramatically suppressed compared with the wild type. We determined the nucleotide sequences of the full-length cDNA and genomic region corresponding to Bm-muted and found that a 538-bp long DNA sequence similar to B. mori transposon Organdy was inserted into the 3' end of the first intron of Bm-muted in two otm strains. The Bm-muted cDNA of otm mutants lacked exon 2, and accordingly generated a premature stop codon in exon 3. In addition, short interfering RNA (siRNA)-mediated knockdown of this gene caused localized partial translucency of larval skin. These data indicate that the mutation in Bm-muted caused the otm-mutant phenotype. We propose that the insertion of Organdy caused a splicing disorder in Bm-muted in the otm mutant, resulting in a null mutation of Bm-muted. This mutation is likely to cause deficiencies in urate granule formation in epidermal cells that result in translucent larval skin. Copyright © 2017 Elsevier B.V. All rights reserved.

Revitalization of a Forward Genetic Screen Identifies Three New Regulators of Fungal Secondary Metabolism in the Genus Aspergillus

PubMed Central

Pfannenstiel, Brandon T.; Zhao, Xixi; Wortman, Jennifer; Throckmorton, Kurt; Spraker, Joseph E.; Luo, Xingyu; Lindner, Daniel L.; Lim, Fang Yun; Knox, Benjamin P.; Haas, Brian; Fischer, Gregory J.; Choera, Tsokyi; Butchko, Robert A. E.; Bok, Jin-Woo; Affeldt, Katharyn J.

2017-01-01

ABSTRACT The study of aflatoxin in Aspergillus spp. has garnered the attention of many researchers due to aflatoxin’s carcinogenic properties and frequency as a food and feed contaminant. Significant progress has been made by utilizing the model organism Aspergillus nidulans to characterize the regulation of sterigmatocystin (ST), the penultimate precursor of aflatoxin. A previous forward genetic screen identified 23 A. nidulans mutants involved in regulating ST production. Six mutants were characterized from this screen using classical mapping (five mutations in mcsA) and complementation with a cosmid library (one mutation in laeA). The remaining mutants were backcrossed and sequenced using Illumina and Ion Torrent sequencing platforms. All but one mutant contained one or more sequence variants in predicted open reading frames. Deletion of these genes resulted in identification of mutant alleles responsible for the loss of ST production in 12 of the 17 remaining mutants. Eight of these mutations were in genes already known to affect ST synthesis (laeA, mcsA, fluG, and stcA), while the remaining four mutations (in laeB, sntB, and hamI) were in previously uncharacterized genes not known to be involved in ST production. Deletion of laeB, sntB, and hamI in A. flavus results in loss of aflatoxin production, confirming that these regulators are conserved in the aflatoxigenic aspergilli. This report highlights the multifaceted regulatory mechanisms governing secondary metabolism in Aspergillus. Additionally, these data contribute to the increasing number of studies showing that forward genetic screens of fungi coupled with whole-genome resequencing is a robust and cost-effective technique. PMID:28874473

Herpes Simplex Virus 2 Latency-Associated Transcript (LAT) region mutations do not identify a role for LAT-Associated Micro RNAs in viral reactivation in the Guinea Pig Genital Model.

PubMed

Kawamura, Yoshiki; Bosch-Marce, Marta; Tang, Shuang; Patel, Amita; Krause, Philip R

2018-05-02

Despite the long-standing observation that herpes simplex virus (HSV) Latency-Associated Transcript (LAT) promoter-deletion viruses show impaired recurrence phenotypes in relevant animal models, the mechanism by which these sequences exert this phenotypic effect is unknown. We constructed and evaluated four mutant HSV-2 viruses with targeted mutations in the LAT promoter and LAT-associated miRNAs affecting (1) the LAT TATA box, (2) the LAT ICP4-binding site, (3) miR-I and miR-II (miR-I/II), which both target ICP34.5, and (4) miR-III, which targets ICP0. While the LAT-TATA box mutant caused milder acute infections than wild-type (WT), there was no difference in recurrence phenotype between these viruses. LAT and miRNA expression during latency were not impaired by this mutation, suggesting that other promoter elements may be more important for latent HSV-2 LAT expression. Mutation of the LAT ICP4-binding site also did not cause an in vivo phenotypic difference between mutant and WT viruses. Acute infection and reactivation from latency of the miR-I/II mutant was similar to that of its rescuant, although slightly reduced in severity relative to the wild-type virus. The miR-III mutant also exhibited WT phenotypes in acute and recurrent phases of infection. While not ruling out an effect of these elements in human latency or reactivation, these findings do not identify a specific role for LAT or LAT-associated miRNAs in the HSV-2 LAT promoter deletion phenotype in guinea pigs. Thus, other sequences in this region may play a more important role in the long-studied LAT-associated phenotype in animals. IMPORTANCE While it has been known for several decades that specific HSV-1 and HSV-2 sequences near the LAT promoter are required for efficient viral reactivation in animal models, the mechanism is still not known. We constructed four mutant viruses with the goal of identifying critical sequence elements and of specifically testing the hypothesis that microRNAs that are expressed during latency play a role. Determination that specific LAT promoter sequences and miRNA sequences do not influence viral reactivation of HSV-2 helps to narrow down the search for the mechanism by which the virus controls its latency and recurrence phenotype. This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.

Varicella-zoster virus complements herpes simplex virus type 1 temperature-sensitive mutants.

PubMed Central

Felser, J M; Straus, S E; Ostrove, J M

1987-01-01

Varicella-zoster virus (VZV) can complement temperature-sensitive mutants of herpes simplex virus. Of seven mutants tested, two, carrying mutations in the immediate-early ICP4 and ICP27 proteins, were complemented. This complementation was not seen in coinfections with adenovirus type 5 or cytomegalovirus. Following transfection into CV-1 cells, a DNA fragment containing the VZV short repeat sequence complemented the ICP4 mutant. These data demonstrate a functional relationship between VZV and herpes simplex virus and have allowed localization of a putative VZV immediate-early gene. PMID:3023701

Mutation detection in the human HSP70B′ gene by denaturing high-performance liquid chromatography

PubMed Central

Hecker, Karl H.; Asea, Alexzander; Kobayashi, Kaoru; Green, Stacy; Tang, Dan; Calderwood, Stuart K.

2000-01-01

Variances, particularly single nucleotide polymorphisms (SNP), in the genomic sequence of individuals are the primary key to understanding gene function as it relates to differences in the susceptibility to disease, environmental influences, and therapy. In this report, the HSP70B′ gene is the target sequence for mutation detection in biopsy samples from human prostate cancer patients undergoing combined hyperthermia and radiation therapy at the Dana-Farber Cancer Institute, using temperature-modulated heteroduplex analysis (TMHA). The underlying principles of TMHA for mutation detection using DHPLC technology are discussed. The procedures involved in amplicon design for mutation analysis by DHPLC are detailed. The melting behavior of the complete coding sequence of the target gene is characterized using WAVEMAKERTM software. Four overlapping amplicons, which span the complete coding region of the HSP70B′ gene, amenable to mutation detection by DHPLC were identified based on the software-predicted melting profile of the target sequence. TMHA was performed on PCR products of individual amplicons of the HSP70B′ gene on the WAVE® Nucleic Acid Fragment Analysis System. The criteria for mutation calling by comparing wild-type and mutant chromatographic patterns are discussed. PMID:11189446

Mutation detection in the human HSP7OB' gene by denaturing high-performance liquid chromatography.

PubMed

Hecker, K H; Asea, A; Kobayashi, K; Green, S; Tang, D; Calderwood, S K

2000-11-01

Variances, particularly single nucleotide polymorphisms (SNP), in the genomic sequence of individuals are the primary key to understanding gene function as it relates to differences in the susceptibility to disease, environmental influences, and therapy. In this report, the HSP70B' gene is the target sequence for mutation detection in biopsy samples from human prostate cancer patients undergoing combined hyperthermia and radiation therapy at the Dana-Farber Cancer Institute, using temperature-modulated heteroduplex analysis (TMHA). The underlying principles of TMHA for mutation detection using DHPLC technology are discussed. The procedures involved in amplicon design for mutation analysis by DHPLC are detailed. The melting behavior of the complete coding sequence of the target gene is characterized using WAVEMAKER software. Four overlapping amplicons, which span the complete coding region of the HSP70B' gene, amenable to mutation detection by DHPLC were identified based on the software-predicted melting profile of the target sequence. TMHA was performed on PCR products of individual amplicons of the HSP70B' gene on the WAVE Nucleic Acid Fragment Analysis System. The criteria for mutation calling by comparing wild-type and mutant chromatographic patterns are discussed.

Identification and characterization of dwarf 62, a loss-of-function mutation in DLT/OsGRAS-32 affecting gibberellin metabolism in rice.

PubMed

Li, Wenqiang; Wu, Jianguo; Weng, Shili; Zhang, Yujiang; Zhang, Dapeng; Shi, Chunhai

2010-11-01

A dwarf mutant, dwarf 62 (d62), was isolated from rice cultivar 93-11 by mutagenesis with γ-rays. Under normal growth conditions, the mutant had multiple abnormal phenotypes, such as dwarfism, wide and dark-green leaf blades, reduced tiller numbers, late and asynchronous heading, short roots, partial male sterility, etc. Genetic analysis indicated that the abnormal phenotypes were controlled by the recessive mutation of a single nuclear gene. Using molecular markers, the D62 gene was fine mapped in 131-kb region at the short arm of chromosome 6. Positional cloning of D62 gene revealed that it was the same locus as DLT/OsGRAS-32, which encodes a member of the GRAS family. In previous studies, the DLT/OsGRAS-32 is confirmed to play positive roles in brassinosteroid (BR) signaling. Sequence analysis showed that the d62 carried a 2-bp deletion in ORF region of D62 gene which led to a loss-of-function mutation. The function of D62 gene was confirmed by complementation experiment. RT-PCR analysis and promoter activity analysis showed that the D62 gene expressed in all tested tissues including roots, stems, leaves and panicles of rice plant. The d62 mutant exhibited decreased activity of α-amylase in endosperm and reduced content of endogenous GA(1). The expression levels of gibberellin (GA) biosynthetic genes including OsCPS1, OsKS1, OsKO1, OsKAO, OsGA20ox2/SD1 and OsGA2ox3 were significantly increased in d62 mutant. Briefly, these results demonstrated that the D62 (DLT/OsGRAS-32) not only participated in the regulation of BR signaling, but also influenced GA metabolism in rice.

Genome-Scale Analysis of Mycoplasma agalactiae Loci Involved in Interaction with Host Cells

PubMed Central

Skapski, Agnès; Hygonenq, Marie-Claude; Sagné, Eveline; Guiral, Sébastien; Citti, Christine; Baranowski, Eric

2011-01-01

Mycoplasma agalactiae is an important pathogen of small ruminants, in which it causes contagious agalactia. It belongs to a large group of “minimal bacteria” with a small genome and reduced metabolic capacities that are dependent on their host for nutrients. Mycoplasma survival thus relies on intimate contact with host cells, but little is known about the factors involved in these interactions or in the more general infectious process. To address this issue, an assay based on goat epithelial and fibroblastic cells was used to screen a M. agalactiae knockout mutant library. Mutants with reduced growth capacities in cell culture were selected and 62 genomic loci were identified as contributing to this phenotype. As expected for minimal bacteria, “transport and metabolism” was the functional category most commonly implicated in this phenotype, but 50% of the selected mutants were disrupted in coding sequences (CDSs) with unknown functions, with surface lipoproteins being most commonly represented in this category. Since mycoplasmas lack a cell wall, lipoproteins are likely to be important in interactions with the host. A few intergenic regions were also identified that may act as regulatory sequences under co-culture conditions. Interestingly, some mutants mapped to gene clusters that are highly conserved across mycoplasma species but located in different positions. One of these clusters was found in a transcriptionally active region of the M. agalactiae chromosome, downstream of a cryptic promoter. A possible scenario for the evolution of these loci is discussed. Finally, several CDSs identified here are conserved in other important pathogenic mycoplasmas, and some were involved in horizontal gene transfer with phylogenetically distant species. These results provide a basis for further deciphering functions mediating mycoplasma-host interactions. PMID:21966487

Longitudinal study of a heteroplasmic 3460 Leber hereditary optic neuropathy family by multiplexed primer-extension analysis and nucleotide sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, S.S.; Fahy, E.; Bodis-Wollner, I.

1996-02-01

Nucleotide-sequencing and multiplexed primer-extension assays have been used to quantitate the mutant-allele frequency in 14 maternal relatives, spanning three generations, from a family that is heteroplasmic for the primary Leber hereditary optic neuropathy (LHON) mutation at nucleotide 3460 of the mitochondrial genome. There was excellent agreement between the values that were obtained with the two different methods. The longitudinal study shows that the mutant-allele frequency was constant within individual family members over a sampling period of 3.5 years. Second, although there was an overall increase in the mutant-allele frequency in successive generations, segregation in the direction of the mutant allelemore » was not invariant, and there was one instance in which there was a significant decrease in the frequency from parent to offspring. From these two sets of results, and from previous studies of heteroplasmic LHON families, we conclude that there is no evidence for a marked selective pressure that determines the replication, segregation, or transmission of primary LHON mutations to white blood cells and platelets. Instead, the mtDNA molecules are most likely to replicate and segregate under conditions of random drift at the cellular level. Finally, the pattern of transmission in this maternal lineage is compatible with a developmental bottleneck model in which the number of mitochondrial units of segregation in the female germ line is relatively small in relation to the number of mtDNA molecules within a cell. However, this is not an invariant pattern for humans, and simple models of mitochondrial gene transmission are inappropriate at the present time. 37 refs., 4 figs., 1 tab.« less

In Vitro Expansion of CAG, CAA, and Mixed CAG/CAA Repeats.

PubMed

Figura, Grzegorz; Koscianska, Edyta; Krzyzosiak, Wlodzimierz J

2015-08-11

Polyglutamine diseases, including Huntington's disease and a number of spinocerebellar ataxias, are caused by expanded CAG repeats that are located in translated sequences of individual, functionally-unrelated genes. Only mutant proteins containing polyglutamine expansions have long been thought to be pathogenic, but recent evidence has implicated mutant transcripts containing long CAG repeats in pathogenic processes. The presence of two pathogenic factors prompted us to attempt to distinguish the effects triggered by mutant protein from those caused by mutant RNA in cellular models of polyglutamine diseases. We used the SLIP (Synthesis of Long Iterative Polynucleotide) method to generate plasmids expressing long CAG repeats (forming a hairpin structure), CAA-interrupted CAG repeats (forming multiple unstable hairpins) or pure CAA repeats (not forming any secondary structure). We successfully modified the original SLIP protocol to generate repeats of desired length starting from constructs containing short repeat tracts. We demonstrated that the SLIP method is a time- and cost-effective approach to manipulate the lengths of expanded repeat sequences.

A reverse genetics approach identifies novel mutants in light responses and anthocyanin metabolism in petunia.

PubMed

Berenschot, Amanda S; Quecini, Vera

2014-01-01

Flower color and plant architecture are important commercially valuable features for ornamental petunias (Petunia x hybrida Vilm.). Photoperception and light signaling are the major environmental factors controlling anthocyanin and chlorophyll biosynthesis and shade-avoidance responses in higher plants. The genetic regulators of these processes were investigated in petunia by in silico analyses and the sequence information was used to devise a reverse genetics approach to probe mutant populations. Petunia orthologs of photoreceptor, light-signaling components and anthocyanin metabolism genes were identified and investigated for functional conservation by phylogenetic and protein motif analyses. The expression profiles of photoreceptor gene families and of transcription factors regulating anthocyanin biosynthesis were obtained by bioinformatic tools. Two mutant populations, generated by an alkalyting agent and by gamma irradiation, were screened using a phenotype-independent, sequence-based method by high-throughput PCR-based assay. The strategy allowed the identification of novel mutant alleles for anthocyanin biosynthesis (CHALCONE SYNTHASE) and regulation (PH4), and for light signaling (CONSTANS) genes.

Structure of adenovirus bound to cellular receptor car

DOEpatents

Freimuth, Paul I.

2004-05-18

Disclosed is a mutant adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have significantly weakened binding affinity for CARD1 relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type. In the method, residues of the adenovirus fiber protein knob domain which are predicted to alter D1 binding when mutated, are identified from the crystal structure coordinates of the AD12knob:CAR-D1 complex. A mutation which alters one or more of the identified residues is introduced into the genome of the adenovirus to generate a mutant adenovirus. Whether or not the mutant produced exhibits altered adenovirus-CAR binding properties is then determined.

Organization of the qa Gene Cluster in NEUROSPORA CRASSA: Direction of Transcription of the qa-3 Gene

PubMed Central

Strøman, Per; Reinert, William; Case, Mary E.; Giles, Norman H.

1979-01-01

In Neurospora crassa, the enzyme quinate (shikimate) dehydrogenase catalyzes the first reaction in the inducible quinic acid catabolic pathway and is encoded in the qa-3 gene of the qa cluster. In this cluster, the order of genes has been established as qa-1 qa-3 qa-4 qa-2. Amino-terminal sequences have been determined for purified quinate dehydrogenase from wild type and from UV-induced revertants in two different qa-3 mutants. These two mutants (M16 and M45) map at opposite ends of the qa-3 locus. In addition, mapping data (Case et al. 1978) indicate that the end of the qa-3 gene specified by M45 is closer to the adjacent qa-1 gene than is the end specified by the M16 mutant site. In one of the revertants (R45 from qa-3 mutant M45), the aminoterminal sequence for the first ten amino acids is identical to that of wild type. The other revertant (R1 from qa-3 mutant M16) differs from wild type at the amino-terminal end by a single altered residue at position three in the sequence. The observed change involves the substitution of an isoleucine in M16-R1 for a proline in wild type. This substitution requires a two-nucleotide change in the corresponding wild-type codon.——The combined genetic and biochemical data indicate that the qa-3 mutants M16 and M45 carry amino acid substitutions near the amino-terminal and carboxyl-terminal ends of the quinate dehydrogenase enzyme, respectively. On this basis we conclude that transcription of the qa-3 gene proceeds from the end specified by the M16 mutant site in the direction of the qa-1 gene. It appears probable that transcription is initiated from a promoter site within the qa cluster, possibly immediately adjacent to the qa-3 gene. PMID:159203

Involvement of the VEP1 gene in vascular strand development in Arabidopsis thaliana.

PubMed

Jun, Ji Hyung; Ha, Chan Man; Nam, Hong Gil

2002-03-01

A dominant mutant line characterized by abnormal leaf venation pattern was isolated from a transgenic Arabidopsis plant pool that was generated with Agrobacterium culture harboring an Arabidopsis antisense cDNA library. In the mutant line, the phenotype was due to antisense suppression of a gene we named VEP1 (Vein Patterning). The predicted amino acid sequence of the gene contained a motif related to the mammalian death domain that is found in the apoptotic machinery. Reduced expression of the VEP1 gene resulted in the reduced complexity of the venation pattern of the cotyledons and foliar leaves, which was mainly due to the reduced number of the minor veins and their incomplete connection. The analysis of mutant embryos indicated that the phenotype was originated, at least in part, from a defect in the procambium patterning. In the mutant, the stem and root were thinner than those in wild type. This phenotype was associated with reduced vascular development. The promoter activity of the VEP1 gene was detected preferentially in the vascular regions. We propose that the death domain-containing protein VEP1 functions as a positive element required for vascular strand development in Arabidopsis thaliana.

Transport of 5-aminolevulinic acid by the dipeptide permease in Salmonella typhimurium.

PubMed

Elliott, T

1993-01-01

In a previous search for mutants of Salmonella typhimurium that are defective in heme synthesis, one class that is apparently defective in 5-aminolevulinic acid (ALA) uptake (alu) was found. Here, I describe the characterization of these mutations. The mutations all map to a single locus near 77.5 min on the genetic map, which is transcribed counterclockwise. Nutritional tests, genetic and physical mapping, and partial DNA sequence analysis revealed that alu mutants are defective in a periplasmic binding protein-dependent permease that also transports dipeptides, encoded by the dpp operon. The uptake of labeled ALA is defective in dpp mutants and is markedly increased in a strain that has elevated transcription of the dpp locus. Unlabeled L-leucyl-glycine competes with labeled ALA for uptake. In a strain carrying both a dpp-lac operon fusion and a functional copy of the dpp locus, the expression of beta-galactosidase is not induced by ALA, nor, in a hemL mutant, does expression of dpp change substantially during starvation for ALA. The dipeptide permease displays a relaxed substrate specificity that allows transport of the important nonpeptide nutrient ALA, whose structure is closely related to that of glycyl-glycine.

Nanolock-Nanopore Facilitated Digital Diagnostics of Cancer Driver Mutation in Tumor Tissue.

PubMed

Wang, Yong; Tian, Kai; Shi, Ruicheng; Gu, Amy; Pennella, Michael; Alberts, Lindsey; Gates, Kent S; Li, Guangfu; Fan, Hongxin; Wang, Michael X; Gu, Li-Qun

2017-07-28

Cancer driver mutations are clinically significant biomarkers. In precision medicine, accurate detection of these oncogenic changes in patients would enable early diagnostics of cancer, individually tailored targeted therapy, and precise monitoring of treatment response. Here we investigated a novel nanolock-nanopore method for single-molecule detection of a serine/threonine protein kinase gene BRAF V600E mutation in tumor tissues of thyroid cancer patients. The method lies in a noncovalent, mutation sequence-specific nanolock. We found that the nanolock formed on the mutant allele/probe duplex can separate the duplex dehybridization procedure into two sequential steps in the nanopore. Remarkably, this stepwise unzipping kinetics can produce a unique nanopore electric marker, with which a single DNA molecule of the cancer mutant allele can be unmistakably identified in various backgrounds of the normal wild-type allele. The single-molecule sensitivity for mutant allele enables both binary diagnostics and quantitative analysis of mutation occurrence. In the current configuration, the method can detect the BRAF V600E mutant DNA lower than 1% in the tumor tissues. The nanolock-nanopore method can be adapted to detect a broad spectrum of both transversion and transition DNA mutations, with applications from diagnostics to targeted therapy.

Functional Analysis of the Accessory Protein TapA in Bacillus subtilis Amyloid Fiber Assembly

PubMed Central

Romero, Diego; Vlamakis, Hera; Losick, Richard

2014-01-01

Bacillus subtilis biofilm formation relies on the assembly of a fibrous scaffold formed by the protein TasA. TasA polymerizes into highly stable fibers with biochemical and morphological features of functional amyloids. Previously, we showed that assembly of TasA fibers requires the auxiliary protein TapA. In this study, we investigated the roles of TapA sequences from the C-terminal and N-terminal ends and TapA cysteine residues in its ability to promote the assembly of TasA amyloid-like fibers. We found that the cysteine residues are not essential for the formation of TasA fibers, as their replacement by alanine residues resulted in only minor defects in biofilm formation. Mutating sequences in the C-terminal half had no effect on biofilm formation. However, we identified a sequence of 8 amino acids in the N terminus that is key for TasA fiber formation. Strains expressing TapA lacking these 8 residues were completely defective in biofilm formation. In addition, this TapA mutant protein exhibited a dominant negative effect on TasA fiber formation. Even in the presence of wild-type TapA, the mutant protein inhibited fiber assembly in vitro and delayed biofilm formation in vivo. We propose that this 8-residue sequence is crucial for the formation of amyloid-like fibers on the cell surface, perhaps by mediating the interaction between TapA or TapA and TasA molecules. PMID:24488317

Functional analysis of the accessory protein TapA in Bacillus subtilis amyloid fiber assembly.

PubMed

Romero, Diego; Vlamakis, Hera; Losick, Richard; Kolter, Roberto

2014-04-01

Bacillus subtilis biofilm formation relies on the assembly of a fibrous scaffold formed by the protein TasA. TasA polymerizes into highly stable fibers with biochemical and morphological features of functional amyloids. Previously, we showed that assembly of TasA fibers requires the auxiliary protein TapA. In this study, we investigated the roles of TapA sequences from the C-terminal and N-terminal ends and TapA cysteine residues in its ability to promote the assembly of TasA amyloid-like fibers. We found that the cysteine residues are not essential for the formation of TasA fibers, as their replacement by alanine residues resulted in only minor defects in biofilm formation. Mutating sequences in the C-terminal half had no effect on biofilm formation. However, we identified a sequence of 8 amino acids in the N terminus that is key for TasA fiber formation. Strains expressing TapA lacking these 8 residues were completely defective in biofilm formation. In addition, this TapA mutant protein exhibited a dominant negative effect on TasA fiber formation. Even in the presence of wild-type TapA, the mutant protein inhibited fiber assembly in vitro and delayed biofilm formation in vivo. We propose that this 8-residue sequence is crucial for the formation of amyloid-like fibers on the cell surface, perhaps by mediating the interaction between TapA or TapA and TasA molecules.

Identification of a classical mutant in the industrial host Aspergillus niger by systems genetics: LaeA is required for citric acid production and regulates the formation of some secondary metabolites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Jing; Arentshorst, Mark; Nair, Deepa

Rapid acidification of the culture medium by the production of organic acids and the production of acid-induced proteases are key characteristics of the filamentous fungus Aspergillus niger. The D15 mutant of A. niger is non-acidifying mutant and used often for the expression of recombinant proteins in A. niger, because of its reduced production of extracellular proteases under non-acidic conditions. In this study, the D15 mutant is characterized in detail. Strongly reduced levels of citric and oxalic acid were observed in the D15 mutant both in shake flask cultures and in controlled batch cultivations. To identify the mutation in the D15more » mutant, we successfully combined high-throughput sequencing (Illumina) with bulk segregant analysis. Because of the lack of a sexual cycle for A. niger, the parasexual cycle was used to generate a pool of segregants. From the 52 single nucleotide polymorphisms (SNPs) between the parental strains, three SNPs were homozygous in the genomic DNA of pool of segregants. These three SNPs mapped to all the right arm of chromosome II, indicating that this region contains the genetic locus affecting the phenotype related to acid production. Of the three SNPs, one mutation resulted in a missense mutation in the gene encoding the A. niger homologue of the A. nidulans methyltransferase gene laeA. Complementation analysis of the original mutant with the laeA gene and targeted disruption of laeA further confirmed that LaeA is involved in citric acid production in A. niger lab (N402) and citric acid production strains (ATCC 11414). Analysis of the secondary metabolite (SM) profile of the laeA mutants indicate that LaeA is required for the production of several SMs (asperrubrol, atromentin and JBIR86), but deletion of laeA also resulted in the presence of SMs (aspernigrin A/B and BMS-192548) that were not detected in the wild-type strain. The levels of ten other SMs were not strongly affected as a result of laeA deletion indicating that only a limited number of SM gene clusters are controlled by LaeA activity.« less

Structural, molecular motions, and free-energy landscape of Leishmania sterol-14α-demethylase wild type and drug resistant mutant: a comparative molecular dynamics study.

PubMed

Vijayakumar, Saravanan; Das, Pradeep

2018-04-18

Sterol-14α-demethylase (CYP51) is an ergosterol pathway enzyme crucial for the survival of infectious Leishmania parasite. Recent high-throughput metabolomics and whole genome sequencing study revealed amphotericin B resistance in Leishmania is indeed due to mutation in CYP51. The residue of mutation (asparagine 176) is conserved across the kinetoplastidae and not in yeast or humans, portraying its functional significance. In order to understand the possible cause for the resistance, knowledge of structural changes due to mutation is of high importance. To shed light on the structural changes of wild and mutant CYP51, we conducted comparative molecular dynamics simulation study. The active site, substrate biding cavity, substrate channel entrance (SCE), and cavity involving the mutated site were studied based on basic parameters and large concerted molecular motions derived from essential dynamics analyses of 100 ns simulation. Results indicated that mutant CYP51 is stable and less compact than the wild type. Correspondingly, the solvent accessible surface area (SASA) of the mutant was found to be increased, especially in active site and cavities not involving the mutation site. Free-energy landscape analysis disclosed mutant to have a rich conformational diversity than wild type, with various free-energy conformations of mutant having SASA greater than wild type with SCE open. More residues were found to interact with the mutant CYP51 upon docking of substrate to both the wild and mutant CYP51. These results indicate that, relative to wild type, the N176I mutation of CYP51 in Leishmania mexicana could possibly favor increased substrate binding efficiency.

Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

PubMed Central

González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

2004-01-01

The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

Transgenic mice expressing mutant Pinin exhibit muscular dystrophy, nebulin deficiency and elevated expression of slow-type muscle fiber genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai

Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species.more » The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.« less

Trafficking Defect and Proteasomal Degradation Contribute to the Phenotype of a Novel KCNH2 Long QT Syndrome Mutation

PubMed Central

Mihic, Anton; Chauhan, Vijay S.; Gao, Xiaodong; Oudit, Gavin Y.; Tsushima, Robert G.

2011-01-01

The Kv11.1 (hERG) K+ channel plays a fundamental role in cardiac repolarization. Missense mutations in KCNH2, the gene encoding Kv11.1, cause long QT syndrome (LQTS) and frequently cause channel trafficking-deficiencies. This study characterized the properties of a novel KCNH2 mutation discovered in a LQT2 patient resuscitated from a ventricular fibrillation arrest. Proband genotyping was performed by SSCP and DNA sequencing. The electrophysiological and biochemical properties of the mutant channel were investigated after expression in HEK293 cells. The proband manifested a QTc of 554 ms prior to electrolyte normalization. Mutation analysis revealed an autosomal dominant frameshift mutation at proline 1086 (P1086fs+32X; 3256InsG). Co-immunoprecipitation demonstrated that wild-type Kv11.1 and mutant channels coassemble. Western blot showed that the mutation did not produce mature complex-glycosylated Kv11.1 channels and coexpression resulted in reduced channel maturation. Electrophysiological recordings revealed mutant channel peak currents to be similar to untransfected cells. Co-expression of channels in a 1∶1 ratio demonstrated dominant negative suppression of peak Kv11.1 currents. Immunocytochemistry confirmed that mutant channels were not present at the plasma membrane. Mutant channel trafficking rescue was attempted by incubation at reduced temperature or with the pharmacological agents E-4031. These treatments did not significantly increase peak mutant currents or induce the formation of mature complex-glycosylated channels. The proteasomal inhibitor lactacystin increased the protein levels of the mutant channels demonstrating proteasomal degradation, but failed to induce mutant Kv11.1 protein trafficking. Our study demonstrates a novel dominant-negative Kv11.1 mutation, which results in degraded non-functional channels leading to a LQT2 phenotype. PMID:21483829

Involvement of signal peptidase I in Streptococcus sanguinis biofilm formation

PubMed Central

Ge, Xiuchun; Stone, Victoria; Zhu, Bin; Kitten, Todd

2017-01-01

Biofilm accounts for 65–80 % of microbial infections in humans. Considerable evidence links biofilm formation by oral microbiota to oral disease and consequently systemic infections. Streptococcus sanguinis, a Gram-positive bacterium, is one of the most abundant species of the oral microbiota and it contributes to biofilm development in the oral cavity. Due to its altered biofilm formation, we investigated a biofilm mutant, ΔSSA_0351, that is deficient in type I signal peptidase (SPase) in this study. Although the growth curve of the ΔSSA_0351 mutant showed no significant difference from that of the wild-type strain SK36, biofilm assays using both microtitre plate assay and confocal laser scanning microscopy (CLSM) confirmed a sharp reduction in biofilm formation in the mutant compared to the wild-type strain and the paralogous mutant ΔSSA_0849. Scanning electron microscopy (SEM) revealed remarkable differences in the cell surface morphologies and chain length of the ΔSSA_0351 mutant compared with those of the wild-type strain. Transcriptomic and proteomic assays using RNA sequencing and mass spectrometry, respectively, were conducted on the ΔSSA_0351 mutant to evaluate the functional impact of SPase on biofilm formation. Subsequently, bioinformatics analysis revealed a number of proteins that were differentially regulated in the ΔSSA_0351 mutant, narrowing down the list of SPase substrates involved in biofilm formation to lactate dehydrogenase (SSA_1221) and a short-chain dehydrogenase (SSA_0291). With further experimentation, this list defined the link between SSA_0351-encoded SPase, cell wall biosynthesis and biofilm formation. PMID:28869408

Circularized Chromosome with a Large Palindromic Structure in Streptomyces griseus Mutants

PubMed Central

Uchida, Tetsuya; Ishihara, Naoto; Zenitani, Hiroyuki; Hiratsu, Keiichiro; Kinashi, Haruyasu

2004-01-01

Streptomyces linear chromosomes display various types of rearrangements after telomere deletion, including circularization, arm replacement, and amplification. We analyzed the new chromosomal deletion mutants Streptomyces griseus 301-22-L and 301-22-M. In these mutants, chromosomal arm replacement resulted in long terminal inverted repeats (TIRs) at both ends; different sizes were deleted again and recombined inside the TIRs, resulting in a circular chromosome with an extremely large palindrome. Short palindromic sequences were found in parent strain 2247, and these sequences might have played a role in the formation of this unique structure. Dynamic structural changes of Streptomyces linear chromosomes shown by this and previous studies revealed extraordinary strategies of members of this genus to keep a functional chromosome, even if it is linear or circular. PMID:15150216

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

PubMed

Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

Determination of the amino acid change responsible for the nontoxic, cross-reactive exotoxin A protein (CRM 66) of Pseudomonas aeruginosa PAO-PR1.

PubMed Central

Wick, M J; Iglewski, B H

1988-01-01

Analysis of purified exotoxin A from parental Pseudomonas aeruginosa PAO1 and mutant strain PAO-PR1, which produces enzymatically inactive exotoxin A (CRM 66), revealed that CRM 66 lost 90% of parental enzymatic activity. Nucleotide sequence analysis of cloned exotoxin A genes showed a single amino acid substitution in CRM 66. Position 426 in the mature protein of parental (PAO1) exotoxin A is histidine, whereas in CRM 66, it is tyrosine. Images PMID:3141388

Next-generation sequencing for targeted discovery of rare mutations in rice

USDA-ARS?s Scientific Manuscript database

Advances in DNA sequencing (i.e., next-generation sequencing, NGS) have greatly increased the power and efficiency of detecting rare mutations in large mutant populations. Targeting Induced Local Lesions in Genomes (TILLING) is a reverse genetics approach for identifying gene mutations resulting fro...

Identification of a functional capsule locus in Streptococcus mitis.

PubMed

Rukke, H V; Hegna, I K; Petersen, F C

2012-04-01

The polysaccharide capsule of Streptococcus pneumoniae is a hallmark for virulence in humans. In its close relative Streptococcus mitis, a common human commensal, analysis of the sequenced genomes of six strains revealed the presence of a putative capsule locus in four of them. We constructed an isogenic S. mitis mutant from the type strain that lacked the 19 open reading frames in the capsule locus (Δcps mutant), using a deletion strategy similar to previous capsule functional studies in S. pneumoniae. Transmission electron microscopy and atomic force microscopy revealed a capsule-like structure in the S. mitis type strain that was absent or reduced in the Δcps mutant. Since S. mitis are predominant oral colonizers of tooth surfaces, we addressed the relevance of the capsule locus for the S. mitis overall surface properties, autoaggregation and biofilm formation. The capsule deletion resulted in a mutant with approximately two-fold increase in hydrophobicity. Binding to the Stains-all cationic dye was reduced by 40%, suggesting a reduction in the overall negative surface charge of the mutant. The mutant exhibited also increased autoaggregation in coaggregation buffer, and up to six-fold increase in biofilm levels. The results suggested that the capsule locus is associated with production of a capsule-like structure in S. mitis and indicated that the S. mitis capsule-like structure may confer surface attributes similar to those associated with the capsule in S. pneumoniae. © 2011 John Wiley & Sons A/S.

Characterization of a Thermo-Inducible Chlorophyll-Deficient Mutant in Barley.

PubMed

Wang, Rong; Yang, Fei; Zhang, Xiao-Qi; Wu, Dianxin; Tan, Cong; Westcott, Sharon; Broughton, Sue; Li, Chengdao; Zhang, Wenying; Xu, Yanhao

2017-01-01

Leaf color is an important trait for not only controlling crop yield but also monitoring plant status under temperature stress. In this study, a thermo-inducible chlorophyll-deficient mutant, named V-V-Y, was identified from a gamma-radiated population of the barley variety Vlamingh. The leaves of the mutant were green under normal growing temperature but turned yellowish under high temperature in the glasshouse experiment. The ratio of chlorophyll a and chlorophyll b in the mutant declined much faster in the first 7-9 days under heat treatment. The leaves of V-V-Y turned yellowish but took longer to senesce under heat stress in the field experiment. Genetic analysis indicated that a single nuclear gene controlled the mutant trait. The mutant gene ( vvy ) was mapped to the long arm of chromosome 4H between SNP markers 1_0269 and 1_1531 with a genetic distance of 2.2 cM and a physical interval of 9.85 Mb. A QTL for grain yield was mapped to the same interval and explained 10.4% of the yield variation with a LOD score of 4. This QTL is coincident with the vvy gene interval that is responsible for the thermo-inducible chlorophyll-deficient trait. Fine mapping, based on the barley reference genome sequence, further narrowed the vvy gene to a physical interval of 0.428 Mb with 11 annotated genes. This is the first report of fine mapping a thermo-inducible chlorophyll-deficient gene in barley.

Improving Xylose Utilization of Saccharomyces cerevisiae by Expressing the MIG1 Mutant from the Self-Flocculating Yeast SPSC01.

PubMed

Xu, Jian-Ren; Zhao, Xin-Qing; Liu, Chen-Guang; Bai, Feng-Wu

2018-01-01

The major carbohydrate components of lignocellulosic biomass are cellulose and hemicelluloses. Saccharomyces cerevisiae cannot efficiently utilize xylose derived upon the hydrolysis of hemicelluloses. Although engineering the yeast with xylose metabolic pathway has been intensively studied, challenges are still ahead for developing robust strains for lignocellulosic bioethanol production. The main objective of this study was to reveal the role of the MIG1 mutant isolated from the self-flocculating S. cerevisiae SPSC01 in xylose utilization, glucose repression and ethanol fermentation by S. cerevisiae. The MIG1 mutant was amplified from S. cerevisiae SPSC01 by PCR and MIG1- overexpression-cassette was transformed into S. cerevisiae S288c and xylose-metabolizing strain YB-2625-T through homologous recombination. Yeast growth was measured by colony assay on plates with or without xylose supplementation. Then xylose utilization and ethanol production were further evaluated through flask fermentation when mixed sugars of glucose and xylose at 3:1 and 2:1, respectively, were supplied. Fermentation products were detected by HPLC, and activities of xylose reductase (XR), xylitol dehydrogenase (XDH) and xylulokinase (XK) were also measured. The transcription of genes regulated by the expression of the MIG1 mutant was analyzed by RTqPCR. Evolutionary relationship of various MIG1s was developed by gene sequencing and sequence alignment. No difference was observed for S288c growing with xylose when it was engineered with the overexpression or deletion of its native MIG1, but its growth was enhanced when overexpressing the MIG1 mutant from SPSC01. The submerged culture of YB-2625-T MIG1-SPSC engineered with xylose-metabolic pathway and the MIG1 mutant indicated that xylitol accumulation was decreased, and consequently, more biomass was accumulated. Furthermore, improved activities of the key enzymes such as XR, XDH and XK were detected in YB-2625-T MIG1-SPSC. Evolutionary analysis of MIG1s amplified from S. cerevisiae strains commonly used for ethanol production revealed a close relationship of SPSC01 and YB-2625. Our results demonstrated the effect of the overexpression of the MIG1 mutant from SPSC01 on xylose utilization of S. cerevisiae. This study could be an alternative strategy for engineering S. cerevisiae with improved xylose utilization. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Novel genetic tools for studying food-borne Salmonella.

PubMed

Andrews-Polymenis, Helene L; Santiviago, Carlos A; McClelland, Michael

2009-04-01

Nontyphoidal Salmonellae are highly prevalent food-borne pathogens. High-throughput sequencing of Salmonella genomes is expanding our knowledge of the evolution of serovars and epidemic isolates. Genome sequences have also allowed the creation of complete microarrays. Microarrays have improved the throughput of in vivo expression technology (IVET) used to uncover promoters active during infection. In another method, signature tagged mutagenesis (STM), pools of mutants are subjected to selection. Changes in the population are monitored on a microarray, revealing genes under selection. Complete genome sequences permit the construction of pools of targeted in-frame deletions that have improved STM by minimizing the number of clones and the polarity of each mutant. Together, genome sequences and the continuing development of new tools for functional genomics will drive a revolution in the understanding of Salmonellae in many different niches that are critical for food safety.

Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

PubMed

Reid-Bayliss, Kate S; Loeb, Lawrence A

2017-08-29

Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

Regulatory link between DNA methylation and active demethylation in Arabidopsis

PubMed Central

Lei, Mingguang; Zhang, Huiming; Julian, Russell; Tang, Kai; Xie, Shaojun; Zhu, Jian-Kang

2015-01-01

De novo DNA methylation through the RNA-directed DNA methylation (RdDM) pathway and active DNA demethylation play important roles in controlling genome-wide DNA methylation patterns in plants. Little is known about how cells manage the balance between DNA methylation and active demethylation activities. Here, we report the identification of a unique RdDM target sequence, where DNA methylation is required for maintaining proper active DNA demethylation of the Arabidopsis genome. In a genetic screen for cellular antisilencing factors, we isolated several REPRESSOR OF SILENCING 1 (ros1) mutant alleles, as well as many RdDM mutants, which showed drastically reduced ROS1 gene expression and, consequently, transcriptional silencing of two reporter genes. A helitron transposon element (TE) in the ROS1 gene promoter negatively controls ROS1 expression, whereas DNA methylation of an RdDM target sequence between ROS1 5′ UTR and the promoter TE region antagonizes this helitron TE in regulating ROS1 expression. This RdDM target sequence is also targeted by ROS1, and defective DNA demethylation in loss-of-function ros1 mutant alleles causes DNA hypermethylation of this sequence and concomitantly causes increased ROS1 expression. Our results suggest that this sequence in the ROS1 promoter region serves as a DNA methylation monitoring sequence (MEMS) that senses DNA methylation and active DNA demethylation activities. Therefore, the ROS1 promoter functions like a thermostat (i.e., methylstat) to sense DNA methylation levels and regulates DNA methylation by controlling ROS1 expression. PMID:25733903

Microfluidics for rapid detection of isocitrate dehydrogenase 1 mutation for intraoperative application.

PubMed

Aibaidula, Abudumijiti; Zhao, Wang; Wu, Jin-Song; Chen, Hong; Shi, Zhi-Feng; Zheng, Lu-Lu; Mao, Ying; Zhou, Liang-Fu; Sui, Guo-Dong

2016-06-01

OBJECT Conventional methods for isocitrate dehydrogenase 1 (IDH1) detection, such as DNA sequencing and immunohistochemistry, are time- and labor-consuming and cannot be applied for intraoperative analysis. To develop a new approach for rapid analysis of IDH1 mutation from tiny tumor samples, this study used microfluidics as a method for IDH1 mutation detection. METHODS Forty-seven glioma tumor samples were used; IDH1 mutation status was investigated by immunohistochemistry and DNA sequencing. The microfluidic device was fabricated from polydimethylsiloxane following standard soft lithography. The immunoanalysis was conducted in the microfluidic chip. Fluorescence images of the on-chip microcolumn taken by the charge-coupled device camera were collected as the analytical results readout. Fluorescence signals were analyzed by NIS-Elements software to gather detailed information about the IDH1 concentration in the tissue samples. RESULTS DNA sequencing identified IDH1 R132H mutation in 33 of 47 tumor samples. The fluorescence signal for IDH1-mutant samples was 5.49 ± 1.87 compared with 3.90 ± 1.33 for wild type (p = 0.005). Thus, microfluidics was capable of distinguishing IDH1-mutant tumor samples from wild-type samples. When the cutoff value was 4.11, the sensitivity of microfluidics was 87.9% and the specificity was 64.3%. CONCLUSIONS This new approach was capable of analyzing IDH1 mutation status of tiny tissue samples within 30 minutes using intraoperative microsampling. This approach might also be applied for rapid pathological diagnosis of diffuse gliomas, thus guiding personalized resection.

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Assisted Design of Antibody and Protein Therapeutics (ADAPT)

PubMed Central

Vivcharuk, Victor; Baardsnes, Jason; Deprez, Christophe; Sulea, Traian; Jaramillo, Maria; Corbeil, Christopher R.; Mullick, Alaka; Magoon, Joanne; Marcil, Anne; Durocher, Yves; O’Connor-McCourt, Maureen D.

2017-01-01

Effective biologic therapeutics require binding affinities that are fine-tuned to their disease-related molecular target. The ADAPT (Assisted Design of Antibody and Protein Therapeutics) platform aids in the selection of mutants that improve/modulate the affinity of antibodies and other biologics. It uses a consensus z-score from three scoring functions and interleaves computational predictions with experimental validation, significantly enhancing the robustness of the design and selection of mutants. The platform was tested on three antibody Fab-antigen systems that spanned a wide range of initial binding affinities: bH1-VEGF-A (44 nM), bH1-HER2 (3.6 nM) and Herceptin-HER2 (0.058 nM). Novel triple mutants were obtained that exhibited 104-, 46- and 32-fold improvements in binding affinity for each system, respectively. Moreover, for all three antibody-antigen systems over 90% of all the intermediate single and double mutants that were designed and tested showed higher affinities than the parent sequence. The contributions of the individual mutants to the change in binding affinity appear to be roughly additive when combined to form double and triple mutants. The new interactions introduced by the affinity-enhancing mutants included long-range electrostatics as well as short-range nonpolar interactions. This diversity in the types of new interactions formed by the mutants was reflected in SPR kinetics that showed that the enhancements in affinities arose from increasing on-rates, decreasing off-rates or a combination of the two effects, depending on the mutation. ADAPT is a very focused search of sequence space and required only 20–30 mutants for each system to be made and tested to achieve the affinity enhancements mentioned above. PMID:28750054

Multi-source and ontology-based retrieval engine for maize mutant phenotypes

USDA-ARS?s Scientific Manuscript database

In the midst of this genomics era, major plant genome databases are collecting massive amounts of heterogeneous information, including sequence data, gene product information, images of mutant phenotypes, etc., as well as textual descriptions of many of these entities. While basic browsing and sear...

Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same

DOEpatents

Oda, Michael N [Benicia, CA; Forte, Trudy M [Berkeley, CA

2007-05-29

Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.

Updating the Micro-Tom TILLING platform.

PubMed

Okabe, Yoshihiro; Ariizumi, Tohru; Ezura, Hiroshi

2013-03-01

The dwarf tomato variety Micro-Tom is regarded as a model system for functional genomics studies in tomato. Various tomato genomic tools in the genetic background of Micro-Tom have been established, such as mutant collections, genome information and a metabolomic database. Recent advances in tomato genome sequencing have brought about a significant need for reverse genetics tools that are accessible to the larger community, because a great number of gene sequences have become available from public databases. To meet the requests from the tomato research community, we have developed the Micro-Tom Targeting-Induced Local Lesions IN Genomes (TILLING) platform, which is comprised of more than 5000 EMS-mutagenized lines. The platform serves as a reverse genetics tool for efficiently identifying mutant alleles in parallel with the development of Micro-Tom mutant collections. The combination of Micro-Tom mutant libraries and the TILLING approach enables researchers to accelerate the isolation of desirable mutants for unraveling gene function or breeding. To upgrade the genomic tool of Micro-Tom, the development of a new mutagenized population is underway. In this paper, the current status of the Micro-Tom TILLING platform and its future prospects are described.

Genome-wide analytical approaches for reverse metabolic engineering of industrially relevant phenotypes in yeast

PubMed Central

Oud, Bart; Maris, Antonius J A; Daran, Jean-Marc; Pronk, Jack T

2012-01-01

Successful reverse engineering of mutants that have been obtained by nontargeted strain improvement has long presented a major challenge in yeast biotechnology. This paper reviews the use of genome-wide approaches for analysis of Saccharomyces cerevisiae strains originating from evolutionary engineering or random mutagenesis. On the basis of an evaluation of the strengths and weaknesses of different methods, we conclude that for the initial identification of relevant genetic changes, whole genome sequencing is superior to other analytical techniques, such as transcriptome, metabolome, proteome, or array-based genome analysis. Key advantages of this technique over gene expression analysis include the independency of genome sequences on experimental context and the possibility to directly and precisely reproduce the identified changes in naive strains. The predictive value of genome-wide analysis of strains with industrially relevant characteristics can be further improved by classical genetics or simultaneous analysis of strains derived from parallel, independent strain improvement lineages. PMID:22152095

Genome-wide analytical approaches for reverse metabolic engineering of industrially relevant phenotypes in yeast.

PubMed

Oud, Bart; van Maris, Antonius J A; Daran, Jean-Marc; Pronk, Jack T

2012-03-01

Successful reverse engineering of mutants that have been obtained by nontargeted strain improvement has long presented a major challenge in yeast biotechnology. This paper reviews the use of genome-wide approaches for analysis of Saccharomyces cerevisiae strains originating from evolutionary engineering or random mutagenesis. On the basis of an evaluation of the strengths and weaknesses of different methods, we conclude that for the initial identification of relevant genetic changes, whole genome sequencing is superior to other analytical techniques, such as transcriptome, metabolome, proteome, or array-based genome analysis. Key advantages of this technique over gene expression analysis include the independency of genome sequences on experimental context and the possibility to directly and precisely reproduce the identified changes in naive strains. The predictive value of genome-wide analysis of strains with industrially relevant characteristics can be further improved by classical genetics or simultaneous analysis of strains derived from parallel, independent strain improvement lineages. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Molecular and bioinformatic analysis of the FB-NOF transposable element.

PubMed

Badal, Martí; Portela, Anna; Xamena, Noel; Cabré, Oriol

2006-04-12

The Drosophila melanogaster transposable element FB-NOF is known to play a role in genome plasticity through the generation of all sort of genomic rearrangements. Moreover, several insertional mutants due to FB mobilizations have been reported. Its structure and sequence, however, have been poorly studied mainly as a consequence of the long, complex and repetitive sequence of FB inverted repeats. This repetitive region is composed of several 154 bp blocks, each with five almost identical repeats. In this paper, we report the sequencing process of 2 kb long FB inverted repeats of a complete FB-NOF element, with high precision and reliability. This achievement has been possible using a new map of the FB repetitive region, which identifies unambiguously each repeat with new features that can be used as landmarks. With this new vision of the element, a list of FB-NOF in the D. melanogaster genomic clones has been done, improving previous works that used only bioinformatic algorithms. The availability of many FB and FB-NOF sequences allowed an analysis of the FB insertion sequences that showed no sequence specificity, but a preference for A/T rich sequences. The position of NOF into FB is also studied, revealing that it is always located after a second repeat in a random block. With the results of this analysis, we propose a model of transposition in which NOF jumps from FB to FB, using an unidentified transposase enzyme that should specifically recognize the second repeat end of the FB blocks.

DWARF – a data warehouse system for analyzing protein families

PubMed Central

Fischer, Markus; Thai, Quan K; Grieb, Melanie; Pleiss, Jürgen

2006-01-01

Background The emerging field of integrative bioinformatics provides the tools to organize and systematically analyze vast amounts of highly diverse biological data and thus allows to gain a novel understanding of complex biological systems. The data warehouse DWARF applies integrative bioinformatics approaches to the analysis of large protein families. Description The data warehouse system DWARF integrates data on sequence, structure, and functional annotation for protein fold families. The underlying relational data model consists of three major sections representing entities related to the protein (biochemical function, source organism, classification to homologous families and superfamilies), the protein sequence (position-specific annotation, mutant information), and the protein structure (secondary structure information, superimposed tertiary structure). Tools for extracting, transforming and loading data from public available resources (ExPDB, GenBank, DSSP) are provided to populate the database. The data can be accessed by an interface for searching and browsing, and by analysis tools that operate on annotation, sequence, or structure. We applied DWARF to the family of α/β-hydrolases to host the Lipase Engineering database. Release 2.3 contains 6138 sequences and 167 experimentally determined protein structures, which are assigned to 37 superfamilies 103 homologous families. Conclusion DWARF has been designed for constructing databases of large structurally related protein families and for evaluating their sequence-structure-function relationships by a systematic analysis of sequence, structure and functional annotation. It has been applied to predict biochemical properties from sequence, and serves as a valuable tool for protein engineering. PMID:17094801

MR textural analysis on T2 FLAIR images for the prediction of true oligodendroglioma by the 2016 WHO genetic classification.

PubMed

Rui, Wenting; Ren, Yan; Wang, Yin; Gao, Xinyi; Xu, Xiao; Yao, Zhenwei

2017-11-15

The genetic status of 1p/19q is important for differentiating oligodendroglioma, isocitrate-dehydrogenase (IDH)-mutant, and 1p/19q-codeleted from diffuse astrocytoma, IDH-mutant according to the 2016 World Health Organization (WHO) criteria. To assess the value of magnetic resonance textural analysis (MRTA) on T 2 fluid-attenuated inversion recovery (FLAIR) images for making a genetically integrated diagnosis of true oligodendroglioma by WHO guidelines. Retrospective case control. In all, there were 54 patients with a histopathological diagnosis of diffuse glioma (grade II). All were tested for IDH and 1p/19q. 3.0T, including T 2 FLAIR sequence, axial T 1 -weighted, and T 2 -weighted sequence. MRTA on a representative tumor region of interest (ROI) was made on preoperative T 2 FLAIR images around the area that had the largest diameter of solid tumor using Omni Kinetics software. Differences between IDH-mutant and 1p/19q-codeleted and IDH-mutant and 1p/19q-intact gliomas were analyzed by the Mann-Whitney rank sum test. Receiver operating characteristic curves (ROC) were created to assess MRTA diagnostic performance. Sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated with a cutoff value according to the Youden Index. Comparisons demonstrated significant differences in kurtosis (P = 0.007), energy (0.008), entropy (0.008), mean deviation (MD) (<0.001), and high gray-level run emphasis (HGLRE) (0.002), cluster shade (0.025), and sum average (0.002). First-order features comprising entropy (area under the curve [AUC] = 0.718, sensitivity = 97.1%) and energy (0.719, 94.1%) had the highest sensitivity but lower specificity (both 45%). Second-order features such as HGLRE (AUC = 0.750, sensitivity = 73.5%, specificity = 80.0%) and sum average (0.751, 70.6%, 80.0%) had relatively higher specificity, and all had AUC >0.7. MD had the highest diagnostic performance, with AUC = 0.878, sensitivity = 94.1%, specificity = 75.0%, PPV = 86.5%, and NPV = 88.2%. MRTA on T 2 FLAIR images may be helpful in identifying oligodendroglioma, IDH-mutant, and 1p/19q-codeleted. 3 Technical Efficacy: Stage 2 J. Magn. Reson. Imaging 2017. © 2017 International Society for Magnetic Resonance in Medicine.

Structural Analysis of Single-Point Mutations Given an RNA Sequence: A Case Study with RNAMute

NASA Astrophysics Data System (ADS)

Churkin, Alexander; Barash, Danny

2006-12-01

We introduce here for the first time the RNAMute package, a pattern-recognition-based utility to perform mutational analysis and detect vulnerable spots within an RNA sequence that affect structure. Mutations in these spots may lead to a structural change that directly relates to a change in functionality. Previously, the concept was tried on RNA genetic control elements called "riboswitches" and other known RNA switches, without an organized utility that analyzes all single-point mutations and can be further expanded. The RNAMute package allows a comprehensive categorization, given an RNA sequence that has functional relevance, by exploring the patterns of all single-point mutants. For illustration, we apply the RNAMute package on an RNA transcript for which individual point mutations were shown experimentally to inactivate spectinomycin resistance in Escherichia coli. Functional analysis of mutations on this case study was performed experimentally by creating a library of point mutations using PCR and screening to locate those mutations. With the availability of RNAMute, preanalysis can be performed computationally before conducting an experiment.

Simultaneous Identification of Potential Pathogenicity Factors of Mycoplasma agalactiae in the Natural Ovine Host by Negative Selection

PubMed Central

Hegde, Shivanand; Hegde, Shrilakshmi; Zimmermann, Martina; Flöck, Martina; Spergser, Joachim; Rosengarten, Renate

2015-01-01

Mycoplasmas possess complex pathogenicity determinants that are largely unknown at the molecular level. Mycoplasma agalactiae serves as a useful model to study the molecular basis of mycoplasma pathogenicity. The generation and in vivo screening of a transposon mutant library of M. agalactiae were employed to unravel its host colonization factors. Tn4001mod mutants were sequenced using a novel sequencing method, and functionally heterogeneous pools containing 15 to 19 selected mutants were screened simultaneously through two successive cycles of sheep intramammary infections. A PCR-based negative selection method was employed to identify mutants that failed to colonize the udders and draining lymph nodes in the animals. A total of 14 different mutants found to be absent from ≥95% of samples were identified and subsequently verified via a second round of stringent confirmatory screening where 100% absence was considered attenuation. Using this criterion, seven mutants with insertions in genes MAG1050, MAG2540, MAG3390, uhpT, eutD, adhT, and MAG4460 were not recovered from any of the infected animals. Among the attenuated mutants, many contain disruptions in hypothetical genes, implying their previously unknown role in M. agalactiae pathogenicity. These data indicate the putative role of functionally different genes, including hypothetical ones, in the pathogenesis of M. agalactiae. Defining the precise functions of the identified genes is anticipated to increase our understanding of M. agalactiae infections and to develop successful intervention strategies against it. PMID:25916984

Plant height revertants of Dominant Semidwarf mutant rice created by low-energy ion irradiation

NASA Astrophysics Data System (ADS)

Liu, Binmei; Wu, Yuejin; Xu, Xue; Song, M.; Zhao, M.; Fu, X. D.

2008-04-01

Dominant Semidwarf mutant rice (Sdd) was obtained from its wild type (WT) by irradiation with a low-energy ion beam. Six tall revertants of Sdd were induced by irradiation. The revertants restored the plant height to that of WT plants. Investigation of the agronomic character and genetic analysis indicate that the revertants are similar to WT plants with putative different inherited mutations. The revertants were checked for DNA differences using the simple sequence repeat technique. Among 408 such primers used, only 2 primers detected mutation sites in the revertants, which provided the molecular evidence for the revertants induced from Sdd. This study indicates that ion irradiation may be used as a mutagen to create revertants for plant architecture studies and could be a new application.

Escherichia coli K-12: a cooperatively developed annotation snapshot—2005

PubMed Central

Riley, Monica; Abe, Takashi; Arnaud, Martha B.; Berlyn, Mary K.B.; Blattner, Frederick R.; Chaudhuri, Roy R.; Glasner, Jeremy D.; Horiuchi, Takashi; Keseler, Ingrid M.; Kosuge, Takehide; Mori, Hirotada; Perna, Nicole T.; Plunkett, Guy; Rudd, Kenneth E.; Serres, Margrethe H.; Thomas, Gavin H.; Thomson, Nicholas R.; Wishart, David; Wanner, Barry L.

2006-01-01

The goal of this group project has been to coordinate and bring up-to-date information on all genes of Escherichia coli K-12. Annotation of the genome of an organism entails identification of genes, the boundaries of genes in terms of precise start and end sites, and description of the gene products. Known and predicted functions were assigned to each gene product on the basis of experimental evidence or sequence analysis. Since both kinds of evidence are constantly expanding, no annotation is complete at any moment in time. This is a snapshot analysis based on the most recent genome sequences of two E.coli K-12 bacteria. An accurate and up-to-date description of E.coli K-12 genes is of particular importance to the scientific community because experimentally determined properties of its gene products provide fundamental information for annotation of innumerable genes of other organisms. Availability of the complete genome sequence of two K-12 strains allows comparison of their genotypes and mutant status of alleles. PMID:16397293

[Completed sequences analysis on the Chinese attenuated yellow fever 17D vaccine strain and the WHO standard yellow fever 17D vaccine strain].

PubMed

Li, Jing; Yu, Yong-Xin; Dong, Guan-Mu

2009-04-01

To compare the molecular characteristics of the Chinese attenuated yellow fever 17D vaccine strain and the WHO reference yellow fever 17D vaccine strain. The primers were designed according to the published nucleotide sequences of YFV 17D strains in GenBank. Total RNA of was extracted by the Trizol and reverse transcripted. The each fragments of the YFV genome were amplified by PCR and sequenced subsequently. The fragments of the 5' and 3' end of the two strains were cloned into the pGEM T-easy vector and then sequenced. The nucleotide acid and amino acid sequences of the homology to both strains were 99% with each other. No obvious nulceotide changes were found in the sequences of the entire genome of each 17D strains. Moreover, there was no obvious changes in the E protein genes. But the E173 of YF17D Tiantan, associted with the virulence, had mutantions. And the two live attenuated yellow fever 17D vaccine strains fell to the same lineage by the phylogenetic analysis. The results indicated that the two attenuated yellow fever 17D vaccine viruses accumulates mutations at a very low frequency and the genomes were relative stable.

Identification and functional characterization of a novel bipartite nuclear localization sequence in ARID1A.

PubMed

Bateman, Nicholas W; Shoji, Yutaka; Conrads, Kelly A; Stroop, Kevin D; Hamilton, Chad A; Darcy, Kathleen M; Maxwell, George L; Risinger, John I; Conrads, Thomas P

2016-01-01

AT-rich interactive domain-containing protein 1A (ARID1A) is a recently identified nuclear tumor suppressor frequently altered in solid tumor malignancies. We have identified a bipartite-like nuclear localization sequence (NLS) that contributes to nuclear import of ARID1A not previously described. We functionally confirm activity using GFP constructs fused with wild-type or mutant NLS sequences. We further show that cyto-nuclear localized, bipartite NLS mutant ARID1A exhibits greater stability than nuclear-localized, wild-type ARID1A. Identification of this undescribed functional NLS within ARID1A contributes vital insights to rationalize the impact of ARID1A missense mutations observed in patient tumors. Copyright © 2015 Elsevier Inc. All rights reserved.

Genome-wide annotation of mutations in a phenotyped mutant library provides an efficient platform for discovery of casual gene mutations

USDA-ARS?s Scientific Manuscript database

Ethyl methanesulfonate (EMS) efficiently generates high-density mutations in genomes. Conventionally, these mutations are identified by techniques that can detect single-nucleotide mismatches in heteroduplexes of individual PCR amplicons. We applied whole-genome sequencing to 256-phenotyped mutant l...

Large scale parallel pyrosequencing technology: PRRSV strain VR-2332 nsp2 deletion mutant stability in swine

USDA-ARS?s Scientific Manuscript database

Genomes from fifteen porcine reproductive and respiratory syndrome virus (PRRSV) isolates were derived simultaneously using 454 pyrosequencing technology. The viral isolates sequenced were from a recent swine study, in which engineered Type 2 prototype PRRSV strain VR-2332 mutants, with 87, 184, 200...

Evolution of a mass spectrometry-grade protease with PTM-directed specificity.

PubMed

Tran, Duc T; Cavett, Valerie J; Dang, Vuong Q; Torres, Héctor L; Paegel, Brian M

2016-12-20

Mapping posttranslational modifications (PTMs), which diversely modulate biological functions, represents a significant analytical challenge. The centerpiece technology for PTM site identification, mass spectrometry (MS), requires proteolytic cleavage in the vicinity of a PTM to yield peptides for sequencing. This requirement catalyzed our efforts to evolve MS-grade mutant PTM-directed proteases. Citrulline, a PTM implicated in epigenetic and immunological function, made an ideal first target, because citrullination eliminates arginyl tryptic sites. Bead-displayed trypsin mutant genes were translated in droplets, the mutant proteases were challenged to cleave bead-bound fluorogenic probes of citrulline-dependent proteolysis, and the resultant beads (1.3 million) were screened. The most promising mutant efficiently catalyzed citrulline-dependent peptide bond cleavage (k cat /K M = 6.9 × 10 5 M -1 ⋅s -1 ). The resulting C-terminally citrullinated peptides generated characteristic isotopic patterns in MALDI-TOF MS, and both a fragmentation product y 1 ion corresponding to citrulline (176.1030 m/z) and diagnostic peak pairs in the extracted ion chromatograms of LC-MS/MS analysis. Using these signatures, we identified citrullination sites in protein arginine deiminase 4 (12 sites) and in fibrinogen (25 sites, two previously unknown). The unique mass spectral features of PTM-dependent proteolytic digest products promise a generalized PTM site-mapping strategy based on a toolbox of such mutant proteases, which are now accessible by laboratory evolution.

New applications of CRISPR/Cas9 system on mutant DNA detection.

PubMed

Jia, Chenqiang; Huai, Cong; Ding, Jiaqi; Hu, Lingna; Su, Bo; Chen, Hongyan; Lu, Daru

2018-01-30

The detection of mutant DNA is critical for precision medicine, but low-frequency DNA mutation is very hard to be determined. CRISPR/Cas9 is a robust tool for in vivo gene editing, and shows the potential for precise in vitro DNA cleavage. Here we developed a DNA mutation detection system based on CRISPR/Cas9 that can detect gene mutation efficiently even in a low-frequency condition. The system of CRISPR/Cas9 cleavage in vitro showed a high accuracy similar to traditional T7 endonuclease I (T7E1) assay in estimating mutant DNA proportion in the condition of normal frequency. The technology was further used for low-frequency mutant DNA detection of EGFR and HBB somatic mutations. To the end, Cas9 was employed to cleave the wild-type (WT) DNA and to enrich the mutant DNA. Using amplified fragment length polymorphism analysis (AFLPA) and Sanger sequencing, we assessed the sensitivity of CRISPR/Cas9 cleavage-based PCR, in which mutations at 1%-10% could be enriched and detected. When combined with blocker PCR, its sensitivity reached up to 0.1%. Our results suggested that this new application of CRISPR/Cas9 system is a robust and potential method for heterogeneous specimens in the clinical diagnosis and treatment management. Copyright © 2017 Elsevier B.V. All rights reserved.

Possible involvement of inefficient cleavage of preprovasopressin by signal peptidase as a cause for familial central diabetes insipidus.

PubMed Central

Ito, M; Oiso, Y; Murase, T; Kondo, K; Saito, H; Chinzei, T; Racchi, M; Lively, M O

1993-01-01

A transition of G to A at nucleotide position 279 in exon 1 of the vasopressin gene has been identified in patients with familial central diabetes insipidus. The mutation predicts an amino acid substitution of Thr (ACG) for Ala (GCG) at the COOH terminus of the signal peptide in preprovasopression (preproVP). Translation in vitro of wild-type and mutant mRNAs produced 19-kD preproVPs. When translated in the presence of canine pancreatic rough microsomes, wild-type preproVP was converted to a 21-kD protein, whereas the mutant mRNA produced proteins of 21 kD and 23 kD. NH2-terminal amino acid sequence analysis revealed that the 21-kD proteins from the wild-type and the mutants were proVPs generated by the proteolytic cleavage of the 19-residue signal peptide and the addition of carbohydrate. Accordingly, mutant preproVP was cleaved at the correct site after Thr-19, but the efficiency of cleavage by signal peptidase was < 25% that observed for the wild-type preproVP, resulting in the formation of a predominant glycosylated but uncleaved 23-kD product. These data suggest that inefficient processing of preproVP produced by the mutant allele is possibly involved in the pathogenesis of diabetes insipidus in the affected individuals. Images PMID:8514868

Interplay Between Capsule Expression and Uracil Metabolism in Streptococcus pneumoniae D39

PubMed Central

Carvalho, Sandra M.; Kloosterman, Tomas G.; Manzoor, Irfan; Caldas, José; Vinga, Susana; Martinussen, Jan; Saraiva, Lígia M.; Kuipers, Oscar P.; Neves, Ana R.

2018-01-01

Pyrimidine nucleotides play an important role in the biosynthesis of activated nucleotide sugars (NDP-sugars). NDP-sugars are the precursors of structural polysaccharides in bacteria, including capsule, which is a major virulence factor of the human pathogen S. pneumoniae. In this work, we identified a spontaneous non-reversible mutant of strain D39 that displayed a non-producing capsule phenotype. Whole-genome sequencing analysis of this mutant revealed several non-synonymous single base modifications, including in genes of the de novo synthesis of pyrimidines and in the −10 box of capsule operon promoter (Pcps). By directed mutagenesis we showed that the point mutation in Pcps was solely responsible for the drastic decrease in capsule expression. We also demonstrated that D39 subjected to uracil deprivation shows increased biomass and decreased Pcps activity and capsule amounts. Importantly, Pcps expression is further decreased by mutating the first gene of the de novo synthesis of pyrimidines, carA. In contrast, the absence of uracil from the culture medium showed no effect on the spontaneous mutant strain. Co-cultivation of the wild-type and the mutant strain indicated a competitive advantage of the spontaneous mutant (non-producing capsule) in medium devoid of uracil. We propose a model in that uracil may act as a signal for the production of different capsule amounts in S. pneumoniae. PMID:29599757

Interplay Between Capsule Expression and Uracil Metabolism in Streptococcus pneumoniae D39.

PubMed

Carvalho, Sandra M; Kloosterman, Tomas G; Manzoor, Irfan; Caldas, José; Vinga, Susana; Martinussen, Jan; Saraiva, Lígia M; Kuipers, Oscar P; Neves, Ana R

2018-01-01

Pyrimidine nucleotides play an important role in the biosynthesis of activated nucleotide sugars (NDP-sugars). NDP-sugars are the precursors of structural polysaccharides in bacteria, including capsule, which is a major virulence factor of the human pathogen S. pneumoniae . In this work, we identified a spontaneous non-reversible mutant of strain D39 that displayed a non-producing capsule phenotype. Whole-genome sequencing analysis of this mutant revealed several non-synonymous single base modifications, including in genes of the de novo synthesis of pyrimidines and in the -10 box of capsule operon promoter (P cps ). By directed mutagenesis we showed that the point mutation in P cps was solely responsible for the drastic decrease in capsule expression. We also demonstrated that D39 subjected to uracil deprivation shows increased biomass and decreased P cps activity and capsule amounts. Importantly, P cps expression is further decreased by mutating the first gene of the de novo synthesis of pyrimidines, carA . In contrast, the absence of uracil from the culture medium showed no effect on the spontaneous mutant strain. Co-cultivation of the wild-type and the mutant strain indicated a competitive advantage of the spontaneous mutant (non-producing capsule) in medium devoid of uracil. We propose a model in that uracil may act as a signal for the production of different capsule amounts in S. pneumoniae .

Rubisco activase is required for optimal photosynthesis in the green alga Chlamydomonas reinhardtii in a low-CO(2) atmosphere.

PubMed

Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V

2003-12-01

This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.

Identification of novel BRCA founder mutations in Middle Eastern breast cancer patients using capture and Sanger sequencing analysis.

PubMed

Bu, Rong; Siraj, Abdul K; Al-Obaisi, Khadija A S; Beg, Shaham; Al Hazmi, Mohsen; Ajarim, Dahish; Tulbah, Asma; Al-Dayel, Fouad; Al-Kuraya, Khawla S

2016-09-01

Ethnic differences of breast cancer genomics have prompted us to investigate the spectra of BRCA1 and BRCA2 mutations in different populations. The prevalence and effect of BRCA 1 and BRCA 2 mutations in Middle Eastern population is not fully explored. To characterize the prevalence of BRCA mutations in Middle Eastern breast cancer patients, BRCA mutation screening was performed in 818 unselected breast cancer patients using Capture and/or Sanger sequencing. 19 short tandem repeat (STR) markers were used for founder mutation analysis. In our study, nine different types of deleterious mutation were identified in 28 (3.4%) cases, 25 (89.3%) cases in BRCA 1 and 3 (10.7%) cases in BRCA 2. Seven recurrent mutations identified accounted for 92.9% (26/28) of all the mutant cases. Haplotype analysis was performed to confirm c.1140 dupG and c.4136_4137delCT mutations as novel putative founder mutation, accounting for 46.4% (13/28) of all BRCA mutant cases and 1.6% (13/818) of all the breast cancer cases, respectively. Moreover, BRCA 1 mutation was significantly associated with BRCA 1 protein expression loss (p = 0.0005). Our finding revealed that a substantial number of BRCA mutations were identified in clinically high risk breast cancer from Middle East region. Identification of the mutation spectrum, prevalence and founder effect in Middle Eastern population facilitates genetic counseling, risk assessment and development of cost-effective screening strategy. © 2016 UICC.

Defining the ABC of gene essentiality in streptococci.

PubMed

Charbonneau, Amelia R L; Forman, Oliver P; Cain, Amy K; Newland, Graham; Robinson, Carl; Boursnell, Mike; Parkhill, Julian; Leigh, James A; Maskell, Duncan J; Waller, Andrew S

2017-05-31

Utilising next generation sequencing to interrogate saturated bacterial mutant libraries provides unprecedented information for the assignment of genome-wide gene essentiality. Exposure of saturated mutant libraries to specific conditions and subsequent sequencing can be exploited to uncover gene essentiality relevant to the condition. Here we present a barcoded transposon directed insertion-site sequencing (TraDIS) system to define an essential gene list for Streptococcus equi subsp. equi, the causative agent of strangles in horses, for the first time. The gene essentiality data for this group C Streptococcus was compared to that of group A and B streptococci. Six barcoded variants of pGh9:ISS1 were designed and used to generate mutant libraries containing between 33,000-66,000 unique mutants. TraDIS was performed on DNA extracted from each library and data were analysed separately and as a combined master pool. Gene essentiality determined that 19.5% of the S. equi genome was essential. Gene essentialities were compared to those of group A and group B streptococci, identifying concordances of 90.2% and 89.4%, respectively and an overall concordance of 83.7% between the three species. The use of barcoded pGh9:ISS1 to generate mutant libraries provides a highly useful tool for the assignment of gene function in S. equi and other streptococci. The shared essential gene set of group A, B and C streptococci provides further evidence of the close genetic relationships between these important pathogenic bacteria. Therefore, the ABC of gene essentiality reported here provides a solid foundation towards reporting the functional genome of streptococci.

Directed evolution to re-adapt a co-evolved network within an enzyme.

PubMed

Strafford, John; Payongsri, Panwajee; Hibbert, Edward G; Morris, Phattaraporn; Batth, Sukhjeet S; Steadman, David; Smith, Mark E B; Ward, John M; Hailes, Helen C; Dalby, Paul A

2012-01-01

We have previously used targeted active-site saturation mutagenesis to identify a number of transketolase single mutants that improved activity towards either glycolaldehyde (GA), or the non-natural substrate propionaldehyde (PA). Here, all attempts to recombine the singles into double mutants led to unexpected losses of specific activity towards both substrates. A typical trade-off occurred between soluble expression levels and specific activity for all single mutants, but many double mutants decreased both properties more severely suggesting a critical loss of protein stability or native folding. Statistical coupling analysis (SCA) of a large multiple sequence alignment revealed a network of nine co-evolved residues that affected all but one double mutant. Such networks maintain important functional properties such as activity, specificity, folding, stability, and solubility and may be rapidly disrupted by introducing one or more non-naturally occurring mutations. To identify variants of this network that would accept and improve upon our best D469 mutants for activity towards PA, we created a library of random single, double and triple mutants across seven of the co-evolved residues, combining our D469 variants with only naturally occurring mutations at the remaining sites. A triple mutant cluster at D469, E498 and R520 was found to behave synergistically for the specific activity towards PA. Protein expression was severely reduced by E498D and improved by R520Q, yet variants containing both mutations led to improved specific activity and enzyme expression, but with loss of solubility and the formation of inclusion bodies. D469S and R520Q combined synergistically to improve k(cat) 20-fold for PA, more than for any previous transketolase mutant. R520Q also doubled the specific activity of the previously identified D469T to create our most active transketolase mutant to date. Our results show that recombining active-site mutants obtained by saturation mutagenesis can rapidly destabilise critical networks of co-evolved residues, whereas beneficial single mutants can be retained and improved upon by randomly recombining them with natural variants at other positions in the network. Copyright © 2011 Elsevier B.V. All rights reserved.

Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.

PubMed

Wang, Limei; Beer, Steven V

2006-12-01

To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.

Heme oxygenase 1 defects lead to reduced chlorophyll in Brassica napus.

PubMed

Zhu, Lixia; Yang, Zonghui; Zeng, Xinhua; Gao, Jie; Liu, Jie; Yi, Bin; Ma, Chaozhi; Shen, Jinxiong; Tu, Jinxing; Fu, Tingdong; Wen, Jing

2017-04-01

We previously described a Brassica napus chlorophyll-deficient mutant (ygl) with yellow-green seedling leaves and mapped the related gene, BnaC.YGL, to a 0.35 cM region. However, the molecular mechanisms involved in this chlorophyll defect are still unknown. In this study, the BnaC07.HO1 gene (equivalent to BnaC.YGL) was isolated by the candidate gene approach, and its function was confirmed by genetic complementation. Comparative sequencing analysis suggested that BnaC07.HO1 was lost in the mutant, while a long noncoding-RNA was inserted into the promoter of the homologous gene BnaA07.HO1. This insert was widely present in B. napus cultivars and down-regulated BnaA07.HO1 expression. BnaC07.HO1 was highly expressed in the seedling leaves and encoded heme oxygenase 1, which was localized in the chloroplast. Biochemical analysis showed that BnaC07.HO1 can catalyze heme conversion to form biliverdin IXα. RNA-seq analysis revealed that the loss of BnaC07.HO1 impaired tetrapyrrole metabolism, especially chlorophyll biosynthesis. According, the levels of chlorophyll intermediates were reduced in the ygl mutant. In addition, gene expression in multiple pathways was affected in ygl. These findings provide molecular evidences for the basis of the yellow-green leaf phenotype and further insights into the crucial role of HO1 in B. napus.

De Novo Transcriptome Analysis for Kentucky Bluegrass Dwarf Mutants Induced by Space Mutation

PubMed Central

Gan, Lu; Di, Rong; Chao, Yuehui; Han, Liebao; Chen, Xingwu; Wu, Chao; Yin, Shuxia

2016-01-01

Kentucky bluegrass (Poa pratensis L.) is a major cool-season turfgrass requiring frequent mowing. Utilization of cultivars with slow growth is a promising method to decrease mowing frequency. In this study, two dwarf mutant selections of Kentucky bluegrass (A12 and A16) induced by space mutation were analyzed for the differentially expressed genes compared with the wild type (WT) by the high-throughput RNA-Seq technology. 253,909 unigenes were obtained by de novo assembly. 24.20% of the unigenes had a significant level of amino acid sequence identity to Brachypodium distachyon proteins, followed by Hordeum vulgare with 18.72% among the non-redundant (NR) Blastx top hits. Assembled unigenes were associated with 32 pathways using KEGG orthology terms and their respective KEGG maps. Between WT and A16 libraries, 4,203 differentially expressed genes (DEGs) were identified, whereas there were 883 DEGs between WT and A12 libraries. Further investigation revealed that the DEG pathways were mainly involved in terpenoid biosynthesis and plant hormone metabolism, which might account for the differences of plant height and leaf blade color between dwarf mutant and WT plants. Our study presents the first comprehensive transcriptomic data and gene function analysis of Poa pratensis L., providing a valuable resource for future studies in plant dwarfing breeding and comparative genome analysis for Pooideae plants. PMID:27010560

Arabidopsis Class I and Class II TCP Transcription Factors Regulate Jasmonic Acid Metabolism and Leaf Development Antagonistically1[C][W

PubMed Central

Danisman, Selahattin; van der Wal, Froukje; Dhondt, Stijn; Waites, Richard; de Folter, Stefan; Bimbo, Andrea; van Dijk, Aalt DJ; Muino, Jose M.; Cutri, Lucas; Dornelas, Marcelo C.; Angenent, Gerco C.; Immink, Richard G.H.

2012-01-01

TEOSINTE BRANCHED1/CYCLOIDEA/PROLIFERATING CELL FACTOR1 (TCP) transcription factors control developmental processes in plants. The 24 TCP transcription factors encoded in the Arabidopsis (Arabidopsis thaliana) genome are divided into two classes, class I and class II TCPs, which are proposed to act antagonistically. We performed a detailed phenotypic analysis of the class I tcp20 mutant, showing an increase in leaf pavement cell sizes in 10-d-old seedlings. Subsequently, a glucocorticoid receptor induction assay was performed, aiming to identify potential target genes of the TCP20 protein during leaf development. The LIPOXYGENASE2 (LOX2) and class I TCP9 genes were identified as TCP20 targets, and binding of TCP20 to their regulatory sequences could be confirmed by chromatin immunoprecipitation analyses. LOX2 encodes for a jasmonate biosynthesis gene, which is also targeted by class II TCP proteins that are under the control of the microRNA JAGGED AND WAVY (JAW), although in an antagonistic manner. Mutation of TCP9, the second identified TCP20 target, resulted in increased pavement cell sizes during early leaf developmental stages. Analysis of senescence in the single tcp9 and tcp20 mutants and the tcp9tcp20 double mutants showed an earlier onset of this process in comparison with wild-type control plants in the double mutant only. Both the cell size and senescence phenotypes are opposite to the known class II TCP mutant phenotype in JAW plants. Altogether, these results point to an antagonistic function of class I and class II TCP proteins in the control of leaf development via the jasmonate signaling pathway. PMID:22718775

High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis.

PubMed

Meeske, Alexander J; Rodrigues, Christopher D A; Brady, Jacqueline; Lim, Hoong Chuin; Bernhardt, Thomas G; Rudner, David Z

2016-01-01

The differentiation of the bacterium Bacillus subtilis into a dormant spore is among the most well-characterized developmental pathways in biology. Classical genetic screens performed over the past half century identified scores of factors involved in every step of this morphological process. More recently, transcriptional profiling uncovered additional sporulation-induced genes required for successful spore development. Here, we used transposon-sequencing (Tn-seq) to assess whether there were any sporulation genes left to be discovered. Our screen identified 133 out of the 148 genes with known sporulation defects. Surprisingly, we discovered 24 additional genes that had not been previously implicated in spore formation. To investigate their functions, we used fluorescence microscopy to survey early, middle, and late stages of differentiation of null mutants from the B. subtilis ordered knockout collection. This analysis identified mutants that are delayed in the initiation of sporulation, defective in membrane remodeling, and impaired in spore maturation. Several mutants had novel sporulation phenotypes. We performed in-depth characterization of two new factors that participate in cell-cell signaling pathways during sporulation. One (SpoIIT) functions in the activation of σE in the mother cell; the other (SpoIIIL) is required for σG activity in the forespore. Our analysis also revealed that as many as 36 sporulation-induced genes with no previously reported mutant phenotypes are required for timely spore maturation. Finally, we discovered a large set of transposon insertions that trigger premature initiation of sporulation. Our results highlight the power of Tn-seq for the discovery of new genes and novel pathways in sporulation and, combined with the recently completed null mutant collection, open the door for similar screens in other, less well-characterized processes.

Identification of a Classical Mutant in the Industrial Host Aspergillus niger by Systems Genetics: LaeA Is Required for Citric Acid Production and Regulates the Formation of Some Secondary Metabolites

PubMed Central

Niu, Jing; Arentshorst, Mark; Nair, P. Deepa S.; Dai, Ziyu; Baker, Scott E.; Frisvad, Jens C.; Nielsen, Kristian F.; Punt, Peter J.; Ram, Arthur F.J.

2015-01-01

The asexual filamentous fungus Aspergillus niger is an important industrial cell factory for citric acid production. In this study, we genetically characterized a UV-generated A. niger mutant that was originally isolated as a nonacidifying mutant, which is a desirable trait for industrial enzyme production. Physiological analysis showed that this mutant did not secrete large amounts of citric acid and oxalic acid, thus explaining the nonacidifying phenotype. As traditional complementation approaches to characterize the mutant genotype were unsuccessful, we used bulk segregant analysis in combination with high-throughput genome sequencing to identify the mutation responsible for the nonacidifying phenotype. Since A. niger has no sexual cycle, parasexual genetics was used to generate haploid segregants derived from diploids by loss of whole chromosomes. We found that the nonacidifying phenotype was caused by a point mutation in the laeA gene. LaeA encodes a putative methyltransferase-domain protein, which we show here to be required for citric acid production in an A. niger lab strain (N402) and in other citric acid production strains. The unexpected link between LaeA and citric acid production could provide new insights into the transcriptional control mechanisms related to citric acid production in A. niger. Interestingly, the secondary metabolite profile of a ΔlaeA strain differed from the wild-type strain, showing both decreased and increased metabolite levels, indicating that LaeA is also involved in regulating the production of secondary metabolites. Finally, we show that our systems genetics approach is a powerful tool to identify trait mutations. PMID:26566947

Identification of a Classical Mutant in the Industrial Host Aspergillus niger by Systems Genetics: LaeA Is Required for Citric Acid Production and Regulates the Formation of Some Secondary Metabolites.

PubMed

Niu, Jing; Arentshorst, Mark; Nair, P Deepa S; Dai, Ziyu; Baker, Scott E; Frisvad, Jens C; Nielsen, Kristian F; Punt, Peter J; Ram, Arthur F J

2015-11-13

The asexual filamentous fungus Aspergillus niger is an important industrial cell factory for citric acid production. In this study, we genetically characterized a UV-generated A. niger mutant that was originally isolated as a nonacidifying mutant, which is a desirable trait for industrial enzyme production. Physiological analysis showed that this mutant did not secrete large amounts of citric acid and oxalic acid, thus explaining the nonacidifying phenotype. As traditional complementation approaches to characterize the mutant genotype were unsuccessful, we used bulk segregant analysis in combination with high-throughput genome sequencing to identify the mutation responsible for the nonacidifying phenotype. Since A. niger has no sexual cycle, parasexual genetics was used to generate haploid segregants derived from diploids by loss of whole chromosomes. We found that the nonacidifying phenotype was caused by a point mutation in the laeA gene. LaeA encodes a putative methyltransferase-domain protein, which we show here to be required for citric acid production in an A. niger lab strain (N402) and in other citric acid production strains. The unexpected link between LaeA and citric acid production could provide new insights into the transcriptional control mechanisms related to citric acid production in A. niger. Interestingly, the secondary metabolite profile of a ΔlaeA strain differed from the wild-type strain, showing both decreased and increased metabolite levels, indicating that LaeA is also involved in regulating the production of secondary metabolites. Finally, we show that our systems genetics approach is a powerful tool to identify trait mutations. Copyright © 2016 Niu et al.

High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis

PubMed Central

Brady, Jacqueline; Lim, Hoong Chuin; Bernhardt, Thomas G.; Rudner, David Z.

2016-01-01

The differentiation of the bacterium Bacillus subtilis into a dormant spore is among the most well-characterized developmental pathways in biology. Classical genetic screens performed over the past half century identified scores of factors involved in every step of this morphological process. More recently, transcriptional profiling uncovered additional sporulation-induced genes required for successful spore development. Here, we used transposon-sequencing (Tn-seq) to assess whether there were any sporulation genes left to be discovered. Our screen identified 133 out of the 148 genes with known sporulation defects. Surprisingly, we discovered 24 additional genes that had not been previously implicated in spore formation. To investigate their functions, we used fluorescence microscopy to survey early, middle, and late stages of differentiation of null mutants from the B. subtilis ordered knockout collection. This analysis identified mutants that are delayed in the initiation of sporulation, defective in membrane remodeling, and impaired in spore maturation. Several mutants had novel sporulation phenotypes. We performed in-depth characterization of two new factors that participate in cell–cell signaling pathways during sporulation. One (SpoIIT) functions in the activation of σE in the mother cell; the other (SpoIIIL) is required for σG activity in the forespore. Our analysis also revealed that as many as 36 sporulation-induced genes with no previously reported mutant phenotypes are required for timely spore maturation. Finally, we discovered a large set of transposon insertions that trigger premature initiation of sporulation. Our results highlight the power of Tn-seq for the discovery of new genes and novel pathways in sporulation and, combined with the recently completed null mutant collection, open the door for similar screens in other, less well-characterized processes. PMID:26735940

CmPEX6, a Gene Involved in Peroxisome Biogenesis, Is Essential for Parasitism and Conidiation by the Sclerotial Parasite Coniothyrium minitans

PubMed Central

Wei, Wei; Zhu, Wenjun; Cheng, Jiasen; Xie, Jiatao; Li, Bo; Jiang, Daohong; Li, Guoqing; Yi, Xianhong

2013-01-01

Coniothyrium minitans is a sclerotial parasite of the plant-pathogenic fungus Sclerotinia sclerotiorum, and conidial production and parasitism are two important aspects for commercialization of this biological control agent. To understand the mechanism of conidiation and parasitism at the molecular level, we constructed a transfer DNA (tDNA) insertional library with the wild-type strain ZS-1. A conidiation-deficient mutant, ZS-1TN22803, was uncovered through screening of this library. This mutant could produce pycnidia on potato dextrose agar (PDA), but most were immature and did not bear conidia. Moreover, this mutant lost the ability to parasitize or rot the sclerotia of S. sclerotiorum. Analysis of the tDNA flanking sequences revealed that a peroxisome biogenesis factor 6 (PEX6) homolog of Saccharomyces cerevisiae, named CmPEX6, was disrupted by the tDNA insertion in this mutant. Targeted gene replacement and gene complementation tests confirmed that a null mutation of CmPEX6 was responsible for the phenotype of ZS-1TN22803. Further analysis showed that both ZS-1TN22803 and the targeted replacement mutants could not grow on PDA medium containing oleic acid, and they produced much less nitric oxide (NO) and hydrogen peroxide (H2O2) than wild-type strain ZS-1. The conidiation of ZS-1TN22803 was partially restored by adding acetyl-CoA or glyoxylic acid to the growth media. Our results suggest that fatty acid β-oxidation, reactive oxygen and nitrogen species, and possibly other unknown pathways in peroxisomes are involved in conidiation and parasitism by C. minitans. PMID:23563946

Identification of a classical mutant in the industrial host Aspergillus niger by systems genetics: LaeA is required for citric acid production and regulates the formation of some secondary metabolites

DOE PAGES

Niu, Jing; Arentshorst, Mark; Nair, P. Deepa S.; ...

2015-11-13

The asexual filamentous fungus Aspergillus niger is an important industrial cell factory for citric acid production. In this study, we genetically characterized a UV-generated A. niger mutant that was originally isolated as a nonacidifying mutant, which is a desirable trait for industrial enzyme production. Physiological analysis showed that this mutant did not secrete large amounts of citric acid and oxalic acid, thus explaining the nonacidifying phenotype. As traditional complementation approaches to characterize the mutant genotype were unsuccessful, we used bulk segregant analysis in combination with high-throughput genome sequencing to identify the mutation responsible for the nonacidifying phenotype. Since A. nigermore » has no sexual cycle, parasexual genetics was used to generate haploid segregants derived from diploids by loss of whole chromosomes. We found that the nonacidifying phenotype was caused by a point mutation in the laeA gene. LaeA encodes a putative methyltransferase-domain protein, which we show here to be required for citric acid production in an A. niger lab strain (N402) and in other citric acid production strains. The unexpected link between LaeA and citric acid production could provide new insights into the transcriptional control mechanisms related to citric acid production in A. niger. Interestingly, the secondary metabolite profile of a Δ laeA strain differed from the wild-type strain, showing both decreased and increased metabolite levels, indicating that LaeA is also involved in regulating the production of secondary metabolites. As a result, we show that our systems genetics approach is a powerful tool to identify trait mutations.« less

Molecular Characterization of Protease Activity in Serratia sp. Strain SCBI and Its Importance in Cytotoxicity and Virulence

PubMed Central

Petersen, Lauren M.

2014-01-01

A newly recognized Serratia species, termed South African Caenorhabditis briggsae isolate (SCBI), is both a mutualist of the nematode Caenorhabditis briggsae KT0001 and a pathogen of lepidopteran insects. Serratia sp. strain SCBI displays high proteolytic activity, and because secreted proteases are known virulence factors for many pathogens, the purpose of this study was to identify genes essential for extracellular protease activity in Serratia sp. strain SCBI and to determine what role proteases play in insect pathogenesis and cytotoxicity. A bank of 2,100 transposon mutants was generated, and six SCBI mutants with defective proteolytic activity were identified. These mutants were also defective in cytotoxicity. The mutants were found defective in genes encoding the following proteins: alkaline metalloprotease secretion protein AprE, a BglB family transcriptional antiterminator, an inosine/xanthosine triphosphatase, GidA, a methyl-accepting chemotaxis protein, and a PIN domain protein. Gene expression analysis on these six mutants showed significant downregulation in mRNA levels of several different types of predicted protease genes. In addition, transcriptome sequencing (RNA-seq) analysis provided insight into how inactivation of AprE, GidA, and a PIN domain protein influences motility and virulence, as well as protease activity. Using quantitative reverse transcription-PCR (qRT-PCR) to further characterize expression of predicted protease genes in wild-type Serratia sp. SCBI, the highest mRNA levels for the alkaline metalloprotease genes (termed prtA1 to prtA4) occurred following the death of an insect host, while two serine protease and two metalloprotease genes had their highest mRNA levels during active infection. Overall, these results indicate that proteolytic activity is essential for cytotoxicity in Serratia sp. SCBI and that its regulation appears to be highly complex. PMID:25182493

Effect of P to A Mutation of the N-Terminal Residue Adjacent to the Rgd Motif on Rhodostomin: Importance of Dynamics in Integrin Recognition

PubMed Central

Chen, Yi-Chun; Chang, Yao-Tsung; Chang, Yung-Sheng; Huang, Chun-Hao; Chuang, Woei-Jer

2012-01-01

Rhodostomin (Rho) is an RGD protein that specifically inhibits integrins. We found that Rho mutants with the P48A mutation 4.4–11.5 times more actively inhibited integrin α5β1. Structural analysis showed that they have a similar 3D conformation for the RGD loop. Docking analysis also showed no difference between their interactions with integrin α5β1. However, the backbone dynamics of RGD residues were different. The values of the R2 relaxation parameter for Rho residues R49 and D51 were 39% and 54% higher than those of the P48A mutant, which caused differences in S2, Rex, and τe. The S2 values of the P48A mutant residues R49, G50, and D51 were 29%, 14%, and 28% lower than those of Rho. The Rex values of Rho residues R49 and D51 were 0.91 s−1 and 1.42 s−1; however, no Rex was found for those of the P48A mutant. The τe values of Rho residues R49 and D51 were 9.5 and 5.1 times lower than those of P48A mutant. Mutational study showed that integrin α5β1 prefers its ligands to contain (G/A)RGD but not PRGD sequences for binding. These results demonstrate that the N-terminal proline residue adjacent to the RGD motif affect its function and dynamics, which suggests that the dynamic properties of the RGD motif may be important in Rho's interaction with integrin α5β1. PMID:22238583

Identification of a classical mutant in the industrial host Aspergillus niger by systems genetics: LaeA is required for citric acid production and regulates the formation of some secondary metabolites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niu, Jing; Arentshorst, Mark; Nair, P. Deepa S.

The asexual filamentous fungus Aspergillus niger is an important industrial cell factory for citric acid production. In this study, we genetically characterized a UV-generated A. niger mutant that was originally isolated as a nonacidifying mutant, which is a desirable trait for industrial enzyme production. Physiological analysis showed that this mutant did not secrete large amounts of citric acid and oxalic acid, thus explaining the nonacidifying phenotype. As traditional complementation approaches to characterize the mutant genotype were unsuccessful, we used bulk segregant analysis in combination with high-throughput genome sequencing to identify the mutation responsible for the nonacidifying phenotype. Since A. nigermore » has no sexual cycle, parasexual genetics was used to generate haploid segregants derived from diploids by loss of whole chromosomes. We found that the nonacidifying phenotype was caused by a point mutation in the laeA gene. LaeA encodes a putative methyltransferase-domain protein, which we show here to be required for citric acid production in an A. niger lab strain (N402) and in other citric acid production strains. The unexpected link between LaeA and citric acid production could provide new insights into the transcriptional control mechanisms related to citric acid production in A. niger. Interestingly, the secondary metabolite profile of a Δ laeA strain differed from the wild-type strain, showing both decreased and increased metabolite levels, indicating that LaeA is also involved in regulating the production of secondary metabolites. As a result, we show that our systems genetics approach is a powerful tool to identify trait mutations.« less

From model to crop: functional analysis of a STAY-GREEN gene in the model legume Medicago truncatula and effective use of the gene for alfalfa improvement.

PubMed

Zhou, Chuanen; Han, Lu; Pislariu, Catalina; Nakashima, Jin; Fu, Chunxiang; Jiang, Qingzhen; Quan, Li; Blancaflor, Elison B; Tang, Yuhong; Bouton, Joseph H; Udvardi, Michael; Xia, Guangmin; Wang, Zeng-Yu

2011-11-01

Medicago truncatula has been developed into a model legume. Its close relative alfalfa (Medicago sativa) is the most widely grown forage legume crop in the United States. By screening a large population of M. truncatula mutants tagged with the transposable element of tobacco (Nicotiana tabacum) cell type1 (Tnt1), we identified a mutant line (NF2089) that maintained green leaves and showed green anthers, central carpels, mature pods, and seeds during senescence. Genetic and molecular analyses revealed that the mutation was caused by Tnt1 insertion in a STAY-GREEN (MtSGR) gene. Transcript profiling analysis of the mutant showed that loss of the MtSGR function affected the expression of a large number of genes involved in different biological processes. Further analyses revealed that SGR is implicated in nodule development and senescence. MtSGR expression was detected across all nodule developmental zones and was higher in the senescence zone. The number of young nodules on the mutant roots was higher than in the wild type. Expression levels of several nodule senescence markers were reduced in the sgr mutant. Based on the MtSGR sequence, an alfalfa SGR gene (MsSGR) was cloned, and transgenic alfalfa lines were produced by RNA interference. Silencing of MsSGR led to the production of stay-green transgenic alfalfa. This beneficial trait offers the opportunity to produce premium alfalfa hay with a more greenish appearance. In addition, most of the transgenic alfalfa lines retained more than 50% of chlorophylls during senescence and had increased crude protein content. This study illustrates the effective use of knowledge gained from a model system for the genetic improvement of an important commercial crop.

From Model to Crop: Functional Analysis of a STAY-GREEN Gene in the Model Legume Medicago truncatula and Effective Use of the Gene for Alfalfa Improvement1[W][OA

PubMed Central

Zhou, Chuanen; Han, Lu; Pislariu, Catalina; Nakashima, Jin; Fu, Chunxiang; Jiang, Qingzhen; Quan, Li; Blancaflor, Elison B.; Tang, Yuhong; Bouton, Joseph H.; Udvardi, Michael; Xia, Guangmin; Wang, Zeng-Yu

2011-01-01

Medicago truncatula has been developed into a model legume. Its close relative alfalfa (Medicago sativa) is the most widely grown forage legume crop in the United States. By screening a large population of M. truncatula mutants tagged with the transposable element of tobacco (Nicotiana tabacum) cell type1 (Tnt1), we identified a mutant line (NF2089) that maintained green leaves and showed green anthers, central carpels, mature pods, and seeds during senescence. Genetic and molecular analyses revealed that the mutation was caused by Tnt1 insertion in a STAY-GREEN (MtSGR) gene. Transcript profiling analysis of the mutant showed that loss of the MtSGR function affected the expression of a large number of genes involved in different biological processes. Further analyses revealed that SGR is implicated in nodule development and senescence. MtSGR expression was detected across all nodule developmental zones and was higher in the senescence zone. The number of young nodules on the mutant roots was higher than in the wild type. Expression levels of several nodule senescence markers were reduced in the sgr mutant. Based on the MtSGR sequence, an alfalfa SGR gene (MsSGR) was cloned, and transgenic alfalfa lines were produced by RNA interference. Silencing of MsSGR led to the production of stay-green transgenic alfalfa. This beneficial trait offers the opportunity to produce premium alfalfa hay with a more greenish appearance. In addition, most of the transgenic alfalfa lines retained more than 50% of chlorophylls during senescence and had increased crude protein content. This study illustrates the effective use of knowledge gained from a model system for the genetic improvement of an important commercial crop. PMID:21957014

Control of Maize Vegetative and Reproductive Development, Fertility, and rRNAs Silencing by HISTONE DEACETYLASE 108

PubMed Central

Forestan, Cristian; Farinati, Silvia; Rouster, Jacques; Lassagne, Hervé; Lauria, Massimiliano; Dal Ferro, Nicola; Varotto, Serena

2018-01-01

Histone deacetylases (HDACs) catalyze the removal of acetyl groups from acetylated histone tails that consequently interact more closely with DNA, leading to chromatin state refractory to transcription. Zea mays HDA108 belongs to the Rpd3/HDA1 HDAC family and is ubiquitously expressed during development. The newly isolated hda108/hda108 insertional mutant exhibited many developmental defects: significant reduction in plant height, alterations of shoot and leaf development, and alterations of inflorescence patterning and fertility. Western blot analyses and immunolocalization experiments revealed an evident increase in histone acetylation, accompanied by a marked reduction in H3K9 dimethylation, in mutant nuclei. The DNA methylation status, in the CHG sequence context, and the transcript level of ribosomal sequences were also affected in hda108 mutants, while enrichment in H3 and H4 acetylation characterizes both repetitive and nonrepetitive transcriptional up-regulated loci. RNA-Seq of both young leaf and anthers indicated that transcription factor expression is highly affected and that the pollen developmental program is disrupted in hda108 mutants. Crosses between hda108/hda108 and epiregulator mutants did not produce any double mutant progeny indicating possible genetic interactions of HDA108 with distinct epigenetic pathways. Our findings indicate that HDA108 is directly involved in regulation of maize development, fertility, and epigenetic regulation of genome activity. PMID:29382649

A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

PubMed

White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

2018-03-28

A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

Mutational analysis of the MS2 lysis protein L

PubMed Central

Chamakura, Karthik R.; Edwards, Garrett B.

2017-01-01

Small single-stranded nucleic acid phages effect lysis by expressing a single protein, the amurin, lacking muralytic enzymatic activity. Three amurins have been shown to act like ‘protein antibiotics’ by inhibiting cell-wall biosynthesis. However, the L lysis protein of the canonical ssRNA phage MS2, a 75 aa polypeptide, causes lysis by an unknown mechanism without affecting net peptidoglycan synthesis. To identify residues important for lytic function, randomly mutagenized alleles of L were generated, cloned into an inducible plasmid and the transformants were selected on agar containing the inducer. From a total of 396 clones, 67 were unique single base-pair changes that rendered L non-functional, of which 44 were missense mutants and 23 were nonsense mutants. Most of the non-functional missense alleles that accumulated in levels comparable to the wild-type allele are localized in the C-terminal half of L, clustered in and around an LS dipeptide sequence. The LS motif was used to align L genes from ssRNA phages lacking any sequence similarity to MS2 or to each other. This alignment revealed a conserved domain structure, in terms of charge, hydrophobic character and predicted helical content. None of the missense mutants affected membrane-association of L. Several of the L mutations in the central domains were highly conservative and recessive, suggesting a defect in a heterotypic protein–protein interaction, rather than in direct disruption of the bilayer structure, as had been previously proposed for L. PMID:28691656

miRCat2: accurate prediction of plant and animal microRNAs from next-generation sequencing datasets

PubMed Central

Paicu, Claudia; Mohorianu, Irina; Stocks, Matthew; Xu, Ping; Coince, Aurore; Billmeier, Martina; Dalmay, Tamas; Moulton, Vincent; Moxon, Simon

2017-01-01

Abstract Motivation MicroRNAs are a class of ∼21–22 nt small RNAs which are excised from a stable hairpin-like secondary structure. They have important gene regulatory functions and are involved in many pathways including developmental timing, organogenesis and development in eukaryotes. There are several computational tools for miRNA detection from next-generation sequencing datasets. However, many of these tools suffer from high false positive and false negative rates. Here we present a novel miRNA prediction algorithm, miRCat2. miRCat2 incorporates a new entropy-based approach to detect miRNA loci, which is designed to cope with the high sequencing depth of current next-generation sequencing datasets. It has a user-friendly interface and produces graphical representations of the hairpin structure and plots depicting the alignment of sequences on the secondary structure. Results We test miRCat2 on a number of animal and plant datasets and present a comparative analysis with miRCat, miRDeep2, miRPlant and miReap. We also use mutants in the miRNA biogenesis pathway to evaluate the predictions of these tools. Results indicate that miRCat2 has an improved accuracy compared with other methods tested. Moreover, miRCat2 predicts several new miRNAs that are differentially expressed in wild-type versus mutants in the miRNA biogenesis pathway. Availability and Implementation miRCat2 is part of the UEA small RNA Workbench and is freely available from http://srna-workbench.cmp.uea.ac.uk/. Contact v.moulton@uea.ac.uk or s.moxon@uea.ac.uk Supplementary information Supplementary data are available at Bioinformatics online. PMID:28407097

Biallelic Mutations in NBAS Cause Recurrent Acute Liver Failure with Onset in Infancy.

PubMed

Haack, Tobias B; Staufner, Christian; Köpke, Marlies G; Straub, Beate K; Kölker, Stefan; Thiel, Christian; Freisinger, Peter; Baric, Ivo; McKiernan, Patrick J; Dikow, Nicola; Harting, Inga; Beisse, Flemming; Burgard, Peter; Kotzaeridou, Urania; Kühr, Joachim; Himbert, Urban; Taylor, Robert W; Distelmaier, Felix; Vockley, Jerry; Ghaloul-Gonzalez, Lina; Zschocke, Johannes; Kremer, Laura S; Graf, Elisabeth; Schwarzmayr, Thomas; Bader, Daniel M; Gagneur, Julien; Wieland, Thomas; Terrile, Caterina; Strom, Tim M; Meitinger, Thomas; Hoffmann, Georg F; Prokisch, Holger

2015-07-02

Acute liver failure (ALF) in infancy and childhood is a life-threatening emergency. Few conditions are known to cause recurrent acute liver failure (RALF), and in about 50% of cases, the underlying molecular cause remains unresolved. Exome sequencing in five unrelated individuals with fever-dependent RALF revealed biallelic mutations in NBAS. Subsequent Sanger sequencing of NBAS in 15 additional unrelated individuals with RALF or ALF identified compound heterozygous mutations in an additional six individuals from five families. Immunoblot analysis of mutant fibroblasts showed reduced protein levels of NBAS and its proposed interaction partner p31, both involved in retrograde transport between endoplasmic reticulum and Golgi. We recommend NBAS analysis in individuals with acute infantile liver failure, especially if triggered by fever. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Rapid identification of kidney cyst mutations by whole exome sequencing in zebrafish

PubMed Central

Ryan, Sean; Willer, Jason; Marjoram, Lindsay; Bagwell, Jennifer; Mankiewicz, Jamie; Leshchiner, Ignaty; Goessling, Wolfram; Bagnat, Michel; Katsanis, Nicholas

2013-01-01

Forward genetic approaches in zebrafish have provided invaluable information about developmental processes. However, the relative difficulty of mapping and isolating mutations has limited the number of new genetic screens. Recent improvements in the annotation of the zebrafish genome coupled to a reduction in sequencing costs prompted the development of whole genome and RNA sequencing approaches for gene discovery. Here we describe a whole exome sequencing (WES) approach that allows rapid and cost-effective identification of mutations. We used our WES methodology to isolate four mutations that cause kidney cysts; we identified novel alleles in two ciliary genes as well as two novel mutants. The WES approach described here does not require specialized infrastructure or training and is therefore widely accessible. This methodology should thus help facilitate genetic screens and expedite the identification of mutants that can inform basic biological processes and the causality of genetic disorders in humans. PMID:24130329

Detection of cystic fibrosis mutations in a GeneChip{trademark} assay format

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyada, C.G.; Cronin, M.T.; Kim, S.M.

1994-09-01

We are developing assays for the detection of cystic fibrosis mutations based on DNA hybridization. A DNA sample is amplified by PCR, labeled by incorporating a fluorescein-tagged dNTP, enzymatically treated to produce smaller fragments and hybridized to a series of short (13-16 bases) oligonucleotides synthesized on a glass surface via photolithography. The hybrids are detected by eqifluorescence and mutations are identified by the specific pattern of hybridization. In a GeneChip assay, the chip surface is composed of a series of subarrays, each being specific for a particular mutation. Each subarray is further subdivided into a series of probes (40 total),more » half based on the mutant sequence and the remainder based on the wild-type sequence. For each of the subarrays, there is a redundancy in the number of probes that should hybridize to either a wild-type or a mutant target. The multiple probe strategy provides sequence information for a short five base region overlapping the mutation site. In addition, homozygous wild-type and mutant as well as heterozygous samples are each identified by a specific pattern of hybridization. The small size of each probe feature (250 x 250 {mu}m{sup 2}) permits the inclusion of additional probes required to generate sequence information by hybridization.« less

The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

NASA Astrophysics Data System (ADS)

Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

1989-06-01

The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Molecular and Mutational Analysis of a Gelsolin-Family Member Encoded by the Flightless I Gene of Drosophila Melanogaster

PubMed Central

de-Couet, H. G.; Fong, KSK.; Weeds, A. G.; McLaughlin, P. J.; Miklos, GLG.

1995-01-01

The flightless locus of Drosophila melanogaster has been analyzed at the genetic, molecular, ultrastructural and comparative crystallographic levels. The gene encodes a single transcript encoding a protein consisting of a leucine-rich amino terminal half and a carboxyterminal half with high sequence similarity to gelsolin. We determined the genomic sequence of the flightless landscape, the breakpoints of four chromosomal rearrangements, and the molecular lesions in two lethal and two viable alleles of the gene. The two alleles that lead to flight muscle abnormalities encode mutant proteins exhibiting amino acid replacements within the S1-like domain of their gelsolin-like region. Furthermore, the deduced intronexon structure of the D. melanogaster gene has been compared with that of the Caenorhabditis elegans homologue. Furthermore, the sequence similarities of the flightless protein with gelsolin allow it to be evaluated in the context of the published crystallographic structure of the S1 domain of gelsolin. Amino acids considered essential for the structural integrity of the core are found to be highly conserved in the predicted flightless protein. Some of the residues considered essential for actin and calcium binding in gelsolin S1 and villin V1 are also well conserved. These data are discussed in light of the phenotypic characteristics of the mutants and the putative functions of the protein. PMID:8582612

Transposon mutagenesis of type III group B Streptococcus: correlation of capsule expression with virulence.

PubMed

Rubens, C E; Wessels, M R; Heggen, L M; Kasper, D L

1987-10-01

The capsular polysaccharide of type III group B Streptococcus (GBS) is thought to be a major factor in the virulence of this organism. Transposon mutagenesis was used to obtain isogenic strains of a GBS serotype III clinical isolate (COH 31r/s) with site-specific mutations in the gene(s) responsible for capsule production. The self-conjugative transposon Tn916 was transferred to strain COH 31r/s during incubation with Streptococcus faecalis strain CG110 on membrane filters. Eleven transconjugant clones did not bind type III GBS antiserum by immunoblot. Immunofluorescence, competitive ELISA, and electron microscopy confirmed the absence of detectable GBS type III capsular polysaccharide in one of the transconjugants, COH 31-15. Southern hybridization analysis with a Tn916 probe confirmed the presence of the transposon sequence within each mutant. A 3.0-kilobase EcoRI fragment that flanked the Tn916 sequence was subcloned from mutant COH 31-15. This fragment shared homology with DNA from the other GBS serotypes, suggesting a common sequence for capsulation shared by organisms of different capsular types. Loss of capsule expression resulted in loss of virulence in a neonatal rat model. We conclude that a gene common to all capsular types of GBS is required for surface expression of the type III capsule and that inactivation of this gene by Tn916 results in the loss of virulence.

Identification of Bacterial Groups Preferentially Associated with Mycorrhizal Roots of Medicago truncatula▿

PubMed Central

Offre, P.; Pivato, B.; Siblot, S.; Gamalero, E.; Corberand, T.; Lemanceau, P.; Mougel, C.

2007-01-01

The genetic structures of bacterial communities associated with Medicago truncatula Gaertn. cv. Jemalong line J5 (Myc+ Nod+) and its symbiosis-defective mutants TRV48 (Myc+ Nod−) and TRV25 (Myc− Nod−) were compared. Plants were cultivated in a fertile soil (Châteaurenard, France) and in soil from the Mediterranean basin showing a low fertility (Mas d'Imbert, France). Plant growth, root architecture, and the efficiency of root symbiosis of the three plant genotypes were characterized in the two soils. Structures of the bacterial communities were assessed by automated-ribosomal intergenic spacer analysis (A-RISA) fingerprinting from DNA extracted from the rhizosphere soil and root tissues. As expected, the TRV25 mutant did not develop endomycorrhizal symbiosis in any of the soils, whereas mycorrhization of line J5 and the TRV48 mutant occurred in both soils but at a higher intensity in the Mas d'Imbert (low fertility) than in the Châteaurenard soil. However, modifications of plant growth and root architecture, between mycorrhizal (J5 and TRV48) and nonmycorrhizal (TRV25) plants, were recorded only when cultivated in the Mas d'Imbert soil. Similarly, the genetic structures of bacterial communities associated with mycorrhizal and nonmycorrhizal plants differed significantly in the Mas d'Imbert soil but not in the Châteaurenard soil. Multivariate analysis of the patterns allowed the identification of molecular markers, explaining these differences, and markers were further sequenced. Molecular marker analysis allowed the delineation of 211 operational taxonomic units. Some of those belonging to the Comamonadaceae and Oxalobacteraceae (β-Proteobacteria) families were found to be significantly more represented within bacterial communities associated with the J5 line and the TRV48 mutant than within those associated with the TRV25 mutant, indicating that these bacterial genera were preferentially associated with mycorrhizal roots in the Mas d'Imbert soil. PMID:17142371

Genetic Characterization of Escherichia coli Type 1 Pilus Adhesin Mutants and Identification of a Novel Binding Phenotype

PubMed Central

Hamrick, Terri S.; Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Horton, John R.; Russell, Perry W.; Orndorff, Paul E.

2000-01-01

Five Escherichia coli type 1 pilus mutants that had point mutations in fimH, the gene encoding the type 1 pilus adhesin FimH, were characterized. FimH is a minor component of type 1 pili that is required for the pili to bind and agglutinate guinea pig erythrocytes in a mannose-inhibitable manner. Point mutations were located by DNA sequencing and deletion mapping. All mutations mapped within the signal sequence or in the first 28% of the predicted mature protein. All mutations were missense mutations except for one, a frameshift lesion that was predicted to cause the loss of approximately 60% of the mature FimH protein. Bacterial agglutination tests with polyclonal antiserum raised to a LacZ-FimH fusion protein failed to confirm that parental amounts of FimH cross-reacting material were expressed in four of the five mutants. The remaining mutant, a temperature-sensitive (ts) fimH mutant that agglutinated guinea pig erythrocytes after growth at 31°C but not at 42°C, reacted with antiserum at both temperatures in a manner similar to the parent. Consequently, this mutant was chosen for further study. Temperature shift experiments revealed that new FimH biosynthesis was required for the phenotypic change. Guinea pig erythrocyte and mouse macrophage binding experiments using the ts mutant grown at the restrictive and permissive temperatures revealed that whereas erythrocyte binding was reduced to a level comparable to that of a fimH insertion mutant at the restrictive temperature, mouse peritoneal macrophages were bound with parental efficiency at both the permissive and restrictive temperatures. Also, macrophage binding by the ts mutant was insensitive to mannose inhibition after growth at 42°C but sensitive after growth at 31°C. The ts mutant thus binds macrophages with one receptor specificity at 31°C and another at 42°C. PMID:10869080

Missense Mutations Allow a Sequence-Blind Mutant of SpoIIIE to Successfully Translocate Chromosomes during Sporulation.

PubMed

Bose, Baundauna; Reed, Sydney E; Besprozvannaya, Marina; Burton, Briana M

2016-01-01

SpoIIIE directionally pumps DNA across membranes during Bacillus subtilis sporulation and vegetative growth. The sequence-reading domain (γ domain) is required for directional DNA transport, and its deletion severely impairs sporulation. We selected suppressors of the spoIIIEΔγ sporulation defect. Unexpectedly, many suppressors were intragenic missense mutants, and some restore sporulation to near-wild-type levels. The mutant proteins are likely not more abundant, faster at translocating DNA, or sequence-sensitive, and rescue does not involve the SpoIIIE homolog SftA. Some mutants behave differently when co-expressed with spoIIIEΔγ, consistent with the idea that some, but not all, variants may form mixed oligomers. In full-length spoIIIE, these mutations do not affect sporulation, and yet the corresponding residues are rarely found in other SpoIIIE/FtsK family members. The suppressors do not rescue chromosome translocation defects during vegetative growth, indicating that the role of the γ domain cannot be fully replaced by these mutations. We present two models consistent with our findings: that the suppressors commit to transport in one arbitrarily-determined direction or delay spore development. It is surprising that missense mutations somehow rescue loss of an entire domain with a complex function, and this raises new questions about the mechanism by which SpoIIIE pumps DNA and the roles SpoIIIE plays in vivo.

Mutation site and context dependent effects of ESR1 mutation in genome-edited breast cancer cell models.

PubMed

Bahreini, Amir; Li, Zheqi; Wang, Peilu; Levine, Kevin M; Tasdemir, Nilgun; Cao, Lan; Weir, Hazel M; Puhalla, Shannon L; Davidson, Nancy E; Stern, Andrew M; Chu, David; Park, Ben Ho; Lee, Adrian V; Oesterreich, Steffi

2017-05-23

Mutations in the estrogen receptor alpha (ERα) 1 gene (ESR1) are frequently detected in ER+ metastatic breast cancer, and there is increasing evidence that these mutations confer endocrine resistance in breast cancer patients with advanced disease. However, their functional role is not well-understood, at least in part due to a lack of ESR1 mutant models. Here, we describe the generation and characterization of genome-edited T47D and MCF7 breast cancer cell lines with the two most common ESR1 mutations, Y537S and D538G. Genome editing was performed using CRISPR and adeno-associated virus (AAV) technologies to knock-in ESR1 mutations into T47D and MCF7 cell lines, respectively. Various techniques were utilized to assess the activity of mutant ER, including transactivation, growth and chromatin-immunoprecipitation (ChIP) assays. The level of endocrine resistance was tested in mutant cells using a number of selective estrogen receptor modulators (SERMs) and degraders (SERDs). RNA sequencing (RNA-seq) was employed to study gene targets of mutant ER. Cells with ESR1 mutations displayed ligand-independent ER activity, and were resistant to several SERMs and SERDs, with cell line and mutation-specific differences with respect to magnitude of effect. The SERD AZ9496 showed increased efficacy compared to other drugs tested. Wild-type and mutant cell co-cultures demonstrated a unique evolution of mutant cells under estrogen deprivation and tamoxifen treatment. Transcriptome analysis confirmed ligand-independent regulation of ERα target genes by mutant ERα, but also identified novel target genes, some of which are involved in metastasis-associated phenotypes. Despite significant overlap in the ligand-independent genes between Y537S and D538G, the number of mutant ERα-target genes shared between the two cell lines was limited, suggesting context-dependent activity of the mutant receptor. Some genes and phenotypes were unique to one mutation within a given cell line, suggesting a mutation-specific effect. Taken together, ESR1 mutations in genome-edited breast cancer cell lines confer ligand-independent growth and endocrine resistance. These biologically relevant models can be used for further mechanistic and translational studies, including context-specific and mutation site-specific analysis of the ESR1 mutations.

Novel Synthesis and Phenotypic Analysis of Mutant Clouds for Hepatitis E Virus Genotype 1.

PubMed

Agarwal, Shubhra; Baccam, Prasith; Aggarwal, Rakesh; Veerapu, Naga Suresh

2018-02-15

Many RNA viruses exist as an ensemble of genetically diverse, replicating populations known as a mutant cloud. The genetic diversity (cloud size) and composition of this mutant cloud may influence several important phenotypic features of the virus, including its replication capacity. We applied a straightforward, bacterium-free approach using error-prone PCR coupled with reverse genetics to generate infectious mutant RNA clouds with various levels of genetic diversity from a genotype 1 strain of hepatitis E virus (HEV). Cloning and sequencing of a genomic fragment encompassing 70% of open reading frame 1 ( ORF1 ) or of the full genome from variants in the resultant clouds showed the occurrence of nucleotide mutations at a frequency on the order of 10 -3 per nucleotide copied and the existence of marked genetic diversity, with a high normalized Shannon entropy value. The mutant clouds showed transient replication in cell culture, while wild-type HEV did not. Cross-sectional data from these cell cultures supported the existence of differential effects of clouds of various sizes and compositions on phenotypic characteristics, such as the replication level of (+)-RNA progeny, the amounts of double-stranded RNA (a surrogate for the rate of viral replication) and ORF1 protein, and the expression of interferon-stimulated genes. Since mutant cloud size and composition influenced the viral phenotypic properties, a better understanding of this relationship may help to provide further insights into virus evolution and prediction of emerging viral diseases. IMPORTANCE Several biological or practical limitations currently prevent the study of phenotypic behavior of a mutant cloud in vitro We developed a simple and rapid method for synthesizing mutant clouds of hepatitis E virus (HEV), a single-stranded (+)-RNA [ss(+) RNA] virus, with various and controllable levels of genetic diversity, which could then be used in a cell culture system to study the effects of cloud size and composition on viral phenotype. In a cross-sectional analysis, we demonstrated that a particular mutant cloud which had an extremely high genetic diversity had a replication rate exceeding that of wild-type HEV. This method should thus provide a useful model for understanding the phenotypic behavior of ss(+) RNA viruses. Copyright © 2018 American Society for Microbiology.

Upregulation of IRS1 Enhances IGF1 Response in Y537S and D538G ESR1 Mutant Breast Cancer Cells.

PubMed

Li, Zheqi; Levine, Kevin M; Bahreini, Amir; Wang, Peilu; Chu, David; Park, Ben Ho; Oesterreich, Steffi; Lee, Adrian V

2018-01-01

Increased evidence suggests that somatic mutations in the ligand-binding domain of estrogen receptor [ER (ERα/ESR1)] are critical mediators of endocrine-resistant breast cancer progression. Insulinlike growth factor-1 (IGF1) is an essential regulator of breast development and tumorigenesis and also has a role in endocrine resistance. A recent study showed enhanced crosstalk between IGF1 and ERα in ESR1 mutant cells, but detailed mechanisms are incompletely understood. Using genome-edited MCF-7 and T47D cell lines harboring Y537S and D538G ESR1 mutations, we characterized altered IGF1 signaling. RNA sequencing revealed upregulation of multiple genes in the IGF1 pathway, including insulin receptor substrate-1 (IRS1), consistent in both Y537S and D538G ESR1 mutant cell line models. Higher IRS1 expression was confirmed by quantitative reverse transcription polymerase chain reaction and immunoblotting. ESR1 mutant cells also showed increased levels of IGF-regulated genes, reflected by activation of an IGF signature. IGF1 showed increased sensitivity and potency in growth stimulation of ESR1 mutant cells. Analysis of downstream signaling revealed the phosphoinositide 3-kinase (PI3K)-Akt axis as a major pathway mediating the enhanced IGF1 response in ESR1 mutant cells. Decreasing IRS1 expression by small interfering RNA diminished the increased sensitivity to IGF1. Combination treatment with inhibitors against IGF1 receptor (IGF1R; OSI-906) and ER (fulvestrant) showed synergistic growth inhibition in ESR1 mutant cells, particularly at lower effective concentrations. Our study supports a critical role of enhanced IGF1 signaling in ESR1 mutant cell lines, pointing toward a potential for cotargeting IGF1R and ERα in endocrine-resistant breast tumors with mutant ESR1. Copyright © 2018 Endocrine Society.

Analysis of Triclosan-Selected Salmonella enterica Mutants of Eight Serovars Revealed Increased Aminoglycoside Susceptibility and Reduced Growth Rates

PubMed Central

Rensch, Ulrike; Klein, Guenter; Kehrenberg, Corinna

2013-01-01

The biocide triclosan (TRC) is used in a wide range of household, personal care, veterinary, industrial and medical products to control microbial growth. This extended use raises concerns about a possible association between the application of triclosan and the development of antibiotic resistance. In the present study we determined triclosan mutant prevention concentrations (MPC) for Salmonella enterica isolates of eight serovars and investigated selected mutants for their mechanisms mediating decreased susceptibility to triclosan. MPCTRC values were 8 - 64-fold higher than MIC values and ranged between 1 - 16 µg/ml. The frequencies at which mutants were selected varied between 1.3 x 10-10 - 9.9 x 10-11. Even if MIC values of mutants decreased by 3-7 dilution steps in the presence of the efflux pump inhibitor Phe-Arg-β-naphtylamide, only minor changes were observed in the expression of genes encoding efflux components or regulators, indicating that neither the major multidrug efflux pump AcrAB-TolC nor AcrEF are up-regulated in triclosan-selected mutants. Nucleotide sequence comparisons confirmed the absence of alterations in the regulatory regions acrRA, soxRS, marORAB, acrSE and ramRA of selected mutants. Single bp and deduced Gly93→Val amino acid exchanges were present in fabI, the target gene of triclosan, starting from a concentration of 1 µg/ml TRC used for MPC determinations. The fabI genes were up to 12.4-fold up-regulated. Complementation experiments confirmed the contribution of Gly93→Val exchanges and fabI overexpression to decreased triclosan susceptibility. MIC values of mutants compared to parent strains were even equal or resulted in a more susceptible phenotype (1-2 dilution steps) for the aminoglycoside antibiotics kanamycin and gentamicin as well as for the biocide chlorhexidine. Growth rates of selected mutants were significantly lower and hence, might partly explain the rare occurrence of Salmonella field isolates exhibiting decreased susceptibility to triclosan. PMID:24205194

Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

PubMed

Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

2012-07-17

The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an increased probability of being important for enzyme function or stability.

Structure of adenovirus bound to cellular receptor car

DOEpatents

Freimuth, Paul I.

2007-01-02

Disclosed is a mutant CAR-DI-binding adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have a significantly weakened binding affinity for CAR-DI relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type.

The Region between Amino Acids 245 and 265 of the Bovine Leukemia Virus (BLV) Tax Protein Restricts Transactivation Not Only via the BLV Enhancer but Also via Other Retrovirus Enhancers

PubMed Central

Tajima, Shigeru; Aida, Yoko

2000-01-01

Bovine leukemia virus (BLV) is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type 1 (HTLV-1). The Tax protein of BLV acts through the 5′ long terminal repeat (LTR) of BLV and activates the transcription of BLV. In this study, we amplified tax genes from BLV-infected cattle using PCR. We cloned the genes and monitored the transcriptional activities of the products. Seven independent mutant Tax proteins, with at least one amino acid substitution between residues 240 and 265, exhibited a markedly stronger ability to stimulate the viral LTR-directed transcription than the wild-type Tax protein. Analysis of chimeric Tax proteins derived from wild-type and mutant Tax proteins clearly demonstrated that a single substitution between residue 240 and 265 might be critical for the higher activities of the Tax mutant proteins. Furthermore, it appeared that transient expression of a Tax mutant protein was better able to increase the production of viral proteins and particles from a defective recombinant proviral clone of BLV than was wild-type Tax. Analysis of mutations within the U3 region of the LTR revealed that a cyclic AMP-responsive element in Tax-responsive element 2 might be sufficient for the enhanced activation mediated by the mutant proteins. In addition to the LTR of BLV, other viral enhancers, such as the enhancers of HTLV-1 and of mouse mammary tumor virus, which cannot be activated by wild-type BLV Tax protein, were activated by a Tax mutant protein. Our observations suggest that the transactivation activity and target sequence specificity of BLV Tax might be limited or negatively regulated by the region of the protein between amino acids 240 and 265. PMID:11069988