Sample records for mutation causing cystic

  1. L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rozen, R.; Ferreira-Rajabi, L.; Robb, L.

    Cystic fibrosis is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Over 400 mutations have been reported at this locus. Although severe forms of cystic fibrosis are usually associated with pancreatic insufficiency, pulmonary dysfunction, and elevated sweat chloride, there is a wide range of phenotypes, including congenital absence of the vas deferens, observed with some of the milder mutations. The L206W mutation, which was first identified in patients from South France, is relatively frequent in French Canadians from Quebec. In this report, we document the atypical form of cystic fibrosis associated with this mutation in amore » cohort of 7 French Canadian probands. 20 refs.« less

  2. Pharmacogenetics of cystic fibrosis treatment.

    PubMed

    Carter, Suzanne C; McKone, Edward F

    2016-08-01

    Cystic fibrosis (CF) is genetic autosomal recessive disease caused by reduced or absent function of CFTR protein. Treatments for patients with CF have primarily focused on the downstream end-organ consequences of defective CFTR. Since the discovery of the CFTR gene that causes CF in 1989 there have been tremendous advances in our understanding of the genetics and pathophysiology of CF. This has recently led to the development of new CFTR mutation-specific targeted therapies for select patients with CF. This review will discuss the characteristics of the CFTR gene, the CFTR mutations that cause CF and the new mutation specific pharmacological treatments including gene therapy that are contributing to the dawning of a new era in cystic fibrosis care.

  3. Preimplantation genetic diagnosis for cystic fibrosis: a case report.

    PubMed

    Biazotti, Maria Cristina Santoro; Pinto Junior, Walter; Albuquerque, Maria Cecília Romano Maciel de; Fujihara, Litsuko Shimabukuro; Suganuma, Cláudia Haru; Reigota, Renata Bednar; Bertuzzo, Carmen Sílvia

    2015-01-01

    Cystic fibrosis is an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane conductance regulator gene. This disorder produces a variable phenotype including lung disease, pancreatic insufficiency, and meconium ileus plus bilateral agenesis of the vas deferens causing obstructive azoospermia and male infertility. Preimplantation genetic diagnosis is an alternative that allows identification of embryos affected by this or other genetic diseases. We report a case of couple with cystic fibrosis; the woman had the I148 T mutation and the man had the Delta F508 gene mutation. The couple underwent in vitro fertilization, associated with preimplantation genetic diagnosis, and with subsequent selection of healthy embryos for uterine transfer. The result was an uneventful pregnancy and delivery of a healthy male baby.

  4. Preimplantation genetic diagnosis for cystic fibrosis: a case report

    PubMed Central

    Biazotti, Maria Cristina Santoro; Pinto, Walter; de Albuquerque, Maria Cecília Romano Maciel; Fujihara, Litsuko Shimabukuro; Suganuma, Cláudia Haru; Reigota, Renata Bednar; Bertuzzo, Carmen Sílvia

    2015-01-01

    Cystic fibrosis is an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane conductance regulator gene. This disorder produces a variable phenotype including lung disease, pancreatic insufficiency, and meconium ileus plus bilateral agenesis of the vas deferens causing obstructive azoospermia and male infertility. Preimplantation genetic diagnosis is an alternative that allows identification of embryos affected by this or other genetic diseases. We report a case of couple with cystic fibrosis; the woman had the I148 T mutation and the man had the Delta F508 gene mutation. The couple underwent in vitro fertilization, associated with preimplantation genetic diagnosis, and with subsequent selection of healthy embryos for uterine transfer. The result was an uneventful pregnancy and delivery of a healthy male baby. PMID:25993078

  5. Cystic fibrosis screening in assisted reproduction.

    PubMed

    Gazvani, Rafet; Lewis-Jones, Iwan

    2006-06-01

    The purpose of this review is to discuss the incidence of cystic fibrosis in the general population, in ethnically diverse populations and specifically in couples needing assisted reproduction caused by male factor subfertility. We review the current understanding of risks for reproductive couples and discuss ideal screening strategies. In ethnically diverse populations, a large difference in clinical sensitivity and birth prevalence exists between the broad racial/ethnic groups examined. Extensive data clearly demonstrate the cost-effectiveness of cystic fibrosis screening. Testing for cystic fibrosis gene mutations is reliable and, with a 26-mutation panel, nearly 90% of possible severe mutations can be detected. To halve the incidence of cystic fibrosis in the community, by offering genetic testing of the fetus if both partners are carrier positive, may also be possible. Recent guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for cystic fibrosis carrier status for purposes of genetic counselling. In ethnically diverse populations, ethnic-specific mutations should be included in the mutation panels.

  6. Stabilization of a nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator yields insight into disease-causing mutations.

    PubMed

    Vernon, Robert M; Chong, P Andrew; Lin, Hong; Yang, Zhengrong; Zhou, Qingxian; Aleksandrov, Andrei A; Dawson, Jennifer E; Riordan, John R; Brouillette, Christie G; Thibodeau, Patrick H; Forman-Kay, Julie D

    2017-08-25

    Characterization of the second nucleotide-binding domain (NBD2) of the cystic fibrosis transmembrane conductance regulator (CFTR) has lagged behind research into the NBD1 domain, in part because NBD1 contains the F508del mutation, which is the dominant cause of cystic fibrosis. Research on NBD2 has also been hampered by the overall instability of the domain and the difficulty of producing reagents. Nonetheless, multiple disease-causing mutations reside in NBD2, and the domain is critical for CFTR function, because channel gating involves NBD1/NBD2 dimerization, and NBD2 contains the catalytically active ATPase site in CFTR. Recognizing the paucity of structural and biophysical data on NBD2, here we have defined a bioinformatics-based method for manually identifying stabilizing substitutions in NBD2, and we used an iterative process of screening single substitutions against thermal melting points to both produce minimally mutated stable constructs and individually characterize mutations. We present a range of stable constructs with minimal mutations to help inform further research on NBD2. We have used this stabilized background to study the effects of NBD2 mutations identified in cystic fibrosis (CF) patients, demonstrating that mutants such as N1303K and G1349D are characterized by lower stability, as shown previously for some NBD1 mutations, suggesting a potential role for NBD2 instability in the pathology of CF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.

    PubMed

    Baker, Mei W; Atkins, Anne E; Cordovado, Suzanne K; Hendrix, Miyono; Earley, Marie C; Farrell, Philip M

    2016-03-01

    Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology. An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation. The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified. The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.

  8. Breakthrough Therapies: Cystic Fibrosis (CF) Potentiators and Correctors

    PubMed Central

    Solomon, George M.; Marshall, Susan G.; Ramsey, Bonnie W.; Rowe, Steven M.

    2015-01-01

    Cystic Fibrosis is caused by mutations in the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene resulting in abnormal protein function. Recent advances of targeted molecular therapies and high throughput screening have resulted in multiple drug therapies that target many important mutations in the CFTR protein. In this review, we provide the latest results and current progress of CFTR modulators for the treatment of cystic fibrosis, focusing on potentiators of CFTR channel gating and Phe508del processing correctors for the Phe508del CFTR mutation. Special emphasis is placed on the molecular basis underlying these new therapies and emerging results from the latest clinical trials. The future directions for augmenting the rescue of Phe508del with CFTR modulators is also emphasized. PMID:26097168

  9. Cystic fibrosis Δf508 mutation screening in Brazilian women with altered fertility.

    PubMed

    Brunoro, G V F; Wolfgramm, E V; Louro, I D; Degasperi, I I; Busatto, V C W; Perrone, A M S; Batitucci, M C P

    2011-10-01

    Cystic Fibrosis (CF) is an autosomal recessive disease, caused by mutations in the Cystic Fibrosis Transmembrane Regulator gene (CFTR). The most frequent mutation in CF is ΔF508. The disease is clinically characterized by elevated concentrations of sweat chlorides and abnormally thick mucus. It affects organs such as lung, pancreas, gastrointestinal and reproductive tract. Women with CF commonly present delayed puberty and amenorrhea due to malnutrition. Our objective was to screen the presence of ΔF508 mutation in 24 women with altered fertility. Nine of these women presented reduced fertility without a known cause, four showed polycystic ovaries and two had early menopause. One woman with early menopause was a carrier of the ΔF508 mutation. Our study demonstrates that it is possible that the frequency of CF mutations among patients with altered fertility may be higher than expected. Previous data showed that fibrocystic women can show reduced fertility, maternal mortality associated with pregnancy and increased incidence of spontaneous abortion. We therefore recommend that women with reduced fertility undertake genetic tests for a better evaluation of pregnancy risks and clinical monitoring.

  10. Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.

    PubMed

    Dell'Edera, Domenico; Benedetto, Michele; Gadaleta, Gemma; Carone, Domenico; Salvatore, Donatello; Angione, Antonella; Gallo, Massimiliano; Milo, Michele; Pisaturo, Maria Laura; Di Pierro, Giuseppe; Mazzone, Eleonora; Epifania, Annunziata Anna

    2014-10-10

    Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

  11. New and emerging targeted therapies for cystic fibrosis

    PubMed Central

    Rowe, Steven M

    2016-01-01

    Cystic fibrosis (CF) is a monogenic autosomal recessive disorder that affects about 70 000 people worldwide. The clinical manifestations of the disease are caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR) protein. The discovery of the CFTR gene in 1989 has led to a sophisticated understanding of how thousands of mutations in the CFTR gene affect the structure and function of the CFTR protein. Much progress has been made over the past decade with the development of orally bioavailable small molecule drugs that target defective CFTR proteins caused by specific mutations. Furthermore, there is considerable optimism about the prospect of gene replacement or editing therapies to correct all mutations in cystic fibrosis. The recent approvals of ivacaftor and lumacaftor represent the genesis of a new era of precision medicine in the treatment of this condition. These drugs are having a positive impact on the lives of people with cystic fibrosis and are potentially disease modifying. This review provides an update on advances in our understanding of the structure and function of the CFTR, with a focus on state of the art targeted drugs that are in development. PMID:27030675

  12. Analysis of 16 cystic fibrosis mutations in Mexican patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Villalobos-Torres, C.; Rojas-Martinez, A.; Barrera-Saldana, H.A.

    1997-04-14

    We carried out molecular analysis of 80 chromosomes from 40 unrelated Mexican patients with a diagnosis of cystic fibrosis. The study was performed in two PCR steps: a preliminary one to identify mutation AF508, the most frequent cause of cystic fibrosis worldwide, and the second a reverse dot-blot with allele-specific oligonucleotide probes to detect 15 additional common mutations in the Caucasian population. A frequency of 45% for AF508 was found, making it the most common in our sample of Mexican patients. Another five mutations (G542X, 3849 + 10 kb C{r_arrow}T, N1303K, S549N, and 621 + 1 G{r_arrow}T) were detected, andmore » these accounted for 11.25%. The remaining mutations (43.75%) were undetectable with the methodology used. 20 refs., 2 tabs.« less

  13. Novel NEK8 Mutations Cause Severe Syndromic Renal Cystic Dysplasia through YAP Dysregulation

    PubMed Central

    Grampa, Valentina; Odye, Gweltas; Thomas, Sophie; Elkhartoufi, Nadia; Filhol, Emilie; Niel, Olivier; Silbermann, Flora; Lebreton, Corinne; Collardeau-Frachon, Sophie; Rouvet, Isabelle; Alessandri, Jean-Luc; Devisme, Louise; Dieux-Coeslier, Anne; Cordier, Marie-Pierre; Capri, Yline; Khung-Savatovsky, Suonavy; Sigaudy, Sabine; Salomon, Rémi; Antignac, Corinne; Gubler, Marie-Claire; Benmerah, Alexandre; Terzi, Fabiola; Attié-Bitach, Tania; Jeanpierre, Cécile; Saunier, Sophie

    2016-01-01

    Ciliopathies are a group of genetic multi-systemic disorders related to dysfunction of the primary cilium, a sensory organelle present at the cell surface that regulates key signaling pathways during development and tissue homeostasis. In order to identify novel genes whose mutations would cause severe developmental ciliopathies, >500 patients/fetuses were analyzed by a targeted high throughput sequencing approach allowing exome sequencing of >1200 ciliary genes. NEK8/NPHP9 mutations were identified in five cases with severe overlapping phenotypes including renal cystic dysplasia/hypodysplasia, situs inversus, cardiopathy with hypertrophic septum and bile duct paucity. These cases highlight a genotype-phenotype correlation, with missense and nonsense mutations associated with hypodysplasia and enlarged cystic organs, respectively. Functional analyses of NEK8 mutations in patient fibroblasts and mIMCD3 cells showed that these mutations differentially affect ciliogenesis, proliferation/apoptosis/DNA damage response, as well as epithelial morphogenesis. Notably, missense mutations exacerbated some of the defects due to NEK8 loss of function, highlighting their likely gain-of-function effect. We also showed that NEK8 missense and loss-of-function mutations differentially affect the regulation of the main Hippo signaling effector, YAP, as well as the expression of its target genes in patient fibroblasts and renal cells. YAP imbalance was also observed in enlarged spheroids of Nek8-invalidated renal epithelial cells grown in 3D culture, as well as in cystic kidneys of Jck mice. Moreover, co-injection of nek8 MO with WT or mutated NEK8-GFP RNA in zebrafish embryos led to shortened dorsally curved body axis, similar to embryos injected with human YAP RNA. Finally, treatment with Verteporfin, an inhibitor of YAP transcriptional activity, partially rescued the 3D spheroid defects of Nek8-invalidated cells and the abnormalities of NEK8-overexpressing zebrafish embryos. Altogether, our study demonstrates that NEK8 human mutations cause major organ developmental defects due to altered ciliogenesis and cell differentiation/proliferation through deregulation of the Hippo pathway. PMID:26967905

  14. A new compound heterozygous CFTR mutation in a Chinese family with cystic fibrosis.

    PubMed

    Xie, Yingjun; Huang, Xueqiong; Liang, Yujian; Xu, Lingling; Pei, Yuxin; Cheng, Yucai; Zhang, Lidan; Tang, Wen

    2017-11-01

    Cystic fibrosis (CF) is the most common autosomal recessive disease among Caucasians but is rarer in the Chinese population, because mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. To elucidate the causative role of a novel compound heterozygous mutation of CF. In this study, clinical samples were obtained from two siblings with recurrent airway infections, clubbed fingers, salt-sweat and failure to gain weight in a non-consanguineous Chinese family. Next-generation sequencing was performed on the 27 coding exons of CFTR in both children, with confirmation by Sanger sequencing. Next-generation sequencing showed the same compound heterozygous CFTR mutation (c.865A>T p.Arg289X and c.3651_3652insAAAT p.Tyr1219X) in both children. As this mutation is consistent with the clinical manifestations of CF and no other mutations were detected after scanning the gene sequence, we suggest that the CF phenotype is caused by compound heterozygosity for c.865A>T and c.3651_3652insAAAT. As c865A>T is not currently listed in the "Cystic Fibrosis Mutation Database", this information about CF in a Chinese population is of interest. © 2015 John Wiley & Sons Ltd.

  15. Atomic Structure of the Cystic Fibrosis Transmembrane Conductance Regulator.

    PubMed

    Zhang, Zhe; Chen, Jue

    2016-12-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel evolved from the ATP-binding cassette (ABC) transporter family. In this study, we determined the structure of zebrafish CFTR in the absence of ATP by electron cryo-microscopy to 3.7 Å resolution. Human and zebrafish CFTR share 55% sequence identity, and 42 of the 46 cystic-fibrosis-causing missense mutational sites are identical. In CFTR, we observe a large anion conduction pathway lined by numerous positively charged residues. A single gate near the extracellular surface closes the channel. The regulatory domain, dephosphorylated, is located in the intracellular opening between the two nucleotide-binding domains (NBDs), preventing NBD dimerization and channel opening. The structure also reveals why many cystic-fibrosis-causing mutations would lead to defects either in folding, ion conduction, or gating and suggests new avenues for therapeutic intervention. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Cystic fibrosis swine fail to secrete airway surface liquid in response to inhalation of pathogens.

    PubMed

    Luan, Xiaojie; Belev, George; Tam, Julian S; Jagadeeshan, Santosh; Hassan, Noman; Gioino, Paula; Grishchenko, Nikolay; Huang, Yanyun; Carmalt, James L; Duke, Tanya; Jones, Teela; Monson, Bev; Burmester, Monique; Simovich, Tomer; Yilmaz, Orhan; Campanucci, Veronica A; Machen, Terry E; Chapman, L Dean; Ianowski, Juan P

    2017-10-05

    Cystic fibrosis is caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) channel, which can result in chronic lung disease. The sequence of events leading to lung disease is not fully understood but recent data show that the critical pathogenic event is the loss of the ability to clear bacteria due to abnormal airway surface liquid secretion (ASL). However, whether the inhalation of bacteria triggers ASL secretion and whether this is abnormal in cystic fibrosis has never been tested. Here we show, using a novel synchrotron-based in vivo imaging technique, that wild-type pigs display both a basal and a Toll-like receptor-mediated ASL secretory response to the inhalation of cystic fibrosis relevant bacteria. Both mechanisms fail in CFTR -/- swine, suggesting that cystic fibrosis airways do not respond to inhaled pathogens, thus favoring infection and inflammation that may eventually lead to tissue remodeling and respiratory disease.Cystic fibrosis is caused by mutations in the CFTR chloride channel, leading to reduced airway surface liquid secretion. Here the authors show that exposure to bacteria triggers secretion in wild-type but not in pig models of cystic fibrosis, suggesting an impaired response to pathogens contributes to infection.

  17. Short communication: novel truncating mutations in the CFTR gene causing a severe form of cystic fibrosis in Italian patients.

    PubMed

    Lenarduzzi, S; Morgutti, M; Crovella, S; Coiana, A; Rosatelli, M C

    2014-11-14

    Cystic fibrosis (CF) is a common recessive genetic disease caused by mutations in the gene encoding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. More than 1800 different mutations have been described to date. Here, we report 3 novel mutations in CFTR in 3 Italian CF patients. To detect and identify 36 frequent mutations in Caucasians, we used the INNO-LiPA CFTR19 and INNO-LiPA CFTR17+Tn Update kits (Innogenetics; Ghent, Belgium). Our first analysis did not reveal both of the responsible mutations; thus, direct sequencing of the CFTR gene coding region was performed. The 3 patients were compound heterozygous. In one allele, the F508del (c.1521_1523delCTT, p.PHE508del) mutation in exon 11 was observed in each case. For the second allele, in patient No.1, direct sequencing revealed an 11-base pair deletion (GAGGCGATACT) in exon 14 (c.2236_2246del; pGlu746Alafs*29). In patient No. 2, direct sequencing revealed a nonsense mutation at nucleotide 3892 (c.3892G>T) in exon 24. In patient No. 3, direct sequencing revealed a deletion of cytosine in exon 27 (c.4296delC; p.Asn1432Lysfs*16). These 3 novel mutations indicate the production of a truncated protein, which consequently results in a non-functional polypeptide.

  18. CFTR Modulators for the Treatment of Cystic Fibrosis.

    PubMed

    Pettit, Rebecca S; Fellner, Chris

    2014-07-01

    Defects in a single gene lead to the defective proteins that cause cystic fibrosis, making the disease an ideal candidate for mutation-targeted therapy. Although ivacaftor is currently the only FDA-approved CFTR modifier, others are in development.

  19. New and emerging targeted therapies for cystic fibrosis.

    PubMed

    Quon, Bradley S; Rowe, Steven M

    2016-03-30

    Cystic fibrosis (CF) is a monogenic autosomal recessive disorder that affects about 70,000 people worldwide. The clinical manifestations of the disease are caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR) protein. The discovery of the CFTR gene in 1989 has led to a sophisticated understanding of how thousands of mutations in the CFTR gene affect the structure and function of the CFTR protein. Much progress has been made over the past decade with the development of orally bioavailable small molecule drugs that target defective CFTR proteins caused by specific mutations. Furthermore, there is considerable optimism about the prospect of gene replacement or editing therapies to correct all mutations in cystic fibrosis. The recent approvals of ivacaftor and lumacaftor represent the genesis of a new era of precision medicine in the treatment of this condition. These drugs are having a positive impact on the lives of people with cystic fibrosis and are potentially disease modifying. This review provides an update on advances in our understanding of the structure and function of the CFTR, with a focus on state of the art targeted drugs that are in development. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  20. Precision Medicine In Action: The Impact Of Ivacaftor On Cystic Fibrosis-Related Hospitalizations.

    PubMed

    Feng, Lisa B; Grosse, Scott D; Green, Ridgely Fisk; Fink, Aliza K; Sawicki, Gregory S

    2018-05-01

    Cystic fibrosis is a life-threatening genetic disease that causes severe damage to the lungs. Ivacaftor, the first drug that targeted the underlying defect of the disease caused by specific mutations, is a sterling example of the potential of precision medicine. Clinical trial and registry studies showed that ivacaftor improved outcomes and reduced hospitalizations. Our study used US administrative claims data to assess the real-world effectiveness of ivacaftor. Comparing twelve-month rates before and after starting the use of ivacaftor among people who initiated therapy during 2012-2015, we found that overall and cystic fibrosis-related inpatient admissions fell by 55 percent and 81 percent, respectively. There was a comparable reduction in inpatient spending. Ivacaftor appears to be effective for multiple mutations that cause the disease, as suggested by the fact that during the study period, ivacaftor's use was extended to nine additional mutations in 2014. Examination of evidence from clinical trial, clinical care, and administrative data sources is important for understanding the real-world effectiveness of precision medicines such as ivacaftor.

  1. Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

    PubMed

    Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

    2017-11-01

    High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  2. Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

    PubMed

    Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

    2000-08-01

    We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

  3. The L441P mutation of cystic fibrosis transmembrane conductance regulator and its molecular pathogenic mechanisms in a Korean patient with cystic fibrosis.

    PubMed

    Gee, Heon Yung; Kim, Chang Keun; Kim, So Won; Lee, Ji Hyun; Kim, Jeong-Ho; Kim, Kyung Hwan; Lee, Min Goo

    2010-01-01

    Cystic fibrosis (CF) is an autosomal recessive disorder usually found in populations of white Caucasian descent. CF is caused by mutations in the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene. A 5-yr-old Korean girl was admitted complaining of coughing and greenish sputum. Chest radiographs and computed tomographic (CT) scan revealed diffuse bronchiectasis in both lungs. The patient had chronic diarrhea and poor weight gain, and the abdominal pancreaticobiliary CT scan revealed atrophy of the pancreas. Finally, CF was confirmed by the repeated analysis of the quantitative pilocarpine iontophoresis test. The chloride concentration of sweat samples taken from both forearms of the pateint was an average of 88.7 mM/L (normal value <40 mM/L). After a comprehensive search for mutations in the CFTR gene, the patient was found to carry the non-synonymous L441P mutation in one allele. Molecular physiologic analysis of the L441P mutation of CFTR revealed that the L441P mutation completely abolished the CFTR Cl(-) channel activity by disrupting proper protein folding and membrane trafficking of CFTR protein. These results confirmed the pathogenicity of the L441P mutation of CFTR circulating in the Korean population. The possibility of CF should be suspected in patients with chronic bronchiectasis, although the frequency of CF is relatively rare in East Asia.

  4. Analysis of the CFTR gene in Venezuelan cystic fibrosis patients, identification of six novel cystic fibrosis-causing genetic variants.

    PubMed

    Sánchez, Karen; de Mendonca, Elizabeth; Matute, Xiorama; Chaustre, Ismenia; Villalón, Marlene; Takiff, Howard

    2016-01-01

    The mutations in the CFTR gene found in patients with cystic fibrosis (CF) have geographic differences, but there are scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in a group of Venezuelan patients with CF. The 27 exons of the CFTR gene from 110 Venezuelan patients in the National CF Program were amplified and sequenced. A total of 36 different mutations were identified, seven with frequencies greater than 1%: p.Phe508del (27.27%), p.Gly542* (3.18%), c.2988+1G>A (3.18%), p.Arg334Trp (1.36%), p.Arg1162* (1.36%), c.1-8G>C (1.36%), and p.[Gly628Arg;Ser1235Arg](1.36). In 40% of patients, all with a clinical diagnosis of CF, no mutations were found. This report represents the largest cohort of Venezuelan patients with CF ever examined, and includes a wider mutation panel than has been previously studied in this population. Mutations common in Southern European populations predominate, and several new mutations were discovered, but no mutations were found in 40% of the cohort.

  5. Analysis of the CFTR gene in Venezuelan cystic fibrosis patients, identification of six novel cystic fibrosis-causing genetic variants

    PubMed Central

    Sánchez, Karen; de Mendonca, Elizabeth; Matute, Xiorama; Chaustre, Ismenia; Villalón, Marlene; Takiff, Howard

    2016-01-01

    The mutations in the CFTR gene found in patients with cystic fibrosis (CF) have geographic differences, but there are scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in a group of Venezuelan patients with CF. The 27 exons of the CFTR gene from 110 Venezuelan patients in the National CF Program were amplified and sequenced. A total of 36 different mutations were identified, seven with frequencies greater than 1%: p.Phe508del (27.27%), p.Gly542* (3.18%), c.2988+1G>A (3.18%), p.Arg334Trp (1.36%), p.Arg1162* (1.36%), c.1-8G>C (1.36%), and p.[Gly628Arg;Ser1235Arg](1.36). In 40% of patients, all with a clinical diagnosis of CF, no mutations were found. This report represents the largest cohort of Venezuelan patients with CF ever examined, and includes a wider mutation panel than has been previously studied in this population. Mutations common in Southern European populations predominate, and several new mutations were discovered, but no mutations were found in 40% of the cohort. PMID:27022295

  6. A novel mutation causing nephronophthisis in the Lewis polycystic kidney rat localises to a conserved RCC1 domain in Nek8

    PubMed Central

    2012-01-01

    Background Nephronophthisis (NPHP) as a cause of cystic kidney disease is the most common genetic cause of progressive renal failure in children and young adults. NPHP is characterized by abnormal and/or loss of function of proteins associated with primary cilia. Previously, we characterized an autosomal recessive phenotype of cystic kidney disease in the Lewis Polycystic Kidney (LPK) rat. Results In this study, quantitative trait locus analysis was used to define a ~1.6Mbp region on rat chromosome 10q25 harbouring the lpk mutation. Targeted genome capture and next-generation sequencing of this region identified a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene. This is a novel Nek8 mutation that occurs within the regulator of chromosome condensation 1 (RCC1)-like region of the protein. Specifically, the R650C substitution is located within a G[QRC]LG repeat motif of the predicted seven bladed beta-propeller structure of the RCC1 domain. The rat Nek8 gene is located in a region syntenic to portions of human chromosome 17 and mouse 11. Scanning electron microscopy confirmed abnormally long cilia on LPK kidney epithelial cells, and fluorescence immunohistochemistry for Nek8 protein revealed altered cilia localisation. Conclusions When assessed relative to other Nek8 NPHP mutations, our results indicate the whole propeller structure of the RCC1 domain is important, as the different mutations cause comparable phenotypes. This study establishes the LPK rat as a novel model system for NPHP and further consolidates the link between cystic kidney disease and cilia proteins. PMID:22899815

  7. Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy.

    PubMed

    Audrézet, Marie Pierre; Munck, Anne; Scotet, Virginie; Claustres, Mireille; Roussey, Michel; Delmas, Dominique; Férec, Claude; Desgeorges, Marie

    2015-02-01

    Newborn screening (NBS) for cystic fibrosis (CF) was implemented throughout France in 2002. It involves a four-tiered procedure: immunoreactive trypsin (IRT)/DNA/IRT/sweat test [corrected] was implemented throughout France in 2002. The aim of this study was to assess the performance of molecular CFTR gene analysis from the French NBS cohort, to evaluate CF incidence, mutation detection rate, and allelic heterogeneity. During the 8-year period, 5,947,148 newborns were screened for cystic fibrosis. The data were collected by the Association Française pour le Dépistage et la Prévention des Handicaps de l'Enfant. The mutations identified were classified into four groups based on their potential for causing disease, and a diagnostic algorithm was proposed. Combining the genetic and sweat test results, 1,160 neonates were diagnosed as having cystic fibrosis. The corresponding incidence, including both the meconium ileus (MI) and false-negative cases, was calculated at 1 in 4,726 live births. The CF30 kit, completed with a comprehensive CFTR gene analysis, provides an excellent detection rate of 99.77% for the mutated alleles, enabling the identification of a complete genotype in 99.55% of affected neonates. With more than 200 different mutations characterized, we confirmed the French allelic heterogeneity. The very good sensitivity, specificity, and positive predictive value obtained suggest that the four-tiered IRT/DNA/IRT/sweat test procedure may provide an effective strategy for newborn screening for cystic fibrosis.

  8. Targeting a genetic defect: cystic fibrosis transmembrane conductance regulator modulators in cystic fibrosis.

    PubMed

    Derichs, Nico

    2013-03-01

    Cystic fibrosis (CF) is caused by genetic mutations that affect the cystic fibrosis transmembrane conductance regulator (CFTR) protein. These mutations can impact the synthesis and transfer of the CFTR protein to the apical membrane of epithelial cells, as well as influencing the gating or conductance of chloride and bicarbonate ions through the channel. CFTR dysfunction results in ionic imbalance of epithelial secretions in several organ systems, such as the pancreas, gastrointestinal tract, liver and the respiratory system. Since discovery of the CFTR gene in 1989, research has focussed on targeting the underlying genetic defect to identify a disease-modifying treatment for CF. Investigated management strategies have included gene therapy and the development of small molecules that target CFTR mutations, known as CFTR modulators. CFTR modulators are typically identified by high-throughput screening assays, followed by preclinical validation using cell culture systems. Recently, one such modulator, the CFTR potentiator ivacaftor, was approved as an oral therapy for CF patients with the G551D-CFTR mutation. The clinical development of ivacaftor not only represents a breakthrough in CF care but also serves as a noteworthy example of personalised medicine.

  9. A universal array-based multiplexed test for cystic fibrosis carrier screening.

    PubMed

    Amos, Jean A; Bridge-Cook, Philippa; Ponek, Victor; Jarvis, Michael R

    2006-01-01

    Cystic fibrosis is a multisystem autosomal recessive disorder with high carrier frequencies in caucasians and significant, but lower, carrier frequencies in other ethnicities. Based on technology that allows high detection of mutations in caucasians and significant detection in other ethnic groups, the American College of Medical Genetics (ACMG) and American College of Obstetricians and Gynecologists (ACOG) have recommended pan-ethnic cystic fibrosis carrier screening for all reproductive couples. This paper discusses carrier screening using the Tag-It multiplex mutation platform and the Cystic Fibrosis Mutation Detection Kit. The Tag-It cystic fibrosis assay is a multiplexed genotyping assay that detects a panel of 40 cystic fibrosis transmembrane conductance regulator mutations including the 23 mutations recommended by the ACMG and ACOG for population screening. A total of 16 additional mutations detected by the Tag-It cystic fibrosis assay may also be common. The assay method is described in detail, and its performance in a genetics reference laboratory performing high-volume cystic fibrosis carrier screening is assessed.

  10. Cystic fibrosis transmembrane conductance regulator-emerging regulator of cancer.

    PubMed

    Zhang, Jieting; Wang, Yan; Jiang, Xiaohua; Chan, Hsiao Chang

    2018-05-01

    Mutations of cystic fibrosis transmembrane conductance regulator (CFTR) cause cystic fibrosis, the most common life-limiting recessive genetic disease among Caucasians. CFTR mutations have also been linked to increased risk of various cancers but remained controversial for a long time. Recent studies have begun to reveal that CFTR is not merely an ion channel but also an important regulator of cancer development and progression with multiple signaling pathways identified. In this review, we will first present clinical findings showing the correlation of genetic mutations or aberrant expression of CFTR with cancer incidence in multiple cancers. We will then focus on the roles of CFTR in fundamental cellular processes including transformation, survival, proliferation, migration, invasion and epithelial-mesenchymal transition in cancer cells, highlighting the signaling pathways involved. Finally, the association of CFTR expression levels with patient prognosis, and the potential of CFTR as a cancer prognosis indicator in human malignancies will be discussed.

  11. Disease-causing Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator Determine the Functional Responses of Alveolar Macrophages*

    PubMed Central

    Deriy, Ludmila V.; Gomez, Erwin A.; Zhang, Guangping; Beacham, Daniel W.; Hopson, Jessika A.; Gallan, Alexander J.; Shevchenko, Pavel D.; Bindokas, Vytautas P.; Nelson, Deborah J.

    2009-01-01

    Alveolar macrophages (AMs) play a major role in host defense against microbial infections in the lung. To perform this function, these cells must ingest and destroy pathogens, generally in phagosomes, as well as secrete a number of products that signal other immune cells to respond. Recently, we demonstrated that murine alveolar macrophages employ the cystic fibrosis transmembrane conductance regulator (CFTR) Cl− channel as a determinant in lysosomal acidification (Di, A., Brown, M. E., Deriy, L. V., Li, C., Szeto, F. L., Chen, Y., Huang, P., Tong, J., Naren, A. P., Bindokas, V., Palfrey, H. C., and Nelson, D. J. (2006) Nat. Cell Biol. 8, 933–944). Lysosomes and phagosomes in murine cftr−/− AMs failed to acidify, and the cells were deficient in bacterial killing compared with wild type controls. Cystic fibrosis is caused by mutations in CFTR and is characterized by chronic lung infections. The information about relationships between the CFTR genotype and the disease phenotype is scarce both on the organismal and cellular level. The most common disease-causing mutation, ΔF508, is found in 70% of patients with cystic fibrosis. The mutant protein fails to fold properly and is targeted for proteosomal degradation. G551D, the second most common mutation, causes loss of function of the protein at the plasma membrane. In this study, we have investigated the impact of CFTR ΔF508 and G551D on a set of core intracellular functions, including organellar acidification, granule secretion, and microbicidal activity in the AM. Utilizing primary AMs from wild type, cftr−/−, as well as mutant mice, we show a tight correlation between CFTR genotype and levels of lysosomal acidification, bacterial killing, and agonist-induced secretory responses, all of which would be expected to contribute to a significant impact on microbial clearance in the lung. PMID:19837664

  12. Contribution of the TTC21B gene to glomerular and cystic kidney diseases.

    PubMed

    Bullich, Gemma; Vargas, Iván; Trujillano, Daniel; Mendizábal, Santiago; Piñero-Fernández, Juan Alberto; Fraga, Gloria; García-Solano, José; Ballarín, José; Estivill, Xavier; Torra, Roser; Ars, Elisabet

    2017-01-01

    The TTC21B gene was initially described as causative of nephronophthisis (NPHP). Recently, the homozygous TTC21B p.P209L mutation has been identified in families with focal segmental glomerulosclerosis (FSGS) and tubulointerstitial lesions. Heterozygous TTC21B variants have been proposed as genetic modifiers in ciliopathies. We aimed to study the causative and modifying role of the TTC21B gene in glomerular and cystic kidney diseases. Mutation analysis of the TTC21B gene was performed by massive parallel sequencing. We studied the causative role of the TTC21B gene in 17 patients with primary diagnosis of FSGS or NPHP and its modifying role in 184 patients with inherited glomerular or cystic kidney diseases. Disease-causing TTC21B mutations were identified in three families presenting nephrotic proteinuria with FSGS and tubulointerstitial lesions in which some family members presented hypertension and myopia. Two families carried the homozygous p.P209L and the third was compound heterozygous for the p.P209L and a novel p.H426D mutation. Rare heterozygous TTC21B variants predicted to be pathogenic were found in five patients. These TTC21B variants were significantly more frequent in renal patients compared with controls (P = 0.0349). Two patients with a heterozygous deleterious TTC21B variant in addition to the disease-causing mutation presented a more severe phenotype than expected. Our results confirm the causal role of the homozygous p.P209L TTC21B mutation in two new families with FSGS and tubulointerstitial disease. We identified a novel TTC21B mutation demonstrating that p.P209L is not the unique causative mutation of this nephropathy. Thus, TTC21B mutation analysis should be considered for the genetic diagnosis of families with FSGS and tubulointerstitial lesions. Finally, we provide evidence that heterozygous deleterious TTC21B variants may act as genetic modifiers of the severity of glomerular and cystic kidney diseases. © The Author 2016. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  13. Inversin, the gene product mutated in nephronophthisis type II, functions as a molecular switch between Wnt signaling pathways

    PubMed Central

    Simons, Matias; Gloy, Joachim; Ganner, Athina; Bullerkotte, Axel; Bashkurov, Mikhail; Krönig, Corinna; Schermer, Bernhard; Benzing, Thomas; Cabello, Olga A; Jenny, Andreas; Mlodzik, Marek; Polok, Bozena; Driever, Wolfgang; Obara, Tomoko; Walz, Gerd

    2013-01-01

    Cystic renal diseases are caused by mutations of proteins that share a unique subcellular localization: the primary cilium of tubular epithelial cells1. Mutations of the ciliary protein inversin cause nephronophthisis type II, an autosomal recessive cystic kidney disease characterized by extensive renal cysts, situs inversus and renal failure2. Here we report that inversin acts as a molecular switch between different Wnt signaling cascades. Inversin inhibits the canonical Wnt pathway by targeting cytoplasmic dishevelled (Dsh or Dvl1) for degradation; concomitantly, it is required for convergent extension movements in gastrulating Xenopus laevis embryos and elongation of animal cap explants, both regulated by noncanonical Wnt signaling. In zebrafish, the structurally related switch molecule diversin ameliorates renal cysts caused by the depletion of inversin, implying that an inhibition of canonical Wnt signaling is required for normal renal development. Fluid flow increases inversin levels in ciliated tubular epithelial cells and seems to regulate this crucial switch between Wnt signaling pathways during renal development. PMID:15852005

  14. Longitudinal cystic fibrosis care.

    PubMed

    Antunovic, S S; Lukac, M; Vujovic, D

    2013-01-01

    Cystic fibrosis is a complex disease entity that presents considerable lifelong challenges. Implementation of medical and surgical treatment options involves multisystem interventions to prevent and treat lung and gastrointestinal manifestations of cystic fibrosis and associated comorbidities. From birth through adulthood, cystic fibrosis care entails a longitudinal regimen aimed at achieving relief of disease symptoms and enhanced life expectancy. With increased knowledge of the molecular behavior of the cystic fibrosis transmembrane conductance regulator (CFTR) in health and disease, clinical practice has been enriched by the prospect of novel strategies, including mutation-specific drug and gene therapy targeting restoration of corrupted transepithelial ion transport. Emerging paradigms of comprehensive care increasingly enable personalized solutions to address the root cause of disease-transforming management options for individuals with cystic fibrosis.

  15. Revisiting sweat chloride test results based on recent guidelines for diagnosis of cystic fibrosis.

    PubMed

    Pagaduan, Jayson V; Ali, Mahesheema; Dowlin, Michael; Suo, Liye; Ward, Tabitha; Ruiz, Fadel; Devaraj, Sridevi

    2018-03-01

    Recent sweat chloride guidelines published by the Cystic Fibrosis Foundation changed the intermediate sweat chloride concentration range from 40-59 mmol/L to 30-59 mmol/L for age > 6 months. We wanted to know how this new guideline would impact detection of cystic fibrosis among patients who previously had sweat tests done at Texas Children's Hospital. We revisited sweat chloride test results (n = 3012) in the last 5 years at Texas Children's Hospital based on the new guidelines on diagnosis of cystic fibrosis from the Cystic Fibrosis Foundation. We identified 125 patients that would be reclassified in the intermediate sweat chloride value with the new guidelines that were classified as "unlikely to have CF" in the previous guidelines. 8 (32%) patients with CFTR gene testing were positive for CFTR gene mutation(s). 4 (50%) of these patients were identified to have 2 CFTR mutations. One had variant combination that was reported to cause CF but all were diagnosed with CFTR-related metabolic syndrome. Our findings concur with the new CF diagnosis guidelines that changing the intermediate cut-off to 30-59 mmol/L sweat chloride concentration in combination with CFTR genetic analysis enhances the probability of identifying individuals that have risk of developing CF or have CF and enables for earlier therapeutic intervention.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thibodeau, Patrick H.; Brautigam, Chad A.; Machius, Mischa

    Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), an integral membrane protein, cause cystic fibrosis (CF). The most common CF-causing mutant, deletion of Phe508, fails to properly fold. To elucidate the role Phe508 plays in the folding of CFTR, missense mutations at this position were generated. Only one missense mutation had a pronounced effect on the stability and folding of the isolated domain in vitro. In contrast, many substitutions, including those of charged and bulky residues, disrupted folding of full-length CFTR in cells. Structures of two mutant nucleotide-binding domains (NBDs) reveal only local alterations of the surface near positionmore » 508. These results suggest that the peptide backbone plays a role in the proper folding of the domain, whereas the side chain plays a role in defining a surface of NBD1 that potentially interacts with other domains during the maturation of intact CFTR.« less

  17. Cystic fibrosis carrier screening in a North American population.

    PubMed

    Zvereff, Val V; Faruki, Hawazin; Edwards, Marcia; Friedman, Kenneth J

    2014-07-01

    The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

  18. Strategies for the etiological therapy of cystic fibrosis.

    PubMed

    Maiuri, Luigi; Raia, Valeria; Kroemer, Guido

    2017-11-01

    Etiological therapies aim at repairing the underlying cause of cystic fibrosis (CF), which is the functional defect of the cystic fibrosis transmembrane conductance regulator (CFTR) protein owing to mutations in the CFTR gene. Among these, the F508del CFTR mutation accounts for more than two thirds of CF cases worldwide. Two somehow antinomic schools of thought conceive CFTR repair in a different manner. According to one vision, drugs should directly target the mutated CFTR protein to increase its plasma membrane expression (correctors) or improve its ion transport function (potentiators). An alternative strategy consists in modulating the cellular environment and proteostasis networks in which the mutated CFTR protein is synthesized, traffics to its final destination, the plasma membrane, and is turned over. We will analyze distinctive advantages and drawbacks of these strategies in terms of their scientific and clinical dimensions, and we will propose a global strategy for CF research and development based on a reconciliatory approach. Moreover, we will discuss the utility of preclinical biomarkers that may guide the personalized, patient-specific implementation of CF therapies.

  19. Strategies for the etiological therapy of cystic fibrosis

    PubMed Central

    Maiuri, Luigi; Raia, Valeria; Kroemer, Guido

    2017-01-01

    Etiological therapies aim at repairing the underlying cause of cystic fibrosis (CF), which is the functional defect of the cystic fibrosis transmembrane conductance regulator (CFTR) protein owing to mutations in the CFTR gene. Among these, the F508del CFTR mutation accounts for more than two thirds of CF cases worldwide. Two somehow antinomic schools of thought conceive CFTR repair in a different manner. According to one vision, drugs should directly target the mutated CFTR protein to increase its plasma membrane expression (correctors) or improve its ion transport function (potentiators). An alternative strategy consists in modulating the cellular environment and proteostasis networks in which the mutated CFTR protein is synthesized, traffics to its final destination, the plasma membrane, and is turned over. We will analyze distinctive advantages and drawbacks of these strategies in terms of their scientific and clinical dimensions, and we will propose a global strategy for CF research and development based on a reconciliatory approach. Moreover, we will discuss the utility of preclinical biomarkers that may guide the personalized, patient-specific implementation of CF therapies. PMID:28937684

  20. Sweat chloride and immunoreactive trypsinogen in infants carrying two CFTR mutations and not affected by cystic fibrosis.

    PubMed

    Castellani, Carlo; Tridello, Gloria; Tamanini, Anna; Assael, Baroukh M

    2017-07-01

    Newborns with raised immunotrypsinogen levels who have non-pathological sweat chloride values and carry two cystic fibrosis transmembrane regulator ( CFTR ) mutations of which at least one is not acknowledged to be cystic fibrosis (CF)-causing are at risk of developing clinical manifestations consistent with CFTR-related disorders or even CF. It is not known whether newborns with similar genotypes and normal immunoreactive trypsinogen (IRT) may share the same risk. This study found that newborns with these characteristics and normal IRT have lower sweat chloride values than those with raised IRT (p=0.007). Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  1. Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis.

    PubMed

    Furlan, Larissa Lazzarini; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia; Salomão Junior, João Batista; Souza, Dorotéia Rossi Silva; Marson, Fernando Augusto Lima

    Interleukin 8 protein promotes inflammatory responses, even in airways. The presence of interleukin 8 gene variants causes altered inflammatory responses and possibly varied responses to inhaled bronchodilators. Thus, this study analyzed the interleukin 8 variants (rs4073, rs2227306, and rs2227307) and their association with the response to inhaled bronchodilators in cystic fibrosis patients. Analysis of interleukin 8 gene variants was performed by restriction fragment length polymorphism of polymerase chain reaction. The association between spirometry markers and the response to inhaled bronchodilators was evaluated by Mann-Whitney and Kruskal-Wallis tests. The analysis included all cystic fibrosis patients, and subsequently patients with two mutations in the cystic fibrosis transmembrane conductance regulator gene belonging to classes I to III. This study included 186 cystic fibrosis patients. There was no association of the rs2227307 variant with the response to inhaled bronchodilators. The rs2227306 variant was associated with FEF 50% in the dominant group and in the group with two identified mutations in the cystic fibrosis transmembrane conductance regulator gene. The rs4073 variant was associated with spirometry markers in four genetic models: co-dominant (FEF 25-75% and FEF 75% ), dominant (FEV 1 , FEF 50% , FEF 75% , and FEF 25-75% ), recessive (FEF 75% and FEF 25-75% ), and over-dominant (FEV 1 /FVC). This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  2. Kidney enlargement and multiple liver cyst formation implicate mutations in PKD1/2 in adult sporadic polycystic kidney disease.

    PubMed

    Fujimaru, T; Mori, T; Sekine, A; Mandai, S; Chiga, M; Kikuchi, H; Ando, F; Mori, Y; Nomura, N; Iimori, S; Naito, S; Okado, T; Rai, T; Hoshino, J; Ubara, Y; Uchida, S; Sohara, E

    2018-07-01

    Distinguishing autosomal-dominant polycystic kidney disease (ADPKD) from other inherited renal cystic diseases in patients with adult polycystic kidney disease and no family history is critical for correct treatment and appropriate genetic counseling. However, for patients with no family history, there are no definitive imaging findings that provide an unequivocal ADPKD diagnosis. We analyzed 53 adult polycystic kidney disease patients with no family history. Comprehensive genetic testing was performed using capture-based next-generation sequencing for 69 genes currently known to cause hereditary renal cystic diseases including ADPKD. Through our analysis, 32 patients had PKD1 or PKD2 mutations. Additionally, 3 patients with disease-causing mutations in NPHP4, PKHD1, and OFD1 were diagnosed with an inherited renal cystic disease other than ADPKD. In patients with PKD1 or PKD2 mutations, the prevalence of polycystic liver disease, defined as more than 20 liver cysts, was significantly higher (71.9% vs 33.3%, P = .006), total kidney volume was significantly increased (median, 1580.7 mL vs 791.0 mL, P = .027) and mean arterial pressure was significantly higher (median, 98 mm Hg vs 91 mm Hg, P = .012). The genetic screening approach and clinical features described here are potentially beneficial for optimal management of adult sporadic polycystic kidney disease patients. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. R248G cystic fibrosis transmembrane conductance regulator mutation in three siblings presenting with recurrent acute pancreatitis and reproductive issues: a case series.

    PubMed

    Villalona, Seiichi; Glover-López, Guillermo; Ortega-García, Juan Antonio; Moya-Quiles, Rosa; Mondejar-López, Pedro; Martínez-Romero, Maria C; Rigabert-Montiel, Mariano; Pastor-Vivero, María D; Sánchez-Solís, Manuel

    2017-02-15

    Mutational combinations of the cystic fibrosis transmembrane conductance regulator, CFTR, gene have different phenotypic manifestations at the molecular level with varying clinical consequences for individuals possessing such mutations. Reporting cystic fibrosis transmembrane conductance regulator mutations is important in understanding the genotype-phenotype correlations and associated clinical presentations in patients with cystic fibrosis. Understanding the effects of mutations is critical in developing appropriate treatments for individuals affected with cystic fibrosis, non-classic cystic fibrosis, or cystic fibrosis transmembrane conductance regulator-related disorders. This is the first report of related individuals possessing the R248G missense cystic fibrosis transmembrane conductance regulator mutation and we present their associated clinical histories. All three patients are of Spanish descent. Deoxyribonucleic acid analysis revealed that all three siblings possessed a novel c.742A>G mutation, resulting in a p.Arg248Gly (R248G) amino acid change in exon 6 in trans with the known N1303K mutant allele. Case 1 patient is a 39-year-old infertile man presenting with congenital unilateral absence of the vas deferens and recurrent episodes of epigastric pain. Case 2 patient is a 32-year-old woman presenting with periods of infertility, two previous spontaneous abortions, recurrent epigastric pain, and recurrent pancreatitis. Case 3 patient is a 29-year-old woman presenting with recurrent pancreatitis and epigastric pain. We report the genotype-phenotype correlations and clinical manifestations of a novel R248G cystic fibrosis transmembrane conductance regulator mutation: congenital unilateral absence of the vas deferens in males, reduced female fertility, and recurrent acute pancreatitis. In addition, we discuss the possible functional consequences of the mutations at the molecular level.

  4. Heterogeneity of the cystic fibrosis phenotype in a large kindred family in Qatar with cystic fibrosis mutation (I1234V).

    PubMed

    Abdul Wahab, A; Al Thani, G; Dawod, S T; Kambouris, M; Al Hamed, M

    2001-04-01

    Twenty-nine subjects (17 families) with cystic fibrosis belonging to the same Bedouin tribe were screened for cystic fibrosis transmembrane regulator gene mutations (CFTR). Homozygous I1234V mutation in exon 19 was identified in all families with a relatively high rate of consanguinity (96.6 per cent). The homozygous I1234V mutation tended to present with a variable degree of pulmonary disease, pancreatic insufficiency and electrolyte imbalance. Homozygous I1234V was found to be a common mutation in the studied Bedouin tribe in Qatar.

  5. Mutation spectrum and differential gene expression in cystic and solid vestibular schwannoma.

    PubMed

    Zhang, Zhihua; Wang, Zhaoyan; Sun, Lianhua; Li, Xiaohua; Huang, Qi; Yang, Tao; Wu, Hao

    2014-03-01

    We sought to characterize the mutation spectrum of NF2 and the differential gene expression in cystic and solid vestibular schwannomas. We collected tumor tissue and blood samples of 31 cystic vestibular schwannomas and 114 solid vestibular schwannomas. Mutation screening of NF2 was performed in both tumor and blood DNA samples of all patients. cDNA microarray was used to analyze the differential gene expression between 11 cystic vestibular schwannomas and 6 solid vestibular schwannomas. Expression levels of top candidate genes were verified by quantitative reverse transcription PCR. NF2 mutations were identified in 34.5% of sporadic vestibular schwannomas, with all mutations being exclusively somatic. No significant difference was found between the mutation detection rates of cystic vestibular schwannoma (35.5%) and solid vestibular schwannoma (34.2%). cDNA microarray analysis detected a total of 46 differentially expressed genes between the cystic vestibular schwannoma and solid vestibular schwannoma samples. The significantly decreased expression of four top candidate genes, C1orf130, CNTF, COL4A3, and COL4A4, was verified by quantitative reverse transcription PCR. NF2 mutations are not directly involved in the cystic formation of vestibular schwannoma. In addition, the differential gene expression of cystic vestibular schwannoma reported in our study may provide useful insights into the molecular mechanism underlying this process.

  6. Frequency of 8 CFTR gene mutations in cystic fibrosis patients in Minas Gerais, Brazil, diagnosed by neonatal screening.

    PubMed

    Perone, C; Medeiros, G S; del Castillo, D M; de Aguiar, M J B; Januário, J N

    2010-02-01

    The nature and frequency of cystic fibrosis mutations in Brazil is not uniform due to the highly varied ethnic composition of the population. The average frequency of the F508del mutation has been reported to be 48.6%. Other common mutations in Brazil are G542X, R1162X, and N1303K. The aim of this study was to analyze the frequency of 8 mutations (F508del, G542X, R1162X, N1303K, W1282X, G85E, 3120+1G>A, and 711+1G>T) in a sample of 111 newborn patients with cystic fibrosis diagnosed by the Cystic Fibrosis Neonatal Screening Program of Minas Gerais State. The mutations were tested by allele-specific oligonucleotide PCR with specially designed primers. An allele frequency of 48.2% was observed for the F508del mutation, and allele frequencies of 5.41, 4.50, 4.05, and 3.60% were found for the R1162X, G542X, 3120+1G>A, and G85E mutations, respectively. The genotypes obtained were in Hardy-Weinberg equilibrium. These data demonstrate that the 8-mutation panel studied here has extensive coverage (68%) for the cystic fibrosis mutations in Minas Gerais. These data improve our knowledge of cystic fibrosis in Brazil, particularly in this region. In addition, this investigation contributed to the establishment of a sensitive and population-specific mutation panel, which can be helpful for molecular diagnosis of cystic fibrosis.

  7. Impact of the F508del mutation on ovine CFTR, a Cl− channel with enhanced conductance and ATP-dependent gating

    PubMed Central

    Cai, Zhiwei; Palmai-Pallag, Timea; Khuituan, Pissared; Mutolo, Michael J; Boinot, Clément; Liu, Beihui; Scott-Ward, Toby S; Callebaut, Isabelle; Harris, Ann; Sheppard, David N

    2015-01-01

    Cross-species comparative studies are a powerful approach to understanding the epithelial Cl− channel cystic fibrosis transmembrane conductance regulator (CFTR), which is defective in the genetic disease cystic fibrosis (CF). Here, we investigate the single-channel behaviour of ovine CFTR and the impact of the most common CF mutation, F508del-CFTR, using excised inside-out membrane patches from transiently transfected CHO cells. Like human CFTR, ovine CFTR formed a weakly inwardly rectifying Cl− channel regulated by PKA-dependent phosphorylation, inhibited by the open-channel blocker glibenclamide. However, for three reasons, ovine CFTR was noticeably more active than human CFTR. First, single-channel conductance was increased. Second, open probability was augmented because the frequency and duration of channel openings were increased. Third, with enhanced affinity and efficacy, ATP more strongly stimulated ovine CFTR channel gating. Consistent with these data, the CFTR modulator phloxine B failed to potentiate ovine CFTR Cl− currents. Similar to its impact on human CFTR, the F508del mutation caused a temperature-sensitive folding defect, which disrupted ovine CFTR protein processing and reduced membrane stability. However, the F508del mutation had reduced impact on ovine CFTR channel gating in contrast to its marked effects on human CFTR. We conclude that ovine CFTR forms a regulated Cl− channel with enhanced conductance and ATP-dependent channel gating. This phylogenetic analysis of CFTR structure and function demonstrates that subtle changes in structure have pronounced effects on channel function and the consequences of the CF mutation F508del. Key points Malfunction of the cystic fibrosis transmembrane conductance regulator (CFTR), a gated pathway for chloride movement, causes the common life-shortening genetic disease cystic fibrosis (CF). Towards the development of a sheep model of CF, we have investigated the function of sheep CFTR. We found that sheep CFTR was noticeably more active than human CFTR, while the most common CF mutation, F508del, had reduced impact on sheep CFTR function. Our results demonstrate that subtle changes in protein structure have marked effects on CFTR function and the consequences of the CF mutation F508del. PMID:25763566

  8. Nephronophthisis: Disease Mechanisms of a Ciliopathy

    PubMed Central

    Hildebrandt, Friedhelm; Attanasio, Massimo; Otto, Edgar

    2009-01-01

    Nephronophthisis (NPHP), a recessive cystic kidney disease, is the most frequent genetic cause of end-stage kidney disease in children and young adults. Positional cloning of nine genes (NPHP1-9) and functional characterization of their encoded proteins (nephrocystins) has contributed to a unifying theory that defines cystic kidney diseases as “ciliopathies”. The theory is based on the finding that all proteins mutated in cystic kidney diseases of humans or animal models are expressed in primary cilia or centrosomes of renal epithelial cells. Primary cilia are sensory organelles that connect mechanosensory, visual, and other stimuli to mechanisms of epithelial cell polarity and cell cycle control. Mutations in NPHP genes cause defects in signaling mechanisms that involve the non-canonical Wnt signaling pathway and the sonic hedgehog signaling pathway, resulting in defects of planar cell polarity and tissue maintenance. The ciliary theory explains the multiple organ involvement in NPHP, which includes retinal degeneration, cerebellar hypoplasia, liver fibrosis, situs inversus, and mental retardation. Positional cloning of dozens of unknown genes that cause NPHP will elucidate further signaling mechanisms involved. Nephrocystins are highly conserved in evolution, thus allowing the use of animal models to develop future therapeutic approaches. PMID:19118152

  9. A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis

    PubMed Central

    Lucarelli, Marco; Bruno, Sabina Maria; Pierandrei, Silvia; Ferraguti, Giampiero; Stamato, Antonella; Narzi, Fabiana; Amato, Annalisa; Cimino, Giuseppe; Bertasi, Serenella; Quattrucci, Serena; Strom, Roberto

    2015-01-01

    Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype–phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype–phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype–phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway. PMID:25910067

  10. [Molecular diagnosis of cystic fibrosis in 93 Argentinean patients and detection of heterozygotes in affected families. Impact on health services and therapeutic advances].

    PubMed

    Oller de Ramírez, Ana M; Ghio, Addy; Melano de Botelli, Myrna; Dodelson de Kremer, Raquel

    2008-08-01

    The cystic fibrosis is an autosomal recessive disease caused by more than 1500 mutations and variants in the cystic fibrosis transmembrane conductance regulator gene. To establish the spectrum and frequency of mutations on this gene in Argentinean patients.To detect heterozygotes in affected families. We investigated 91 clinical and biochemically confirmed patients with 2 elevated sweat tests and 2 sterile adults. We worked with 165 relatives. The molecular diagnosis was accomplished in 3 serial stages: a) determination of 29 frequent mutations; b) haplotypes for microsatellites; c) an extensive screening of gene through single strand conformation analysis and multiplex denaturing gradient gel electrophoresis with sequencing of abnormal patterns. Once patient's genotype was confirmed, we investigated the heterozygotes' state in the relatives. 1ST OBJECTIVE: Fourteen mutations were identified. Three more mutations were detected and other 11 mutations were characterized, 3 of them novel (p.G27R, c.622-2A>G, p.W277R). In total, we have identified 28 mutations responsible for 90.3% of the mutated alleles, 14 with a higher frequency than 1%. 2ND OBJECTIVE: From 165 investigated people, 143 were confirmed as heterozygotes and with normal genotype 22. This work contributed to the molecular characterization of patients with classic and atypical phenotypes and to the detection of great numbers of carriers. New pharmacological therapeutic investigations are based on the mutation type. Therefore, knowledge of patients, mutations (genotype) has significant importance for the future application of specific therapies.

  11. Novel short chain fatty acids restore chloride secretion in cystic fibrosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Toan D.; Kim, Ug-Sung; Perrine, Susan P.

    2006-03-31

    Phenylalanine deletion at position 508 of the cystic fibrosis transmembrane conductance regulator ({delta}F508-CFTR), the most common mutation in cystic fibrosis (CF), causes a misfolded protein exhibiting partial chloride conductance and impaired trafficking to the plasma membrane. 4-Phenylbutyrate corrects defective {delta}F508-CFTR trafficking in vitro, but is not clinically efficacious. From a panel of short chain fatty acid derivatives, we showed that 2,2-dimethyl-butyrate (ST20) and {alpha}-methylhydrocinnamic acid (ST7), exhibiting high oral bioavailability and sustained plasma levels, correct the {delta}F508-CFTR defect. Pre-incubation ({>=}6 h) of CF IB3-1 airway cells with {>=}1 mM ST7 or ST20 restored the ability of 100 {mu}M forskolin tomore » stimulate an {sup 125}I{sup -} efflux. This efflux was fully inhibited by NPPB, DPC, or glibenclamide, suggesting mediation through CFTR. Partial inhibition by DIDS suggests possible contribution from an additional Cl{sup -} channel regulated by CFTR. Thus, ST7 and ST20 offer treatment potential for CF caused by the {delta}F508 mutation.« less

  12. Restoring Cystic Fibrosis Transmembrane Conductance Regulator Function Reduces Airway Bacteria and Inflammation in People with Cystic Fibrosis and Chronic Lung Infections.

    PubMed

    Hisert, Katherine B; Heltshe, Sonya L; Pope, Christopher; Jorth, Peter; Wu, Xia; Edwards, Rachael M; Radey, Matthew; Accurso, Frank J; Wolter, Daniel J; Cooke, Gordon; Adam, Ryan J; Carter, Suzanne; Grogan, Brenda; Launspach, Janice L; Donnelly, Seamas C; Gallagher, Charles G; Bruce, James E; Stoltz, David A; Welsh, Michael J; Hoffman, Lucas R; McKone, Edward F; Singh, Pradeep K

    2017-06-15

    Previous work indicates that ivacaftor improves cystic fibrosis transmembrane conductance regulator (CFTR) activity and lung function in people with cystic fibrosis and G551D-CFTR mutations but does not reduce density of bacteria or markers of inflammation in the airway. These findings raise the possibility that infection and inflammation may progress independently of CFTR activity once cystic fibrosis lung disease is established. To better understand the relationship between CFTR activity, airway microbiology and inflammation, and lung function in subjects with cystic fibrosis and chronic airway infections. We studied 12 subjects with G551D-CFTR mutations and chronic airway infections before and after ivacaftor. We measured lung function, sputum bacterial content, and inflammation, and obtained chest computed tomography scans. Ivacaftor produced rapid decreases in sputum Pseudomonas aeruginosa density that began within 48 hours and continued in the first year of treatment. However, no subject eradicated their infecting P. aeruginosa strain, and after the first year P. aeruginosa densities rebounded. Sputum total bacterial concentrations also decreased, but less than P. aeruginosa. Sputum inflammatory measures decreased significantly in the first week of treatment and continued to decline over 2 years. Computed tomography scans obtained before and 1 year after ivacaftor treatment revealed that ivacaftor decreased airway mucous plugging. Ivacaftor caused marked reductions in sputum P. aeruginosa density and airway inflammation and produced modest improvements in radiographic lung disease in subjects with G551D-CFTR mutations. However, P. aeruginosa airway infection persisted. Thus, measures that control infection may be required to realize the full benefits of CFTR-targeting treatments.

  13. Cystic fibrosis liver disease - from diagnosis to risk factors.

    PubMed

    Ciucă, Ioana Mihaiela; Pop, Liviu; Tămaş, Liviu; Tăban, Sorina

    2014-01-01

    Cystic fibrosis (CF) is the most frequent monogenic genetic disease, autosomal recessive transmitted, characterized by an impressive clinical polymorphism and appreciative fatal prospective. Liver disease is the second non-pulmonary cause of death in cystic fibrosis, which, with increasing life expectancy, became an important management problem. Predisposing factors like male gender, pancreatic insufficiency, meconium ileus and severe mutation are incriminated to influence the occurrence of cystic fibrosis associated liver disease (CFLD). Our study included 174 patients with CF, monitored in the National Cystic Fibrosis Centre, Timisoara, Romania. They were routinely followed-up by clinical assessment, liver biochemical tests, ultrasound examinations and other methods like transient elastography, biopsy, in selected cases. Sixty-six patients, with median age at diagnosis 4.33 years, diagnosed with CFLD, without significant gender gap. CFLD was frequent in patients aged over eight years, with meconium ileus history, carriers of severe mutations (p=0.002). Pancreatic insufficiency, although present in 75% of patients with CFLD was not confirmed as risk factor, not male gender, in our study. CF children older than eight years, carriers of a severe genotype, with a positive history of meconium ileus, were more likely predisposed to CFLD.

  14. Cystic Fibrosis in the African Diaspora.

    PubMed

    Stewart, Cheryl; Pepper, Michael S

    2017-01-01

    Identifying mutations that cause cystic fibrosis (CF) is important for making an early, unambiguous diagnosis, which, in turn, is linked to better health and a greater life expectancy. In patients of African descent, a molecular diagnosis is often confounded by the fact that the majority of investigations undertaken to identify causative mutations have been conducted on European populations, and CF-causing mutations tend to be population specific. We undertook a survey of published data with the aim of identifying causative CF mutations in patients of African descent in the Americas. We found that 1,584 chromosomes had been tested in only 6 countries, of which 876 alleles (55.3%) still remained unidentified. There were 59 mutations identified. Of those, 41 have been shown to cause CF, 17 have no associated functional studies, and one (R117H) is of varying clinical consequence. The most common mutations identified in the patients of African descent were: ΔF508 (29.4% identified in the United States, Colombia, Brazil, and Venezuela); 3120 + 1G>A (8.4% identified in Brazil, the United States, and Colombia); G85E (3.8% identified in Brazil); 1811 + 1.6kbA>G (3.7% identified in Colombia); and 1342 - 1G>C (3.1% identified in the United States). The majority of the mutations identified (81.4%) have been described in just one country. Our findings indicate that there is a need to fully characterize the spectrum of CF mutations in the diaspora to improve diagnostic accuracy for these patients and facilitate treatment.

  15. mRNA-based detection of rare CFTR mutations improves genetic diagnosis of cystic fibrosis in populations with high genetic heterogeneity.

    PubMed

    Felício, V; Ramalho, A S; Igreja, S; Amaral, M D

    2017-03-01

    Even with advent of next generation sequencing complete sequencing of large disease-associated genes and intronic regions is economically not feasible. This is the case of cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible for cystic fibrosis (CF). Yet, to confirm a CF diagnosis, proof of CFTR dysfunction needs to be obtained, namely by the identification of two disease-causing mutations. Moreover, with the advent of mutation-based therapies, genotyping is an essential tool for CF disease management. There is, however, still an unmet need to genotype CF patients by fast, comprehensive and cost-effective approaches, especially in populations with high genetic heterogeneity (and low p.F508del incidence), where CF is now emerging with new diagnosis dilemmas (Brazil, Asia, etc). Herein, we report an innovative mRNA-based approach to identify CFTR mutations in the complete coding and intronic regions. We applied this protocol to genotype individuals with a suspicion of CF and only one or no CFTR mutations identified by routine methods. It successfully detected multiple intronic mutations unlikely to be detected by CFTR exon sequencing. We conclude that this is a rapid, robust and inexpensive method to detect any CFTR coding/intronic mutation (including rare ones) that can be easily used either as primary approach or after routine DNA analysis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Nationwide genetic analysis for molecularly unresolved cystic fibrosis patients in a multiethnic society: implications for preconception carrier screening.

    PubMed

    Behar, Doron M; Inbar, Ori; Shteinberg, Michal; Gur, Michal; Mussaffi, Huda; Shoseyov, David; Ashkenazi, Moshe; Alkrinawi, Soliman; Bormans, Concetta; Hakim, Fahed; Mei-Zahav, Meir; Cohen-Cymberknoh, Malena; Dagan, Adi; Prais, Dario; Sarouk, Ifat; Stafler, Patrick; Bar Aluma, Bat El; Akler, Gidon; Picard, Elie; Aviram, Micha; Efrati, Ori; Livnat, Galit; Rivlin, Joseph; Bentur, Lea; Blau, Hannah; Kerem, Eitan; Singer, Amihood

    2017-05-01

    Preconception carrier screening for cystic fibrosis (CF) is usually performed using ethnically targeted panels of selected mutations. This has been recently challenged by the use of expanded, ethnically indifferent, pan-population panels. Israel is characterized by genetically heterogeneous populations carrying a wide range of CFTR mutations. To assess the potential of expanding the current Israeli preconception screening program, we sought the subset of molecularly unresolved CF patients listed in the Israeli CF data registry comprising ~650 patients. An Israeli nationwide genotyping of 152 CF cases, representing 176 patients lacking molecular diagnosis, was conducted. Molecular analysis included Sanger sequencing for all exons and splice sites, multiplex ligation probe amplification (MLPA), and next-generation sequencing of the poly-T/TG tracts. We identified 54 different mutations, of which only 16 overlapped the 22 mutations included in the Israeli preconception screening program. A total of 29/54 (53.7%) mutations were already listed as CF causing by the CFTR2 database, and only 4/54 (7.4%) were novel. Molecular diagnosis was reached in 78/152 (51.3%) cases. Prenatal diagnosis of 24/78 (30.8%) cases could have been achieved by including all CFTR2-causing mutations in the Israeli panel. Our data reveal an overwhelming hidden abundance of CFTR gene mutations suggesting that expanded preconception carrier screening might achieve higher preconception detection rates.

  17. Association of a nonsense mutation (W1282X), the most common mutation in the Ashkenazi Jewish cystic fibrosis patients in Israel, with presentation of severe disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shoshani, T.; Bashan, N.; Seret, H.

    1992-01-01

    Only about 30% of the cystic fibrosis chromosomes in the Israeli cystic fibrosis patient populations carry the major CF mutation ({Delta}F508). Since different Jewish ethnic groups tended to live as closed isolates until recent times, high frequencies of specific mutations are expected among the remainder cystic fibrosis chromosomes of these ethnic groups. Genetic factors appear to influence the severity of the disease. It is therefore expected that different mutations will be associated with either severe or mild phenotype. Direct genomic sequencing of exons included in the two nucleotide-binding folds of the putative CFTR protein was performed on 119 Israeli cysticmore » fibrosis patients from 97 families. One sequence alteration which is expected to create a termination at residue 1282 (W1282X) was found in 63 chromosomes. Of 95 chromosomes, 57(60%) are of Ashkenazi origin. In conclusion, the W1282X mutation is the most common cystic fibrosis mutation in the Ashkenazi Jewish patient population in Israel. This nonsense mutation is associated with presentation of severe disease.« less

  18. Cystic fibrosis presenting with neonatal cholestasis simulating biliary atresia in a patient with a novel mutation.

    PubMed

    Eminoglu, Tuba Fatma; Polat, Emine; Gökçe, Selim; Ezgü, Fatih Süheyl; Senel, Saliha; Apaydin, Sema

    2013-06-01

    Neonatal cholestasis is a rare presenting feature of cystic fibrosis which usually cannot be differentiated from other types of cholestasis. Herein, the authors report a 63 d-old boy with cystic fibrosis presenting with neonatal cholestasis mimicking biliary atresia. A new mutation in CFTR gene resulting in severe phenotype has been described. The cystic fibrosis patients with c.3871 G > T mutation may have acholic gaita mimicking biliary atresia in the absence of insipissated bile with minimal histologic findings in the liver.

  19. Zebrafish mutations affecting cilia motility share similar cystic phenotypes and suggest a mechanism of cyst formation that differs from pkd2 morphants

    PubMed Central

    Sullivan-Brown, Jessica; Schottenfeld, Jodi; Okabe, Noriko; Hostetter, Christine L.; Serluca, Fabrizio C.; Thiberge, Stephan Y.; Burdine, Rebecca D.

    2008-01-01

    Zebrafish are an attractive model for studying the earliest cellular defects occurring during renal cyst formation because its kidney (the pronephros) is simple and genes that cause cystic kidney diseases (CKD) in humans, cause pronephric dilations in zebrafish. By comparing phenotypes in three different mutants, locke, swt and kurly, we find that dilations occur prior to 48 hpf in the medial tubules, a location similar to where cysts form in some mammalian diseases. We demonstrate that the first observeable phenotypes associated with dilation include cilia motility and luminal remodeling defects. Importantly, we show that some phenotypes common to human CKD, such as an increased number of cells, are secondary consequences of dilation. Despite having differences in cilia motility, locke, swt and kurly share similar cystic phenotypes, suggesting that they function in a common pathway. To begin to understand the molecular mechanisms involved in cyst formation, we have cloned the swt mutation and find that it encodes a novel leucine rich repeat containing protein (LRRC50), which is thought to function in correct dynein assembly in cilia. Finally, we show that knockdown of polycystic kidney disease 2 (pkd2) specifically causes glomerular cysts and does not affect cilia motility, suggesting multiple mechanisms exist for cyst formation. PMID:18178183

  20. Mutation and new polymorphisms insight in introns 11 to 14a of CFTR gene of northern Iranian cystic fibrosis patients.

    PubMed

    Esmaeili Dooki, Mohammad Reza; Tabaripour, Reza; Rahimi, Razieh; Akhavan-Niaki, Haleh

    2015-06-15

    Cystic fibrosis (CF) is the most common autosomal recessive disease in Caucasians, caused by mutation in cystic fibrosis transmembrane conductance regulator (CFTR). The type and distribution of mutations vary widely between different countries and ethnic groups. We therefore aimed to perform a comprehensive analysis of the CFTR gene in northern Iranian CF patients. Forty northern Iranian CF patients were analyzed for mutations in introns 11 to 14a of their CFTR genes, using sequencing and reverse dot blot methods. Five normal subjects were also analyzed as normal control. One mutation and seven polymorphisms were identified. Of the eighty alleles studied, c.2043delG in exon 13 represented 12.5% of mutant alleles and was associated with two distinct haplotypes. rs1042077T>G, rs4148712delAT, rs4148711T>A and rs3808183 T>C with frequencies varying between 29.2% and 6.9% for the least common allele, as well as three new polymorphisms c.1680-224C>A (11.1%), c.2491-275T>G (14.1%) and c.2491-274C>G (35.9%) were detected. These findings suggest a founder effect for c.2043delG in the Middle East and will assist in genetic counseling, prenatal diagnosis and future screening of CF in Iran. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Year to year change in FEV1 in patients with cystic fibrosis and different mutation classes.

    PubMed

    De Boeck, K; Zolin, A

    2017-03-01

    In patients with cystic fibrosis, most treatments addressing the underlying basic defect are mutation or mutation class specific. These treatments are disease modifying if they lower the year to year change in lung function. We therefore calculated the current loss of lung function, measured by year to year change in forced expired volume in 1s in 11,417 patients included in the European Cystic Fibrosis Society Patient Registry. Whereas patients with at least one mutation of class IV or V have on average a lower year to year change, we did not find a difference between patients with a stop codon mutation, homozygous for F508del or at least one class III mutation. These data are useful background information to discuss the impact of different disease modifying treatments. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  2. Ivacaftor treatment of cystic fibrosis patients with the G551D mutation: a review of the evidence.

    PubMed

    Kotha, Kavitha; Clancy, John P

    2013-10-01

    Cystic fibrosis (CF) is a recessive disorder caused by mutations in the gene that encodes the CF transmembrane conductance regulator (CFTR) protein. CFTR protein is a chloride and bicarbonate channel that is critical for normal epithelial ion transport and hydration of epithelial surfaces. Current CF care is supportive, but recent breakthroughs have occurred with the advent of novel therapeutic strategies that assist the function of mutant CFTR proteins. The development and key clinical trial results of ivacaftor, a small molecule that targets gating defects in disease-causing CFTR mutations including G551D CFTR, are summarized in this review. The G551D mutation is reasonably common in the CF patient population and produces a CFTR protein that localizes normally to the plasma membrane, but fails to open in response to cellular cues. Ivacaftor treatment produces dramatic improvements in lung function, weight, lung disease stability, patient-reported outcomes, and CFTR biomarkers in patients with CF harboring the G551D CFTR mutation compared with placebo controls and patients with two copies of the common F508del CFTR mutation. The unprecedented success of ivacaftor treatment for the G551D CF patient population has generated excitement in the CF care community regarding the expansion of its use to other CF patient populations with primary or secondary gating defects.

  3. Small-scale high-throughput sequencing-based identification of new therapeutic tools in cystic fibrosis.

    PubMed

    Bonini, Jennifer; Varilh, Jessica; Raynal, Caroline; Thèze, Corinne; Beyne, Emmanuelle; Audrezet, Marie-Pierre; Ferec, Claude; Bienvenu, Thierry; Girodon, Emmanuelle; Tuffery-Giraud, Sylvie; Des Georges, Marie; Claustres, Mireille; Taulan-Cadars, Magali

    2015-10-01

    Although 97-99% of CFTR mutations have been identified, great efforts must be made to detect yet-unidentified mutations. We developed a small-scale next-generation sequencing approach for reliably and quickly scanning the entire gene, including noncoding regions, to identify new mutations. We applied this approach to 18 samples from patients suffering from cystic fibrosis (CF) in whom only one mutation had hitherto been identified. Using an in-house bioinformatics pipeline, we could rapidly identify a second disease-causing CFTR mutation for 16 of 18 samples. Of them, c.1680-883A>G was found in three unrelated CF patients. Analysis of minigenes and patients' transcripts showed that this mutation results in aberrantly spliced transcripts because of the inclusion of a pseudoexon. It is located only three base pairs from the c.1680-886A>G mutation (1811+1.6kbA>G), the fourth most frequent mutation in southwestern Europe. We next tested the effect of antisense oligonucleotides targeting splice sites on these two mutations on pseudoexon skipping. Oligonucleotide transfection resulted in the restoration of the full-length, in-frame CFTR transcript, demonstrating the effect of antisense oligonucleotide-induced pseudoexon skipping in CF. Our data confirm the importance of analyzing noncoding regions to find unidentified mutations, which is essential to designing targeted therapeutic approaches.

  4. CFTR dysfunction in cystic fibrosis and chronic obstructive pulmonary disease.

    PubMed

    Fernandez Fernandez, Elena; de Santi, Chiara; De Rose, Virginia; Greene, Catherine M

    2018-05-11

    Obstructive lung diseases such as cystic fibrosis (CF) and chronic obstructive pulmonary disease (COPD) are causes of high morbidity and mortality worldwide. CF is a multiorgan genetic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and is characterized by progressive chronic obstructive lung disease. Most cases of COPD are a result of noxious particles, mainly cigarette smoke but also other environmental pollutants. Areas covered: Although the pathogenesis and pathophysiology of CF and COPD differ, they do share key phenotypic features and because of these similarities there is great interest in exploring common mechanisms and/or factors affected by CFTR mutations and environmental insults involved in COPD. Various molecular, cellular and clinical studies have confirmed that CFTR protein dysfunction is common in both the CF and COPD airways. This review provides an update of our understanding of the role of dysfunctional CFTR in both respiratory diseases. Expert Commentary: Drugs developed for people with CF to improve mutant CFTR function and enhance CFTR ion channel activity might also be beneficial in patients with COPD. A move toward personalized therapy using, for example, microRNA modulators in conjunction with CFTR potentiators or correctors, could enhance treatment of both diseases.

  5. CFTR genotype and clinical outcomes of adult patients carried as cystic fibrosis disease.

    PubMed

    Bonadia, Luciana Cardoso; de Lima Marson, Fernando Augusto; Ribeiro, Jose Dirceu; Paschoal, Ilma Aparecida; Pereira, Monica Corso; Ribeiro, Antonio Fernando; Bertuzzo, Carmen Silvia

    2014-05-01

    There are nearly 2000 cystic fibrosis transmembrane regulator (CFTR) mutations that cause cystic fibrosis (CF). These mutations are classified into six classes; on the one hand, the first three classes cause severe disease involvement in early childhood, on the other hand, the Class IV, V and VI mutations cause minor severe disease in the same age. Nowadays, with therapeutic advances in CF management and competence of pediatricians, physicians of adults have to deal with two groups of CF patients: (i) adults diagnosed in childhood with severe mutations and (ii) adults who initiated symptoms in adulthood and with Class IV, V and VI mutations. The aim of this study was to analyze adults from a clinical center, treated as CF disease, screening the CFTR genotype and evaluating the clinical characteristics. Thirty patients followed as CF disease at the University Hospital were enrolled. After a complete molecular CFTR negative screening and sweat test levels between 40 and 59mEq/L, five patients were characterized as non-CF disease and were excluded. Molecular screening was performed by CFTR gene sequencing/MLPA or by specific mutation screening. Clinical data was obtained from medical records. The patients were divided into three groups: (1) patients with Class I, II and III mutations in two CFTR alleles; (2) genotype with at least one allele of Class IV, V or VI CFTR mutations and, (3) non-identified CFTR mutation+one patient with one allele with CFTR mutation screened (Class I). There was an association of CFTR class mutation and sodium/chloride concentration in the sweat test (sodium: p=0.040; chloride: p=0.016), onset of digestive symptoms (p=0.012), lung function parameter (SpO2 - p=0.016), Bhalla score (p=0.021), age at diagnosis (p=0.008) and CF-related diabetes (p=0.029). There was an association between Pseudomonas aeruginosa chronic colonization (as clinical marker for the lung disease status) and lung impairment (FEV1% - p=0.027; Bhalla score - p=0.021), CF-related diabetes (p=0.040), chloride concentration in the sweat test (p=0.040) and chronic infection by microorganisms (Staphylococcus aureus - p=0.039; mucoid P. aeruginosa - p=0.001). There is no positive association with the status of other clinical markers and the CFTR genotype groups. For clinical association with pancreatic insufficiency (as clinical marker for digestive symptoms), no association was related. The adults with CF diagnosed by sweat test have specific clinical and genotypic characteristics, being a population that should be studied to cause better future management. Some patients treated as CF disease by clinical symptoms, showed no disease, taking into account the sweat test and complete exon sequencing/MLPA screening. Copyright © 2014. Published by Elsevier B.V.

  6. The ABC protein turned chloride channel whose failure causes cystic fibrosis

    NASA Astrophysics Data System (ADS)

    Gadsby, David C.; Vergani, Paola; Csanády, László

    2006-03-01

    CFTR chloride channels are encoded by the gene mutated in patients with cystic fibrosis. These channels belong to the superfamily of ABC transporter ATPases. ATP-driven conformational changes, which in other ABC proteins fuel uphill substrate transport across cellular membranes, in CFTR open and close a gate to allow transmembrane flow of anions down their electrochemical gradient. New structural and biochemical information from prokaryotic ABC proteins and functional information from CFTR channels has led to a unifying mechanism explaining those ATP-driven conformational changes.

  7. Thymosin α1 represents a potential potent single-molecule-based therapy for cystic fibrosis.

    PubMed

    Romani, Luigina; Oikonomou, Vasilis; Moretti, Silvia; Iannitti, Rossana G; D'Adamo, Maria Cristina; Villella, Valeria R; Pariano, Marilena; Sforna, Luigi; Borghi, Monica; Bellet, Marina M; Fallarino, Francesca; Pallotta, Maria Teresa; Servillo, Giuseppe; Ferrari, Eleonora; Puccetti, Paolo; Kroemer, Guido; Pessia, Mauro; Maiuri, Luigi; Goldstein, Allan L; Garaci, Enrico

    2017-05-01

    Cystic fibrosis (CF) is caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) that compromise its chloride channel activity. The most common mutation, p.Phe508del, results in the production of a misfolded CFTR protein, which has residual channel activity but is prematurely degraded. Because of the inherent complexity of the pathogenetic mechanisms involved in CF, which include impaired chloride permeability and persistent lung inflammation, a multidrug approach is required for efficacious CF therapy. To date, no individual drug with pleiotropic beneficial effects is available for CF. Here we report on the ability of thymosin alpha 1 (Tα1)-a naturally occurring polypeptide with an excellent safety profile in the clinic when used as an adjuvant or an immunotherapeutic agent-to rectify the multiple tissue defects in mice with CF as well as in cells from subjects with the p.Phe508del mutation. Tα1 displayed two combined properties that favorably opposed CF symptomatology: it reduced inflammation and increased CFTR maturation, stability and activity. By virtue of this two-pronged action, Tα1 has strong potential to be an efficacious single-molecule-based therapeutic agent for CF.

  8. Thymosin α1 represents a potential potent single molecule-based therapy for cystic fibrosis

    PubMed Central

    Romani, Luigina; Oikonomou, Vasilis; Moretti, Silvia; Iannitti, Rossana G.; D’Adamo, Maria Cristina; Villella, Valeria R.; Pariano, Marilena; Sforna, Luigi; Borghi, Monica; Bellet, Marina M.; Fallarino, Francesca; Pallotta, Maria Teresa; Servillo, Giuseppe; Ferrari, Eleonora; Puccetti, Paolo; Kroemer, Guido; Pessia, Mauro; Maiuri, Luigi; Goldstein, Allan L.; Garaci, Enrico

    2017-01-01

    Cystic fibrosis (CF) is caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) that compromise its chloride-channel activity. The most common mutation, p.Phe508del, results in the production of a misfolded CFTR protein, which has residual channel activity but is prematurely degraded. Because of the inherent complexity of the pathogenetic mechanisms involved in CF —which include impaired chloride permeability and persistent lung inflammation—a multidrug approach is required for efficacious CF therapy. To date, no individual, drug with pleiotropic beneficial effects for CF is available. Here we report on the ability of thymosin alpha 1 (Tα1)—a naturally occurring polypeptide with an excellent safety profile in the clinic when used as an adjuvant or an immunotherapeutic agent—to rectify the multiple tissue defects in CF mice as well as in cells from subjects with the p.Phe508del mutation. Tα1 displayed two combined properties that favorably opposed CF symptomatology; namely, it reduced inflammation and increased CFTR maturation, stability and activity. By virtue of this two-pronged action, Tα1 offers a strong potential to be an efficacious single molecule-based therapeutic agent in CF. PMID:28394330

  9. Cystic fibrosis–adapted Pseudomonas aeruginosa quorum sensing lasR mutants cause hyperinflammatory responses

    PubMed Central

    LaFayette, Shantelle L.; Houle, Daniel; Beaudoin, Trevor; Wojewodka, Gabriella; Radzioch, Danuta; Hoffman, Lucas R.; Burns, Jane L.; Dandekar, Ajai A.; Smalley, Nicole E.; Chandler, Josephine R.; Zlosnik, James E.; Speert, David P.; Bernier, Joanie; Matouk, Elias; Brochiero, Emmanuelle; Rousseau, Simon; Nguyen, Dao

    2015-01-01

    Cystic fibrosis lung disease is characterized by chronic airway infections with the opportunistic pathogen Pseudomonas aeruginosa and severe neutrophilic pulmonary inflammation. P. aeruginosa undergoes extensive genetic adaptation to the cystic fibrosis (CF) lung environment, and adaptive mutations in the quorum sensing regulator gene lasR commonly arise. We sought to define how mutations in lasR alter host-pathogen relationships. We demonstrate that lasR mutants induce exaggerated host inflammatory responses in respiratory epithelial cells, with increased accumulation of proinflammatory cytokines and neutrophil recruitment due to the loss of bacterial protease–dependent cytokine degradation. In subacute pulmonary infections, lasR mutant–infected mice show greater neutrophilic inflammation and immunopathology compared with wild-type infections. Finally, we observed that CF patients infected with lasR mutants have increased plasma interleukin-8 (IL-8), a marker of inflammation. These findings suggest that bacterial adaptive changes may worsen pulmonary inflammation and directly contribute to the pathogenesis and progression of chronic lung disease in CF patients. PMID:26457326

  10. Secondary Hypertension, Erythrocytosis, and Unilateral Renal Cystic Disease in a Submariner: A Case Report.

    PubMed

    Forbes, Angela S; Yeo, Fred E

    Erythrocytosis, or increased red blood cell mass, may be primary as in the case of polycythemia vera (PV), or secondary due to a variety of causes related to erythropoietin (EPO) secretion and hypoxia. Chronic pulmonary disease and certain EPO-secreting tumors should be addressed and excluded early during the course of evaluation for a patient presenting with increased red blood cell mass. Inclusion of the JAK2 V617F gene mutation in the recent World Health Organization criteria for the diagnosis of PV allows for facilitated diagnosis and guides therapy. EPO levels can be helpful in diagnosis and guiding therapy, but in the case of cystic renal diseases, EPO levels are often not elevated, creating diagnostic uncertainty. This report describes a case of symptoms directly attributable to erythrocytosis in the setting of negative JAK2 mutation and normal EPO levels. The subsequent discovery of a large cystic renal kidney and PV were the leading diagnostic considerations. 2016.

  11. CFTR: A new horizon in the pathomechanism and treatment of pancreatitis

    PubMed Central

    Hegyi, Péter; Wilschanski, Michael; Muallem, Shmuel; Lukacs, Gergely; Sahin-Tóth, Miklós; Uc, Aliye; Gray, Michael A.; Rakonczay, Zoltán; Maléth, József

    2017-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an ion channel that conducts chloride and bicarbonate ions across epithelial cell membranes. Mutations in the CFTR gene diminish the ion channel function and lead to impaired epithelial fluid transport in multiple organs such as the lung and the pancreas resulting in cystic fibrosis. Heterozygous carriers of CFTR mutations do not develop cystic fibrosis but exhibit increased risk for pancreatitis and associated pancreatic damage characterized by elevated mucus levels, fibrosis and cyst formation. Importantly, recent studies demonstrated that pancreatitis causing insults, such as alcohol, smoking or bile acids strongly inhibit CFTR function. Furthermore, human studies showed reduced levels of CFTR expression and function in all forms of pancreatitis. These findings indicate that impairment of CFTR is critical in the development of pancreatitis; therefore, correcting CFTR function could be the first specific therapy in pancreatitis. In this review, we summarize recent advances in the field and discuss new possibilities for the treatment of pancreatitis. PMID:26856995

  12. [Cystic fibrosis gene mutations in the West of France: clinical application].

    PubMed

    Verlingue, C; Travert, G; Le Roux, M G; Laroche, D; Audrézet, M P; Mercier, B; Moisan, J P; Férec, C

    1994-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) gene, responsible for the cystic fibrosis phenotype when both alleles are mutated, was cloned and sequenced in 1989. Since then, more than 400 mutations have been reported in the gene, although most of these are rare. We have systematically analysed the entire coding sequence of the CFTR gene in a cohort of patients originating from the West of France (Caen, Brest and Nantes). More than 450 CF children, 914 chromosomes in all, have been exhaustively studied in the three centers. We have been able to characterize more than 90% of the mutations, respectively 93.5%, 99% and 95.8%. Despite the large diversity in the CFTR mutations occurring in CF patients from this area, these results can help to improve genetic counselling, prenatal diagnosis as well as our understanding of the molecular basis of the pathophysiology of cystic fibrosis.

  13. Cystic fibrosis transmembrane conductance regulator regulates epithelial cell response to Aspergillus and resultant pulmonary inflammation.

    PubMed

    Chaudhary, Neelkamal; Datta, Kausik; Askin, Frederic B; Staab, Janet F; Marr, Kieren A

    2012-02-01

    Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) alter epithelial cell (EC) interactions with multiple microbes, such that dysregulated inflammation and injury occur with airway colonization in people with cystic fibrosis (CF). Aspergillus fumigatus frequently colonizes CF airways, but it has been assumed to be an innocent saprophyte; its potential role as a cause of lung disease is controversial. To study the interactions between Aspergillus and EC, and the role of the fungus in evoking inflammatory responses. A. fumigatus expressing green fluorescent protein was developed for in vitro and in vivo models, which used cell lines and mouse tracheal EC. Fungal spores (conidia) are rapidly ingested by ECs derived from bronchial cell lines and murine tracheas, supporting a role for EC in early airway clearance. Bronchial ECs harboring CFTR mutations (ΔF508) or deletion demonstrate impaired uptake and killing of conidia, and ECs with CFTR mutation undergo more conidial-induced apoptosis. Germinated (hyphal) forms of the fungus evoke secretion of inflammatory mediators, with CFTR mutation resulting in increased airway levels of macrophage inflammatory protein 2 and KC, and higher lung monocyte chemotactic protein-1. After A. fumigatus inhalation, CFTR(-/-) mice develop exaggerated lymphocytic inflammation, mucin accumulation, and lung injury. Data demonstrate a critical role for CFTR in mediating EC responses to A. fumigatus. Results suggest that the fungus elicits aberrant pulmonary inflammation in the setting of CFTR mutation, supporting the potential role of antifungals to halt progressive CF lung disease.

  14. Distribution of CFTR mutations in Eastern Hungarians: relevance to genetic testing and to the introduction of newborn screening for cystic fibrosis.

    PubMed

    Ivady, Gergely; Madar, Laszlo; Nagy, Bela; Gonczi, Ferenc; Ajzner, Eva; Dzsudzsak, Erika; Dvořáková, Lenka; Gombos, Eva; Kappelmayer, Janos; Macek, Milan; Balogh, Istvan

    2011-05-01

    The aim of this study was characterization of an updated distribution of CFTR mutations in a representative cohort of 40 CF patients with the classical form of the disease drawn from Eastern Hungary. Due to the homogeneity of the Hungarian population our data are generally applicable to other regions of the country, including the sizeable diaspora. We utilized the recommended "cascade" CFTR mutation screening approach, initially using a commercial assay, followed by examination of the common "Slavic" deletion CFTRdele2,3(21kb). Subsequently, the entire CFTR coding region of the CFTR gene was sequenced in patients with yet unidentified mutations. The Elucigene CF29(Tm) v2 assay detected 81.25% of all CF causing mutations. An addition of the CFTRdele2,3(21kb) increased the mutation detection rate to 86.25%. DNA sequencing enabled us to identify mutations on 79/80 CF alleles. Mutations [CFTRdele2,3(21kb), p.Gln685ThrfsX4 (2184insA) were found at an unusually high frequency, each comprising 5.00% of all CF alleles. We have identified common CF causing mutations in the Hungarian population with the most common mutations (p.Phe508del, p.Asn1303Lys, CFTRdele2,3(21kb), 2184insA, p.Gly542X, and p.Leu101X), comprising over 93.75% of all CF alleles. Obtained data are applicable to the improvement of DNA diagnostics in Hungary and beyond, and are the necessary prerequisite for the introduction of a nationwide "two tier" CF newborn screening program. Copyright © 2011 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  15. Recent Progress in CFTR Interactome Mapping and Its Importance for Cystic Fibrosis.

    PubMed

    Lim, Sang Hyun; Legere, Elizabeth-Ann; Snider, Jamie; Stagljar, Igor

    2017-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a chloride channel found in secretory epithelia with a plethora of known interacting proteins. Mutations in the CFTR gene cause cystic fibrosis (CF), a disease that leads to progressive respiratory illness and other complications of phenotypic variance resulting from perturbations of this protein interaction network. Studying the collection of CFTR interacting proteins and the differences between the interactomes of mutant and wild type CFTR provides insight into the molecular machinery of the disease and highlights possible therapeutic targets. This mini review focuses on functional genomics and proteomics approaches used for systematic, high-throughput identification of CFTR-interacting proteins to provide comprehensive insight into CFTR regulation and function.

  16. A cystic fibrosis patient who is homozygous for the A559T mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McDowell, T.; Shackleton, S.; Dear, S.

    1995-09-01

    We have recently defined a cystic fibrosis (CF) patient who is homozygous for the A559T mutation in exon 11 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. This mutation was detected by direct sequence analysis and confirmed to be carried by both parents (of West Indian origin) of the index case. The A559T mutation has not been detected in any Caucasian CF patients. The presence of this mutation in North American black CF patients and a British CF patient of West Indian origin is clearly of interest in designing CF screening tests that are tailored to specific ethnic groups.more » 1 ref.« less

  17. CFTR Mutations Spectrum and the Efficiency of Molecular Diagnostics in Polish Cystic Fibrosis Patients

    PubMed Central

    Ziętkiewicz, Ewa; Rutkiewicz, Ewa; Pogorzelski, Andrzej; Klimek, Barbara; Voelkel, Katarzyna; Witt, Michał

    2014-01-01

    Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers. PMID:24586523

  18. CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.

    PubMed

    Ziętkiewicz, Ewa; Rutkiewicz, Ewa; Pogorzelski, Andrzej; Klimek, Barbara; Voelkel, Katarzyna; Witt, Michał

    2014-01-01

    Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

  19. Cystic fibrosis.

    PubMed

    Elborn, J Stuart

    2016-11-19

    Cystic fibrosis is a common life-limiting autosomal recessive genetic disorder, with highest prevalence in Europe, North America, and Australia. The disease is caused by mutation of a gene that encodes a chloride-conducting transmembrane channel called the cystic fibrosis transmembrane conductance regulator (CFTR), which regulates anion transport and mucociliary clearance in the airways. Functional failure of CFTR results in mucus retention and chronic infection and subsequently in local airway inflammation that is harmful to the lungs. CFTR dysfunction mainly affects epithelial cells, although there is evidence of a role in immune cells. Cystic fibrosis affects several body systems, and morbidity and mortality is mostly caused by bronchiectasis, small airways obstruction, and progressive respiratory impairment. Important comorbidities caused by epithelial cell dysfunction occur in the pancreas (malabsorption), liver (biliary cirrhosis), sweat glands (heat shock), and vas deferens (infertility). The development and delivery of drugs that improve the clearance of mucus from the lungs and treat the consequent infection, in combination with correction of pancreatic insufficiency and undernutrition by multidisciplinary teams, have resulted in remarkable improvements in quality of life and clinical outcomes in patients with cystic fibrosis, with median life expectancy now older than 40 years. Innovative and transformational therapies that target the basic defect in cystic fibrosis have recently been developed and are effective in improving lung function and reducing pulmonary exacerbations. Further small molecule and gene-based therapies are being developed to restore CFTR function; these therapies promise to be disease modifying and to improve the lives of people with cystic fibrosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. An "ex vivo model" contributing to the diagnosis and evaluation of new drugs in cystic fibrosis.

    PubMed

    Di Lullo, A M; Scorza, M; Amato, F; Comegna, M; Raia, V; Maiuri, L; Ilardi, G; Cantone, E; Castaldo, G; Iengo, M

    2017-06-01

    Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane regulator (CFTR) gene. About 2000 mutations have been described so far. We setup an ex vivo model of human nasal epithelial cells (HNECs) to study CF patients testing the effect of novel mutations and molecular therapies. We performed sampling (by brushing), followed by culture and analysis of HNECs using a series of molecular techniques. We performed 50 brushings from CF patients and controls. Using cultured cells, we: i) demonstrated the widely heterogeneous CFTR expression in patients and in controls; ii) defined the splicing effect of a CFTR mutation; iii) assessed the CFTR gating activity in patients bearing different mutations; iv) demonstrated that butyrate significantly enhances CFTR expression. Based on our data, we can conclude: 1) HNEC brushing is performed without anaesthesia and is well tolerated in all CF patients (children and adults); 2) HNECs can be preserved for up to 48 hours before culture allowings multicentre studies; 3) HNECs culture can be considered a suitable model to study the molecular effects of new CFTR gene mutations and/or uncertain meaning specific mutations of carriers; 4) an ex vivo model of HNECs may be used to evaluate, before human use, the effect of new drugs on patients' cells bearing specific CFTR mutations; 5) the methodology is adequate for a quantitative measurement, by fluorescence, of the CFTR gating activity of the HNECs from patients with different genotypes identifying: a) CF patients bearing two severe mutations with an activity < 10% (compared to controls - 100%); b) CF patients bearing at least a mild mutation with an activity of 10-20%; c) CF carriers (heterozygous subjects) with an activity between 40-70%. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

  1. CRISPR-Cas9 Corrects Mutation in Immune Disorder, Suggesting New Therapeutic Approach | FNLCR Staging

    Cancer.gov

    Gene editing using the powerful new CRISPR-Cas9 system is showing promise as a tool for developing potential treatments for inherited diseases, particularly for those caused by single genetic defects. Examples of these diseases are cystic fibrosis, m

  2. New treatments targeting the basic defects in cystic fibrosis.

    PubMed

    Fajac, Isabelle; Wainwright, Claire E

    2017-06-01

    Cystic fibrosis (CF) is a monogenic autosomal recessive disorder affecting around 75,000 individuals worldwide. It is a multi-system disease but the main morbidity and mortality is caused by chronic lung disease. Due to newborn screening, a multidisciplinary approach to care and intensive symptomatic treatment, the prognosis has dramatically improved over the last decades and there are currently more adults than children in many countries. However, CF is still a very severe disease with a current median age of life expectancy in the fourth decade of life. The disease is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene which encodes the CFTR protein, a protein kinase A-activated ATP-gated anion channel that regulates the transport of electrolytes such as chloride and bicarbonate. More than 2000 mutations have been reported, although not all of these have functional consequences. An enormous research effort and progress has been made in understanding the consequences of these mutations on the CFTR protein structure and function, and this has led to the approval of two new drug therapies that are able to bind to defective CFTR proteins and partially restore their function. They are mutation-specific therapies and available at present for specific mutations only. They are the first personalized medicine for CF with a possible disease-modifying effect. A pipeline of other compounds is under development with different mechanisms of action. It is foreseeable that new combinations of compounds will further improve the correction of CFTR function. Other strategies including premature stop codon read-through drugs, antisense oligonucleotides that correct the basic defect at the mRNA level or gene editing to restore the defective gene as well as gene therapy approaches are all in the pipeline. All these strategies are needed to develop disease-modifying therapies for all patients with CF. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  3. A kidney-disease gene panel allows a comprehensive genetic diagnosis of cystic and glomerular inherited kidney diseases.

    PubMed

    Bullich, Gemma; Domingo-Gallego, Andrea; Vargas, Iván; Ruiz, Patricia; Lorente-Grandoso, Laura; Furlano, Mónica; Fraga, Gloria; Madrid, Álvaro; Ariceta, Gema; Borregán, Mar; Piñero-Fernández, Juan Alberto; Rodríguez-Peña, Lidia; Ballesta-Martínez, Maria Juliana; Llano-Rivas, Isabel; Meñica, Mireia Aguirre; Ballarín, José; Torrents, David; Torra, Roser; Ars, Elisabet

    2018-05-22

    Molecular diagnosis of inherited kidney diseases remains a challenge due to their expanding phenotypic spectra as well as the constantly growing list of disease-causing genes. Here we develop a comprehensive approach for genetic diagnosis of inherited cystic and glomerular nephropathies. Targeted next generation sequencing of 140 genes causative of or associated with cystic or glomerular nephropathies was performed in 421 patients, a validation cohort of 116 patients with previously known mutations, and a diagnostic cohort of 207 patients with suspected inherited cystic disease and 98 patients with glomerular disease. In the validation cohort, a sensitivity of 99% was achieved. In the diagnostic cohort, causative mutations were found in 78% of patients with cystic disease and 62% of patients with glomerular disease, mostly familial cases, including copy number variants. Results depict the distribution of different cystic and glomerular inherited diseases showing the most likely diagnosis according to perinatal, pediatric and adult disease onset. Of all the genetically diagnosed patients, 15% were referred with an unspecified clinical diagnosis and in 2% genetic testing changed the clinical diagnosis. Therefore, in 17% of cases our genetic analysis was crucial to establish the correct diagnosis. Complex inheritance patterns in autosomal dominant polycystic kidney disease and Alport syndrome were suspected in seven and six patients, respectively. Thus, our kidney-disease gene panel is a comprehensive, noninvasive, and cost-effective tool for genetic diagnosis of cystic and glomerular inherited kidney diseases. This allows etiologic diagnosis in three-quarters of patients and is especially valuable in patients with unspecific or atypical phenotypes. Copyright © 2018 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  4. Targeted mutation screening panels expose systematic population bias in detection of cystic fibrosis risk.

    PubMed

    Lim, Regine M; Silver, Ari J; Silver, Maxwell J; Borroto, Carlos; Spurrier, Brett; Petrossian, Tanya C; Larson, Jessica L; Silver, Lee M

    2016-02-01

    Carrier screening for mutations contributing to cystic fibrosis (CF) is typically accomplished with panels composed of variants that are clinically validated primarily in patients of European descent. This approach has created a static genetic and phenotypic profile for CF. An opportunity now exists to reevaluate the disease profile of CFTR at a global population level. CFTR allele and genotype frequencies were obtained from a nonpatient cohort with more than 60,000 unrelated personal genomes collected by the Exome Aggregation Consortium. Likely disease-contributing mutations were identified with the use of public database annotations and computational tools. We identified 131 previously described and likely pathogenic variants and another 210 untested variants with a high probability of causing protein damage. None of the current genetic screening panels or existing CFTR mutation databases covered a majority of deleterious variants in any geographical population outside of Europe. Both clinical annotation and mutation coverage by commercially available targeted screening panels for CF are strongly biased toward detection of reproductive risk in persons of European descent. South and East Asian populations are severely underrepresented, in part because of a definition of disease that preferences the phenotype associated with European-typical CFTR alleles.

  5. Dental treatment for people with cystic fibrosis.

    PubMed

    Harrington, N; Barry, P J; Barry, S M

    2016-06-01

    To describe the nature and consequences of the multi-system genetic condition cystic fibrosis with a view to ensuring optimal dental treatment planning for these patients. A literature search was conducted to identify the key medical and dental manifestations of cystic fibrosis. These findings are discussed and utilised to create recommendations for treatment planning in patients with cystic fibrosis for the practising dental practitioner. Cystic fibrosis is a complex, lethal, multisystem autosomal recessive disorder resulting from mutations on chromosome 7 which result in dysfunction of an ion channel that sits on epithelial surfaces. Respiratory disease remains the leading cause of mortality. Survival has greatly increased in recent decades secondary to improved treatment and specialist care. Specific dental manifestations of the disease may result from the condition itself or complications of treatment. Modification of patient management may be necessary to provide optimum patient care. The pathophysiology and clinical manifestations are relevant to practicing dental practitioners and inform recommendations to be utilised to ensure optimal treatment planning for these patients.

  6. Cystic Fibrosis Transmembrane Conductance Regulator Regulates Epithelial Cell Response to Aspergillus and Resultant Pulmonary Inflammation

    PubMed Central

    Chaudhary, Neelkamal; Datta, Kausik; Askin, Frederic B.; Staab, Janet F.

    2012-01-01

    Rationale: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) alter epithelial cell (EC) interactions with multiple microbes, such that dysregulated inflammation and injury occur with airway colonization in people with cystic fibrosis (CF). Aspergillus fumigatus frequently colonizes CF airways, but it has been assumed to be an innocent saprophyte; its potential role as a cause of lung disease is controversial. Objectives: To study the interactions between Aspergillus and EC, and the role of the fungus in evoking inflammatory responses. Methods: A. fumigatus expressing green fluorescent protein was developed for in vitro and in vivo models, which used cell lines and mouse tracheal EC. Measurements and Main Results: Fungal spores (conidia) are rapidly ingested by ECs derived from bronchial cell lines and murine tracheas, supporting a role for EC in early airway clearance. Bronchial ECs harboring CFTR mutations (ΔF508) or deletion demonstrate impaired uptake and killing of conidia, and ECs with CFTR mutation undergo more conidial-induced apoptosis. Germinated (hyphal) forms of the fungus evoke secretion of inflammatory mediators, with CFTR mutation resulting in increased airway levels of macrophage inflammatory protein 2 and KC, and higher lung monocyte chemotactic protein-1. After A. fumigatus inhalation, CFTR−/− mice develop exaggerated lymphocytic inflammation, mucin accumulation, and lung injury. Conclusions: Data demonstrate a critical role for CFTR in mediating EC responses to A. fumigatus. Results suggest that the fungus elicits aberrant pulmonary inflammation in the setting of CFTR mutation, supporting the potential role of antifungals to halt progressive CF lung disease. PMID:22135344

  7. Determination of CFTR densities in erythrocyte plasma membranes using recognition imaging

    NASA Astrophysics Data System (ADS)

    Ebner, Andreas; Nikova, Dessy; Lange, Tobias; Häberle, Johannes; Falk, Sabine; Dübbers, Angelika; Bruns, Reimer; Hinterdorfer, Peter; Oberleithner, Hans; Schillers, Hermann

    2008-09-01

    CFTR (cystic fibrosis transmembrane conductance regulator) is a cAMP-regulated chloride (Cl-) channel that plays an important role in salt and fluid movement across epithelia. Cystic fibrosis (CF), the most common genetic disease among Caucasians, is caused by mutations in the gene encoding CFTR. The most predominant mutation, F508del, disturbs CFTR protein trafficking, resulting in a reduced number of CFTR in the plasma membrane. Recent studies indicate that CFTR is not only found in epithelia but also in human erythrocytes. Although considerable attempts have been made to quantify CFTR in cells, conclusions on numbers of CFTR molecules localized in the plasma membrane have been drawn indirectly. AFM has the power to provide the needed information, since both sub-molecular spatial resolution and direct protein recognition via antibody-antigen interaction can be observed. We performed a quantification study of the CFTR copies in erythrocyte membranes at the single molecule level, and compared the difference between healthy donors and CF patients. We detected that the number of CFTR molecules is reduced by 70% in erythrocytes of cystic fibrosis patients.

  8. Correctors and Potentiators Rescue Function of the Truncated W1282X-Cystic Fibrosis Transmembrane Regulator (CFTR) Translation Product.

    PubMed

    Haggie, Peter M; Phuan, Puay-Wah; Tan, Joseph-Anthony; Xu, Haijin; Avramescu, Radu G; Perdomo, Doranda; Zlock, Lorna; Nielson, Dennis W; Finkbeiner, Walter E; Lukacs, Gergely L; Verkman, Alan S

    2017-01-20

    W1282X is the fifth most common cystic fibrosis transmembrane regulator (CFTR) mutation that causes cystic fibrosis. Here, we investigated the utility of a small molecule corrector/potentiator strategy, as used for ΔF508-CFTR, to produce functional rescue of the truncated translation product of the W1282X mutation, CFTR 1281 , without the need for read-through. In transfected cell systems, certain potentiators and correctors, including VX-809 and VX-770, increased CFTR 1281 activity. To identify novel correctors and potentiators with potentially greater efficacy on CFTR 1281 , functional screens were done of ∼30,000 synthetic small molecules and drugs/nutraceuticals in CFTR 1281 -transfected cells. Corrector scaffolds of 1-arylpyrazole-4-arylsulfonyl-piperazine and spiro-piperidine-quinazolinone classes were identified with up to ∼5-fold greater efficacy than VX-809, some of which were selective for CFTR 1281 , whereas others also corrected ΔF508-CFTR. Several novel potentiator scaffolds were identified with efficacy comparable with VX-770; remarkably, a phenylsulfonamide-pyrrolopyridine acted synergistically with VX-770 to increase CFTR 1281 function ∼8-fold over that of VX-770 alone, normalizing CFTR 1281 channel activity to that of wild type CFTR. Corrector and potentiator combinations were tested in primary cultures and conditionally reprogrammed cells generated from nasal brushings from one W1282X homozygous subject. Although robust chloride conductance was seen with correctors and potentiators in homozygous ΔF508 cells, increased chloride conductance was not found in W1282X cells despite the presence of adequate transcript levels. Notwithstanding the negative data in W1282X cells from one human subject, we speculate that corrector and potentiator combinations may have therapeutic efficacy in cystic fibrosis caused by the W1282X mutation, although additional studies are needed on human cells from W1282X subjects. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Correctors and Potentiators Rescue Function of the Truncated W1282X-Cystic Fibrosis Transmembrane Regulator (CFTR) Translation Product*♦

    PubMed Central

    Haggie, Peter M.; Phuan, Puay-Wah; Tan, Joseph-Anthony; Xu, Haijin; Avramescu, Radu G.; Perdomo, Doranda; Zlock, Lorna; Nielson, Dennis W.; Finkbeiner, Walter E.; Lukacs, Gergely L.; Verkman, Alan S.

    2017-01-01

    W1282X is the fifth most common cystic fibrosis transmembrane regulator (CFTR) mutation that causes cystic fibrosis. Here, we investigated the utility of a small molecule corrector/potentiator strategy, as used for ΔF508-CFTR, to produce functional rescue of the truncated translation product of the W1282X mutation, CFTR1281, without the need for read-through. In transfected cell systems, certain potentiators and correctors, including VX-809 and VX-770, increased CFTR1281 activity. To identify novel correctors and potentiators with potentially greater efficacy on CFTR1281, functional screens were done of ∼30,000 synthetic small molecules and drugs/nutraceuticals in CFTR1281-transfected cells. Corrector scaffolds of 1-arylpyrazole-4-arylsulfonyl-piperazine and spiro-piperidine-quinazolinone classes were identified with up to ∼5-fold greater efficacy than VX-809, some of which were selective for CFTR1281, whereas others also corrected ΔF508-CFTR. Several novel potentiator scaffolds were identified with efficacy comparable with VX-770; remarkably, a phenylsulfonamide-pyrrolopyridine acted synergistically with VX-770 to increase CFTR1281 function ∼8-fold over that of VX-770 alone, normalizing CFTR1281 channel activity to that of wild type CFTR. Corrector and potentiator combinations were tested in primary cultures and conditionally reprogrammed cells generated from nasal brushings from one W1282X homozygous subject. Although robust chloride conductance was seen with correctors and potentiators in homozygous ΔF508 cells, increased chloride conductance was not found in W1282X cells despite the presence of adequate transcript levels. Notwithstanding the negative data in W1282X cells from one human subject, we speculate that corrector and potentiator combinations may have therapeutic efficacy in cystic fibrosis caused by the W1282X mutation, although additional studies are needed on human cells from W1282X subjects. PMID:27895116

  10. The SAM domain of ANKS6 has different interacting partners and mutations can induce different cystic phenotypes.

    PubMed

    Bakey, Zeineb; Bihoreau, Marie-Thérèse; Piedagnel, Rémi; Delestré, Laure; Arnould, Catherine; de Villiers, Alexandre d'Hotman; Devuyst, Olivier; Hoffmann, Sigrid; Ronco, Pierre; Gauguier, Dominique; Lelongt, Brigitte

    2015-08-01

    The ankyrin repeat and sterile α motif (SAM) domain-containing six gene (Anks6) is a candidate for polycystic kidney disease (PKD). Originally identified in the PKD/Mhm(cy/+) rat model of PKD, the disease is caused by a mutation (R823W) in the SAM domain of the encoded protein. Recent studies support the etiological role of the ANKS6 SAM domain in human cystic diseases, but its function in kidney remains unknown. To investigate the role of ANKS6 in cyst formation, we screened an archive of N-ethyl-N-nitrosourea-treated mice and derived a strain carrying a missense mutation (I747N) within the SAM domain of ANKS6. This mutation is only six amino acids away from the PKD-causing mutation (R823W) in cy/+ rats. Evidence of renal cysts in these mice confirmed the crucial role of the SAM domain of ANKS6 in kidney function. Comparative phenotype analysis in cy/+ rats and our Anks6(I747N) mice further showed that the two models display noticeably different PKD phenotypes and that there is a defective interaction between ANKS6 with ANKS3 in the rat and between ANKS6 and BICC1 (bicaudal C homolog 1) in the mouse. Thus, our data demonstrate the importance of ANKS6 for kidney structure integrity and the essential mediating role of its SAM domain in the formation of protein complexes.

  11. ∆F508 CFTR interactome remodelling promotes rescue of cystic fibrosis.

    PubMed

    Pankow, Sandra; Bamberger, Casimir; Calzolari, Diego; Martínez-Bartolomé, Salvador; Lavallée-Adam, Mathieu; Balch, William E; Yates, John R

    2015-12-24

    Deletion of phenylalanine 508 of the cystic fibrosis transmembrane conductance regulator (∆F508 CFTR) is the major cause of cystic fibrosis, one of the most common inherited childhood diseases. The mutated CFTR anion channel is not fully glycosylated and shows minimal activity in bronchial epithelial cells of patients with cystic fibrosis. Low temperature or inhibition of histone deacetylases can partly rescue ∆F508 CFTR cellular processing defects and function. A favourable change of ∆F508 CFTR protein-protein interactions was proposed as a mechanism of rescue; however, CFTR interactome dynamics during temperature shift and inhibition of histone deacetylases are unknown. Here we report the first comprehensive analysis of the CFTR and ∆F508 CFTR interactome and its dynamics during temperature shift and inhibition of histone deacetylases. By using a novel deep proteomic analysis method, we identify 638 individual high-confidence CFTR interactors and discover a ∆F508 deletion-specific interactome, which is extensively remodelled upon rescue. Detailed analysis of the interactome remodelling identifies key novel interactors, whose loss promote ∆F508 CFTR channel function in primary cystic fibrosis epithelia or which are critical for CFTR biogenesis. Our results demonstrate that global remodelling of ∆F508 CFTR interactions is crucial for rescue, and provide comprehensive insight into the molecular disease mechanisms of cystic fibrosis caused by deletion of F508.

  12. Ethnic heterogeneity and cystic fibrosis transmembrane regulator (CFTR) mutation frequencies in Chicago-area CF families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ober, C.; Lester, L.A.; Mott, C.

    1992-12-01

    The identification of a common mutation, [Delta]F508, in the CFTR gene allowed, for the first time, the detection of cystic fibrosis (CF) carriers in the general population. Further genetic studies revealed >100 additional disease-causing mutations in this gene, few of which occur on >1% of CF chromosomes in any ethnic group. Prior to establishing counseling guidelines and carrier risk assessments, the authors sought to establish the frequencies of the CFTR mutations that are present in CF families living in the Chicago are, a region notable for its ethnic heterogeneity. Their sample included 283 unrelated CF carriers, with the following ethnicmore » composition: 78% non-Ashkenazi Caucasians, 5% Ashkenazi, 9% African-American, 3% Mexican, 0.3% Native American, and 5% mixed ancestry. When a panel of 10 mutations ([Delta]F508, [Delta]I507, G542X, G551D, R553X, S549N, R1162X, W1282X, N1303K, and 1717-1G[r arrow]A) was used, detection rates ranged from 75% in non-Ashkenazi Caucasians to 40% in African-Americans. These data suggest that the goal of screening for 90%-95% of CF mutations may be unrealistic in this and other, similar US populations. 22 refs., 1 tab.« less

  13. Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene mutations in North Egyptian population: implications for the genetic diagnosis in Egypt.

    PubMed

    El-Seedy, A; Pasquet, M C; Shafiek, H; Morsi, T; Kitzis, A; Ladevèze, V

    2016-11-30

    Cystic fibrosis (CF) occurrence in Arab populations is not common and still remains underidentified. Furthermore, the lack of disease awareness and diagnosis facilities have mislead the identification of cystic fibrosis for decades. The knowledge about cystic fibrosis (CF) in Egypt is very limited, and a few reports have drawn attention to the existence of CF or CFTR-related disorders (CFTR-RDs) in the Egyptian population. Therefore a comprehensive genetic analysis of the CFTR gene was realized in patients of North Egypt. DNA samples of 56 Egyptian patients were screened for the CFTR gene mutations. The 27 exons and their flanking regions of the CFTR gene were amplified by PCR, using the published primer pairs, and were studied by automated direct DNA sequencing to detect disease-causing mutations. Moreover, large duplication/deletion was analysed by MLPA technique. CFTR screening revealed the identification of thirteen mutations including four novel ones: c.92G>A (p.Arg31His), c.2782G>C (p.Ala928Pro), c.3718-24G>A, c.4207A>G (p.Arg1403Gly) and nine previously reported mutations: c.454A>T (p.Met152Leu), c.902A>G (p.Tyr301Cys), c.1418delG, c.2620-15C>G, c.2997_3000delAATT, c.3154T>G (p.Phe1052Val), c.3872A>G (p.Gln1291Arg), c.3877G>A (p.Val1293Ile), c.4242+10T>C. Furthermore, eight polymorphisms were found: c.743+40A>G, c.869+11C>T, c.1408A>G, c.1584G>A, c.2562T>G, c.3870A>G, c.4272C>T, c.4389G>A. These mutations and polymorphisms were not previously described in the Egyptian population except for the c.1408A>G polymorphism. Here we demonstrate the importance of the newly discovered mutations in Egyptian patients and the presence of CF, whereas the p.Phe508del mutation is not detected. The identification of CFTR mutations will become increasingly important in undocumented populations. The current findings will help us expand the mutational spectrum of CF and establish the first panel of the CFTR gene mutations in the Egyptian population and design an appropriate strategy for future genetic diagnosis of CF.

  14. CFTR gene mutations in isolated chronic obstructive pulmonary disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pignatti, P.F.; Bombien, C.; Marigo, C.

    1994-09-01

    In order to identify a possible hereditary predisposition to the development of chronic obstructive pulmonary disease (COPD), we have looked for the presence of cystic fibrosis transmembrane regulator (CFTR) gene DNA sequence modifications in 28 unrelated patients with no signs of cystic fibrosis. The known mutations in Italian CF patients, as well as the most frequent worldwide CF mutations, were investigated. In addition, a denaturing gradient gel electrophoresis analysis of about half of the coding sequence of the gene in 56 chromosomes from the patients and in 102 chromosomes from control individuals affected by other pulmonary diseases and from normalmore » controls was performed. Nine different CFTR gene mutations and polymorphisms were found in seven patients, a highly significant increase over controls. Two of the patients were compound heterozygotes. Two frequent CF mutations were detected: deletion F508 and R117H; two rare CF mutations: R1066C and 3667ins4; and five CF sequence variants: R75Q (which was also described as a disease-causing mutation in male sterility cases due to the absence of the vasa deferentia), G576A, 2736 A{r_arrow}G, L997F, and 3271+18C{r_arrow}T. Seven (78%) of the mutations are localized in transmembrane domains. Six (86%) of the patients with defined mutations and polymorphisms had bronchiectasis. These results indicate that CFTR gene mutations and sequence alterations may be involved in the etiopathogenesis of some cases of COPD.« less

  15. Pediatric Cystic Nephroma Is Morphologically, Immunohistochemically, and Genetically Distinct From Adult Cystic Nephroma.

    PubMed

    Li, Yunjie; Pawel, Bruce R; Hill, Dana A; Epstein, Jonathan I; Argani, Pedram

    2017-04-01

    The term cystic nephroma has traditionally been used to refer to 2 neoplasms, a lesion in adults that is now thought to be part of the spectrum of mixed epithelial stromal tumor (MEST) and a pediatric lesion that has been associated with mutations in the DICER1 gene. A direct detailed morphologic, immunohistochemical, and genetic comparison of these 2 lesions has not been performed. In this study, we compare the morphologic features, immunoreactivity for estrogen receptor and inhibin, and DICER1 genetic status of 12 adult cystic nephroma/MEST (median age 50.5 y, all females) and 7 pediatric cystic nephroma (median age 1.3 y, male:female=6:1). Both lesions (11 of 12 adult cases, 6 of 7 pediatric cases) frequently demonstrated subepithelial accentuation of stromal cellularity, though the increased cellularity frequently included inflammatory cells in the pediatric cases. All adult and pediatric cases labeled for estrogen receptor; however, whereas most (83%) of adult cases labeled for inhibin at least focally, no pediatric case labeled for inhibin. Most adult cases (58%) demonstrated wavy, ropy collagen in association with cellular stroma, whereas this was not found in pediatric cases. 86% of pediatric cases demonstrated DICER1 mutations, whereas only 1 of 10 adult cases demonstrated a DICER1 mutation. In summary, although cellular stroma and estrogen receptor immunoreactivity are commonly present in both adult and pediatric cystic nephroma, ropy collagen and inhibin immunoreactivity are far more common in adult cystic nephroma/MEST, whereas DICER1 mutations are far more prevalent in pediatric cystic nephroma. These results support the current World Health Organization Classification's separation of adult and pediatric cystic nephromas as distinct entities.

  16. Transcriptional Activation of Mucin by Pseudomonas aeruginosa Lipopolysaccharide in the Pathogenesis of Cystic Fibrosis Lung Disease

    NASA Astrophysics Data System (ADS)

    Li, Jian-Dong; Dohrman, Austin F.; Gallup, Marianne; Miyata, Susumu; Gum, James R.; Kim, Young S.; Nadel, Jay A.; Prince, Alice; Basbaum, Carol B.

    1997-02-01

    An unresolved question in cystic fibrosis (CF) research is how mutations of the CF transmembrane conductance regulator, a CI ion channel, cause airway mucus obstruction leading to fatal lung disease. Recent evidence has linked the CF transmembrane conductance regulator mutation to the onset and persistence of Pseudomonas aeruginosa infection in the airways, and here we provide evidence directly linking P. aeruginosa infection to mucus overproduction. We show that P. aeruginosa lipopolysaccharide profoundly upregulates transcription of the mucin gene MUC 2 in epithelial cells via inducible enhancer elements and that this effect is blocked by the tyrosine kinase inhibitors genistein and tyrphostin AG 126. These findings improve our understanding of CF pathogenesis and suggest that the attenuation of mucin production by lipopolysaccharide antagonists and tyrosine kinase inhibitors could reduce morbidity and mortality in this disease.

  17. CRISPR-Cas9 Corrects Mutation in Immune Disorder, Suggesting New Therapeutic Approach | Frederick National Laboratory for Cancer Research

    Cancer.gov

    Gene editing using the powerful new CRISPR-Cas9 system is showing promise as a tool for developing potential treatments for inherited diseases, particularly for those caused by single genetic defects. Examples of these diseases are cystic fibrosis, m

  18. Integrin Alpha 8 Recessive Mutations Are Responsible for Bilateral Renal Agenesis in Humans

    PubMed Central

    Humbert, Camille; Silbermann, Flora; Morar, Bharti; Parisot, Mélanie; Zarhrate, Mohammed; Masson, Cécile; Tores, Frédéric; Blanchet, Patricia; Perez, Marie-José; Petrov, Yuliya; Khau Van Kien, Philippe; Roume, Joelle; Leroy, Brigitte; Gribouval, Olivier; Kalaydjieva, Luba; Heidet, Laurence; Salomon, Rémi; Antignac, Corinne; Benmerah, Alexandre; Saunier, Sophie; Jeanpierre, Cécile

    2014-01-01

    Renal hypodysplasia (RHD) is a heterogeneous condition encompassing a spectrum of kidney development defects including renal agenesis, hypoplasia, and (cystic) dysplasia. Heterozygous mutations of several genes have been identified as genetic causes of RHD with various severity. However, these genes and mutations are not associated with bilateral renal agenesis, except for RET mutations, which could be involved in a few cases. The pathophysiological mechanisms leading to total absence of kidney development thus remain largely elusive. By using a whole-exome sequencing approach in families with several fetuses with bilateral renal agenesis, we identified recessive mutations in the integrin α8-encoding gene ITGA8 in two families. Itga8 homozygous knockout in mice is known to result in absence of kidney development. We provide evidence of a damaging effect of the human ITGA8 mutations. These results demonstrate that mutations of ITGA8 are a genetic cause of bilateral renal agenesis and that, at least in some cases, bilateral renal agenesis is an autosomal-recessive disease. PMID:24439109

  19. Implementation of newborn screening for cystic fibrosis in Norway. Results from the first three years.

    PubMed

    Lundman, Emma; Gaup, H Junita; Bakkeheim, Egil; Olafsdottir, Edda J; Rootwelt, Terje; Storrøsten, Olav Trond; Pettersen, Rolf D

    2016-05-01

    Norway introduced newborn screening for cystic fibrosis (CF) March 1, 2012. We present results from the first three years of the national newborn CF screening program. Positive primary screening of immunoreactive trypsinogen (IRT) was followed by DNA testing of the Cystic fibrosis transmembrane conductance regulator (CFTR) gene. Infants with two CFTR mutations were reported for diagnostic follow-up. Of 181,859 infants tested, 1454 samples (0.80%) were assessed for CFTR mutations. Forty children (1:4546) had two CFTR mutations, of which only 21 (1:8660) were confirmed to have a CF diagnosis. The CFTR mutations differed from previously clinically diagnosed CF patients, and p.R117H outnumbered p.F508del as the most frequent mutation. One child with a negative IRT screening test was later clinically diagnosed with CF. The CF screening program identified fewer children with a conclusive CF diagnosis than expected. Our data suggest a revision of the IRT/DNA protocol. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  20. Genotype-phenotype correlation and functional studies in patients with cystic fibrosis bearing CFTR complex alleles.

    PubMed

    Terlizzi, Vito; Castaldo, Giuseppe; Salvatore, Donatello; Lucarelli, Marco; Raia, Valeria; Angioni, Adriano; Carnovale, Vincenzo; Cirilli, Natalia; Casciaro, Rosaria; Colombo, Carla; Di Lullo, Antonella Miriam; Elce, Ausilia; Iacotucci, Paola; Comegna, Marika; Scorza, Manuela; Lucidi, Vincenzina; Perfetti, Anna; Cimino, Roberta; Quattrucci, Serena; Seia, Manuela; Sofia, Valentina Maria; Zarrilli, Federica; Amato, Felice

    2017-04-01

    The effect of complex alleles in cystic fibrosis (CF) is poorly defined for the lack of functional studies. To describe the genotype-phenotype correlation and the results of either in vitro and ex vivo studies performed on nasal epithelial cells (NEC) in a cohort of patients with CF carrying cystic fibrosis transmembrane conductance regulator ( CFTR ) complex alleles. We studied 70 homozygous, compound heterozygous or heterozygous for CFTR mutations: p.[Arg74Trp;Val201Met;Asp1270Asn], n=8; p.[Ile148Thr;Ile1023_Val1024del], n=5; p.[Arg117Leu;Leu997Phe], n=6; c.[1210-34TG[12];1210-12T[5];2930C>T], n=3; p.[Arg74Trp;Asp1270Asn], n=4; p.Asp1270Asn, n=2; p.Ile148Thr, n=6; p.Leu997Phe, n=36. In 39 patients, we analysed the CFTR gating activity on NEC in comparison with patients with CF (n=8) and carriers (n=4). Finally, we analysed in vitro the p.[Arg74Trp;Val201Met;Asp1270Asn] complex allele. The p.[Ile148Thr;Ile1023_Val1024del] caused severe CF in five compound heterozygous with a class I-II mutation. Their CFTR activity on NEC was comparable with patients with two class I-II mutations (mean 7.3% vs 6.9%). The p.[Arg74Trp;Asp1270Asn] and the p.Asp1270Asn have scarce functional effects, while p.[Arg74Trp;Val201Met;Asp1270Asn] caused mild CF in four of five subjects carrying a class I-II mutation in trans , or CFTR-related disorders (CFTR-RD) in three having in trans a class IV-V mutation. The p.[Arg74Trp;Val201Met;Asp1270Asn] causes significantly (p<0.001) higher CFTR activity compared with compound heterozygous for class I-II mutations. Furthermore, five of six compounds heterozygous with the p.[Arg117Leu;Leu997Phe] had mild CF, whereas the p.Leu997Phe, in trans with a class I-II CFTR mutation, caused CFTR-RD or a healthy status (CFTR activity: 21.3-36.9%). Finally, compounds heterozygous for the c.[1210-34TG[12];1210-12T[5];2930C>T] and a class I-II mutation had mild CF or CFTR-RD (gating activity: 18.5-19.0%). The effect of complex alleles partially depends on the mutation in trans . Although larger studies are necessary, the CFTR activity on NEC is a rapid contributory tool to classify patients with CFTR dysfunction. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  1. Stem cell-derived organoids to model gastrointestinal facets of cystic fibrosis

    PubMed Central

    Hohwieler, Meike; Perkhofer, Lukas; Liebau, Stefan; Seufferlein, Thomas; Müller, Martin

    2016-01-01

    Cystic fibrosis (CF) is one of the most frequently occurring inherited human diseases caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) which lead to ample defects in anion transport and epithelial fluid secretion. Existing models lack both access to early stages of CF development and a coeval focus on the gastrointestinal CF phenotypes, which become increasingly important due increased life span of the affected individuals. Here, we provide a comprehensive overview of gastrointestinal facets of CF and the opportunity to model these in various systems in an attempt to understand and treat CF. A particular focus is given on forward-leading organoid cultures, which may circumvent current limitations of existing models and thereby provide a platform for drug testing and understanding of disease pathophysiology in gastrointestinal organs. PMID:28815024

  2. COLD-PCR and microarray: two independent highly sensitive approaches allowing the identification of fetal paternally inherited mutations in maternal plasma.

    PubMed

    Galbiati, Silvia; Monguzzi, Alessandra; Damin, Francesco; Soriani, Nadia; Passiu, Marianna; Castellani, Carlo; Natacci, Federica; Curcio, Cristina; Seia, Manuela; Lalatta, Faustina; Chiari, Marcella; Ferrari, Maurizio; Cremonesi, Laura

    2016-07-01

    Until now, non-invasive prenatal diagnosis of genetic diseases found only limited routine applications. In autosomal recessive diseases, it can be used to determine the carrier status of the fetus through the detection of a paternally inherited disease allele in cases where maternal and paternal mutated alleles differ. Conditions for non-invasive identification of fetal paternally inherited mutations in maternal plasma were developed by two independent approaches: coamplification at lower denaturation temperature-PCR (COLD-PCR) and highly sensitive microarrays. Assays were designed for identifying 14 mutations, 7 causing β-thalassaemia and 7 cystic fibrosis. In total, 87 non-invasive prenatal diagnoses were performed by COLD-PCR in 75 couples at risk for β-thalassaemia and 12 for cystic fibrosis. First, to identify the more appropriate methodology for the analysis of minority mutated fetal alleles in maternal plasma, both fast and full COLD-PCR protocols were developed for the most common Italian β-thalassaemia Cd39 and IVSI.110 mutations. In 5 out of 31 samples, no enrichment was obtained with the fast protocol, while full COLD-PCR provided the correct fetal genotypes. Thus, full COLD-PCR protocols were developed for all the remaining mutations and all analyses confirmed the fetal genotypes obtained by invasive prenatal diagnosis. Microarray analysis was performed on 40 samples from 28 couples at risk for β-thalassaemia and 12 for cystic fibrosis. Results were in complete concordance with those obtained by both COLD-PCR and invasive procedures. COLD-PCR and microarray approaches are not expensive, simple to handle, fast and can be easily set up in specialised clinical laboratories where prenatal diagnosis is routinely performed. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  3. Normal sweat chloride test does not rule out cystic fibrosis.

    PubMed

    Başaran, Abdurrahman Erdem; Karataş-Torun, Nimet; Maslak, İbrahim Cemal; Bingöl, Ayşen; Alper, Özgül M

    2017-01-01

    Başaran AE, Karataş-Torun N, Maslak İC, Bingöl A, Alper ÖM. Normal sweat chloride test does not rule out cystic fibrosis. Turk J Pediatr 2017; 59: 68-70. A 5-month-old patient presented with complaints of fever and cough. He was hospitalized with the diagnosis of bronchopneumonia and pseudo-Bartter's syndrome. Patient was further investigated for diagnosis of cystic fibrosis. The chloride (Cl) level in sweat was determined within the normal range (25.1 mmol/L, 20.3 mmol/L). CFTR (Cystic Fibrosis Transmembrane Regulator gene; NM_000492.2) genotyping results were positive for p.E92K; p.F1052V mutations. The patient was diagnosed with cystic fibrosis. In our patient, with features of CF and normal sweat test, mutation analysis was helpful for the diagnosis of cystic fibrosis.

  4. RACK1 interacts with filamin-A to regulate plasma membrane levels of the cystic fibrosis transmembrane conductance regulator

    PubMed Central

    Smith, Laura; Litman, Paul; Kohli, Ekta; Amick, Joseph; Page, Richard C.; Misra, Saurav

    2013-01-01

    Mutations in cystic fibrosis transmembrane regulator (CFTR), a chloride channel in the apical membranes of secretory epithelial cells, underlie the fatal genetic disorder cystic fibrosis. Certain CFTR mutations, including the common mutation ΔF508-CFTR, result in greatly decreased levels of active CFTR at the apical membrane. Direct interactions between CFTR and the cytoskeletal adaptors filamin-A (FlnA) and Na+/H+ exchanger regulatory factor 1 (NHERF1) stabilize the expression and localization of CFTR at the plasma membrane. The scaffold protein receptor for activated C kinase 1 (RACK1) also stabilizes CFTR surface expression; however, RACK1 does not interact directly with CFTR and its mechanism of action is unknown. In the present study, we report that RACK1 interacts directly with FlnA in vitro and in a Calu-3 airway epithelial cell line. We mapped the interaction between RACK1 and FlnA to the WD4 and WD6 repeats of RACK1 and to a segment of the large rod domain of FlnA, consisting of immunoglobulin-like repeats 8–15. Disruption of the RACK1-FlnA interaction causes a reduction in CFTR surface levels. Our results suggest that a novel RACK1-FlnA interaction is an important regulator of CFTR surface localization. PMID:23636454

  5. Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Potentiator VX-770 (Ivacaftor) Opens the Defective Channel Gate of Mutant CFTR in a Phosphorylation-dependent but ATP-independent Manner* ♦

    PubMed Central

    Eckford, Paul D. W.; Li, Canhui; Ramjeesingh, Mohabir; Bear, Christine E.

    2012-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) acts as a channel on the apical membrane of epithelia. Disease-causing mutations in the cystic fibrosis gene can lead to CFTR protein misfolding as in the case of the F508del mutation and/or channel dysfunction. Recently, a small molecule, VX-770 (ivacaftor), has shown efficacy in restoring lung function in patients bearing the G551D mutation, and this has been linked to repair of its channel gating defect. However, these studies did not reveal the mechanism of action of VX-770 in detail. Normally, CFTR channel activity is regulated by phosphorylation, ATP binding, and hydrolysis. Hence, it has been hypothesized that VX-770 modifies one or more of these metabolic events. In this study, we examined VX-770 activity using a reconstitution system for purified CFTR protein, a system that enables control of known regulatory factors. We studied the consequences of VX-770 interaction with CFTR incorporated in planar lipid bilayers and in proteoliposomes, using a novel flux-based assay. We found that purified and phosphorylated CFTR was potentiated in the presence of Mg-ATP, suggesting that VX-770 bound directly to the CFTR protein, rather than associated kinases or phosphatases. Interestingly, we also found that VX-770 enhanced the channel activity of purified and mutant CFTR in the nominal absence of Mg-ATP. These findings suggest that VX-770 can cause CFTR channel opening through a nonconventional ATP-independent mechanism. This work sets the stage for future studies of the structural properties that mediate CFTR gating using VX-770 as a probe. PMID:22942289

  6. Cystic fibrosis transmembrane conductance regulator (CFTR) potentiator VX-770 (ivacaftor) opens the defective channel gate of mutant CFTR in a phosphorylation-dependent but ATP-independent manner.

    PubMed

    Eckford, Paul D W; Li, Canhui; Ramjeesingh, Mohabir; Bear, Christine E

    2012-10-26

    The cystic fibrosis transmembrane conductance regulator (CFTR) acts as a channel on the apical membrane of epithelia. Disease-causing mutations in the cystic fibrosis gene can lead to CFTR protein misfolding as in the case of the F508del mutation and/or channel dysfunction. Recently, a small molecule, VX-770 (ivacaftor), has shown efficacy in restoring lung function in patients bearing the G551D mutation, and this has been linked to repair of its channel gating defect. However, these studies did not reveal the mechanism of action of VX-770 in detail. Normally, CFTR channel activity is regulated by phosphorylation, ATP binding, and hydrolysis. Hence, it has been hypothesized that VX-770 modifies one or more of these metabolic events. In this study, we examined VX-770 activity using a reconstitution system for purified CFTR protein, a system that enables control of known regulatory factors. We studied the consequences of VX-770 interaction with CFTR incorporated in planar lipid bilayers and in proteoliposomes, using a novel flux-based assay. We found that purified and phosphorylated CFTR was potentiated in the presence of Mg-ATP, suggesting that VX-770 bound directly to the CFTR protein, rather than associated kinases or phosphatases. Interestingly, we also found that VX-770 enhanced the channel activity of purified and mutant CFTR in the nominal absence of Mg-ATP. These findings suggest that VX-770 can cause CFTR channel opening through a nonconventional ATP-independent mechanism. This work sets the stage for future studies of the structural properties that mediate CFTR gating using VX-770 as a probe.

  7. [Dehydration and metabolic alkalosis: an unusual presentation of cystic fibrosis in an infant].

    PubMed

    Aranzamendi, Roberto J; Breitman, Fanny; Asciutto, Carolina; Delgado, Norma; Castaños, Claudio

    2008-10-01

    Cystic fibrosis (CF) may present during neonatal period with classic clinic symptoms related to the disease. The severity of the disease is multifactorial, one of the factors depends on the level of activity of the CFTR protein, which is related with the mutation type that affects the patient. An infant is presented who developed recurrent episodes of vomiting, anorexia, weight loss, dehydration and electrolyte abnormalities, such as metabolic alkalosis, hyponatremia, hypokalemia and hypochloremia. CF was diagnosed after the third episode showing an unusual and not very publicized presentation of the disease. Mutations !F 508 and 2789+5G-A were found. CF should be considered in patients of any age, but particularly in infants, presenting with anorexia, vomiting, failure to thrive, that are associated with recurrent episodes of hyponatremic hypochloremic, dehydration with metabolic alkalosis unexplained by other causes, even in the absence of respiratory or gastrointestinal symptoms or failure to thrive.

  8. Early severe anemia as the first sign of cystic fibrosis.

    PubMed

    Sismanlar, Tugba; Aslan, Ayşe Tana; Köse, Mehmet; Pekcan, Sevgi; Ezgü, Fatih Süheyl; Budakoğlu, Işıl İrem; Yenicesu, İdil

    2016-09-01

    Severe anemia is reported to occur rarely in patients with cystic fibrosis (CF). This study aimed to determine the factors associated with early severe anemia in infants with CF. This study included 231 infants with CF from 3 pediatric CF centers ten year period that were retrospectively reviewed in terms of severe anemia as the first sign of CF. Factors that could affect anemia, such as age, pancreatic insufficiency, mutations, vitamin A and E, and albumin level were evaluated. Clinical and laboratory findings in CF patients that presented with severe anemia and no respiratory symptoms were compared to those in CF patients that did not present with severe anemia. Severe anemia as the first sign of CF was noted in 17 of 231 patients. Patient age, prolonged PT/INR and the albumin level differed significantly between the 2 groups of patients (P < 0.001). Feeding pattern, pancreatic insufficiency, vitamin E and A levels, and the types of genetic mutations did not differ between the 2 groups. The mean hemoglobin level was 5.59 ± 0.21 g/dL and respiratory symptoms began a mean 6.3 months after diagnosis of CF in the anemia group. In early infancy severe anemia in the absence of respiratory symptoms can be the first sign of CF. CF should be considered in the differential diagnosis of severe anemia in infants. Anemia can occur several months before respiratory symptoms in patients with CF and may be caused due to several reasons. • Severe anemia as a first sign is reported to occur rarely in patients with cystic fibrosis. • Although anemia is well known in cystic fibrosis, factors that cause severe anemia are not known clearly. What is New: • This study shows the importance of severe anemia as the first sign of cystic fibrosis. • Anemia can occur several months before respiratory symptoms in patients with CF.

  9. Mutations of Cystic Fibrosis Transmembrane Conductance Regulator Gene Cause a Monocyte-Selective Adhesion Deficiency.

    PubMed

    Sorio, Claudio; Montresor, Alessio; Bolomini-Vittori, Matteo; Caldrer, Sara; Rossi, Barbara; Dusi, Silvia; Angiari, Stefano; Johansson, Jan E; Vezzalini, Marzia; Leal, Teresinha; Calcaterra, Elisa; Assael, Baroukh M; Melotti, Paola; Laudanna, Carlo

    2016-05-15

    Cystic fibrosis (CF) is a common genetic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Persistent lung inflammation, characterized by increasing polymorphonuclear leukocyte recruitment, is a major cause of the decline in respiratory function in patients with CF and is a leading cause of morbidity and mortality. CFTR is expressed in various cell types, including leukocytes, but its involvement in the regulation of leukocyte recruitment is unknown. We evaluated whether CF leukocytes might present with alterations in cell adhesion and migration, a key process governing innate and acquired immune responses. We used ex vivo adhesion and chemotaxis assays, flow cytometry, immunofluorescence, and GTPase activity assays in this study. We found that chemoattractant-induced activation of β1 and β2 integrins and of chemotaxis is defective in mononuclear cells isolated from patients with CF. In contrast, polymorphonuclear leukocyte adhesion and chemotaxis were normal. The functionality of β1 and β2 integrins was restored by treatment of CF monocytes with the CFTR-correcting drugs VRT325 and VX809. Moreover, treatment of healthy monocytes with the CFTR inhibitor CFTR(inh)-172 blocked integrin activation by chemoattractants. In a murine model of lung inflammation, we found that integrin-independent migration of CF monocytes into the lung parenchyma was normal, whereas, in contrast, integrin-dependent transmigration into the alveolar space was impaired. Finally, signal transduction analysis showed that, in CF monocytes, chemoattractant-triggered activation of RhoA and CDC42 Rho small GTPases (controlling integrin activation and chemotaxis, respectively) was strongly deficient. Altogether, these data highlight the critical regulatory role of CFTR in integrin activation by chemoattractants in monocytes and identify CF as a new, cell type-selective leukocyte adhesion deficiency disease, providing new insights into CF pathogenesis.

  10. Detection of 98. 5% of the mutations in 200 Belgian cystic fibrosis alleles by reverse dot-blot and sequencing of the complete coding region and exon/intron junctions of the CFTR gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuppens, H.; Marynen, P.; Cassiman, J.J.

    1993-12-01

    The authors have previously shown that about 85% of the mutations in 194 Belgian cystic fibrosis alleles could be detected by a reverse dot-blot assay. In the present study, 50 Belgian chromosomes were analyzed for mutations in the cystic fibrosis transmembrane conductance regulator gene by means of direct solid phase automatic sequencing of PCR products of individual exons. Twenty-six disease mutations and 14 polymorphisms were found. Twelve of these mutations and 3 polymorphisms were not described before. With the exception of one mutant allele carrying two mutations, these mutations were the only mutations found in the complete coding region andmore » their exon/intron boundaries. The total sensitivity of mutant CF alleles that could be identified was 98.5%. Given the heterogeneity of these mutations, most of them very rare, CFTR mutation screening still remains rather complex in the population, and population screening, whether desirable or not, does not appear to be technically feasible with the methods currently available. 24 refs., 1 fig., 2 tabs.« less

  11. Mechanistic Approaches to Improve Correction of the Most Common Disease-Causing Mutation in Cystic Fibrosis

    PubMed Central

    Bali, Vedrana; Lazrak, Ahmed; Guroji, Purushotham; Matalon, Sadis; Bebok, Zsuzsanna

    2016-01-01

    The most common mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene leads to deletion of the phenylalanine at position 508 (ΔF508) in the CFTR protein and causes multiple folding and functional defects. Contrary to large-scale efforts by industry and academia, no significant therapeutic benefit has been achieved with a single “corrector”. Therefore, investigations concentrate on drug combinations. Orkambi (Vertex Pharmaceuticals), the first FDA-approved drug for treatment of cystic fibrosis (CF) caused by this mutation, is a combination of a corrector (VX-809) that facilitates ΔF508 CFTR biogenesis and a potentiator (VX-770), which improves its function. Yet, clinical trials utilizing this combination showed only modest therapeutic benefit. The low efficacy Orkambi has been attributed to VX-770-mediated destabilization of VX-809-rescued ΔF508 CFTR. Here we report that the negative effects of VX-770 can be reversed by increasing the half-life of the endoplasmic reticulum (ER) form (band B) of ΔF508 CFTR with another corrector (Corr-4a.) Although Corr-4a alone has only minimal effects on ΔF508 CFTR rescue, it increases the half-life of ΔF508 CFTR band B when it is present during half-life measurements. Our data shows that stabilization of band B ΔF508 CFTR with Corr-4a and simultaneous rescue with VX-809, leads to a >2-fold increase in cAMP-activated, CFTRinh-172-inhibited currents compared to VX-809 alone, or VX-809+VX-770. The negative effects of VX-770 and the Corr-4a protection are specific to the native I507-ATT ΔF508 CFTR without affecting the inherently more stable, synonymous variant I507-ATC ΔF508 CFTR. Our studies emphasize that stabilization of ΔF508 CFTR band B in the ER might improve its functional rescue by Orkambi. PMID:27214033

  12. Enlarging cystic lymphangioma of the mediastinum in an adult: is this a neoplastic lesion related to the recently discovered PIK3CA mutation?

    PubMed

    Tajima, Shogo; Takanashi, Yusuke; Koda, Kenji

    2015-01-01

    Cystic lymphangioma, a lymphatic system malformation, is usually observed in infants and children and is rarely found in adults. It most commonly occurs in the cervicofacial region, followed by the axilla. Mediastinal cystic lymphangioma is rare, accounting for 1.8% of all mediastinal cysts. Herein, we present an exceedingly rare adult case of mediastinal cystic lymphangioma that had increased in size over a 5-year period. Although fluid collection might be an alternative explanation for this increase in size, this lymphangioma might harbor a neoplastic nature related to the recently discovered PIK3CA mutation.

  13. Rare association between cystic fibrosis, Chiari I malformation, and hydrocephalus in a baby: a case report and review of the literature

    PubMed Central

    2011-01-01

    Introduction Cystic fibrosis, an epithelial cell transport disorder caused by mutations of the cystic fibrosis transmembrane conductance regulator gene, is not generally associated with malformations of the central nervous system. We review eight previously published reports detailing an infrequent association between cystic fibrosis and Chiari I malformation. Case presentation To the best of our knowledge, our report describes only the ninth case of a baby presenting with a new diagnosis of cystic fibrosis and Chiari I malformation, in this case in a 10-month-old, full-term Caucasian baby boy from the United States of America. Neurosurgical consultation was obtained for associated developmental delay, macrocephaly, bulging anterior fontanel, and papilledema. An MRI scan demonstrated an extensive Chiari I malformation with effacement of the fourth ventricle, obliteration of the outlets of the fourth ventricle and triventricular hydrocephalus without aqueductal stenosis. Our patient was taken to the operating room for ventriculoperitoneal shunt placement. Conclusions It is possible that the cystic fibrosis transmembrane conductance regulator gene may play a previously unrecognized role in central nervous system development; alternatively, this central nervous system abnormality may have been acquired due to constant valsalva from recurrent coughing or wheezing or metabolic and electrolyte imbalances that occur characteristically in cystic fibrosis. PMID:21838874

  14. Manipulating proteostasis to repair the F508del-CFTR defect in cystic fibrosis.

    PubMed

    Esposito, Speranza; Tosco, Antonella; Villella, Valeria R; Raia, Valeria; Kroemer, Guido; Maiuri, Luigi

    2016-12-01

    Cystic fibrosis (CF) is a lethal monogenic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene that entails the (diagnostic) increase in sweat electrolyte concentrations, progressive lung disease with chronic inflammation and recurrent bacterial infections, pancreatic insufficiency, and male infertility. Therapies aimed at restoring the CFTR defect have emerged. Thus, a small molecule which facilitates chloride channel opening, the potentiator Ivacaftor, has been approved for the treatment of CF patients bearing a particular class of rare CFTR mutations. However, small molecules that directly target the most common misfolded CFTR mutant, F508del, and improve its intracellular trafficking in vitro, have been less effective than expected when tested in CF patients, even in combination with Ivacaftor. Thus, new strategies are required to circumvent the F508del-CFTR defect. Airway and intestinal epithelial cells from CF patients bearing the F508del-CFTR mutation exhibit an impressive derangement of cellular proteostasis, with oxidative stress, overactivation of the tissue transglutaminase (TG2), and disabled autophagy. Proteostasis regulators such as cysteamine can rescue and stabilize a functional F508del-CFTR protein through suppressing TG2 activation and restoring autophagy in vivo in F508del-CFTR homozygous mice, in vitro in CF patient-derived cell lines, ex vivo in freshly collected primary patient's nasal cells, as well as in a pilot clinical trial involving homozygous F508del-CFTR patients. Here, we discuss how the therapeutic normalization of defective proteostasis can be harnessed for the treatment of CF patients with the F508del-CFTR mutation.

  15. Distribution of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Mutations in a Cohort of Patients Residing in Palestine.

    PubMed

    Siryani, Issa; Jama, Mohamed; Rumman, Nisreen; Marzouqa, Hiyam; Kannan, Moein; Lyon, Elaine; Hindiyeh, Musa

    2015-01-01

    Cystic fibrosis (CF) is an autosomal recessive inherited life-threatening disorder that causes severe damage to the lungs and the digestive system. In Palestine, mutations in the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR) that contributes to the clinical presentation of CF are ill defined. A cohort of thirty three clinically diagnosed CF patients from twenty one different Palestinian families residing in the central and southern part of Palestine were incorporated in this study. Sweat chloride testing was performed using the Sweat Chek Conductivity Analyzer (ELITECH Group, France) to confirm the clinical diagnosis of CF. In addition, nucleic acid from the patients' blood samples was extracted and the CFTR mutation profiles were assessed by direct sequencing of the CFTR 27 exons and the intron-exon boundaries. For patient's DNA samples where no homozygous or two heterozygous CFTR mutations were identified by exon sequencing, DNA samples were tested for deletions or duplications using SALSA MLPA probemix P091-D1 CFTR assay. Sweat chloride testing confirmed the clinical diagnosis of CF in those patients. All patients had NaCl conductivity >60 mmol/l. In addition, nine different CFTR mutations were identified in all 21 different families evaluated. These mutations were c.1393-1G>A, F508del, W1282X, G85E, c.313delA, N1303K, deletion exons 17a-17b-18, deletion exons 17a-17b and Q1100P. c.1393-1G>A was shown to be the most frequent occurring mutation among tested families. We have profiled the underling mutations in the CFTR gene of a cohort of 21 different families affected by CF. Unlike other studies from the Arab countries where F508del was reported to be the most common mutation, in southern/central Palestine, the c.1393-1G>A appeared to be the most common. Further studies are needed per sample size and geographic distribution to account for other possible CFTR genetic alterations and their frequencies. Genotype/phenotype assessments are also recommended and finally carrier frequency should be ascertained.

  16. Robust method for TALEN-edited correction of pF508del in patient-specific induced pluripotent stem cells.

    PubMed

    Camarasa, María Vicenta; Gálvez, Víctor Miguel

    2016-02-09

    Cystic fibrosis is one of the most frequent inherited rare diseases, caused by mutations in the cystic fibrosis transmembrane conductance regulator gene. Apart from symptomatic treatments, therapeutic protocols for curing the disease have not yet been established. The regeneration of genetically corrected, disease-free epithelia in cystic fibrosis patients is envisioned by designing a stem cell/genetic therapy in which patient-derived pluripotent stem cells are genetically corrected, from which target tissues are derived. In this framework, we present an efficient method for seamless correction of pF508del mutation in patient-specific induced pluripotent stem cells by gene edited homologous recombination. Gene edition has been performed by transcription activator-like effector nucleases and a homologous recombination donor vector which contains a PiggyBac transposon-based double selectable marker cassette.This new method has been designed to partially avoid xenobiotics from the culture system, improve cell culture efficiency and genome stability by using a robust culture system method, and optimize timings. Overall, once the pluripotent cells have been amplified for the first nucleofection, the procedure can be completed in 69 days, and can be easily adapted to edit and change any gene of interest.

  17. Matrine in association with FD-2 stimulates F508del-cystic fibrosis transmembrane conductance regulator activity in the presence of corrector VX809

    PubMed Central

    Marengo, Barbara; Speciale, Andrea; Senatore, Lisa; Garibaldi, Silvano; Musumeci, Francesca; Nieddu, Erika; Pollarolo, Benedetta; Pronzato, Maria Adelaide; Schenone, Silvia; Mazzei, Mauro; Domenicotti, Cinzia

    2017-01-01

    Cystic fibrosis is caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, and the predominant mutation is termed Phe508del (F508del). Therapy for F508del-CFTR patients is based on the use of Orkambi®, a combination of VX809 and VX770. However, though Orkambi leads to an improvement in the lung function of patients, a progressive reduction in its efficacy has been observed. In order to overcome this effect, the aim of the present study was to investigate the role of matrine and the in-house compound FD-2 in increasing the action of VX809 and VX770. Fischer rat thyroid cells overexpressing F508del-CFTR were treated with matrine, VX809 (corrector) and/or with a number of potentiators (VX770, FD-1 and FD-2). The results demonstrated that matrine was able to stimulate CFTR activity and, in association with FD-2, increased the functionality of the channel in the presence of VX809. Based on these results, it may be hypothesized that FD-2 may be a novel and more effective potentiator compared with VX770. PMID:29039559

  18. Preimplantation genetic diagnosis for cystic fibrosis: the Montpellier center's 10-year experience.

    PubMed

    Girardet, A; Ishmukhametova, A; Willems, M; Coubes, C; Hamamah, S; Anahory, T; Des Georges, M; Claustres, M

    2015-02-01

    This study provides an overview of 10 years of experience of preimplantation genetic diagnosis (PGD) for cystic fibrosis (CF) in our center. Owing to the high allelic heterogeneity of CF transmembrane conductance regulator (CFTR) mutations in south of France, we have set up a powerful universal test based on haplotyping eight short tandem repeats (STR) markers together with the major mutation p.Phe508del. Of 142 couples requesting PGD for CF, 76 have been so far enrolled in the genetic work-up, and 53 had 114 PGD cycles performed. Twenty-nine cycles were canceled upon in vitro fertilization (IVF) treatment because of hyper- or hypostimulation. Of the remaining 85 cycles, a total of 493 embryos were biopsied and a genetic diagnosis was obtained in 463 (93.9%), of which 262 (without or with a single CF-causing mutation) were transferable. Twenty-eight clinical pregnancies were established, yielding a pregnancy rate per transfer of 30.8% in the group of seven couples with one member affected with CF, and 38.3% in the group of couples whose both members are carriers of a CF-causing mutation [including six couples with congenital bilateral absence of the vas deferens (CBAVD)]. So far, 25 children were born free of CF and no misdiagnosis was recorded. Our test is applicable to 98% of couples at risk of transmitting CF. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.

    PubMed

    Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D

    2016-02-01

    Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing. © 2015 WILEY PERIODICALS, INC.

  20. R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family.

    PubMed

    Xu, Jun; Gu, Hong; Ma, Kai; Liu, Xipu; Snellingen, Torkel; Sun, Erdan; Wang, Ningli; Liu, Ningpu

    2010-08-12

    We identified a large Chinese family with X-linked juvenile retinoschisis. The purpose of this study was to report the clinical findings of the family and to identify the genetic mutation by screening the retinoschisis 1 (RS1) gene. Family history was collected and all family members underwent routine ophthalmic examination. Venous blood was collected from family members and genomic DNA was extracted. The exons of RS1 were screened by PCR followed by direct sequencing and/or restriction enzyme digestion. The pedigree of interest was a four-generation family with 52 family members, including seven affected individuals. The proband was a 5-year-old boy showing highly elevated bullous retinoschisis with moderate vitreous hemorrhage in both eyes. Vitrectomy was performed in the left eye of the proband. Five affected males showed large peripheral retinoschisis in both eyes, either involving the macula or combined with foveal stellate cystic change. One of the affected family members showed only a foveal stellate cystic change in both eyes without periphery retinoschisis. Visual acuity of affected individuals ranged from hand motion to 0.4. The R213W mutation in exon 6 of RS1 was identified in all affected individuals, predicting an amino acid substitution of arginine to tryptophan at codon 213. Our data show that the R213W mutation in RS1 causes various severities of retinoschisis in a large Chinese family, providing further evidence for X-linked juvenile retinoschisis phenotypic variability.

  1. Potential impact on fertility of new systemic therapies for cystic fibrosis.

    PubMed

    Jones, Gareth Huw; Walshaw, Martin John

    2015-10-01

    Cystic fibrosis is primarily considered a respiratory disease with superadded pancreatic dysfunction; however the underlying genetic mutation results in the abnormal function of cells throughout the body - including tissues involved in reproduction. Practically all males and up to 50% of females with CF will suffer fertility issues - the causes of which are multifactorial and could be improved by treatments that target the underlying physiological deficit, such as ivacaftor. We consider the mechanisms by which the rapidly developing field of systemic treatments for CF could impact on the fertility of this group and review the available real world evidence. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Increased NF-κB Activity and Decreased Wnt/β-Catenin Signaling Mediate Reduced Osteoblast Differentiation and Function in ΔF508 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Mice.

    PubMed

    Le Henaff, Carole; Mansouri, Rafik; Modrowski, Dominique; Zarka, Mylène; Geoffroy, Valérie; Marty, Caroline; Tarantino, Nadine; Laplantine, Emmanuel; Marie, Pierre J

    2015-07-17

    The prevalent human ΔF508 mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) is associated with reduced bone formation and bone loss in mice. The molecular mechanisms by which the ΔF508-CFTR mutation causes alterations in bone formation are poorly known. In this study, we analyzed the osteoblast phenotype in ΔF508-CFTR mice and characterized the signaling mechanisms underlying this phenotype. Ex vivo studies showed that the ΔF508-CFTR mutation negatively impacted the differentiation of bone marrow stromal cells into osteoblasts and the activity of osteoblasts, demonstrating that the ΔF508-CFTR mutation alters both osteoblast differentiation and function. Treatment with a CFTR corrector rescued the abnormal collagen gene expression in ΔF508-CFTR osteoblasts. Mechanistic analysis revealed that NF-κB signaling and transcriptional activity were increased in mutant osteoblasts. Functional studies showed that the activation of NF-κB transcriptional activity in mutant osteoblasts resulted in increased β-catenin phosphorylation, reduced osteoblast β-catenin expression, and altered expression of Wnt/β-catenin target genes. Pharmacological inhibition of NF-κB activity or activation of canonical Wnt signaling rescued Wnt target gene expression and corrected osteoblast differentiation and function in bone marrow stromal cells and osteoblasts from ΔF508-CFTR mice. Overall, the results show that the ΔF508-CFTR mutation impairs osteoblast differentiation and function as a result of overactive NF-κB and reduced Wnt/β-catenin signaling. Moreover, the data indicate that pharmacological inhibition of NF-κB or activation of Wnt/β-catenin signaling can rescue the abnormal osteoblast differentiation and function induced by the prevalent ΔF508-CFTR mutation, suggesting novel therapeutic strategies to correct the osteoblast dysfunctions in cystic fibrosis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Increased NF-κB Activity and Decreased Wnt/β-Catenin Signaling Mediate Reduced Osteoblast Differentiation and Function in ΔF508 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Mice*

    PubMed Central

    Le Henaff, Carole; Mansouri, Rafik; Modrowski, Dominique; Zarka, Mylène; Geoffroy, Valérie; Marty, Caroline; Tarantino, Nadine; Laplantine, Emmanuel; Marie, Pierre J.

    2015-01-01

    The prevalent human ΔF508 mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) is associated with reduced bone formation and bone loss in mice. The molecular mechanisms by which the ΔF508-CFTR mutation causes alterations in bone formation are poorly known. In this study, we analyzed the osteoblast phenotype in ΔF508-CFTR mice and characterized the signaling mechanisms underlying this phenotype. Ex vivo studies showed that the ΔF508-CFTR mutation negatively impacted the differentiation of bone marrow stromal cells into osteoblasts and the activity of osteoblasts, demonstrating that the ΔF508-CFTR mutation alters both osteoblast differentiation and function. Treatment with a CFTR corrector rescued the abnormal collagen gene expression in ΔF508-CFTR osteoblasts. Mechanistic analysis revealed that NF-κB signaling and transcriptional activity were increased in mutant osteoblasts. Functional studies showed that the activation of NF-κB transcriptional activity in mutant osteoblasts resulted in increased β-catenin phosphorylation, reduced osteoblast β-catenin expression, and altered expression of Wnt/β-catenin target genes. Pharmacological inhibition of NF-κB activity or activation of canonical Wnt signaling rescued Wnt target gene expression and corrected osteoblast differentiation and function in bone marrow stromal cells and osteoblasts from ΔF508-CFTR mice. Overall, the results show that the ΔF508-CFTR mutation impairs osteoblast differentiation and function as a result of overactive NF-κB and reduced Wnt/β-catenin signaling. Moreover, the data indicate that pharmacological inhibition of NF-κB or activation of Wnt/β-catenin signaling can rescue the abnormal osteoblast differentiation and function induced by the prevalent ΔF508-CFTR mutation, suggesting novel therapeutic strategies to correct the osteoblast dysfunctions in cystic fibrosis. PMID:26060255

  4. Molecular genetic analysis of some mutations in the cystic fibrosis gene in Moldova: Characterization of molecular markers and their linkage to various mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gimbovskaya, S.D.; Kalinin, V.N.; Ivashchenko, T.E.

    1994-12-01

    Sixty-one patients with cystic fibrosis (CF) from Moldova were tested for mutations {Delta}F508, G551D, and R553X. Frequencies of various alleles of the repeated GATT sequence in intron 6B of the GFTR gene, their linkage to other polymorphic markers, and various mutations were determined. The frequency of occurrence of mutation {Delta}F508 was only 25%. An absolute majority of CF patients (80%) had pancreatic insufficiency. Mutations G551D and R553X were not found in our sample. Each of 31 chromosomes with mutation {Delta}F508 carry the 6-GATT allele. Most {open_quotes}non {Delta}F508{close_quotes} (78%) and normal (80%) chromosomes were marked by the 7-GATT allele. Twenty-seven {Delta}F508more » chromosomes (96.4%) belong to haplotype B6, and only one to D6. Most chromosomes with {open_quotes}non {Delta}F508{close_quotes} mutations are associated with haplotypes D7 (26.3%) and C7 (21%). In addition, a significant portion of chromosomes from this subgroup were associated with haplotypes A7 (23.7%), A6 (10.5%), and C6 (2.7%), which are not yet described for mutant chromosomes. The results obtained demonstrate that CF in Moldova is mainly associated with mutations other than {Delta}F508, G551D, and R553X. Severe forms of the disease, with pancreatic insufficiency, are more frequently caused by these mutations; moreover, our data provides strong evidence for the presence of at least seven additional CF mutations in Moldova, apart from {Delta}F508, G551D, and R553X. Some of these are probably not described.« less

  5. Low abundance of sweat duct Cl− channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise

    PubMed Central

    Haack, Karla K. V.; Pollack, Brian P.; Millard-Stafford, Mindy; McCarty, Nael A.

    2011-01-01

    To understand potential mechanisms explaining interindividual variability observed in human sweat sodium concentration ([Na+]), we investigated the relationship among [Na+] of thermoregulatory sweat, plasma membrane expression of Na+ and Cl− transport proteins in biopsied human eccrine sweat ducts, and basal levels of vasopressin (AVP) and aldosterone. Lower ductal luminal membrane expression of the Cl− channel cystic fibrosis transmembrane conductance regulator (CFTR) was observed in immunofluorescent staining of sweat glands from healthy young adults identified as exceptionally “salty sweaters” (SS) (n = 6, P < 0.05) and from patients with cystic fibrosis (CF) (n = 6, P < 0.005) compared with ducts from healthy young adults with “typical” sweat [Na+] (control, n = 6). Genetic testing of healthy subjects did not reveal any heterozygotes (“carriers”) for any of the 39 most common disease-causing CFTR mutations in the United States. SS had higher baseline plasma [AVP] compared with control (P = 0.029). Immunostaining to investigate a potential relationship between higher plasma [AVP] (and sweat [Na+]) and ductal membrane aquaporin-5 revealed for all groups a relatively sparse and location-dependent ductal expression of the water channel with localization primarily to the secretory coil. Availability of CFTR for NaCl transport across the ductal membrane appears related to the significant physiological variability observed in sweat salt concentration in apparently healthy humans. At present, a heritable link between healthy salty sweaters and the most prevalent disease-causing CFTR mutations cannot be established. PMID:21228336

  6. Postzygotic HRAS mutation causing both keratinocytic epidermal nevus and thymoma and associated with bone dysplasia and hypophosphatemia due to elevated FGF23.

    PubMed

    Avitan-Hersh, Emily; Tatur, Sameh; Indelman, Margarita; Gepstein, Vardit; Shreter, Roni; Hershkovitz, Dov; Brick, Riva; Bergman, Reuven; Tiosano, Dov

    2014-01-01

    Epidermal nevus syndrome is a rare group of disorders characterized by the combination of congenital epidermal nevi and extracutaneous features, including skeletal, neurological, ocular, and other systemic findings. We report a case of keratinocytic epidermal nevus syndrome that includes a thymoma, bone dysplasia, and hypophosphatemia with elevated fibroblast growth factor 23 (FGF23) levels associated with postzygotic HRAS mutation. A 14-year-old boy was admitted due to recent limping. The physical examination revealed multiple right-sided linear epidermal nevi along Blaschko's lines. Magnetic resonance imaging showed cystic lesions in cervical bones and thymoma, and x-ray examination showed cystic lesions in the hands. Biochemical studies demonstrated severe hypophosphatemia, normocalcemia, high normal PTH, low 25-hydroxyvitamin D and low 1,25-dihydroxyvitamin D levels. The serum FGF23 C-terminal level was normal, but the intact FGF23 level was found to be elevated. Genetic evaluation revealed a heterozygote mutation in the HRAS gene in both the keratinocytic epidermal nevus and thymoma but not in DNA extracted from blood lymphocytes, thus establishing the mutation as postzygotic. Postzygotic mutations in HRAS lead to elevation of FGF23 levels, as found in mutated PHEX, FGF23, DMP1, and ENPP1 genes, which lead to hypophosphatemia. An identical postzygotic HRAS mutation was shown to be present in both keratinocytic epidermal nevus and thymoma and to be associated with bone lesions and hypophosphatemia due to elevated FGF23 levels. These may all be related to the HRAS mutation.

  7. Four case reports of Chinese cystic fibrosis patients and literature review.

    PubMed

    Xu, Juan; Yin, Yong; Zhang, Lei; Zhang, Jing; Yuan, Shuhua; Zhang, Hao

    2017-08-01

    Cystic fibrosis (CF) is an extremely rare disease in Asians. Here, we report four Chinese children with CF and review the literature about Chinese CF patients. The cystic fibrosis transmembrane conductance regulator (CFTR) gene testing was performed on four suspected patients for CF screening. We also reviewed the literature about Chinese CF patients from 1970s. The clinical data of all these CF patients were summarized. We diagnosed four CF patients who had mutations in the CFTR gene. We identified six different mutations in the four patients. The c.1766+5G>T, c.595C>T, c.2909G>A, and c.4056G>C had been reported already. The two splicing mutations of c.579+1_579+2insACAT and c.1117-1G>C were novel mutations. There have been 46 Chinese CF patients reported in literature from 1974 up to present (2016.12). The clinical manifestations of CF involved several systems. The most common symptom was recurrent pulmonary infections. Thirty-three different mutations were identified; c.1766 + 5G>T was the most common mutation among Chinese CF patients. Only one of these mutations (R553X) was in the Caucasian CF screening panel. The spectrum of CFTR mutations in Chinese was highly different from that of Caucasian. There was a high risk of misdiagnosis or delayed diagnosis of CF even in suspected cases in China. It is necessary to educate Chinese clinicians about the signs, symptoms, and diagnosis of cystic fibrosis and promote the implementation of the sweat chloride test. © 2017 Wiley Periodicals, Inc.

  8. Probing Conformational Rescue Induced by a Chemical Corrector of F508del-Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Mutant*

    PubMed Central

    Yu, Wilson; Chiaw, Patrick Kim; Bear, Christine E.

    2011-01-01

    Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene that cause loss of function of the CFTR channel on the apical surface of epithelial cells. The major CF-causing mutation, F508del-CFTR, is misfolded, retained in the endoplasmic reticulum, and degraded. Small molecule corrector compounds have been identified using high throughput screens, which partially rescue the trafficking defect of F508del-CFTR, allowing a fraction of the mutant protein to escape endoplasmic reticulum retention and traffic to the plasma membrane, where it exhibits partial function as a cAMP-regulated chloride channel. A subset of such corrector compounds binds directly to the mutant protein, prompting the hypothesis that they rescue the biosynthetic defect by inducing improved protein conformation. We tested this hypothesis directly by evaluating the consequences of a corrector compound on the conformation of each nucleotide binding domain (NBD) in the context of the full-length mutant protein in limited proteolytic digest studies. Interestingly, we found that VRT-325 was capable of partially restoring compactness in NBD1. However, VRT-325 had no detectable effect on the conformation of the second half of the molecule. In comparison, ablation of the di-arginine sequence, R553XR555 (F508del-KXK-CFTR), modified protease susceptibility of NBD1, NBD2, and the full-length protein. Singly, each intervention led to a partial correction of the processing defect. Together, these interventions restored processing of F508del-CFTR to near wild type. Importantly, however, a defect in NBD1 conformation persisted, as did a defect in channel activation after the combined interventions. Importantly, this defect in channel activation can be fully corrected by the addition of the potentiator, VX-770. PMID:21602569

  9. Management of male infertility due to congenital bilateral absence of vas deferens should not ignore the diagnosis of cystic fibrosis.

    PubMed

    Grzegorczyk, V; Rives, N; Sibert, L; Dominique, S; Macé, B

    2012-10-01

    Microsurgical or percutaneous epididymal sperm aspiration and intracytoplasmic sperm injection (ICSI) are proposed to overcome male infertility due to congenital bilateral absence of vas deferens (CBAVD). CBAVD has been associated with mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and consequently, genetic counselling has to be addressed before beginning ICSI procedure. However, management of male infertility due to CBAVD should not ignore a mild form of cystic fibrosis. We describe the case of cystic fibrosis late diagnosis performed in a 49-year-old infertile men with CBAVD. CFTR molecular testing detected two mutations F508del and A455E corresponding to a cystic fibrosis genotype. Pneumological evaluation revealed a severe obstructive respiratory disease, bronchiectasis and high sweat chloride levels. Symptoms consistent with a cystic fibrosis have to be identified in infertile men with CBAVD before beginning assisted reproductive procedures. © 2012 Blackwell Verlag GmbH.

  10. eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

    NASA Astrophysics Data System (ADS)

    Reed, Michael R.; Coty, William A.

    We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

  11. Genetic events in the progression of adenoid cystic carcinoma of the breast to high-grade triple-negative breast cancer.

    PubMed

    Fusco, Nicola; Geyer, Felipe C; De Filippo, Maria R; Martelotto, Luciano G; Ng, Charlotte K Y; Piscuoglio, Salvatore; Guerini-Rocco, Elena; Schultheis, Anne M; Fuhrmann, Laetitia; Wang, Lu; Jungbluth, Achim A; Burke, Kathleen A; Lim, Raymond S; Vincent-Salomon, Anne; Bamba, Masamichi; Moritani, Suzuko; Badve, Sunil S; Ichihara, Shu; Ellis, Ian O; Reis-Filho, Jorge S; Weigelt, Britta

    2016-11-01

    Adenoid cystic carcinoma of the breast is a rare histological type of triple-negative breast cancer with an indolent clinical behavior, often driven by the MYB-NFIB fusion gene. Here we sought to define the repertoire of somatic genetic alterations in two adenoid cystic carcinomas associated with high-grade triple-negative breast cancer. The different components of each case were subjected to copy number profiling and massively parallel sequencing targeting all exons and selected regulatory and intronic regions of 488 genes. Reverse transcription PCR and fluorescence in situ hybridization were employed to investigate the presence of the MYB-NFIB translocation. The MYB-NFIB fusion gene was detected in both adenoid cystic carcinomas and their associated high-grade triple-negative breast cancer components. Although the distinct components of both cases displayed similar patterns of gene copy number alterations, massively parallel sequencing analysis revealed intratumor genetic heterogeneity. In case 1, progression from the trabecular adenoid cystic carcinoma to the high-grade triple-negative breast cancer was found to involve clonal shifts with enrichment of mutations affecting EP300, NOTCH1, ERBB2 and FGFR1 in the high-grade triple-negative breast cancer. In case 2, a clonal KMT2C mutation was present in the cribriform adenoid cystic carcinoma, solid adenoid cystic carcinoma and high-grade triple-negative breast cancer components, whereas a mutation affecting MYB was present only in the solid and high-grade triple-negative breast cancer areas and additional three mutations targeting STAG2, KDM6A and CDK12 were restricted to the high-grade triple-negative breast cancer. In conclusion, adenoid cystic carcinomas of the breast with high-grade transformation are underpinned by the MYB-NFIB fusion gene and, akin to other forms of cancer, may be constituted by a mosaic of cancer cell clones at diagnosis. The progression from adenoid cystic carcinoma to high-grade triple-negative breast cancer of no special type may involve the selection of neoplastic clones and/or the acquisition of additional genetic alterations.

  12. Genetic events in the progression of adenoid cystic carcinoma of the breast to high-grade triple-negative breast cancer

    PubMed Central

    Fusco, Nicola; Geyer, Felipe C; De Filippo, Maria R; Martelotto, Luciano G; Ng, Charlotte K Y; Piscuoglio, Salvatore; Guerini-Rocco, Elena; Schultheis, Anne M; Fuhrmann, Laetitia; Wang, Lu; Jungbluth, Achim A; Burke, Kathleen A; Lim, Raymond S; Vincent-Salomon, Anne; Bamba, Masamichi; Moritani, Suzuko; Badve, Sunil S; Ichihara, Shu; Ellis, Ian O; Reis-Filho, Jorge S; Weigelt, Britta

    2016-01-01

    Adenoid cystic carcinoma of the breast is a rare histologic type of triple-negative breast cancer with an indolent clinical behavior, often driven by the MYB-NFIB fusion gene. Here we sought to define the repertoire of somatic genetic alterations in two adenoid cystic carcinomas associated with high-grade triple-negative breast cancer. The different components of each case were subjected to copy number profiling and massively parallel sequencing targeting all exons and selected regulatory and intronic regions of 488 genes. Reverse transcription PCR and fluorescence in situ hybridization were employed to investigate the presence of the MYB-NFIB translocation. The MYB-NFIB fusion gene was detected in both adenoid cystic carcinomas and their associated high-grade triple-negative breast cancer components. Whilst the distinct components of both cases displayed similar patterns of gene copy number alterations, massively parallel sequencing analysis revealed intra-tumor genetic heterogeneity. In case 1, progression from the trabecular adenoid cystic carcinoma to the high-grade triple-negative breast cancer was found to involve clonal shifts with enrichment of mutations affecting EP300, NOTCH1, ERBB2 and FGFR1 in the high-grade triple-negative breast cancer. In case 2, a clonal KMT2C mutation was present in the cribriform adenoid cystic carcinoma, solid adenoid cystic carcinoma and high-grade triple-negative breast cancer components, whereas a mutation affecting MYB was present only in the solid and high-grade triple-negative breast cancer areas and additional three mutations targeting STAG2, KDM6A and CDK12 were restricted to the high-grade triple-negative breast cancer. In conclusion, adenoid cystic carcinomas of the breast with high-grade transformation are underpinned by MYB-NFIB fusion gene, and, akin to other forms of cancer, may be constituted by a mosaic of cancer cell clones at diagnosis. The progression from adenoid cystic carcinoma to high-grade triple-negative breast cancer of no special type may involve the selection of neoplastic clones and/ or the acquisition of additional genetic alterations. PMID:27491809

  13. Applying Cystic Fibrosis Transmembrane Conductance Regulator Genetics and CFTR2 Data to Facilitate Diagnoses.

    PubMed

    Sosnay, Patrick R; Salinas, Danieli B; White, Terry B; Ren, Clement L; Farrell, Philip M; Raraigh, Karen S; Girodon, Emmanuelle; Castellani, Carlo

    2017-02-01

    As a Mendelian disease, genetics plays an integral role in the diagnosis of cystic fibrosis (CF). The identification of 2 disease-causing mutations in the CF transmembrane conductance regulator (CFTR) in an individual with a phenotype provides evidence that the disease is CF. However, not all variations in CFTR always result in CF. Therefore, for CFTR genotype to provide the same level of evidence of CFTR dysfunction as shown by direct tests such as sweat chloride or nasal potential difference, the mutations identified must be known to always result in CF. The use of CFTR genetics in CF diagnosis, therefore, relies heavily on mutation interpretation. Progress that has been made on mutation interpretation and annotation was reviewed at the recent CF Foundation Diagnosis Consensus Conference. A modified Delphi method was used to identify consensus statements on the use of genetic analysis in CF diagnosis. The largest recent advance in CF genetics has come through the Clinical and Functional Translation of CFTR (CFTR2) project. This undertaking seeks to characterize CFTR mutations from patients with CF around the world. The project also established guidelines for the clinical, functional, and population/penetrance criteria that can be used to interpret mutations not yet included in CFTR2's review. The use of CFTR genetics to aid in diagnosis of CF requires that the mutations identified have a known disease liability. The demonstration of 2 in trans mutations known to always result in CF is satisfactory evidence of CFTR dysfunction. However, if the identified mutations are known to be associated with variable outcomes, or have unknown consequence, that genotype may not result in a CF phenotype. In these cases, other tests of CFTR function may help. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lewis, Hal A.; Zhao, Xun; Wang, Chi

    Cystic fibrosis is caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR), commonly the deletion of residue Phe-508 (DeltaF508) in the first nucleotide-binding domain (NBD1), which results in a severe reduction in the population of functional channels at the epithelial cell surface. Previous studies employing incomplete NBD1 domains have attributed this to aberrant folding of DeltaF508 NBD1. We report structural and biophysical studies on complete human NBD1 domains, which fail to demonstrate significant changes of in vitro stability or folding kinetics in the presence or absence of the DeltaF508 mutation. Crystal structures show minimal changes in protein conformationmore » but substantial changes in local surface topography at the site of the mutation, which is located in the region of NBD1 believed to interact with the first membrane spanning domain of CFTR. These results raise the possibility that the primary effect of DeltaF508 is a disruption of proper interdomain interactions at this site in CFTR rather than interference with the folding of NBD1. Interestingly, increases in the stability of NBD1 constructs are observed upon introduction of second-site mutations that suppress the trafficking defect caused by the DeltaF508 mutation, suggesting that these suppressors might function indirectly by improving the folding efficiency of NBD1 in the context of the full-length protein. The human NBD1 structures also solidify the understanding of CFTR regulation by showing that its two protein segments that can be phosphorylated both adopt multiple conformations that modulate access to the ATPase active site and functional interdomain interfaces.« less

  15. R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family

    PubMed Central

    Xu, Jun; Gu, Hong; Ma, Kai; Liu, Xipu; Snellingen, Torkel; Sun, Erdan; Wang, Ningli

    2010-01-01

    Purpose We identified a large Chinese family with X-linked juvenile retinoschisis. The purpose of this study was to report the clinical findings of the family and to identify the genetic mutation by screening the retinoschisis 1 (RS1) gene. Methods Family history was collected and all family members underwent routine ophthalmic examination. Venous blood was collected from family members and genomic DNA was extracted. The exons of RS1 were screened by PCR followed by direct sequencing and/or restriction enzyme digestion. Results The pedigree of interest was a four-generation family with 52 family members, including seven affected individuals. The proband was a 5-year-old boy showing highly elevated bullous retinoschisis with moderate vitreous hemorrhage in both eyes. Vitrectomy was performed in the left eye of the proband. Five affected males showed large peripheral retinoschisis in both eyes, either involving the macula or combined with foveal stellate cystic change. One of the affected family members showed only a foveal stellate cystic change in both eyes without periphery retinoschisis. Visual acuity of affected individuals ranged from hand motion to 0.4. The R213W mutation in exon 6 of RS1 was identified in all affected individuals, predicting an amino acid substitution of arginine to tryptophan at codon 213. Conclusions Our data show that the R213W mutation in RS1 causes various severities of retinoschisis in a large Chinese family, providing further evidence for X-linked juvenile retinoschisis phenotypic variability. PMID:20806044

  16. Molecular diagnosis of cystic fibrosis.

    PubMed

    Shrimpton, Antony E

    2002-05-01

    A review of the current molecular diagnosis of cystic fibrosis including an introduction to cystic fibrosis, the gene function, the phenotypic variation, who should be screened for which mutation, newborn and couple screening, quality assurance, phenotype-genotype correlation, methods and method limitations, options, statements, recommendations, useful Websites and treatments.

  17. Increased folding and channel activity of a rare cystic fibrosis mutant with CFTR modulators

    PubMed Central

    Grove, Diane E.; Houck, Scott A.

    2011-01-01

    Cystic fibrosis (CF) is a lethal recessive genetic disease caused by mutations in the CFTR gene. The gene product is a PKA-regulated anion channel that is important for fluid and electrolyte transport in the epithelia of lung, gut, and ducts of the pancreas and sweat glands. The most common CFTR mutation, ΔF508, causes a severe, but correctable, folding defect and gating abnormality, resulting in negligible CFTR function and disease. There are also a large number of rare CF-related mutations where disease is caused by CFTR misfolding. Yet the extent to which defective biogenesis of these CFTR mutants can be corrected is not clear. CFTRV232D is one such mutant that exhibits defective folding and trafficking. CFTRΔF508 misfolding is difficult to correct, but defective biogenesis of CFTRV232D is corrected to near wild-type levels by small-molecule folding correctors in development as CF therapeutics. To determine if CFTRV232D protein is competent as a Cl− channel, we utilized single-channel recordings from transfected human embryonic kidney (HEK-293) cells. After PKA stimulation, CFTRV232D channels were detected in patches with a unitary Cl− conductance indistinguishable from that of CFTR. Yet the frequency of detecting CFTRV232D channels was reduced to ∼20% of patches compared with 60% for CFTR. The folding corrector Corr-4a increased the CFTRV232D channel detection rate and activity to levels similar to CFTR. CFTRV232D-corrected channels were inhibited with CFTRinh-172 and stimulated fourfold by the CFTR channel potentiator VRT-532. These data suggest that CF patients with rare mutations that cause CFTR misfolding, such as CFTRV232D, may benefit from treatment with folding correctors and channel potentiators in development to restore CFTRΔF508 function. PMID:21642448

  18. CFTR Genotype and Maximal Exercise Capacity in Cystic Fibrosis: A Cross-sectional Study.

    PubMed

    Radtke, Thomas; Hebestreit, Helge; Gallati, Sabina; Schneiderman, Jane E; Braun, Julia; Stevens, Daniel; Hulzebos, Erik Hj; Takken, Tim; Boas, Steven R; Urquhart, Don S; Lands, Larry C; Tejero, Sergio; Sovtic, Aleksandar; Dwyer, Tiffany; Petrovic, Milos; Harris, Ryan A; Karila, Chantal; Savi, Daniela; Usemann, Jakob; Mei-Zahav, Meir; Hatziagorou, Elpis; Ratjen, Felix; Kriemler, Susi

    2018-02-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is expressed in human skeletal muscle cells. Variations of CFTR dysfunction among patients with cystic fibrosis may be an important determinant of maximal exercise capacity in cystic fibrosis. Previous studies on the relationship between CFTR genotype and maximal exercise capacity are scarce and contradictory. This study was designed to explore factors influencing maximal exercise capacity, expressed as peak oxygen uptake (V.O2peak), with a specific focus on CFTR genotype in children and adults with cystic fibrosis. In an international, multicenter, cross-sectional study, we collected data on CFTR genotype and cardiopulmonary exercise tests in patients with cystic fibrosis who were ages 8 years and older. CFTR mutations were classified into functional classes I–V. The final analysis included 726 patients (45% females; age range, 8–61 yr; forced expiratory volume in 1 s, 16 to 123% predicted) from 17 cystic fibrosis centers in North America, Europe, Australia, and Asia, all of whom had both valid maximal cardiopulmonary exercise tests and complete CFTR genotype data. Overall, patients exhibited exercise intolerance (V.O2peak, 77.3 ± 19.1% predicted), but values were comparable among different CFTR classes. We did not detect an association between CFTR genotype functional classes I–III and either V.O2peak (percent predicted) (adjusted β = −0.95; 95% CI, −4.18 to 2.29; P = 0.57) or maximum work rate (Wattmax) (adjusted β = −1.38; 95% CI, −5.04 to 2.27; P = 0.46) compared with classes IV–V. Those with at least one copy of a F508del-CFTR mutation and one copy of a class V mutation had a significantly lower V.O2peak (β = −8.24%; 95% CI, −14.53 to −2.99; P = 0.003) and lower Wattmax (adjusted β = −7.59%; 95% CI, −14.21 to −0.95; P = 0.025) than those with two copies of a class II mutation. On the basis of linear regression analysis adjusted for relevant confounders, lung function and body mass index were associated with V.O2peak. CFTR functional genotype class was not associated with maximal exercise capacity in patients with cystic fibrosis overall, but those with at least one copy of a F508del-CFTR mutation and a single class V mutation had lower maximal exercise capacity.

  19. Cystic fibrosis transmembrane regulator haplotypes in households of patients with cystic fibrosis.

    PubMed

    Furgeri, Daniela Tenório; Marson, Fernando Augusto Lima; Correia, Cyntia Arivabeni Araújo; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia

    2018-01-30

    Nearly 2000 mutations in the cystic fibrosis transmembrane regulator (CFTR) gene have been reported. The F508del mutation occurs in approximately 50-65% of patients with cystic fibrosis (CF). However, molecular diagnosis is not always possible. Therefore, silent polymorphisms can be used to label the mutant allele in households of patients with CF. To verify the haplotypes of four polymorphisms at the CFTR locus in households of patients with CF for pre-fertilization, pre-implantation, and prenatal indirect mutation diagnosis to provide better genetic counseling for families and patients with CF and to associate the genotypes/haplotypes with the F508del mutation screening. GATT polymorphism analysis was performed using direct polymerase chain reaction amplification, and the MP6-D9, TUB09 and TUB18 polymorphism analyses were performed using restriction fragment length polymorphism. Nine haplotypes were found in 37 CFTR alleles, and of those, 24 were linked with the F508del mutation and 13 with other CFTR mutations. The 6 (GATT), C (MP6-D9), G (TUB09), and C (TUB18) haplotypes showed the highest prevalence (48%) of the mutant CFTR allele and were linked to the F508del mutation (64%). In 43% of households analyzed, at least one informative polymorphism can be used for the indirect diagnostic test. CFTR polymorphisms are genetic markers that are useful for identifying the mutant CFTR alleles in households of patients with CF when it is not possible to establish the complete CFTR genotype. Moreover, the polymorphisms can be used for indirect CFTR mutation identification in cases of pre-fertilization, pre-implantation and prenatal analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Cystic fibrosis: a mucosal immunodeficiency syndrome

    PubMed Central

    Cohen, Taylor Sitarik; Prince, Alice

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) functions as a channel that regulates the transport of ions and the movement of water across the epithelial barrier. Mutations in CFTR, which form the basis for the clinical manifestations of cystic fibrosis, affect the epithelial innate immune function in the lung, resulting in exaggerated and ineffective airway inflammation that fails to eradicate pulmonary pathogens. Compounding the effects of excessive neutrophil recruitment, the mutant CFTR channel does not transport antioxidants to counteract neutrophil-associated oxidative stress. Whereas mutant CFTR expression in leukocytes outside of the lung does not markedly impair their function, the expected regulation of inflammation in the airways is clearly deficient in cystic fibrosis. The resulting bacterial infections, which are caused by organisms that have substantial genetic and metabolic flexibility, can resist multiple classes of antibiotics and evade phagocytic clearance. The development of animal models that approximate the human pulmonary phenotypes—airway inflammation and spontaneous infection—may provide the much-needed tools to establish how CFTR regulates mucosal immunity and to test directly the effect of pharmacologic potentiation and correction of mutant CFTR function on bacterial clearance. PMID:22481418

  1. A Low-Cost and Simple Genetic Screening for Cystic Fibrosis Provided by the Brazilian Public Health System.

    PubMed

    Rispoli, Thaiane; Martins de Castro, Simone; Grandi, Tarciana; Prado, Mayara; Filippon, Letícia; Dornelles da Silva, Cláudia Maria; Vargas, José Eduardo; Rossetti, Lucia Maria Rosa

    2018-05-03

    Cystic fibrosis newborn screening was implemented in Brazil by the Public Health System in 2012. Because of cost, only 1 mutation was tested - p.Phe508del. We developed a robust low-cost genetic test for screening 11 CFTR gene mutations with potential use in developing countries. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Role of CFTR mutation analysis in the diagnostic algorithm for cystic fibrosis.

    PubMed

    Ratkiewicz, Michelle; Pastore, Matthew; McCoy, Karen Sharrock; Thompson, Rohan; Hayes, Don; Sheikh, Shahid Ijaz

    2017-04-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation identification is being used with increased frequency to aid in the diagnosis of cystic fibrosis (CF) in those suspected with CF. Aim of this study was to identify diagnostic outcomes when CFTR mutational analysis was used in CF diagnosis. CFTR mutational analysis results were also compared with sweat chloride results. This study was done on all patients at our institution who had CFTR mutation analysis over a sevenyear period since August 2006. A total of 315 patients underwent CFTR mutational analysis. Fifty-one (16.2%) patients had two mutations identified. Among them 32 had positive sweat chloride levels (≥60 mmol/L), while seven had borderline sweat chloride levels (40-59 mmol/L). An additional 70 patients (22.3%) had only one mutation identified. Among them eight had positive sweat chloride levels, and 17 had borderline sweat chloride levels. Fifty-five patients (17.5%) without CFTR mutations had either borderline (n=45) or positive (n=10) sweat chloride results. Three patients with a CF phenotype had negative CFTR analysis but elevated sweat chloride levels. In eighty-three patients (26.4%) CFTR mutational analysis was done without corresponding sweat chloride testing. Although CFTR mutation analysis has improved the diagnostic capability for CF, its use either as the first step or the only test to diagnose CFTR dysfunction should be discouraged and CF diagnostic guidelines need to be followed.

  3. [News in cystic fibrosis].

    PubMed

    Delaisi, B

    2013-08-01

    The improvement over the last two decades in the treatment of cystic fibrosis led to an increase in life expectancy approaching 40 years at birth. Logically, the population of adult patients has been increasing and is currently 50% of patients followed in France. These therapeutic advances have justified the establishment in 2003 of a generalized neonatal screening for cystic fibrosis. The latest data of this screening show an incidence of CF of 1/5359 live births, far below the incidence of 1/2500 which was widely accepted twenty years ago. The performance of this screening is currently based on the dosage of trypsin immuno reactive, followed in case of exceeding the threshold of a search of the 30 most common mutations, can detect around 96% of 150 to 200 CF cases every year. Therefore, the possibility of a false negative of the screening cannot be excluded and evocative symptoms of cystic fibrosis, even for children born after 2003, will lead to prescribe a sweat test. While treatments available so far goal consequences of cystic fibrosis, a new therapeutic class to correct the functional defect of the mutated protein, called CFTR modulators, is emerging. Ivacaftor, leader of this new class, belonging to the category of "CFTR potentiator" got its access on the market in September 2012 for patients carrying the G551D mutation. New other molecules, named "CFTR correctors" which can have synergistic effect with ivacaftor and concern patients carrying the most common mutation--DF 508--are under development. Copyright © 2013. Published by Elsevier Masson SAS.

  4. Two Small Molecules Restore Stability to a Subpopulation of the Cystic Fibrosis Transmembrane Conductance Regulator with the Predominant Disease-causing Mutation.

    PubMed

    Meng, Xin; Wang, Yiting; Wang, Xiaomeng; Wrennall, Joe A; Rimington, Tracy L; Li, Hongyu; Cai, Zhiwei; Ford, Robert C; Sheppard, David N

    2017-03-03

    Cystic fibrosis (CF) is caused by mutations that disrupt the plasma membrane expression, stability, and function of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl - channel. Two small molecules, the CFTR corrector lumacaftor and the potentiator ivacaftor, are now used clinically to treat CF, although some studies suggest that they have counteracting effects on CFTR stability. Here, we investigated the impact of these compounds on the instability of F508del-CFTR, the most common CF mutation. To study individual CFTR Cl - channels, we performed single-channel recording, whereas to assess entire CFTR populations, we used purified CFTR proteins and macroscopic CFTR Cl - currents. At 37 °C, low temperature-rescued F508del-CFTR more rapidly lost function in cell-free membrane patches and showed altered channel gating and current flow through open channels. Compared with purified wild-type CFTR, the full-length F508del-CFTR was about 10 °C less thermostable. Lumacaftor partially stabilized purified full-length F508del-CFTR and slightly delayed deactivation of individual F508del-CFTR Cl - channels. By contrast, ivacaftor further destabilized full-length F508del-CFTR and accelerated channel deactivation. Chronic (prolonged) co-incubation of F508del-CFTR-expressing cells with lumacaftor and ivacaftor deactivated macroscopic F508del-CFTR Cl - currents. However, at the single-channel level, chronic co-incubation greatly increased F508del-CFTR channel activity and temporal stability in most, but not all, cell-free membrane patches. We conclude that chronic lumacaftor and ivacaftor co-treatment restores stability in a small subpopulation of F508del-CFTR Cl - channels but that the majority remain destabilized. A fuller understanding of these effects and the characterization of the small F508del-CFTR subpopulation might be crucial for CF therapy development. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Correctors of the Major Cystic Fibrosis Mutant Interact through Membrane-Spanning Domains.

    PubMed

    Laselva, Onofrio; Molinski, Steven; Casavola, Valeria; Bear, Christine E

    2018-06-01

    The most common cystic fibrosis causing mutation is deletion of phenylalanine at position 508 (F508del), a mutation that leads to protein misassembly with defective processing. Small molecule corrector compounds: VX-809 or Corr-4a (C4) partially restores processing of the major mutant. These two prototypical corrector compounds cause an additive effect on F508del/cystic fibrosis transmembrane conductance regulator (CFTR) processing, and hence were proposed to act through distinct mechanisms: VX-809 stabilizing the first membrane-spanning domain (MSD) 1, and C4 acting on the second half of the molecule [consisting of MSD2 and/or nucleotide binding domain (NBD) 2]. We confirmed the effect of VX-809 in enhancing the stability of MSD1 and showed that it also allosterically modulates MSD2 when coexpressed with MSD1. We showed for the first time that C4 stabilizes the second half of the CFTR protein through its action on MSD2. Given the allosteric effect of VX-809 on MSD2, we were prompted to test the hypothesis that the two correctors interact in the full-length mutant protein. We did see evidence supporting their interaction in the full-length F508del-CFTR protein bearing secondary mutations targeting domain:domain interfaces. Disruption of the MSD1:F508del-NBD1 interaction (R170G) prevented correction by both compounds, pointing to the importance of this interface in processing. On the other hand, stabilization of the MSD2:F508del-NBD1 interface (by introducing R1070W) led to a synergistic effect of the compound combination on the total abundance of both the immature and mature forms of the protein. Together, these findings suggest that the two correctors interact in stabilizing the complex of MSDs in F508del-CFTR. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

  6. CFTR allelic heterogeneity in Mexican patients with cystic fibrosis: implications for molecular screening.

    PubMed

    Chávez-Saldaña, Margarita; Yokoyama, Emiy; Lezana, José Luis; Carnevale, Alessandra; Macías, Miguel; Vigueras, Rosa M; López, Marisol; Orozco, Lorena

    2010-01-01

    Cystic fibrosis, the most common autosomal recessive disorder, is caused by defects in the CF transmembrane conductance regulator gene (CFTR) that encodes a chloride channel. To date, over 1,800 mutations have been described related to the causative gene of CF, showing a variable frequency among populations. In a previous extensive analysis of the CFTR locus in 97 Mexican patients, 34 different mutations (75% of CF alleles) were found using several strategies for mutation screening; however, 63% had at least an uncharacterized allele. Despite the combined technologies used, there are still a great number of unknown mutations in the Mexican population. Screening of the CFTR gene to provide additional evidence of the mutational wide spectrum responsible for CF in Mexican patients. In this study, the number of unrelated CF patients was increased to 230, 133 new cases and the 97 previously reported to include 63% with at least an uncharacterized allele. Additional tools were used to improve the detection rate of CF mutations, such as a commercial kit for 36 mutations plus a single chain conformational polymorphism method and DNA sequencing. By using a combination of these strategies we characterized 77.7% of all the CF alleles, resulting in a total of 46 different mutations detected, including the identification of 12 additional mutations (p.R334W, p.A455E, c.3120+1G > A, c.3272-26A > G, c.711+1G > T, p.Q552X, p.W1282X, c.IVS8-5T, p.R1162X and p.R347P, p.D1152H and p.T1036N). Although these 12 mutations have been reported in other populations, they have not yet been reported in Mexican patients. This report shows that Mexico has one of the widest spectra of CFTR mutations worldwide. The knowledge of the ethnic and geographic distribution of CFTR mutations in this population will allow the development of more effective methods for diagnosis and treatment.

  7. Ion Channel Modulators in Cystic Fibrosis.

    PubMed

    Gentzsch, Martina; Mall, Marcus A

    2018-05-08

    Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and remains one of the most common life-shortening genetic diseases affecting the lung and other organs. CFTR functions as a cAMP-dependent anion channel that transports chloride and bicarbonate across epithelial surfaces and disruption of these ion transport processes plays a central role in the pathogenesis of CF. These findings provided the rationale for pharmacological modulation of ion transport, either by targeting mutant CFTR or alternative ion channels that can compensate for CFTR dysfunction, as a promising therapeutic approach. High throughput screening has supported the development of CFTR modulator compounds. CFTR correctors are designed to improve defective protein processing, trafficking and cell surface expression, whereas potentiators increase the activity of mutant CFTR at the cell surface. The approval of the first potentiator ivacaftor for the treatment of patients with specific CFTR mutations and, more recently the corrector lumacaftor in combination with ivacaftor for patients homozygous for the common F508del mutation, were major breakthroughs on the path to causal therapies for all patients with CF. In this review, we focus on recent developments and remaining challenges of CFTR-directed therapies, as well as modulators of other ion channels such as alternative chloride channels and the epithelial sodium channel (ENaC) as additional targets in CF lung disease. Further, we discuss how patient-derived precision medicine models may aid the translation of emerging next generation ion channel modulators from the laboratory to the clinic and tailor their use for optimal therapeutic benefits in individual patients with CF. Copyright © 2018. Published by Elsevier Inc.

  8. Cystic kidneys in fetal Walker-Warburg syndrome with POMT2 mutation: Intrafamilial phenotypic variability in four siblings and review of literature.

    PubMed

    Nabhan, Marwa M; ElKhateeb, Nour; Braun, Daniela A; Eun, Sungho; Saleem, Sahar N; YungGee, Heon; Hildebrandt, Friedhelm; Soliman, Neveen A

    2017-10-01

    Walker-Warburg syndrome (WWS) is a severe form of congenital muscular dystrophy secondary to α-dystroglycanopathy with muscle, brain, and eye abnormalities often leading to death in the first weeks of life. It is transmitted in an autosomal recessive pattern, and has been linked to at least 15 different genes; including protein O-mannosyltransferase 1 (POMT1), protein O-mannosyltransferase 2 (POMT2), protein O-mannose beta-1,2-N acetylglucosaminyltransferase (POMGNT1), fukutin (FKTN), isoprenoid synthase domain-containing protein (ISPD), and other genes. We report on a consanguineous family with four consecutive siblings affected by this condition with lethal outcome in three (still birth), and termination of the fourth pregnancy based on antenatal MRI identification of brain and kidney anomalies that heralded proper and deep clinical phenotyping. The diagnosis of WWS was suggested based on the unique collective phenotype comprising brain anomalies in the form of lissencephaly, subcortical/subependymal heterotopia, and cerebellar hypoplasia shared by all four siblings; microphthalmia in one sibling; and large cystic kidneys in the fetus and another sibling. Other unshared neurological abnormalities included hydrocephalus and Dandy-Walker malformation. Whole exome sequencing of the fetus revealed a highly conserved missense mutation in POMT2 that is known to cause WWS with brain and eye anomalies.In conclusion, the heterogeneous clinical presentation in the four affected conceptions with POMT2 mutation expands the current clinical spectrum of POMT2-associated WWS to include large cystic kidneys; and confirms intra-familial variability in terms of brain, kidney, and eye anomalies. © 2017 Wiley Periodicals, Inc.

  9. Cystic fibrosis: terminology and diagnostic algorithms

    PubMed Central

    De Boeck, K; Wilschanski, M; Castellani, C; Taylor, C; Cuppens, H; Dodge, J; Sinaasappel, M

    2006-01-01

    There is great heterogeneity in the clinical manifestations of cystic fibrosis (CF). Some patients may have all the classical manifestations of CF from infancy and have a relatively poor prognosis, while others have much milder or even atypical disease manifestations and still carry mutations on each of the CFTR genes. It is important to distinguish between these categories of patients. The European Diagnostic Working Group proposes the following terminology. Patients are diagnosed with classic or typical CF if they have one or more phenotypic characteristics and a sweat chloride concentration of >60 mmol/l. The vast majority of CF patients fall into this category. Usually one established mutation causing CF can be identified on each CFTR gene. Patients with classic CF can have exocrine pancreatic insufficiency or pancreatic sufficiency. The disease can have a severe course with rapid progression of symptoms or a milder course with very little deterioration over time. Patients with non‐classic or atypical CF have a CF phenotype in at least one organ system and a normal (<30 mmol/l) or borderline (30–60 mmol/l) sweat chloride level. In these patients confirmation of the diagnosis of CF requires detection of one disease causing mutation on each CFTR gene or direct quantification of CFTR dysfunction by nasal potential difference measurement. Non‐classic CF includes patients with multiorgan or single organ involvement. Most of these patients have exocrine pancreatic sufficiency and milder lung disease. Algorithms for a structured diagnostic process are proposed. PMID:16384879

  10. Cystic fibrosis: terminology and diagnostic algorithms.

    PubMed

    De Boeck, K; Wilschanski, M; Castellani, C; Taylor, C; Cuppens, H; Dodge, J; Sinaasappel, M

    2006-07-01

    There is great heterogeneity in the clinical manifestations of cystic fibrosis (CF). Some patients may have all the classical manifestations of CF from infancy and have a relatively poor prognosis, while others have much milder or even atypical disease manifestations and still carry mutations on each of the CFTR genes. It is important to distinguish between these categories of patients. The European Diagnostic Working Group proposes the following terminology. Patients are diagnosed with classic or typical CF if they have one or more phenotypic characteristics and a sweat chloride concentration of >60 mmol/l. The vast majority of CF patients fall into this category. Usually one established mutation causing CF can be identified on each CFTR gene. Patients with classic CF can have exocrine pancreatic insufficiency or pancreatic sufficiency. The disease can have a severe course with rapid progression of symptoms or a milder course with very little deterioration over time. Patients with non-classic or atypical CF have a CF phenotype in at least one organ system and a normal (<30 mmol/l) or borderline (30-60 mmol/l) sweat chloride level. In these patients confirmation of the diagnosis of CF requires detection of one disease causing mutation on each CFTR gene or direct quantification of CFTR dysfunction by nasal potential difference measurement. Non-classic CF includes patients with multiorgan or single organ involvement. Most of these patients have exocrine pancreatic sufficiency and milder lung disease. Algorithms for a structured diagnostic process are proposed.

  11. Assessing the residual CFTR gene expression in human nasal epithelium cells bearing CFTR splicing mutations causing cystic fibrosis

    PubMed Central

    Masvidal, Laia; Igreja, Susana; Ramos, Maria D; Alvarez, Antoni; de Gracia, Javier; Ramalho, Anabela; Amaral, Margarida D; Larriba, Sara; Casals, Teresa

    2014-01-01

    The major purpose of the present study was to quantify correctly spliced CFTR transcripts in human nasal epithelial cells from cystic fibrosis (CF) patients carrying the splicing mutations c.580-1G>T (712-1G>T) and c.2657+5G>A (2789+5G>A) and to assess the applicability of this model in CFTR therapeutic approaches. We performed the relative quantification of CFTR mRNA by reverse transcription quantitative PCR (RT-qPCR) of these splicing mutations in four groups (wild type, CF-F508del controls, CF patients and CF carriers) of individuals. In addition, in vitro assays using minigene constructs were performed to evaluate the effect of a new CF complex allele c.[2657+5G>A; 2562T>G]. Ex vivo qPCR data show that the primary consequence of both mutations at the RNA level is the skipping of their neighboring exon (6 and 16, respectively). The CFTR minigenes results mimicked the ex vivo data, as exon 16 skipping is the main aberrant transcript, and the correctly spliced transcript level was observed in a similar proportion when the c.2657+5G>A mutation is present. In summary, we provide evidence that ex vivo quantitative transcripts analysis using RT/qPCR is a robust technology that could be useful for measuring the efficacy of therapeutic approaches that attempt to achieve an increase in CFTR gene expression. PMID:24129438

  12. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5900 Cystic fibrosis transmembrane conductance regulator (CFTR...

  13. Potentiator Ivacaftor Abrogates Pharmacological Correction of ΔF508 CFTR in Cystic Fibrosis

    PubMed Central

    Cholon, Deborah M.; Quinney, Nancy L.; Fulcher, M. Leslie; Esther, Charles R.; Das, Jhuma; Dokholyan, Nikolay V.; Randell, Scott H.; Boucher, Richard C.; Gentzsch, Martina

    2014-01-01

    Cystic Fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR). Newly developed “correctors” such as lumacaftor (VX-809) that improve CFTR maturation and trafficking and “potentiators” such as ivacaftor (VX-770) that enhance channel activity may provide important advances in CF therapy. Although VX-770 has demonstrated substantial clinical efficacy in the small subset of patients with a mutation (G551D) that affects only channel activity, a single compound is not sufficient to treat patients with the more common CFTR mutation, ΔF508. Thus, patients with ΔF508 will likely require treatment with both correctors and potentiators to achieve clinical benefit. However, whereas the effectiveness of acute treatment with this drug combination has been demonstrated in vitro, the impact of chronic therapy has not been established. In studies of human primary airway epithelial cells, we found that both acute and chronic treatment with VX-770 improved CFTR function in cells with the G551D mutation, consistent with clinical studies. In contrast, chronic VX-770 administration caused a dose-dependent reversal of VX-809-mediated CFTR correction in ΔF508 homozygous cultures. This result reflected the destabilization of corrected ΔF508 CFTR by VX-770, dramatically increasing its turnover rate. Chronic VX-770 treatment also reduced mature wild-type CFTR levels and function. These findings demonstrate that chronic treatment with CFTR potentiators and correctors may have unexpected effects that cannot be predicted from short-term studies. Combining of these drugs to maximize rescue of ΔF508 CFTR may require changes in dosing and/or development of new potentiator compounds that do not interfere with CFTR stability. PMID:25101886

  14. A G542X cystic fibrosis mouse model for examining nonsense mutation directed therapies.

    PubMed

    McHugh, Daniel R; Steele, Miarasa S; Valerio, Dana M; Miron, Alexander; Mann, Rachel J; LePage, David F; Conlon, Ronald A; Cotton, Calvin U; Drumm, Mitchell L; Hodges, Craig A

    2018-01-01

    Nonsense mutations are present in 10% of patients with CF, produce a premature termination codon in CFTR mRNA causing early termination of translation, and lead to lack of CFTR function. There are no currently available animal models which contain a nonsense mutation in the endogenous Cftr locus that can be utilized to test nonsense mutation therapies. In this study, we create a CF mouse model carrying the G542X nonsense mutation in Cftr using CRISPR/Cas9 gene editing. The G542X mouse model has reduced Cftr mRNA levels, demonstrates absence of CFTR function, and displays characteristic manifestations of CF mice such as reduced growth and intestinal obstruction. Importantly, CFTR restoration is observed in G542X intestinal organoids treated with G418, an aminoglycoside with translational readthrough capabilities. The G542X mouse model provides an invaluable resource for the identification of potential therapies of CF nonsense mutations as well as the assessment of in vivo effectiveness of these potential therapies targeting nonsense mutations.

  15. Evolution of the Pseudomonas aeruginosa Aminoglycoside Mutational Resistome In Vitro and in the Cystic Fibrosis Setting.

    PubMed

    López-Causapé, Carla; Rubio, Rosa; Cabot, Gabriel; Oliver, Antonio

    2018-04-01

    Inhaled administration of high doses of aminoglycosides is a key maintenance treatment of Pseudomonas aeruginosa chronic respiratory infections in cystic fibrosis (CF). We analyzed the dynamics and mechanisms of stepwise high-level tobramycin resistance development in vitro and compared the results with those of isogenic pairs of susceptible and resistant clinical isolates. Resistance development correlated with fusA1 mutations in vitro and in vivo. pmrB mutations, conferring polymyxin resistance, were also frequently selected in vitro In contrast, mutational overexpression of MexXY, a hallmark of aminoglycoside resistance in CF, was not observed in in vitro evolution experiments. Copyright © 2018 American Society for Microbiology.

  16. Disease expression in Usher syndrome caused by VLGR1 gene mutation (USH2C) and comparison with USH2A phenotype.

    PubMed

    Schwartz, Sharon B; Aleman, Tomas S; Cideciyan, Artur V; Windsor, Elizabeth A M; Sumaroka, Alexander; Roman, Alejandro J; Rane, Tej; Smilko, Elaine E; Bennett, Jean; Stone, Edwin M; Kimberling, William J; Liu, Xue-Zhong; Jacobson, Samuel G

    2005-02-01

    To investigate the retinal disease expression in USH2C, the subtype of Usher syndrome type 2 recently shown to be caused by mutation in the VLGR1 gene, and compare results with those from USH2A, a more common cause of Usher syndrome. Three siblings with USH2C and 14 patients with USH2A were studied. Visual function was measured by kinetic perimetry, static chromatic perimetry, and electroretinography (ERG). Central retinal microstructure was studied with optical coherence tomography (OCT). The siblings with VLGR1 mutation showed abnormal photoreceptor-mediated function in all retinal regions, and there was greater rod than cone dysfunction. USH2A had a wider spectrum of disease expression and included patients with normal function in some retinal regions. When abnormalities were detected, there was more rod than cone dysfunction. Retinal microstructure in both USH2C and USH2A shared the abnormality of loss of outer nuclear layer thickness. Central retinal structure in both genotypes was complicated by cystic macular lesions. A coincidental finding in an USH2C patient was that oral intake of antihistamines was associated with temporary resolution of the macular cystic change. USH2C and USH2A manifest photoreceptor disease with rod- and cone-mediated visual losses and thinning of the outer nuclear layer. An orderly progression through disease stages was estimated from cross-sectional and limited longitudinal data. Intrafamilial and interfamilial variation in retinal severity in USH2A, however, suggests that genetic or nongenetic modifiers may be involved in the disease expression.

  17. Convergent evolution and adaptation of Pseudomonas aeruginosa within patients with cystic fibrosis.

    PubMed

    Marvig, Rasmus Lykke; Sommer, Lea Mette; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Little is known about how within-host evolution compares between genotypically different strains of the same pathogenic species. We sequenced the whole genomes of 474 longitudinally collected clinical isolates of Pseudomonas aeruginosa sampled from 34 children and young individuals with cystic fibrosis. Our analysis of 36 P. aeruginosa lineages identified convergent molecular evolution in 52 genes. This list of genes suggests a role in host adaptation for remodeling of regulatory networks and central metabolism, acquisition of antibiotic resistance and loss of extracellular virulence factors. Furthermore, we find an ordered succession of mutations in key regulatory networks. Accordingly, mutations in downstream transcriptional regulators were contingent upon mutations in upstream regulators, suggesting that remodeling of regulatory networks might be important in adaptation. The characterization of genes involved in host adaptation may help in predicting bacterial evolution in patients with cystic fibrosis and in the design of future intervention strategies.

  18. Cysteamine re-establishes the clearance of Pseudomonas aeruginosa by macrophages bearing the cystic fibrosis-relevant F508del-CFTR mutation.

    PubMed

    Ferrari, Eleonora; Monzani, Romina; Villella, Valeria R; Esposito, Speranza; Saluzzo, Francesca; Rossin, Federica; D'Eletto, Manuela; Tosco, Antonella; De Gregorio, Fabiola; Izzo, Valentina; Maiuri, Maria C; Kroemer, Guido; Raia, Valeria; Maiuri, Luigi

    2017-01-12

    Cystic fibrosis (CF), the most common lethal monogenic disease in Caucasians, is characterized by recurrent bacterial infections and colonization, mainly by Pseudomonas aeruginosa, resulting in unresolved airway inflammation. CF is caused by mutations in the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein, which functions as a chloride channel in epithelial cells, macrophages, and other cell types. Impaired bacterial handling by macrophages is a feature of CF airways, although it is still debated how defective CFTR impairs bacterial killing. Recent evidence indicates that a defective autophagy in CF macrophages leads to alterations of bacterial clearance upon infection. Here we use bone marrow-derived macrophages from transgenic mice to provide the genetic proof that defective CFTR compromises both uptake and clearance of internalized Pseudomonas aeruginosa. We demonstrate that the proteostasis regulator cysteamine, which rescues the function of the most common F508del-CFTR mutant and hence reduces lung inflammation in CF patients, can also repair the defects of CF macrophages, thus restoring both bacterial internalization and clearance through a process that involves upregulation of the pro-autophagic protein Beclin 1 and re-establishment of the autophagic pathway. Altogether these results indicate that cysteamine restores the function of several distinct cell types, including that of macrophages, which might contribute to its beneficial effects on CF.

  19. Cysteamine re-establishes the clearance of Pseudomonas aeruginosa by macrophages bearing the cystic fibrosis-relevant F508del-CFTR mutation

    PubMed Central

    Ferrari, Eleonora; Monzani, Romina; Villella, Valeria R; Esposito, Speranza; Saluzzo, Francesca; Rossin, Federica; D'Eletto, Manuela; Tosco, Antonella; De Gregorio, Fabiola; Izzo, Valentina; Maiuri, Maria C; Kroemer, Guido; Raia, Valeria; Maiuri, Luigi

    2017-01-01

    Cystic fibrosis (CF), the most common lethal monogenic disease in Caucasians, is characterized by recurrent bacterial infections and colonization, mainly by Pseudomonas aeruginosa, resulting in unresolved airway inflammation. CF is caused by mutations in the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein, which functions as a chloride channel in epithelial cells, macrophages, and other cell types. Impaired bacterial handling by macrophages is a feature of CF airways, although it is still debated how defective CFTR impairs bacterial killing. Recent evidence indicates that a defective autophagy in CF macrophages leads to alterations of bacterial clearance upon infection. Here we use bone marrow-derived macrophages from transgenic mice to provide the genetic proof that defective CFTR compromises both uptake and clearance of internalized Pseudomonas aeruginosa. We demonstrate that the proteostasis regulator cysteamine, which rescues the function of the most common F508del-CFTR mutant and hence reduces lung inflammation in CF patients, can also repair the defects of CF macrophages, thus restoring both bacterial internalization and clearance through a process that involves upregulation of the pro-autophagic protein Beclin 1 and re-establishment of the autophagic pathway. Altogether these results indicate that cysteamine restores the function of several distinct cell types, including that of macrophages, which might contribute to its beneficial effects on CF. PMID:28079883

  20. Impact of cystic fibrosis disease on archaea and bacteria composition of gut microbiota.

    PubMed

    Miragoli, Francesco; Federici, Sara; Ferrari, Susanna; Minuti, Andrea; Rebecchi, Annalisa; Bruzzese, Eugenia; Buccigrossi, Vittoria; Guarino, Alfredo; Callegari, Maria Luisa

    2017-02-01

    Cystic fibrosis is often associated with intestinal inflammation due to several factors, including altered gut microbiota composition. In this study, we analyzed the fecal microbiota among patients with cystic fibrosis of 10-22 years of age, and compared the findings with age-matched healthy subjects. The participating patients included 14 homozygotes and 14 heterozygotes with the delF508 mutation, and 2 heterozygotes presenting non-delF508 mutations. We used PCR-DGGE and qPCR to analyze the presence of bacteria, archaea and sulfate-reducing bacteria. Overall, our findings confirmed disruption of the cystic fibrosis gut microbiota. Principal component analysis of the qPCR data revealed no differences between homozygotes and heterozygotes, while both groups were distinct from healthy subjects who showed higher biodiversity. Archaea were under the detection limit in all homozygotes subjects, whereas methanogens were detected in 62% of both cystic fibrosis heterozygotes and healthy subjects. Our qPCR results revealed a low frequency of sulfate-reducing bacteria in the homozygote (13%) and heterozygote (13%) patients with cystic fibrosis compared with healthy subjects (87.5%). This is a pioneer study showing that patients with cystic fibrosis exhibit significant reduction of H 2 -consuming microorganisms, which could increase hydrogen accumulation in the colon and the expulsion of this gas through non-microbial routes. © FEMS 2016.

  1. Is there evidence for correct diagnosis in cystic fibrosis registries?

    PubMed

    Thomas, Muriel; Lemonnier, Lydie; Gulmans, Vincent; Naehrlich, Lutz; Vermeulen, François; Cuppens, Harry; Castellani, Carlo; Norek, Aleksandra; De Boeck, Kris

    2014-05-01

    Cystic fibrosis (CF) spans a wide spectrum. Therefore, benchmarking between registries implies comparing similar cohorts. Explore patient characteristics in Belgian (B), French (F), German (G) and Dutch (NL) registries (total N=13,122) and determine whether they fulfill predefined diagnostic criteria. Using as case definition sweat chloride >60mmol/L or 2 CFTR mutations identified, CF diagnosis was not documented in 2.8, 5.7, 6.5 and 21.6% of subjects in the F, B, NL, and G registries. Restricting CFTR mutation interpretation to 124 CF causing mutations in CFTR2, these numbers rose to 10.5, 10.4, 14.5 and 24.3% respectively. Excluding these subjects impacted on outcomes. The impact differed between countries; the largest changes seen were a decrease in % adults from 51.9 to 47.8% in G, a decrease in % pancreas sufficiency from 17.0 to 13.0 in F, an increase in % homozygous for F508del from 55.3 to 63.7 in NL and a decrease of % with sweat chloride ≤60mmol/L from 8.4 to 1.1 in B. CF diagnosis is not documented in 10 to 24% of patients included in CF registries. Excluding these patients for analyses leads to significant changes in outcomes. © 2013.

  2. Ivacaftor and symptoms of extra-oesophageal reflux in patients with cystic fibrosis and G551D mutation.

    PubMed

    Zeybel, Gemma L; Pearson, Jeffrey P; Krishnan, Amaran; Bourke, Stephen J; Doe, Simon; Anderson, Alan; Faruqi, Shoaib; Morice, Alyn H; Jones, Rhys; McDonnell, Melissa; Zeybel, Mujdat; Dettmar, Peter W; Brodlie, Malcolm; Ward, Chris

    2017-01-01

    Extra-oesophageal reflux (EOR) may lead to microaspiration in patients with cystic fibrosis (CF), a probable cause of deteriorating lung function. Successful clinical trials of ivacaftor highlight opportunities to understand EOR in a real world study. Data from 12 patients with CF and the G551D mutation prescribed ivacaftor (150mg bd) was collected at baseline, 6, 26 and 52weeks. The changes in symptoms of EOR were assessed by questionnaire (reflux symptom index (RSI) and Hull airway reflux questionnaire (HARQ)). Six patients presented EOR at baseline (RSI >13; median 13; range 2-29) and 5 presented airway reflux (HARQ >13; median 12; range 3 to 33). Treatment with ivacaftor was associated with a significant reduction of EOR symptoms (P<0∙04 versus baseline) denoted by the reflux symptom index and Hull airway reflux questionnaire. Ivacaftor treatment was beneficial for patients with symptoms of EOR, thought to be a precursor to microaspiration. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  3. Pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis in a child with 711+G>T/IVS8-5T mutation: a new face of an old disease.

    PubMed

    Tinsa, Faten; Hadj Fredj, Sondes; Bel Hadj, Imen; Khalsi, Fatma; Abdelhak, Sonia; Boussetta, Khadija; Messaoud, Taieb

    2017-08-01

    Pseudo-Bartter syndrome (PBS) describes an uncommon complication of cystic fibrosis leading to hypochloraemic, hypokalaemic metabolic alkalosis. PBS as the sole manifestation of cystic fibrosis in children is extremely rare and has never been described in patients carrying 5T variant. We report a clinical, biochemical and genetic study of a four year-old boy presenting a pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis. All 27 exons and the flanking intron regions of the CFTR gene were analysed by PCR and direct sequencing. Direct sequencing was also used to analyse TG m T n and M470V polymorphisms in the patient and his parents. Two sweat tests were abnormal with elevated chloride levels at 78 and 88 mmol/L. DNA sequencing revealed a heterozygous mutation 711+1 G>T and an IVS8-T5 allele. The mutation 711+1 G>T is in trans with the IVS8-T5-TG11 allele and the child carried M470/V470 genotype. To the best of our knowledge, the genotype 711+1 G>T /IVS8-5T found in our patient is described for the first time. The role of TG11-5T-V470 allele in cases of cystic fibrosis with PB syndrome remains to be determined.

  4. Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in allergic bronchopulmonary aspergillosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, P.W.; Hamosh, A.; Macek, M. Jr.

    The etiology of allergic bronchopulmonary aspergillosis (ABPA) is not well understood. A clinical phenotype resembling the pulmonary disease seen in cystic fibrosis (CF) patients can occur in some individuals with ABPA. Reports of familial occurrence of ABPA and increased incidence in CF patients suggest a possible genetic basis for the disease. To test this possibility, the entire coding region of the cystic fibrosis transmembrane regulator (CFTR) gene was analyzed in 11 individuals who met strict criteria for the diagnosis of ABPA and had normal sweat electrolytes ({le}40 mmol/liter). One patient carried two CF mutations ({Delta}F508/R347H), and five were found tomore » carry one CF mutation (four {Delta}F508; one R117H). The frequency of the {Delta}F508 mutation in patients with ABPA was significantly higher than in 53 Caucasian patients with chronic bronchitis (P < .0003) and the general population (P < .003). These results suggest that CFTR plays an etiologic role in a subset of ABPA patients. 54 refs., 2 tabs.« less

  5. Binding screen for cystic fibrosis transmembrane conductance regulator correctors finds new chemical matter and yields insights into cystic fibrosis therapeutic strategy.

    PubMed

    Hall, Justin D; Wang, Hong; Byrnes, Laura J; Shanker, Suman; Wang, Kelong; Efremov, Ivan V; Chong, P Andrew; Forman-Kay, Julie D; Aulabaugh, Ann E

    2016-02-01

    The most common mutation in cystic fibrosis (CF) patients is deletion of F508 (ΔF508) in the first nucleotide binding domain (NBD1) of the CF transmembrane conductance regulator (CFTR). ΔF508 causes a decrease in the trafficking of CFTR to the cell surface and reduces the thermal stability of isolated NBD1; it is well established that both of these effects can be rescued by additional revertant mutations in NBD1. The current paradigm in CF small molecule drug discovery is that, like revertant mutations, a path may exist to ΔF508 CFTR correction through a small molecule chaperone binding to NBD1. We, therefore, set out to find small molecule binders of NBD1 and test whether it is possible to develop these molecules into potent binders that increase CFTR trafficking in CF-patient-derived human bronchial epithelial cells. Several fragments were identified that bind NBD1 at either the CFFT-001 site or the BIA site. However, repeated attempts to improve the affinity of these fragments resulted in only modest gains. Although these results cannot prove that there is no possibility of finding a high-affinity small molecule binder of NBD1, they are discouraging and lead us to hypothesize that the nature of these two binding sites, and isolated NBD1 itself, may not contain the features needed to build high-affinity interactions. Future work in this area may, therefore, require constructs including other domains of CFTR in addition to NBD1, if high-affinity small molecule binding is to be achieved. © 2016 The Protein Society.

  6. Survival of Patients with Cystic Fibrosis Depending on Mutation Type and Nutritional Status.

    PubMed

    Szwed, A; John, A; Goździk-Spychalska, J; Czaiński, W; Czerniak, W; Ratajczak, J; Batura-Gabryel, H

    2018-01-01

    The purpose of the study was to evaluate the influence of nutrition and of the severity of mutation type on survival rate in cystic fibrosis (CF) patients. Data were longitudinally collected from 60 hospitalized adult CF patients, aged 18-50. The variables consisted of body mass index (BMI) ratio, Cole's BMI cut-off points, severity of mutation type, and survival rate of CF patients. We found that the mean BMI was strongly associated with the severity of mutation type and was significantly lower in patients with severe mutations of grade I and II. The mutation type significantly affected the patients' survival rate; survival was greater in patients with mild and undefined mutation types. The BMI and Cole's cut-off points also had a significant influence on survival rate. CF patients, who suffered from malnutrition and emaciation, had a shorter survival rate than those with proper nutritional status. In conclusion, the study findings confirmed a significant effect of nutritional status and of mutation type on survival rate of CF patients.

  7. The Mutational Landscape of Adenoid Cystic Carcinoma

    PubMed Central

    Ho, Allen S.; Kannan, Kasthuri; Roy, David M.; Morris, Luc G.T.; Ganly, Ian; Katabi, Nora; Ramaswami, Deepa; Walsh, Logan A.; Eng, Stephanie; Huse, Jason T.; Zhang, Jianan; Dolgalev, Igor; Huberman, Kety; Heguy, Adriana; Viale, Agnes; Drobnjak, Marija; Leversha, Margaret A.; Rice, Christine E.; Singh, Bhuvanesh; Iyer, N. Gopalakrishna; Leemans, C. Rene; Bloemena, Elisabeth; Ferris, Robert L.; Seethala, Raja R.; Gross, Benjamin E.; Liang, Yupu; Sinha, Rileen; Peng, Luke; Raphael, Benjamin J.; Turcan, Sevin; Gong, Yongxing; Schultz, Nikolaus; Kim, Seungwon; Chiosea, Simion; Shah, Jatin P.; Sander, Chris; Lee, William; Chan, Timothy A.

    2013-01-01

    Adenoid cystic carcinomas (ACCs) are among the most enigmatic of human malignancies. These aggressive salivary cancers frequently recur and metastasize despite definitive treatment, with no known effective chemotherapy regimen. Here, we determined the ACC mutational landscape and report the exome or whole genome sequences of 60 ACC tumor/normal pairs. These analyses revealed a low exonic somatic mutation rate (0.31 non-silent events/megabase) and wide mutational diversity. Interestingly, mutations selectively involved chromatin state regulators, such as SMARCA2, CREBBP, and KDM6A, suggesting aberrant epigenetic regulation in ACC oncogenesis. Mutations in genes central to DNA damage and protein kinase A signaling also implicate these processes. We observed MYB-NFIB translocations and somatic mutations in MYB-associated genes, solidifying these aberrations as critical events. Lastly, we identified recurrent mutations in the FGF/IGF/PI3K pathway that may potentially offer new avenues for therapy (30%). Collectively, our observations establish a molecular foundation for understanding and exploring new treatments for ACC. PMID:23685749

  8. The suitability of matrix assisted laser desorption/ionization time of flight mass spectrometry in a laboratory developed test using cystic fibrosis carrier screening as a model.

    PubMed

    Farkas, Daniel H; Miltgen, Nicholas E; Stoerker, Jay; van den Boom, Dirk; Highsmith, W Edward; Cagasan, Lesley; McCullough, Ron; Mueller, Reinhold; Tang, Lin; Tynan, John; Tate, Courtney; Bombard, Allan

    2010-09-01

    We designed a laboratory developed test (LDT) by using an open platform for mutation/polymorphism detection. Using a 108-member (mutation plus variant) cystic fibrosis carrier screening panel as a model, we completed the last phase of LDT validation by using matrix-assisted laser desorption/ionization time of flight mass spectrometry. Panel customization was accomplished via specific amplification primer and extension probe design. Amplified genomic DNA was subjected to allele specific, single base extension endpoint analysis by mass spectrometry for inspection of the cystic fibrosis transmembrane regulator gene (NM_000492.3). The panel of mutations and variants was tested against 386 blinded samples supplied by "authority" laboratories highly experienced in cystic fibrosis transmembrane regulator genotyping; >98% concordance was observed. All discrepant and discordant results were resolved satisfactorily. Taken together, these results describe the concluding portion of the LDT validation process and the use of mass spectrometry to detect a large number of complex reactions within a single run as well as its suitability as a platform appropriate for interrogation of scores to hundreds of targets.

  9. Sources of Variation in Sweat Chloride Measurements in Cystic Fibrosis.

    PubMed

    Collaco, Joseph M; Blackman, Scott M; Raraigh, Karen S; Corvol, Harriet; Rommens, Johanna M; Pace, Rhonda G; Boelle, Pierre-Yves; McGready, John; Sosnay, Patrick R; Strug, Lisa J; Knowles, Michael R; Cutting, Garry R

    2016-12-01

    Expanding the use of cystic fibrosis transmembrane conductance regulator (CFTR) potentiators and correctors for the treatment of cystic fibrosis (CF) requires precise and accurate biomarkers. Sweat chloride concentration provides an in vivo assessment of CFTR function, but it is unknown the degree to which CFTR mutations account for sweat chloride variation. To estimate potential sources of variation for sweat chloride measurements, including demographic factors, testing variability, recording biases, and CFTR genotype itself. A total of 2,639 sweat chloride measurements were obtained in 1,761 twins/siblings from the CF Twin-Sibling Study, French CF Modifier Gene Study, and Canadian Consortium for Genetic Studies. Variance component estimation was performed by nested mixed modeling. Across the tested CF population as a whole, CFTR gene mutations were found to be the primary determinant of sweat chloride variability (56.1% of variation) with contributions from variation over time (e.g., factors related to testing on different days; 13.8%), environmental factors (e.g., climate, family diet; 13.5%), other residual factors (e.g., test variability; 9.9%), and unique individual factors (e.g., modifier genes, unique exposures; 6.8%) (likelihood ratio test, P < 0.001). Twin analysis suggested that modifier genes did not play a significant role because the heritability estimate was negligible (H 2  = 0; 95% confidence interval, 0.0-0.35). For an individual with CF, variation in sweat chloride was primarily caused by variation over time (58.1%) with the remainder attributable to residual/random factors (41.9%). Variation in the CFTR gene is the predominant cause of sweat chloride variation; most of the non-CFTR variation is caused by testing variability and unique environmental factors. If test precision and accuracy can be improved, sweat chloride measurement could be a valuable biomarker for assessing response to therapies directed at mutant CFTR.

  10. Sources of Variation in Sweat Chloride Measurements in Cystic Fibrosis

    PubMed Central

    Blackman, Scott M.; Raraigh, Karen S.; Corvol, Harriet; Rommens, Johanna M.; Pace, Rhonda G.; Boelle, Pierre-Yves; McGready, John; Sosnay, Patrick R.; Strug, Lisa J.; Knowles, Michael R.; Cutting, Garry R.

    2016-01-01

    Rationale: Expanding the use of cystic fibrosis transmembrane conductance regulator (CFTR) potentiators and correctors for the treatment of cystic fibrosis (CF) requires precise and accurate biomarkers. Sweat chloride concentration provides an in vivo assessment of CFTR function, but it is unknown the degree to which CFTR mutations account for sweat chloride variation. Objectives: To estimate potential sources of variation for sweat chloride measurements, including demographic factors, testing variability, recording biases, and CFTR genotype itself. Methods: A total of 2,639 sweat chloride measurements were obtained in 1,761 twins/siblings from the CF Twin-Sibling Study, French CF Modifier Gene Study, and Canadian Consortium for Genetic Studies. Variance component estimation was performed by nested mixed modeling. Measurements and Main Results: Across the tested CF population as a whole, CFTR gene mutations were found to be the primary determinant of sweat chloride variability (56.1% of variation) with contributions from variation over time (e.g., factors related to testing on different days; 13.8%), environmental factors (e.g., climate, family diet; 13.5%), other residual factors (e.g., test variability; 9.9%), and unique individual factors (e.g., modifier genes, unique exposures; 6.8%) (likelihood ratio test, P < 0.001). Twin analysis suggested that modifier genes did not play a significant role because the heritability estimate was negligible (H2 = 0; 95% confidence interval, 0.0–0.35). For an individual with CF, variation in sweat chloride was primarily caused by variation over time (58.1%) with the remainder attributable to residual/random factors (41.9%). Conclusions: Variation in the CFTR gene is the predominant cause of sweat chloride variation; most of the non-CFTR variation is caused by testing variability and unique environmental factors. If test precision and accuracy can be improved, sweat chloride measurement could be a valuable biomarker for assessing response to therapies directed at mutant CFTR. PMID:27258095

  11. Antenatal testing for cystic fibrosis in Cuba, 1988-2011.

    PubMed

    Collazo, Teresa; López, Ixchel; Clark, Yulia; Piloto, Yaixa; González, Laura; Gómez, Manuel; García, Marileivis; Reyes, Lidice; Rodríguez, Fidel

    2014-01-01

    INTRODUCTION Cystic fibrosis is a multisystem autosomal recessive disease with wide variability in clinical severity. It is incurable and characterized by elevated and premature mortality, as well as poor quality of life. Its frequency, lethality and devastating impact on both the physical and psychological wellbeing of patients and their families, make it a serious health problem. Its frequency in Cuba is 1 in 9862 live births, where marked molecular heterogeneity of the CFTR gene makes molecular diagnosis difficult. Six mutations have been identified that together enable molecular characterization of only 55.5% of cystic fibrosis chromosomes. This paper presents national results of antenatal diagnostic testing, using direct and indirect methods, for detection of cystic fibrosis. OBJECTIVE Characterize the Cuban public health system's experience with antenatal molecular testing for cystic fibrosis from 1988 through 2011. METHODS A retrospective descriptive study was conducted with results of antenatal diagnostic testing of amniotic fluid, performed nationwide from 1988 through 2011, for 108 fetuses of couples with some risk of having children affected by cystic fibrosis, who requested testing. Polymerase chain reaction detected mutations p.F508del, p.G542X, p.R1162X, p.R334W, p.R553X and c.3120+1G>A, and markers XV2C and KM19. Data were analyzed using absolute frequencies and percentages, and presented in tables. RESULTS For 93 cases (86.1%), testing for cystic fibrosis was done using direct analysis of mutations p.F508del, p.G542X, p.R1162X, p.R334W, p.R553X and c.3120+1G>A; five cases (4.6%) were tested indirectly using markers XV2C/Taq I and KM19/Pst I; and 10 (9.3%) were tested using a combination of the two methods. A total of 72 diagnoses (66.7% of studies done) were concluded, of which there were 20 healthy fetuses, 16 affected, 27 carrier, and 9 who were either healthy or carriers of an unknown mutation. CONCLUSIONS Direct or indirect molecular study was successfully used in over half of antenatal tests requested by couples throughout Cuba at risk of having children affected by cystic fibrosis, which is of great social value because of CF's burden on affected persons and their families.

  12. Clinical characterization and diagnosis of cystic fibrosis through exome sequencing in Chinese infants with Bartter-syndrome-like hypokalemia alkalosis.

    PubMed

    Qiu, Liru; Yang, Fengjie; He, Yonghua; Yuan, Huiqing; Zhou, Jianhua

    2018-03-09

    Cystic fibrosis (CF) is a fatal autosomal-recessive disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. CF is characterized by recurrent pulmonary infection with obstructive pulmonary disease. CF is common in the Caucasian population but is rare in the Chinese population. The symptoms of early-stage CF are often untypical and may sometimes manifest as Bartter syndrome (BS)-like hypokalemic alkalosis. Therefore, the ability of doctors to differentiate CF from BS-like hypokalemic alkalosis in Chinese infants is a great challenge in the timely and accurate diagnosis of CF. In China, sporadic CF has not been diagnosed in children younger than three years of age to date. Three infants, who were initially admitted to our hospital over the period of June 2013 to September 2014 with BS-like hypokalemic alkalosis, were diagnosed with CF through exome sequencing and sweat chloride measurement. The compound heterozygous mutations of the CFTR gene were detected in two infants, and a homozygous missense mutation was found in one infant. Among the six identified mutations, two are novel point mutations (c.1526G > C and c.3062C > T) that are possibly pathogenic. The three infants are the youngest Chinese patients to have been diagnosed with sporadic CF at a very early stage. Follow-up examination showed that all of the cases remained symptom-free after early intervention, indicating the potential benefit of very early diagnosis and timely intervention in children with CF. Our results demonstrate the necessity of distinguishing CF from BS in Chinese infants with hypokalemic alkalosis and the significant diagnostic value of powerful exome sequencing for rare genetic diseases. Furthermore, our findings expand the CFTR mutation spectrum associated with CF.

  13. Lumacaftor-Ivacaftor in Patients with Cystic Fibrosis Homozygous for Phe508del CFTR.

    PubMed

    Wainwright, Claire E; Elborn, J Stuart; Ramsey, Bonnie W; Marigowda, Gautham; Huang, Xiaohong; Cipolli, Marco; Colombo, Carla; Davies, Jane C; De Boeck, Kris; Flume, Patrick A; Konstan, Michael W; McColley, Susanna A; McCoy, Karen; McKone, Edward F; Munck, Anne; Ratjen, Felix; Rowe, Steven M; Waltz, David; Boyle, Michael P

    2015-07-16

    Cystic fibrosis is a life-limiting disease that is caused by defective or deficient cystic fibrosis transmembrane conductance regulator (CFTR) protein activity. Phe508del is the most common CFTR mutation. We conducted two phase 3, randomized, double-blind, placebo-controlled studies that were designed to assess the effects of lumacaftor (VX-809), a CFTR corrector, in combination with ivacaftor (VX-770), a CFTR potentiator, in patients 12 years of age or older who had cystic fibrosis and were homozygous for the Phe508del CFTR mutation. In both studies, patients were randomly assigned to receive either lumacaftor (600 mg once daily or 400 mg every 12 hours) in combination with ivacaftor (250 mg every 12 hours) or matched placebo for 24 weeks. The primary end point was the absolute change from baseline in the percentage of predicted forced expiratory volume in 1 second (FEV1) at week 24. A total of 1108 patients underwent randomization and received study drug. The mean baseline FEV1 was 61% of the predicted value. In both studies, there were significant improvements in the primary end point in both lumacaftor-ivacaftor dose groups; the difference between active treatment and placebo with respect to the mean absolute improvement in the percentage of predicted FEV1 ranged from 2.6 to 4.0 percentage points (P<0.001), which corresponded to a mean relative treatment difference of 4.3 to 6.7% (P<0.001). Pooled analyses showed that the rate of pulmonary exacerbations was 30 to 39% lower in the lumacaftor-ivacaftor groups than in the placebo group; the rate of events leading to hospitalization or the use of intravenous antibiotics was lower in the lumacaftor-ivacaftor groups as well. The incidence of adverse events was generally similar in the lumacaftor-ivacaftor and placebo groups. The rate of discontinuation due to an adverse event was 4.2% among patients who received lumacaftor-ivacaftor versus 1.6% among those who received placebo. These data show that lumacaftor in combination with ivacaftor provided a benefit for patients with cystic fibrosis homozygous for the Phe508del CFTR mutation. (Funded by Vertex Pharmaceuticals and others; TRAFFIC and TRANSPORT ClinicalTrials.gov numbers, NCT01807923 and NCT01807949.).

  14. [Four Cases Report on Primary Lung Adenoid Cystic Carcinoma].

    PubMed

    He, Xilan; Chen, Jianhua

    2017-11-20

    Lung adenoid cystic carcinoma is a kind of rare lung cancer. Diagnosis and treatment is not enough understandable for them. We collected and analyzed 4 cases of lung adenoid cystic carcinoma for broadening the sight of this disease. Retrospectively analysed the 4 cases we collected from Hunan Cancer Hospital Between January 2012 and December 2016. We depicted the pathology, immunohistochemical, epidermal growth factor receptor (EGFR) mutation and anaplastic lymphoma kinase (ALK) arrangement in these cases. And the methods of the diagnosis and treatment were analyzed. Lung adenoid cystic carcinoma is usually located in the airway, EGFR mutation and ALK arrangement is rare in this disease. Generally the metastasis of the lung cancer occurred in the advanced stage. The prognosis is good if the mass could be resected completely. Diagnosis of the lung adenoid cystic carcinoma depends on pathological experiments, surgery is the main treatment in the early stage, radiotherapy and chemotherapy is an advisable therapy in the advanced stage. And the prognosis of this kind of lung cancer is better than small cell lung cancer and non-small cell lung cancer.

  15. Clinical spectrum in homozygotes and compound heterozygotes inheriting cystic fibrosis mutation 3849+10kbC>T: Significance for geneticists

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilbert, F.; Li, Zhen; Arzimanoglou, I.

    We describe patients inheriting cystic fibrosis (CF) mutation 3849+10kbC>T as homozygotes or compound heterozygotes. Three unrelated homozygotes for this mutation were all pancreatic-sufficient and sweat test-negative or inconclusive. Among the compound heterozygotes, both pancreatic sufficiency and insufficiency, as well as positive and negative/inconclusive sweat test results are reported, expanding the range of clinical expression associated with inheritance of this mutation. 3849+10kbC>T is one of several CF mutations that can result in atypical or variant forms of CF. For geneticists, the diagnosis of variant CF has implications for recurrence risk and prognosis counseling of the families of affected individuals, and possiblymore » for CF carrier screening in the general population. 19 refs., 1 tab.« less

  16. Berberine slows cell growth in autosomal dominant polycystic kidney disease cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bonon, Anna; Mangolini, Alessandra; Pinton, Paolo

    Highlights: •Berberine at appropriate doses slows cell proliferation in ADPKD cystic cells. •Reduction of cell growth by berberine occurs by inhibition of ERK and p70-S6 kinase. •Higher doses of berberine cause an overall cytotoxic effect. •Berberine overdose induces apoptotic bodies formation and DNA fragmentation. •Antiproliferative properties of this drug make it a new candidate for ADPKD therapy. -- Abstract: Autosomal dominant polycystic kidney disease (ADPKD) is the most common hereditary monogenic disorder characterized by development and enlargement of kidney cysts that lead to loss of renal function. It is caused by mutations in two genes (PKD1 and PKD2) encoding formore » polycystin-1 and polycystin-2 proteins which regulate different signals including cAMP, mTOR and EGFR pathways. Abnormal activation of these signals following PC1 or PC2 loss of function causes an increased cell proliferation which is a typical hallmark of this disease. Despite the promising findings obtained in animal models with targeted inhibitors able to reduce cystic cell growth, currently, no specific approved therapy for ADPKD is available. Therefore, the research of new more effective molecules could be crucial for the treatment of this severe pathology. In this regard, we have studied the effect of berberine, an isoquinoline quaternary alkaloid, on cell proliferation and apoptosis in human and mouse ADPKD cystic cell lines. Berberine treatment slows cell proliferation of ADPKD cystic cells in a dose-dependent manner and at high doses (100 μg/mL) it induces cell death in cystic cells as well as in normal kidney tubule cells. However, at 10 μg/mL, berberine reduces cell growth in ADPKD cystic cells only enhancing G{sub 0}/G{sub 1} phase of cell cycle and inhibiting ERK and p70-S6 kinases. Our results indicate that berberine shows a selected antiproliferative activity in cellular models for ADPKD, suggesting that this molecule and similar natural compounds could open new opportunities for the therapy of ADPKD patients.« less

  17. Chronic pancreatitis associated with the p.G208A variant of PRSS1 gene in a European patient.

    PubMed

    Hegyi, Eszter; Cierna, Iveta; Vavrova, Ludmila; Ilencikova, Denisa; Konecny, Michal; Kovacs, Laszlo

    2014-01-10

    The major etiologic factor of chronic pancreatitis in adults is excessive alcohol consumption, whereas among children structural anomalies, systemic and metabolic disorders, and genetic factors are prevalent. Mutations in the cationic trypsinogen gene (PRSS1) cause hereditary pancreatitis, while mutations in serine protease inhibitor Kazal type 1 (SPINK1), cystic fibrosis transmembrane conductance regulator (CFTR) and chymotrypsin C (CTRC) genes have been shown to associate with chronic pancreatitis as independent risk factors. We present a case of 13-year-old boy with idiopathic chronic pancreatitis. Given the unexplained attacks of pancreatitis since early childhood and despite the negative family history, molecular-genetic analysis of four pancreatitis susceptibility genes (PRSS1, SPINK1, CTRC and CFTR) was performed. The boy was found to carry the c.623G>C (p.G208A) mutation of the PRSS1 gene and the c.180C>T (p.G60G) mutation of the CTRC gene, both in heterozygous state. These mutations are considered as contributing risk factors for chronic pancreatitis. In children with idiopathic chronic pancreatitis genetic causes should be considered, even in absence of positive family history. To the best of our knowledge, this is the first description of a European patient with chronic pancreatitis associated with the p.G208A mutation of PRSS1 gene. This mutation was previously reported only in Asian subjects and is thought to be a unique genetic cause of pancreatitis in Asia.

  18. Cystic fibrosis identified by neonatal screening: incidence, genotype, and early natural history.

    PubMed

    Green, M R; Weaver, L T; Heeley, A F; Nicholson, K; Kuzemko, J A; Barton, D E; McMahon, R; Payne, S J; Austin, S; Yates, J R

    1993-04-01

    The incidence of cystic fibrosis over the last 10 years in East Anglia (a region of the United Kingdom with a population of 2.1 million) has halved. This has happened during the establishment of a neonatal screening programme, which has enabled early diagnosis, genetic counselling, and lately the option of prenatal diagnosis in subsequent pregnancies. One hundred and seven children were born with cystic fibrosis between 1981 and 1990, eight of whom were siblings. The Guthrie blood spots of 82 infants detected by neonatal immunoreactive trypsin screening between 1981 and 1990 were examined for the presence of the most common cystic fibrosis gene mutation (delta F508). It was present in 135 (82%) of the 164 cystic fibrosis genes analysed with 54 (66%) cases being homozygous and 27 (33%) heterozygous. Sixty nine per cent of infants were symptomatic at the time of diagnosis regardless of genotype. No association was found between the early clinical or biochemical features of the disease and homozygosity or heterozygosity for this mutation. Screening for cystic fibrosis using the blood immunoreactive trypsin assay alone remains an effective method of identifying infants with the disease soon after birth, thereby allowing early therapeutic intervention. Genetic counselling and prenatal diagnosis have contributed to a reduction in the number of children born with cystic fibrosis, but may not entirely explain the decreasing incidence of the disease.

  19. Structural Changes Fundamental to Gating of the Cystic Fibrosis Transmembrane Conductance Regulator Anion Channel Pore.

    PubMed

    Linsdell, Paul

    2017-01-01

    Cystic fibrosis is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), an epithelial cell anion channel. Potentiator drugs used in the treatment of cystic fibrosis act on the channel to increase overall channel function, by increasing the stability of its open state and/or decreasing the stability of its closed state. The structure of the channel in either the open state or the closed state is not currently known. However, changes in the conformation of the protein as it transitions between these two states have been studied using functional investigation and molecular modeling techniques. This review summarizes our current understanding of the architecture of the transmembrane channel pore that controls the movement of chloride and other small anions, both in the open state and in the closed state. Evidence for different kinds of changes in the conformation of the pore as it transitions between open and closed states is described, as well as the mechanisms by which these conformational changes might be controlled to regulate normal channel gating. The ways that key conformational changes might be targeted by small compounds to influence overall CFTR activity are also discussed. Understanding the changes in pore structure that might be manipulated by such small compounds is key to the development of novel therapeutic strategies for the treatment of cystic fibrosis.

  20. Digestive system dysfunction in cystic fibrosis: challenges for nutrition therapy.

    PubMed

    Li, Li; Somerset, Shawn

    2014-10-01

    Cystic fibrosis can affect food digestion and nutrient absorption. The underlying mutation of the cystic fibrosis trans-membrane regulator gene depletes functional cystic fibrosis trans-membrane regulator on the surface of epithelial cells lining the digestive tract and associated organs, where Cl(-) secretion and subsequently secretion of water and other ions are impaired. This alters pH and dehydrates secretions that precipitate and obstruct the lumen, causing inflammation and the eventual degradation of the pancreas, liver, gallbladder and intestine. Associated conditions include exocrine pancreatic insufficiency, impaired bicarbonate and bile acid secretion and aberrant mucus formation, commonly leading to maldigestion and malabsorption, particularly of fat and fat-soluble vitamins. Pancreatic enzyme replacement therapy is used to address this insufficiency. The susceptibility of pancreatic lipase to acidic and enzymatic inactivation and decreased bile availability often impedes its efficacy. Brush border digestive enzyme activity and intestinal uptake of certain disaccharides and amino acids await clarification. Other complications that may contribute to maldigestion/malabsorption include small intestine bacterial overgrowth, enteric circular muscle dysfunction, abnormal intestinal mucus, and intestinal inflammation. However, there is some evidence that gastric digestive enzymes, colonic microflora, correction of fatty acid abnormalities using dietary n-3 polyunsaturated fatty acid supplementation and emerging intestinal biomarkers can complement nutrition management in cystic fibrosis. Copyright © 2014 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  1. A mouse model for the cystic fibrosis delta F508 mutation.

    PubMed Central

    van Doorninck, J H; French, P J; Verbeek, E; Peters, R H; Morreau, H; Bijman, J; Scholte, B J

    1995-01-01

    Most cystic fibrosis (CF) patients produce a mutant form (delta F508) of the cystic fibrosis transmembrane conductance regulator (CFTR), which is not properly processed in normal cells but is active as a chloride channel in several experimental systems. We used a double homologous recombination ('Hit and Run') procedure to generate a mouse model for the delta F508 mutation. Targeted embryonic stem (ES) cells (Hit clones) were found; of these either 80 or 20% of the clones had lost the delta F508 mutation, depending on the distance between the linearization site in the targeting construct and the delta F508 mutation. Correctly targeted clones underwent a second selection step resulting in ES cell clones (Run clones) heterozygous for the delta F508 mutation with an efficiency of 2-7%. Chimeric mice were generated and offspring homozygous for the delta F508 mutation showed electrophysiological abnormalities in nasal epithelium, gallbladder and in the intestine, and histological abnormalities in the intestine, typical of CF. Our data suggest that the delta F508 mice have residual delta F508 CFTR activity which would explain the mild pathology of the delta F508 mice. The delta F508 mouse may provide a useful model for the study of the processing defect of delta F508 CFTR and for the development of novel therapeutic approaches based on circumvention of the processing block. Images PMID:7556083

  2. Genomic sequencing in cystic fibrosis newborn screening: what works best, two-tier predefined CFTR mutation panels or second-tier CFTR panel followed by third-tier sequencing?

    PubMed

    Currier, Robert J; Sciortino, Stan; Liu, Ruiling; Bishop, Tracey; Alikhani Koupaei, Rasoul; Feuchtbaum, Lisa

    2017-10-01

    PurposeThe purpose of this study was to model the performance of several known two-tier, predefined mutation panels and three-tier algorithms for cystic fibrosis (CF) screening utilizing the ethnically diverse California population.MethodsThe cystic fibrosis transmembrane conductance regulator (CFTR) mutations identified among the 317 CF cases in California screened between 12 August 2008 and 18 December 2012 were used to compare the expected CF detection rates for several two- and three-tier screening approaches, including the current California approach, which consists of a population-specific 40-mutation panel followed by third-tier sequencing when indicated.ResultsThe data show that the strategy of using third-tier sequencing improves CF detection following an initial elevated immunoreactive trypsinogen and detection of only one mutation on a second-tier panel.ConclusionIn a diverse population, the use of a second-tier panel followed by third-tier CFTR gene sequencing provides a better detection rate for CF, compared with the use of a second-tier approach alone, and is an effective way to minimize the referrals of CF carriers for sweat testing. Restricting screening to a second-tier testing to predefined mutation panels, even broad ones, results in some missed CF cases and demonstrates the limited utility of this approach in states that have diverse multiethnic populations.

  3. Cystic fibrosis transmembrane conductance regulator modulators: precision medicine in cystic fibrosis.

    PubMed

    Burgener, Elizabeth B; Moss, Richard B

    2018-06-01

    The aim of this study was to describe the newest development in cystic fibrosis (CF) care, CF transmembrane conductance regulator (CFTR) modulator therapies. Phase II results showing CFTR modulator triple therapies are more effective than current CFTR modulators. CFTR modulator therapy targets the protein defective in CF and boosts its function, but the drug must match mutation pathobiology. Ivacaftor, a CFTR potentiator, was the first modulator approved in 2012, with impressive improvement in lung function and other measures of disease in patients with gating and other residual function mutations (∼10% of CF patients). In 2015, the combination of lumacaftor, a CFTR corrector, and ivacaftor was approved for patients homozygous for the F508del mutation (∼40-50% of the CF population) with positive but less impressive clinical response and 10-20% incidence of intolerance. A next-generation CFTR corrector, tezacaftor, with ivacaftor equally effective and better tolerated than lumacaftor, has also received US Food and Drug Administration approval. Novel CFTR correctors, entering Phase 3 trials in triple modulator combination with tezacaftor-ivacaftor, appear substantially more effective for patients who are homozygous for the F508del mutation and can provide benefit for patients with a single F508del mutation. This offers promise of effective CFTR modulator therapy for nearly 90% of CF patients.

  4. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

  5. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

  6. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

  7. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

  8. Expression of cystic fibrosis transmembrane conductance regulator corrects defective chloride channel regulation in cystic fibrosis airway epithelial cells

    NASA Astrophysics Data System (ADS)

    Rich, Devra P.; Anderson, Matthew P.; Gregory, Richard J.; Cheng, Seng H.; Paul, Sucharita; Jefferson, Douglas M.; McCann, John D.; Klinger, Katherine W.; Smith, Alan E.; Welsh, Michael J.

    1990-09-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) was expressed in cultured cystic fibrosis airway epithelial cells and Cl- channel activation assessed in single cells using a fluorescence microscopic assay and the patch-clamp technique. Expression of CFTR, but not of a mutant form of CFTR (ΔF508), corrected the Cl- channel defect. Correction of the phenotypic defect demonstrates a causal relationship between mutations in the CFTR gene and defective Cl- transport which is the hallmark of the disease.

  9. Uncertain diagnosis after newborn screening for cystic fibrosis: An ethics-based approach to a clinical dilemma.

    PubMed

    Massie, John; Gillam, Lynn

    2014-01-01

    There is uncertainty about the diagnosis of cystic fibrosis after newborn screening (NBS) for some babies, either because of an intermediate sweat chloride test or inconclusive gene mutation analysis. There is considerable difficulty knowing how best to manage these babies, some of whom will develop cystic fibrosis, but many not. This article offers an ethics-based approach to this clinical dilemma that should be helpful to clinicians managing the baby with an uncertain diagnosis of cystic fibrosis after NBS. © 2013 Wiley Periodicals, Inc.

  10. Long-Term Evolution of Burkholderia multivorans during a Chronic Cystic Fibrosis Infection Reveals Shifting Forces of Selection

    PubMed Central

    Silva, Inês N.; Santos, Mário R.; Zlosnik, James E. A.; Speert, David P.; Buskirk, Sean W.; Bruger, Eric L.; Waters, Christopher M.

    2016-01-01

    ABSTRACT Burkholderia multivorans is an opportunistic pathogen capable of causing severe disease in patients with cystic fibrosis (CF). Patients may be chronically infected for years, during which the bacterial population evolves in response to unknown forces. Here we analyze the genomic and functional evolution of a B. multivorans infection that was sequentially sampled from a CF patient over 20 years. The population diversified into at least four primary, coexisting clades with distinct evolutionary dynamics. The average substitution rate was only 2.4 mutations/year, but notably, some lineages evolved more slowly, whereas one diversified more rapidly by mostly nonsynonymous mutations. Ten loci, mostly involved in gene expression regulation and lipid metabolism, acquired three or more independent mutations and define likely targets of selection. Further, a broad range of phenotypes changed in association with the evolved mutations; they included antimicrobial resistance, biofilm regulation, and the presentation of lipopolysaccharide O-antigen repeats, which was directly caused by evolved mutations. Additionally, early isolates acquired mutations in genes involved in cyclic di-GMP (c-di-GMP) metabolism that associated with increased c-di-GMP intracellular levels. Accordingly, these isolates showed lower motility and increased biofilm formation and adhesion to CFBE41o− epithelial cells than the initial isolate, and each of these phenotypes is an important trait for bacterial persistence. The timing of the emergence of this clade of more adherent genotypes correlated with the period of greatest decline in the patient’s lung function. All together, our observations suggest that selection on B. multivorans populations during long-term colonization of CF patient lungs either directly or indirectly targets adherence, metabolism, and changes in the cell envelope related to adaptation to the biofilm lifestyle. IMPORTANCE Bacteria may become genetically and phenotypically diverse during long-term colonization of cystic fibrosis (CF) patient lungs, yet our understanding of within-host evolutionary processes during these infections is lacking. Here we combined current genome sequencing technologies and detailed phenotypic profiling of the opportunistic pathogen Burkholderia multivorans using sequential isolates sampled from a CF patient over 20 years. The evolutionary history of these isolates highlighted bacterial genes and pathways that were likely subject to strong selection within the host and were associated with altered phenotypes, such as biofilm production, motility, and antimicrobial resistance. Importantly, multiple lineages coexisted for years or even decades within the infection, and the period of diversification within the dominant lineage was associated with deterioration of the patient’s lung function. Identifying traits under strong selection during chronic infection not only sheds new light onto Burkholderia evolution but also sets the stage for tailored therapeutics targeting the prevailing lineages associated with disease progression. PMID:27822534

  11. Attenuation of Phosphorylation-dependent Activation of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) by Disease-causing Mutations at the Transmission Interface*

    PubMed Central

    Chin, Stephanie; Yang, Donghe; Miles, Andrew J.; Eckford, Paul D. W.; Molinski, Steven; Wallace, B. A.; Bear, Christine E.

    2017-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a multidomain membrane protein that functions as a phosphorylation-regulated anion channel. The interface between its two cytosolic nucleotide binding domains and coupling helices conferred by intracellular loops extending from the channel pore domains has been referred to as a transmission interface and is thought to be critical for the regulated channel activity of CFTR. Phosphorylation of the regulatory domain of CFTR by protein kinase A (PKA) is required for its channel activity. However, it was unclear if phosphorylation modifies the transmission interface. Here, we studied purified full-length CFTR protein using spectroscopic techniques to determine the consequences of PKA-mediated phosphorylation. Synchrotron radiation circular dichroism spectroscopy confirmed that purified full-length wild-type CFTR is folded and structurally responsive to phosphorylation. Intrinsic tryptophan fluorescence studies of CFTR showed that phosphorylation reduced iodide-mediated quenching, consistent with an effect of phosphorylation in burying tryptophans at the transmission interface. Importantly, the rate of phosphorylation-dependent channel activation was compromised by the introduction of disease-causing mutations in either of the two coupling helices predicted to interact with nucleotide binding domain 1 at the interface. Together, these results suggest that phosphorylation modifies the interface between the catalytic and pore domains of CFTR and that this modification facilitates CFTR channel activation. PMID:28003367

  12. Cystic fibrosis: a clinical view.

    PubMed

    Castellani, Carlo; Assael, Baroukh M

    2017-01-01

    Cystic fibrosis (CF), a monogenic disease caused by mutations in the CFTR gene on chromosome 7, is complex and greatly variable in clinical expression. Airways, pancreas, male genital system, intestine, liver, bone, and kidney are involved. The lack of CFTR or its impaired function causes fat malabsorption and chronic pulmonary infections leading to bronchiectasis and progressive lung damage. Previously considered lethal in infancy and childhood, CF has now attained median survivals of 50 years of age, mainly thanks to the early diagnosis through neonatal screening, recognition of mild forms, and an aggressive therapeutic attitude. Classical treatment includes pancreatic enzyme replacement, respiratory physiotherapy, mucolitics, and aggressive antibiotic therapy. A significant proportion of patients with severe symptoms still requires lung or, less frequently, liver transplantation. The great number of mutations and their diverse effects on the CFTR protein account only partially for CF clinical variability, and modifier genes have a role in modulating the clinical expression of the disease. Despite the increasing understanding of CFTR functioning, several aspects of CF need still to be clarified, e.g., the worse outcome in females, the risk of malignancies, the pathophysiology, and best treatment of comorbidities, such as CF-related diabetes or CF-related bone disorder. Research is focusing on new drugs restoring CFTR function, some already available and with good clinical impact, others showing promising preliminary results that need to be confirmed in phase III clinical trials.

  13. Bone disease in cystic fibrosis: new pathogenic insights opening novel therapies.

    PubMed

    Jacquot, J; Delion, M; Gangloff, S; Braux, J; Velard, F

    2016-04-01

    Mutations within the gene encoding for the chloride ion channel cystic fibrosis transmembrane conductance regulator (CFTR) results in cystic fibrosis (CF), the most common lethal autosomal recessive genetic disease that causes a number of long-term health problems, as the bone disease. Osteoporosis and increased vertebral fracture risk associated with CF disease are becoming more important as the life expectancy of patients continues to improve. The etiology of low bone density is multifactorial, most probably a combination of inadequate peak bone mass during puberty and increased bone losses in adults. Body mass index, male sex, advanced pulmonary disease, malnutrition and chronic therapies are established additional risk factors for CF-related bone disease (CFBD). Consistently, recent evidence has confirmed that CFTR plays a major role in the osteoprotegerin (OPG) and COX-2 metabolite prostaglandin E2 (PGE2) production, two key regulators in the bone formation and regeneration. Several others mechanisms were also recognized from animal and cell models contributing to malfunctions of osteoblast (cell that form bone) and indirectly of bone-resorpting osteoclasts. Understanding such mechanisms is crucial for the development of therapies in CFBD. Innovative therapeutic approaches using CFTR modulators such as C18 have recently shown in vitro capacity to enhance PGE2 production and normalized the RANKL-to-OPG ratio in human osteoblasts bearing the mutation F508del-CFTR and therefore potential clinical utility in CFBD. This review focuses on the recently identified pathogenic mechanisms leading to CFBD and potential future therapies for treating CFBD.

  14. Liver Disease in Cystic Fibrosis: an Update

    PubMed Central

    Parisi, Giuseppe Fabio; Di Dio, Giovanna; Franzonello, Chiara; Gennaro, Alessia; Rotolo, Novella; Lionetti, Elena; Leonardi, Salvatore

    2013-01-01

    Context Cystic fibrosis (CF) is the most widespread autosomal recessive genetic disorder that limits life expectation amongst the Caucasian population. As the median survival has increased related to early multidisciplinary intervention, other manifestations of CF have emergedespecially for the broad spectrum of hepatobiliary involvement. The present study reviews the existing literature on liver disease in cystic fibrosis and describes the key issues for an adequate clinical evaluation and management of patients, with a focus on the pathogenetic, clinical and diagnostic-therapeutic aspects of liver disease in CF. Evidence Acquisition A literature search of electronic databases was undertaken for relevant studies published from 1990 about liver disease in cystic fibrosis. The databases searched were: EMBASE, PubMed and Cochrane Library. Results CF is due to mutations in the gene on chromosome 7 that encodes an amino acidic polypeptide named CFTR (cystic fibrosis transmembrane regulator). The hepatic manifestations include particular changes referring to the basic CFTR defect, iatrogenic lesions or consequences of the multisystem disease. Even though hepatobiliary disease is the most common non-pulmonary cause ofmortalityin CF (the third after pulmonary disease and transplant complications), only about the 33%ofCF patients presents clinically significant hepatobiliary disease. Conclusions Liver disease will have a growing impact on survival and quality of life of cystic fibrosis patients because a longer life expectancy and for this it is important its early recognition and a correct clinical management aimed atdelaying the onset of complications. This review could represent an opportunity to encourage researchers to better investigate genotype-phenotype correlation associated with the development of cystic fibrosis liver disease, especially for non-CFTR genetic polymorphisms, and detect predisposed individuals. Therapeutic trials are needed to find strategies of fibrosis prevention and to avoid its progression prior to development its related complications. PMID:24171010

  15. Activation of deltaF508 CFTR in a cystic fibrosis respiratory epithelial cell line by 4-phenylbutyrate, genistein and CPX.

    PubMed

    Andersson, C; Roomans, G M

    2000-05-01

    The cellular basis of cystic fibrosis (CF) is a defect in a cyclic adenosine monophosphate (cAMP)-activated chloride channel (CF transmembrane conductance regulator) in epithelial cells that leads to decreased chloride ion transport and impaired water transport across the cell membrane. This study investigated whether it was possible to activate the defective chloride channel in cystic fibrosis respiratory epithelial cells with 4-phenylbutyrate (4PBA), genistein and 8-cyclopentyl-1,3-dipropylxanthine (CPX). The CF bronchial epithelial cell line CFBE41o-, which expresses the deltaF508 mutation, was treated with these agents and loss of Cl-, indicating Cl- efflux, measured by X-ray microanalysis. 8-bromo-cAMP alone did not induce Cl- efflux in CFBE41o- cells, but after incubation with 4PBA a significant efflux of Cl- occurred. Stimulation of cells with a combination of genistein and cAMP also induced Cl- efflux, whereas a combination of pretreatment with 4PBA and a combined stimulation with genistein and cAMP induced an even larger Cl- efflux. Cl- efflux could also be stimulated by CPX, but this effect was not enhanced by 4PBA pretreatment. The deltaF508 mutation leads to impaired processing of the cystic fibrosis transmembrane conductance regulator. The increased efflux of chloride after 4-phenylbutyrate treatment can be explained by the fact that 4-phenylbutyrate allows the deltaF508 cystic fibrosis transmembrane conductance regulator to escape degradation and to be transported to the cell surface. Genistein and 8-cyclopentyl-1,3-dipropylxanthine act by stimulating chloride ion efflux by increasing the probability of the cystic fibrosis transmembrane conductance regulator being open. The combination of 4-phenylbutyrate and genistein may be useful in a potential pharmacological therapy for cystic fibrosis patients with the deltaF508 mutation.

  16. Impact of Gene Patents and Licensing Practices on Access to Genetic Testing for Cystic Fibrosis

    PubMed Central

    Chandrasekharan, Subhashini; Heaney, Christopher; James, Tamara; Conover, Chris; Cook-Deegan, Robert

    2010-01-01

    Cystic fibrosis (CF) is one of the most commonly tested autosomal recessive disorders in the US. Clinical CF is associated with mutations in the CFTR gene, of which the most common mutation among Caucasians, ΔF508, was identified in 1989. The University of Michigan, Johns Hopkins University, and the Hospital for Sick Children, where much of the initial research occurred, hold key patents for CF genetic sequences, mutations and methods for detecting them. Several patents including the one that covers detection of the ΔF508 mutation are jointly held by the University of Michigan and the Hospital for Sick Children in Toronto, with Michigan administering patent licensing in the US. The University of Michigan broadly licenses the ΔF508 patent for genetic testing with over 60 providers of genetic testing to date. Genetic testing is now used in newborn screening, diagnosis, and reproductive decisions. Interviews with key researchers and intellectual property managers, a survey of laboratories’ prices for CF genetic testing, a review of literature on CF tests’ cost effectiveness, and a review of the developing market for CF testing provide no evidence that patents have significantly hindered access to genetic tests for CF or prevented financially cost-effective screening. Current licensing practices for cystic fibrosis (CF) genetic testing appear to facilitate both academic research and commercial testing. More than one thousand different CFTR mutations have been identified, and research continues to determine their clinical significance. Patents have been nonexclusively licensed for diagnostic use, and have been variably licensed for gene transfer and other therapeutic applications. The Cystic Fibrosis Foundation has been engaged in licensing decisions, making CF a model of collaborative and cooperative patenting and licensing practice. PMID:20393308

  17. Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis.

    PubMed

    Coutinho, Cyntia Arivabeni de Araújo Correia; Marson, Fernando Augusto de Lima; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu; Bertuzzo, Carmen Silvia

    2013-01-01

    To determine the frequency of six mutations (F508del, G542X, G551D, R553X, R1162X, and N1303K) in patients with cystic fibrosis (CF) diagnosed, at a referral center, on the basis of abnormal results in two determinations of sweat sodium and chloride concentrations. This was a cross-sectional study involving 70 patients with CF. The mean age of the patients was 12.38 ± 9.00 years, 51.43% were female, and 94.29% were White. Mutation screening was performed with polymerase chain reaction (for F508del), followed by enzymatic digestion (for other mutations). Clinical analysis was performed on the basis of gender, age, ethnicity, pulmonary/gastrointestinal symptoms, and Shwachman-Kulczycki (SK) score. All of the patients showed pulmonary symptoms, and 8 had no gastrointestinal symptoms. On the basis of the SK scores, CF was determined to be mild, moderate, and severe in 22 (42.3%), 17 (32.7%), and 13 (25.0%) of the patients, respectively. There was no association between F508del mutation and disease severity by SK score. Of the 140 alleles analyzed, F508del mutation was identified in 70 (50%). Other mutations (G542X, G551D, R553X, R1162X, and N1303K) were identified in 12 (7.93%) of the alleles studied. In F508del homozygous patients with severe disease, the OR was 0.124 (95% CI: 0.005-0.826). In 50% of the alleles studied, the molecular diagnosis of CF was confirmed by identifying a single mutation (F508del). If we consider the analysis of the six most common mutations in the Brazilian population (including F508del), the molecular diagnosis was confirmed in 58.57% of the alleles studied.

  18. Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mercier, B.; Verlingue, C.; Audrezet, M.P.

    1995-01-01

    Congenital bilateral absence of the vas deferens (CBAVD) is an important cause of sterility in men. Although the genetic basis of this condition is still unclear, it has been shown recently that some of these patients carry mutations in their cystic fibrosis transmembrane conductance regulator (CFTR) genes. To extend this observation, we have analyzed the entire coding sequence of the CFTR gene in a cohort of 67 men with CBAVD, who are otherwise healthy. We have identified four novel missense mutations (A800G, G149R, R258G, and E193K). We have shown that 42% of subjects were carriers of one CFTR allele andmore » that 24% are compound heterozygous for CFTR alleles. Thus, we have been unable to identify 76% of these patients as carrying two CFTR mutations. Furthermore, we have described the segregation of CFTR haplotypes in the family of one CBAVD male; in this family are two male siblings, with identical CFTR loci but displaying different phenotypes, one of them being fertile and the other sterile. The data presented in this family, indicating a discordance between the CBAVD phenotype and a marked carrier ({delta}F508) chromosome, support the involvement of another gene(s), in the etiology of CBAVD. 35 refs., 2 figs., 1 tab.« less

  19. Meconium ileus caused by mutations in GUCY2C, encoding the CFTR-activating guanylate cyclase 2C.

    PubMed

    Romi, Hila; Cohen, Idan; Landau, Daniella; Alkrinawi, Suliman; Yerushalmi, Baruch; Hershkovitz, Reli; Newman-Heiman, Nitza; Cutting, Garry R; Ofir, Rivka; Sivan, Sara; Birk, Ohad S

    2012-05-04

    Meconium ileus, intestinal obstruction in the newborn, is caused in most cases by CFTR mutations modulated by yet-unidentified modifier genes. We now show that in two unrelated consanguineous Bedouin kindreds, an autosomal-recessive phenotype of meconium ileus that is not associated with cystic fibrosis (CF) is caused by different homozygous mutations in GUCY2C, leading to a dramatic reduction or fully abrogating the enzymatic activity of the encoded guanlyl cyclase 2C. GUCY2C is a transmembrane receptor whose extracellular domain is activated by either the endogenous ligands, guanylin and related peptide uroguanylin, or by an external ligand, Escherichia coli (E. coli) heat-stable enterotoxin STa. GUCY2C is expressed in the human intestine, and the encoded protein activates the CFTR protein through local generation of cGMP. Thus, GUCY2C is a likely candidate modifier of the meconium ileus phenotype in CF. Because GUCY2C heterozygous and homozygous mutant mice are resistant to E. coli STa enterotoxin-induced diarrhea, it is plausible that GUCY2C mutations in the desert-dwelling Bedouin kindred are of selective advantage. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  20. The cystic fibrosis transmembrane conductance regulator (CFTR) and its stability.

    PubMed

    Meng, Xin; Clews, Jack; Kargas, Vasileios; Wang, Xiaomeng; Ford, Robert C

    2017-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) is responsible for the disease cystic fibrosis (CF). It is a membrane protein belonging to the ABC transporter family functioning as a chloride/anion channel in epithelial cells around the body. There are over 1500 mutations that have been characterised as CF-causing; the most common of these, accounting for ~70 % of CF cases, is the deletion of a phenylalanine at position 508. This leads to instability of the nascent protein and the modified structure is recognised and then degraded by the ER quality control mechanism. However, even pharmacologically 'rescued' F508del CFTR displays instability at the cell's surface, losing its channel function rapidly and it is rapidly removed from the plasma membrane for lysosomal degradation. This review will, therefore, explore the link between stability and structure/function relationships of membrane proteins and CFTR in particular and how approaches to study CFTR structure depend on its stability. We will also review the application of a fluorescence labelling method for the assessment of the thermostability and the tertiary structure of CFTR.

  1. Interaction among variants in the SLC gene family (SLC6A14, SLC26A9, SLC11A1, and SLC9A3) and CFTR mutations with clinical markers of cystic fibrosis.

    PubMed

    Pereira, Stephanie V N; Ribeiro, Jose D; Bertuzzo, Carmen S; Marson, Fernando A L

    2018-04-10

    Cystic fibrosis (CF) is due to dysfunction of the CFTR channel and function of this channel is, in turn, affected by modifier genes that can impact the clinical phenotype. In this context, we analyzed the interaction among rs3788766*SLC6A14, rs7512462*SLC26A9, rs17235416*SLC11A1, and rs17563161*SLC9A3 variants, CFTR mutations and 40 CF severity markers by the Multifactor Dimensionality Reduction (MDR) model. A total of 164 patients with CF were included in the study. The variants in the modifier genes were identified by real-time PCR and the genotype of the CFTR gene in the diagnostic routine. Analysis of interaction between variants, CFTR mutations groupings and demographic, clinical and laboratory data were performed by the MDR. There were interaction between the rs3788766, rs7512462, rs17235416, and rs17563161 variants, and CFTR mutations with pancreatic insufficiency (PI), onset of digestive symptoms, and presence of mucoid Pseudomonas aeruginosa. Regarding PI, the interaction was observed for CFTR*rs17563161 (P-value = 0.015). Also, for onset of digestive symptoms the interaction was observed for CFTR*rs3788766*rs7512462*rs17235416*rs17563161 (P-value = 0.036). Considering the presence of mucoid P. aeruginosa, the interaction occurred for CFTR*rs3788766*rs7512462*rs17563161 (P-value = 0.035). Interaction between variants in the SLC family genes and the grouping for CFTR mutations were associated with PI, onset of digestive symptoms and mucoid P. aeruginosa, being important to determine one of the factors that may cause the diversity among the patients with CF. © 2018 Wiley Periodicals, Inc.

  2. What's it Like to Have Cystic Fibrosis?

    MedlinePlus

    ... deal with cystic fibrosis. What Is CF? Cystic fibrosis (CF) is a disease that causes the body to make thick, sticky mucus (say: ... special protein. This protein is defective in cystic fibrosis, producing the thick, sticky mucus that causes problems for people with CF. What Causes CF? ...

  3. Diagnostic contribution of molecular analysis of the cystic fibrosis transmembrane conductance regulator gene in patients suspected of having mild or atypical cystic fibrosis *

    PubMed Central

    Dal'Maso, Vinícius Buaes; Mallmann, Lucas; Siebert, Marina; Simon, Laura; Saraiva-Pereira, Maria Luiza; Dalcin, Paulo de Tarso Roth

    2013-01-01

    OBJECTIVE: To evaluate the diagnostic contribution of molecular analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in patients suspected of having mild or atypical cystic fibrosis (CF). METHODS: This was a cross-sectional study involving adolescents and adults aged ≥ 14 years. Volunteers underwent clinical, laboratory, and radiological evaluation, as well as spirometry, sputum microbiology, liver ultrasound, sweat tests, and molecular analysis of the CFTR gene. We then divided the patients into three groups by the number of mutations identified (none, one, and two or more) and compared those groups in terms of their characteristics. RESULTS: We evaluated 37 patients with phenotypic findings of CF, with or without sweat test confirmation. The mean age of the patients was 32.5 ± 13.6 years, and females predominated (75.7%). The molecular analysis contributed to the definitive diagnosis of CF in 3 patients (8.1%), all of whom had at least two mutations. There were 7 patients (18.9%) with only one mutation and 26 patients (70.3%) with no mutations. None of the clinical characteristics evaluated was found to be associated with the genetic diagnosis. The most common mutation was p.F508del, which was found in 5 patients. The combination of p.V232D and p.F508del was found in 2 patients. Other mutations identified were p.A559T, p.D1152H, p.T1057A, p.I148T, p.V754M, p.P1290P, p.R1066H, and p.T351S. CONCLUSIONS: The molecular analysis of the CFTR gene coding region showed a limited contribution to the diagnostic investigation of patients suspected of having mild or atypical CF. In addition, there were no associations between the clinical characteristics and the genetic diagnosis. PMID:23670503

  4. Diagnostic contribution of molecular analysis of the cystic fibrosis transmembrane conductance regulator gene in patients suspected of having mild or atypical cystic fibrosis.

    PubMed

    Dal'Maso, Vinícius Buaes; Mallmann, Lucas; Siebert, Marina; Simon, Laura; Saraiva-Pereira, Maria Luiza; Dalcin, Paulo de Tarso Roth

    2013-01-01

    To evaluate the diagnostic contribution of molecular analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in patients suspected of having mild or atypical cystic fibrosis (CF). This was a cross-sectional study involving adolescents and adults aged > 14 years. Volunteers underwent clinical, laboratory, and radiological evaluation, as well as spirometry, sputum microbiology, liver ultrasound, sweat tests, and molecular analysis of the CFTR gene. We then divided the patients into three groups by the number of mutations identified (none, one, and two or more) and compared those groups in terms of their characteristics. We evaluated 37 patients with phenotypic findings of CF, with or without sweat test confirmation. The mean age of the patients was 32.5 ± 13.6 years, and females predominated (75.7%). The molecular analysis contributed to the definitive diagnosis of CF in 3 patients (8.1%), all of whom had at least two mutations. There were 7 patients (18.9%) with only one mutation and 26 patients (70.3%) with no mutations. None of the clinical characteristics evaluated was found to be associated with the genetic diagnosis. The most common mutation was p.F508del, which was found in 5 patients. The combination of p.V232D and p.F508del was found in 2 patients. Other mutations identified were p.A559T, p.D1152H, p.T1057A, p.I148T, p.V754M, p.P1290P, p.R1066H, and p.T351S. The molecular analysis of the CFTR gene coding region showed a limited contribution to the diagnostic investigation of patients suspected of having mild or atypical CF. In addition, there were no associations between the clinical characteristics and the genetic diagnosis.

  5. Modeling cystic fibrosis disease progression in patients with the rare CFTR mutation P67L.

    PubMed

    MacKenzie, Isobel E R; Paquette, Valerie; Gosse, Frances; George, Sheenagh; Chappe, Frederic; Chappe, Valerie

    2017-05-01

    The progression of cystic fibrosis (CF) in patients with the rare mutation P67L was examined to determine if it induced a milder form of CF compared to the common severe ΔF508 mutation. Parameters of lung function, level of bacterial infection, nutritional status and hospitalization were used to represent CF progression. Age at diagnosis and pancreatic status were used to assess CF presentation. Analysis of data from the CF Canada Registry collected over a 15-year period included 266 ΔF508/ΔF508 homozygote patients from CF clinics in Atlantic Canada and 26 compound heterozygote patients with the rare P67L mutation from clinics across Canada. Late age at diagnosis, high incidence of pancreatic sufficiency, maintained Body Mass Index (BMI) with age, delayed life-threatening bacterial infection, and fewer days in hospital were observed for P67L heterozygote patients included in this study. Although the decline of lung function did not differ from ΔF508 homozygotes, the fact that a greater proportion of P67L heterozygotes live to an older age suggests that lung function is not the primary factor determining CF progression for P67L heterozygote patients. The P67L mutation is associated with a mild disease, even when combined with the severe ΔF508 mutation. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  6. Evolution of the Pseudomonas aeruginosa mutational resistome in an international Cystic Fibrosis clone.

    PubMed

    López-Causapé, Carla; Sommer, Lea Mette; Cabot, Gabriel; Rubio, Rosa; Ocampo-Sosa, Alain A; Johansen, Helle Krogh; Figuerola, Joan; Cantón, Rafael; Kidd, Timothy J; Molin, Soeren; Oliver, Antonio

    2017-07-17

    Emergence of epidemic clones and antibiotic resistance development compromises the management of Pseudomonas aeruginosa cystic fibrosis (CF) chronic respiratory infections. Whole genome sequencing (WGS) was used to decipher the phylogeny, interpatient dissemination, WGS mutator genotypes (mutome) and resistome of a widespread clone (CC274), in isolates from two highly-distant countries, Australia and Spain, covering an 18-year period. The coexistence of two divergent CC274 clonal lineages was revealed, but without evident geographical barrier; phylogenetic reconstructions and mutational resistome demonstrated the interpatient transmission of mutators. The extraordinary capacity of P. aeruginosa to develop resistance was evidenced by the emergence of mutations in >100 genes related to antibiotic resistance during the evolution of CC274, catalyzed by mutator phenotypes. While the presence of classical mutational resistance mechanisms was confirmed and correlated with resistance phenotypes, results also showed a major role of unexpected mutations. Among them, PBP3 mutations, shaping up β-lactam resistance, were noteworthy. A high selective pressure for mexZ mutations was evidenced, but we showed for the first time that high-level aminoglycoside resistance in CF is likely driven by mutations in fusA1/fusA2, coding for elongation factor G. Altogether, our results provide valuable information for understanding the evolution of the mutational resistome of CF P. aeruginosa.

  7. Within-host whole genome analysis of an antibiotic resistant Pseudomonas aeruginosa strain sub-type in cystic fibrosis.

    PubMed

    Sherrard, Laura J; Tai, Anna S; Wee, Bryan A; Ramsay, Kay A; Kidd, Timothy J; Ben Zakour, Nouri L; Whiley, David M; Beatson, Scott A; Bell, Scott C

    2017-01-01

    A Pseudomonas aeruginosa AUST-02 strain sub-type (M3L7) has been identified in Australia, infects the lungs of some people with cystic fibrosis and is associated with antibiotic resistance. Multiple clonal lineages may emerge during treatment with mutations in chromosomally encoded antibiotic resistance genes commonly observed. Here we describe the within-host diversity and antibiotic resistance of M3L7 during and after antibiotic treatment of an acute pulmonary exacerbation using whole genome sequencing and show both variation and shared mutations in important genes. Eleven isolates from an M3L7 population (n = 134) isolated over 3 months from an individual with cystic fibrosis underwent whole genome sequencing. A phylogeny based on core genome SNPs identified three distinct phylogenetic groups comprising two groups with higher rates of mutation (hypermutators) and one non-hypermutator group. Genomes were screened for acquired antibiotic resistance genes with the result suggesting that M3L7 resistance is principally driven by chromosomal mutations as no acquired mechanisms were detected. Small genetic variations, shared by all 11 isolates, were found in 49 genes associated with antibiotic resistance including frame-shift mutations (mexA, mexT), premature stop codons (oprD, mexB) and mutations in quinolone-resistance determining regions (gyrA, parE). However, whole genome sequencing also revealed mutations in 21 genes that were acquired following divergence of groups, which may also impact the activity of antibiotics and multi-drug efflux pumps. Comparison of mutations with minimum inhibitory concentrations of anti-pseudomonal antibiotics could not easily explain all resistance profiles observed. These data further demonstrate the complexity of chronic and antibiotic resistant P. aeruginosa infection where a multitude of co-existing genotypically diverse sub-lineages might co-exist during and after intravenous antibiotic treatment.

  8. Identification of the M1101K mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and complete detection of cystic fibrosis mutations in the Hutterite population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zielenski, J.; Markiewicz, D.; Fujiwara, M.

    1993-03-01

    The Hutterite population is a genetic isolate with an increased incidence of cystic fibrosis (CF). Previously the authors identified three CF haplotypes defined by polymorphisms flanking the CF transmembrane conductance regulator (CFTR) gene. [Delta]F508 was present on one of the haplotypes in only 35% of CF chromosomes. They hypothesized that the other two CF haplotypes, one of which was the most common and the other of which is rare, each harbored different non-[Delta]F508 mutations. Single-strand conformation polymorphism analysis detected a missense mutation, M1101K, in both chromosomes of a Hutterite patient carrying the two non-[Delta]F508 haplotypes. M1101K appears to have originatedmore » on an uncommon CFTR allele and to be infrequent outside the Hutterite population. The presence of M1101K on two haplotypes is likely the result of a CFTR intragenic recombination which occurred since the founding, 10-12 generations ago, of the Hutterite population. The crossover was located between exons 14a and 17b, an interval of approximately 15 kbp. [Delta]F508 and M1101K accounted for all of the CF mutations in patients from 16 CF families representing the three subdivisions of the Hutterite population. 38 refs., 3 figs., 1 tab.« less

  9. Ovarian Tumors related to Intronic Mutations in DICER1: A Report from the International Ovarian and Testicular Stromal Tumor Registry

    PubMed Central

    Schultz, Kris Ann; Harris, Anne; Messinger, Yoav; Sencer, Susan; Baldinger, Shari; Dehner, Louis P.; Hill, D. Ashley

    2015-01-01

    Germline DICER1 mutations have been described in individuals with pleuropulmonary blastoma (PPB), ovarian Sertoli-Leydig cell tumor (SLCT), sarcomas, multinodular goiter, thyroid carcinoma, cystic nephroma and other neoplastic conditions. Early results from the International Ovarian and Testicular Stromal Tumor Registry show germline DICER1 mutations in 48% of girls and women with SLCT. In this report, a young woman presented with ovarian undifferentiated sarcoma. Four years later, she presented with SLCT. She was successfully treated for both malignancies. Sequence results showed a germline intronic mutation in DICER1. This mutation results in an exact duplication of the six bases at the splice site at the intron 23 and exon 24 junction. Predicted improper splicing leads to inclusion of 10 bases of intronic sequence, frameshift and premature truncation of the protein disrupting the RNase IIIb domain. A second individual with SLCT was found to have an identical germline mutation. In each of the ovarian tumors, an additional somatic mutation in the RNase IIIb domain of DICER1 was found. In rare patients, germline intronic mutations in DICER1 that are predicted to cause incorrect splicing can also contribute to the pathogenesis of SLCT. PMID:26289771

  10. Orkambi® and amplifier co-therapy improves function from a rare CFTR mutation in gene-edited cells and patient tissue.

    PubMed

    Molinski, Steven V; Ahmadi, Saumel; Ip, Wan; Ouyang, Hong; Villella, Adriana; Miller, John P; Lee, Po-Shun; Kulleperuma, Kethika; Du, Kai; Di Paola, Michelle; Eckford, Paul Dw; Laselva, Onofrio; Huan, Ling Jun; Wellhauser, Leigh; Li, Ellen; Ray, Peter N; Pomès, Régis; Moraes, Theo J; Gonska, Tanja; Ratjen, Felix; Bear, Christine E

    2017-09-01

    The combination therapy of lumacaftor and ivacaftor (Orkambi ® ) is approved for patients bearing the major cystic fibrosis (CF) mutation: ΔF508 It has been predicted that Orkambi ® could treat patients with rarer mutations of similar "theratype"; however, a standardized approach confirming efficacy in these cohorts has not been reported. Here, we demonstrate that patients bearing the rare mutation: c.3700 A>G, causing protein misprocessing and altered channel function-similar to ΔF508-CFTR, are unlikely to yield a robust Orkambi ® response. While  in silico  and biochemical studies confirmed that this mutation could be corrected and potentiated by lumacaftor and ivacaftor, respectively, this combination led to a minor in vitro response in patient-derived tissue. A CRISPR/Cas9-edited bronchial epithelial cell line bearing this mutation enabled studies showing that an "amplifier" compound, effective in increasing the levels of immature CFTR protein, augmented the Orkambi ® response. Importantly, this "amplifier" effect was recapitulated in patient-derived nasal cultures-providing the first evidence for its efficacy in augmenting Orkambi ® in tissues harboring a rare CF-causing mutation. We propose that this multi-disciplinary approach, including creation of CRISPR/Cas9-edited cells to profile modulators together with validation using primary tissue, will facilitate therapy development for patients with rare CF mutations. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  11. Diagnostic problems in cystic fibrosis - specific characteristics of a group of infants and young children diagnosed positive through neonatal screening, in whom cystic fibrosis had not been diagnosed.

    PubMed

    Woś, Halina; Sankiewicz-Szkółka, Magda; Więcek, Sabina; Kordys-Darmolińska, Bożena; Grzybowska-Chlebowczyk, Urszula; Kniażewska, Maria

    2015-01-01

    Neonatal cystic fibrosis screening contributes to an early diagnosis of cystic fibrosis and to implementing appropriate therapeutic management. Long-standing screening tests have made it possible to identify a group of newborns in whom the diagnosis was ambiguous and required further specialised tests. The aim is to present cases of patients with a positive result of newborn screening for cystic fibrosis who were found to be carriers of the mutation in both alleles, however the lack of clinical symptoms and correct sweat testing values did not lead doctors to diagnosing cystic fibrosis and by the same token implementing the treatment. The analysis encompassed a group of 22 infants and children 3 months to 3 years of age, in whom, in spite of a positive result of newborn screening for cystic fibrosis and the presence of 2 mutations in the CFTR gene, the diagnosis of cystic fibrosis was not made, and appropriate treatment was not administered because of diagnostic doubts (due to correct concentration of chlorides in sweat, correct IRT level and lack of clinical signs of cystic fibrosis). The control group consisted of 55 children treated in our centre, in whom neonatal screening for cystic fibrosis was positive and the diagnosis was confirmed by genetic testing, sweat chloride testing and IRT concentration. There were no differences in birth body weight between the groups. The differences in chlorideion levels in sweat secretion tests and mean IRT values were statistically significant and were: 97.5 for the control group and 26.4 for the test group. At the present time there are no clinical symptoms to give a diagnosis of cystic fibrosis and start treatment in the test group. Newborn screening contributes not only to an early diagnosis of cystic fibrosis but also to CFTR-related metabolic syndromes (CRMS), which is a phenomenon requiring further observation. This fact constitutes a definite psychological problem for the parents of these patients. .

  12. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811 + 1.6kbA {yields} G, produces a new exon: High frequency in spanish cystic fibrosis chromosomes and association with severe phenotype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chillon, M.; Casals, T.; Gimenez, J.

    1995-03-01

    mRNA analysis of the cystic fibrosis transmembrane regulator (CFTR) gene in tissues of cystic fibrosis (CF) patients has allowed us to detect a cryptic exon. The new exon involves 49 base pairs between exons 11 and 12 and is due to a point mutation (1811+1.6bA{yields}G) that creates a new donor splice site in intron 11. Semiquantitative mRNA analysis showed that 1811+1.6kbA{r_arrow}G-mRNA was 5-10-fold less abundant than {triangle}F508 mRNA. Mutations 1811+1.6kbA{yields}G was found in 21 Spanish and 1 German CF chromosome(s), making it the fourth-most-frequent mutation (2%) in the Spanish population. Individuals with genotype {triangle}F508/1811+1.6kbA{yields}G have only 1%-3% of normal CFTRmore » mRNA. This loss of 97% of normal CFTR mRNA must be responsible for the pancreatic insufficiency and for the severe CF phenotype in these patients. 30 refs., 3 figs., 2 tabs.« less

  13. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  14. A Novel Mutation on RAF1 in Association with Fetal Findings Suggestive of Noonan Syndrome.

    PubMed

    Kneitel, Anna W; Norby, Audrey; Vettraino, Ivana; Treadwell, Marjorie C

    2015-01-01

    Noonan syndrome is a multisystem genetic disorder caused by genes encoding proteins involved in the RAS-MAPK pathway. Affected fetuses have variable presentations ranging from the absence of prenatal findings to increased nuchal fold, cystic hygromas, pleural effusions, cardiac malformations, or skin edema. We describe a male fetus who had features consistent with Noonan syndrome at the time of fetal anatomic survey, including hydrops and a possible cardiac defect. Subsequent scan revealed persistent bilateral pleural effusions (with predominance of lymphocytes). After bilateral thoracoamniotic shunt placement, the fetus did well and delivered at term. Prenatal testing revealed an S650F missense mutation in the RAF1 gene, which had not previously been associated with Noonan syndrome.

  15. Increased apical Na+ permeability in cystic fibrosis is supported by a quantitative model of epithelial ion transport

    PubMed Central

    O’Donoghue, Donal L; Dua, Vivek; Moss, Guy W J; Vergani, Paola

    2013-01-01

    Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes an anion channel. In the human lung CFTR loss causes abnormal ion transport across airway epithelial cells. As a result CF individuals produce thick mucus, suffer persistent bacterial infections and have a much reduced life expectancy. Trans-epithelial potential difference (Vt) measurements are routinely carried out on nasal epithelia of CF patients in the clinic. CF epithelia exhibit a hyperpolarised basal Vt and a larger Vt change in response to amiloride (a blocker of the epithelial Na+ channel, ENaC). Are these altered bioelectric properties solely a result of electrical coupling between the ENaC and CFTR currents, or are they due to an increased ENaC permeability associated with CFTR loss? To examine these issues we have developed a quantitative mathematical model of human nasal epithelial ion transport. We find that while the loss of CFTR permeability hyperpolarises Vt and also increases amiloride-sensitive Vt, these effects are too small to account for the magnitude of change observed in CF epithelia. Instead, a parallel increase in ENaC permeability is required to adequately fit observed experimental data. Our study provides quantitative predictions for the complex relationships between ionic permeabilities and nasal Vt, giving insights into the physiology of CF disease that have important implications for CF therapy. PMID:23732645

  16. Identification of eight mutations and three sequence variations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghanem, N.; Costes, B.; Girodon, E.

    1994-05-15

    To determine cystic fibrosis (CF) defects in a sample of 224 non-[Delta]F508 CF chromosomes, the authors used denaturing gradient gel multiplex analysis of CF transmembrane conductance regulator gene segments, a strategy based on blind exhaustive analysis rather than a search for known mutations. This process allowed detection of 11 novel variations comprising two nonsense mutations (Q890X and W1204X), a splice defect (405 + 4 A [yields] G), a frameshift (3293delA), four presumed missense mutations (S912L, H949Y, L1065P, Q1071P), and three sequence polymorphisms (R31C or 223 C/T, 3471 T/C, and T1220I or 3791 C/T). The authors describe these variations, together withmore » the associated phenotype when defects on both CF chromosomes were identified. 8 refs., 1 fig., 1 tab.« less

  17. [Autosomal-recessive renal cystic disease and congenital hepatic fibrosis: clinico-anatomic case].

    PubMed

    Rostol'tsev, K V; Burenkov, R A; Kuz'micheva, I A

    2012-01-01

    Clinico-anatomic observation of autosomal-recessive renal cystic disease and congenital hepatic fibrosis at two fetuses from the same family was done. Mutation of His3124Tyr in 58 exon of PKHD1 gene in heterozygous state was found out. The same pathomorphological changes in the epithelium of cystic renal tubules and bile ducts of the liver were noted. We suggest that the autopsy research of fetuses with congenital abnormalities, detected after prenatal ultrasonic screening, has high diagnostic importance.

  18. Carrier screening for cystic fibrosis.

    PubMed

    Dungan, Jeffrey S

    2010-03-01

    Cystic fibrosis is the first genetic disorder for which universal screening of preconceptional or prenatal patients became a component of standard prenatal care. The molecular genetics and mutation profile of the CFTR gene are complex, with a wide range of phenotypic consequences. Carrier screening can facilitate risk assessment for prospective parents to have an affected offspring, although there remains a small residual risk for carrying a mutation even with a negative screening result. There are ethnic differences with respect to disease incidence and effectiveness of carrier testing, which may complicate counseling. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  19. Cystic fibrosis transmembrane regulator gene (CFTR) is associated with abnormal enamel formation.

    PubMed

    Arquitt, C K; Boyd, C; Wright, J T

    2002-07-01

    Cystic fibrosis (CF), a chloride ion transport disorder, is caused by mutations of the cftr gene and is the most common autosomal-recessive heritable disease in Caucasians. CFTR knockout mice have enamel with crystallite defects, retained protein, and hypomineralization, suggesting a role for CFTR in enamel formation and mineralization. This investigation examined CFTR expression and elemental composition in developing murine incisor teeth. RT-PCR showed cftr mRNA expression in the normal mouse apical incisor tissue but not in the CFTR knockout tissue. Elemental analysis by energy-dispersive x-ray spectroscopy showed relatively decreased chloride in secretory-stage CF enamel. Iron and potassium were significantly increased, and calcium was significantly decreased (p value = 0.05) in the CF mature enamel. Abnormal enamel mineralization, ion concentrations, and molecular evidence of cftr mRNA expression by odontogenic cells strongly suggest that CFTR plays an important role in enamel formation.

  20. Patterns of haplotypes for 92 cystic fibrosis mutations: Variability, association and recurrence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morral, N.; Llevadot, R.; Estivill, X.

    1994-09-01

    Most CFTR mutations are very uncommon among the cystic fibrosis population, with frequencies of less than 1%, and many are found only in specific areas. We have analyzed 92 CF mutations for several markers (4 microsatellites and 3 other polymorphisms) scattered in the CFTR gene. Haplotypes associated with these mutations can be used as a framework in the screening of chromosomes carrying unknown mutations. The association between mutation and haplotype reduces the number of mutations it is necessary to search for to a maximum of 16 for the same haplotype. Only mutations {triangle}F508, G542X and N1303K are associated with moremore » than one haplotype as a result of slippage at more than one microsatellite loci, suggesting that these three are the most ancient CF mutations. Recurrence has been found for at least 7 mutations: H199Y, R347P, L558S, R553X, 2184insA, 3272-26A{r_arrow}G, 3849+10kbC{r_arrow}T and R1162X. Also microsatellite analysis of chromosomes of several ethnic origins (Czech, Italian, Russian, Slovac and Spanish) suggested that possibility of three or more independent origins for mutations R334W, R347P, R1162X, and 3849+10kbC{r_arrow}T, which was confirmed by analysis of markers flanking these mutations.« less

  1. Efficacy and safety of ivacaftor in patients aged 6 to 11 years with cystic fibrosis with a G551D mutation.

    PubMed

    Davies, Jane C; Wainwright, Claire E; Canny, Gerard J; Chilvers, Mark A; Howenstine, Michelle S; Munck, Anne; Mainz, Jochen G; Rodriguez, Sally; Li, Haihong; Yen, Karl; Ordoñez, Claudia L; Ahrens, Richard

    2013-06-01

    Ivacaftor (VX-770), a cystic fibrosis transmembrane conductance regulator (CFTR) potentiator, has been shown to improve lung function, pulmonary exacerbation rate, respiratory symptoms, and weight gain compared with placebo in patients with cystic fibrosis aged 12 years or older with a G551D-CFTR mutation. This randomized, double-blind, placebo-controlled trial evaluated ivacaftor in patients with cystic fibrosis aged 6-11 years with a G551D-CFTR mutation on at least one allele. Patients were randomly assigned to receive ivacaftor administered orally at 150 mg (n = 26) or placebo (n = 26) every 12 hours for 48 weeks in addition to existing prescribed cystic fibrosis therapies. Despite near-normal mean baseline values in FEV1, patients receiving ivacaftor had a significant increase in percent predicted FEV1 from baseline through Week 24 versus placebo group (treatment effect, 12.5 percentage points; P < 0.001). Effects on pulmonary function were evident by 2 weeks, and a significant treatment effect was maintained through Week 48. Patients treated with ivacaftor gained, on average, 2.8 kg more than those receiving placebo at Week 48 (P < 0.001). The change from baseline through Week 48 in the concentration of sweat chloride, a measure of CFTR activity, with ivacaftor was -53.5 mmol/L (P < 0.001) versus placebo. The incidence of adverse events was similar in the two groups. In patients who are younger and healthier than those in previously studied populations, ivacaftor demonstrated a significant improvement in pulmonary function, weight, and CFTR activity compared with placebo. Clinical trial registered with www.clinicaltrials.gov (NCT00909727).

  2. Efficacy and Safety of Ivacaftor in Patients Aged 6 to 11 Years with Cystic Fibrosis with a G551D Mutation

    PubMed Central

    Wainwright, Claire E.; Canny, Gerard J.; Chilvers, Mark A.; Howenstine, Michelle S.; Munck, Anne; Mainz, Jochen G.; Rodriguez, Sally; Li, Haihong; Yen, Karl; Ordoñez, Claudia L.; Ahrens, Richard

    2013-01-01

    Rationale: Ivacaftor (VX-770), a cystic fibrosis transmembrane conductance regulator (CFTR) potentiator, has been shown to improve lung function, pulmonary exacerbation rate, respiratory symptoms, and weight gain compared with placebo in patients with cystic fibrosis aged 12 years or older with a G551D-CFTR mutation. Objectives: This randomized, double-blind, placebo-controlled trial evaluated ivacaftor in patients with cystic fibrosis aged 6–11 years with a G551D-CFTR mutation on at least one allele. Methods: Patients were randomly assigned to receive ivacaftor administered orally at 150 mg (n = 26) or placebo (n = 26) every 12 hours for 48 weeks in addition to existing prescribed cystic fibrosis therapies. Measurements and Main Results: Despite near-normal mean baseline values in FEV1, patients receiving ivacaftor had a significant increase in percent predicted FEV1 from baseline through Week 24 versus placebo group (treatment effect, 12.5 percentage points; P < 0.001). Effects on pulmonary function were evident by 2 weeks, and a significant treatment effect was maintained through Week 48. Patients treated with ivacaftor gained, on average, 2.8 kg more than those receiving placebo at Week 48 (P < 0.001). The change from baseline through Week 48 in the concentration of sweat chloride, a measure of CFTR activity, with ivacaftor was −53.5 mmol/L (P < 0.001) versus placebo. The incidence of adverse events was similar in the two groups. Conclusions: In patients who are younger and healthier than those in previously studied populations, ivacaftor demonstrated a significant improvement in pulmonary function, weight, and CFTR activity compared with placebo. Clinical trial registered with www.clinicaltrials.gov (NCT00909727). PMID:23590265

  3. Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis*

    PubMed Central

    Coutinho, Cyntia Arivabeni de Araújo Correia; Marson, Fernando Augusto de Lima; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu; Bertuzzo, Carmen Silvia

    2013-01-01

    OBJECTIVE: To determine the frequency of six mutations (F508del, G542X, G551D, R553X, R1162X, and N1303K) in patients with cystic fibrosis (CF) diagnosed, at a referral center, on the basis of abnormal results in two determinations of sweat sodium and chloride concentrations. METHODS: This was a cross-sectional study involving 70 patients with CF. The mean age of the patients was 12.38 ± 9.00 years, 51.43% were female, and 94.29% were White. Mutation screening was performed with polymerase chain reaction (for F508del), followed by enzymatic digestion (for other mutations). Clinical analysis was performed on the basis of gender, age, ethnicity, pulmonary/gastrointestinal symptoms, and Shwachman-Kulczycki (SK) score. RESULTS: All of the patients showed pulmonary symptoms, and 8 had no gastrointestinal symptoms. On the basis of the SK scores, CF was determined to be mild, moderate, and severe in 22 (42.3%), 17 (32.7%), and 13 (25.0%) of the patients, respectively. There was no association between F508del mutation and disease severity by SK score. Of the 140 alleles analyzed, F508del mutation was identified in 70 (50%). Other mutations (G542X, G551D, R553X, R1162X, and N1303K) were identified in 12 (7.93%) of the alleles studied. In F508del homozygous patients with severe disease, the OR was 0.124 (95% CI: 0.005-0.826). CONCLUSIONS: In 50% of the alleles studied, the molecular diagnosis of CF was confirmed by identifying a single mutation (F508del). If we consider the analysis of the six most common mutations in the Brazilian population (including F508del), the molecular diagnosis was confirmed in 58.57% of the alleles studied. PMID:24310628

  4. [Molecular diagnosis of two Chinese cystic fibrosis children and literature review].

    PubMed

    Xu, B P; Wang, H; Zhao, Y H; Liu, J; Yao, Y; Feng, X L; Shen, K L

    2016-05-01

    To investigate the clinical manifestations and molecular features of cystic fibrosis in Chinese children. A retrospective analysis of two pediatric cystic fibrosis cases diagnosed by gene test in Beijing Children's Hospital, Capital Medical University from 2010 to 2015, and Chinese cystic fibrosis reported patients searched of"cystic fibrosis, Chinese"on Chinese databases (CNKI, Wanfang Data) and PubMed from 1975 to 2015.The clinical manifestations and molecular features were analyzed. One of the two newly diagnosed cystic fibrosis cases was a 10-year old girl who suffered from reccurent cough with expectoration and associated with cirrhosis.Sweat tests showed increased chloride twice with the lower level of 306.82 mmol/L.The other was an 8-month old boy with reccurent pneumonia from neonate, failure to thrive and fatty diarrhea.Two children had various degrees of bronchiectasis and massive sticky secretion on the bronchoscopy.They had no family history and their parents had no consanguineous marriage.CFTR mutations of c. 595C>T and c. 2290C>T were found in gene tests.On the database, twenty-one reports involving thirty-six Chinese patients (16 males and 20 females) were retrieved.Together with this group of 2 cases, a total of 38 cases were involved.The age at diagnosis was 4 months to 28 years with a median age of 10 years.All patients had reccurent respiratory infections, twenty-seven cases (71%) had malnutrition, fifteen (39%)had chronic diarrhea, and 16 cases (42%) had other digestive manifestations, including jaundice (4 cases), hepatomegaly (11 cases), ascites (2 cases) and pancreatic atrophy (3 cases). Five cases had a positive family history and six cases had a suspicious family history.Consanguineous marriage was found in three families.Sweat test revealed elevated chloride (52-327 mmol/L) in 28 cases.Eight of the 16 patients who performed pancreatic exocrine function examination showed pancreatic insufficiency.Eighteen of the 20 patients described the image manifestation of bronchiectasis.The age at death of 13 patients(34%) was 4 months to 25 years with a median of 11 years.Twenty-nine rare CFTR mutations were found in 25 tested patients, and c. 1766+ 5G>T(5 cases), c.2083dupG and c. 2684G>A (3 cases) held the top three mutation patterns. Respiratory symptoms and bronchiectasis are the main manifestations of Chinese cystic fibrosis patients, although some of them may be associated with malnutrition, digestive symptoms and pancreatic insufficiency. CFTR mutations are various and rare in Caucasians.

  5. Mechanisms of CFTR Functional Variants That Impair Regulated Bicarbonate Permeation and Increase Risk for Pancreatitis but Not for Cystic Fibrosis

    PubMed Central

    Lewis, Michele D.; Park, Hyun Woo; Brand, Randall E.; Gelrud, Andres; Anderson, Michelle A.; Banks, Peter A.; Conwell, Darwin; Lawrence, Christopher; Romagnuolo, Joseph; Baillie, John; Alkaade, Samer; Cote, Gregory; Gardner, Timothy B.; Amann, Stephen T.; Slivka, Adam; Sandhu, Bimaljit; Aloe, Amy; Kienholz, Michelle L.; Yadav, Dhiraj; Barmada, M. Michael; Bahar, Ivet; Lee, Min Goo; Whitcomb, David C.

    2014-01-01

    CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system. PMID:25033378

  6. Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.

    PubMed

    LaRusch, Jessica; Jung, Jinsei; General, Ignacio J; Lewis, Michele D; Park, Hyun Woo; Brand, Randall E; Gelrud, Andres; Anderson, Michelle A; Banks, Peter A; Conwell, Darwin; Lawrence, Christopher; Romagnuolo, Joseph; Baillie, John; Alkaade, Samer; Cote, Gregory; Gardner, Timothy B; Amann, Stephen T; Slivka, Adam; Sandhu, Bimaljit; Aloe, Amy; Kienholz, Michelle L; Yadav, Dhiraj; Barmada, M Michael; Bahar, Ivet; Lee, Min Goo; Whitcomb, David C

    2014-07-01

    CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

  7. Computed tomography correlates with improvement with ivacaftor in cystic fibrosis patients with G551D mutation.

    PubMed

    Sheikh, Shahid I; Long, Frederick R; McCoy, Karen S; Johnson, Terri; Ryan-Wenger, Nancy A; Hayes, Don

    2015-01-01

    Ivacaftor corrects the cystic fibrosis transmembrane conductance regulator (CFTR) gating defect associated with G551D mutation and is quickly becoming an important treatment in patients with cystic fibrosis (CF) due to this genetic mutation. A single-center study was performed in CF patients receiving ivacaftor to evaluate the usefulness of high resolution computed tomography (HRCT) of the chest as a way to gauge response to ivacaftor therapy. Ten patients with CF were enrolled for at least one year before and after starting ivacaftor. At time of enrollment, mean age was 20.9 ± 10.8 (range 10-44) years. There were significant improvements from baseline to 6 months in mean %FVC (93 ± 16 to 99 ± 16) and %FEV1 (79 ± 26 to 87 ± 28) but reverted to baseline at one year. Mean sweat chloride levels decreased significantly from baseline to one year. Mean weight and BMI improved at 6 months. Weight continued to improve with stabilization of BMI at one year. Chest HRCT showed significant improvement at one year in mean modified Brody scores for bronchiectasis, mucous plugging, airway wall thickness, and total Brody scores. Elevated bronchiectasis and airway wall thickness scores correlated significantly with lower %FEV1, while higher airway wall thickness and mucus plugging scores correlated with more pulmonary exacerbations requiring IV and oral antibiotics respectively. Based on our findings, HRCT imaging is a useful tool in monitoring response to ivacaftor therapy that corrects the gating defect associated with the G551D-CFTR mutation. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  8. Pharmacological correction of a defect in PPAR-gamma signaling ameliorates disease severity in Cftr-deficient mice.

    PubMed

    Harmon, Gregory S; Dumlao, Darren S; Ng, Damian T; Barrett, Kim E; Dennis, Edward A; Dong, Hui; Glass, Christopher K

    2010-03-01

    Cystic fibrosis is caused by mutations in the cystic fibrosis transmembrane conductance regulator (encoded by Cftr) that impair its role as an apical chloride channel that supports bicarbonate transport. Individuals with cystic fibrosis show retained, thickened mucus that plugs airways and obstructs luminal organs as well as numerous other abnormalities that include inflammation of affected organs, alterations in lipid metabolism and insulin resistance. Here we show that colonic epithelial cells and whole lung tissue from Cftr-deficient mice show a defect in peroxisome proliferator-activated receptor-gamma (PPAR-gamma, encoded by Pparg) function that contributes to a pathological program of gene expression. Lipidomic analysis of colonic epithelial cells suggests that this defect results in part from reduced amounts of the endogenous PPAR-gamma ligand 15-keto-prostaglandin E(2) (15-keto-PGE(2)). Treatment of Cftr-deficient mice with the synthetic PPAR-gamma ligand rosiglitazone partially normalizes the altered gene expression pattern associated with Cftr deficiency and reduces disease severity. Rosiglitazone has no effect on chloride secretion in the colon, but it increases expression of the genes encoding carbonic anhydrases 4 and 2 (Car4 and Car2), increases bicarbonate secretion and reduces mucus retention. These studies reveal a reversible defect in PPAR-gamma signaling in Cftr-deficient cells that can be pharmacologically corrected to ameliorate the severity of the cystic fibrosis phenotype in mice.

  9. Cystic fibrosis research topics featured at the 14th ECFS Basic Science Conference: Chairman's summary.

    PubMed

    Mall, Marcus A; Hwang, Tzyh-Chang; Braakman, Ineke

    2018-03-01

    In recent years, tremendous progress has been made in the development of novel drugs targeting the basic defect in patients with cystic fibrosis (CF). This breakthrough is based on a solid foundation of knowledge on CFTR's function in health and how mutations in CFTR cause CF multi-organ disease. This knowledge has been collected and continuously expanded by an active and persistent CF research community and has paved the way for precision medicine for CF. Since 2004, the European Cystic Fibrosis Society (ECFS) has held an annual Basic Science Conference that has evolved as an international forum for interdisciplinary discussion of hot topics and unsolved questions related to CF research. This Special Issue reviews CF research topics featured at the 14th ECFS Basic Science Conference and provides an up-to-date overview of recent progress in our understanding of CFTR structure and function, disease mechanisms implicated in airway mucus plugging, inflammation and abnormal host-pathogen interactions, and advancements with enhanced cell and animal model systems and breakthrough therapies directed at mutant CFTR or alternative targets. In addition, this Special Issue also identifies a number of fundamental questions and hurdles that still have to be overcome to realize the full potential of precision medicine and develop transformative therapies for all patients with CF. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  10. Cystic Fibrosis Revisited - a Review Study.

    PubMed

    Klimova, Blanka; Kuca, Kamil; Novotny, Michal; Maresova, Petra

    2017-01-01

    Cystic fibrosis (CF) is an incurable, chronic disease, which causes severe damages to respiratory and digestive tracts. It is the most common genetically inherited disease among caucasians. This disease is caused by defects in CF genes, the so-called mutations in cystic fibrosis transmembrane conductance regulator (CFTR) gene population. At present over 100,000 people suffer from this disease worldwide. The purpose of this review study is to describe the pathophysiology of CF and provide the latest information on its diagnosis and treatment therapies with respect to the improvement of patient's quality of life and emphasis on targeted specialized care. The methodological approaches include a method of literature review of available sources exploring the issue of cystic fibrosis both from a global and specific perspective point of view. A search was performed in the databases PubMed, MEDLINE, Web of Science, Scopus, Springer and ScienceDirect. Furthermore, other sources cited in the analyzed studies were also examined. On the basis of evaluation of these literature sources, the research issue was explored. The main benefits (e.g., specialized centres for the treatment of CF exist or a new breakthrough in the gene therapy of CF has been made) and limitations (e.g., comorbidity of CF, lifelong and costly treatment, or adverse impact on patient's and caregiver's quality of life) in the treatment of narcolepsy are highlighted. CF requires an integrated treatment approach in specialized CF centers, involving various factors contributing to a better patient's state of health in the form of relevant and well-balanced non-pharmacological and pharmacological therapies. In addition, further large scale clinical trials are needed in order to develop compounds that are aimed at the most common classes of CFTR. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  11. Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma.

    PubMed

    Saida, Kosuke; Murase, Takayuki; Ito, Mayuko; Fujii, Kana; Takino, Hisashi; Masaki, Ayako; Kawakita, Daisuke; Ijichi, Kei; Tada, Yuichiro; Kusafuka, Kimihide; Iida, Yoshiyuki; Onitsuka, Tetsuro; Yatabe, Yasushi; Hanai, Nobuhiro; Hasegawa, Yasuhisa; Shinomiya, Hitomi; Nibu, Ken-Ichi; Shimozato, Kazuo; Inagaki, Hiroshi

    2018-03-30

    Adenoid cystic carcinoma (AdCC), one of the most common salivary gland carcinomas, usually has a fatal outcome. Epidermal growth factor receptor (EGFR) pathway gene mutations are important in predicting a patient's prognosis and estimating the efficacy of molecular therapy targeting the EGFR pathway. In this study of salivary gland AdCC (SAdCC), we looked for gene mutations in EGFR, RAS family ( KRAS, HRAS, and NRAS ), PIK3CA, BRAF, and AKT1 , using a highly sensitive single-base extension multiplex assay, SNaPshot. Out of 70 cases, EGFR pathway missense mutations were found in 13 (18.6%): RAS mutations in 10 (14.3%), EGFR in one (1.4%), and PIK3CA in 5 (7.1%). None of the cases showed an EGFR deletion by direct sequencing. Concurrent gene mutations were found in three cases (4.3%). EGFR pathway mutations were significantly associated with a shorter disease-free ( p = 0.011) and overall survival ( p = 0.049) and RAS mutations were as well; ( p = 0.010) and ( p = 0.024), respectively. The gene fusion status as determined by a FISH assay had no significant association with mutations of the genes involved in the EGFR pathway. In conclusion, EGFR pathway mutations, especially RAS mutations, may be frequent in SAdCC, and associated with a poor prognosis for the patient.

  12. New possibilities for population control of cystic fibrosis.

    PubMed Central

    Dodge, J. A.; Boulyjenkov, V.

    1992-01-01

    Cystic fibrosis (CF), which is caused exclusively by mutation of a single gene, is inherited in autosomal recessive fashion and is the commonest such disorder in populations of Caucasian origin. Although much progress has been made during the last 50 years in its clinical management, with a corresponding improvement in the mean life expectancy in developed countries from a few months to a few decades, it remains incurable and a complete understanding of its biochemical basis is still being sought. Consequently, attention has been given to the possibility of screening for carriers of the defective gene, who represent up to 5% in some populations, so that they may be given appropriate genetic counselling. Whereas previously carriers were identified only when they became parents of affected children, in recent years carriers who were more distantly related to CF patients have often been identified by means of genetic linkage techniques. A new strategy for the control of CF at the population level is now proposed. It is based on the report of a joint WHO/ICF(M)A (International Cystic Fibrosis (Mucoviscidosis) Association) Task Force on CF which met in November 1990. PMID:1464143

  13. Measurement of nasal potential difference in young children with an equivocal sweat test following newborn screening for cystic fibrosis.

    PubMed

    Sermet-Gaudelus, Isabelle; Girodon, Emmanuelle; Roussel, Delphine; Deneuville, Eric; Bui, Stéphanie; Huet, Frédéric; Guillot, Marcel; Aboutaam, Rola; Renouil, Michel; Munck, Anne; des Georges, Marie; Iron, Albert; Thauvin-Robinet, Christel; Fajac, Isabelle; Lenoir, Gerard; Roussey, Michel; Edelman, Aleksander

    2010-06-01

    A challenging problem arising from cystic fibrosis (CF) newborn screening is the significant number of infants with hypertrypsinaemia (HIRT) with sweat chloride levels in the intermediate range and only one or no identified CF-causing mutations. To investigate the diagnostic value for CF of assessing CF transmembrane conductance regulator (CFTR) protein function by measuring nasal potential difference in children with HIRT. A specially designed protocol was used to assess nasal potential difference (NPD) in 23 young children with HIRT (3 months-4 years) with inconclusive neonatal screening. Results were analysed with a composite score including CFTR-dependent sodium and chloride secretion. Results were correlated with genotype after extensive genetic screening and with clinical phenotype at follow-up 3 years later. NPD was interpretable for 21 children with HIRT: 13 had NPD composite scores in the CF range. All 13 were finally found to carry two CFTR mutations. At follow-up, nine had developed a chronic pulmonary disease consistent with a CF diagnosis. The sweat test could be repeated in nine children, and six had sweat chloride values >or=60 mmol/l. Of the eight children with normal NPD scores, only two had two CFTR mutations, both wide-spectrum mutations. None had developed a CF-like lung disease at follow-up. The sweat test could be reassessed in five of these eight children and all had sweat chloride values <60 mmol/l. CF diagnosis was ruled out in six of these eight children. Evaluation of CFTR function in the nasal epithelium of young children with inconclusive results at CF newborn screening is a useful diagnostic tool for CF.

  14. Genetic rearrangements, hotspot mutations, and microRNA expression in the progression of metastatic adenoid cystic carcinoma of the salivary gland

    PubMed Central

    Andreasen, Simon; Agander, Tina Klitmøller; Bjørndal, Kristine; Erentaite, Daiva; Heegaard, Steffen; Larsen, Stine R.; Melchior, Linea Cecilie; Tan, Qihua; Ulhøi, Benedicte Parm; Wessel, Irene; Homøe, Preben

    2018-01-01

    Adenoid cystic carcinoma (ACC) is among the most common salivary gland malignancies, and is notorious for its unpredictable clinical course with frequent local recurrences and metastatic spread. However, the molecular mechanisms for metastatic spread are poorly understood. This malignancy is known to frequently harbor gene fusions involving MYB, MYBL1, and NFIB, and to have a low mutational burden. Most studies have focused on primary tumors to understand the biology of ACC, but this has not revealed a genetic cause for metastatic dissemination in the majority of cases. Hence, other molecular mechanisms are likely to be involved. Here, we characterize the genetic and microRNA expressional landscape of primary ACC and corresponding metastatic lesions from 11 patients. FISH demonstrated preservation of MYB aberrations between primary tumors and metastases, and targeted next-generation sequencing identified mutations exclusive for the metastatic lesions in 3/11 cases (27.3%). Global microRNA profiling identified several differentially expressed miRNAs between primary ACC and metastases as compared to normal salivary gland tissue. Interestingly, individual tumor pairs differed in miRNA profile, but there was no general difference between primary ACCs and metastases. Collectively, we show that MYB and NFIB aberrations are consistently preserved in ACC metastatic lesions, and that additional mutations included in the 50-gene hotspot panel used are infrequently acquired by the metastatic lesions. In contrast, tumor pairs differ in microRNA expression and our data suggest that they are heterogeneous according to their microRNA profile. This adds an additional layer to the complex process of ACC metastatic spread. PMID:29731974

  15. Personalized oncogenomic analysis of metastatic adenoid cystic carcinoma: using whole-genome sequencing to inform clinical decision-making

    PubMed Central

    Chahal, Manik; Pleasance, Erin; Grewal, Jasleen; Zhao, Eric; Ng, Tony; Chapman, Erin; Jones, Martin R.; Shen, Yaoqing; Mungall, Karen L.; Bonakdar, Melika; Taylor, Gregory A.; Ma, Yussanne; Mungall, Andrew J.; Moore, Richard A.; Lim, Howard; Renouf, Daniel; Yip, Stephen; Jones, Steven J.M.; Marra, Marco A.; Laskin, Janessa

    2018-01-01

    Metastatic adenoid cystic carcinomas (ACCs) can cause significant morbidity and mortality. Because of their slow growth and relative rarity, there is limited evidence for systemic therapy regimens. Recently, molecular profiling studies have begun to reveal the genetic landscape of these poorly understood cancers, and new treatment possibilities are beginning to emerge. The objective is to use whole-genome and transcriptome sequencing and analysis to better understand the genetic alterations underlying the pathology of metastatic and rare ACCs and determine potentially actionable therapeutic targets. We report five cases of metastatic ACC, not originating in the salivary glands, in patients enrolled in the Personalized Oncogenomics (POG) Program at the BC Cancer Agency. Genomic workup included whole-genome and transcriptome sequencing, detailed analysis of tumor alterations, and integration with existing knowledge of drug–target combinations to identify potential therapeutic targets. Analysis reveals low mutational burden in these five ACC cases, and mutation signatures that are commonly observed in multiple cancer types. Notably, the only recurrent structural aberration identified was the well-described MYB-NFIB fusion that was present in four of five cases, and one case exhibited a closely related MYBL1-NFIB fusion. Recurrent mutations were also identified in BAP1 and BCOR, with additional mutations in individual samples affecting NOTCH1 and the epigenetic regulators ARID2, SMARCA2, and SMARCB1. Copy changes were rare, and they included amplification of MYC and homozygous loss of CDKN2A in individual samples. Genomic analysis revealed therapeutic targets in all five cases and served to inform a therapeutic choice in three of the cases to date. PMID:29610392

  16. A European regulatory perspective on cystic fibrosis: current treatments, trends in drug development and translational challenges for CFTR modulators.

    PubMed

    Ponzano, Stefano; Nigrelli, Giulia; Fregonese, Laura; Eichler, Irmgard; Bertozzi, Fabio; Bandiera, Tiziano; Galietta, Luis J V; Papaluca, Marisa

    2018-06-30

    In this article we analyse the current authorised treatments and trends in early drug development for cystic fibrosis (CF) in the European Union for the time period 2000-2016. The analysis indicates a significant improvement in the innovation and development of new potential medicines for CF, shifting from products that act on the symptoms of the disease towards new therapies targeting the cause of CF. However, within these new innovative medicines, results for CF transmembrane conductance regulator (CFTR) modulators indicate that one major challenge for turning a CF concept product into an actual medicine for the benefit of patients resides in the fact that, although pre-clinical models have shown good predictability for certain mutations, a good correlation to clinical end-points or biomarkers ( e.g. forced expiratory volume in 1 s and sweat chloride) for all mutations has not yet been achieved. In this respect, the use of alternative end-points and innovative nonclinical models could be helpful for the understanding of those translational discrepancies. Collaborative endeavours to promote further research and development in these areas as well as early dialogue with the regulatory bodies available at the European competent authorities are recommended. Copyright ©ERS 2018.

  17. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerem, B.; Zielenski, J.; Markiewicz, D.

    1990-11-01

    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probablymore » affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.« less

  18. Clinical expression of patients with the D1152H CFTR mutation.

    PubMed

    Terlizzi, Vito; Carnovale, Vincenzo; Castaldo, Giuseppe; Castellani, Carlo; Cirilli, Natalia; Colombo, Carla; Corti, Fabiola; Cresta, Federico; D'Adda, Alice; Lucarelli, Marco; Lucidi, Vincenzina; Macchiaroli, Annamaria; Madarena, Elisa; Padoan, Rita; Quattrucci, Serena; Salvatore, Donatello; Zarrilli, Federica; Raia, Valeria

    2015-07-01

    Discordant results were reported on the clinical expression of subjects bearing the D1152H CFTR mutation, and also for the small number of cases reported so far. A retrospective review of clinical, genetic and biochemical data was performed from individuals homozygous or compound heterozygous for the D1152H mutation followed in 12 Italian cystic fibrosis (CF) centers. 89 subjects carrying at least D1152H on one allele were identified. 7 homozygous patients had very mild clinical expression. Over half of the 74 subjects compound heterozygous for D1152H and a I-II-III class mutation had borderline or pathological sweat test and respiratory or gastrointestinal symptoms; one third had pulmonary bacteria colonization and 10/74 cases had complications (i.e. diabetes, allergic bronchopulmonary aspergillosis, and hemoptysis). However, their clinical expression was less severe as compared to a group of CF patients homozygous for the F508del mutation. Finally, 8 subjects compound heterozygous for D1152H and a IV-V class mutation showed very mild disease. The natural history of subjects bearing the D1152H mutation is widely heterogeneous and is influenced by the mutation in trans. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  19. Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iovannisci, D.; Brown, C.; Winn-Deen, E.

    1994-09-01

    The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

  20. Orphan missense mutations in the cystic fibrosis transmembrane conductance regulator: A three-step biological approach to establishing a correlation between genotype and phenotype.

    PubMed

    Fresquet, Fleur; Clement, Romain; Norez, Caroline; Sterlin, Adélaïde; Melin, Patricia; Becq, Frédéric; Kitzis, Alain; Thoreau, Vincent; Bilan, Frédéric

    2011-09-01

    More than 1860 mutations have been found within the human cystic fibrosis transmembrane conductance regulator (CFTR) gene sequence. These mutations can be classified according to their degree of severity in CF disease. Although the most common mutations are well characterized, few data are available for rare mutations. Thus, genetic counseling is particularly difficult when fetuses or patients with CF present these orphan variations. We describe a three-step in vitro assay that can evaluate rare missense CFTR mutation consequences to establish a correlation between genotype and phenotype. By using a green fluorescent protein-tagged CFTR construct, we expressed mutated proteins in COS-7 cells. CFTR trafficking was visualized by confocal microscopy, and the cellular localization of CFTR was determined using intracellular markers. We studied the CFTR maturation process using Western blot analysis and evaluated CFTR channel activity by automated iodide efflux assays. Of six rare mutations that we studied, five have been isolated in our laboratory. The cellular and functional impact that we observed in each case was compared with the clinical data concerning the patients in whom we encountered these mutations. In conclusion, we propose that performing this type of analysis for orphan CFTR missense mutations can improve CF genetic counseling. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  1. Quorum quenching quandary: resistance to antivirulence compounds

    PubMed Central

    Maeda, Toshinari; García-Contreras, Rodolfo; Pu, Mingming; Sheng, Lili; Garcia, Luis Rene; Tomás, Maria; Wood, Thomas K

    2012-01-01

    Quorum sensing (QS) is the regulation of gene expression in response to the concentration of small signal molecules, and its inactivation has been suggested to have great potential to attenuate microbial virulence. It is assumed that unlike antimicrobials, inhibition of QS should cause less Darwinian selection pressure for bacterial resistance. Using the opportunistic pathogen Pseudomonas aeruginosa, we demonstrate here that bacterial resistance arises rapidly to the best-characterized compound that inhibits QS (brominated furanone C-30) due to mutations that increase the efflux of C-30. Critically, the C-30-resistant mutant mexR was more pathogenic to Caenorhabditis elegans in the presence of C-30, and the same mutation arises in bacteria responsible for chronic cystic fibrosis infections. Therefore, bacteria may evolve resistance to many new pharmaceuticals thought impervious to resistance. PMID:21918575

  2. Potentiators (specific therapies for class III and IV mutations) for cystic fibrosis.

    PubMed

    Patel, Sanjay; Sinha, Ian P; Dwan, Kerry; Echevarria, Carlos; Schechter, Michael; Southern, Kevin W

    2015-03-26

    Cystic fibrosis is the most common inherited life-shortening illness in Caucasians and caused by a mutation in the gene that codes for the cystic fibrosis transmembrane regulator protein (CFTR), which functions as a salt transporter. This mutation most notably affects the airways of people with cystic fibrosis. Excess salt absorption by defective CFTR dehydrates the airway lining and leads to defective mucociliary clearance. Consequent accumulation of thick, sticky mucus makes the airway prone to chronic infection and progressive inflammation; respiratory failure often ensues. Additionally, abnormalities with CFTR lead to systemic complications like malnutrition, diabetes and subfertility.Since the discovery of the causative gene, our understanding of the structure and function of CFTR and the impact of different mutations has increased and allowed pharmaceutical companies to design new mutation-specific therapies targeting the underlying molecular defect. Therapies targeting mutation classes III and IV (CFTR potentiators) aim to normalise airway surface liquid and help re-establish mucociliary clearance, which then has a beneficial impact on the chronic infection and inflammation that characterizes lung disease in people with cystic fibrosis. These therapies may also affect other mutations. To evaluate the effects of CFTR potentiators on clinically important outcomes in children and adults with cystic fibrosis. We searched the Cochrane Cystic Fibrosis Trials Register, compiled from electronic database searches and handsearching of journals and conference abstract books. We also searched the reference lists of relevant articles and reviews. Last search: 05 March 2015.We searched the EU Clinical Trials Register, clinicaltrials.gov (US Clinical Trials Register) and the International Clinical Trials Registry Platform (ICTRP). Last search of clinical trial registries: 06 February 2014. Randomised controlled trials of parallel design comparing CFTR potentiators to placebo in people with cystic fibrosis. In a post hoc change we excluded trials combining CFTR potentiators with other mutation-specific therapies. These will be considered in a separate review. The authors independently extracted data and assessed the risk of bias in included trials; they contacted trial authors for additional data. Meta-analyses were undertaken on outcomes at a number of time points. We included four randomised controlled trials (n = 378), lasting from 28 days to 48 weeks, comparing the potentiator ivacaftor to placebo. Trials differed in terms of design and participant eligibility criteria, which limited the meta-analyses. The phase 2 trial (n = 19) and two phase 3 trials (adult trial (n = 167), paediatric trial (n = 52)), recruited participants with the G551D mutation (class III). The fourth trial (n = 140) enrolled participants homozygous for the ΔF508 mutation (class II).Risks of bias in the trials were moderate. Random sequence generation, allocation concealment and blinding of trial personnel were well-documented. Participant blinding was less clear throughout all trials; in three trials, some participant data were excluded from the analysis. Selective outcome reporting was apparent in three trials. All trials were sponsored by industry and supported by other non-pharmaceutical funding bodies.No trial reported any deaths. Significantly higher quality of life scores in the respiratory domain were reported by the adult phase 3 G551D trial at 24 weeks, mean difference 8.10 (95% confidence interval (CI) 4.77 to 11.43) and 48 weeks, mean difference 8.60 (95% CI 5.27 to 11.93); but not by the paediatric phase 3 G551D trial. The adult phase 3 G551D trial reported improvements in relative change from baseline in forced expiratory volume at one second at 24 weeks, mean difference 16.90% (95% CI 13.60 to 20.20) and 48 weeks, mean difference 16.80% (95% CI 13.50 to 20.10); as did the paediatric G551D trial at 24 weeks, mean difference 17.4% (P < 0.0001)). No improvements in quality of life or lung function were reported in the ΔF508 participants.Combined data from both phase 3 G551D trials demonstrated increased reporting of cough, odds ratio 0.57 (95% CI 0.33 to 1.00) and increased episodes of decreased pulmonary function, odds ratio 0.29 (95% CI 0.10 to 0.82) in the placebo group. The adult phase 3 G551D trial demonstrated increased reporting of dizziness amongst the ivacaftor group, OR 10.55 (95% CI 1.32 to 84.47). No trial showed a difference between treatment arms in the number of participants interrupting or discontinuing the trial drug.In the phase 3 G551D trials, fewer participants assigned to ivacaftor developed serious pulmonary exacerbations. When considering all data for exacerbations, participants taking ivacaftor in the adult phase 3 G551D study developed fewer exacerbations, odds ratio 0.54 (95% CI 0.29 to 1.01). In the other G551D studies and in the ΔF508 study, there was no difference between groups in the number of participants who developed pulmonary exacerbations.Combined data from both phase 3 G551D trials demonstrated significant improvements in absolute change from baseline in forced expiratory volume at one second (% predicted) at 24 weeks, mean difference 10.80% (95% CI 8.91 to 12.69) and 48 weeks, mean difference 10.44% (95% CI 8.56 to 12.32); also in weight at 24 weeks, mean difference 2.37 kg (95% CI 1.68 to 3.06) and 48 weeks, mean difference 2.75 kg (95% CI 1.74 to 3.75). No improvements in these outcomes were reported in the ΔF508 participants.Significant reductions in sweat chloride concentration were reported in both G551D and ΔF508 participants: in combined data from both phase 3 G551D trials at 24 weeks, mean difference -48.98 mmol/L (95% CI -52.07 to -45.89) and 48 weeks, mean difference -49.03 mmol/L (95% CI -52.11 to -45.94); and from the ΔF508 trial at 16 weeks, mean difference -2.90 mmol/L (95% CI -5.60 to -0.20). Both G551D phase 3 trials (n = 219) demonstrated a clinically relevant impact of the potentiator ivacaftor on outcomes at 24 and 48 weeks, providing evidence for the use of this treatment in adults and children (over six years of age) with cystic fibrosis and the G551D mutation (class III). There is no evidence to support the use of ivacaftor in people with the ΔF508 mutation (class II) (n = 140). Trials on ivacaftor in people with different mutations are ongoing.

  3. Chloride and sodium ion concentrations in saliva and sweat as a method to diagnose cystic fibrosis.

    PubMed

    Gonçalves, Aline Cristina; Marson, Fernando Augusto Lima; Mendonça, Regina Maria Holanda; Bertuzzo, Carmen Sílvia; Paschoal, Ilma Aparecida; Ribeiro, José Dirceu; Ribeiro, Antônio Fernando; Levy, Carlos Emílio

    2018-05-19

    Cystic fibrosis diagnosis is dependent on the chloride ion concentration in the sweat test (≥60mEq/mL - recognized as the gold standard indicator for cystic fibrosis diagnosis). Moreover, the salivary glands express the CFTR protein in the same manner as sweat glands. Given this context, the objective was to verify the correlation of saliva chloride concentration and sweat chloride concentration, and between saliva sodium concentration and sweat sodium concentration, in patients with cystic fibrosis and healthy control subjects, as a tool for cystic fibrosis diagnosis. There were 160 subjects enrolled: 57/160 (35.70%) patients with cystic fibrosis and two known CFTR mutations and 103/160 (64.40%) healthy controls subjects. Saliva ion concentration was analyzed by ABL 835 Radiometer ® equipment and, sweat chloride concentration and sweat sodium concentration, respectively, by manual titration using the mercurimetric procedure of Schales & Schales and flame photometry. Statistical analysis was performed by the chi-squared test, the Mann-Whitney test, and Spearman's correlation. Alpha=0.05. Patients with cystic fibrosis showed higher values of sweat chloride concentration, sweat sodium concentration, saliva chloride concentration, and saliva sodium concentration than healthy controls subjects (p-value<0.001). The correlation between saliva chloride concentration and sweat chloride concentration showed a positive Spearman's Rho (correlation coefficient)=0.475 (95% CI=0.346 to 0.587). Also, the correlation between saliva sodium concentration and sweat sodium concentration showed a positive Spearman's Rho=0.306 (95% CI=0.158 to 0.440). Saliva chloride concentration and saliva sodium concentration are candidates to be used in cystic fibrosis diagnosis, mainly in cases where it is difficult to achieve the correct sweat amount, and/or CFTR mutation screening is difficult, and/or reference methods for sweat test are unavailable to implement or are not easily accessible by the general population. Copyright © 2018 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  4. GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

    1994-09-01

    GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

  5. Postnatal airway growth in cystic fibrosis piglets.

    PubMed

    Adam, Ryan J; Abou Alaiwa, Mahmoud H; Bouzek, Drake C; Cook, Daniel P; Gansemer, Nicholas D; Taft, Peter J; Powers, Linda S; Stroik, Mallory R; Hoegger, Mark J; McMenimen, James D; Hoffman, Eric A; Zabner, Joseph; Welsh, Michael J; Meyerholz, David K; Stoltz, David A

    2017-09-01

    Mutations in the gene encoding the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) anion channel cause CF. The leading cause of death in the CF population is lung disease. Increasing evidence suggests that in utero airway development is CFTR-dependent and that developmental abnormalities may contribute to CF lung disease. However, relatively little is known about postnatal CF airway growth, largely because such studies are limited in humans. Therefore, we examined airway growth and lung volume in a porcine model of CF. We hypothesized that CF pigs would have abnormal postnatal airway growth. To test this hypothesis, we performed CT-based airway and lung volume measurements in 3-wk-old non-CF and CF pigs. We found that 3-wk-old CF pigs had tracheas of reduced caliber and irregular shape. Their bronchial lumens were reduced in size proximally but not distally, were irregularly shaped, and had reduced distensibility. Our data suggest that lack of CFTR results in aberrant postnatal airway growth and development, which could contribute to CF lung disease pathogenesis. NEW & NOTEWORTHY This CT scan-based study of airway morphometry in the cystic fibrosis (CF) postnatal period is unique, as analogous studies in humans are greatly limited for ethical and technical reasons. Findings such as reduced airway lumen area and irregular caliber suggest that airway growth and development are CF transmembrane conductance regulator-dependent and that airway growth defects may contribute to CF lung disease pathogenesis. Copyright © 2017 the American Physiological Society.

  6. Monoallelic Mutations to DNAJB11 Cause Atypical Autosomal-Dominant Polycystic Kidney Disease.

    PubMed

    Cornec-Le Gall, Emilie; Olson, Rory J; Besse, Whitney; Heyer, Christina M; Gainullin, Vladimir G; Smith, Jessica M; Audrézet, Marie-Pierre; Hopp, Katharina; Porath, Binu; Shi, Beili; Baheti, Saurabh; Senum, Sarah R; Arroyo, Jennifer; Madsen, Charles D; Férec, Claude; Joly, Dominique; Jouret, François; Fikri-Benbrahim, Oussamah; Charasse, Christophe; Coulibaly, Jean-Marie; Yu, Alan S; Khalili, Korosh; Pei, York; Somlo, Stefan; Le Meur, Yannick; Torres, Vicente E; Harris, Peter C

    2018-05-03

    Autosomal-dominant polycystic kidney disease (ADPKD) is characterized by the progressive development of kidney cysts, often resulting in end-stage renal disease (ESRD). This disorder is genetically heterogeneous with ∼7% of families genetically unresolved. We performed whole-exome sequencing (WES) in two multiplex ADPKD-like pedigrees, and we analyzed a further 591 genetically unresolved, phenotypically similar families by targeted next-generation sequencing of 65 candidate genes. WES identified a DNAJB11 missense variant (p.Pro54Arg) in two family members presenting with non-enlarged polycystic kidneys and a frameshifting change (c.166_167insTT) in a second family with small renal and liver cysts. DNAJB11 is a co-factor of BiP, a key chaperone in the endoplasmic reticulum controlling folding, trafficking, and degradation of secreted and membrane proteins. Five additional multigenerational families carrying DNAJB11 mutations were identified by the targeted analysis. The clinical phenotype was consistent in the 23 affected members, with non-enlarged cystic kidneys that often evolved to kidney atrophy; 7 subjects reached ESRD from 59 to 89 years. The lack of kidney enlargement, histologically evident interstitial fibrosis in non-cystic parenchyma, and recurring episodes of gout (one family) suggested partial phenotypic overlap with autosomal-dominant tubulointerstitial diseases (ADTKD). Characterization of DNAJB11-null cells and kidney samples from affected individuals revealed a pathogenesis associated with maturation and trafficking defects involving the ADPKD protein, PC1, and ADTKD proteins, such as UMOD. DNAJB11-associated disease is a phenotypic hybrid of ADPKD and ADTKD, characterized by normal-sized cystic kidneys and progressive interstitial fibrosis resulting in late-onset ESRD. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis?

    PubMed

    Eaton, T E; Weiner Miller, P; Garrett, J E; Cutting, G R

    2002-05-01

    Previous work suggests that cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations may be implicated in the aetiology of allergic bronchopulmonary aspergilosis (ABPA). To compare the frequency of CF gene mutations in asthmatics with ABPA of varying severity with asthmatics who were skin prick test (SPT)-positive to Aspergillus fumigatus (Af) without evidence of ABPA and asthmatics SPT-negative to Af. Thirty-one Caucasian patients with ABPA were identified, together with asthmatics SPT positive to Af without evidence of ABPA (n = 23) and SPT negative to Af (n = 28). Genomic DNA was tested for 16 CF mutations accounting for approximately 85% of CF alleles in Caucasian New Zealanders. Four (12.9%) ABPA patients were found to be carriers of a CF mutation (DeltaF508 n = 3, R117H n = 1), one (4.3%) asthmatic SPT positive to Af without ABPA (DeltaF508), and one (3.6%) asthmatic SPT negative to Af (R117H). All patients with a CF mutation had normal sweat chloride (< 40 mM). There was no significant difference between the frequency of CF mutations in the ABPA patients and asthmatics without ABPA. However, the frequency of CF mutations in the ABPA patients was significantly different (P = 0.0125) to the expected carrier rate in the general population. These results lend further support to a possible link between CF mutations and ABPA.

  8. Mutation analysis of the cystic fibrosis transmembrane regulator gene in native American populations of the southwest

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grebe, T.A.; Doane, W.W.; Norman, R.A.

    1992-10-01

    The authors report DNA and clinical analysis of cystic fibrosis (CF) in two previously unstudied, genetically isolated populations: Pueblo and Navajo Native Americans. Direct mutation analysis of six mutations of the CFTR gene - namely, [Delta]F508, G542X, G551D, R553X, N1303K, and W1282X - was performed on PCR-amplified genomic DNA extracted from blood samples. Haplotype analyses with marker/enzyme pairs XV2c/TaqI and KM29/PstI were performed as well. Of the 12 affected individuals studied, no [Delta]F508 mutation was detected; only one G542X mutation was found. None of the other mutations was detected. All affected individuals have either an AA, AC, or CC haplotype,more » except for the one carrying the G542X mutation, who has the haplotye AB. Clinically, six of the affected individuals examined exhibit growth deficiency, and five (all from the Zuni Pueblo) have a severe CF phenotype. Four of the six Zunis with CF are also microcephalic, a finding not previously noted in CF patients. The DNA data have serious implications for risk assessment of CF carrier status for these people. 14 refs., 3 tabs.« less

  9. Four novel cystic fibrosis mutations in splice junction sequences affecting the CFTR nucleotide binding folds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Doerk, T.; Wulbrand, U.; Tuemmler, B.

    1993-03-01

    Single cases of the four novel splice site mutations 1525[minus]1 G [r arrow] A (intron 9), 3601[minus]2 A [r arrow] G (intron 18), 3850[minus]3 T [r arrow] G (intron 19), and 4374+1 G [r arrow] T (intron 23) were detected in the CFTR gene of cystic fibrosis patients of Indo-Iranian, Turkish, Polish, and Germany descent. The nucleotide substitutions at the +1, [minus]1, and [minus]2 positions all destroy splice sites and lead to severe disease alleles associated with features typical of gastrointestinal and pulmonary cystic fibrosis disease. The 3850[minus]3 T-to-G change was discovered in a very mildly affected 33-year-old [Delta]F508 compoundmore » heterozygote, suggesting that the T-to-G transversion at the less conserved [minus]3 position of the acceptor splice site may retain some wildtype function. 13 refs., 1 fig., 2 tabs.« less

  10. ALDH1A3 Mutations Cause Recessive Anophthalmia and Microphthalmia

    PubMed Central

    Fares-Taie, Lucas; Gerber, Sylvie; Chassaing, Nicolas; Clayton-Smith, Jill; Hanein, Sylvain; Silva, Eduardo; Serey, Margaux; Serre, Valérie; Gérard, Xavier; Baumann, Clarisse; Plessis, Ghislaine; Demeer, Bénédicte; Brétillon, Lionel; Bole, Christine; Nitschke, Patrick; Munnich, Arnold; Lyonnet, Stanislas; Calvas, Patrick; Kaplan, Josseline; Ragge, Nicola; Rozet, Jean-Michel

    2013-01-01

    Anophthalmia and microphthalmia (A/M) are early-eye-development anomalies resulting in absent or small ocular globes, respectively. A/M anomalies occur in syndromic or nonsyndromic forms. They are genetically heterogeneous, some mutations in some genes being responsible for both anophthalmia and microphthalmia. Using a combination of homozygosity mapping, exome sequencing, and Sanger sequencing, we identified homozygosity for one splice-site and two missense mutations in the gene encoding the A3 isoform of the aldehyde dehydrogenase 1 (ALDH1A3) in three consanguineous families segregating A/M with occasional orbital cystic, neurological, and cardiac anomalies. ALDH1A3 is a key enzyme in the formation of a retinoic acid gradient along the dorso-ventral axis during early eye development. Transitory expression of mutant ALDH1A3 open reading frames showed that both missense mutations reduce the accumulation of the enzyme, potentially leading to altered retinoic acid synthesis. Although the role of retinoic acid signaling in eye development is well established, our findings provide genetic evidence of a direct link between retinoic-acid-synthesis dysfunction and early-eye-development anomalies in humans. PMID:23312594

  11. VX-809 corrects folding defects in cystic fibrosis transmembrane conductance regulator protein through action on membrane-spanning domain 1

    PubMed Central

    Ren, Hong Yu; Grove, Diane E.; De La Rosa, Oxana; Houck, Scott A.; Sopha, Pattarawut; Van Goor, Fredrick; Hoffman, Beth J.; Cyr, Douglas M.

    2013-01-01

    Cystic fibrosis (CF) is a fatal genetic disorder associated with defective hydration of lung airways due to the loss of chloride transport through the CF transmembrane conductance regulator protein (CFTR). CFTR contains two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory domain, and its channel assembly requires multiple interdomain contacts. The most common CF-causing mutation, F508del, occurs in NBD1 and results in misfolding and premature degradation of F508del-CFTR. VX-809 is an investigational CFTR corrector that partially restores CFTR function in people who are homozygous for F508del-CFTR. To identify the folding defect(s) in F508del-CFTR that must be repaired to treat CF, we explored the mechanism of VX-809 action. VX-809 stabilized an N-terminal domain in CFTR that contains only MSD1 and efficaciously restored function to CFTR forms that have missense mutations in MSD1. The action of VX-809 on MSD1 appears to suppress folding defects in F508del-CFTR by enhancing interactions among the NBD1, MSD1, and MSD2 domains. The ability of VX-809 to correct F508del-CFTR is enhanced when combined with mutations that improve F508del-NBD1 interaction with MSD2. These data suggest that the use of VX-809 in combination with an additional CFTR corrector that suppresses folding defects downstream of MSD1 may further enhance CFTR function in people with F508del-CFTR. PMID:23924900

  12. VX-809 corrects folding defects in cystic fibrosis transmembrane conductance regulator protein through action on membrane-spanning domain 1.

    PubMed

    Ren, Hong Yu; Grove, Diane E; De La Rosa, Oxana; Houck, Scott A; Sopha, Pattarawut; Van Goor, Fredrick; Hoffman, Beth J; Cyr, Douglas M

    2013-10-01

    Cystic fibrosis (CF) is a fatal genetic disorder associated with defective hydration of lung airways due to the loss of chloride transport through the CF transmembrane conductance regulator protein (CFTR). CFTR contains two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory domain, and its channel assembly requires multiple interdomain contacts. The most common CF-causing mutation, F508del, occurs in NBD1 and results in misfolding and premature degradation of F508del-CFTR. VX-809 is an investigational CFTR corrector that partially restores CFTR function in people who are homozygous for F508del-CFTR. To identify the folding defect(s) in F508del-CFTR that must be repaired to treat CF, we explored the mechanism of VX-809 action. VX-809 stabilized an N-terminal domain in CFTR that contains only MSD1 and efficaciously restored function to CFTR forms that have missense mutations in MSD1. The action of VX-809 on MSD1 appears to suppress folding defects in F508del-CFTR by enhancing interactions among the NBD1, MSD1, and MSD2 domains. The ability of VX-809 to correct F508del-CFTR is enhanced when combined with mutations that improve F508del-NBD1 interaction with MSD2. These data suggest that the use of VX-809 in combination with an additional CFTR corrector that suppresses folding defects downstream of MSD1 may further enhance CFTR function in people with F508del-CFTR.

  13. The diagnosis of cystic fibrosis.

    PubMed

    De Boeck, Kris; Vermeulen, Francois; Dupont, Lieven

    2017-06-01

    Establishing the diagnosis of cystic fibrosis (CF) is straight forward in the majority of patients: they present with a clear clinical picture (most frequently chronic respiratory symptoms plus malabsorption), the sweat chloride value is>60mmol/L and two known disease causing CFTR mutations are identified. In less than 5% of subjects, mainly those with a milder or limited phenotype, the diagnostic process is more complex, because initial diagnostic test results are inconclusive: sweat chloride concentration in the intermediate range, less than 2 CF causing mutations identified or both. These patients should be referred to expert centers where bioassays of CFTR function like nasal potential difference measurement or intestinal current measurement can be done. Still, in some patients, despite symptoms compatible with CF and some indication of CFTR dysfunction (e.g. only intermediate sweat chloride value), diagnostic criteria are not met (e.g. only 1 CFTR mutation identified). For these subjects, the term CFTR related disorder (CFTR-RD) is used. Patients with disseminated bronchiectasis, congenital bilateral absence of the vas deferens and acute or recurrent pancreatitis may fall in this category. CF has a very wide disease spectrum and increasingly the diagnosis is being made during adult life, mainly in subjects with milder phenotypes. In many countries, nationwide CF newborn screening (NBS) has been introduced. In screen positive babies, the diagnosis of CF must be confirmed by a sweat test demonstrating a sweat chloride concentration above 60mmol/L. To achieve the benefit of NBS, every baby in whom the diagnosis of CF is confirmed must receive immediate follow-up and treatment in a CF reference center. CF NBS is not full proof: some diagnoses will be missed and in some babies the diagnosis cannot be confirmed nor ruled out with certainty. Screening algorithms that include gene sequencing will detect a high number of such babies that are screen positive with an inconclusive diagnosis (CFSPID). Even in 2016, the most reliable and widely available diagnostic test for CF is the measurement of chloride concentration in sweat. The method of choice is sweat induction by pilocarpine iontophoresis, followed by sweat collection on a gauze or filter paper or in a Macroduct coil. Since mutation specific therapies have become available, it is important to identify the mutations responsible for CF in each individual patient. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. A familial case of achondrogenesis type II caused by a dominant COL2A1 mutation and "patchy" expression in the mosaic father.

    PubMed

    Forzano, F; Lituania, M; Viassolo, A; Superti-Furga, V; Wildhardt, G; Zabel, B; Faravelli, F

    2007-12-01

    Achondrogenesis type II (ACG2) is the most severe disorder that can be produced by dominant mutations in COL2A1. We report on four pregnancies of an apparently healthy, nonconsanguineous young couple. The father had scoliosis as a child, and has slight body disproportion with short trunk. The first child was born at 32 weeks and died neonatally. In the second pregnancy, short limbs and fetal hygroma were noted on ultrasound at 17 weeks' gestation. Similar findings were observed in the third fetus. Clinical, radiological, and histological evaluation of the fetuses after termination of the pregnancies showed findings consistent with ACG2. Molecular analysis of genomic DNA extracted from amniotic cells of the second and third fetuses revealed heterozygosity for a 10370G > T missense mutation (G346V) in the COL2A1 gene. This mutation was also found in the father, as a mosaic. The couple had a fourth pregnancy, and at 11 weeks fetal hydrops with a septated cystic hygroma were obvious. DNA from CVS demonstrated the same COL2A1 mutation. (c) 2007 Wiley-Liss, Inc.

  15. Mendelian diseases among Roman Jews: implications for the origins of disease alleles.

    PubMed

    Oddoux, C; Guillen-Navarro, E; Ditivoli, C; Dicave, E; Cilio, M R; Clayton, C M; Nelson, H; Sarafoglou, K; McCain, N; Peretz, H; Seligsohn, U; Luzzatto, L; Nafa, K; Nardi, M; Karpatkin, M; Aksentijevich, I; Kastner, D; Axelrod, F; Ostrer, H

    1999-12-01

    The Roman Jewish community has been historically continuous in Rome since pre-Christian times and may have been progenitor to the Ashkenazi Jewish community. Despite a history of endogamy over the past 2000 yr, the historical record suggests that there was admixture with Ashkenazi and Sephardic Jews during the Middle Ages. To determine whether Roman and Ashkenazi Jews shared common signature mutations, we tested a group of 107 Roman Jews, representing 176 haploid sets of chromosomes. No mutations were found for Bloom syndrome, BRCA1, BRCA2, Canavan disease, Fanconi anemia complementation group C, or Tay-Sachs disease. Two unrelated individuals were positive for the 3849 + 10C->T cystic fibrosis mutation; one carried the N370S Gaucher disease mutation, and one carried the connexin 26 167delT mutation. Each of these was shown to be associated with the same haplotype of tightly linked microsatellite markers as that found among Ashkenazi Jews. In addition, 14 individuals had mutations in the familial Mediterranean fever gene and three unrelated individuals carried the factor XI type III mutation previously observed exclusively among Ashkenazi Jews. These findings suggest that the Gaucher, connexin 26, and familial Mediterranean fever mutations are over 2000 yr old, that the cystic fibrosis 3849 + 10kb C->T and factor XI type III mutations had a common origin in Ashkenazi and Roman Jews, and that other mutations prevalent among Ashkenazi Jews are of more recent origin.

  16. [Frequency of the most common mutations of the CFTR gene in peruvian patients with cystic fibrosis using the ARMS-PCR technique].

    PubMed

    Aquino, Ruth; Protzel, Ana; Rivera, Juan; Abarca, Hugo; Dueñas, Milagros; Nestarez, Cecilia; Purizaga, Nestor; Diringer, Benoit

    2017-01-01

    To determine the frequency of the ten most common mutations of the CFTR gene reported in Latin Americausing amplification-refractory mutation system-polymerase chain reaction (ARMS-PCR) in patients with cystic fibrosis (CF) in two referral hospitals in Peru during the year 2014. The frequency of the ten most common mutations of the CFTR gene was assessed in patients of the Hospital Nacional Edgardo Rebagliati Martins and the Instituto Nacional de Salud del Niño, both located in Lima, Peru. Blood samples were collected from 36 patients with CF, and the ARMS-PCR technique was used to determine the presence of these mutations. The study group included 73.5% of patients with a known diagnosis of CF in the country when the study was carried out. ARMS-PCR allowed three of the mutations to be identified in a combined 30.6% of the alleles from patients with CF, and 64.9% of the mutated alleles were not identified. The mutations found were p.Phe508del (22,2%), p.Gly542* (6,9%), and p.Arg1162* (1,4%). There is significant variability in both the frequency and type of mutations present in our study population and in what has been reported in other Latin American countries. It is necessary to perform studies that use complete sequencing technology for the CFTR gene to identify other mutations present in our population.

  17. [CF Lung Disease - a German S3 Guideline: Module 2: Diagnostics and Treatment in Chronic Infection with Pseudomonas aeruginosa].

    PubMed

    Schwarz, C; Schulte-Hubbert, B; Bend, J; Abele-Horn, M; Baumann, I; Bremer, W; Brunsmann, F; Dieninghoff, D; Eickmeier, O; Ellemunter, H; Fischer, R; Grosse-Onnebrink, J; Hammermann, J; Hebestreit, H; Hogardt, M; Hügel, C; Hug, M; Illing, S; Jung, A; Kahl, B; Koitschev, A; Mahlberg, R; Mainz, J G; Mattner, F; Mehl, A; Möller, A; Muche-Borowski, C; Nüßlein, T; Puderbach, M; Renner, S; Rietschel, E; Ringshausen, F C; Schmidt, S; Sedlacek, L; Sitter, H; Smaczny, C; Tümmler, B; Vonberg, R; Wielpütz, M O; Wilkens, H; Wollschläger, B; Zerlik, J; Düesberg, U; van Koningsbruggen-Rietschel, S

    2018-05-01

    Cystic Fibrosis (CF) is the most common autosomal-recessive genetic disease affecting approximately 8000 people in Germany. The disease is caused by mutations in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene leading to dysfunction of CFTR, a transmembrane chloride channel. This defect causes insufficient hydration of the epithelial lining fluid which leads to chronic inflammation of the airways. Recurrent infections of the airways as well as pulmonary exacerbations aggravate chronic inflammation, lead to pulmonary fibrosis and tissue destruction up to global respiratory insufficiency, which is responsible for the mortality in over 90 % of patients. The main aim of pulmonary treatment in CF is to reduce pulmonary inflammation and chronic infection. Pseudomonas aeruginosa ( Pa ) is the most relevant pathogen in the course of CF lung disease. Colonization and chronic infection are leading to additional loss of pulmonary function. There are many possibilities to treat Pa -infection. This is a S3-clinical guideline which implements a definition for chronic Pa -infection and demonstrates evidence-based diagnostic methods and medical treatment for Pa -infection in order to give guidance for individual treatment options. © Georg Thieme Verlag KG Stuttgart · New York.

  18. New horizons for cystic fibrosis treatment.

    PubMed

    Fajac, Isabelle; De Boeck, Kris

    2017-02-01

    Cystic fibrosis is an inherited multi-system disease associated with chronic lung infection, malabsorption, salt loss syndromes, male infertility and leading to numerous comorbidities. The landscape in cystic fibrosis care has changed markedly with currently more adult patients than children in many countries. Over 2000 different mutations in the CFTR gene have been reported and the majority are extremely rare. Understanding how CFTR mutations translate to disturbed synthesis or function of the CFTR protein has opened the way to 'personalized' treatments to correct the basic defect. The first 2 drugs have reached the clinic: a CFTR potentiator to augment CFTR channel function, and the combination of this potentiator with a corrector to increase CFTR expression at the cell membrane. To obtain robust correction of CFTR expression at the cell membrane, combinations of correctors with additive efficacy are under investigation. Other mutation type-specific treatments under clinical investigation are premature stop codon-read through drugs and antisense oligonucleotides that correct the basic defect at the mRNA level. Restoring the defective gene by gene editing can already be achieved ex vivo. Mutation agnostic treatments are explored as well: stabilizing CFTR expression at the cell membrane, circumventing the CFTR channel by blocking or activating other ion channels, and gene therapy. Combinations of these therapies can be anticipated. The pipeline of corrective strategies under clinical investigation is increasing continuously and a rising number of pharmaceutical companies are entering the field. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Lumacaftor/ivacaftor, a novel agent for the treatment of cystic fibrosis patients who are homozygous for the F580del CFTR mutation.

    PubMed

    Bulloch, Marilyn N; Hanna, Cameron; Giovane, Richard

    2017-10-01

    Cystic Fibrosis (CF) is an autosomal recessive disease affecting up to 90,000 people worldwide. Approximately 73% of patients are homozygous for the F508del cystic fibrosis transmembrane conductance regulator [CFTR] mutation. Traditionally treatment has only included supportive care. Therefore, there is a need for safe and effective novel therapies targeting the underlying molecular defects seen with CF. Areas covered: In 2016, the Food and Drug Administration and the European Commission approved LUM/IVA (Orkambi), a CFTR modulator that includes both a CFTR corrector and potentiator, for CF patients homozygous for the F508del CFTR mutation. This article reviews the pharmacologic features, clinical efficacy, and safety of LUM/IVA and summarize the available pre-clinical and clinical data of LUM/IVA use. Expert commentary: LUM/IVA showed modest, but significant improvements from baseline in percent predicted FEV 1 (ppFEV 1 ) as well as a reduction in pulmonary exacerbations by 35% It was shown to be safe for short- and long-term use. Currently, LUM/IVA is the only oral agent in its class available and represents a milestone the development of therapies for the management of CF. Nonetheless, pharmacoeconomic data are necessary to justify its high cost before is use becomes standard of care.

  20. Global Analysis of the Fungal Microbiome in Cystic Fibrosis Patients Reveals Loss of Function of the Transcriptional Repressor Nrg1 as a Mechanism of Pathogen Adaptation

    PubMed Central

    Kim, Sang Hu; Clark, Shawn T.; Surendra, Anuradha; Copeland, Julia K.; Wang, Pauline W.; Ammar, Ron; Collins, Cathy; Tullis, D. Elizabeth; Nislow, Corey; Hwang, David M.; Guttman, David S.; Cowen, Leah E.

    2015-01-01

    The microbiome shapes diverse facets of human biology and disease, with the importance of fungi only beginning to be appreciated. Microbial communities infiltrate diverse anatomical sites as with the respiratory tract of healthy humans and those with diseases such as cystic fibrosis, where chronic colonization and infection lead to clinical decline. Although fungi are frequently recovered from cystic fibrosis patient sputum samples and have been associated with deterioration of lung function, understanding of species and population dynamics remains in its infancy. Here, we coupled high-throughput sequencing of the ribosomal RNA internal transcribed spacer 1 (ITS1) with phenotypic and genotypic analyses of fungi from 89 sputum samples from 28 cystic fibrosis patients. Fungal communities defined by sequencing were concordant with those defined by culture-based analyses of 1,603 isolates from the same samples. Different patients harbored distinct fungal communities. There were detectable trends, however, including colonization with Candida and Aspergillus species, which was not perturbed by clinical exacerbation or treatment. We identified considerable inter- and intra-species phenotypic variation in traits important for host adaptation, including antifungal drug resistance and morphogenesis. While variation in drug resistance was largely between species, striking variation in morphogenesis emerged within Candida species. Filamentation was uncoupled from inducing cues in 28 Candida isolates recovered from six patients. The filamentous isolates were resistant to the filamentation-repressive effects of Pseudomonas aeruginosa, implicating inter-kingdom interactions as the selective force. Genome sequencing revealed that all but one of the filamentous isolates harbored mutations in the transcriptional repressor NRG1; such mutations were necessary and sufficient for the filamentous phenotype. Six independent nrg1 mutations arose in Candida isolates from different patients, providing a poignant example of parallel evolution. Together, this combined clinical-genomic approach provides a high-resolution portrait of the fungal microbiome of cystic fibrosis patient lungs and identifies a genetic basis of pathogen adaptation. PMID:26588216

  1. Global Analysis of the Fungal Microbiome in Cystic Fibrosis Patients Reveals Loss of Function of the Transcriptional Repressor Nrg1 as a Mechanism of Pathogen Adaptation.

    PubMed

    Kim, Sang Hu; Clark, Shawn T; Surendra, Anuradha; Copeland, Julia K; Wang, Pauline W; Ammar, Ron; Collins, Cathy; Tullis, D Elizabeth; Nislow, Corey; Hwang, David M; Guttman, David S; Cowen, Leah E

    2015-11-01

    The microbiome shapes diverse facets of human biology and disease, with the importance of fungi only beginning to be appreciated. Microbial communities infiltrate diverse anatomical sites as with the respiratory tract of healthy humans and those with diseases such as cystic fibrosis, where chronic colonization and infection lead to clinical decline. Although fungi are frequently recovered from cystic fibrosis patient sputum samples and have been associated with deterioration of lung function, understanding of species and population dynamics remains in its infancy. Here, we coupled high-throughput sequencing of the ribosomal RNA internal transcribed spacer 1 (ITS1) with phenotypic and genotypic analyses of fungi from 89 sputum samples from 28 cystic fibrosis patients. Fungal communities defined by sequencing were concordant with those defined by culture-based analyses of 1,603 isolates from the same samples. Different patients harbored distinct fungal communities. There were detectable trends, however, including colonization with Candida and Aspergillus species, which was not perturbed by clinical exacerbation or treatment. We identified considerable inter- and intra-species phenotypic variation in traits important for host adaptation, including antifungal drug resistance and morphogenesis. While variation in drug resistance was largely between species, striking variation in morphogenesis emerged within Candida species. Filamentation was uncoupled from inducing cues in 28 Candida isolates recovered from six patients. The filamentous isolates were resistant to the filamentation-repressive effects of Pseudomonas aeruginosa, implicating inter-kingdom interactions as the selective force. Genome sequencing revealed that all but one of the filamentous isolates harbored mutations in the transcriptional repressor NRG1; such mutations were necessary and sufficient for the filamentous phenotype. Six independent nrg1 mutations arose in Candida isolates from different patients, providing a poignant example of parallel evolution. Together, this combined clinical-genomic approach provides a high-resolution portrait of the fungal microbiome of cystic fibrosis patient lungs and identifies a genetic basis of pathogen adaptation.

  2. [Isonymy analysis in a sample of parents of cystic fibrosis patients from Antioquia, Colombia].

    PubMed

    Rodríguez-Acevedo, Astrid; Morales, Olga; Durango, Harold; Pineda-Trujillo, Nicolás

    2012-01-01

    Cystic fibrosis (CTFR) is one of the most common autosomal recessive disorders in European descendants. Geographic distribution of CFTR gene mutations vary worldwide. The degree of isonimy was evaluated in a sample of parents with children affected by cystic fibrosis. Observed and expected isonimy as well as endogamy components (Fr, Fn, Ft, and the values α and B) were calculated for 35 parents of children diagnosed with cystic fibrosis. These parameters were calculated for both the total population of Antioquia Province and for an eastern subpopulation of Antioquia. The values obtained for Fr, Fn, Ft, α and B were 0.01, 0.007, 0.019, 268 and 0.44, respectively for the total population of Antioquia. For the eastern subpopulation, the values were 0.026, 0.0017, 0.027, 135 and 0.62. The most frequent last-names in the total sample (n=70) were Gómez (6%), Alzate (4%), and González (3.7 %), whilst for the eastern subpopulation (n=32) were Gómez (8%) and Marín (6%). A high percentage of last-names was shared, as is reflected in the isonimy values. Similarly, the presence of a reduced number of last-names in an important percentage of the population is reflected in the Fr values obtained for both analyses, which suggest homogeneity. Thus, it is expected a low number of CFTR mutations in the children from Antioquia with cystic fibrosis.

  3. Diagnosing cystic fibrosis in newborn screening in Poland - 15 years of experience.

    PubMed

    Sands, Dorota; Zybert, Katarzyna; Mierzejewska, Ewa; Ołtarzewski, Mariusz

    2015-01-01

    Early diagnosis of cystic fibrosis (CF) made by the introduction of CF NBS (Cystic Fibrosis Newborn Screening) provides the opportunity to undertake preventive measures and provide treatment before the development of irreversible changes in the respiratory tract and other complications. CF NBS was conducted as a pilot programme in four Polish districts in the period 1999-2003. In 2006 CF NBS started again and was gradually extended across the country. The aim of this study was to show the evolution of the Polish CF NBS strategies and assess the diagnostic consequences of this programme. The study involved children diagnosed and treated only in the IMiD Centre. The strategy in Polish CF NBS was modified over time. Firstly, the model IRT/IRT and IRT/IRT/DNA with one mutation was implemented, which was followed by IRT/DNA with a gradually expanding number of CFTR mutations (tab. I). Newborns with positive results of CF NBS were called to the CF IMiD Centre, and sweat tests were performed. The children diagnosed and children with mutations in both alleles of the CFTR gene even if at least one of them had undefined pathogenicity) were taken under IMiD Centre care. Sensitivity, specificity and positive predictive values during subsequent stages of CF NBS were calculated (tab. III). During the 1999-2003 pilot study 444 063 newborns underwent CF NBS and in 74 cases CF was diagnosed. 582 693 newborns were screened from September 2006 to December 2011 in four regions and 100 children were diagnosed with CF. The frequencies of CF in the Polish population in both screening periods were 1:5767 and 1:5712 respectively. Firstly, the IRT/IRT model was implemented, but the number of newborns called to the CF Centre was high - the PPV was 7.6%. In the next step CF NBS DNA analysis was used. Here sensitivity and specificity were high - nearly 100%. In the following years the number of mutations detected was expanded (including 16 most common ones in the Polish population). Due to the panel changes, the number of calls declined and the PPV (predictive positive value) improved (to 26.1%) after the application of expanded genetic analysis. Expanding the panel of mutations resulted in an increased number of carriers and observational subjects. IRT/DNA strategy with expanded DNA analysis provides the opportunity for earlier CF diagnosis even in children with normal sweat test values. However, this model caused frequent carrier detection and inconclusive diagnosis in comparison to IRT/IRT or IRT/IRT/DNA with a limited number of mutations. Further research and changes in Polish CF NBS are needed to increase the PPV, while preserving high sensitivity and specificity..

  4. Rescue of CF airway epithelial cell function in vitro by a CFTR potentiator, VX-770

    PubMed Central

    Van Goor, Fredrick; Hadida, Sabine; Grootenhuis, Peter D. J.; Burton, Bill; Cao, Dong; Neuberger, Tim; Turnbull, Amanda; Singh, Ashvani; Joubran, John; Hazlewood, Anna; Zhou, Jinglan; McCartney, Jason; Arumugam, Vijayalaksmi; Decker, Caroline; Yang, Jennifer; Young, Chris; Olson, Eric R.; Wine, Jeffery J.; Frizzell, Raymond A.; Ashlock, Melissa; Negulescu, Paul

    2009-01-01

    Cystic fibrosis (CF) is a fatal genetic disease caused by mutations in the gene encoding the CF transmembrane conductance regulator (CFTR), a protein kinase A (PKA)-activated epithelial anion channel involved in salt and fluid transport in multiple organs, including the lung. Most CF mutations either reduce the number of CFTR channels at the cell surface (e.g., synthesis or processing mutations) or impair channel function (e.g., gating or conductance mutations) or both. There are currently no approved therapies that target CFTR. Here we describe the in vitro pharmacology of VX-770, an orally bioavailable CFTR potentiator in clinical development for the treatment of CF. In recombinant cells VX-770 increased CFTR channel open probability (Po) in both the F508del processing mutation and the G551D gating mutation. VX-770 also increased Cl− secretion in cultured human CF bronchial epithelia (HBE) carrying the G551D gating mutation on one allele and the F508del processing mutation on the other allele by ≈10-fold, to ≈50% of that observed in HBE isolated from individuals without CF. Furthermore, VX-770 reduced excessive Na+ and fluid absorption to prevent dehydration of the apical surface and increased cilia beating in these epithelial cultures. These results support the hypothesis that pharmacological agents that restore or increase CFTR function can rescue epithelial cell function in human CF airway. PMID:19846789

  5. The novel complex allele [A238V;F508del] of the CFTR gene: clinical phenotype and possible implications for cystic fibrosis etiological therapies.

    PubMed

    Diana, Anna; Polizzi, Angela Maria; Santostasi, Teresa; Ratclif, Luigi; Pantaleo, Maria Giuseppina; Leonetti, Giuseppina; Iusco, Danila Rosa; Gallo, Crescenzio; Conese, Massimo; Manca, Antonio

    2016-06-01

    Few mutations in cis have been annotated for F508del homozygous patients. Southern Italy patients who at a first analysis appeared homozygous for the F508del mutation (n=63) or compound heterozygous for the F508del and another mutation in the cystic fibrosis transmembrane conductance regulator gene (n=155) were searched for the A238V mutation in exon 6. The allelic frequency of the complex allele [A238V;F508del] was 0.04. When the whole data set was used (comprised also of 56 F508del/F508del and 34 F508del/other mutation controls), no differences reached the statistical significance in the clinical parameters, except chloride concentrations which were lower in [A238V;F508del]/other mutation compared with F508del/other mutation (P=0.03). The two study groups presented less complications than the control groups. Within the minimal data set (34 F508del/F508del, 27 F508del/other mutation, 4 [A238V;F508del]/F508del cases and 5 [A238V;F508del]/other mutation cases); that is, presenting all the variables in each patient, forced expiratory volume in 1 s and forced vital capacity presented a trend to lower levels in the study groups in comparison with the F508del/F508del group, and C-reactive protein approximated statistically significant higher levels in the [A238V;F508del]/other mutation as compared with F508del/F508del patients (P=0.09). The analysis of statistical dependence among the variables showed a significant anticorrelation between chloride and body mass index in the [A238V;F508del]/other mutation group. In conclusion, the complex allele [A238V;F508del] seems to be associated with less general complications than in the control groups, on the other hand possibly giving a worse pulmonary phenotype and higher systemic/local inflammatory response. These findings have implications for the correct recruitment and clinical response of F508del patients in the clinical trials testing the new etiological drugs for cystic fibrosis.

  6. Cystic Fibrosis and the Nervous System.

    PubMed

    Reznikov, Leah R

    2017-05-01

    Cystic fibrosis (CF) is a life-shortening autosomal recessive disorder caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). CFTR is an anion channel that conducts bicarbonate and chloride across cell membranes. Although defective anion transport across epithelial cells is accepted as the basic defect in CF, many of the features observed in people with CF and organs affected by CF are modulated by the nervous system. This is of interest because CFTR expression has been reported in both the peripheral and central nervous systems, and it is well known that the transport of anions, such as chloride, greatly modulates neuronal excitability. Thus it is predicted that in CF, lack of CFTR in the nervous system affects neuronal function. Consistent with this prediction, several nervous system abnormalities and nervous system disorders have been described in people with CF and in animal models of CF. The goal of this special feature article is to highlight the expression and function of CFTR in the nervous system. Special emphasis is placed on nervous system abnormalities described in people with CF and in animal models of CF. Finally, features of CF that may be modulated by or attributed to faulty nervous system function are discussed. Copyright © 2016 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  7. Channel Gating Regulation by the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) First Cytosolic Loop.

    PubMed

    Ehrhardt, Annette; Chung, W Joon; Pyle, Louise C; Wang, Wei; Nowotarski, Krzysztof; Mulvihill, Cory M; Ramjeesingh, Mohabir; Hong, Jeong; Velu, Sadanandan E; Lewis, Hal A; Atwell, Shane; Aller, Steve; Bear, Christine E; Lukacs, Gergely L; Kirk, Kevin L; Sorscher, Eric J

    2016-01-22

    In this study, we present data indicating a robust and specific domain interaction between the cystic fibrosis transmembrane conductance regulator (CFTR) first cytosolic loop (CL1) and nucleotide binding domain 1 (NBD1) that allows ion transport to proceed in a regulated fashion. We used co-precipitation and ELISA to establish the molecular contact and showed that binding kinetics were not altered by the common clinical mutation F508del. Both intrinsic ATPase activity and CFTR channel gating were inhibited severely by CL1 peptide, suggesting that NBD1/CL1 binding is a crucial requirement for ATP hydrolysis and channel function. In addition to cystic fibrosis, CFTR dysregulation has been implicated in the pathogenesis of prevalent diseases such as chronic obstructive pulmonary disease, acquired rhinosinusitis, pancreatitis, and lethal secretory diarrhea (e.g. cholera). On the basis of clinical relevance of the CFTR as a therapeutic target, a cell-free drug screen was established to identify modulators of NBD1/CL1 channel activity independent of F508del CFTR and pharmacologic rescue. Our findings support a targetable mechanism of CFTR regulation in which conformational changes in the NBDs cause reorientation of transmembrane domains via interactions with CL1 and result in channel gating. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Synergy-based small-molecule screen using a human lung epithelial cell line yields ΔF508-CFTR correctors that augment VX-809 maximal efficacy.

    PubMed

    Phuan, Puay-Wah; Veit, Guido; Tan, Joseph; Roldan, Ariel; Finkbeiner, Walter E; Lukacs, Gergely L; Verkman, A S

    2014-07-01

    The most prevalent cystic fibrosis transmembrane conductance regulator (CFTR) mutation causing cystic fibrosis, ΔF508, impairs folding of nucleotide binding domain (NBD) 1 and stability of the interface between NBD1 and the membrane-spanning domains. The interfacial stability defect can be partially corrected by the investigational drug VX-809 (3-[6-[[[1-(2,2-difluoro-1,3-benzodioxol-5-yl)cyclopropyl]carbonyl]amino]-3-methyl-2-pyridinyl]-benzoic acid) or the R1070W mutation. Second-generation ΔF508-CFTR correctors are needed to improve on the modest efficacy of existing cystic fibrosis correctors. We postulated that a second corrector targeting a distinct folding/interfacial defect might act in synergy with VX-809 or the R1070W suppressor mutation. A biochemical screen for ΔF508-CFTR cell surface expression was developed in a human lung epithelium-derived cell line (CFBE41o(-)) by expressing chimeric CFTRs with a horseradish peroxidase (HRP) in the fourth exofacial loop in either the presence or absence of R1070W. Using a luminescence readout of HRP activity, screening of approximately 110,000 small molecules produced nine novel corrector scaffolds that increased cell surface ∆F508-CFTR expression by up to 200% in the presence versus absence of maximal VX-809. Further screening of 1006 analogs of compounds identified from the primary screen produced 15 correctors with an EC50 < 5 µM. Eight chemical scaffolds showed synergy with VX-809 in restoring chloride permeability in ∆F508-expressing A549 cells. An aminothiazole increased chloride conductance in human bronchial epithelial cells from a ΔF508 homozygous subject beyond that of maximal VX-809. Mechanistic studies suggested that NBD2 is required for the aminothiazole rescue. Our results provide proof of concept for synergy screening to identify second-generation correctors, which, when used in combination, may overcome the "therapeutic ceiling" of first-generation correctors. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

  9. Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.

    PubMed

    Coiana, Alessandra; Faa', Valeria; Carta, Daniela; Puddu, Rosalba; Cao, Antonio; Rosatelli, Maria Cristina

    2011-05-01

    In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%). Copyright © 2010 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  10. Molecular Mechanisms of Fluoroquinolone Resistance in Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients

    PubMed Central

    Jalal, Shah; Ciofu, Oana; Høiby, Niels; Gotoh, Naomasa; Wretlind, Bengt

    2000-01-01

    Twenty P. aeruginosa isolates were collected from six cystic fibrosis (CF) patients, aged 27 to 33, in 1994 (9 isolates) and 1997 (11 isolates) at the CF Center, Copenhagen, Denmark, and were typed by pulse-field gel electrophoresis (PFGE) or ribotyping. Five of the patients had isolates with the same PFGE or ribotyping patterns in 1997 as in 1994, and ciprofloxacin had a two- to fourfold higher MIC for the isolates collected in 1997 than those from 1994. Genomic DNA was amplified for gyrA, parC, mexR, and nfxB by PCR and sequenced. Eleven isolates had mutations in gyrA, seven isolates had mutations at codon 83 (Thr to Ile), and four isolates had mutations at codon 87 (Asp to Asn or Tyr). Sixteen isolates had mutations in nfxB at codon 82 (Arg to Leu). Increased amounts of OprN were found in six isolates and OprJ in eight isolates as determined by immunoblotting. No isolates had mutations in parC or mexR. Six isolates had mutations in efflux pumps without gyrA mutations. The average number of mutations was higher in isolates from 1997 than in those from 1994. The results also suggested that efflux resistance mechanisms are more common in isolates from CF patients than in strains from urine and wounds from non-CF patients, in which mutations in gyrA and parC dominate (S. Jalal and B. Wretlind, Microb. Drug Resist. 4:257–261, 1998). PMID:10681343

  11. Molecular basis of cystic fibrosis in Lithuania: incomplete CFTR mutation detection by PCR-based screening protocols.

    PubMed

    Giannattasio, S; Bobba, A; Jurgelevicius, V; Vacca, R A; Lattanzio, P; Merafina, R S; Utkus, A; Kucinskas, V; Marra, E

    2006-01-01

    Mutational analysis of the cystic fibrosis transmembrane regulator (CFTR) gene was performed in 98 unrelated CF chromosomes from 49 Lithuanian CF patients through a combined approach in which the p.F508del mutation was first screened by allele-specific PCR while CFTR mutations in nonp.F508del chromosomes have been screened for by denaturing gradient gel electrophoresis analysis. A CFTR mutation was characterized in 62.2% of CF chromosomes, two of which (2.0%) have been previously shown to carry a large gene deletion CFTRdele2,3(21 kb). The most frequent Lithuanian CF mutation is p.F508del (52.0%). Seven CFTR mutations, p.N1303K (2.0%), p.R75Q (1.0%), p.G314R (1.0%), p.R553X (4.2%), p.W1282X (1.0%), and g.3944delGT (1.0%), accounted for 10.1% of Lithuanian CF chromosomes. It was not possible to characterize 35.8% of the CF Lithuanian chromosomes. Analysis of intron 8 (TG)mTn and M470V polymorphic loci did not permit the characterization of the CFTR dysfunction underlying the CF phenotype in the patients for which no CFTR mutation was identified. Thus, screening of the eight CFTR mutations identified in this study and of the large deletion CFTRdele2,3(21 kb) allows the implementation of an early molecular or confirmatory CF diagnosis for 65% of Lithuanian CF chromosomes.

  12. Effectiveness of ivacaftor in cystic fibrosis patients with non-G551D gating mutations.

    PubMed

    Guimbellot, Jennifer; Solomon, George M; Baines, Arthur; Heltshe, Sonya L; VanDalfsen, Jill; Joseloff, Elizabeth; Sagel, Scott D; Rowe, Steven M

    2018-04-20

    The cystic fibrosis transmembrane conductance regulator (CFTR) potentiator ivacaftor is approved for patients with CF with gating and residual function CFTR mutations. We report the results of an observational study investigating its effects in CF patients with non-G551D gating mutations. Patients with non-G551D gating mutations were recruited to an open-label study evaluating ivacaftor. Primary outcomes included: lung function, sweat chloride, weight gain, and quality of life scores. Twenty-one subjects were enrolled and completed 6 months follow-up on ivacaftor; mean age was 25.6 years with 52% <18. Baseline ppFEV 1 was 68% and mean sweat chloride 89.6 mEq/L. Participants experienced significant improvements in ppFEV 1 (mean absolute increase of 10.9% 95% CI = [2.6,19.3], p = 0.0134), sweat chloride (-48.6 95% CI = [-67.4,-29.9], p < 0.0001), and weight (5.1 kg, 95% CI = [2.8, 7.3], p = 0.0002). Patients with non-G551D gating mutations experienced improved lung function, nutritional status, and quality of life. This study supports ongoing use of ivacaftor for patients with these mutations. Copyright © 2018. Published by Elsevier B.V.

  13. [Management of infants whose diagnosis is inconclusive at neonatal screening for cystic fibrosis].

    PubMed

    Sermet-Gaudelus, I; Brouard, J; Audrézet, M-P; Couderc Kohen, L; Weiss, L; Wizla, N; Vrielynck, S; LLerena, K; Le Bourgeois, M; Deneuville, E; Remus, N; Nguyen-Khoa, T; Raynal, C; Roussey, M; Girodon, E

    2017-04-01

    Neonatal screening for cystic fibrosis (CF) may detect infants with elevated immunoreactive trypsinogen (IRT) levels but with inconclusive sweat tests and/or DNA results. This includes cases associating (1) either the presence of at most one CF-causing mutation and sweat chloride values between 30 and 59mmol/L or (2) two CFTR mutations with at least one of unknown pathogenicity and a sweat chloride below 60mmol/L. This encompasses different clinical situations whose progression cannot be predicted. These cases require redoing the sweat test at 12 months and if possible at 6 and 24 months of life. This must be associated with extended genotyping. CFTR functional explorations can also help by investigating CFTR dysfunction. These infants must be initially evaluated in dedicated CF centers including bacteriological sputum analysis, chest radiology and fecal elastase dosage. A home practitioner must be informed of the specificity of follow-up. These infants will be reviewed in the CF center at 3, 6 and 12 months and every year. Any CF-related symptom requires reevaluation of the diagnosis. These guidelines were established by the "neonatal screening and difficult diagnoses" working group of the French CF Society. They aim to standardize management of infants with unclear diagnosis in French CF centers. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. [Historical compilation of cystic fibrosis].

    PubMed

    Navarro, Salvador

    2016-01-01

    Cystic fibrosis is the most common life-shortening recessively inherited disorder in the Caucasian population. The genetic mutation that most frequently provokes cystic fibrosis (ΔF508) appeared at least 53,000years ago. For many centuries, the disease was thought to be related to witchcraft and the "evil eye" and it was only in 1938 that Dorothy H. Andersen characterized this disorder and suspected its genetic origin. The present article reviews the pathological discoveries and diagnostic and therapeutic advances made in the last 75 years. The review ends with some considerations for the future. Copyright © 2015 Elsevier España, S.L.U. and AEEH y AEG. All rights reserved.

  15. Diagnosis of Adult Patients with Cystic Fibrosis.

    PubMed

    Nick, Jerry A; Nichols, David P

    2016-03-01

    The diagnosis of cystic fibrosis (CF) is being made with increasing frequency in adults. Patients with CF diagnosed in adulthood typically present with respiratory complaints, and often have recurrent or chronic airway infection. At the time of initial presentation individuals may appear to have clinical manifestation limited to a single organ, but with subclinical involvement of the respiratory tract. Adult-diagnosed patients have a good response to CF center care, and newly available cystic fibrosis transmembrane receptor-modulating therapies are promising for the treatment of residual function mutation, thus increasing the importance of the diagnosis in adults with unexplained bronchiectasis. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abeliovich, D.; Lavon, I.P.; Lerer, I.

    1992-11-01

    To determine the distribution and frequency of cystic fibrosis (CF) mutations in the Israeli population, the authors have screened 96 patients for 11 relatively common mutations. Five mutations - [Delta]F508, G542X, W1282X, N1303K, and 3849 + 10kb C[yields]T-were found to account for 97% of the CF alleles in the Ashkenazi Jews. In contrast, of the 11 mutations tested, only [Delta]F508 was detected in Jewish patients of Sephardic or Oriental origin, accounting for 43% of the CF alleles. Four mutations - [Delta]F508, G542X, W1282X, and N1303K- accounted for 55% of the CF alleles in Arab patients. In a pilot screening study,more » a random sample of 424 Ashkenazi individuals was analyzed for three mutations - [Delta]F508, W128X, and G542X. Thirteen individuals were detected as heterozygotes (six for [Delta]F508 and seven for W1282X), predicting a heterozygote frequency of 1:29. This is similar to the frequency of carriers in the Caucasian population of northern European ancestry. On the basis of these data, the Ashkenazi populations is considered to be a candidate for CF heterozygote screening. 32 refs., 2 tabs.« less

  17. Changes of CFTR functional measurements and clinical improvements in cystic fibrosis patients with non p.Gly551Asp gating mutations treated with ivacaftor.

    PubMed

    Mesbahi, Myriam; Shteinberg, Michal; Wilschanski, Michael; Hatton, Aurelie; Nguyen-Khoa, Thao; Friedman, Hannah; Cohen, Michael; Escabasse, Virginie; Le Bourgeois, Muriel; Lucidi, Vicenzina; Sermet-Gaudelus, Isabelle; Bassinet, Laurence; Livnat, Galit

    2017-01-01

    Ivacaftor, a CFTR potentiator, has been found to improve CFTR function and clinical outcomes in patients with cystic fibrosis (CF) gating mutations. We investigated the effects of ivacaftor on CFTR functional measurement in CF patients carrying gating mutations other than p.Gly551Asp. Two siblings aged 13 and 12 carrying the p.Ser549Asn mutation, two sisters (45 and 43years old) compound heterozygotes for p.Asp1152His and p.Gly1244Glu, a 37year old man homozygous for the p.Gly1244Glu mutation, and a 7year old girl with p.Arg352Gln and p.Gly1244Glu mutations commenced treatment with ivacaftor. NPD was performed in all the patients and approached normal for four patients who had also clinical improvement (p.Ser549Asn compound heterozygotes, and p.Asp1152His/p.Gly1244Glu siblings). Beta-adrenergic sweat chloride secretion performed in thep.Asp1152His/p.Gly1244Glu patients improved significantly. The p.Gly1244Glu mutation homozygous patient, who had undergone an ileal resection with ileostomy and enterocutaneous fistula, did not respond clinically to ivacaftor and did not modify his sweat test. These results highlight the importance of different CFTR activity measurements to explore CFTR modulator efficacy. Copyright © 2016. Published by Elsevier B.V.

  18. A New Targeted CFTR Mutation Panel Based on Next-Generation Sequencing Technology.

    PubMed

    Lucarelli, Marco; Porcaro, Luigi; Biffignandi, Alice; Costantino, Lucy; Giannone, Valentina; Alberti, Luisella; Bruno, Sabina Maria; Corbetta, Carlo; Torresani, Erminio; Colombo, Carla; Seia, Manuela

    2017-09-01

    Searching for mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR) is a key step in the diagnosis of and neonatal and carrier screening for cystic fibrosis (CF), and it has implications for prognosis and personalized therapy. The large number of mutations and genetic and phenotypic variability make this search a complex task. Herein, we developed, validated, and tested a laboratory assay for an extended search for mutations in CFTR using a next-generation sequencing-based method, with a panel of 188 CFTR mutations customized for the Italian population. Overall, 1426 dried blood spots from neonatal screening, 402 genomic DNA samples from various origins, and 1138 genomic DNA samples from patients with CF were analyzed. The assay showed excellent analytical and diagnostic operative characteristics. We identified and experimentally validated 159 (of 188) CFTR mutations. The assay achieved detection rates of 95.0% and 95.6% in two large-scale case series of CF patients from central and northern Italy, respectively. These detection rates are among the highest reported so far with a genetic test for CF based on a mutation panel. This assay appears to be well suited for diagnostics, neonatal and carrier screening, and assisted reproduction, and it represents a considerable advantage in CF genetic counseling. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  19. Genetic analysis of hispanic individuals with cystic fibrosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grebe, T.A.; Doane, W.W.; Norman, R.A.

    1994-03-01

    The authors have performed molecular genetic analysis of Hispanic individuals with cystic fibrosis (CF) in the southwestern United States. Of 129 CF chromosomes analyzed, oly 46% (59/129) carry [Delta]F508. The G542X mutation was found on 5% (7/129) of CF chromosomes. The 3849+10kbC[yields]T mutation, detected primarily in Ashkenazi Jews, was present on 2% (3/129). R1162X and R334W, mutations identified in Spain and Italy, each occurred on 1.6% (2/129) of CF chromosomes. W1282X and R553X were each detected once. G551D and N1303K were not found. Overall, screening for 22 or more mutations resulted in detection of only 58% of CF transmembrane conductancemore » regulator gene mutations among Hispanic individuals. Analysis of KM19/XV2c haplotypes revealed an unusual distribution. Although the majority of [Delta]508 mutations are on chromosomes of B haplotypes, the other CF mutations are on A and C haplotypes at higher-than-expected frequencies. These genetic analysis demonstrate significant differences between Hispanic individuals with CF and those of the general North American population. Assessment of carrier/affected risk in Hispanic CF individuals cannot, therefore, be based on the mutation frequencies found through studies of the general population but must be adjusted to better reflect the genetic makeup of this ethnic group. Further studies are necessary to identify the causative mutation(s) in this population and to better delineate genotype/phenotype correlations. These will enable counselors to provide more accurate genetic counseling. 22 refs., 2 tabs.« less

  20. Cystic fibrosis respiratory tract salt concentration: An Exploratory Cohort Study.

    PubMed

    Grandjean Lapierre, Simon; Phelippeau, Michael; Hakimi, Cyrine; Didier, Quentin; Reynaud-Gaubert, Martine; Dubus, Jean-Christophe; Drancourt, Michel

    2017-11-01

    In cystic fibrosis patients, electrolytic and osmolality imbalance secondary to cystic fibrosis transmembrane conductance regulator mutations may impact on mucoid secretion accumulation and secondary colonization by opportunistic pathogens such as nontuberculous mycobacteria.We performed a noninvasive exploratory prospective controlled clinical study comparing sputum salinity and acid-base characteristics of cystic fibrosis and noncystic fibrosis control patients. A total of 57 patients and 62 controls were included.Sputum salt concentrations were 10.5 g/L (95% CI: 7.7-13.3) in patients and 7.4 g/L (95% CI: 5.9-8.9) in aged-matched controls, a difference that was found to be statistically significant (P < .05). No difference in pH was observed between patients and controls.These differences in respiratory secretions salt concentrations could influence host-pathogen interactions in the context of cystic fibrosis respiratory infections. We propose to include respiratory secretion salt measurement as a routine analysis on cystic fibrosis patients' sputum submitted for bacterial culture. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  1. Acute administration of ivacaftor to people with cystic fibrosis and a G551D-CFTR mutation reveals smooth muscle abnormalities

    PubMed Central

    Adam, Ryan J.; Hisert, Katherine B.; Dodd, Jonathan D.; Grogan, Brenda; Launspach, Janice L.; Barnes, Janel K.; Gallagher, Charles G.; Sieren, Jered P.; Gross, Thomas J.; Fischer, Anthony J.; Cavanaugh, Joseph E.; Hoffman, Eric A.; Singh, Pradeep K.; Welsh, Michael J.; McKone, Edward F.; Stoltz, David A.

    2016-01-01

    BACKGROUND. Airflow obstruction is common in cystic fibrosis (CF), yet the underlying pathogenesis remains incompletely understood. People with CF often exhibit airway hyperresponsiveness, CF transmembrane conductance regulator (CFTR) is present in airway smooth muscle (ASM), and ASM from newborn CF pigs has increased contractile tone, suggesting that loss of CFTR causes a primary defect in ASM function. We hypothesized that restoring CFTR activity would decrease smooth muscle tone in people with CF. METHODS. To increase or potentiate CFTR function, we administered ivacaftor to 12 adults with CF with the G551D-CFTR mutation; ivacaftor stimulates G551D-CFTR function. We studied people before and immediately after initiation of ivacaftor (48 hours) to minimize secondary consequences of CFTR restoration. We tested smooth muscle function by investigating spirometry, airway distensibility, and vascular tone. RESULTS. Ivacaftor rapidly restored CFTR function, indicated by reduced sweat chloride concentration. Airflow obstruction and air trapping also improved. Airway distensibility increased in airways less than 4.5 mm but not in larger-sized airways. To assess smooth muscle function in a tissue outside the lung, we measured vascular pulse wave velocity (PWV) and augmentation index, which both decreased following CFTR potentiation. Finally, change in distensibility of <4.5-mm airways correlated with changes in PWV. CONCLUSIONS. Acute CFTR potentiation provided a unique opportunity to investigate CFTR-dependent mechanisms of CF pathogenesis. The rapid effects of ivacaftor on airway distensibility and vascular tone suggest that CFTR dysfunction may directly cause increased smooth muscle tone in people with CF and that ivacaftor may relax smooth muscle. FUNDING. This work was funded in part from an unrestricted grant from the Vertex Investigator-Initiated Studies Program. PMID:27158673

  2. Diagnosis of cystic fibrosis in the kindred of an infant with CFTR-related metabolic syndrome: importance of follow-up that includes monitoring sweat chloride concentrations over time.

    PubMed

    Williams, Sophia N; Nussbaum, Eliezer; Chin, Terry W; Do, Paul C M; Singh, Kathryn E; Randhawa, Inderpal

    2014-03-01

    Newly implemented newborn screening (NBS) programs in California have resulted in a large subset of patients in whom at least two cystic fibrosis transmembrane conductance regulator (CFTR) mutations are identified, but subsequent sweat chloride analysis reveals normal or indeterminate values. These patients are diagnosed with CFTR-Related Metabolic Syndrome (CRMS). However, the natural progression and management of these patients are not clearly understood and frequently after the age of 1-year these patients are lost to follow-up with Cystic Fibrosis (CF) Centers. We present the first case of an infant who was referred to Miller Children's Hospital for a NBS positive for CF and subsequent discovery of identical mutations in six of his seven older brothers. Several siblings had positive sweat chloride results on repeat testing after the age of 3 years. We suggest the need for continued follow-up of CRMS in a CF center with diagnostic evaluation including repeat sweat chloride testing, beyond the currently recommended period. © 2013 Wiley Periodicals, Inc.

  3. Epistatic selection of a sequence 5{prime} of the gene responsible for cystic fibrosis may account for the high frequency of this disease in the Caucasian population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Macek, M. Jr.; Nash, E.; Cutting, G.R.

    1994-09-01

    Cystic fibrosis (CF) is one of the more common lethal autosomal recessive disorders in Caucasian populations. Numerous hypotheses including genetic drift, founder effect, sex ratio, segregation distortions and various forms of heterozygote advantage have been proposed to explain the relatively high frequency of CF alleles. The observation of high linkage disequilibrium between markers at the 5{prime} end of CFTR and mutations that cause CF raised the possibility of epistatic selection. CF-linked marker allele frequencies were determined in 417 elderly individuals from a stable Czech population that survived high levels of infant and childhood mortality in the pre-antibiotic era. These datamore » were compared with allele frequencies of 646 contemporary newborns and 345 young adults drawn from the same population who had significantly lower mortality rates in the antibiotic era. Allele frequencies of markers CS7/Hhal and KM19/Pstl from the D7S23 locus are significantly different (p<0.05) between elderly female and male subjects in this population. Furthermore, there is a significant difference in the allele frequencies of marker CS7/Hhal when newborn females and elderly women are compared (p<0.05). Taken together, these data suggest that the allele status at the CS7 region influenced female survival in the period of high infant and childhood mortality in the pre-antibiotic era. Under this selective pressure, CFTR mutations that occurred on the {open_quotes}favorable{close_quotes} background would marginally increase in frequency in each successive generation and more ancient mutations residing on this background would become the most frequent in the general population.« less

  4. Restoration of CFTR function in patients with cystic fibrosis carrying the F508del-CFTR mutation.

    PubMed

    De Stefano, Daniela; Villella, Valeria R; Esposito, Speranza; Tosco, Antonella; Sepe, Angela; De Gregorio, Fabiola; Salvadori, Laura; Grassia, Rosa; Leone, Carlo A; De Rosa, Giuseppe; Maiuri, Maria C; Pettoello-Mantovani, Massimo; Guido, Stefano; Bossi, Anna; Zolin, Anna; Venerando, Andrea; Pinna, Lorenzo A; Mehta, Anil; Bona, Gianni; Kroemer, Guido; Maiuri, Luigi; Raia, Valeria

    2014-01-01

    Restoration of BECN1/Beclin 1-dependent autophagy and depletion of SQSTM1/p62 by genetic manipulation or autophagy-stimulatory proteostasis regulators, such as cystamine, have positive effects on mouse models of human cystic fibrosis (CF). These measures rescue the functional expression of the most frequent pathogenic CFTR mutant, F508del, at the respiratory epithelial surface and reduce lung inflammation in Cftr(F508del) homozygous mice. Cysteamine, the reduced form of cystamine, is an FDA-approved drug. Here, we report that oral treatment with cysteamine greatly reduces the mortality rate and improves the phenotype of newborn mice bearing the F508del-CFTR mutation. Cysteamine was also able to increase the plasma membrane expression of the F508del-CFTR protein in nasal epithelial cells from F508del homozygous CF patients, and these effects persisted for 24 h after cysteamine withdrawal. Importantly, this cysteamine effect after washout was further sustained by the sequential administration of epigallocatechin gallate (EGCG), a green tea flavonoid, both in vivo, in mice, and in vitro, in primary epithelial cells from CF patients. In a pilot clinical trial involving 10 F508del-CFTR homozygous CF patients, the combination of cysteamine and EGCG restored BECN1, reduced SQSTM1 levels and improved CFTR function from nasal epithelial cells in vivo, correlating with a decrease of chloride concentrations in sweat, as well as with a reduction of the abundance of TNF/TNF-alpha (tumor necrosis factor) and CXCL8 (chemokine [C-X-C motif] ligand 8) transcripts in nasal brushing and TNF and CXCL8 protein levels in the sputum. Altogether, these results suggest that optimal schedules of cysteamine plus EGCG might be used for the treatment of CF caused by the F508del-CFTR mutation.

  5. Impact of the CFTR-potentiator ivacaftor on airway microbiota in cystic fibrosis patients carrying a G551D mutation.

    PubMed

    Bernarde, Cédric; Keravec, Marlène; Mounier, Jérôme; Gouriou, Stéphanie; Rault, Gilles; Férec, Claude; Barbier, Georges; Héry-Arnaud, Geneviève

    2015-01-01

    Airway microbiota composition has been clearly correlated with many pulmonary diseases, and notably with cystic fibrosis (CF), an autosomal genetic disorder caused by mutation in the CF transmembrane conductance regulator (CFTR). Recently, a new molecule, ivacaftor, has been shown to re-establish the functionality of the G551D-mutated CFTR, allowing significant improvement in lung function. The purpose of this study was to follow the evolution of the airway microbiota in CF patients treated with ivacaftor, using quantitative PCR and pyrosequencing of 16S rRNA amplicons, in order to identify quantitative and qualitative changes in bacterial communities. Three G551D children were followed up longitudinally over a mean period of more than one year covering several months before and after initiation of ivacaftor treatment. 129 operational taxonomy units (OTUs), representing 64 genera, were identified. There was no significant difference in total bacterial load before and after treatment. Comparison of global community composition found no significant changes in microbiota. Two OTUs, however, showed contrasting dynamics: after initiation of ivacaftor, the relative abundance of the anaerobe Porphyromonas 1 increased (p<0.01) and that of Streptococcus 1 (S. mitis group) decreased (p<0.05), possibly in relation to the anti-Gram-positive properties of ivacaftor. The anaerobe Prevotella 2 correlated positively with the pulmonary function test FEV-1 (r=0.73, p<0.05). The study confirmed the presumed positive role of anaerobes in lung function. Several airway microbiota components, notably anaerobes (obligate or facultative anaerobes), could be valuable biomarkers of lung function improvement under ivacaftor, and could shed light on the pathophysiology of lung disease in CF patients.

  6. Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients.

    PubMed

    Boj, Sylvia F; Vonk, Annelotte M; Statia, Marvin; Su, Jinyi; Vries, Robert R G; Beekman, Jeffrey M; Clevers, Hans

    2017-02-11

    Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 °C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

  7. ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

    PubMed Central

    Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

    2012-01-01

    Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

  8. ALDH1A3 mutations cause recessive anophthalmia and microphthalmia.

    PubMed

    Fares-Taie, Lucas; Gerber, Sylvie; Chassaing, Nicolas; Clayton-Smith, Jill; Hanein, Sylvain; Silva, Eduardo; Serey, Margaux; Serre, Valérie; Gérard, Xavier; Baumann, Clarisse; Plessis, Ghislaine; Demeer, Bénédicte; Brétillon, Lionel; Bole, Christine; Nitschke, Patrick; Munnich, Arnold; Lyonnet, Stanislas; Calvas, Patrick; Kaplan, Josseline; Ragge, Nicola; Rozet, Jean-Michel

    2013-02-07

    Anophthalmia and microphthalmia (A/M) are early-eye-development anomalies resulting in absent or small ocular globes, respectively. A/M anomalies occur in syndromic or nonsyndromic forms. They are genetically heterogeneous, some mutations in some genes being responsible for both anophthalmia and microphthalmia. Using a combination of homozygosity mapping, exome sequencing, and Sanger sequencing, we identified homozygosity for one splice-site and two missense mutations in the gene encoding the A3 isoform of the aldehyde dehydrogenase 1 (ALDH1A3) in three consanguineous families segregating A/M with occasional orbital cystic, neurological, and cardiac anomalies. ALDH1A3 is a key enzyme in the formation of a retinoic acid gradient along the dorso-ventral axis during early eye development. Transitory expression of mutant ALDH1A3 open reading frames showed that both missense mutations reduce the accumulation of the enzyme, potentially leading to altered retinoic acid synthesis. Although the role of retinoic acid signaling in eye development is well established, our findings provide genetic evidence of a direct link between retinoic-acid-synthesis dysfunction and early-eye-development anomalies in humans. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  9. Missense variations in the cystic fibrosis gene: Heteroduplex formation in the F508C mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Macek, M. Jr.; Ladanyi, L.; Buerger, J.

    1992-11-01

    Kobayashi et al. (1990) have described missense variations in the conserved region of exon 10 of the cystic fibrosis (CF) transmembrane conductance regulator gene. In their paper, two [Delta]F508/F508C compound heterozygous individuals were reported. Clinical and epithelial physiological studies in both cases were normal, suggesting that the substitution of cysteine for phenylalanine at position 508, the F508C mutation, is benign. However, Kerem et al. reported a patient with this substitution who had typical symptoms of CF. In routine [Delta]F508 mutation screening by visualization of the 3-bp deletion on a 12% polyacrylamide gel the authors detected an abnormal heteroduplex in themore » father of a CF patient of German origin. Subsequent direct sequencing of the PCR product confirmed that this clinically normal father is a compound heterozygote for the [Delta]F508/F508C mutations. This heteroduplex is slightly different from the usual heteroduplex in [Delta]F508/F508C heteroduplex was not published, it is likely that similar cases can be overseen during the widely performed [Delta]F508 mutation screening by PAGE. Detection of more cases, such as the one presented here, together with careful, standardized clinical examination of the proband, would be valuable to verify the nature of this mutation. 4 refs., 1 fig.« less

  10. The 3849 + 10 kB C-->T mutation in a 21-year-old patient with cystic fibrosis.

    PubMed

    Kaplan, D M; Niv, A; Aviram, M; Parvari, R; Leiberman, A; Fliss, D M

    1996-12-01

    Cystic fibrosis (CF) is the most common lethal inherited disease in the white population. It is characterized by exocrine gland epithelia dysfunction, which leads to pulmonary and pancreatic insufficiency. Since the cloning of the CF gene in 1989 and the identification of the most common CF mutation (delta F508), more than 400 different mutations have been described. These mutations appear to contribute to the heterogeneity of the CF phenotype and several reports have speculated on the relationship between the most common CF mutations and the patient's clinical status. We report the case of a 21-year-old woman with longstanding chronic pansinusitis, nasal polyposis, chronic cough and severe nasal crusting. During a period of five years she had been followed by her otolaryngologist and pediatric pulmonologist. Sweat tests performed at the age of 17 and 18 were within normal limits and she underwent repeated conventional sinonasal procedures, with no improvement in her clinical status. On her present admission, sweat tests showed a 70 meq/l chloride concentration. The diagnosis of CF was then confirmed by DNA analysis and the patient was found to carry the 3849 + 10 kB C-->T mutation. The early detection of this newly recognized form of CF in adults as well as in children presenting with sinonasal symptoms is critical for life expectancy and quality.

  11. Cystic fibrosis in the Basque country: high frequency of mutation delta F508 in patients of Basque origin.

    PubMed Central

    Casals, T; Vázquez, C; Lázaro, C; Girbau, E; Giménez, F J; Estivill, X

    1992-01-01

    The Basque population is one of the oldest populations of Europe. It has been suggested that the Basques arose from a population established in western Europe during the late Paleolithic Age. The Basque language (Euskera) is a supposedly pre-Indo-European language that originates from the first settlers of Europe. The variable distribution of the major cystic fibrosis (CF) mutation (delta F508 deletion) in Europe, with higher frequencies of the mutation in northern Europe and lower frequencies in southern Europe, has suggested that the delta F508 mutation was spread by early farmers migrating from the Middle East during the Neolithic period. We have studied 45 CF families from the Basque Country, where the incidence of CF is approximately 1/4,500. The birthplaces of the parents and grandparents have been traced and are distributed according to their origin as Basque or Mixed Basque. The frequency of the delta F508 mutation in the chromosomes of Basque origin is 87%, compared with 58% in those of Mixed Basque origin. The analysis of haplotypes, both with markers closely linked to the CF gene and with intragenic markers, suggests that the delta F508 mutation was not spread by the Indo-European invasions but was already present in Europe more than 10,000 years ago, during the Paleolithic period. PMID:1370875

  12. Non-invasive prenatal diagnosis for cystic fibrosis: detection of paternal mutations, exploration of patient preferences and cost analysis.

    PubMed

    Hill, Melissa; Twiss, Philip; Verhoef, Talitha I; Drury, Suzanne; McKay, Fiona; Mason, Sarah; Jenkins, Lucy; Morris, Stephen; Chitty, Lyn S

    2015-10-01

    We aim to develop non-invasive prenatal diagnosis (NIPD) for cystic fibrosis (CF) and determine costs and implications for implementation. A next-generation sequencing assay was developed to detect ten common CF mutations for exclusion of the paternal mutation in maternal plasma. Using uptake data from a study exploring views on NIPD for CF, total test-related costs were estimated for the current care pathway and compared with those incorporating NIPD. The assay reliably predicted mutation status in all control and maternal plasma samples. Of carrier or affected adults with CF (n = 142) surveyed, only 43.5% reported willingness to have invasive testing for CF with 94.4% saying they would have NIPD. Using these potential uptake data, the incremental costs of NIPD over invasive testing per 100 pregnancies at risk of CF are £9025 for paternal mutation exclusion, and £26,510 for direct diagnosis. We have developed NIPD for risk stratification in around a third of CF families. There are economic implications due to potential increased test demand to inform postnatal management rather than to inform decisions around termination of an affected pregnancy. © 2015 The Authors. Prenatal Diagnosis published by John Wiley & Sons, Ltd.

  13. Nasal potential difference in cystic fibrosis considering severe CFTR mutations.

    PubMed

    Ng, Ronny Tah Yen; Marson, Fernando Augusto de Lima; Ribeiro, Jose Dirceu; Ribeiro, Antonio Fernando; Bertuzzo, Carmen Silvia; Ribeiro, Maria Angela Gonçalves de Oliveira; Severino, Silvana Dalge; Sakano, Eulalia

    2015-01-01

    The gold standard for diagnosing cystic fibrosis (CF) is a sweat chloride value above 60 mEq/L. However, this historical and important tool has limitations; other techniques should be studied, including the nasal potential difference (NPD) test. CFTR gene sequencing can identify CFTR mutations, but this method is time-consuming and too expensive to be used in all CF centers. The present study compared CF patients with two classes I-III CFTR mutations (10 patients) (G1), CF patients with classes IV-VI CFTR mutations (five patients) (G2), and 21 healthy subjects (G3). The CF patients and healthy subjects also underwent the NPD test. A statistical analysis was performed using the Mann-Whitney, Kruskal-Wallis, χ(2), and Fisher's exact tests, α = 0.05. No differences were observed between the CF patients and healthy controls for the PDMax, Δamiloride, and Δchloride + free + amiloride markers from the NPD test. For the finger value, a difference between G2 and G3 was described. The Wilschanski index values were different between G1 and G3. In conclusion, our data showed that NPD is useful for CF diagnosis when classes I-III CFTR mutations are screened. However, if classes IV-VI are considered, the NPD test showed an overlap in values with healthy subjects.

  14. Nasal Potential Difference in Cystic Fibrosis considering Severe CFTR Mutations

    PubMed Central

    Ng, Ronny Tah Yen; Marson, Fernando Augusto de Lima; Ribeiro, Jose Dirceu; Ribeiro, Antonio Fernando; Bertuzzo, Carmen Silvia; Ribeiro, Maria Angela Gonçalves de Oliveira; Severino, Silvana Dalge; Sakano, Eulalia

    2015-01-01

    The gold standard for diagnosing cystic fibrosis (CF) is a sweat chloride value above 60 mEq/L. However, this historical and important tool has limitations; other techniques should be studied, including the nasal potential difference (NPD) test. CFTR gene sequencing can identify CFTR mutations, but this method is time-consuming and too expensive to be used in all CF centers. The present study compared CF patients with two classes I-III CFTR mutations (10 patients) (G1), CF patients with classes IV-VI CFTR mutations (five patients) (G2), and 21 healthy subjects (G3). The CF patients and healthy subjects also underwent the NPD test. A statistical analysis was performed using the Mann-Whitney, Kruskal-Wallis, χ 2, and Fisher's exact tests, α = 0.05. No differences were observed between the CF patients and healthy controls for the PDMax, Δamiloride, and Δchloride + free + amiloride markers from the NPD test. For the finger value, a difference between G2 and G3 was described. The Wilschanski index values were different between G1 and G3. In conclusion, our data showed that NPD is useful for CF diagnosis when classes I-III CFTR mutations are screened. However, if classes IV-VI are considered, the NPD test showed an overlap in values with healthy subjects. PMID:25667564

  15. Cystic fibrosis (CF) mutation detection and frequencies in central New York state using single strand conformation (SSC) and heteroduplex analysis (HA) gel analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shrimpton, A.E.; Lamberson, C.M.; Hicks, K.E.

    1994-09-01

    Over 100 cystic fibrosis (CF) bearing chromosomes from patients living in central New York state have been screened in order to identify their CF mutations. Ethnic background information and parental samples were also collected when available. Polymerase chain reaction (PCR) amplified products from exons 3, 4, 5, 7, 9, 10, 11, 12, 13, 14B, 15, 17B, 19, 20, 21 and intro 19 have been screened for over 50 known CF mutations by restriction enzyme digest, heteroduplex analysis (HA) and/or single stand conformation (SSC) gel analysis. The exon 9 PCR product was difficult to analyze by HA or SSC gel analysis.more » Restriction enzyme site generating PCR primers were used to identify the R117H, 711+1,G>T, G542X, 1717-1,G>A, 1898-1,G>A and N1303K CF mutations. Haplotyping at CFTR-linked (xv-2c/Taq I, km19/Pst, I, MP6d.9/Msp I and J3.11/Pst I) and CFTR intragenic markers (intron 6 GATT{sub n}, 1540 A/G, 1898+152,T/A) was performed to aid in CF mutation identification.« less

  16. Detection of cystic fibrosis mutations in a GeneChip{trademark} assay format

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyada, C.G.; Cronin, M.T.; Kim, S.M.

    1994-09-01

    We are developing assays for the detection of cystic fibrosis mutations based on DNA hybridization. A DNA sample is amplified by PCR, labeled by incorporating a fluorescein-tagged dNTP, enzymatically treated to produce smaller fragments and hybridized to a series of short (13-16 bases) oligonucleotides synthesized on a glass surface via photolithography. The hybrids are detected by eqifluorescence and mutations are identified by the specific pattern of hybridization. In a GeneChip assay, the chip surface is composed of a series of subarrays, each being specific for a particular mutation. Each subarray is further subdivided into a series of probes (40 total),more » half based on the mutant sequence and the remainder based on the wild-type sequence. For each of the subarrays, there is a redundancy in the number of probes that should hybridize to either a wild-type or a mutant target. The multiple probe strategy provides sequence information for a short five base region overlapping the mutation site. In addition, homozygous wild-type and mutant as well as heterozygous samples are each identified by a specific pattern of hybridization. The small size of each probe feature (250 x 250 {mu}m{sup 2}) permits the inclusion of additional probes required to generate sequence information by hybridization.« less

  17. Non-invasive prenatal diagnosis for cystic fibrosis: detection of paternal mutations, exploration of patient preferences and cost analysis

    PubMed Central

    Hill, Melissa; Twiss, Philip; Verhoef, Talitha I; Drury, Suzanne; McKay, Fiona; Mason, Sarah; Jenkins, Lucy; Morris, Stephen; Chitty, Lyn S

    2015-01-01

    Abstract Objectives We aim to develop non-invasive prenatal diagnosis (NIPD) for cystic fibrosis (CF) and determine costs and implications for implementation. Methods A next-generation sequencing assay was developed to detect ten common CF mutations for exclusion of the paternal mutation in maternal plasma. Using uptake data from a study exploring views on NIPD for CF, total test-related costs were estimated for the current care pathway and compared with those incorporating NIPD. Results The assay reliably predicted mutation status in all control and maternal plasma samples. Of carrier or affected adults with CF (n = 142) surveyed, only 43.5% reported willingness to have invasive testing for CF with 94.4% saying they would have NIPD. Using these potential uptake data, the incremental costs of NIPD over invasive testing per 100 pregnancies at risk of CF are £9025 for paternal mutation exclusion, and £26 510 for direct diagnosis. Conclusions We have developed NIPD for risk stratification in around a third of CF families. There are economic implications due to potential increased test demand to inform postnatal management rather than to inform decisions around termination of an affected pregnancy. © 2015 The Authors. Prenatal Diagnosis published by John Wiley & Sons, Ltd. PMID:25708280

  18. Disease phenotype of a ferret CFTR-knockout model of cystic fibrosis

    PubMed Central

    Sun, Xingshen; Sui, Hongshu; Fisher, John T.; Yan, Ziying; Liu, Xiaoming; Cho, Hyung-Ju; Joo, Nam Soo; Zhang, Yulong; Zhou, Weihong; Yi, Yaling; Kinyon, Joann M.; Lei-Butters, Diana C.; Griffin, Michelle A.; Naumann, Paul; Luo, Meihui; Ascher, Jill; Wang, Kai; Frana, Timothy; Wine, Jeffrey J.; Meyerholz, David K.; Engelhardt, John F.

    2010-01-01

    Cystic fibrosis (CF) is a recessive disease that affects multiple organs. It is caused by mutations in CFTR. Animal modeling of this disease has been challenging, with species- and strain-specific differences in organ biology and CFTR function influencing the emergence of disease pathology. Here, we report the phenotype of a CFTR-knockout ferret model of CF. Neonatal CFTR-knockout ferrets demonstrated many of the characteristics of human CF disease, including defective airway chloride transport and submucosal gland fluid secretion; variably penetrant meconium ileus (MI); pancreatic, liver, and vas deferens disease; and a predisposition to lung infection in the early postnatal period. Severe malabsorption by the gastrointestinal (GI) tract was the primary cause of death in CFTR-knockout kits that escaped MI. Elevated liver function tests in CFTR-knockout kits were corrected by oral administration of ursodeoxycholic acid, and the addition of an oral proton-pump inhibitor improved weight gain and survival. To overcome the limitations imposed by the severe intestinal phenotype, we cloned 4 gut-corrected transgenic CFTR-knockout kits that expressed ferret CFTR specifically in the intestine. One clone passed feces normally and demonstrated no detectable ferret CFTR expression in the lung or liver. The animals described in this study are likely to be useful tools for dissecting CF disease pathogenesis and developing treatments. PMID:20739752

  19. Disease phenotype of a ferret CFTR-knockout model of cystic fibrosis.

    PubMed

    Sun, Xingshen; Sui, Hongshu; Fisher, John T; Yan, Ziying; Liu, Xiaoming; Cho, Hyung-Ju; Joo, Nam Soo; Zhang, Yulong; Zhou, Weihong; Yi, Yaling; Kinyon, Joann M; Lei-Butters, Diana C; Griffin, Michelle A; Naumann, Paul; Luo, Meihui; Ascher, Jill; Wang, Kai; Frana, Timothy; Wine, Jeffrey J; Meyerholz, David K; Engelhardt, John F

    2010-09-01

    Cystic fibrosis (CF) is a recessive disease that affects multiple organs. It is caused by mutations in CFTR. Animal modeling of this disease has been challenging, with species- and strain-specific differences in organ biology and CFTR function influencing the emergence of disease pathology. Here, we report the phenotype of a CFTR-knockout ferret model of CF. Neonatal CFTR-knockout ferrets demonstrated many of the characteristics of human CF disease, including defective airway chloride transport and submucosal gland fluid secretion; variably penetrant meconium ileus (MI); pancreatic, liver, and vas deferens disease; and a predisposition to lung infection in the early postnatal period. Severe malabsorption by the gastrointestinal (GI) tract was the primary cause of death in CFTR-knockout kits that escaped MI. Elevated liver function tests in CFTR-knockout kits were corrected by oral administration of ursodeoxycholic acid, and the addition of an oral proton-pump inhibitor improved weight gain and survival. To overcome the limitations imposed by the severe intestinal phenotype, we cloned 4 gut-corrected transgenic CFTR-knockout kits that expressed ferret CFTR specifically in the intestine. One clone passed feces normally and demonstrated no detectable ferret CFTR expression in the lung or liver. The animals described in this study are likely to be useful tools for dissecting CF disease pathogenesis and developing treatments.

  20. Blood Culture Test

    MedlinePlus

    ... Mutation Testing Breast Cancer Gene Expression Tests C-peptide C-Reactive Protein (CRP) CA 15-3 CA- ... Kinase (CK) Creatinine Creatinine Clearance Cryoglobulins Cyclic Citrullinated Peptide Antibody Cyclosporine Cystatin C Cystic Fibrosis (CF) Gene ...

  1. Synovial Fluid Analysis

    MedlinePlus

    ... Mutation Testing Breast Cancer Gene Expression Tests C-peptide C-Reactive Protein (CRP) CA 15-3 CA- ... Kinase (CK) Creatinine Creatinine Clearance Cryoglobulins Cyclic Citrullinated Peptide Antibody Cyclosporine Cystatin C Cystic Fibrosis (CF) Gene ...

  2. Pericardial Fluid Analysis

    MedlinePlus

    ... Mutation Testing Breast Cancer Gene Expression Tests C-peptide C-Reactive Protein (CRP) CA 15-3 CA- ... Kinase (CK) Creatinine Creatinine Clearance Cryoglobulins Cyclic Citrullinated Peptide Antibody Cyclosporine Cystatin C Cystic Fibrosis (CF) Gene ...

  3. Comparison of Ambient and Atmospheric Pressure Ion Sources for Cystic Fibrosis Exhaled Breath Condensate Ion Mobility-Mass Spectrometry Metabolomics

    NASA Astrophysics Data System (ADS)

    Zang, Xiaoling; Pérez, José J.; Jones, Christina M.; Monge, María Eugenia; McCarty, Nael A.; Stecenko, Arlene A.; Fernández, Facundo M.

    2017-08-01

    Cystic fibrosis (CF) is an autosomal recessive disorder caused by mutations in the gene that encodes the cystic fibrosis transmembrane conductance regulator (CFTR) protein. The vast majority of the mortality is due to progressive lung disease. Targeted and untargeted CF breath metabolomics investigations via exhaled breath condensate (EBC) analyses have the potential to expose metabolic alterations associated with CF pathology and aid in assessing the effectiveness of CF therapies. Here, transmission-mode direct analysis in real time traveling wave ion mobility spectrometry time-of-flight mass spectrometry (TM-DART-TWIMS-TOF MS) was tested as a high-throughput alternative to conventional direct infusion (DI) electrospray ionization (ESI) and atmospheric pressure chemical ionization (APCI) methods, and a critical comparison of the three ionization methods was conducted. EBC was chosen as the noninvasive surrogate for airway sampling over expectorated sputum as EBC can be collected in all CF subjects regardless of age and lung disease severity. When using pooled EBC collected from a healthy control, ESI detected the most metabolites, APCI a log order less, and TM-DART the least. TM-DART-TWIMS-TOF MS was used to profile metabolites in EBC samples from five healthy controls and four CF patients, finding that a panel of three discriminant EBC metabolites, some of which had been previously detected by other methods, differentiated these two classes with excellent cross-validated accuracy.

  4. Synergistic Potentiation of Cystic Fibrosis Transmembrane Conductance Regulator Gating by Two Chemically Distinct Potentiators, Ivacaftor (VX-770) and 5-Nitro-2-(3-Phenylpropylamino) Benzoate.

    PubMed

    Lin, Wen-Ying; Sohma, Yoshiro; Hwang, Tzyh-Chang

    2016-09-01

    Cystic fibrosis (CF) is caused by loss-of-function mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene encoding a phosphorylation-activated but ATP-gated chloride channel. Previous studies suggested that VX-770 [ivacaftor, N-(2,4-di-tert-butyl-5-hydroxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide], a CFTR potentiator now used in clinics, increases the open probability of CFTR by shifting the gating conformational changes to favor the open channel configuration. Recently the chloride channel blocker and CFTR potentiator 5-nitro-2-(3-phenylpropylamino) benzoate (NPPB) has been reported to enhance CFTR activity by a mechanism that exploits the ATP hydrolysis-driven, nonequilibrium gating mechanism unique to CFTR. Surprisingly however, NPPB increased the activity of nonhydrolytic G551D-CFTR, the third most common disease-associated mutation. Here, we further investigated the mechanism of NPPB's effects on CFTR gating by assessing its interaction with well-studied VX-770. Interestingly, once G551D-CFTR was maximally potentiated by VX-770, NPPB further increased its activity. However, quantitative analysis of this drug-drug interaction suggests that this pharmacologic synergism is not due to independent actions of NPPB and VX-770 on CFTR gating; instead, our data support a dependent mechanism involving two distinct binding sites. This latter idea is further supported by the observation that the locked-open time of a hydrolysis-deficient mutant K1250A was shortened by NPPB but prolonged by VX-770. In addition, the effectiveness of NPPB, but not of VX-770, was greatly diminished in a mutant whose second nucleotide-binding domain was completely removed. Interpreting these results under the framework of current understanding of CFTR gating not only reveals insights into the mechanism of action for different CFTR potentiators but also brings us one step forward to a more complete schematic for CFTR gating. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  5. Synergistic Potentiation of Cystic Fibrosis Transmembrane Conductance Regulator Gating by Two Chemically Distinct Potentiators, Ivacaftor (VX-770) and 5-Nitro-2-(3-Phenylpropylamino) Benzoate

    PubMed Central

    Lin, Wen-Ying; Sohma, Yoshiro

    2016-01-01

    Cystic fibrosis (CF) is caused by loss-of-function mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene encoding a phosphorylation-activated but ATP-gated chloride channel. Previous studies suggested that VX-770 [ivacaftor, N-(2,4-di-tert-butyl-5-hydroxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide], a CFTR potentiator now used in clinics, increases the open probability of CFTR by shifting the gating conformational changes to favor the open channel configuration. Recently the chloride channel blocker and CFTR potentiator 5-nitro-2-(3-phenylpropylamino) benzoate (NPPB) has been reported to enhance CFTR activity by a mechanism that exploits the ATP hydrolysis-driven, nonequilibrium gating mechanism unique to CFTR. Surprisingly however, NPPB increased the activity of nonhydrolytic G551D-CFTR, the third most common disease-associated mutation. Here, we further investigated the mechanism of NPPB’s effects on CFTR gating by assessing its interaction with well-studied VX-770. Interestingly, once G551D-CFTR was maximally potentiated by VX-770, NPPB further increased its activity. However, quantitative analysis of this drug–drug interaction suggests that this pharmacologic synergism is not due to independent actions of NPPB and VX-770 on CFTR gating; instead, our data support a dependent mechanism involving two distinct binding sites. This latter idea is further supported by the observation that the locked-open time of a hydrolysis-deficient mutant K1250A was shortened by NPPB but prolonged by VX-770. In addition, the effectiveness of NPPB, but not of VX-770, was greatly diminished in a mutant whose second nucleotide-binding domain was completely removed. Interpreting these results under the framework of current understanding of CFTR gating not only reveals insights into the mechanism of action for different CFTR potentiators but also brings us one step forward to a more complete schematic for CFTR gating. PMID:27413118

  6. HIV Genotypic Resistance Testing

    MedlinePlus

    ... Mutation Testing Breast Cancer Gene Expression Tests C-peptide C-Reactive Protein (CRP) CA 15-3 CA- ... Kinase (CK) Creatinine Creatinine Clearance Cryoglobulins Cyclic Citrullinated Peptide Antibody Cyclosporine Cystatin C Cystic Fibrosis (CF) Gene ...

  7. Prenatal diagnosis of cystic fibrosis: 10-years experience.

    PubMed

    Hadj Fredj, S; Ouali, F; Siala, H; Bibi, A; Othmani, R; Dakhlaoui, B; Zouari, F; Messaoud, T

    2015-06-01

    We present in this study our 10years experience in prenatal diagnosis of cystic fibrosis performed in the Tunisian population. Based on family history, 40 Tunisian couples were selected for prenatal diagnosis. Fetal DNA was isolated from amniotic fluid collected by transabdominal amniocentesis or from chronic villi by transcervical chorionic villus sampling. The genetic analysis for cystic fibrosis mutations was performed by denaturant gradient gel electrophoresis and denaturing high-pressure liquid phase chromatography. We performed microsatellites analysis by capillary electrophoresis in order to verify the absence of maternal cell contamination. Thirteen fetuses were affected, 21 were heterozygous carriers and 15 were healthy with two normal alleles of CFTR gene. Ten couples opted for therapeutic abortion. The microsatellites genotyping showed the absence of contamination of the fetal DNA by maternal DNA in 93.75%. Our diagnostic strategy provides rapid and reliable prenatal diagnosis at risk families of cystic fibrosis. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  8. Spectrum of Clinical Diseases Caused By Disorders of Primary Cilia

    PubMed Central

    Aygun, Meral Gunay-; Hildebrandt, Friedhelm

    2011-01-01

    The ciliopathies are a category of diseases caused by disruption of the physiological functions of cilia. Ciliary dysfunction results in a broad range of phenotypes, including renal, hepatic, and pancreatic cyst formation; situs abnormalities; retinal degeneration; anosmia; cerebellar or other brain anomalies; postaxial polydactyly; bronchiectasis; and infertility. The specific clinical features are dictated by the subtype, structure, distribution, and function of the affected cilia. This review highlights the clinical variability caused by dysfunction of motile and nonmotile primary cilia and emphasizes the genetic heterogeneity and phenotypic overlap that are characteristics of these disorders. There is a need for additional research to understand the shared and unique functions of motile and nonmotile cilia and the pathophysiology resulting from mutations in cilia, basal bodies, or centrosomes. Increased understanding of ciliary biology will improve the diagnosis and management of primary ciliary dyskinesia, syndromic ciliopathies, and cilia-related cystic diseases. PMID:21926397

  9. PIK3CA Mutations in Mucinous Cystic Neoplasms of the Pancreas

    PubMed Central

    Garcia-Carracedo, Dario; Chen, Zong-Ming; Qiu, Wanglong; Huang, Alicia S.; Tang, Sophia M.; Hruban, Ralph H.; Su, Gloria H.

    2014-01-01

    Objectives Mucinous cystic neoplasms (MCNs) are rare, potentially curable, mucin-producing neoplasms of the pancreas. We have previously reported PIK3CA (phosphoinositide-3-kinase catalytic subunit, p110α) mutations in intraductal papillary mucinous neoplasms, another mucin-producing neoplasm of the pancreas. In this study, we analyzed the presence of PIK3CA and AKT1/PKB (V-akt murine thymoma viral oncogene homolog 1) hot-spot mutations in MCN specimens. Methods Using the genomic DNA sequencing of tumor tissues isolated by laser capture microdissection, we evaluated 15 well-characterized MCNs for the E542K, E545K(exon 9), and H1047R (exon 20) hot-spotmutations in the PIK3CA gene and the E17K mutation in the AKT1 gene. Results A hot-spotmutation (E545K) of the PIK3CA gene was detected in 1 of the 15 MCNs and further confirmed by a mutant-enriched method. Interestingly, this mutation was found to be present only in the high-grade but not in low-grade dysplastic epithelium obtained from this neoplasm and coexisted with a KRASG12D mutation. No mutations were identified in the AKT1 gene. Conclusions Our data, when combined with previous reports on intraductal papillary mucinous neoplasms, indicate that oncogenic activation of the PI3K pathway involving PIK3CA gene mutations can contribute to the progression of mucin-producing neoplasms but not pancreatic intraepithelial neoplasia. PIK3CA status could be useful for understanding their progression to malignancy. PMID:24518503

  10. Assessment of Correlation between Sweat Chloride Levels and Clinical Features of Cystic Fibrosis Patients.

    PubMed

    Raina, Manzoor A; Khan, Mosin S; Malik, Showkat A; Raina, Ab Hameed; Makhdoomi, Mudassir J; Bhat, Javed I; Mudassar, Syed

    2016-12-01

    Cystic Fibrosis (CF) is an autosomal recessive disorder and the incidence of this disease is undermined in Northern India. The distinguishable salty character of the sweat belonging to individuals suffering from CF makes sweat chloride estimation essential for diagnosis of CF disease. The aim of this prospective study was to elucidate the relationship of sweat chloride levels with clinical features and pattern of CF. A total of 182 patients, with clinical features of CF were included in this study for quantitative measurement of sweat chloride. Sweat stimulation and collection involved pilocarpine iontophoresis based on the Gibson and Cooks methodology. The quantitative estimation of chloride was done by Schales and Schales method with some modifications. Cystic Fibrosis Trans Membrane Conductance Regulator (CFTR) mutation status was recorded in case of patients with borderline sweat chloride levels to correlate the results and for follow-up. Out of 182 patients having clinical features consistent with CF, borderline and elevated sweat chloride levels were present in 9 (5%) and 41 (22.5%) subjects respectively. Elevated sweat chloride levels were significantly associated with wheeze, Failure To Thrive (FTT), history of CF in Siblings, product of Consanguineous Marriage (CM), digital clubbing and steatorrhoea on univariate analysis. On multivariate analysis only wheeze, FTT and steatorrhoea were found to be significantly associated with elevated sweat chloride levels (p<0.05). Among the nine borderline cases six cases were positive for at least two CFTR mutations and rest of the three cases were not having any mutation in CFTR gene. The diagnosis is often delayed and the disease is advanced in most patients at the time of diagnosis. Sweat testing is a gold standard for diagnosis of CF patients as genetic mutation profile being heterozygous and unlikely to become diagnostic test.

  11. The ΔF508 Mutation in the Cystic Fibrosis Transmembrane Conductance Regulator Is Associated With Progressive Insulin Resistance and Decreased Functional β-Cell Mass in Mice.

    PubMed

    Fontés, Ghislaine; Ghislain, Julien; Benterki, Isma; Zarrouki, Bader; Trudel, Dominique; Berthiaume, Yves; Poitout, Vincent

    2015-12-01

    Cystic fibrosis (CF) is the result of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR). CF-related diabetes affects 50% of adult CF patients. How CFTR deficiency predisposes to diabetes is unknown. Herein, we examined the impact of the most frequent cftr mutation in humans, deletion of phenylalanine at position 508 (ΔF508), on glucose homeostasis in mice. We compared ΔF508 mutant mice with wild-type (WT) littermates. Twelve-week-old male ΔF508 mutants had lower body weight, improved oral glucose tolerance, and a trend toward higher insulin tolerance. Glucose-induced insulin secretion was slightly diminished in ΔF508 mutant islets, due to reduced insulin content, but ΔF508 mutant islets were not more sensitive to proinflammatory cytokines than WT islets. Hyperglycemic clamps confirmed an increase in insulin sensitivity with normal β-cell function in 12- and 18-week-old ΔF508 mutants. In contrast, 24-week-old ΔF508 mutants exhibited insulin resistance and reduced β-cell function. β-Cell mass was unaffected at 11 weeks of age but was significantly lower in ΔF508 mutants versus controls at 24 weeks. This was not associated with gross pancreatic pathology. We conclude that the ΔF508 CFTR mutation does not lead to an intrinsic β-cell secretory defect but is associated with insulin resistance and a β-cell mass deficit in aging mutants. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  12. Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.

    PubMed

    Padoan, R; Genoni, S; Moretti, E; Seia, M; Giunta, A; Corbetta, C

    2002-01-01

    A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

  13. Cystic fibrosis gene therapy: a mutation-independent treatment.

    PubMed

    Griesenbach, Uta; Davies, Jane C; Alton, Eric

    2016-11-01

    Since cloning of the disease-causing gene 27 years ago, the development of cystic fibrosis (CF) gene therapy has been pursued. Here, we will summarize key findings with a particular focus on recent developments. Almost 3 decades of research have highlighted the complexity of lung gene transfer and have generated a body of data that has recently led to the completion of a large phase IIB study. This trial has, for the first time, shown that nonviral gene transfer can, albeit modestly, stabilize lung function in CF and provides the impetus for further development of more potent gene transfer agents. Lentiviral vectors, specifically pseudotyped to enable entry into airway epithelial cells have most recently been developed. Persistent expression after a single dose and the ability to be administered repeatedly suggest that these viral vectors hold promise for the treatment of CF; a first-in-man clinical trial will shortly be initiated. Although the development of CF gene therapy has been slower than initially anticipated, recent progress has been encouraging and has renewed the interest of academics and industry to pursue lung gene therapy.

  14. Structure and Dynamics of NBD1 from CFTR Characterized Using Crystallography and Hydrogen/Deuterium Exchange Mass Spectrometry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lewis, H.A.; Wang, C.; Zhao, X.

    2012-04-30

    The {Delta}F508 mutation in nucleotide-binding domain 1 (NBD1) of the cystic fibrosis transmembrane conductance regulator (CFTR) is the predominant cause of cystic fibrosis. Previous biophysical studies on human F508 and {Delta}F508 domains showed only local structural changes restricted to residues 509-511 and only minor differences in folding rate and stability. These results were remarkable because {Delta}F508 was widely assumed to perturb domain folding based on the fact that it prevents trafficking of CFTR out of the endoplasmic reticulum. However, the previously reported crystal structures did not come from matched F508 and {Delta}F508 constructs, and the {Delta}F508 structure contained additional mutationsmore » that were required to obtain sufficient protein solubility. In this article, we present additional biophysical studies of NBD1 designed to address these ambiguities. Mass spectral measurements of backbone amide {sup 1}H/{sup 2}H exchange rates in matched F508 and {Delta}F508 constructs reveal that {Delta}F508 increases backbone dynamics at residues 509-511 and the adjacent protein segments but not elsewhere in NBD1. These measurements also confirm a high level of flexibility in the protein segments exhibiting variable conformations in the crystal structures. We additionally present crystal structures of a broader set of human NBD1 constructs, including one harboring the native F508 residue and others harboring the {Delta}F508 mutation in the presence of fewer and different solubilizing mutations. The only consistent conformational difference is observed at residues 509-511. The side chain of residue V510 in this loop is mostly buried in all non-{Delta}F508 structures but completely solvent exposed in all {Delta}F508 structures. These results reinforce the importance of the perturbation {Delta}F508 causes in the surface topography of NBD1 in a region likely to mediate contact with the transmembrane domains of CFTR. However, they also suggest that increased exposure of the 509-511 loop and increased dynamics in its vicinity could promote aggregation in vitro and aberrant intermolecular interactions that impede trafficking in vivo.« less

  15. Fatal Airway Obstruction in a Man With a Cystic Hygroma.

    PubMed

    Wygant, Cassandra Maria; Cohle, Stephen D

    2018-05-03

    We describe a 24-year-old man with a cystic hygroma of the left side of the lower neck that led to sudden death. Cystic hygroma (cystic lymphangioma) is a congenital malformation of the lymphatic system. The patient, who had a tracheostomy because of airway obstruction from the cystic hygroma, was found dead with his tracheostomy tube on the floor next to him. Complications of cystic hygroma include infiltration of the neck causing airway obstruction, dysphagia, pain, and obstructive sleep apnea.

  16. Evolution and adaptation in Pseudomonas aeruginosa biofilms driven by mismatch repair system-deficient mutators.

    PubMed

    Luján, Adela M; Maciá, María D; Yang, Liang; Molin, Søren; Oliver, Antonio; Smania, Andrea M

    2011-01-01

    Pseudomonas aeruginosa is an important opportunistic pathogen causing chronic airway infections, especially in cystic fibrosis (CF) patients. The majority of the CF patients acquire P. aeruginosa during early childhood, and most of them develop chronic infections resulting in severe lung disease, which are rarely eradicated despite intensive antibiotic therapy. Current knowledge indicates that three major adaptive strategies, biofilm development, phenotypic diversification, and mutator phenotypes [driven by a defective mismatch repair system (MRS)], play important roles in P. aeruginosa chronic infections, but the relationship between these strategies is still poorly understood. We have used the flow-cell biofilm model system to investigate the impact of the mutS associated mutator phenotype on development, dynamics, diversification and adaptation of P. aeruginosa biofilms. Through competition experiments we demonstrate for the first time that P. aeruginosa MRS-deficient mutators had enhanced adaptability over wild-type strains when grown in structured biofilms but not as planktonic cells. This advantage was associated with enhanced micro-colony development and increased rates of phenotypic diversification, evidenced by biofilm architecture features and by a wider range and proportion of morphotypic colony variants, respectively. Additionally, morphotypic variants generated in mutator biofilms showed increased competitiveness, providing further evidence for mutator-driven adaptive evolution in the biofilm mode of growth. This work helps to understand the basis for the specific high proportion and role of mutators in chronic infections, where P. aeruginosa develops in biofilm communities.

  17. Evolution and Adaptation in Pseudomonas aeruginosa Biofilms Driven by Mismatch Repair System-Deficient Mutators

    PubMed Central

    Yang, Liang; Molin, Søren; Oliver, Antonio; Smania, Andrea M.

    2011-01-01

    Pseudomonas aeruginosa is an important opportunistic pathogen causing chronic airway infections, especially in cystic fibrosis (CF) patients. The majority of the CF patients acquire P. aeruginosa during early childhood, and most of them develop chronic infections resulting in severe lung disease, which are rarely eradicated despite intensive antibiotic therapy. Current knowledge indicates that three major adaptive strategies, biofilm development, phenotypic diversification, and mutator phenotypes [driven by a defective mismatch repair system (MRS)], play important roles in P. aeruginosa chronic infections, but the relationship between these strategies is still poorly understood. We have used the flow-cell biofilm model system to investigate the impact of the mutS associated mutator phenotype on development, dynamics, diversification and adaptation of P. aeruginosa biofilms. Through competition experiments we demonstrate for the first time that P. aeruginosa MRS-deficient mutators had enhanced adaptability over wild-type strains when grown in structured biofilms but not as planktonic cells. This advantage was associated with enhanced micro-colony development and increased rates of phenotypic diversification, evidenced by biofilm architecture features and by a wider range and proportion of morphotypic colony variants, respectively. Additionally, morphotypic variants generated in mutator biofilms showed increased competitiveness, providing further evidence for mutator-driven adaptive evolution in the biofilm mode of growth. This work helps to understand the basis for the specific high proportion and role of mutators in chronic infections, where P. aeruginosa develops in biofilm communities. PMID:22114708

  18. Cystic fibrosis screening using the College panel: platform comparison and lessons learned from the first 20,000 samples.

    PubMed

    Strom, Charles M; Huang, Donghui; Buller, Arlene; Redman, Joy; Crossley, Beryl; Anderson, Ben; Entwistle, Tom; Sun, Weimin

    2002-01-01

    To determine the accuracy of two commercially available kits for cystic fibrosis (CF) genotyping and determine allele frequencies for the ACMG/ACOG recommended mutations. A total of 1,040 consecutive analyses using Roche CF Gold Strips and the ABI CF Genotyper were performed. Subsequently we performed analyses of 20,103 samples. Both kits accurately determined CF genotypes. The I148T mutation was found >100 times more frequently in carrier screening than in CF patients. Asymptomatic patients were identified who are compound heterozygotes for delta F508 and I148T. Four of 13 patients heterozygous for delta F508 and the IVS8-5T polymorphism had some symptoms of CF. Accurate and timely analysis can be performed for the ACMG CF panel. I148T is a low penetrance CF allele.

  19. CORK Study in Cystic Fibrosis: Sustained Improvements in Ultra-Low-Dose Chest CT Scores After CFTR Modulation With Ivacaftor.

    PubMed

    Ronan, Nicola J; Einarsson, Gisli G; Twomey, Maria; Mooney, Denver; Mullane, David; NiChroinin, Muireann; O'Callaghan, Grace; Shanahan, Fergus; Murphy, Desmond M; O'Connor, Owen J; Shortt, Cathy A; Tunney, Michael M; Eustace, Joseph A; Maher, Michael M; Elborn, J Stuart; Plant, Barry J

    2018-02-01

    Ivacaftor produces significant clinical benefit in patients with cystic fibrosis (CF) with the G551D mutation. Prevalence of this mutation at the Cork CF Centre is 23%. This study assessed the impact of cystic fibrosis transmembrane conductance regulator modulation on multiple modalities of patient assessment. Thirty-three patients with the G551D mutation were assessed at baseline and prospectively every 3 months for 1 year after initiation of ivacaftor. Change in ultra-low-dose chest CT scans, blood inflammatory mediators, and the sputum microbiome were assessed. Significant improvements in FEV 1 , BMI, and sweat chloride levels were observed post-ivacaftor treatment. Improvement in ultra-low-dose CT imaging scores were observed after treatment, with significant mean reductions in total Bhalla score (P < .01), peribronchial thickening (P = .035), and extent of mucous plugging (P < .001). Reductions in circulating inflammatory markers, including interleukin (IL)-1β, IL-6, and IL-8 were demonstrated. There was a 30% reduction in the relative abundance of Pseudomonas species and an increase in the relative abundance of bacteria associated with more stable community structures. Posttreatment community richness increased significantly (P = .03). Early and sustained improvements on ultra-low-dose CT scores suggest it may be a useful method of evaluating treatment response. It paralleled improvement in symptoms, circulating inflammatory markers, and changes in the lung microbiota. Copyright © 2017 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  20. Ethnicity impacts the cystic fibrosis diagnosis: A note of caution.

    PubMed

    Bosch, Barbara; Bilton, Diana; Sosnay, Patrick; Raraigh, Karen S; Mak, Denise Y F; Ishiguro, Hiroshi; Gulmans, Vincent; Thomas, Muriel; Cuppens, Harry; Amaral, Margarida; De Boeck, Kris

    2017-07-01

    The diagnosis of Cystic Fibrosis (CF) is by consensus based on the same parameters in all patients, yet the influence of ethnicity has only scarcely been studied. We aimed at elucidating the impact of Asian descent on the diagnosis of CF. We performed a retrospective analysis of the CFTR2 and UK CF databases for clinical phenotype, sweat chloride values and CFTR mutations and compared the diagnostic characteristics of Asian to non-Asian patients with CF. Asian patients with CF do not have a worse clinical phenotype. The repeatedly reported lower FEV 1 of Asian patients with CF is attributable to the influence of ethnicity on lung function in general. However, pancreatic sufficiency is more common in Asian patients with CF. The diagnosis of CF in people with Asian ancestry is heterogeneous as mean sweat chloride values are lower (92±26 versus 99±22mmol/L in controls) and 14% have sweat chloride values below 60mmol/L (versus 6% in non-Asians). Also, CFTR mutations differ from those in Caucasians: 55% of British Asian patients with CF do not have one mutation included in the routine newborn screening panel. Bringing together the largest cohort of patients with CF and Asian ethnicity, we demonstrate that Asian roots impact on all three CF diagnostic pillars. These findings have implications for clinical practice in the increasingly ethnically diverse Western population. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  1. Effect of ivacaftor in patients with advanced cystic fibrosis and a G551D-CFTR mutation: Safety and efficacy in an expanded access program in the United States.

    PubMed

    Taylor-Cousar, Jennifer; Niknian, Minoo; Gilmartin, Geoffrey; Pilewski, Joseph M

    2016-01-01

    Ivacaftor is the first therapeutic agent approved for the treatment of cystic fibrosis (CF) that targets the underlying molecular defect. Patients with severe lung disease were excluded from the randomized Phase 3 trials. This open-label study was designed to provide ivacaftor to patients in critical medical need prior to commercial product availability. CF patients aged ≥6 years with a G551D-CFTR mutation and FEV1 ≤ 40% predicted or listed for lung transplant received ivacaftor 150 mg every 12 h. The primary endpoint was safety as determined by adverse events. Secondary endpoints included assessment of lung function and weight. The rate of serious adverse events was consistent with disease severity. At 24 weeks of treatment with ivacaftor, there was a mean absolute increase in percent predicted FEV1 of 5.5 percentage points and a 3.3 kg mean absolute increase in weight from baseline. In patients with severe lung disease, ivacaftor was well tolerated and was associated with improved lung function and weight gain. Copyright © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  2. Cystic Fibrosis Patents: A Case Study of Successful Licensing

    PubMed Central

    Minear, Mollie A.; Kapustij, Cristina; Boden, Kaeleen; Chandrasekharan, Subhashini; Cook-Deegan, Robert

    2013-01-01

    From 2006–2010, Duke University’s Center for Public Genomics prepared eight case studies examining the effects of gene patent licensing practices on clinical access to genetic testing for ten clinical conditions. One of these case studies focused on the successful licensing practices employed by the University of Michigan and the Hospital for Sick Children in Toronto for patents covering the CFTR gene and its ΔF508 mutation that causes a majority of cystic fibrosis cases. Since the licensing of these patents has not impeded clinical access to genetic testing, we sought to understand how this successful licensing model was developed and whether it might be applicable to other gene patents. We interviewed four key players who either were involved in the initial discussions regarding the structure of licensing or who have recently managed the licenses and collected related documents. Important features of the licensing planning process included thoughtful consideration of potential uses of the patent; anticipation of future scientific discoveries and technological advances; engagement of relevant stakeholders, including the Cystic Fibrosis Foundation; and using separate licenses for in-house diagnostics versus kit manufacture. These features led to the development of a licensing model that has not only allowed the patent holders to avoid the controversy that has plagued other gene patents, but has also allowed research, development of new therapeutics, and wide-spread dissemination of genetic testing for cystic fibrosis. Although this licensing model may not be applicable to all gene patents, it serves as a model in which gene patent licensing can successfully enable innovation, investment in therapeutics research, and protect intellectual property while respecting the needs of patients, scientists, and public health. PMID:24231943

  3. Evolving Mechanistic Views and Emerging Therapeutic Strategies for Cystic Fibrosis–Related Diabetes

    PubMed Central

    2017-01-01

    Diabetes is a common and important complication of cystic fibrosis, an autosomal recessive genetic disease due to mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Cystic fibrosis–related diabetes (CFRD) is associated with profound detrimental effects on the disease course and mortality and is expected to increase in prevalence as the survival of patients with cystic fibrosis continues to improve. Despite progress in the functional characterization of CFTR molecular defects, the mechanistic basis of CFRD is not well understood, in part because of the relative inaccessibility of the pancreatic tissue and the limited availability of representative animal models. This review presents a concise overview of the current understanding of CFRD pathogenesis and provides a cutting-edge update on novel findings from human and animal studies. Potential contributions from paracrine mechanisms and β-cell compensatory mechanisms are highlighted, as well as functional β-cell and α-cell defects, incretin defects, exocrine pancreatic insufficiency, and loss of islet cell mass. State-of-the-art and emerging treatment options are explored, including advances in insulin administration, CFTR modulators, cell replacement, gene replacement, and gene editing therapies. PMID:29264462

  4. Nanoparticles for Site Specific Genome Editing

    NASA Astrophysics Data System (ADS)

    McNeer, Nicole Ali

    Triplex-forming peptide nucleic acids (PNAs) can be used to coordinate the recombination of short 50-60 by "donor DNA" fragments into genomic DNA, resulting in site-specific correction of genetic mutations or the introduction of advantageous genetic modifications. Site-specific gene editing in hematopoietic stem and progenitor cells (HSPCs) could result in treatment or cure of inherited disorders of the blood such as beta-thalassemia. Gene editing in HSPCs and differentiated T cells could help combat HIV/AIDs by modifying receptors, such as CCR5, necessary for R5-tropic HIV entry. However, translation of genome modification technologies to clinical practice is limited by challenges in intracellular delivery, especially in difficult-to-transfect hematolymphoid cells. In vivo gene editing could also provide novel treatment for systemic monogenic disorders such as cystic fibrosis, an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane receptor. Here, we have engineered biodegradable nanoparticles to deliver oligonucleotides for site-specific genome editing of disease-relevant genes in human cells, with high efficiency, low toxicity, and editing of clinically relevant cell types. We designed nanoparticles to edit the human beta-globin and CCR5 genes in hematopoietic cells. We show that poly(lactic-co-glycolic acid) (PLGA) nanoparticles can delivery PNA and donor DNA for site-specific gene modification in human hematopoietic cells in vitro and in vivo in NOD-scid IL2rgammanull mice. Nanoparticles delivered by tail vein localized to hematopoietic compartments in the spleen and bone marrow of humanized mice, resulting in modification of the beta-globin and CCR5 genes. Modification frequencies ranged from 0.005 to 20% of cells depending on the organ and cell type, without detectable toxicity. This project developed highly versatile methods for delivery of therapeutics to hematolymphoid cells and hematopoietic stem cells, and will help to translate gene therapies for diseases of the blood and immune system to clinical practice. In addition, we have expanded the use of this technology to an additional nonhematopoietic model system: correction of the human cystic fibrosis transmembrane receptor gene in human bronchial epithelial cells. The work presented here represents (1) the first use of biodegradable nanoparticles for PNA delivery, (2) the first direct in vivo site-specific genome modification in human cells, and (3) the first use of triplex-PNA technology for site-specific genome editing in cystic fibrosis.

  5. Large Omental Cystic Lymphangioma Masquerading as Mucinous Ovarian Neoplasia in an 8-Year-Old Premenarchal Girl: The Findings from Diagnostic Imaging and Laparoscopic-Assisted Excision.

    PubMed

    Takeda, Akihiro; Ito, Hiroaki; Nakamura, Hiromi

    2017-12-01

    Omental cystic lymphangioma is an extremely rare abdominal mass caused by congenital malformation. An 8-year-old premenarchal girl reported abdominal pain. Diagnostic imaging revealed a large multicystic mass measuring 22 cm in diameter, which occupied the entire abdominal cavity with ascites. Emergency laparoscopy revealed a ruptured large cystic mass originating from the greater omentum; this was followed by successful laparoscopic-assisted excision. The pathological diagnosis was omental cystic lymphangioma. The present findings show that omental cystic lymphangioma masquerading as mucinous ovarian neoplasia was a rare cause of acute abdominal events in a young girl. The present case shows that minimally invasive surgery can be a feasible option, which might achieve a favorable outcome in a young patient with an omental cystic lymphangioma. Copyright © 2017 North American Society for Pediatric and Adolescent Gynecology. Published by Elsevier Inc. All rights reserved.

  6. CFTR Modulators: Shedding Light on Precision Medicine for Cystic Fibrosis

    PubMed Central

    Lopes-Pacheco, Miquéias

    2016-01-01

    Cystic fibrosis (CF) is the most common life-threatening monogenic disease afflicting Caucasian people. It affects the respiratory, gastrointestinal, glandular and reproductive systems. The major cause of morbidity and mortality in CF is the respiratory disorder caused by a vicious cycle of obstruction of the airways, inflammation and infection that leads to epithelial damage, tissue remodeling and end-stage lung disease. Over the past decades, life expectancy of CF patients has increased due to early diagnosis and improved treatments; however, these patients still present limited quality of life. Many attempts have been made to rescue CF transmembrane conductance regulator (CFTR) expression, function and stability, thereby overcoming the molecular basis of CF. Gene and protein variances caused by CFTR mutants lead to different CF phenotypes, which then require different treatments to quell the patients’ debilitating symptoms. In order to seek better approaches to treat CF patients and maximize therapeutic effects, CFTR mutants have been stratified into six groups (although several of these mutations present pleiotropic defects). The research with CFTR modulators (read-through agents, correctors, potentiators, stabilizers and amplifiers) has achieved remarkable progress, and these drugs are translating into pharmaceuticals and personalized treatments for CF patients. This review summarizes the main molecular and clinical features of CF, emphasizes the latest clinical trials using CFTR modulators, sheds light on the molecular mechanisms underlying these new and emerging treatments, and discusses the major breakthroughs and challenges to treating all CF patients. PMID:27656143

  7. Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.

    PubMed

    Dupuis, Annie; Keenan, Katherine; Ooi, Chee Y; Dorfman, Ruslan; Sontag, Marci K; Naehrlich, Lutz; Castellani, Carlo; Strug, Lisa J; Rommens, Johanna M; Gonska, Tanja

    2016-04-01

    Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med 18 4, 333-340.

  8. Identification of eight novel mutations in a collaborative analysis of a part of the second transmembrane domain of the CFTR gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mercier, B.; Audrezet, M.P.; Guillermit, H.

    Cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible, when mutated, for cystic fibrosis (CF), spans over 230 kb on the long arm of chromosome 7 and is composed of 27 exons. The most common mutation responsible for CF worldwide is the deletion of a phenylalanine amino acid at codon 508 in the first nucleotide-binding fold and accounts for approximately 70% of CF chromosomes studied. More than 250 other mutations have been reported through the CF Genetic Analysis Consortium. The majority of the mutations previously described lie in the two nucleotide-binding folds. To explore exhaustively other regions of the gene,more » particularly exons coding for transmembrane domains, the authors have initiated a collaborative study between different laboratories to screen 369 non-[Delta]F508 CF chromosomes of seven ethnic European populations (Belgian, French, Breton, Irish, Italian, Yugoslavian, Russian). Among these chromosomes carrying an unidentified mutation, 63 were from Brittany, 50 of various French origin, 45 of Irish origin, 56 of Italian origin, 41 of Belgian origin, 2 of Turkish origin, 38 of Yugoslavian origin, 22 of Russian origin, and 52 of Bulgarian origin. Diagnostic criteria for CF included at least one positive sweat test and pulmonary disease with or without pancreatic disease. Using a denaturing gradient gel electrophoresis (DGGE) assay, they have identified eight novel mutations in exon 17b coding for part of the second transmembrane domain of the CFTR and they describe them in this report. 8 refs., 1 fig., 1 tab.« less

  9. [Pseudo-Bartter syndrome as manifestation of cystic fibrosis with DF508 mutation].

    PubMed

    Galaviz-Ballesteros, María de Jesús; Acosta-Rodríguez-Bueno, Carlos Patricio; Consuelo-Sánchez, Alejandra; Franco-Álvarez, Isidro; Olalla-Mora, Odilo Iván; Vázquez-Frias, Rodrigo

    Pseudo Bartter syndrome (PBS) is defined as hypokalaemic hypochloraemic metabolic alkalosis in the absence of renal tubular pathology. Children with cystic fibrosis (CF) are at risk of developing electrolyte abnormalities and even PBS may occur. 5 months old female infant with a history of two events of dehydration with vomit, refusal to eat, chronic cough, polyuria, malnutrition, metabolic alkalosis, hypokalemia, hyponatremia, hypochloremia and acute renal failure. Chronic cough study was performed, discarding pulmonary tuberculosis, gastroesophageal reflux disease and impaired swallowing. PBS was diagnosed due to hypokalaemic hypochloraemic metabolic alkalosis in the absence of renal tubular pathology. CF was corroborated by electrolytes in sweat and through molecular analysis of the delta F508 mutation. This is one of the few reported cases linking PBS and this mutation. In patients with hyponatremic dehydration episodes with hypokalaemic hypochloraemic metabolic alkalosis, PBS should be considered as differential diagnosis. CF could be presented as PBS, mainly in patients younger than 2 years. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  10. Microcystic stromal tumour of the ovary: frequent mutations of β-catenin (CTNNB1) in six cases.

    PubMed

    Bi, Rui; Bai, Qian-Ming; Yang, Fei; Wu, Li-Jing; Cheng, Yu-Fan; Shen, Xu-Xia; Cai, Xu; Zhou, Xiao-Yan; Yang, Wen-Tao

    2015-12-01

    To analyse the clinicopathological, immunohistochemical and β-catenin (CTNNB1) mutation characteristics of six cases of microcystic stromal tumour of the ovary (MCST). Six Chinese patients with MCST who ranged in age from 29 to 69 years (mean 50 years) were included in the study. Five patients were detected with a pelvic mass during routine health examinations and one patient presented initially with opsomenorrhoea. All tumours involved the left ovary, with solid-cystic cut surface in five cases and cystic cut surface in one case. Microscopically, microcysts, solid nests and hyaline degenerated fibrous stroma were variably mixed. Immunohistochemically, the tumour cells in all cases were diffusely positive for CD10, vimentin and WT-1 and negative for α-inhibin and calretinin. β-catenin expression was observed in both the nucleus and the cytoplasm in five cases and only in the cytoplasm in one case. The results of CTNNB1 mutation analysis revealed four missense point mutations in four cases, which were c.97T>C, c.101G>A, c.110C>G and c.122C>T. MCST shows a unique morphology with characteristic immunophenotype. β-catenin expression in the nucleus and β-catenin mutations were identified in the majority of cases, which suggests that the Wnt/β-catenin pathway may play a crucial role in the tumorigenesis of MCST. © 2015 John Wiley & Sons Ltd.

  11. Clinical Sensitivity of Cystic Fibrosis Mutation Panels in a Diverse Population.

    PubMed

    Hughes, Erin E; Stevens, Colleen F; Saavedra-Matiz, Carlos A; Tavakoli, Norma P; Krein, Lea M; Parker, April; Zhang, Zhen; Maloney, Breanne; Vogel, Beth; DeCelie-Germana, Joan; Kier, Catherine; Anbar, Ran D; Berdella, Maria N; Comber, Paul G; Dozor, Allen J; Goetz, Danielle M; Guida, Louis; Kattan, Meyer; Ting, Andrew; Voter, Karen Z; van Roey, Patrick; Caggana, Michele; Kay, Denise M

    2016-02-01

    Infants are screened for cystic fibrosis (CF) in New York State (NYS) using an IRT-DNA algorithm. The purpose of this study was to validate and assess clinical validity of the US FDA-cleared Illumina MiSeqDx CF 139-Variant Assay (139-VA) in the diverse NYS CF population. The study included 439 infants with CF identified via newborn screening (NBS) from 2002 to 2012. All had been screened using the Abbott Molecular CF Genotyping Assay or the Hologic InPlex CF Molecular Test. All with CF and zero or one mutation were tested using the 139-VA. DNA extracted from dried blood spots was reliably and accurately genotyped using the 139-VA. Sixty-three additional mutations were identified. Clinical sensitivity of three panels ranged from 76.2% (23 mutations recommended for screening by ACMG/ACOG) to 79.7% (current NYS 39-mutation InPlex panel), up to 86.0% for the 139-VA. For all, sensitivity was highest in Whites and lowest in the Black population. Although the sample size was small, there was a nearly 20% increase in sensitivity for the Black CF population using the 139-VA (68.2%) over the ACMG/ACOG and InPlex panels (both 50.0%). Overall, the 139-VA is more sensitive than other commercially available panels, and could be considered for NBS, clinical, or research laboratories conducting CF screening. © 2015 WILEY PERIODICALS, INC.

  12. Exome Sequencing Frequently Reveals the Cause of Early-Onset Chronic Kidney Disease

    PubMed Central

    Vivante, Asaf; Hildebrandt, Friedhelm

    2016-01-01

    The primary causes of chronic kidney disease (CKD) in children differ from those of adult onset CKD. In the United States the most common diagnostic groups of CKD that manifests before 25 years of age are: i) congenital anomalies of the kidneys and urinary tract (CAKUT) (49.1%), ii) steroid-resistant nephrotic syndrome (SRNS) (10.4%), iii) chronic glomerulonephritis (8.1%), and iv) renal cystic ciliopathies (5.3 %), encompassing >70% of CKD together. Recent findings suggest that early-onset CKD is caused by mutations in any one of over 200 different monogenic genes. High-throughput sequencing has very recently rendered identification of causative mutations in this high number of genes feasible. Molecular genetic diagnostics in early onset-CKD (before the age of 25 years) will, i) provide patients and families with a molecular genetic diagnosis, ii) generate new insights into diseases mechanisms, iii) allow etiology-based classification of patient cohorts for clinical studies and, iv) may have consequences for personalized treatment and prevention of CKD. In this review, we will discuss the implications of next-generation sequencing for clinical genetic diagnostics and discovery of novel genes in early-onset CKD. We also delineate the resulting opportunities for deciphering disease mechanisms and therapeutic implications. PMID:26750453

  13. Structural effects of extracellular loop mutations in CFTR helical hairpins.

    PubMed

    Chang, Yuan-Heng; Stone, Tracy A; Chin, Stephanie; Glibowicka, Mira; Bear, Christine E; Deber, Charles M

    2018-05-01

    Missense mutations constitute 40% of 2000 cystic fibrosis-phenotypic mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) database, yet the precise mechanism as to how a point mutation can render the entire 1480-residue CFTR protein dysfunctional is not well-understood. Here we investigate the structural effects of two CF-phenotypic mutations - glutamic acid to glycine at position 217 (E217G) and glutamine to arginine at position 220 (Q220R) - in the extracellular (ECL2) loop region of human CFTR using helical hairpin constructs derived from transmembrane (TM) helices 3 and 4 of the first membrane domain. We systematically replaced the wild type (WT) residues E217 and Q220 with the subset of missense mutations that could arise through a single nucleotide change in their respective codons. Circular dichroism spectra of E217G revealed that a significant increase in helicity vs. WT arises in the membrane-mimetic environment of sodium dodecylsulfate (SDS) micelles, while this mutant showed a similar gel shift to WT on SDS-PAGE gels. In contrast, the CF-mutant Q220R showed similar helicity but an increased gel shift vs. WT. These structural variations are compared with the maturation levels of the corresponding mutant full-length CFTRs, which we found are reduced to approx. 50% for E217G and 30% for Q220R vs. WT. The overall results with CFTR hairpins illustrate the range of impacts that single mutations can evoke in intramolecular protein-protein and/or protein-lipid interactions - and the levels to which corresponding mutations in full-length CFTR may be flagged by quality control mechanisms during biosynthesis. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Novel SIL1 nonstop mutation in a Chinese consanguineous family with Marinesco-Sjögren syndrome and Dandy-Walker syndrome.

    PubMed

    Gai, Nan; Jiang, Chen; Zou, Yong-Yi; Zheng, Yu; Liang, De-Sheng; Wu, Ling-Qian

    2016-07-01

    Marinesco-Sjögren syndrome (MSS) is a rare autosomal recessive disorder, which is characterized by congenital cataracts, cerebellar ataxia, progressive muscle weakness, and delayed psychomotor development. SIL1, which is located at 5q31.2, is the only gene known to cause MSS. Dandy-Walker syndrome (DWS) is defined by hypoplasia, upward rotation of the cerebellar vermis, and cystic dilation of the fourth ventricle; however, its genetic pathogeny remains unclear. Here, we report a Chinese consanguineous family with MSS and DWS. Whole exome sequencing identified a novel nonstop mutation in SIL1. Sanger sequencing revealed that the mutation was segregated in this family according to a recessive mode of inheritance. We found that the mutation changed a stop codon (TGA) to an arginine codon (CGA), and no in-frame termination codon in the 3' untranslated region (UTR) of SIL1 could be found. The mRNA levels of SIL1 were decreased by 56.6% and 37.5% in immortalized lymphoblasts of the patients respectively; the protein levels of SIL1 were substantially decreased. This case study is the first report on Chinese MSS patients, MSS complicated by DWS, and a nonstop mutation in SIL1. Our findings imply the pathogenetic association between DWS and MSS. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Rathke's Cleft Cyst as Origin of a Pediatric Papillary Craniopharyngioma.

    PubMed

    Schlaffer, Sven-Martin; Buchfelder, Michael; Stoehr, Robert; Buslei, Rolf; Hölsken, Annett

    2018-01-01

    A 6-year old patient presented with an intra and suprasellar cystic lesion accompanied with impairment of the hypothalamic-pituitary axis and partial hypopituitarism. The most likely cause of sellar lesions in this age group are adamantinomatous craniopharyngioma (adaCP) or Rathke´s cleft cysts (RCCs). AdaCP are characterized by CTNNB1 mutations accompanied with aberrant nuclear beta-catenin expression. RCC show neither nuclear beta-catenin expression nor BRAF mutation. The latter is a hallmark of papillary craniopharyngiomas (papCP) that exhibit remarkable histological similarity with metaplasia of RCC. Diagnosis of the patient was elucidated by CTNNB1 and BRAF mutation screening, utilizing different approaches, as well as histological examination of markers, e.g., beta-catenin, claudin-1, EpCAM and the mutated BRAFV600E protein, which are known to be differentially expressed in sellar lesions. The case presented reveals extraordinary aspects for two reasons. Firstly, the lesion appeared clinically, on MRI, intraoperatively and histologically as RCC with prominent squamous metaplasia, but showing an expression pattern of markers also found in papCP, whilst exhibiting a hitherto undescribed BRAF V 600 E mutation. This important result documents a supposable transition of RCC metaplasia into a papillary craniopharyngioma (papCP). Secondly, this intriguing case shows unexpectedly that although papCP usually occurs almost exclusively in adults, it can also arise in childhood.

  16. Some gating potentiators, including VX-770, diminish ΔF508-CFTR functional expression

    PubMed Central

    Veit, Guido; Avramescu, Radu G.; Perdomo, Doranda; Phuan, Puay-Wah; Bagdany, Miklos; Apaja, Pirjo M.; Borot, Florence; Szollosi, Daniel; Wu, Yu-Sheng; Finkbeiner, Walter E.; Hegedus, Tamas; Verkman, Alan S.; Lukacs, Gergely L.

    2015-01-01

    Cystic fibrosis (CF) is caused by mutations in the CF transmembrane regulator (CFTR) that result in reduced anion conductance at the apical membrane of secretory epithelia. Treatment of CF patients carrying the G551D gating mutation with the potentiator VX-770 (ivacaftor) largely restores channel activity and has shown substantial clinical benefit. However, most CF patients carry the ΔF508 mutation, which impairs CFTR folding, processing, function, and stability. Studies in homozygous ΔF508 CF patients indicated little clinical benefit of monotherapy with the investigational corrector VX-809 (lumacaftor) or VX-770, whereas combination clinical trials show limited but significant improvements in lung function. We show that VX-770, as well as most other potentiators, reduces the correction efficacy of VX-809 and another investigational corrector, VX-661. To mimic the administration of VX-770 alone or in combination with VX-809, we examined its long-term effect in immortalized and primary human respiratory epithelia. VX-770 diminished the folding efficiency and the metabolic stability of ΔF508-CFTR at the endoplasmic reticulum (ER) and post-ER compartments, respectively, causing reduced cell surface ΔF508-CFTR density and function. VX-770–induced destabilization of ΔF508-CFTR was influenced by second-site suppressor mutations of the folding defect and was prevented by stabilization of the nucleotide-binding domain 1 (NBD1)–NBD2 interface. The reduced correction efficiency of ΔF508-CFTR, as well as of two other processing mutations in the presence of VX-770, suggests the need for further optimization of potentiators to maximize the clinical benefit of corrector-potentiator combination therapy in CF. PMID:25101887

  17. Some gating potentiators, including VX-770, diminish ΔF508-CFTR functional expression.

    PubMed

    Veit, Guido; Avramescu, Radu G; Perdomo, Doranda; Phuan, Puay-Wah; Bagdany, Miklos; Apaja, Pirjo M; Borot, Florence; Szollosi, Daniel; Wu, Yu-Sheng; Finkbeiner, Walter E; Hegedus, Tamas; Verkman, Alan S; Lukacs, Gergely L

    2014-07-23

    Cystic fibrosis (CF) is caused by mutations in the CF transmembrane regulator (CFTR) that result in reduced anion conductance at the apical membrane of secretory epithelia. Treatment of CF patients carrying the G551D gating mutation with the potentiator VX-770 (ivacaftor) largely restores channel activity and has shown substantial clinical benefit. However, most CF patients carry the ΔF508 mutation, which impairs CFTR folding, processing, function, and stability. Studies in homozygous ΔF508 CF patients indicated little clinical benefit of monotherapy with the investigational corrector VX-809 (lumacaftor) or VX-770, whereas combination clinical trials show limited but significant improvements in lung function. We show that VX-770, as well as most other potentiators, reduces the correction efficacy of VX-809 and another investigational corrector, VX-661. To mimic the administration of VX-770 alone or in combination with VX-809, we examined its long-term effect in immortalized and primary human respiratory epithelia. VX-770 diminished the folding efficiency and the metabolic stability of ΔF508-CFTR at the endoplasmic reticulum (ER) and post-ER compartments, respectively, causing reduced cell surface ΔF508-CFTR density and function. VX-770-induced destabilization of ΔF508-CFTR was influenced by second-site suppressor mutations of the folding defect and was prevented by stabilization of the nucleotide-binding domain 1 (NBD1)-NBD2 interface. The reduced correction efficiency of ΔF508-CFTR, as well as of two other processing mutations in the presence of VX-770, suggests the need for further optimization of potentiators to maximize the clinical benefit of corrector-potentiator combination therapy in CF. Copyright © 2014, American Association for the Advancement of Science.

  18. Whole exome resequencing distinguishes cystic kidney diseases from phenocopies in renal ciliopathies

    PubMed Central

    Gee, Heon Yung; Otto, Edgar A.; Hurd, Toby W.; Ashraf, Shazia; Chaki, Moumita; Cluckey, Andrew; Vega-Warner, Virginia; Saisawat, Pawaree; Diaz, Katrina A.; Fang, Humphrey; Kohl, Stefan; Allen, Susan J.; Airik, Rannar; Zhou, Weibin; Ramaswami, Gokul; Janssen, Sabine; Fu, Clementine; Innis, Jamie L.; Weber, Stefanie; Vester, Udo; Davis, Erica E.; Katsanis, Nicholas; Fathy, Hanan M.; Jeck, Nikola; Klaus, Gunther; Nayir, Ahmet; Rahim, Khawla A.; Attrach, Ibrahim Al; Hassoun, Ibrahim Al; Ozturk, Savas; Drozdz, Dorota; Helmchen, Udo; O’Toole, John F.; Attanasio, Massimo; Nürnberg, Gudrun; Nürnberg, Peter; Washburn, Joseph; MacDonald, James; James, Jeffrey W.; Levy, Shawn; Hildebrandt, Friedhelm

    2013-01-01

    Rare single-gene disorders cause chronic disease. However, half of the 6,000 recessive single gene causes of disease are still unknown. Because recessive disease genes can illuminate, at least in part, disease pathomechanism, their identification offers direct opportunities for improved clinical management and potentially treatment. Rare diseases comprise the majority of chronic kidney disease (CKD) in children but are notoriously difficult to diagnose. Whole exome resequencing facilitates identification of recessive disease genes. However, its utility is impeded by the large number of genetic variants detected. We here overcome this limitation by combining homozygosity mapping with whole exome resequencing in 10 sib pairs with a nephronophthisis-related ciliopathy, which represents the most frequent genetic cause of CKD in the first three decades of life. In 7 of 10 sib-ships with a histologic or ultrasonographic diagnosis of nephronophthisis-related ciliopathy we detect the causative gene. In six sib-ships we identify mutations of known nephronophthisis-related ciliopathy genes, while in two additional sib-ships we found mutations in the known CKD-causing genes SLC4A1 and AGXT as phenocopies of nephronophthisis-related ciliopathy. Thus whole exome resequencing establishes an efficient, non-invasive approach towards early detection and causation-based diagnosis of rare kidney diseases. This approach can be extended to other rare recessive disorders, thereby providing accurate diagnosis and facilitating the study of disease mechanisms. PMID:24257694

  19. Whole-exome resequencing distinguishes cystic kidney diseases from phenocopies in renal ciliopathies.

    PubMed

    Gee, Heon Yung; Otto, Edgar A; Hurd, Toby W; Ashraf, Shazia; Chaki, Moumita; Cluckey, Andrew; Vega-Warner, Virginia; Saisawat, Pawaree; Diaz, Katrina A; Fang, Humphrey; Kohl, Stefan; Allen, Susan J; Airik, Rannar; Zhou, Weibin; Ramaswami, Gokul; Janssen, Sabine; Fu, Clementine; Innis, Jamie L; Weber, Stefanie; Vester, Udo; Davis, Erica E; Katsanis, Nicholas; Fathy, Hanan M; Jeck, Nikola; Klaus, Gunther; Nayir, Ahmet; Rahim, Khawla A; Al Attrach, Ibrahim; Al Hassoun, Ibrahim; Ozturk, Savas; Drozdz, Dorota; Helmchen, Udo; O'Toole, John F; Attanasio, Massimo; Lewis, Richard A; Nürnberg, Gudrun; Nürnberg, Peter; Washburn, Joseph; MacDonald, James; Innis, Jeffrey W; Levy, Shawn; Hildebrandt, Friedhelm

    2014-04-01

    Rare single-gene disorders cause chronic disease. However, half of the 6000 recessive single gene causes of disease are still unknown. Because recessive disease genes can illuminate, at least in part, disease pathomechanism, their identification offers direct opportunities for improved clinical management and potentially treatment. Rare diseases comprise the majority of chronic kidney disease (CKD) in children but are notoriously difficult to diagnose. Whole-exome resequencing facilitates identification of recessive disease genes. However, its utility is impeded by the large number of genetic variants detected. We here overcome this limitation by combining homozygosity mapping with whole-exome resequencing in 10 sib pairs with a nephronophthisis-related ciliopathy, which represents the most frequent genetic cause of CKD in the first three decades of life. In 7 of 10 sibships with a histologic or ultrasonographic diagnosis of nephronophthisis-related ciliopathy, we detect the causative gene. In six sibships, we identify mutations of known nephronophthisis-related ciliopathy genes, while in two additional sibships we found mutations in the known CKD-causing genes SLC4A1 and AGXT as phenocopies of nephronophthisis-related ciliopathy. Thus, whole-exome resequencing establishes an efficient, noninvasive approach towards early detection and causation-based diagnosis of rare kidney diseases. This approach can be extended to other rare recessive disorders, thereby providing accurate diagnosis and facilitating the study of disease mechanisms.

  20. Rapid increase in cystic volume of an anaplastic astrocytoma misdiagnosed as neurocysticercosis: A case report

    PubMed Central

    Li, Hong-Jiang; Han, Hong-Xiu; Feng, Dong-Fu

    2016-01-01

    Reports describing a rapid increase in the cystic volume of anaplastic astrocytoma (AA) in a short time frame are rare. The present study reports the case of a 68-year-old male who was admitted to the No. 9 People's Hospital, Shanghai Jiaotong University School of Medicine (Shanghai, China), with a small cystic brain lesion and positive immunological testing for cysticercosis. Head magnetic resonance imaging (MRI) showed a cystic lesion, 6 mm in diameter, in the left frontal lobe. Neurocysticercosis was suspected and the patient was treated with a clinical trial of albendazole and steroids. A period of 25 days later, the patient's condition had deteriorated, and MRI revealed a cystic lesion in the left frontal lobe; thereafter, the cystic lesion was removed and a diagnosis of AA was established. The tumor was soft, ivory white and gelatinous due to myxoid degeneration. In this case, tumor-related angiogenesis and microvascular extravasation (blood-brain barrier disruption) may have been the main cause of the rapid increase in the cystic volume in such a short time frame. The similarity of the glioma and cysticercus antigens may have been the cause of the positive reactions in the cystic fluid. The present study reports the rare occurrence of a rapid increase of cystic volume and potential diagnostic difficulties. PMID:27698865

  1. Implementation of the first worldwide quality assurance program for cystic fibrosis multiple mutation detection in population-based screening.

    PubMed

    Earley, Marie C; Laxova, Anita; Farrell, Philip M; Driscoll-Dunn, Rena; Cordovado, Suzanne; Mogayzel, Peter J; Konstan, Michael W; Hannon, W Harry

    2011-07-15

    CDC's Newborn Screening Quality Assurance Program collaborated with several U.S. Cystic Fibrosis Care Centers to collect specimens for development of a molecular CFTR proficiency testing program using dried-blood spots for newborn screening laboratories. Adult and adolescent patients or carriers donated whole blood that was aliquoted onto filter paper cards. Five blind-coded specimens were sent to participating newborn screening laboratories quarterly. Proficiency testing results were evaluated based on presumptive clinical assessment. Individual evaluations and summary reports were sent to each participating laboratory and technical consultations were offered if incorrect assessments were reported. The current CDC repository contains specimens with 39 different CFTR mutations. Up to 45 laboratories have participated in the program. Three years of data showed that correct assessments were reported 97.7% of the time overall when both mutations could be determined. Incorrect assessments that could have lead to a missed case occurred 0.9% of the time, and no information was reported 1.1% of the time due to sample failure. Results show that laboratories using molecular assays to detect CFTR mutations are performing satisfactorily. The programmatic results presented demonstrate the importance and complexity of providing proficiency testing for DNA-based assays. Published by Elsevier B.V.

  2. A randomized placebo-controlled trial of miglustat in cystic fibrosis based on nasal potential difference.

    PubMed

    Leonard, Anissa; Lebecque, Patrick; Dingemanse, Jasper; Leal, Teresinha

    2012-05-01

    Preclinical data suggest that miglustat could restore the function of the cystic fibrosis transmembrane conductance regulator gene in cystic fibrosis cells. Single-center, randomized, double-blind, placebo-controlled, crossover Phase II study in 11 patients (mean±SD age, 26.3±7.7 years) homozygous for the F508del mutation received oral miglustat 200 mgt.i.d. or placebo for two 8-day cycles separated by a 14-day washout period. The primary endpoint was the change in total chloride secretion (TCS) assessed by nasal potential difference. No statistically significant changes in TCS, sweat chloride values or FEV(1) were detected. Pharmacokinetic and safety were similar to those observed in patients with other diseases exposed to miglustat. There was no evidence of a treatment effect on any nasal potential difference variable. Further studies with miglustat need to adequately address criteria for assessment of nasal potential difference. Copyright © 2011 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  3. Loss of the ciliary kinase Nek8 causes left-right asymmetry defects.

    PubMed

    Manning, Danielle K; Sergeev, Mikhail; van Heesbeen, Roy G; Wong, Michael D; Oh, Jin-Hee; Liu, Yan; Henkelman, R Mark; Drummond, Iain; Shah, Jagesh V; Beier, David R

    2013-01-01

    A missense mutation in mouse Nek8, which encodes a ciliary kinase, produces the juvenile cystic kidneys (jck) model of polycystic kidney disease, but the functions of Nek8 are incompletely understood. Here, we generated a Nek8-null allele and found that homozygous mutant mice die at birth and exhibit randomization of left-right asymmetry, cardiac anomalies, and glomerular kidney cysts. The requirement for Nek8 in left-right patterning is conserved, as knockdown of the zebrafish ortholog caused randomized heart looping. Ciliogenesis was intact in Nek8-deficient embryos and cells, but we observed misexpression of left-sided marker genes early in development, suggesting that nodal ciliary signaling was perturbed. We also generated jck/Nek8 compound heterozygotes; these mutants developed less severe cystic disease than jck homozygotes and provided genetic evidence that the jck allele may encode a gain-of-function protein. Notably, NEK8 and polycystin-2 (PC2) proteins interact, and we found that Nek8(-/-) and Pkd2(-/-) embryonic phenotypes are strikingly similar. Nek8-deficient embryos and cells did express PC2 normally, which localized properly to the cilia. However, similar to cells lacking PC2, NEK8-depleted inner medullary collecting duct cells exhibited a defective response to fluid shear, suggesting that NEK8 may play a role in mediating PC2-dependent signaling.

  4. Clinical and molecular features of Joubert syndrome and related disorders

    PubMed Central

    Parisi, Melissa A.

    2009-01-01

    Joubert syndrome (JBTS; OMIM 213300) is a rare, autosomal recessive disorder characterized by a specific congenital malformation of the hindbrain and a broad spectrum of other phenotypic findings that is now known to be caused by defects in the structure and/or function of the primary cilium. The complex hindbrain malformation that is characteristic of JBTS can be identified on axial magnetic resonance imaging and is known as the molar tooth sign (MTS); other diagnostic criteria include intellectual disability, hypotonia, and often, abnormal respiratory pattern and/or abnormal eye movements. In addition, a broad spectrum of other anomalies characterize Joubert syndrome and related disorders (JSRD), and may include retinal dystrophy, ocular coloboma, oral frenulae and tongue tumors, polydactyly, cystic renal disease (including cystic dysplasia or juvenile nephronophthisis), and congenital hepatic fibrosis. The clinical course can be variable, but most children with this condition survive infancy to reach adulthood. At least 8 genes cause JSRD, with some genotype-phenotype correlations emerging, including the association between mutations in the MKS3 gene and hepatic fibrosis characteristic of the JSRD subtype known as COACH syndrome. Several of the causative genes for JSRD are implicated in other ciliary disorders, such as juvenile nephronophthisis and Meckel syndrome, illustrating the close association between these conditions and their overlapping clinical features that reflect a shared etiology involving the primary cilium. PMID:19876931

  5. Cystic echinococcosis: Future perspectives of molecular epidemiology

    USDA-ARS?s Scientific Manuscript database

    Human cystic echinococcosis (CE) has been conceived to be caused predominantly by Echinococcus granulosus sensu stricto (the dog-sheep strain). Recent molecular approaches on CE, however, have revealed that human cases are also commonly caused by another species, Echinococcus canadensis. All indices...

  6. Challenges in pulmonary fibrosis · 3: Cystic lung disease

    PubMed Central

    Cosgrove, Gregory P; Frankel, Stephen K; Brown, Kevin K

    2007-01-01

    Cystic lung disease is a frequently encountered problem caused by a diverse group of diseases. Distinguishing true cystic lung disease from other entities, such as cavitary lung disease and emphysema, is important given the differing prognostic implications. In this paper the features of the cystic lung diseases are reviewed and contrasted with their mimics, and the clinical and radiographic features of both diffuse (pulmonary Langerhans' cell histiocytosis and lymphangioleiomyomatosis) and focal or multifocal cystic lung disease are discussed. PMID:17726170

  7. Vanishing white matter disease with a novel EIF2B5 mutation: A 10-year follow-up.

    PubMed

    Bektaş, Gonca; Yeşil, Gözde; Özkan, Melis Ulak; Yıldız, Edibe Pembegül; Uzunhan, Tuğçe Aksu; Çalışkan, Mine

    2018-06-19

    Vanishing white matter disease is a heterogeneous disorder caused by mutation in one of the five genes encoding subunits of the eukaryotic initiation factor eIF2B. It is a heterogeneous disorder due to phenotypic variation and a clear genotype-phenotype correlation could not be established so far. We describe a novel mutation in the EIF2B5 gene by analyzing the clinical phenotype and the progression of brain lesions for 10 years. A novel mutation in the EIF2B5 gene was detected in the heterozygous state; c.1688G > A (p. Arg563Gln) mutation in exon 12, accompanied by a previously detected c.806G > A (p. Arg269Gln) mutation in exon 6, leading to substitution of arginine for a glutamine. This compound heterozygous mutation was associated with disease onset at early childhood and relatively slow progression of neurological deterioration. In contrast to previous findings indicated the association of c.806G > A mutation and peripheral neuropathy in patients with vanishing white matter disease, electromyography of our case was normal. The corpus callosum inner rim was the affected area at early stages, which may be remarkable for early diagnosis of vanishing white matter disease. Serial follow-up magnetic resonance imaging revealed the white matter signal abnormality, subsequently cystic degeneration and decrease in white matter volume. The novel mutation c.1688G > A in compound heterozygous state leads to intermediate phenotype of the vanishing white matter disease. In the early stages of the disease the signal abnormality in the corpus callosum inner rim might be remarkable. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Discovery of Clinically Approved Agents That Promote Suppression of Cystic Fibrosis Transmembrane Conductance Regulator Nonsense Mutations.

    PubMed

    Mutyam, Venkateshwar; Du, Ming; Xue, Xiaojiao; Keeling, Kim M; White, E Lucile; Bostwick, J Robert; Rasmussen, Lynn; Liu, Bo; Mazur, Marina; Hong, Jeong S; Falk Libby, Emily; Liang, Feng; Shang, Haibo; Mense, Martin; Suto, Mark J; Bedwell, David M; Rowe, Steven M

    2016-11-01

    Premature termination codons (PTCs) in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF). Several agents are known to suppress PTCs but are poorly efficacious or toxic. To determine whether there are clinically available agents that elicit translational readthrough and improve CFTR function sufficient to confer therapeutic benefit to patients with CF with PTCs. Two independent screens, firefly luciferase and CFTR-mediated transepithelial chloride conductance assay, were performed on a library of 1,600 clinically approved compounds using fisher rat thyroid cells stably transfected with stop codons. Select agents were further evaluated using secondary screening assays including short circuit current analysis on primary cells from patients with CF. In addition, the effect of CFTR modulators (ivacaftor) was tested in combination with the most efficacious agents. From the primary screen, 48 agents were selected as potentially active. Following confirmatory tests in the transepithelial chloride conductance assay and prioritizing agents based on favorable pharmacologic properties, eight agents were advanced for secondary screening. Ivacaftor significantly increased short circuit current following forskolin stimulation in cells treated with pyranoradine tetraphosphate, potassium p-aminobenzoate, and escin as compared with vehicle control. Escin, an herbal agent, consistently induced readthrough activity as demonstrated by enhanced CFTR expression and function in vitro. Clinically approved drugs identified as potential readthrough agents, in combination with ivacaftor, may induce nonsense suppression to restore therapeutic levels of CFTR function. One or more agents may be suitable to advance to human testing.

  9. Cystic Fibrosis Transmembrane Conductance Regulator Controls Lung Proteasomal Degradation and Nuclear Factor-κB Activity in Conditions of Oxidative Stress

    PubMed Central

    Boncoeur, Emilie; Roque, Telma; Bonvin, Elise; Saint-Criq, Vinciane; Bonora, Monique; Clement, Annick; Tabary, Olivier; Henrion-Caude, Alexandra; Jacquot, Jacky

    2008-01-01

    Cystic fibrosis is a lethal inherited disorder caused by mutations in a single gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) protein, resulting in progressive oxidative lung damage. In this study, we evaluated the role of CFTR in the control of ubiquitin-proteasome activity and nuclear factor (NF)-κB/IκB-α signaling after lung oxidative stress. After a 64-hour exposure to hyperoxia-mediated oxidative stress, CFTR-deficient (cftr−/−) mice exhibited significantly elevated lung proteasomal activity compared with wild-type (cftr+/+) animals. This was accompanied by reduced lung caspase-3 activity and defective degradation of NF-κB inhibitor IκB-α. In vitro, human CFTR-deficient lung cells exposed to oxidative stress exhibited increased proteasomal activity and decreased NF-κB-dependent transcriptional activity compared with CFTR-sufficient lung cells. Inhibition of the CFTR Cl− channel by CFTRinh-172 in the normal bronchial immortalized cell line 16HBE14o− increased proteasomal degradation after exposure to oxidative stress. Caspase-3 inhibition by Z-DQMD in CFTR-sufficient lung cells mimicked the response profile of increased proteasomal degradation and reduced NF-κB activity observed in CFTR-deficient lung cells exposed to oxidative stress. Taken together, these results suggest that functional CFTR Cl− channel activity is crucial for regulation of lung proteasomal degradation and NF-κB activity in conditions of oxidative stress. PMID:18372427

  10. Future directions in early cystic fibrosis lung disease research: an NHLBI workshop report.

    PubMed

    Ramsey, Bonnie W; Banks-Schlegel, Susan; Accurso, Frank J; Boucher, Richard C; Cutting, Garry R; Engelhardt, John F; Guggino, William B; Karp, Christopher L; Knowles, Michael R; Kolls, Jay K; LiPuma, John J; Lynch, Susan; McCray, Paul B; Rubenstein, Ronald C; Singh, Pradeep K; Sorscher, Eric; Welsh, Michael

    2012-04-15

    Since the 1989 discovery that mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF), there has been substantial progress toward understanding the molecular basis for CF lung disease, leading to the discovery and development of new therapeutic approaches. However, the earliest impact of the loss of CFTR function on airway physiology and structure and its relationship to initial infection and inflammation are poorly understood. Universal newborn screening for CF in the United States represents an unprecedented opportunity for investigating CF clinical manifestations very early in life. Recently developed animal models with pulmonary phenotypic manifestations also provide a window into the early consequences of this genetic disorder. For these reasons, the National Heart, Lung, and Blood Institute (NHLBI) convened a working group of extramural experts, entitled "Future Research Directions in Early CF Lung Disease" on September 21-22, 2010, to identify future research directions of great promise in CF. The priority areas identified included (1) exploring pathogenic mechanisms of early CF lung disease; (2) leveraging newborn screening to elucidate the natural history of early lung disease; (3) developing a spectrum of biomarkers of early lung disease that reflects CF pathophysiology, clinical outcome, and response to treatment; (4) exploring the role of genetics/genomics (e.g., modifier genes, gene-environmental interactions, and epigenetics) in early CF pathogenesis; (5) defining early microbiological events in CF lung disease; and (6) elucidating the initial airway inflammatory, remodeling, and repair mechanisms in CF lung disease.

  11. A screening method to distinguish syndromic from sporadic spinal extradural arachnoid cyst.

    PubMed

    Ogura, Yoji; Yabuki, Shoji; Fujibayashi, Shunsuke; Okada, Eijiro; Iwanami, Akio; Watanabe, Kota; Nakamura, Masaya; Matsumoto, Morio; Ishii, Ken; Ikegawa, Shiro

    2018-05-01

    Spinal extradural arachnoid cyst (SEDAC) is a cystic lesion that protrudes into the epidural space from a small dural defect. Early diagnosis of SEDAC is important because its expansion causes neurological damage. Two types of SEDAC, syndromic and sporadic, are present. Syndromic SEDAC is inherited as a part of lymphedema-distichiasis syndrome caused by mutations in the FOXC2 gene; however, it is often mistaken as sporadic because of low penetrance. It is not reasonable to conduct a genetic testing for all SEDAC patients and their family members. The aim of this study is to establish an effective screening method to distinguish syndromic SEDAC from sporadic SEDAC. We performed a retrospective review of medical records and imaging studies of 29 subjects who were diagnosed with SEDAC. Clinical features, family history and magnetic resonance imaging (MRI) were analyzed. Mutations in FOXC2 were examined by Sanger-sequencing of the entire coding region of the genes. SEDAC having a mutation in FOXC2 gene was defined with syndromic SEDAC. Eleven subjects had a heterozygous mutation in FOXC2. They were all familial and hence syndromic SEDAC. Only one proband had known family history of SEDAC at diagnosis. MRI findings and physical examinations, especially eye and leg examinations, were quite useful to screen syndromic SEDAC. Physical examination often showed accompanying lymphedema and distichiasis in syndromic SEDAC. Syndromic SEDAC tended to have multiple cysts out of the thoracolumbar area. We established an effective screening method based on physical examinations and MRI findings. Copyright © 2018 The Japanese Orthopaedic Association. Published by Elsevier B.V. All rights reserved.

  12. Infertility due to congenital absence of vas deferens in mainly caused by variable exon 9 skipping of the CFTR gene in heterozygous males for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chillon, M.; Casals, T.; Nunes, V.

    1994-09-01

    About 65% or the individuals with congenital bilateral absence of the vas deferens (CBAVD) have mutations in at least one of the CFTR alleles. We have studied the phenotypic effects of the CFTR gene intron 8 polyT tract 5T allele in 90 CBAVD subjects and in parents of CF patients. This group was compared with normal individuals, and with fathers and mothers of CF patients. Allele 5T was significantly associated with CBAVD (19.6%) when compared to the general population (5.2%) ({chi}{sup 2} = 33.3%; p<<0.0001). It was represented poorly in fathers of CF patients (1.3%). Mutations were identified in onemore » (60%) or both CFTR alleles (8.9%) of CBAVD patients. Heterozygosity for the 5T allele was strongly associated with heterozygosity for CF mutations ({chi}{sup 2} = 10.9; p<0.0004). The strong correlation between allele 5T and CBAVD, together with the low frequency of this allele in fathers of CF patients, demonstrates that variable {Delta}exon 9 produces infertility in males if associated with a CF mutation on the other chromosome. The 30% of CBAVD cases with only one CFTR mutation and without a 5T-allele may be due to other molecular mechanisms involving CFTR, distinct from {Delta}exon 9. Since there is a relatively high proportion of CBAVD without CF mutations (25%), other gene(s), distinct from CFTR, may have a role in the CBAVD phenotype.« less

  13. Correction of nonsense BMPR2 and SMAD9 mutations by ataluren in pulmonary arterial hypertension.

    PubMed

    Drake, Kylie M; Dunmore, Benjamin J; McNelly, Lauren N; Morrell, Nicholas W; Aldred, Micheala A

    2013-09-01

    Heritable pulmonary arterial hypertension (HPAH) is a serious lung vascular disease caused by heterozygous mutations in the bone morphogenetic protein (BMP) pathway genes, BMPR2 and SMAD9. One noncanonical function of BMP signaling regulates biogenesis of a subset of microRNAs. We have previously shown that this function is abrogated in patients with HPAH, making it a highly sensitive readout of BMP pathway integrity. Ataluren (PTC124) is an investigational drug that permits ribosomal readthrough of premature stop codons, resulting in a full-length protein. It exhibits oral bioavailability and limited toxicity in human trials. Here, we tested ataluren in lung- or blood-derived cells from patients with HPAH with nonsense mutations in BMPR2 (n = 6) or SMAD9 (n = 1). Ataluren significantly increased BMP-mediated microRNA processing in six of the seven cases. Moreover, rescue was achieved even for mutations exhibiting significant nonsense-mediated mRNA decay. Response to ataluren was dose dependent, and complete correction was achieved at therapeutic doses currently used in clinical trials for cystic fibrosis. BMP receptor (BMPR)-II protein levels were normalized and ligand-dependent phosphorylation of downstream target Smads was increased. Furthermore, the usually hyperproliferative phenotype of pulmonary artery endothelial and smooth muscle cells was reversed by ataluren. These results indicate that ataluren can effectively suppress a high proportion of BMPR2 and SMAD9 nonsense mutations and correct BMP signaling in vitro. Approximately 29% of all HPAH mutations are nonsense point mutations. In light of this, we propose ataluren as a potential new personalized therapy for this significant subgroup of patients with PAH.

  14. Generation of Distal Airway Epithelium from Multipotent Human Foregut Stem Cells.

    PubMed

    Hannan, Nicholas R F; Sampaziotis, Fotios; Segeritz, Charis-Patricia; Hanley, Neil A; Vallier, Ludovic

    2015-07-15

    Collectively, lung diseases are one of the largest causes of premature death worldwide and represent a major focus in the field of regenerative medicine. Despite significant progress, only few stem cell platforms are currently available for cell-based therapy, disease modeling, and drug screening in the context of pulmonary disorders. Human foregut stem cells (hFSCs) represent an advantageous progenitor cell type that can be used to amplify large quantities of cells for regenerative medicine applications and can be derived from any human pluripotent stem cell line. Here, we further demonstrate the application of hFSCs by generating a near homogeneous population of early pulmonary endoderm cells coexpressing NKX2.1 and FOXP2. These progenitors are then able to form cells that are representative of distal airway epithelium that express NKX2.1, GATA6, and cystic fibrosis transmembrane conductance regulator (CFTR) and secrete SFTPC. This culture system can be applied to hFSCs carrying the CFTR mutation Δf508, enabling the development of an in vitro model for cystic fibrosis. This platform is compatible with drug screening and functional validations of small molecules, which can reverse the phenotype associated with CFTR mutation. This is the first demonstration that multipotent endoderm stem cells can differentiate not only into both liver and pancreatic cells but also into lung endoderm. Furthermore, our study establishes a new approach for the generation of functional lung cells that can be used for disease modeling as well as for drug screening and the study of lung development.

  15. An unexpected effect of TNF-α on F508del-CFTR maturation and function

    PubMed Central

    Bitam, Sara; Urbach, Valérie; Sermet-Gaudelus, Isabelle; Hinzpeter, Alexandre; Edelman, Aleksander

    2015-01-01

    Cystic fibrosis (CF) is a multifactorial disease caused by mutations in the cystic fibrosis transmembrane conductance regulator gene ( CFTR), which encodes a cAMP-dependent Cl - channel. The most frequent mutation, F508del, leads to the synthesis of a prematurely degraded, otherwise partially functional protein. CFTR is expressed in many epithelia, with major consequences in the airways of patients with CF, characterized by both fluid transport abnormalities and persistent inflammatory responses. The relationship between the acute phase of inflammation and the expression of wild type (WT) CFTR or F508del-CFTR is poorly understood. The aim of the present study was to investigate this effect. The results show that 10 min exposure to TNF-alpha (0.5-50ng/ml) of F508del-CFTR-transfected HeLa cells and human bronchial cells expressing F508del-CFTR in primary culture (HBE) leads to the maturation of F508del-CFTR and induces CFTR chloride currents. The enhanced CFTR expression and function upon TNFα is sustained, in HBE cells, for at least 24 h. The underlying mechanism of action involves a protein kinase C (PKC) signaling pathway, and occurs through insertion of vesicles containing F508del-CFTR to the plasma membrane, with TNFα behaving as a corrector molecule. In conclusion, a novel and unexpected action of TNFα has been discovered and points to the importance of systematic studies on the roles of inflammatory mediators in the maturation of abnormally folded proteins in general and in the context of CF in particular. PMID:26594334

  16. Archetypal analysis of diverse Pseudomonas aeruginosa transcriptomes reveals adaptation in cystic fibrosis airways

    PubMed Central

    2013-01-01

    Background Analysis of global gene expression by DNA microarrays is widely used in experimental molecular biology. However, the complexity of such high-dimensional data sets makes it difficult to fully understand the underlying biological features present in the data. The aim of this study is to introduce a method for DNA microarray analysis that provides an intuitive interpretation of data through dimension reduction and pattern recognition. We present the first “Archetypal Analysis” of global gene expression. The analysis is based on microarray data from five integrated studies of Pseudomonas aeruginosa isolated from the airways of cystic fibrosis patients. Results Our analysis clustered samples into distinct groups with comprehensible characteristics since the archetypes representing the individual groups are closely related to samples present in the data set. Significant changes in gene expression between different groups identified adaptive changes of the bacteria residing in the cystic fibrosis lung. The analysis suggests a similar gene expression pattern between isolates with a high mutation rate (hypermutators) despite accumulation of different mutations for these isolates. This suggests positive selection in the cystic fibrosis lung environment, and changes in gene expression for these isolates are therefore most likely related to adaptation of the bacteria. Conclusions Archetypal analysis succeeded in identifying adaptive changes of P. aeruginosa. The combination of clustering and matrix factorization made it possible to reveal minor similarities among different groups of data, which other analytical methods failed to identify. We suggest that this analysis could be used to supplement current methods used to analyze DNA microarray data. PMID:24059747

  17. Ataluren in cystic fibrosis: development, clinical studies and where are we now?

    PubMed

    Zainal Abidin, Noreen; Haq, Iram J; Gardner, Aaron I; Brodlie, Malcolm

    2017-09-01

    Cystic fibrosis (CF) is one of the most common genetically-acquired life-limiting conditions worldwide. The underlying defect is dysfunction of the cystic fibrosis transmembrane-conductance regulator (CFTR) which leads to progressive lung disease and other multi-system effects. Around 10% of people with CF have a class I nonsense mutation that leads to production of shortened CFTR due to a premature termination codon (PTC). Areas covered: We discuss the discovery of the small-molecule drug ataluren, which in vitro has been shown to allow read-through of PTCs and facilitate synthesis of full-length protein. We review clinical studies that have been performed involving ataluren in CF. Early-phase short-term cross-over studies showed improvement in nasal potential difference. A follow-up phase III randomised controlled trial did not show a significant difference for the primary outcome of lung function, however a post-hoc analysis suggested possible benefit in patients not receiving tobramycin. A further randomised controlled trial in patients not receiving tobramycin has been reported as showing no benefit but has not yet been published in full peer-reviewed form. Expert opinion: A small-molecule approach to facilitate read-through of PTCs in nonsense mutations makes intuitive sense. However, at present there is no high-quality evidence of clinical efficacy for ataluren in people with CF.

  18. Resolving quandaries: basaloid adenoid cystic carcinoma or breast cylindroma? The role of massively parallel sequencing.

    PubMed

    Fusco, Nicola; Colombo, Pierre-Emmanuel; Martelotto, Luciano G; De Filippo, Maria R; Piscuoglio, Salvatore; Ng, Charlotte K Y; Lim, Raymond S; Jacot, William; Vincent-Salomon, Anne; Reis-Filho, Jorge S; Weigelt, Britta

    2016-01-01

    The aims of this study were to perform a whole-exome sequencing analysis of a breast cylindroma and to investigate the role of molecular analyses in the differentiation between breast cylindroma, a benign tumour that displays MYB expression, and CYLD gene mutations, and its main differential diagnosis, the breast solid-basaloid adenoid cystic carcinoma, a malignant tumour that is characterized by the presence of the MYB-NFIB fusion gene and MYB overexpression. A 66-year-old female underwent quadrantectomy after an irregular dense shadow was discovered in the right breast at the screening mammogram. Histologically, the tumour displayed features suggestive of a solid-basaloid variant of adenoid cystic carcinoma with a differential diagnosis of cylindroma. Fluorescence in situ hybridization, reverse transcription-polymerase chain reaction, immunohistochemistry and whole-exome sequencing revealed absence of the MYB-NFIB fusion gene, low levels of MYB protein expression and a clonal somatic CYLD splice site mutation associated with loss of heterozygosity of the wild-type allele. The results of the histological, immunohistochemical and molecular analyses were consistent with a diagnosis of breast cylindroma, providing a proof-of-principle that the integration of histopathological and molecular approaches can help to differentiate between a low-malignant potential and a benign breast tumour of triple-negative phenotype. © 2015 John Wiley & Sons Ltd.

  19. Vx-809/Vx-770 treatment reduces inflammatory response to Pseudomonas aeruginosa in primary differentiated cystic fibrosis bronchial epithelial cells.

    PubMed

    Ruffin, Manon; Roussel, Lucie; Maillé, Émilie; Rousseau, Simon; Brochiero, Emmanuelle

    2018-04-01

    Cystic fibrosis patients exhibit chronic Pseudomonas aeruginosa respiratory infections and sustained proinflammatory state favoring lung tissue damage and remodeling, ultimately leading to respiratory failure. Loss of cystic fibrosis transmembrane conductance regulator (CFTR) function is associated with MAPK hyperactivation and increased cytokines expression, such as interleukin-8 [chemoattractant chemokine (C-X-C motif) ligand 8 (CXCL8)]. Recently, new therapeutic strategies directly targeting the basic CFTR defect have been developed, and ORKAMBI (Vx-809/Vx-770 combination) is the only Food and Drug Administration-approved treatment for CF patients homozygous for the F508del mutation. Here we aimed to determine the effect of the Vx-809/Vx-770 combination on the induction of the inflammatory response by fully differentiated primary bronchial epithelial cell cultures from CF patients carrying F508del mutations, following exposure to P. aeruginosa exoproducts. Our data unveiled that CFTR functional rescue with Vx-809/Vx-770 drastically reduces CXCL8 (as well as CXCL1 and CXCL2) transcripts and p38 MAPK phosphorylation in response to P. aeruginosa exposure through a CFTR-dependent mechanism. These results suggest that ORKAMBI has anti-inflammatory properties that could decrease lung inflammation and contribute to the observed beneficial impact of this treatment in CF patients.

  20. Extensive sequence analysis of CFTR, SCNN1A, SCNN1B, SCNN1G and SERPINA1 suggests an oligogenic basis for cystic fibrosis-like phenotypes.

    PubMed

    Ramos, M D; Trujillano, D; Olivar, R; Sotillo, F; Ossowski, S; Manzanares, J; Costa, J; Gartner, S; Oliva, C; Quintana, E; Gonzalez, M I; Vazquez, C; Estivill, X; Casals, T

    2014-07-01

    The term cystic fibrosis (CF)-like disease is used to describe patients with a borderline sweat test and suggestive CF clinical features but without two CFTR(cystic fibrosis transmembrane conductance regulator) mutations. We have performed the extensive molecular analysis of four candidate genes (SCNN1A, SCNN1B, SCNN1G and SERPINA1) in a cohort of 10 uncharacterized patients with CF and CF-like disease. We have used whole-exome sequencing to characterize mutations in the CFTR gene and these four candidate genes. CFTR molecular analysis allowed a complete characterization of three of four CF patients. Candidate variants in SCNN1A, SCNN1B, SCNN1G and SERPINA1 in six patients with CF-like phenotypes were confirmed by Sanger sequencing and were further supported by in silico predictive analysis, pedigree studies, sweat test in other family members, and analysis in CF patients and healthy subjects. Our results suggest that CF-like disease probably results from complex genotypes in several genes in an oligogenic form, with rare variants interacting with environmental factors. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. The cystic fibrosis gene: Medical and social implications for heterozygote detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilfond, B.S.; Fost, N.

    1990-05-23

    The primary goal of mass screening programs for cystic fibrosis carriers should be to allow people to make more informed reproductive decisions. However, previous experience with genetic screening programs, including those for phenylketonuria and sickle cell disease, have revealed complex problems including error, confusion, and stigmatization. These problems could be greater with cystic fibrosis, since more than 8 million Americans may be carriers and entrepreneurial interests can be expected to promote screening in what could become a billion-dollar industry. The present frequency of the detectable mutation ({Delta}F{sub 508}), 75%, will complicate the counseling process. The sensitivity of the test tomore » detect at-risk couples would be 56%. The cost of screening could be as much as $2.2 million for each cystic fibrosis birth avoided. Regardless of improvements in the detection rate, implementation of population screening should be delayed until pilot studies that demonstrate its safety and effectiveness are completed. While studies are in progress, preconception testing should be offered to adult relatives of cystic fibrosis patients as part of a comprehensive program following institutional review board approval for compassionate use.« less

  2. [Genetic counseling in cystic fibrosis].

    PubMed

    Julia, S; Bieth, E

    2000-08-01

    Genetic counseling is an important part of health care in patients with cystic fibrosis or respiratory diseases associated with the CFTR (cystic fibrosis transmembrane conductance regulator) gene, including certain types of allergic bronchopulmonary aspergilloses or bronchial diseases (diffuse bronchiectasia). The basic goal is to provide patients with information on the transmission of cystic fibrosis and to asses the risk of recurrence. This risk is determined from molecular biology analyses examining the CFTR gene. Genotyping is the only means of screening for the heterozygous state, frequent in the French population (about 1/30). Because of the large number of mutated alleles not covered entirely by the genetic tests, there remains a question of probability expressed as a residual risk of a heterozygous state. A prenatal genotype diagnosis should be proposed to heterozygous couples who have a 25% risk of having a diseased child. Technically, this is almost always possible and the results are highly reliable. Nevertheless, there remains the risks related to sample taking and the ethical issue about which the patients must be informed. Management of these at risk couples who desire a child must be based on a multidisciplinary approach, particularly important when one of the parents has overt cystic fibrosis.

  3. Mutations in GREB1L Cause Bilateral Kidney Agenesis in Humans and Mice.

    PubMed

    De Tomasi, Lara; David, Pierre; Humbert, Camille; Silbermann, Flora; Arrondel, Christelle; Tores, Frédéric; Fouquet, Stéphane; Desgrange, Audrey; Niel, Olivier; Bole-Feysot, Christine; Nitschké, Patrick; Roume, Joëlle; Cordier, Marie-Pierre; Pietrement, Christine; Isidor, Bertrand; Khau Van Kien, Philippe; Gonzales, Marie; Saint-Frison, Marie-Hélène; Martinovic, Jelena; Novo, Robert; Piard, Juliette; Cabrol, Christelle; Verma, Ishwar C; Puri, Ratna; Journel, Hubert; Aziza, Jacqueline; Gavard, Laurent; Said-Menthon, Marie-Hélène; Heidet, Laurence; Saunier, Sophie; Jeanpierre, Cécile

    2017-11-02

    Congenital anomalies of the kidney and urinary tract (CAKUT) constitute a major cause of chronic kidney disease in children and 20% of prenatally detected anomalies. CAKUT encompass a spectrum of developmental kidney defects, including renal agenesis, hypoplasia, and cystic and non-cystic dysplasia. More than 50 genes have been reported as mutated in CAKUT-affected case subjects. However, the pathophysiological mechanisms leading to bilateral kidney agenesis (BKA) remain largely elusive. Whole-exome or targeted exome sequencing of 183 unrelated familial and/or severe CAKUT-affected case subjects, including 54 fetuses with BKA, led to the identification of 16 heterozygous variants in GREB1L (growth regulation by estrogen in breast cancer 1-like), a gene reported as a target of retinoic acid signaling. Four loss-of-function and 12 damaging missense variants, 14 being absent from GnomAD, were identified. Twelve of them were present in familial or simplex BKA-affected case subjects. Female BKA-affected fetuses also displayed uterus agenesis. We demonstrated a significant association between GREB1L variants and BKA. By in situ hybridization, we showed expression of Greb1l in the nephrogenic zone in developing mouse kidney. We generated a Greb1l knock-out mouse model by CRISPR-Cas9. Analysis at E13.5 revealed lack of kidneys and genital tract anomalies in male and female Greb1l -/- embryos and a slight decrease in ureteric bud branching in Greb1l +/- embryos. We showed that Greb1l invalidation in mIMCD3 cells affected tubulomorphogenesis in 3D-collagen culture, a phenotype rescued by expression of the wild-type human protein. This demonstrates that GREB1L plays a major role in early metanephros and genital development in mice and humans. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  4. A chemical corrector modifies the channel function of F508del-CFTR.

    PubMed

    Kim Chiaw, Patrick; Wellhauser, Leigh; Huan, Ling Jun; Ramjeesingh, Mohabir; Bear, Christine E

    2010-09-01

    The deletion of Phe-508 (F508del) constitutes the most prevalent cystic fibrosis-causing mutation. This mutation leads to cystic fibrosis transmembrane conductance regulator (CFTR) misfolding and retention in the endoplasmic reticulum and altered channel activity in mammalian cells. This folding defect can however be partially overcome by growing cells expressing this mutant protein at low (27 degrees C) temperature. Chemical "correctors" have been identified that are also effective in rescuing the biosynthetic defect in F508del-CFTR, thereby permitting its functional expression at the cell surface. The mechanism of action of chemical correctors remains unclear, but it has been suggested that certain correctors [including 4-cyclohexyloxy-2-(1-[4-(4-methoxy-benzenesulfonyl)-piperazin-1-yl]-ethyl)-quinazoline (VRT-325)] may act to promote trafficking by interacting directly with the mutant protein. To test this hypothesis, we assessed the effect of VRT-325 addition on the channel activity of F508del-CFTR after its surface expression had been "rescued" by low temperature. It is noteworthy that short-term pretreatment with VRT-325 [but not with an inactive analog, 4-hydroxy-2-(1-[4-(4-methoxy-benzenesulfonyl)-piperazin-1-yl]-ethyl)-quinazoline (VRT-186)], caused a modest but significant inhibition of cAMP-mediated halide flux. Furthermore, VRT-325 decreased the apparent ATP affinity of purified and reconstituted F508del-CFTR in our ATPase activity assay, an effect that may account for the decrease in channel activity by temperature-rescued F508del-CFTR. These findings suggest that biosynthetic rescue mediated by VRT-325 may be conferred (at least in part) by direct modification of the structure of the mutant protein, leading to a decrease in its ATP-dependent conformational dynamics. Therefore, the challenge for therapy discovery will be the design of small molecules that bind to promote biosynthetic maturation of the major mutant without compromising its activity in vivo.

  5. A small-molecule modulator interacts directly with deltaPhe508-CFTR to modify its ATPase activity and conformational stability.

    PubMed

    Wellhauser, Leigh; Kim Chiaw, Patrick; Pasyk, Stan; Li, Canhui; Ramjeesingh, Mohabir; Bear, Christine E

    2009-06-01

    The deletion of Phe-508 (DeltaPhe508) constitutes the most prevalent of a number of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) that cause cystic fibrosis (CF). This mutation leads to CFTR misfolding and retention in the endoplasmic reticulum, as well as impaired channel activity. The biosynthetic defect can be partially overcome by small-molecule "correctors"; once at the cell surface, small-molecule "potentiators" enhance the channel activity of DeltaPhe508-CFTR. Certain compounds, such as VRT-532, exhibit both corrector and potentiator functions. In the current studies, we confirmed that the inherent chloride channel activity of DeltaPhe508-CFTR (after biosynthetic rescue) is potentiated in studies of intact cells and membrane vesicles. It is noteworthy that we showed that the ATPase activity of the purified and reconstituted mutant protein is directly modulated by binding of VRT-532 [4-methyl-2-(5-phenyl-1H-pyrazol-3-yl)-phenol] ATP turnover by reconstituted DeltaPhe508-CFTR is decreased by VRT-532 treatment, an effect that may account for the increase in channel open time induced by this compound. To determine whether the modification of DeltaPhe508-CFTR function caused by direct VRT-532 binding is associated with structural changes, we evaluated the effect of VRT-532 binding on the protease susceptibility of the major mutant. We found that binding of VRT-532 to DeltaPhe508-CFTR led to a minor but significant decrease in the trypsin susceptibility of the full-length mutant protein and a fragment encompassing the second half of the protein. These findings suggest that direct binding of this small molecule induces and/or stabilizes a structure that promotes the channel open state and may underlie its efficacy as a corrector of DeltaPhe508-CFTR.

  6. Mild CFTR mutations and genetic predisposition to lactase persistence in cystic fibrosis

    PubMed Central

    Mądry, Edyta; Fidler, Ewa; Sobczyńska-Tomaszewska, Agnieszka; Lisowska, Aleksandra; Krzyżanowska, Patrycja; Pogorzelski, Andrzej; Minarowski, Łukasz; Oralewska, Beata; Mojs, Ewa; Sapiejka, Ewa; Marciniak, Ryszard; Sands, Dorota; Korzon-Burakowska, Anna; Kwiecień, Jarosław; Walkowiak, Jarosław

    2011-01-01

    Taking into account the reported incidence of hypolactasia in cystic fibrosis (CF) and the possible impact of milk products on nutritional status we aimed to assess the genetic predisposition to adult-type hypolactasia (ATH) and its incidence in CF. Single nucleotide polymorphism upstream of the lactase gene (LCT) was assessed in 289 CF patients. In subject with −13910C/C genotype (C/C) predisposing to ATH, hydrogen-methane breath test (BT) with lactose loading was conducted and clinical symptoms typical for lactose malabsorption were assessed. The percentage of CF patients with C/C was similar to that observed in healthy subjects (HS) (31.5 vs 32.5% ). Eleven out of 52 (24.5%) CF C/C patients had abnormal BT results. The recalculated frequency of lactose malabsorption was similar for the entire CF and HS populations (6.9 vs 7.2%). Similarly as in the control group, few CF patients have identified and linked to lactose consumption clinical symptoms. The frequency of LCT polymorphic variants in CF patients having and not having severe mutations of CFTR gene showed significant differences. The C allele was more frequent in homozygotes of the severe mutations than in patients carrying at least one mild/unknown mutation (P<0.0028) and in patients with at least one mild mutation (P<0.0377). In conclusion, CF patients carrying mild CFTR mutations seem to have lower genetic predisposition to ATH. Lactose malabsorption due to ATH in CF is not more frequent than in the general population. Symptomatic assessment of lactose malabsorption in CF is not reliable. PMID:21407263

  7. Diffuse Staining for Activated NOTCH1 Correlates With NOTCH1 Mutation Status and Is Associated With Worse Outcome in Adenoid Cystic Carcinoma.

    PubMed

    Sajed, Dipti P; Faquin, William C; Carey, Chris; Severson, Eric A; H Afrogheh, Amir; A Johnson, Carl; Blacklow, Stephen C; Chau, Nicole G; Lin, Derrick T; Krane, Jeffrey F; Jo, Vickie Y; Garcia, Joaquín J; Sholl, Lynette M; Aster, Jon C

    2017-11-01

    NOTCH1 is frequently mutated in adenoid cystic carcinoma (ACC). To test the idea that immunohistochemical (IHC) staining can identify ACCs with NOTCH1 mutations, we performed IHC for activated NOTCH1 (NICD1) in 197 cases diagnosed as ACC from 173 patients. NICD1 staining was positive in 194 cases (98%) in 2 major patterns: subset positivity, which correlated with tubular/cribriform histology; and diffuse positivity, which correlated with a solid histology. To determine the relationship between NICD1 staining and NOTCH1 mutational status, targeted exome sequencing data were obtained on 14 diffusely NICD1-positive ACC specimens from 11 patients and 15 subset NICD1-positive ACC specimens from 15 patients. This revealed NOTCH1 gain-of-function mutations in 11 of 14 diffusely NICD1-positive ACC specimens, whereas all subset-positive tumors had wild-type NOTCH1 alleles. Notably, tumors with diffuse NICD1 positivity were associated with significantly worse outcomes (P=0.003). To determine whether NOTCH1 activation is unique among tumors included in the differential diagnosis with ACC, we performed NICD1 IHC on a cohort of diverse salivary gland and head and neck tumors. High fractions of each of these tumor types were positive for NICD1 in a subset of cells, particularly in basaloid squamous cell carcinomas; however, sequencing of basaloid squamous cell carcinomas failed to identify NOTCH1 mutations. These findings indicate that diffuse NICD1 positivity in ACC correlates with solid growth pattern, the presence of NOTCH1 gain-of-function mutations, and unfavorable outcome, and suggest that staining for NICD1 can be helpful in distinguishing ACC with solid growth patterns from other salivary gland and head and neck tumors.

  8. Restoration of CFTR function in patients with cystic fibrosis carrying the F508del-CFTR mutation

    PubMed Central

    Stefano, Daniela De; Villella, Valeria R; Esposito, Speranza; Tosco, Antonella; Sepe, Angela; Gregorio, Fabiola De; Salvadori, Laura; Grassia, Rosa; Leone, Carlo A; Rosa, Giuseppe De; Maiuri, Maria C; Pettoello-Mantovani, Massimo; Guido, Stefano; Bossi, Anna; Zolin, Anna; Venerando, Andrea; Pinna, Lorenzo A; Mehta, Anil; Bona, Gianni; Kroemer, Guido; Maiuri, Luigi; Raia, Valeria

    2014-01-01

    Restoration of BECN1/Beclin 1-dependent autophagy and depletion of SQSTM1/p62 by genetic manipulation or autophagy-stimulatory proteostasis regulators, such as cystamine, have positive effects on mouse models of human cystic fibrosis (CF). These measures rescue the functional expression of the most frequent pathogenic CFTR mutant, F508del, at the respiratory epithelial surface and reduce lung inflammation in CftrF508del homozygous mice. Cysteamine, the reduced form of cystamine, is an FDA-approved drug. Here, we report that oral treatment with cysteamine greatly reduces the mortality rate and improves the phenotype of newborn mice bearing the F508del-CFTR mutation. Cysteamine was also able to increase the plasma membrane expression of the F508del-CFTR protein in nasal epithelial cells from F508del homozygous CF patients, and these effects persisted for 24 h after cysteamine withdrawal. Importantly, this cysteamine effect after washout was further sustained by the sequential administration of epigallocatechin gallate (EGCG), a green tea flavonoid, both in vivo, in mice, and in vitro, in primary epithelial cells from CF patients. In a pilot clinical trial involving 10 F508del-CFTR homozygous CF patients, the combination of cysteamine and EGCG restored BECN1, reduced SQSTM1 levels and improved CFTR function from nasal epithelial cells in vivo, correlating with a decrease of chloride concentrations in sweat, as well as with a reduction of the abundance of TNF/TNF-alpha (tumor necrosis factor) and CXCL8 (chemokine [C-X-C motif] ligand 8) transcripts in nasal brushing and TNF and CXCL8 protein levels in the sputum. Altogether, these results suggest that optimal schedules of cysteamine plus EGCG might be used for the treatment of CF caused by the F508del-CFTR mutation. PMID:25350163

  9. Functional defect of variants in the adenosine triphosphate-binding sites of ABCB4 and their rescue by the cystic fibrosis transmembrane conductance regulator potentiator, ivacaftor (VX-770).

    PubMed

    Delaunay, Jean-Louis; Bruneau, Alix; Hoffmann, Brice; Durand-Schneider, Anne-Marie; Barbu, Véronique; Jacquemin, Emmanuel; Maurice, Michèle; Housset, Chantal; Callebaut, Isabelle; Aït-Slimane, Tounsia

    2017-02-01

    ABCB4 (MDR3) is an adenosine triphosphate (ATP)-binding cassette (ABC) transporter expressed at the canalicular membrane of hepatocytes, where it mediates phosphatidylcholine (PC) secretion. Variations in the ABCB4 gene are responsible for several biliary diseases, including progressive familial intrahepatic cholestasis type 3 (PFIC3), a rare disease that can be lethal in the absence of liver transplantation. In this study, we investigated the effect and potential rescue of ABCB4 missense variations that reside in the highly conserved motifs of ABC transporters, involved in ATP binding. Five disease-causing variations in these motifs have been identified in ABCB4 (G535D, G536R, S1076C, S1176L, and G1178S), three of which are homologous to the gating mutations of cystic fibrosis transmembrane conductance regulator (CFTR or ABCC7; i.e., G551D, S1251N, and G1349D), that were previously shown to be function defective and corrected by ivacaftor (VX-770; Kalydeco), a clinically approved CFTR potentiator. Three-dimensional structural modeling predicted that all five ABCB4 variants would disrupt critical interactions in the binding of ATP and thereby impair ATP-induced nucleotide-binding domain dimerization and ABCB4 function. This prediction was confirmed by expression in cell models, which showed that the ABCB4 mutants were normally processed and targeted to the plasma membrane, whereas their PC secretion activity was dramatically decreased. As also hypothesized on the basis of molecular modeling, PC secretion activity of the mutants was rescued by the CFTR potentiator, ivacaftor (VX-770). Disease-causing variations in the ATP-binding sites of ABCB4 cause defects in PC secretion, which can be rescued by ivacaftor. These results provide the first experimental evidence that ivacaftor is a potential therapy for selected patients who harbor mutations in the ATP-binding sites of ABCB4. (Hepatology 2017;65:560-570). © 2016 by the American Association for the Study of Liver Diseases.

  10. Molecular Epidemiology of Mutations in Antimicrobial Resistance Loci of Pseudomonas aeruginosa Isolates from Airways of Cystic Fibrosis Patients.

    PubMed

    Greipel, Leonie; Fischer, Sebastian; Klockgether, Jens; Dorda, Marie; Mielke, Samira; Wiehlmann, Lutz; Cramer, Nina; Tümmler, Burkhard

    2016-11-01

    The chronic airway infections with Pseudomonas aeruginosa in people with cystic fibrosis (CF) are treated with aerosolized antibiotics, oral fluoroquinolones, and/or intravenous combination therapy with aminoglycosides and β-lactam antibiotics. An international strain collection of 361 P. aeruginosa isolates from 258 CF patients seen at 30 CF clinics was examined for mutations in 17 antimicrobial susceptibility and resistance loci that had been identified as hot spots of mutation by genome sequencing of serial isolates from a single CF clinic. Combinatorial amplicon sequencing of pooled PCR products identified 1,112 sequence variants that were not present in the genomes of representative strains of the 20 most common clones of the global P. aeruginosa population. A high frequency of singular coding variants was seen in spuE, mexA, gyrA, rpoB, fusA1, mexZ, mexY, oprD, ampD, parR, parS, and envZ (amgS), reflecting the pressure upon P. aeruginosa in lungs of CF patients to generate novel protein variants. The proportion of nonneutral amino acid exchanges was high. Of the 17 loci, mexA, mexZ, and pagL were most frequently affected by independent stop mutations. Private and de novo mutations seem to play a pivotal role in the response of P. aeruginosa populations to the antimicrobial load and the individual CF host. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. Antibiotic exposure and interpersonal variance mask the effect of ivacaftor on respiratory microbiota composition.

    PubMed

    Peleg, Anton Y; Choo, Jocelyn M; Langan, Katherine M; Edgeworth, Deirdre; Keating, Dominic; Wilson, John; Rogers, Geraint B; Kotsimbos, Tom

    2018-01-01

    G551D is a class III mutation of the cystic fibrosis transmembrane regulator (CFTR) that results in impaired chloride channel function in cystic fibrosis (CF). Ivacaftor, a CFTR-potentiating agent improves sweat chloride, weight, lung function, and pulmonary exacerbation rate in CF patients with G551D mutations, but its effect on the airway microbiome remains poorly characterised. Twenty CF patients with at least one G551D mutation from a single centre were recruited to a 4month double-blind, placebo-controlled, crossover study of ivacaftor with 28days of active treatment. Sputum microbiota composition was assessed by 16S rRNA gene amplicon sequencing and quantitative PCR at five key time points, along with regular clinical review, respiratory function assessment, and peripheral blood testing. No significant difference in microbiota composition was observed in subjects following ivacaftor treatment or placebo (PERMANOVA P=0.95, square root ECV=-4.94, 9479 permutations). Microbiota composition variance was significantly greater between subjects, than within subjects over time (P<0.0001, Mann Whitney U test), and an additional within-patient paired assessment of microbiota similarity was therefore performed. Again, change in microbiota composition was not significantly greater during treatment with ivacaftor compared to placebo (Wilcoxon test, P=0.51). A significant change in microbiota composition was however associated with any change in antibiotic exposure, regardless of whether ivacaftor or placebo was administered (P=0.006). In a small, subgroup analysis of subjects whose antibiotic exposure did not change within the study period, a significant reduction in total bacterial load was observed during treatment with ivacaftor (P=0.004, two-tailed paired Student's t-test). The short-term impact of ivacaftor therapy on sputum microbiota composition in patients with G551D mutations are modest compared to those resulting from antibiotic exposure, and may be masked by changes in antibiotic treatment regimen. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  12. Cystic fibrosis genetics: from molecular understanding to clinical application.

    PubMed

    Cutting, Garry R

    2015-01-01

    The availability of the human genome sequence and tools for interrogating individual genomes provide an unprecedented opportunity to apply genetics to medicine. Mendelian conditions, which are caused by dysfunction of a single gene, offer powerful examples that illustrate how genetics can provide insights into disease. Cystic fibrosis, one of the more common lethal autosomal recessive Mendelian disorders, is presented here as an example. Recent progress in elucidating disease mechanism and causes of phenotypic variation, as well as in the development of treatments, demonstrates that genetics continues to play an important part in cystic fibrosis research 25 years after the discovery of the disease-causing gene.

  13. Cystic fibrosis genetics: from molecular understanding to clinical application

    PubMed Central

    Cutting, Garry R.

    2015-01-01

    The availability of the human genome sequence and tools for interrogating individual genomes provide an unprecedented opportunity to apply genetics to medicine. Mendelian conditions, which are caused by dysfunction of a single gene, offer powerful examples that illustrate how genetics can provide insights into disease. Cystic fibrosis, one of the more common lethalautosomal recessive Mendelian disorders, is presented here as an example. Recent progress in elucidating disease mechanism and causes of phenotypic variation, as well as in the development of treatments, demonstrates that genetics continues to play an important part in cystic fibrosis research 25 years after the d iscove1y of the disease-causing gene. PMID:25404111

  14. Within-Host Evolution of Burkholderia pseudomallei during Chronic Infection of Seven Australasian Cystic Fibrosis Patients

    PubMed Central

    Kidd, Timothy J.; Geake, James B.; Bell, Scott C.; Currie, Bart J.

    2017-01-01

    ABSTRACT Cystic fibrosis (CF) is a genetic disorder characterized by progressive lung function decline. CF patients are at an increased risk of respiratory infections, including those by the environmental bacterium Burkholderia pseudomallei, the causative agent of melioidosis. Here, we compared the genomes of B. pseudomallei isolates collected between ~4 and 55 months apart from seven chronically infected CF patients. Overall, the B. pseudomallei strains showed evolutionary patterns similar to those of other chronic infections, including emergence of antibiotic resistance, genome reduction, and deleterious mutations in genes involved in virulence, metabolism, environmental survival, and cell wall components. We documented the first reported B. pseudomallei hypermutators, which were likely caused by defective MutS. Further, our study identified both known and novel molecular mechanisms conferring resistance to three of the five clinically important antibiotics for melioidosis treatment. Our report highlights the exquisite adaptability of microorganisms to long-term persistence in their environment and the ongoing challenges of antibiotic treatment in eradicating pathogens in the CF lung. Convergent evolution with other CF pathogens hints at a degree of predictability in bacterial evolution in the CF lung and potential targeted eradication of chronic CF infections in the future. PMID:28400528

  15. Inversin relays Frizzled-8 signals to promote proximal pronephros development

    PubMed Central

    Lienkamp, Soeren; Ganner, Athina; Boehlke, Christopher; Schmidt, Thorsten; Arnold, Sebastian J.; Schäfer, Tobias; Romaker, Daniel; Schuler, Julia; Hoff, Sylvia; Powelske, Christian; Eifler, Annekathrin; Krönig, Corinna; Bullerkotte, Axel; Nitschke, Roland; Kuehn, E. Wolfgang; Kim, Emily; Burkhardt, Hans; Brox, Thomas; Ronneberger, Olaf; Gloy, Joachim; Walz, Gerd

    2010-01-01

    Mutations of inversin cause type II nephronophthisis, an infantile autosomal recessive disease characterized by cystic kidney disease and developmental defects. Inversin regulates Wnt signaling and is required for convergent extension movements during early embryogenesis. We now show that Inversin is essential for Xenopus pronephros formation, involving two distinct and opposing forms of cell movements. Knockdown of Inversin abrogated both proximal pronephros extension and distal tubule differentiation, phenotypes similar to that of Xenopus deficient in Frizzled-8. Exogenous Inversin rescued the pronephric defects caused by lack of Frizzled-8, indicating that Inversin acts downstream of Frizzled-8 in pronephros morphogenesis. Depletion of Inversin prevents the recruitment of Dishevelled in response to Frizzled-8 and impeded the accumulation of Dishevelled at the apical membrane of tubular epithelial cells in vivo. Thus, defective tubule morphogenesis seems to contribute to the renal pathology observed in patients with nephronophthisis type II. PMID:21059920

  16. Cholesterol Modulates CFTR Confinement in the Plasma Membrane of Primary Epithelial Cells

    PubMed Central

    Abu-Arish, Asmahan; Pandzic, Elvis; Goepp, Julie; Matthes, Elizabeth; Hanrahan, John W.; Wiseman, Paul W.

    2015-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a plasma-membrane anion channel that, when mutated, causes the disease cystic fibrosis. Although CFTR has been detected in a detergent-resistant membrane fraction prepared from airway epithelial cells, suggesting that it may partition into cholesterol-rich membrane microdomains (lipid rafts), its compartmentalization has not been demonstrated in intact cells and the influence of microdomains on CFTR lateral mobility is unknown. We used live-cell imaging, spatial image correlation spectroscopy, and k-space image correlation spectroscopy to examine the aggregation state of CFTR and its dynamics both within and outside microdomains in the plasma membrane of primary human bronchial epithelial cells. These studies were also performed during treatments that augment or deplete membrane cholesterol. We found two populations of CFTR molecules that were distinguishable based on their dynamics at the cell surface. One population showed confinement and had slow dynamics that were highly cholesterol dependent. The other, more abundant population was less confined and diffused more rapidly. Treatments that deplete the membrane of cholesterol caused the confined fraction and average number of CFTR molecules per cluster to decrease. Elevating cholesterol had the opposite effect, increasing channel aggregation and the fraction of channels displaying confinement, consistent with CFTR recruitment into cholesterol-rich microdomains with dimensions below the optical resolution limit. Viral infection caused the nanoscale microdomains to fuse into large platforms and reduced CFTR mobility. To our knowledge, these results provide the first biophysical evidence for multiple CFTR populations and have implications for regulation of their surface expression and channel function. PMID:26153705

  17. Dysfunction of intraflagellar transport-A causes hyperphagia-induced obesity and metabolic syndrome

    PubMed Central

    Jacobs, Damon T.; Silva, Luciane M.; Allard, Bailey A.; Schonfeld, Michael P.; Chatterjee, Anindita; Talbott, George C.

    2016-01-01

    ABSTRACT Primary cilia extend from the plasma membrane of most vertebrate cells and mediate signaling pathways. Ciliary dysfunction underlies ciliopathies, which are genetic syndromes that manifest multiple clinical features, including renal cystic disease and obesity. THM1 (also termed TTC21B or IFT139) encodes a component of the intraflagellar transport-A complex and mutations in THM1 have been identified in 5% of individuals with ciliopathies. Consistent with this, deletion of murine Thm1 during late embryonic development results in cystic kidney disease. Here, we report that deletion of murine Thm1 during adulthood results in obesity, diabetes, hypertension and fatty liver disease, with gender differences in susceptibility to weight gain and metabolic dysfunction. Pair-feeding of Thm1 conditional knock-out mice relative to control littermates prevented the obesity and related disorders, indicating that hyperphagia caused the obese phenotype. Thm1 ablation resulted in increased localization of adenylyl cyclase III in primary cilia that were shortened, with bulbous distal tips on neurons of the hypothalamic arcuate nucleus, an integrative center for signals that regulate feeding and activity. In pre-obese Thm1 conditional knock-out mice, expression of anorexogenic pro-opiomelanocortin (Pomc) was decreased by 50% in the arcuate nucleus, which likely caused the hyperphagia. Fasting of Thm1 conditional knock-out mice did not alter Pomc nor orexogenic agouti-related neuropeptide (Agrp) expression, suggesting impaired sensing of changes in peripheral signals. Together, these data indicate that the Thm1-mutant ciliary defect diminishes sensitivity to feeding signals, which alters appetite regulation and leads to hyperphagia, obesity and metabolic disease. PMID:27482817

  18. Detection of CFTR function and modulation in primary human nasal cell spheroids.

    PubMed

    Brewington, John J; Filbrandt, Erin T; LaRosa, F J; Ostmann, Alicia J; Strecker, Lauren M; Szczesniak, Rhonda D; Clancy, John P

    2018-01-01

    Expansion of CFTR modulators to patients with rare/undescribed mutations will be facilitated by patient-derived models quantifying CFTR function and restoration. We aimed to generate a personalized model system of CFTR function and modulation using non-surgically obtained nasal epithelial cells (NECs). NECs obtained by curettage from healthy volunteers and CF patients were expanded and grown in 3-dimensional culture as spheroids, characterized, and stimulated with cAMP-inducing agents to activate CFTR. Spheroid swelling was quantified as a proxy for CFTR function. NEC spheroids recapitulated characteristics of pseudostratified respiratory epithelia. When stimulated with forskolin/IBMX, spheroids swelled in the presence of functional CFTR, and shrank in its absence. Spheroid swelling quantified mutant CFTR restoration in F508del homozygous cells using clinically available CFTR modulators. NEC spheroids hold promise for understanding rare CFTR mutations and personalized modulator testing to drive evaluation for CF patients with common, rare or undescribed mutations. Portions of this data have previously been presented in abstract form at the 2016 meetings of the American Thoracic Society and the 2016 North American Cystic Fibrosis Conference. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  19. Variants in mannose‐binding lectin and tumour necrosis factor α affect survival in cystic fibrosis

    PubMed Central

    Buranawuti, Kitti; Boyle, Michael P; Cheng, Suzanne; Steiner, Lori L; McDougal, Kathryn; Fallin, M Daniele; Merlo, Christian; Zeitlin, Pamela L; Rosenstein, Beryl J; Mogayzel, Peter J; Wang, Xinjing; Cutting, Garry R

    2007-01-01

    Background Patients with cystic fibrosis with the same mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene differ widely in survival suggesting other factors have a substantial role in mortality. Objective To determine if the genotype distribution of variants in three putative cystic fibrosis modifier genes (tumour necrosis factor α (TNFα), transforming growth factor β1 (TGFβ1) or mannose‐binding lectin (MBL2)) differed among patients with cystic fibrosis grouped according to age and survival status. Methods Genotypes of four variants (TNFα‐238, TNFα‐308, TGFβ1‐509 and MBL2 O) were determined in three groups of Caucasians from a single medical centre: 101 children with cystic fibrosis (aged <17 years; mean age 9.4 years), 115 adults with cystic fibrosis (aged ⩾17 years; mean age 30.8 years) and 38 non‐surviving adults with cystic fibrosis (21 deceased and 17 lung transplant after 17 years of age). Genotypes of 127 healthy Caucasians in the same geographical region were used as controls. Kaplan–Meier and Cox hazard regression were used to evaluate the genotype effect on cumulative survival. Results Genotype frequencies among adults and children with cystic fibrosis differed for TNFα‐238 (G/G vs G/A; p = 0.022) and MBL2 (A/A vs O/O; p = 0.016). When adults with cystic fibrosis were compared to non‐surviving adults with cystic fibrosis, genotype frequencies of both genes differed (TNFα‐238G/G vs G/A; p =  0.0015 and MBL2: A/A vs O/O; p = 0.009). The hazard ratio for TNFα‐238G/G vs G/A was 0.25 (95% CI 0.06 to 1.0, p = 0.04) and for MBL2 O/O vs A/A or A/O was 2.5 (95% CI 1.3 to 4.9, p = 0.007). Conclusions TNFα‐238 G/A and MBL2 O/O genotypes appear to be genetic modifiers of survival of cystic fibrosis. PMID:17158822

  20. Pathogenesis of thyroid nodules: histological classification?

    PubMed

    Salabè, G B

    2001-02-01

    Thyroid nodule genesis may be considered as an amplification of thyroid heterogeneity due to genetic and/or epigenetic mechanisms. We classified the thyroid nodules in five types with distinct histological features: hyperplastic, neoplastic, colloid, cystic and thyroiditic nodules. Hyperplastic: Thyrocyte proliferation is under the control of TSH but several other paracrine and autocrine factors are secreted by follicular cells, the stromal apparatus and the lymphocytes, which are implicated in initiation and perpetuation of thyroid hyperplasia. Growth occurs mainly through TSHR, cAMP and PKA. Constitutive cAMP overproduction has been shown to be due to point mutation of the TSHR or Gs protein, producing overgrowth and hyperfunction. Neoplastic: Several activated oncogenes have been identified in thyroid malignancies. Oncogenes relevant to the thyroid carcinogenesis are: mutated TSHR and gsp (constitutive activation of cAMP); TRK (receptor for NGF); RET/PTC (phosphorylation of tyrosine kinase receptor)--an isoform of this oncogene is induced by radiation: ras (it encodes Gs proteins transducing mitogenic signals); and c-MET (receptor for hepatocyte growth factor). The evolution of a differentiated thyroid cancer towards an undifferentiated cancer is due to a mutation of a family of proteins (i.e., p53), which acts as a brake, preventing the genomic instability of cancer. It is suggested that a tumor initiates by RET or ras and possibly progresses--as a result of additional mutations and by p53 mutation--to anaplastic carcinoma. Colloid: Flattening of the epithelium and dilatation of follicles containing viscous material--made up by a concentrated solution of thyroglobulin (hTg)--is the characteristic of the colloid nodule. A defect of intraluminal reabsorption of hTg has been suggested but not proven. Experimentally, a load of iodine is able to change thyroid hyperplasia to a colloid feature; however, a load of iodine is rarely found in the clinical history of patients. A new clue to the pathogenesis comes from the finding that a relevant part of the colloid (10-20%) is made up of insoluble globules, where hTg is compacted in a polymeric form. It is suggested that stocking hTg into globules is defective in colloid nodules, leading to enormous enlargement of the follicle. Cystic: It is estimated that between 15 and 40% of thyroid nodules are partly or entirely cystic. The 'true cyst' is rare; most of the so-called cystic nodules are 'pseudocysts', which follow necrosis and colliquation. Necrosis issues as an imbalance between growth and the precisely regulated process of angiogenesis. More recently, the VEGF/VPF has been found to be at the origin of recent and recurrent cysts. Immunotoxic and apoptotic mechanisms have also been suggested. Chemical analysis of cystic fluid showed a 'denatured' and 'serum-like' pattern suggesting different mechanisms in the pathogenesis of the pseudocystic thyroid nodules. Thyroiditic: Nodular lymphocytic thyroiditis (NLT) includes two different entities: 1) lymphocyte thyroiditis growing as a nodule in a hyperplastic or normal gland, and 2) lymphocyte thyroiditis associated in the same nodule with other nodular diseases of the thyroid: papillary thyroid carcinoma and lymphoma have been found to be associated to chronic lymphocytic thyroiditis.

  1. Focal dermal hypoplasia (Goltz-Gorlin syndrome): a new case with a novel variant in the PORCN gene (c.1250T>C:p.F417S) and unusual spinal anomaly.

    PubMed

    Garavelli, Livia; Simonte, Graziella; Rosato, Simonetta; Wischmeijer, Anita; Albertini, Enrico; Guareschi, Elisa; Longo, Caterina; Albertini, Giuseppe; Gelmini, Chiara; Greco, Chiara; Errico, Stefania; Savino, Gustavo; Pavanello, Marco; Happle, Rudolf; Unger, Sheila; Superti-Furga, Andrea; Grzeschik, Karl-Heinz

    2013-07-01

    Focal dermal hypoplasia (FDH; Goltz-Gorlin syndrome; OMIM 305600) is a disorder that features involvement of the skin, skeletal system, and eyes. It is caused by loss-of-function mutations in the PORCN gene. We report a young girl with FDH, microphthalmos associated with colobomatous orbital cyst, dural ectasia and cystic malformation of the spinal cord, and a de novo variant in PORCN. This association has not been previously reported, and based on these observations the phenotypic spectrum of FDH might be broader than previously appreciated. It would be prudent to alter the suggested surveillance for this rare disorder. Copyright © 2013 Wiley Periodicals, Inc.

  2. Whole-gene CFTR sequencing combined with digital RT-PCR improves genetic diagnosis of cystic fibrosis.

    PubMed

    Straniero, Letizia; Soldà, Giulia; Costantino, Lucy; Seia, Manuela; Melotti, Paola; Colombo, Carla; Asselta, Rosanna; Duga, Stefano

    2016-12-01

    Despite extensive screening, 1-5% of cystic fibrosis (CF) patients lack a definite molecular diagnosis. Next-generation sequencing (NGS) is making affordable genetic testing based on the identification of variants in extended genomic regions. In this frame, we analyzed 23 CF patients and one carrier by whole-gene CFTR resequencing: 4 were previously characterized and served as controls; 17 were cases lacking a complete diagnosis after a full conventional CFTR screening; 3 were consecutive subjects referring to our centers, not previously submitted to any screening. We also included in the custom NGS design the coding portions of the SCNN1A, SCNN1B and SCNN1G genes, encoding the subunits of the sodium channel ENaC, which were found to be mutated in CF-like patients. Besides 2 novel SCNN1B missense mutations, we identified 22 previously-known CFTR mutations, including 2 large deletions (whose breakpoints were precisely mapped), and novel deep-intronic variants, whose role on splicing was excluded by ex-vivo analyses. Finally, for 2 patients, compound heterozygotes for a CFTR mutation and the intron-9c.1210-34TG [11-12] T 5 allele-known to be associated with decreased CFTR mRNA levels-the molecular diagnosis was implemented by measuring the residual level of wild-type transcript by digital reverse transcription polymerase chain reaction performed on RNA extracted from nasal brushing.

  3. Correction of the F508del-CFTR protein processing defect in vitro by the investigational drug VX-809

    PubMed Central

    Van Goor, Fredrick; Hadida, Sabine; Grootenhuis, Peter D. J.; Burton, Bill; Stack, Jeffrey H.; Straley, Kimberly S.; Decker, Caroline J.; Miller, Mark; McCartney, Jason; Olson, Eric R.; Wine, Jeffrey J.; Frizzell, Ray A.; Ashlock, Melissa; Negulescu, Paul A.

    2011-01-01

    Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene that impair the function of CFTR, an epithelial chloride channel required for proper function of the lung, pancreas, and other organs. Most patients with CF carry the F508del CFTR mutation, which causes defective CFTR protein folding and processing in the endoplasmic reticulum, resulting in minimal amounts of CFTR at the cell surface. One strategy to treat these patients is to correct the processing of F508del-CFTR with small molecules. Here we describe the in vitro pharmacology of VX-809, a CFTR corrector that was advanced into clinical development for the treatment of CF. In cultured human bronchial epithelial cells isolated from patients with CF homozygous for F508del, VX-809 improved F508del-CFTR processing in the endoplasmic reticulum and enhanced chloride secretion to approximately 14% of non-CF human bronchial epithelial cells (EC50, 81 ± 19 nM), a level associated with mild CF in patients with less disruptive CFTR mutations. F508del-CFTR corrected by VX-809 exhibited biochemical and functional characteristics similar to normal CFTR, including biochemical susceptibility to proteolysis, residence time in the plasma membrane, and single-channel open probability. VX-809 was more efficacious and selective for CFTR than previously reported CFTR correctors. VX-809 represents a class of CFTR corrector that specifically addresses the underlying processing defect in F508del-CFTR. PMID:21976485

  4. Unusual growth rate during cystic echinococcosis.

    PubMed

    Valour, Florent; Khenifer, Safia; Della-Schiava, Nellie; Cotte, Eddy; Guibert, Benoit; Wallon, Martine; Durupt, Stéphane; Durieu, Isabelle

    2014-04-01

    Cystic echinococcosis is a world wild zoonosis caused by Echinococcus granulosus, leading to hepatic and lung cysts with a usually slight growth rate. We report the case of an 82year-old Algerian woman with hepatic and lung cystic echinococcosis with a 10-fold size increase in 6months. Copyright © 2013. Published by Elsevier Ireland Ltd.

  5. In vivo and in vitro ivacaftor response in cystic fibrosis patients with residual CFTR function: N-of-1 studies.

    PubMed

    McGarry, Meghan E; Illek, Beate; Ly, Ngoc P; Zlock, Lorna; Olshansky, Sabrina; Moreno, Courtney; Finkbeiner, Walter E; Nielson, Dennis W

    2017-04-01

    Ivacaftor, a cystic fibrosis transmembrane conductance regulator (CFTR) potentiator, decreases sweat chloride concentration, and improves pulmonary function in 6% of cystic fibrosis (CF) patients with specific CFTR mutations. Ivacaftor increases chloride transport in many other CFTR mutations in non-human cells, if CFTR is in the epithelium. Some CF patients have CFTR in the epithelium with residual CFTR function. The effect of ivacaftor in these patients is unknown. This was a series of randomized, crossover N-of-1 trials of ivacaftor and placebo in CF patients ≥8 years old with potential residual CFTR function (intermediate sweat chloride concentration, pancreatic sufficient, or mild bronchiectasis on chest CT). Human nasal epithelium (HNE) was obtained via nasal brushing and cultured. Sweat chloride concentration change was the in vivo outcome. Chloride current change in HNE cultures with ivacaftor was the in vitro outcome. Three subjects had decreased sweat chloride concentration (-14.8 to -40.8 mmol/L, P < 0.01). Two subjects had unchanged sweat chloride concentration. Two subjects had increased sweat chloride concentration (+23.8 and +27.3 mmol/L, P < 0.001); both were heterozygous for A455E and pancreatic sufficient. Only subjects with decreased sweat chloride concentration had increased chloride current in HNE cultures. Some CF patients with residual CFTR function have decreased sweat chloride concentration with ivacaftor. Increased chloride current in HNE cultures among subjects with decreased sweat chloride concentrations may predict clinical response to ivacaftor. Ivacaftor can increase sweat chloride concentration in certain mutations with unclear clinical effect. Pediatr Pulmonol. 2017;52:472-479. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  6. Polymorphisms in the glutathione pathway modulate cystic fibrosis severity: a cross-sectional study

    PubMed Central

    2014-01-01

    Background Cystic fibrosis (CF) clinically manifests with various levels of severity, which are thought to be modulated by mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR), modifier genes, and the environment. This study verified whether polymorphisms in modifier genes associated with glutathione (GSH) metabolism influence CF severity. Methods A cross-sectional study of 180 CF patients was carried out from 2011 to 2012. We analyzed CFTR mutations, polymorphisms (GSTM1 and GSTT1 deletions, GSTP1 + 313A > G, GCLC-129C > T, and GCLC-3506A > G) in modifier genes and CF clinical severity as assessed by 28 clinical and laboratory variables. Results Significant associations were found between modifier gene polymorphisms and particular phenotypes or genotype changes. These included GCLC-129C > T with a higher frequency of the Pseudomonas aeruginosa mucoid to CC genotype (p = 0.044), and GCLC-3506A > G with a higher frequency of the no-mucoid P. aeruginosa (NMPA) to AA genotype (p = 0.012). The GSTT1 deletion was associated with a higher frequency of the NMPA to homozygous deletion (p = 0.008), GSTP1 + 313A > G with a minor risk of osteoporosis (p = 0.036), and patient age ≤ 154 months (p = 0.044) with the AA genotype. The Bhalla score was associated with GCLC-3506A > G (p = 0.044) and GSTM1/GSTT1 deletion polymorphisms (p = 0.02), while transcutaneous hemoglobin oxygen saturation levels were associated with GSTT1 deletions (p = 0.048). Conclusion CF severity is associated with polymorphisms in GSH pathways and CFTR mutations. PMID:24593045

  7. Guidelines for the clinical management and follow-up of infants with inconclusive cystic fibrosis diagnosis through newborn screening.

    PubMed

    Sermet-Gaudelus, I; Brouard, J; Audrézet, M-P; Couderc Kohen, L; Weiss, L; Wizla, N; Vrielynck, S; LLerena, K; Le Bourgeois, M; Deneuville, E; Remus, N; Nguyen-Khoa, T; Raynal, C; Roussey, M; Girodon, E

    2017-12-01

    Neonatal screening for cystic fibrosis (CF) can detect infants with elevated immunoreactive trypsinogen (IRT) levels and inconclusive sweat tests and/or CFTR DNA results. These cases of uncertain diagnosis are defined by (1) either the presence of at most one CF-associated cystic fibrosis transmembrane conductance regulator (CFTR) mutation with sweat chloride values between 30 and 59mmol/L or (2) two CFTR mutations with at least one of unknown pathogenic potential and a sweat chloride concentration below 60mmol/L. This encompasses various clinical situations whose progression cannot be predicted. In these cases, a sweat chloride test has to be repeated at 12 months, and if possible at 6 and 24 months of life along with extended CFTR sequencing to detect rare mutations. When the diagnosis is not definite, CFTR functional explorations may provide a better understanding of CFTR dysfunction. The initial evaluation of these infants must be conducted in dedicated CF reference centers and should include bacteriological sputum analysis, chest radiology, and fecal elastase assay. The primary care physicians in charge of these patients should be familiar with the current management of CF and should work in collaboration with CF centers. A follow-up should be performed in a CF reference center at 3, 6, and 12 months of life and every year thereafter. Any symptom indicative of CF requires immediate reevaluation of the diagnosis. These guidelines were established by the "neonatal screening and difficult diagnoses" working group of the French CF society. Their objective is to standardize the management of infants with unclear diagnosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Incidental late diagnosis of cystic fibrosis following AH1N1 influenza virus pneumonia: a case report.

    PubMed

    Iadevaia, Carlo; Iacotucci, Paola; Carnovale, Vincenzo; Calabrese, Cecilia; Rea, Gaetano; Ferrara, Nicola; Perrotta, Fabio; Mazzarella, Gennaro; Bianco, Andrea

    2017-10-01

    Cystic fibrosis is an autosomal recessive disorder characterized by chronic progressive multisystem involvement. AH1N1 virus infections caused classic influenza symptoms in the majority of cystic fibrosis patients while others experienced severe outcomes. We report a case of late incidental cystic fibrosis diagnosis in a young Caucasian man suffering from respiratory failure following infection due to AH1N1 influenza virus. The patient was admitted to our department with fever, cough, and dyspnea at rest unresponsive to antibiotics CONCLUSIONS: Late diagnosis of cystic fibrosis in uncommon. This report highlights the importance of early cystic fibrosis diagnosis to minimize risk of occurrence of potential life-threatening complications.

  9. Targeted Gene Next-Generation Sequencing in Chinese Children with Chronic Pancreatitis and Acute Recurrent Pancreatitis.

    PubMed

    Xiao, Yuan; Yuan, Wentao; Yu, Bo; Guo, Yan; Xu, Xu; Wang, Xinqiong; Yu, Yi; Yu, Yi; Gong, Biao; Xu, Chundi

    2017-12-01

    To identify causal mutations in certain genes in children with acute recurrent pancreatitis (ARP) or chronic pancreatitis (CP). After patients were enrolled (CP, 55; ARP, 14) and their clinical characteristics were investigated, we performed next-generation sequencing to detect nucleotide variations among the following 10 genes: cationic trypsinogen protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1), cystic fibrosis transmembrane conductance regulator gene (CFTR), chymotrypsin C (CTRC), calcium-sensing receptor (CASR), cathepsin B (CTSB), keratin 8 (KRT8), CLAUDIN 2 (CLDN2), carboxypeptidase A1 (CPA1), and ATPase type 8B member 1 (ATP8B1). Mutations were searched against online databases to obtain information on the cause of the diseases. Certain novel mutations were analyzed using the SIFT2 and Polyphen-2 to predict the effect on protein function. There were 45 patients with CP and 10 patients with ARP who harbored 1 or more mutations in these genes; 45 patients had at least 1 mutation related to pancreatitis. Mutations were observed in the PRSS1, SPINK1, and CFTR genes in 17 patients, the CASR gene in 5 patients, and the CTSB, CTRC, and KRT8 genes in 1 patient. Mutations were not found in the CLDN, CPA1, or ATP8B1 genes. We found that mutations in SPINK1 may increase the risk of pancreatic duct stones (OR, 11.07; P = .003). The patients with CFTR mutations had a higher level of serum amylase (316.0 U/L vs 92.5 U/L; P = .026). Mutations, especially those in PRSS1, SPINK1, and CFTR, accounted for the major etiologies in Chinese children with CP or ARP. Children presenting mutations in the SPINK1 gene may have a higher risk of developing pancreatic duct stones. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Altering intracellular pH reveals the kinetic basis of intraburst gating in the CFTR Cl− channel

    PubMed Central

    Xu, Weiyi; Sheppard, David N.

    2017-01-01

    Key points The cystic fibrosis transmembrane conductance regulator (CFTR), which is defective in the genetic disease cystic fibrosis (CF), forms a gated pathway for chloride movement regulated by intracellular ATP.To understand better CFTR function, we investigated the regulation of channel openings by intracellular pH.We found that short‐lived channel closures during channel openings represent subtle changes in the structure of CFTR that are regulated by intracellular pH, in part, at ATP‐binding site 1 formed by the nucleotide‐binding domains.Our results provide a framework for future studies to understand better the regulation of channel openings, the dysfunction of CFTR in CF and the action of drugs that repair CFTR gating defects. Abstract Cystic fibrosis transmembrane conductance regulator (CFTR) is an ATP‐gated Cl− channel defective in the genetic disease cystic fibrosis (CF). The gating behaviour of CFTR is characterized by bursts of channel openings interrupted by brief, flickery closures, separated by long closures between bursts. Entry to and exit from an open burst is controlled by the interaction of ATP with two ATP‐binding sites, sites 1 and 2, in CFTR. To understand better the kinetic basis of CFTR intraburst gating, we investigated the single‐channel activity of human CFTR at different intracellular pH (pHi) values. When compared with the control (pHi 7.3), acidifying pHi to 6.3 or alkalinizing pHi to 8.3 and 8.8 caused small reductions in the open‐time constant (τo) of wild‐type CFTR. By contrast, the fast closed‐time constant (τcf), which describes the short‐lived closures that interrupt open bursts, was greatly increased at pHi 5.8 and 6.3. To analyse intraburst kinetics, we used linear three‐state gating schemes. All data were satisfactorily modelled by the C1 ↔ O ↔ C2 kinetic scheme. Changing the intracellular ATP concentration was without effect on τo, τcf and their responses to pHi changes. However, mutations that disrupt the interaction of ATP with ATP‐binding site 1, including K464A, D572N and the CF‐associated mutation G1349D all abolished the prolongation of τcf at pHi 6.3. Taken together, our data suggest that the regulation of CFTR intraburst gating is distinct from the ATP‐dependent mechanism that controls channel opening and closing. However, our data also suggest that ATP‐binding site 1 modulates intraburst gating. PMID:27779763

  11. The lipid A of Burkholderia multivorans C1576 smooth-type lipopolysaccharide and its pro-inflammatory activity in a cystic fibrosis airways model.

    PubMed

    Ieranò, Teresa; Cescutti, Paola; Leone, Maria Rosaria; Luciani, Alessandro; Rizzo, Roberto; Raia, Valeria; Lanzetta, Rosa; Parrilli, Michelangelo; Maiuri, Luigi; Silipo, Alba; Molinaro, Antonio

    2010-12-01

    Cystic fibrosis is an autosomal recessive disorder and it is characterised by chronic bacterial airway infection which leads to progressive lung deterioration, sometimes with fatal outcome. Burkholderia multivorans and Burkholderia cenocepacia are the species responsible for most of the infections of cystic fibrosis patients. Lipopolysaccharide endotoxins (LPSs) are among the foremost factors of pathogenesis of Gram-negative infection and, in particular, lipid A is the endotoxic portion of LPS responsible for eliciting host innate immune response. In this work, the complete primary structure of the lipid A from B. multivorans C1576 has been defined and, further, its pro-inflammatory activity in a cystic fibrosis airways model is shown. The structure of B. multivorans lipid A was attained by chemical, mass spectrometry and nuclear magnetic resonance analyses whereas its biological activity was assessed on the intestinal epithelial cell line CACO-2 cells, on the airway epithelial IB3-1 cells, carrying the ΔF508/W1282X CFTR mutation and on an ex vivo model of culture explants of nasal polyps.

  12. Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients.

    PubMed

    Schippa, Serena; Iebba, Valerio; Santangelo, Floriana; Gagliardi, Antonella; De Biase, Riccardo Valerio; Stamato, Antonella; Bertasi, Serenella; Lucarelli, Marco; Conte, Maria Pia; Quattrucci, Serena

    2013-01-01

    In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF). CFTR mutations (F508del is the most common) lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. Patients were classified by two different criteria: 1) presence/absence of F508del mutation; 2) disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme) were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum) were reduced. This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a 'systemic disease', linking the lung and the gut in a joined axis.

  13. Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Allelic Variants Relate to Shifts in Faecal Microbiota of Cystic Fibrosis Patients

    PubMed Central

    Santangelo, Floriana; Gagliardi, Antonella; De Biase, Riccardo Valerio; Stamato, Antonella; Bertasi, Serenella; Lucarelli, Marco

    2013-01-01

    Introduction In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF). CFTR mutations (F508del is the most common) lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. Methods Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. Results Patients were classified by two different criteria: 1) presence/absence of F508del mutation; 2) disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme) were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum) were reduced. Conclusions This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a ‘systemic disease’, linking the lung and the gut in a joined axis. PMID:23613805

  14. Adenocarcinoma arising from intracranial recurrent mature teratoma and featuring mutated KRAS and wild-type BRAF genes.

    PubMed

    Kim, Eun Soo; Kwon, Mi Jung; Song, Joon Ho; Kim, Dong Hoon; Park, Hye-Rim

    2015-02-01

    Malignant transformation or recurrence of intracranial mature teratoma is an extremely rare occurrence, compared to the usual ovarian counterpart. Previously, yolk sac tumor elements have been considered to be selective progenitors of enteric-type adenocarcinoma arising from intracranial germ cell tumors. However, the present case demonstrates the occurrence of enteric-type adenocarcinoma in recurrent intracranial mature cystic teratoma 12 years after gross total removal, a case of which has not previously been documented in the literature. The 11.5-cm long, dura mater-based tumor on the right fronto-temporal lobe displaced the brain; however, the patient had no neurologic symptoms or discomfort other than pus-like discharge on the scalp. Microscopic examinations revealed a small focus of adenocarcinoma and dysplastic colonic mucosa in the mature cystic teratoma. No immature elements were seen. The cystic wall was almost denuded and showed an exuberant xanthogranulomatous reaction with foreign-body type giant cells engulfing keratin materials and cholesterol clefts, suggesting that chronic inflammation due to repeated cyst wall rupture and the previous resection may contribute to malignant transformation. The adenocarcinoma showed strong immunohistochemical expression of CK20 and p53, but CK7 in patches. The molecular profile of the adenocarcinoma showed a mutation in KRAS and wild-type BRAF, which might be associated with malignant transformation of intracranial mature teratomas. In conclusion, the intracranial mature teratomas should require long-term follow-up, and clinicians, radiologists and pathologists should be aware of the potential for malignant progression of recurrent intracranial mature cystic teratoma despite gross total resection and no neurologic symptoms. © 2014 Japanese Society of Neuropathology.

  15. Amniotic fluid digestive enzyme analysis is useful for identifying CFTR gene mutations of unclear significance.

    PubMed

    Oca, Florine; Dreux, Sophie; Gérard, Bénédicte; Simon-Bouy, Brigitte; de Becdelièvre, Alix; Ferec, Claude; Girodon, Emmanuelle; Muller, Françoise

    2009-12-01

    The large number of CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations and the existence of variants of unclear significance complicate the prenatal diagnosis of cystic fibrosis (CF). The aim of this study was to determine whether the pattern of amniotic fluid digestive enzymes (AF-DEs) could be correlated with the severity of CFTR mutations. The AF-DE pattern (gamma-glutamyltranspeptidase, aminopeptidase M, and the intestinal isoform of alkaline phosphatase) was retrospectively analyzed in 43 AF samples. All fetuses presented 2 CFTR mutations, which were classified according to the severity of the disease: CF/CF (n = 38); CF/CFTR-related disorders (n = 1); and CF/unknown variant (n = 4). The relationships between clinical CF status, CFTR mutations, and AF-DE pattern were studied. Of 38 severely affected CF fetuses, an "obstructive" AF-DE pattern was observed in 15 of 15 samples collected before 22 weeks, irrespective of the CFTR mutation (diagnostic sensitivity, 100%; diagnostic specificity, 99.8%). In the 23 fetuses evaluated after 22 weeks, the AF-DE pattern was abnormal in 7 cases and noncontributive in 16 (diagnostic sensitivity, 30.4%; diagnostic specificity, 99.8%). Of the 5 questionable cases (F508del/N1224K, F508del/L73F, 3849+10kbC>T/G1127E, F508del/S1235R, F508del/G622D), all were CF symptom free at 2-4 years of follow-up. The AF-DE pattern (<22 weeks) was typical in 3 cases but abnormal in the last 2 cases. AF-DE analysis is of value for prenatal CF diagnosis in classic forms of CF and could be helpful in nonclassic CF.

  16. The value of KRAS mutation testing with CEA for the diagnosis of pancreatic mucinous cysts

    PubMed Central

    Kadayifci, Abdurrahman; Al-Haddad, Mohammad; Atar, Mustafa; Dewitt, John M.; Forcione, David G.; Sherman, Stuart; Casey, Brenna W.; Fernandez-del Castillo, Carlos; Schmidt, C. Max; Pitman, Martha B.; Brugge, William R.

    2016-01-01

    Background and aims: Pancreatic cyst fluid (PCF) CEA has been shown to be the most accurate preoperative test for detection of cystic mucinous neoplasms (CMNs). This study aimed to assess the added value of PCF KRAS mutational analysis to CEA for diagnosis of CMNs. Patients and methods: This is a retrospective study of prospectively collected endoscopic ultrasonography (EUS) fine-needle aspiration (FNA) data. KRAS mutation was determined by direct sequencing or equivalent methods. Cysts were classified histologically (surgical cohort) or by clinical (EUS or FNA) findings (clinical cohort). Performance characteristics of KRAS, CEA and their combination for detection of a cystic mucinous neoplasm (CMN) and malignancy were calculated. Results: The study cohort consisted of 943 patients: 147 in the surgical cohort and 796 in the clinical cohort. Overall, KRAS and CEA each had high specificity (100 % and 93.2 %), but low sensitivity (48.3 % and 56.3 %) for the diagnosis of a CMN. The positivity of KRAS or CEA increased the diagnostic accuracy (80.8 %) and AUC (0.84) significantly compared to KRAS (65.3 % and 0.74) or CEA (65.8 % and 0.74) alone, but only in the clinical cohort (P < 0.0001 for both). KRAS mutation was significantly more frequent in malignant CMNs compared to histologically confirmed non-malignant CMNs (73 % vs. 37 %, P = 0.001). The negative predictive value of KRAS mutation was 77.6 % in differentiating non-malignant cysts. Conclusions: The detection of a KRAS mutation in PCF is a highly specific test for mucinous cysts. It outperforms CEA for sensitivity in mucinous cyst diagnosis, but the data does not support its routine use. PMID:27092317

  17. Loss of Nephrocystin-3 Function Can Cause Embryonic Lethality, Meckel-Gruber-like Syndrome, Situs Inversus, and Renal-Hepatic-Pancreatic Dysplasia

    PubMed Central

    Bergmann, Carsten; Fliegauf, Manfred; Brüchle, Nadina Ortiz; Frank, Valeska; Olbrich, Heike; Kirschner, Jan; Schermer, Bernhard; Schmedding, Ingolf; Kispert, Andreas; Kränzlin, Bettina; Nürnberg, Gudrun; Becker, Christian; Grimm, Tiemo; Girschick, Gundula; Lynch, Sally A.; Kelehan, Peter; Senderek, Jan; Neuhaus, Thomas J.; Stallmach, Thomas; Zentgraf, Hanswalter; Nürnberg, Peter; Gretz, Norbert; Lo, Cecilia; Lienkamp, Soeren; Schäfer, Tobias; Walz, Gerd; Benzing, Thomas; Zerres, Klaus; Omran, Heymut

    2008-01-01

    Many genetic diseases have been linked to the dysfunction of primary cilia, which occur nearly ubiquitously in the body and act as solitary cellular mechanosensory organelles. The list of clinical manifestations and affected tissues in cilia-related disorders (ciliopathies) such as nephronophthisis is broad and has been attributed to the wide expression pattern of ciliary proteins. However, little is known about the molecular mechanisms leading to this dramatic diversity of phenotypes. We recently reported hypomorphic NPHP3 mutations in children and young adults with isolated nephronophthisis and associated hepatic fibrosis or tapetoretinal degeneration. Here, we chose a combinatorial approach in mice and humans to define the phenotypic spectrum of NPHP3/Nphp3 mutations and the role of the nephrocystin-3 protein. We demonstrate that the pcy mutation generates a hypomorphic Nphp3 allele that is responsible for the cystic kidney disease phenotype, whereas complete loss of Nphp3 function results in situs inversus, congenital heart defects, and embryonic lethality in mice. In humans, we show that NPHP3 mutations can cause a broad clinical spectrum of early embryonic patterning defects comprising situs inversus, polydactyly, central nervous system malformations, structural heart defects, preauricular fistulas, and a wide range of congenital anomalies of the kidney and urinary tract (CAKUT). On the functional level, we show that nephrocystin-3 directly interacts with inversin and can inhibit like inversin canonical Wnt signaling, whereas nephrocystin-3 deficiency leads in Xenopus laevis to typical planar cell polarity defects, suggesting a role in the control of canonical and noncanonical (planar cell polarity) Wnt signaling. PMID:18371931

  18. Adenoid cystic carcinoma: A review of recent advances, molecular targets, and clinical trials.

    PubMed

    Dillon, Patrick M; Chakraborty, Samhita; Moskaluk, Christopher A; Joshi, Prashant J; Thomas, Christopher Y

    2016-04-01

    Adenoid cystic carcinoma (ACC) is a rare tumor of secretory glands. In this study, recent advances in molecular characterization and in therapeutics are reviewed. A search of articles in PubMed and of abstracts from national meetings was performed regarding ACC. Recent genetic analyses found that recurrent chromosome 6:9 translocations in ACC generate an MYB:NFIB gene fusion resulting in overexpression of the MYB oncoprotein. Several other frequent mutations are recently published that may be relevant for drug development. Several trials of targeted drugs are reviewed. Some agents delay tumor progression, but tumor responses remain rare. ACCs have a characteristic chromosomal translocation, but also frequently pick up additional mutations. Clinical research is limited by the rarity and slow growth of ACC. Several ongoing trials are testing agents that inhibit fibroblast growth factor receptor signaling or other signaling pathways. Novel treatments based on the recently sequenced tumor genome are under development. © 2015 Wiley Periodicals, Inc.

  19. Pulmonary cystic echinococcosis.

    PubMed

    Santivanez, Saul; Garcia, Hector H

    2010-05-01

    Pulmonary cystic echinococcosis, a zoonosis caused by the larvae of the dog tapeworm Echinococcus granulosus, is considered as a major public health problem in countries where dogs are used to care for large herds. Despite its frequency and widespread endemicity, the literature on pulmonary cystic echinococcosis is scarce and not systematic. We aimed to summarize currently available information to provide a comprehensive overview for clinicians facing cases of pulmonary cystic echinococcosis. Despite discrepancies in the literature, some patterns can be discerned. The ratio of lung:liver involvement is higher in children than in adults. Most pulmonary cases are discovered incidentally on routine radiograph evaluation; also most infected individuals remain asymptomatic until the cyst enlarges sufficiently to cause symptoms. Symptoms are usually caused by mass effect from the cyst. Complications (cyst rupture, aggregated infection) change the clinical presentation, producing cough, chest pain, hemoptysis, or vomica. Diagnosis is obtained by chest radiographs or computed tomography, and supported by serology. Presurgical chemotherapy reduces the chances of seeding and recurrence. Treatment with benzimidazoles is an option when surgery is unavailable or complete removal is unfeasible. Diagnosis of pulmonary cystic echinococcosis is primarily made by imaging, and surgery remains the main therapeutic approach.

  20. Molecular genetic testing for cystic fibrosis: laboratory performance on the College of American Pathologists external proficiency surveys.

    PubMed

    Lyon, Elaine; Schrijver, Iris; Weck, Karen E; Ferreira-Gonzalez, Andrea; Richards, C Sue; Palomaki, Glenn E

    2015-03-01

    Molecular testing for cystic fibrosis mutations is widespread and routine in reproductive decision making and diagnosis. Our objective was to assess the level of performance of laboratories for this test. The College of American Pathologists administers external proficiency testing with multiple DNA samples distributed biannually. RESULTS are analyzed, reviewed, and graded by the joint College of American Pathologists/American College of Medical Genetics and Genomics Biochemical and Molecular Genetics Committee. Assessment is based on genotype and associated clinical interpretation. Overall, 357 clinical laboratories participated in the proficiency testing survey between 2003 and 2013 (322 in the United States and 35 international). In 2013, US participants reported performing nearly 120,000 tests monthly. Analytical sensitivity and specificity of US laboratories were 98.8% (95% confidence interval: 98.4-99.1%) and 99.6% (95% confidence interval: 99.4-99.7%), respectively. Analytical sensitivity improved between 2003 and 2008 (from 97.9 to 99.3%; P = 0.007) and remained steady thereafter. Clinical interpretation matched the intended response for 98.8, 86.0, and 91.0% of challenges with no, one, or two mutations, respectively. International laboratories performed similarly. Laboratory testing for cystic fibrosis in the United States has improved since 2003, and these data demonstrate a high level of quality. Neither the number of samples tested nor test methodology affected performance.

  1. Cystic fibrosis transmembrane conductance regulator protein (CFTR) expression in the developing human brain: comparative immunohistochemical study between patients with normal and mutated CFTR.

    PubMed

    Marcorelles, Pascale; Friocourt, Gaëlle; Uguen, Arnaud; Ledé, Françoise; Férec, Claude; Laquerrière, Annie

    2014-11-01

    Cystic Fibrosis Transmembrane conductance Regulator (CFTR) protein has recently been shown to be expressed in the human adult central nervous system (CNS). As CFTR expression has also been documented during embryonic development in several organs, such as the respiratory tract, the intestine and the male reproductive system, suggesting a possible role during development we decided to investigate the expression of CFTR in the human developing CNS. In addition, as some, although rare, neurological symptoms have been reported in patients with CF, we compared the expression of normal and mutated CFTR at several fetal stages. Immunohistochemistry was performed on brain and spinal cord samples of foetuses between 13 and 40 weeks of gestation and compared with five patients with cystic fibrosis (CF) of similar ages. We showed in this study that CFTR is only expressed in neurons and has an early and widespread distribution during development. Although we did not observe any cerebral abnormality in patients with CF, we observed a slight delay in the maturation of several brain structures. We also observed different expression and localization of CFTR depending on the brain structure or the cell maturation stage. Our findings, along with a literature review on the neurological phenotypes of patients with CF, suggest that this gene may play previously unsuspected roles in neuronal maturation or function. © The Author(s) 2014.

  2. Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene

    PubMed Central

    Sosnay, Patrick R; Siklosi, Karen R; Van Goor, Fredrick; Kaniecki, Kyle; Yu, Haihui; Sharma, Neeraj; Ramalho, Anabela S; Amaral, Margarida D; Dorfman, Ruslan; Zielenski, Julian; Masica, David L; Karchin, Rachel; Millen, Linda; Thomas, Philip J; Patrinos, George P; Corey, Mary; Lewis, Michelle H; Rommens, Johanna M; Castellani, Carlo; Penland, Christopher M; Cutting, Garry R

    2013-01-01

    Allelic heterogeneity in disease-causing genes presents a substantial challenge to the translation of genomic variation to clinical practice. Few of the almost 2,000 variants in the cystic fibrosis transmembrane conductance regulator (CFTR) gene have empirical evidence that they cause cystic fibrosis. To address this gap, we collected both genotype and phenotype data for 39,696 cystic fibrosis patients in registries and clinics in North America and Europe. Among these patients, 159 CFTR variants had an allele frequency of ≥0.01%. These variants were evaluated for both clinical severity and functional consequence with 127 (80%) meeting both clinical and functional criteria consistent with disease. Assessment of disease penetrance in 2,188 fathers of cystic fibrosis patients enabled assignment of 12 of the remaining 32 variants as neutral while the other 20 variants remained indeterminate. This study illustrates that sourcing data directly from well-phenotyped subjects can address the gap in our ability to interpret clinically-relevant genomic variation. PMID:23974870

  3. Increased efficacy of VX-809 in different cellular systems results from an early stabilization effect of F508del-CFTR.

    PubMed

    Farinha, Carlos M; Sousa, Marisa; Canato, Sara; Schmidt, André; Uliyakina, Inna; Amaral, Margarida D

    2015-08-01

    Cystic fibrosis (CF), the most common recessive autosomal disease among Caucasians, is caused by mutations in the gene encoding the CF transmembrane conductance regulator (CFTR) protein. The most common mutation, F508del, leads to CFTR impaired plasma membrane trafficking. Therapies modulating CFTR basic defect are emerging, such as VX-809, a corrector of F508del-CFTR traffic which just succeeded in a Phase III clinical trial. We recently showed that VX-809 is additive to two other correctors (VRT-325 and compound 4a). Here, we aimed to determine whether the differential rescuing by these compounds results from cell-specific factors or rather from distinct effects at the early biogenesis and/or processing. The rescuing efficiencies of the above three correctors were first compared in different cellular models (primary respiratory cells, cystic fibrosis bronchial epithelial and baby hamster kidney [BHK] cell lines) by functional approaches: micro-Ussing chamber and iodide efflux. Next, biochemical methods (metabolic labeling, pulse-chase and immunoprecipitation) were used to determine their impact on CFTR biogenesis / processing. Functional analyses revealed that VX-809 has the greatest rescuing efficacy and that the relative efficiencies of the three compounds are essentially maintained in all three cellular models tested. Nevertheless, biochemical data show that VX-809 significantly stabilizes F508del-CFTR immature form, an effect that is not observed for C3 nor C4. VX-809 and C3 also significantly increase accumulation of immature CFTR. Our data suggest that VX-809 increases the stability of F508del-CFTR immature form at an early phase of its biogenesis, thus explaining its increased efficacy when inducing its rescue.

  4. Vx-770 potentiates CFTR function by promoting decoupling between the gating cycle and ATP hydrolysis cycle.

    PubMed

    Jih, Kang-Yang; Hwang, Tzyh-Chang

    2013-03-12

    Vx-770 (Ivacaftor), a Food and Drug Administration (FDA)-approved drug for clinical application to patients with cystic fibrosis (CF), shifts the paradigm from conventional symptomatic treatments to therapeutics directly tackling the root of the disease: functional defects of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel caused by pathogenic mutations. The underlying mechanism for the action of Vx-770 remains elusive partly because this compound not only increases the activity of wild-type (WT) channels whose gating is primarily controlled by ATP binding/hydrolysis, but also improves the function of G551D-CFTR, a disease-associated mutation that abolishes CFTR's responsiveness to ATP. Here we provide a unified theory to account for this dual effect of Vx-770. We found that Vx-770 enhances spontaneous, ATP-independent activity of WT-CFTR to a similar magnitude as its effects on G551D channels, a result essentially explaining Vx-770's effect on G551D-CFTR. Furthermore, Vx-770 increases the open time of WT-CFTR in an [ATP]-dependent manner. This distinct kinetic effect is accountable with a newly proposed CFTR gating model depicting an [ATP]-dependent "reentry" mechanism that allows CFTR shuffling among different open states by undergoing multiple rounds of ATP hydrolysis. We further examined the effect of Vx-770 on R352C-CFTR, a unique mutant that allows direct observation of hydrolysis-triggered gating events. Our data corroborate that Vx-770 increases the open time of WT-CFTR by stabilizing a posthydrolytic open state and thereby fosters decoupling between the gating cycle and ATP hydrolysis cycle. The current study also suggests that this unique mechanism of drug action can be further exploited to develop strategies that enhance the function of CFTR.

  5. Increased efficacy of VX-809 in different cellular systems results from an early stabilization effect of F508del-CFTR

    PubMed Central

    Farinha, Carlos M; Sousa, Marisa; Canato, Sara; Schmidt, André; Uliyakina, Inna; Amaral, Margarida D

    2015-01-01

    Cystic fibrosis (CF), the most common recessive autosomal disease among Caucasians, is caused by mutations in the gene encoding the CF transmembrane conductance regulator (CFTR) protein. The most common mutation, F508del, leads to CFTR impaired plasma membrane trafficking. Therapies modulating CFTR basic defect are emerging, such as VX-809, a corrector of F508del-CFTR traffic which just succeeded in a Phase III clinical trial. We recently showed that VX-809 is additive to two other correctors (VRT-325 and compound 4a). Here, we aimed to determine whether the differential rescuing by these compounds results from cell-specific factors or rather from distinct effects at the early biogenesis and/or processing. The rescuing efficiencies of the above three correctors were first compared in different cellular models (primary respiratory cells, cystic fibrosis bronchial epithelial and baby hamster kidney [BHK] cell lines) by functional approaches: micro-Ussing chamber and iodide efflux. Next, biochemical methods (metabolic labeling, pulse-chase and immunoprecipitation) were used to determine their impact on CFTR biogenesis / processing. Functional analyses revealed that VX-809 has the greatest rescuing efficacy and that the relative efficiencies of the three compounds are essentially maintained in all three cellular models tested. Nevertheless, biochemical data show that VX-809 significantly stabilizes F508del-CFTR immature form, an effect that is not observed for C3 nor C4. VX-809 and C3 also significantly increase accumulation of immature CFTR. Our data suggest that VX-809 increases the stability of F508del-CFTR immature form at an early phase of its biogenesis, thus explaining its increased efficacy when inducing its rescue. PMID:26171232

  6. Vx-770 potentiates CFTR function by promoting decoupling between the gating cycle and ATP hydrolysis cycle

    PubMed Central

    Jih, Kang-Yang; Hwang, Tzyh-Chang

    2013-01-01

    Vx-770 (Ivacaftor), a Food and Drug Administration (FDA)-approved drug for clinical application to patients with cystic fibrosis (CF), shifts the paradigm from conventional symptomatic treatments to therapeutics directly tackling the root of the disease: functional defects of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel caused by pathogenic mutations. The underlying mechanism for the action of Vx-770 remains elusive partly because this compound not only increases the activity of wild-type (WT) channels whose gating is primarily controlled by ATP binding/hydrolysis, but also improves the function of G551D-CFTR, a disease-associated mutation that abolishes CFTR’s responsiveness to ATP. Here we provide a unified theory to account for this dual effect of Vx-770. We found that Vx-770 enhances spontaneous, ATP-independent activity of WT-CFTR to a similar magnitude as its effects on G551D channels, a result essentially explaining Vx-770’s effect on G551D-CFTR. Furthermore, Vx-770 increases the open time of WT-CFTR in an [ATP]-dependent manner. This distinct kinetic effect is accountable with a newly proposed CFTR gating model depicting an [ATP]-dependent “reentry” mechanism that allows CFTR shuffling among different open states by undergoing multiple rounds of ATP hydrolysis. We further examined the effect of Vx-770 on R352C-CFTR, a unique mutant that allows direct observation of hydrolysis-triggered gating events. Our data corroborate that Vx-770 increases the open time of WT-CFTR by stabilizing a posthydrolytic open state and thereby fosters decoupling between the gating cycle and ATP hydrolysis cycle. The current study also suggests that this unique mechanism of drug action can be further exploited to develop strategies that enhance the function of CFTR. PMID:23440202

  7. Anchored PDE4 regulates chloride conductance in wild-type and ΔF508-CFTR human airway epithelia

    PubMed Central

    Blanchard, Elise; Zlock, Lorna; Lao, Anna; Mika, Delphine; Namkung, Wan; Xie, Moses; Scheitrum, Colleen; Gruenert, Dieter C.; Verkman, Alan S.; Finkbeiner, Walter E.; Conti, Marco; Richter, Wito

    2014-01-01

    Cystic fibrosis (CF) is caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) that impair its expression and/or chloride channel function. Here, we provide evidence that type 4 cyclic nucleotide phosphodiesterases (PDE4s) are critical regulators of the cAMP/PKA-dependent activation of CFTR in primary human bronchial epithelial cells. In non-CF cells, PDE4 inhibition increased CFTR activity under basal conditions (ΔISC 7.1 μA/cm2) and after isoproterenol stimulation (increased ΔISC from 13.9 to 21.0 μA/cm2) and slowed the return of stimulated CFTR activity to basal levels by >3-fold. In cells homozygous for ΔF508-CFTR, the most common mutation found in CF, PDE4 inhibition alone produced minimal channel activation. However, PDE4 inhibition strongly amplified the effects of CFTR correctors, drugs that increase expression and membrane localization of CFTR, and/or CFTR potentiators, drugs that increase channel gating, to reach ∼25% of the chloride conductance observed in non-CF cells. Biochemical studies indicate that PDE4s are anchored to CFTR and mediate a local regulation of channel function. Taken together, our results implicate PDE4 as an important determinant of CFTR activity in airway epithelia, and support the use of PDE4 inhibitors to potentiate the therapeutic benefits of CFTR correctors and potentiators.—Blanchard, E., Zlock, L., Lao, A., Mika, D., Namkung, W., Xie, M., Scheitrum, C., Gruenert, D.C., Verkman, A.S., Finkbeiner, W.E., Conti, M., Richter, W. Anchored PDE4 regulates chloride conductance in wild type and ΔF508-CFTR human airway epithelia. PMID:24200884

  8. Neutrophil Membrane Cholesterol Content is a Key Factor in Cystic Fibrosis Lung Disease.

    PubMed

    White, Michelle M; Geraghty, Patrick; Hayes, Elaine; Cox, Stephen; Leitch, William; Alfawaz, Bader; Lavelle, Gillian M; McElvaney, Oliver J; Flannery, Ryan; Keenan, Joanne; Meleady, Paula; Henry, Michael; Clynes, Martin; Gunaratnam, Cedric; McElvaney, Noel G; Reeves, Emer P

    2017-09-01

    Identification of mechanisms promoting neutrophil trafficking to the lungs of patients with cystic fibrosis (CF) is a challenge for next generation therapeutics. Cholesterol, a structural component of neutrophil plasma membranes influences cell adhesion, a key step in transmigration. The effect of chronic inflammation on neutrophil membrane cholesterol content in patients with CF (PWCF) remains unclear. To address this we examined neutrophils of PWCF to evaluate the cause and consequence of altered membrane cholesterol and identified the effects of lung transplantation and ion channel potentiator therapy on the cellular mechanisms responsible for perturbed membrane cholesterol and increased cell adhesion. PWCF homozygous for the ΔF508 mutation or heterozygous for the G551D mutation were recruited (n=48). Membrane protein expression was investigated by mass spectrometry. The effect of lung transplantation or ivacaftor therapy was assessed by ELISAs, and calcium fluorometric and μ-calpain assays. Membranes of CF neutrophils contain less cholesterol, yet increased integrin CD11b expression, and respond to inflammatory induced endoplasmic reticulum (ER) stress by activating μ-calpain. In vivo and in vitro, increased μ-calpain activity resulted in proteolysis of the membrane cholesterol trafficking protein caveolin-1. The critical role of caveolin-1 for adequate membrane cholesterol content was confirmed in caveolin-1 knock-out mice. Lung transplant therapy or treatment of PWCF with ivacaftor, reduced levels of circulating inflammatory mediators and actuated increased caveolin-1 and membrane cholesterol, with concurrent normalized neutrophil adhesion. Results demonstrate an auxiliary benefit of lung transplant and potentiator therapy, evident by a reduction in circulating inflammation and controlled neutrophil adhesion. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Bowel ultrasound imaging in patients with cystic fibrosis: Relationship with clinical symptoms and CFTR genotype.

    PubMed

    Fraquelli, Mirella; Baccarin, Alessandra; Corti, Fabiola; Conti, Clara Benedetta; Russo, Maria Chiara; Della Valle, Serena; Pozzi, Roberta; Cressoni, Massimo; Conte, Dario; Colombo, Carla

    2016-03-01

    Ultrasound imaging is used to assess bowel abnormalities in gastrointestinal diseases. We aimed to assess the rate of predefined bowel ultrasound signs and their relationship with gastrointestinal symptoms and the cystic fibrosis transmembrane conductance regulator (CFTR) genotype in cystic fibrosis patients in regular follow-up. Prospective study of 70 consecutive patients with cystic fibrosis and 45 controls who underwent abdominal ultrasound; pertinent findings were related to gastrointestinal symptoms and, in cystic fibrosis patients, to pancreatic status, malabsorption degree, lipase intake, CFTR genotype (classified as severe or mild against functional class of CFTR mutations). 96% patients showed at least one abnormal bowel ultrasound sign. Most frequent signs were lymph node enlargement (64%), bowel loop dilatation (55%), thick corpuscular intraluminal content (49%), bowel wall hypervascularization (26%), thickened bowel wall (22%) and intussusception (17%). Patients with recurrent abdominal pain showed more bowel wall hypervascularization than patients without recurrent pain (47% vs. 19%, respectively; p = 0.02) and intussusception (58% vs. 17%, respectively; p < 0.01). Genotype was not associated to specific bowel ultrasound signs. Patients with bowel loop intussusception showed greater lipase intake than those without intussusception (8.118 ± 2.083 vs. 5.994 ± 4.187, respectively; p < 0.01). Cystic fibrosis patients present a higher rate of bowel ultrasound abnormalities than controls. Bowel ultrasound abnormalities are associated with abdominal symptoms. Copyright © 2015 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  10. Cystic Fibrosis Diagnosis and Newborn Screening.

    PubMed

    Rosenfeld, Margaret; Sontag, Marci K; Ren, Clement L

    2016-08-01

    The diagnosis of cystic fibrosis (CF) has evolved over the past decade as newborn screening has become universal in the United States and elsewhere. The heterogeneity of phenotypes associated with CF transmembrane conductance regulator (CFTR) dysfunction and mutations in the CFTR gene has become clearer, ranging from classic pancreatic-insufficient CF to manifestations in only 1 organ system to indeterminate diagnoses identified by newborn screening. The tools available for diagnosis have also expanded. This article reviews the newest diagnostic criteria for CF, newborn screening, prenatal screening and diagnosis, and indeterminate diagnoses in newborn-screened infants and symptomatic adults. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Molecular Diagnosis of Cystic Fibrosis.

    PubMed

    Deignan, Joshua L; Grody, Wayne W

    2016-01-01

    This unit describes a recommended approach to identifying causal genetic variants in an individual suspected of having cystic fibrosis. An introduction to the genetics and clinical presentation of cystic fibrosis is initially presented, followed by a description of the two main strategies used in the molecular diagnosis of cystic fibrosis: (1) an initial targeted variant panel used to detect only the most common cystic fibrosis-causing variants in the CFTR gene, and (2) sequencing of the entire coding region of the CFTR gene to detect additional rare causal CFTR variants. Finally, the unit concludes with a discussion regarding the analytic and clinical validity of these approaches. Copyright © 2016 John Wiley & Sons, Inc.

  12. Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lishanski, A.; Ostrander, E.A.; Rine, J.

    1994-03-29

    An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS proteinmore » bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.« less

  13. CFTR and/or pancreatitis susceptibility genes mutations as risk factors of pancreatitis in cystic fibrosis patients?

    PubMed

    Gaitch, Natacha; Hubert, Dominique; Gameiro, Christine; Burgel, Pierre-Régis; Houriez, Florence; Martinez, Brigitte; Honoré, Isabelle; Chapron, Jeanne; Kanaan, Reem; Dusser, Daniel; Girodon, Emmanuelle; Bienvenu, Thierry

    2016-01-01

    Currently, factors that promote the occurrence of pancreatitis episodes in patients affected with cystic fibrosis (CF) and pancreatic sufficiency (PS) are largely unknown. Six genes involved in pancreatitis or in ion transport into the pancreatic duct were investigated by next generation sequencing in 59 adult CF-PS patients with two identified CF mutations. Data on predisposing environmental factors were also recorded. 19 experienced at least one episode of acute pancreatitis (AP) (AP+) and 40 patients did not (AP-). No influence of environmental factor was evidenced. No specific CFTR genotype was found predictive of pancreatitis. Patients sharing the same CFTR genotype may or may not experience AP episodes. Frequent and rare missense variants were found in 78.9% patients in group AP+ and 67.5% in group AP- but a few of them were pathogenic. AP or recurrent AP (RAP) is a frequent complication in our series of adult CF-PS patients. The majority of mild CFTR mutations found in group AP+ were located in the first transmembrane region. No clear other genetic factor could be found predictive of AP/RAP. Further experiments in large homogenous cohorts of CF-PS patients, including whole genome sequencing, may identify genetic predisposing factors to pancreatitis. Copyright © 2016 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  14. Ordering Molecular Genetic Tests and Reporting Results

    PubMed Central

    Lubin, Ira M.; Caggana, Michele; Constantin, Carolyn; Gross, Susan J.; Lyon, Elaine; Pagon, Roberta A.; Trotter, Tracy L.; Wilson, Jean Amos; McGovern, Margaret M.

    2008-01-01

    Previous studies have suggested that patient care may be compromised as a consequence of poor communication between clinicians and laboratory professionals in cases in which molecular genetic test results are reported. To understand better the contributing factors to such compromised care, we investigated both pre- and postanalytical processes using cystic fibrosis mutation analysis as our model. We found that although the majority of test requisition forms requested patient/family information that was necessary for the proper interpretation of test results, in many cases, these data were not provided by the individuals filling out the forms. We found instances in which result reports for simulated diagnostic testing described individuals as carriers where only a single mutation was found with no comment pertaining to a diagnosis of cystic fibrosis. Similarly, reports based on simulated scenarios for carrier testing were problematic when no mutations were identified, and the patient's race/ethnicity and family history were not discussed in reference to residual risk of disease. Remarkably, a pilot survey of obstetrician-gynecologists revealed that office staff, including secretaries, often helped order genetic tests and reported test results to patients, raising questions about what efforts are undertaken to ensure personnel competency. These findings are reviewed in light of what efforts should be taken to improve the quality of test-ordering and result-reporting practices. PMID:18669879

  15. Ovarian mature cystic teratoma with fistula formation into the rectum: a case report.

    PubMed

    Kizaki, Yuichiro; Nagai, Tomonori; Ohara, Ken; Gomi, Yosuke; Akahori, Taichi; Ono, Yoshihisa; Matsunaga, Shigetaka; Takai, Yasushi; Saito, Masahiro; Baba, Kazunori; Seki, Hiroyuki

    2016-01-01

    While ovarian mature cystic teratomas are benign ovarian germ-cell tumors and the most common type of all ovarian tumors, the formation of fistulas into surrounding organs such as the bladder and the intestinal tract is extremely rare. This report documents a case of ovarian mature cystic teratoma with a rectal fistula, thought to be caused by local inflammation. A pelvic mass was diagnosed as an ovarian mature cystic teratoma of approximately 10 cm in diameter on transvaginal ultrasound and magnetic resonance examinations. Endoscopic examination of the lower gastrointestinal tract to investigate diarrhea revealed an ulcerative lesion with hair in the rectal wall adjacent to the ovarian cyst, and formation of a fistula from the ovarian teratoma into the rectum was suspected. Laparotomy revealed extensive inflammatory adhesions between a left ovarian tumor and the rectum. Left salpingo-oophorectomy and upper anterior resection of the rectum were performed. The final pathological diagnosis was ovarian mature cystic teratoma with no malignant findings, together with severe rectal inflammation and fistula formation with no structural disorders such as diverticulitis of the colon or malignant signs. The formation of fistulas and invasion into the neighboring organs are extremely rare complications for ovarian mature cystic teratomas. The invasion of malignant cells into neighboring organs due to malignant transformation of the tumor is reported as the cause of fistula formation into the neighboring organs. A review of 17 cases including the present case revealed that fistula formation due to malignant transformation comprised only 4 cases (23.5 %), with inflammation as the actual cause in the majority of cases (13 cases, 76.5 %). Although malignancy is the first consideration when fistula formation is observed between ovarian tumors and surrounding organs, in mature cystic teratoma, local inflammation is more likely than malignant transformation.

  16. Cholesterol modulates CFTR confinement in the plasma membrane of primary epithelial cells.

    PubMed

    Abu-Arish, Asmahan; Pandzic, Elvis; Goepp, Julie; Matthes, Elizabeth; Hanrahan, John W; Wiseman, Paul W

    2015-07-07

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a plasma-membrane anion channel that, when mutated, causes the disease cystic fibrosis. Although CFTR has been detected in a detergent-resistant membrane fraction prepared from airway epithelial cells, suggesting that it may partition into cholesterol-rich membrane microdomains (lipid rafts), its compartmentalization has not been demonstrated in intact cells and the influence of microdomains on CFTR lateral mobility is unknown. We used live-cell imaging, spatial image correlation spectroscopy, and k-space image correlation spectroscopy to examine the aggregation state of CFTR and its dynamics both within and outside microdomains in the plasma membrane of primary human bronchial epithelial cells. These studies were also performed during treatments that augment or deplete membrane cholesterol. We found two populations of CFTR molecules that were distinguishable based on their dynamics at the cell surface. One population showed confinement and had slow dynamics that were highly cholesterol dependent. The other, more abundant population was less confined and diffused more rapidly. Treatments that deplete the membrane of cholesterol caused the confined fraction and average number of CFTR molecules per cluster to decrease. Elevating cholesterol had the opposite effect, increasing channel aggregation and the fraction of channels displaying confinement, consistent with CFTR recruitment into cholesterol-rich microdomains with dimensions below the optical resolution limit. Viral infection caused the nanoscale microdomains to fuse into large platforms and reduced CFTR mobility. To our knowledge, these results provide the first biophysical evidence for multiple CFTR populations and have implications for regulation of their surface expression and channel function. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. Dysfunction of intraflagellar transport-A causes hyperphagia-induced obesity and metabolic syndrome.

    PubMed

    Jacobs, Damon T; Silva, Luciane M; Allard, Bailey A; Schonfeld, Michael P; Chatterjee, Anindita; Talbott, George C; Beier, David R; Tran, Pamela V

    2016-07-01

    Primary cilia extend from the plasma membrane of most vertebrate cells and mediate signaling pathways. Ciliary dysfunction underlies ciliopathies, which are genetic syndromes that manifest multiple clinical features, including renal cystic disease and obesity. THM1 (also termed TTC21B or IFT139) encodes a component of the intraflagellar transport-A complex and mutations in THM1 have been identified in 5% of individuals with ciliopathies. Consistent with this, deletion of murine Thm1 during late embryonic development results in cystic kidney disease. Here, we report that deletion of murine Thm1 during adulthood results in obesity, diabetes, hypertension and fatty liver disease, with gender differences in susceptibility to weight gain and metabolic dysfunction. Pair-feeding of Thm1 conditional knock-out mice relative to control littermates prevented the obesity and related disorders, indicating that hyperphagia caused the obese phenotype. Thm1 ablation resulted in increased localization of adenylyl cyclase III in primary cilia that were shortened, with bulbous distal tips on neurons of the hypothalamic arcuate nucleus, an integrative center for signals that regulate feeding and activity. In pre-obese Thm1 conditional knock-out mice, expression of anorexogenic pro-opiomelanocortin (Pomc) was decreased by 50% in the arcuate nucleus, which likely caused the hyperphagia. Fasting of Thm1 conditional knock-out mice did not alter Pomc nor orexogenic agouti-related neuropeptide (Agrp) expression, suggesting impaired sensing of changes in peripheral signals. Together, these data indicate that the Thm1-mutant ciliary defect diminishes sensitivity to feeding signals, which alters appetite regulation and leads to hyperphagia, obesity and metabolic disease. © 2016. Published by The Company of Biologists Ltd.

  18. Characterization of a Case of Pigmentary Retinopathy in Sanfilippo Syndrome Type IIIA Associated with Compound Heterozygous Mutations in the SGSH Gene.

    PubMed

    Wilkin, Justin; Kerr, Natalie C; Byrd, Kathryn W; Ward, Jewell C; Iannaccone, Alessandro

    2016-06-01

    To report longitudinal phenotypic findings in a patient with Sanfilippo syndrome type IIIA, harboring SGSH mutations, one of which is novel. Heparan-N-sulfatidase enzyme function testing in skin fibroblasts and white blood cells and SGSH gene sequencing were obtained. Clinical office examinations, examinations under anesthesia, electroretinogram, spectral domain optical coherence tomography (SD-OCT), and fundus photography were performed over a 5-year period. Fundus examination revealed a progressive breadcrumb-like pigmentary retinopathy with perifoveal pigmentary involvement. SD-OCT showed loss of normal neuroretinal lamination and cystic macular changes responsive to treatment with carbonic anhydrase inhibitors. Electroretinography exhibited complex characteristics indicative of a generalized retinal rod > cone dysfunction with significant ON > OFF postreceptoral response compromise. Sequencing revealed compound heterozygous mutations in the SGSH gene, the novel c.88G > C (p.A30P) change and a second, previously reported one (c.734G > A, p.R245H). We have identified ocular features of a patient with Sanfilippo syndrome type IIIA harboring a novel SGHS mutation that were not previously known to occur in this disease - namely, a progressive retinopathy with distinctive features, cystic macular changes responsive to carbonic anhydrase inhibitors, and complex electroretinographic abnormalities consistent with postreceptoral dysfunction. SD-OCT imaging revealed retinal lamination changes consistent with previously reported histologic studies. Both the SD-OCT and the electroretinogram changes appear attributable to intraretinal deposition of heparan sulfate.

  19. The Spectrum of CFTR Variants in Nonwhite Cystic Fibrosis Patients: Implications for Molecular Diagnostic Testing.

    PubMed

    Schrijver, Iris; Pique, Lynn; Graham, Steve; Pearl, Michelle; Cherry, Athena; Kharrazi, Martin

    2016-01-01

    Despite the implementation of cystic fibrosis (CF) newborn screening programs across the United States, the identification of CFTR gene variants in nonwhite populations compared with whites remains suboptimal. Our objective was to establish the spectrum of CFTR variants and their frequencies in CF patients in the United States with African, Native American, Asian, East Indian, or Middle Eastern backgrounds. By using direct DNA sequencing, we identified two CFTR variants in 89 of 140 affected nonwhite individuals with uncharacterized genotypes. Seven variants were novel. Multiplex ligation-dependent probe amplification detected 14 rearrangements in the remaining 51 patients, 6 of which were novel. Deletions and duplications accounted for 17% of unidentified alleles. A cross-sectional analysis of genotyping data from the CF Foundation Patient Registry was performed, comparing 3496 nonwhite patients with 22,206 white CF patients. Patients of Hispanic, black, or Asian ancestry were less likely to have two identified CFTR variants (P < 0.0001 for Hispanics and blacks, P = 0.003 for Asians), and more likely to carry no mutations on the commonly used 23 mutation carrier screening panel (P < 0.0001). We analyzed the mutations recorded for each ancestry and summarized the most frequent ones. This research could facilitate equity in mutation detection between white and nonwhite or mixed-ethnicity CF patients, enabling an earlier diagnosis improving their quality of life. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  20. Instability of the insertional mutation in CftrTgH(neoim)Hgu cystic fibrosis mouse model

    PubMed Central

    Charizopoulou, Nikoletta; Jansen, Silke; Dorsch, Martina; Stanke, Frauke; Dorin, Julia R; Hedrich, Hans-Jürgen; Tümmler, Burkhard

    2004-01-01

    Background A major boost to the cystic fibrosis disease research was given by the generation of various mouse models using gene targeting in embryonal stem cells. Moreover, the introduction of the same mutation on different inbred strains generating congenic strains facilitated the search for modifier genes. From the original CftrTgH(neoim)Hgu CF mouse model we have generated using strict brother × sister mating two inbred CftrTgH(neoim)Hgu mouse lines (CF/1 and CF/3). Thereafter, the insertional mutation was introgressed from CF/3 into three inbred backgrounds (C57BL/6, BALB/c, DBA/2J) generating congenic animals. In every backcross cycle germline transmission of the insertional mutation was monitored by direct probing the insertion via Southern RFLP. In order to bypass this time consuming procedure we devised an alternative PCR based protocol whereby mouse strains are differentiated at the Cftr locus by Cftr intragenic microsatellite genotypes that are tightly linked to the disrupted locus. Results Using this method we were able to identify animals carrying the insertional mutation based upon the differential haplotypic backgrounds of the three inbred strains and the mutant CftrTgH(neoim)Hgu at the Cftr locus. Moreover, this method facilitated the identification of the precise vector excision from the disrupted Cftr locus in two out of 57 typed animals. This reversion to wild type status took place without any loss of sequence revealing the instability of insertional mutations during the production of congenic animals. Conclusions We present intragenic microsatellite markers as a tool for fast and efficient identification of the introgressed locus of interest in the recipient strain during congenic animal breeding. Moreover, the same genotyping method allowed the identification of a vector excision event, posing questions on the stability of insertional mutations in mice. PMID:15102331

  1. Cystic Echinococcosis

    PubMed Central

    Brunetti, Enrico; McCloskey, Cindy

    2015-01-01

    Echinococcosis is one of the 17 neglected tropical diseases (NTDs) recognized by the World Health Organization. The two major species of medical importance are Echinococcus granulosus and Echinococcus multilocularis. E. granulosus affects over 1 million people and is responsible for over $3 billion in expenses every year. In this minireview, we discuss aspects of the epidemiology, clinical manifestations, and diagnosis of cystic echinococcosis or cystic hydatid disease caused by E. granulosus. PMID:26677245

  2. SERS detection of the biomarker hydrogen cyanide from Pseudomonas aeruginosa cultures isolated from cystic fibrosis patients

    NASA Astrophysics Data System (ADS)

    Lauridsen, Rikke Kragh; Sommer, Lea M.; Johansen, Helle Krogh; Rindzevicius, Tomas; Molin, Søren; Jelsbak, Lars; Engelsen, Søren Balling; Boisen, Anja

    2017-03-01

    Pseudomonas aeruginosa is the primary cause of chronic airway infections in cystic fibrosis (CF) patients. Persistent infections are seen from the first P. aeruginosa culture in about 75% of young CF patients, and it is important to discover new ways to detect P. aeruginosa at an earlier stage. The P. aeruginosa biomarker hydrogen cyanide (HCN) contains a triple bond, which is utilized in this study because of the resulting characteristic C≡N peak at 2135 cm-1 in a Raman spectrum. The Raman signal was enhanced by surface-enhanced Raman spectroscopy (SERS) on a Au-coated SERS substrate. After long-term infection, a mutation in the patho-adaptive lasR gene can alter the expression of HCN, which is why it is sometimes not possible to detect HCN in the breath of chronically infected patients. Four P. aeruginosa reference strains and 12 clinical P. aeruginosa strains isolated from CF children were evaluated, and HCN was clearly detected from overnight cultures of all wild type-like isolates and half of the later isolates from the same patients. The clinical impact could be that P. aeruginosa infections could be detected at an earlier stage, because daily breath sampling with an immediate output could be possible with a point-of-care SERS device.

  3. Non-invasive prenatal diagnosis (NIPD) of cystic fibrosis: an optimized protocol using MEMO fluorescent PCR to detect the p.Phe508del mutation.

    PubMed

    Guissart, C; Dubucs, C; Raynal, C; Girardet, A; Tran Mau Them, F; Debant, V; Rouzier, C; Boureau-Wirth, A; Haquet, E; Puechberty, J; Bieth, E; Dupin Deguine, D; Khau Van Kien, P; Brechard, M P; Pritchard, V; Koenig, M; Claustres, M; Vincent, M C

    2017-03-01

    Analysis of cell-free foetal DNA (cff-DNA) in maternal plasma is very promising for early diagnosis of monogenic diseases; in particular, cystic fibrosis (CF). However, NIPD of single-gene disorders has been limited by the availability of suitable technical platforms and the need to set up patient or disease-specific custom-made approaches. To make research applications more readily accessible to the clinic, we offer a simple assay combining two independent methods to determine the presence or absence of paternally inherited foetal allele p.Phe508del (the most frequent mutation in CF patients worldwide). The first method detects the presence or absence of a p.Phe508del allele by Mutant Enrichment with 3'-Modified Oligonucleotide PCR coupled to Fragment Length Analysis (MEMO-PCR-FLA). The second method detects the p.Phe508del allele with classical Multiplex Fluorescent PCR including five intragenic and extragenic STR markers of the CFTR locus and a specific SRY sequence. We collected 24 plasma samples from 23 women carrying foetuses at risk for CF and tested each sample using both methods. Our new procedures were successfully applied to 10 couples where fathers carried the p.Phe508del mutation and mothers were carrying a different mutation in the CFTR gene. These simple tests provided clear positive or negative results from the maternal plasma of the pregnant women. We confirmed the presence of cff-DNA in the studied samples by the identification of a tri-allelic DNA profile using a miniSTR kit. All results were correlated with chorionic villus sampling or amniocentesis analyses. This NIPD approach, easily set up in any clinical laboratory where prenatal diagnosis is routinely performed, offers many advantages over current methods: it is simple, rapid, and cost-effective. It opens up the possibility for testing a large number of couples with offspring at risk for CF. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  4. A novel treatment of cystic fibrosis acting on-target: cysteamine plus epigallocatechin gallate for the autophagy-dependent rescue of class II-mutated CFTR.

    PubMed

    Tosco, A; De Gregorio, F; Esposito, S; De Stefano, D; Sana, I; Ferrari, E; Sepe, A; Salvadori, L; Buonpensiero, P; Di Pasqua, A; Grassia, R; Leone, C A; Guido, S; De Rosa, G; Lusa, S; Bona, G; Stoll, G; Maiuri, M C; Mehta, A; Kroemer, G; Maiuri, L; Raia, V

    2016-08-01

    We previously reported that the combination of two safe proteostasis regulators, cysteamine and epigallocatechin gallate (EGCG), can be used to improve deficient expression of the cystic fibrosis transmembrane conductance regulator (CFTR) in patients homozygous for the CFTR Phe508del mutation. Here we provide the proof-of-concept that this combination treatment restored CFTR function and reduced lung inflammation (P<0.001) in Phe508del/Phe508del or Phe508del/null-Cftr (but not in Cftr-null mice), provided that such mice were autophagy-competent. Primary nasal cells from patients bearing different class II CFTR mutations, either in homozygous or compound heterozygous form, responded to the treatment in vitro. We assessed individual responses to cysteamine plus EGCG in a single-centre, open-label phase-2 trial. The combination treatment decreased sweat chloride from baseline, increased both CFTR protein and function in nasal cells, restored autophagy in such cells, decreased CXCL8 and TNF-α in the sputum, and tended to improve respiratory function. These positive effects were particularly strong in patients carrying Phe508del CFTR mutations in homozygosity or heterozygosity. However, a fraction of patients bearing other CFTR mutations failed to respond to therapy. Importantly, the same patients whose primary nasal brushed cells did not respond to cysteamine plus EGCG in vitro also exhibited deficient therapeutic responses in vivo. Altogether, these results suggest that the combination treatment of cysteamine plus EGCG acts 'on-target' because it can only rescue CFTR function when autophagy is functional (in mice) and improves CFTR function when a rescuable protein is expressed (in mice and men). These results should spur the further clinical development of the combination treatment.

  5. A novel treatment of cystic fibrosis acting on-target: cysteamine plus epigallocatechin gallate for the autophagy-dependent rescue of class II-mutated CFTR

    PubMed Central

    Tosco, A; De Gregorio, F; Esposito, S; De Stefano, D; Sana, I; Ferrari, E; Sepe, A; Salvadori, L; Buonpensiero, P; Di Pasqua, A; Grassia, R; Leone, C A; Guido, S; De Rosa, G; Lusa, S; Bona, G; Stoll, G; Maiuri, M C; Mehta, A; Kroemer, G; Maiuri, L; Raia, V

    2016-01-01

    We previously reported that the combination of two safe proteostasis regulators, cysteamine and epigallocatechin gallate (EGCG), can be used to improve deficient expression of the cystic fibrosis transmembrane conductance regulator (CFTR) in patients homozygous for the CFTR Phe508del mutation. Here we provide the proof-of-concept that this combination treatment restored CFTR function and reduced lung inflammation (P<0.001) in Phe508del/Phe508del or Phe508del/null-Cftr (but not in Cftr-null mice), provided that such mice were autophagy-competent. Primary nasal cells from patients bearing different class II CFTR mutations, either in homozygous or compound heterozygous form, responded to the treatment in vitro. We assessed individual responses to cysteamine plus EGCG in a single-centre, open-label phase-2 trial. The combination treatment decreased sweat chloride from baseline, increased both CFTR protein and function in nasal cells, restored autophagy in such cells, decreased CXCL8 and TNF-α in the sputum, and tended to improve respiratory function. These positive effects were particularly strong in patients carrying Phe508del CFTR mutations in homozygosity or heterozygosity. However, a fraction of patients bearing other CFTR mutations failed to respond to therapy. Importantly, the same patients whose primary nasal brushed cells did not respond to cysteamine plus EGCG in vitro also exhibited deficient therapeutic responses in vivo. Altogether, these results suggest that the combination treatment of cysteamine plus EGCG acts ‘on-target' because it can only rescue CFTR function when autophagy is functional (in mice) and improves CFTR function when a rescuable protein is expressed (in mice and men). These results should spur the further clinical development of the combination treatment. PMID:27035618

  6. Cystic fibrosis gene modifier SLC26A9 modulates airway response to CFTR-directed therapeutics.

    PubMed

    Strug, Lisa J; Gonska, Tanja; He, Gengming; Keenan, Katherine; Ip, Wan; Boëlle, Pierre-Yves; Lin, Fan; Panjwani, Naim; Gong, Jiafen; Li, Weili; Soave, David; Xiao, Bowei; Tullis, Elizabeth; Rabin, Harvey; Parkins, Michael D; Price, April; Zuberbuhler, Peter C; Corvol, Harriet; Ratjen, Felix; Sun, Lei; Bear, Christine E; Rommens, Johanna M

    2016-10-15

    Cystic fibrosis is realizing the promise of personalized medicine. Recent advances in drug development that target the causal CFTR directly result in lung function improvement, but variability in response is demanding better prediction of outcomes to improve management decisions. The genetic modifier SLC26A9 contributes to disease severity in the CF pancreas and intestine at birth and here we assess its relationship with disease severity and therapeutic response in the airways. SLC26A9 association with lung disease was assessed in individuals from the Canadian and French CF Gene Modifier consortia with CFTR-gating mutations and in those homozygous for the common Phe508del mutation. Variability in response to a CFTR-directed therapy attributed to SLC26A9 genotype was assessed in Canadian patients with gating mutations. A primary airway model system determined if SLC26A9 shows modification of Phe508del CFTR function upon treatment with a CFTR corrector. In those with gating mutations that retain cell surface-localized CFTR we show that SLC26A9 modifies lung function while this is not the case in individuals homozygous for Phe508del where cell surface expression is lacking. Treatment response to ivacaftor, which aims to improve CFTR-channel opening probability in patients with gating mutations, shows substantial variability in response, 28% of which can be explained by rs7512462 in SLC26A9 (P = 0.0006). When homozygous Phe508del primary bronchial cells are treated to restore surface CFTR, SLC26A9 likewise modifies treatment response (P = 0.02). Our findings indicate that SLC26A9 airway modification requires CFTR at the cell surface, and that a common variant in SLC26A9 may predict response to CFTR-directed therapeutics.

  7. Use of wavelet-packet transforms to develop an engineering model for multifractal characterization of mutation dynamics in pathological and nonpathological gene sequences

    NASA Astrophysics Data System (ADS)

    Walker, David Lee

    1999-12-01

    This study uses dynamical analysis to examine in a quantitative fashion the information coding mechanism in DNA sequences. This exceeds the simple dichotomy of either modeling the mechanism by comparing DNA sequence walks as Fractal Brownian Motion (fbm) processes. The 2-D mappings of the DNA sequences for this research are from Iterated Function System (IFS) (Also known as the ``Chaos Game Representation'' (CGR)) mappings of the DNA sequences. This technique converts a 1-D sequence into a 2-D representation that preserves subsequence structure and provides a visual representation. The second step of this analysis involves the application of Wavelet Packet Transforms, a recently developed technique from the field of signal processing. A multi-fractal model is built by using wavelet transforms to estimate the Hurst exponent, H. The Hurst exponent is a non-parametric measurement of the dynamism of a system. This procedure is used to evaluate gene- coding events in the DNA sequence of cystic fibrosis mutations. The H exponent is calculated for various mutation sites in this gene. The results of this study indicate the presence of anti-persistent, random walks and persistent ``sub-periods'' in the sequence. This indicates the hypothesis of a multi-fractal model of DNA information encoding warrants further consideration. This work examines the model's behavior in both pathological (mutations) and non-pathological (healthy) base pair sequences of the cystic fibrosis gene. These mutations both natural and synthetic were introduced by computer manipulation of the original base pair text files. The results show that disease severity and system ``information dynamics'' correlate. These results have implications for genetic engineering as well as in mathematical biology. They suggest that there is scope for more multi-fractal models to be developed.

  8. Prenatal diagnosis in a cystic fibrosis family: a combined molecular strategy for a precise diagnosis.

    PubMed

    Chávez-Saldaña, Margarita; García-Cavazos, Ricardo; Vigueras, Rosa María; Orozco, Lorena

    2011-01-01

    The high genetic heterogeneity in populations with a wide spectrum of mutations in the CF transmembrane conductance regulator gene (CFTR), makes the detection of mutations a very hard and difficult task, thereby limiting the accurate diagnosis of the disease, mainly in patients with uncharacterized mutations. Molecular strategies, like targeted identification of the most frequent CFTR mutations in Mexican population combined with linkage analysis using markers, is very useful for carrier detection and for prenatal diagnosis in affected families with CF. In this paper we show that the combination of methodologies was a crucial alternative to reach a precise prenatal CF diagnosis. We documented CF diagnosis in a 14th-week fetus combining the screening of the most common mutations in Mexican population with linkage analysis of two extragenic polymorphisms (XV2C/TaqI and KM19/PstI). We determined that the fetus inherited the PG542X mutation from its mother and an unknown mutation from its father through the chromosomal phases analysis.

  9. Vitamin A supplementation for cystic fibrosis.

    PubMed

    Bonifant, Catherine M; Shevill, Elizabeth; Chang, Anne B

    2014-05-14

    People with cystic fibrosis and pancreatic insufficiency are at risk of fat soluble vitamin deficiency as these vitamins (A, D, E and K) are co-absorbed with fat. Thus, some cystic fibrosis centres routinely administer these vitamins as supplements but the centres vary in their approach of addressing the possible development of deficiencies in these vitamins. Vitamin A deficiency causes predominantly eye and skin problems while supplementation of vitamin A to excessive levels may cause harm to the respiratory and skeletal systems in children. Thus a systematic review on vitamin A supplementation in people with cystic fibrosis would help guide clinical practice. To determine if vitamin A supplementation in children and adults with cystic fibrosis:1. reduces the frequency of vitamin A deficiency disorders;2. improves general and respiratory health;3. increases the frequency of vitamin A toxicity. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Trials Register which comprises of references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search of the Group's Cystic Fibrosis Trials Register: 07 April 2014. All randomised or quasi-randomised controlled trials comparing all preparations of oral vitamin A used as a supplement compared to either no supplementation (or placebo) at any dose and for any duration, in children or adults with cystic fibrosis (defined by sweat tests or genetic testing) with and without pancreatic insufficiency. No relevant studies for inclusion were identified in the search. No studies were included in this review. As there were no randomised or quasi-randomised controlled trials identified, we cannot draw any conclusions on the benefits (or otherwise) of regular administration of vitamin A in people with cystic fibrosis. Until further data are available, country or region specific guidelines on the use of vitamin A in people with cystic fibrosis should be followed.

  10. An imbalance between apoptosis and proliferation contributes to follicular persistence in polycystic ovaries in rats

    PubMed Central

    Salvetti, Natalia R; Panzani, Carolina G; Gimeno, Eduardo J; Neme, Leandro G; Alfaro, Natalia S; Ortega, Hugo H

    2009-01-01

    Background Cystic ovarian disease is an important cause of infertility that affects bovine, ovine, caprine and porcine species and even human beings. Alterations in the ovarian micro-environment of females with follicular cysts could alter the normal processes of proliferation and programmed cell death in ovarian cells. Thus, our objective was to evaluate apoptosis and proliferation in ovarian cystic follicles in rats in order to investigate the cause of cystic follicle formation and persistence. Methods We compared the number of in situ apoptotic cells by TUNEL assay, expression of active caspase-3 and members of Bcl-2 family by immunohistochemistry; and cell proliferation by the expression of the proliferation markers: PCNA and Ki-67. Results The proliferation index was low in granulosa of tertiary and cystic follicles of light exposed rats when compared with tertiary follicles of control animals, while in theca interna only cystic follicles presented low proliferation index when compared with tertiary follicles (p < 0.05). The granulosa of cysts exhibited a similar cell DNA fragmentation to early atretic follicles. In the granulosa and theca interna, active caspase-3 shown similar immunostaining levels in tertiary and cystic follicles (p < 0.05). The granulosa cells presented high expression of Bcl-2, Bcl-xL and Bcl-w in the tertiary and cystic follicles with diminishing intensity in the atretic follicles, except with Bcl-w where the intensity was maintained in the atretic follicles (p < 0.05). The expression of Bax was weak in the healthy and cystic follicles. In the theca interna, Bcl-2 expression was the same as the pattern found in the granulosa; no differences were found between tertiary and cystic follicles from both groups for Bcl-xL and Bcl-w. The expression of Bax in this layer was higher in the tertiary follicles of the treated animals (p < 0.05) while the values for cystic follicles were similar to those in the tertiary follicles of controls. The theca externa showed low expression of the pro and anti-apoptotic proteins. Conclusion These results show that the combination of weak proliferation indices and low apoptosis observed in follicular cysts, could explain the cause of the slow growth of cystic follicles and the maintenance of a static condition without degeneration, which leads to their persistence. These alterations may be due to structural and functional modifications that take place in these cells and could be related to hormonal changes in animals with this condition. PMID:19570211

  11. Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes.

    PubMed

    Brennan, Marie-Luise; Pique, Lynn M; Schrijver, Iris

    2016-01-01

    Several lines of evidence suggest a role for the epithelial sodium channel (ENaC) in cystic fibrosis (CF). The purpose of our study was to assess the contribution of genetic variants in the ENaC subunits (α, β, γ) in nonwhite CF patients in whom CFTR molecular testing has been non-diagnostic. Samples were obtained from patients who were nonwhite and whose molecular CFTR testing did not identify two mutations. Sequencing of the SCNN1A, B, and G genes was performed and variants assessed for pathogenicity and association with CF using databases, protein and splice site mutation analysis software, and literature review. We identified four nonsynonymous amino acid variants in SCNN1A, three in SCNN1B and one in SCNN1G. There was no convincing evidence of pathogenicity. Whereas all have been reported in the dbSNP database, only p.Ala334Thr, p.Val573Ile, and p.Thr663Ala in SCNN1A, p.Gly442Val in SCNN1B and p.Gly183Ser in SCNN1G were previously reported in ENaC genetic studies of CF or CF-like patients. Synonymous substitutions were also observed but novel synonymous variants were not detected. There is no conclusive association of ENaC genetic variants with CF in nonwhite CF patients. Copyright © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  12. Functional genomic responses to cystic fibrosis transmembrane conductance regulator (CFTR) and CFTR(delta508) in the lung.

    PubMed

    Xu, Yan; Liu, Cong; Clark, Jean C; Whitsett, Jeffrey A

    2006-04-21

    Cystic fibrosis (CF), a common lethal pulmonary disorder in Caucasians, is caused by mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR) that disturbs fluid homeostasis and host defense in target organs. The effects of CFTR and delta508-CFTR were assessed in transgenic mice that 1) lack CFTR expression (Cftr-/-); 2) express the human delta508 CFTR (CFTR(delta508)); 3) overexpress the normal human CFTR (CFTR(tg)) in respiratory epithelial cells. Genes were selected from Affymetrix Murine Gene-Chips analysis and subjected to functional classification, k-means clustering, promoter cis-elements/modules searching, literature mining, and pathway exploring. Genomic responses to Cftr-/- were not corrected by expression of CFTR(delta508). Genes regulating host defense, inflammation, fluid and electrolyte transport were similarly altered in Cftr-/- and CFTR(delta508) mice. CFTR(delta508) induced a primary disturbance in expression of genes regulating redox and antioxidant systems. Genomic responses to CFTR(tg) were modest and were not associated with lung pathology. CFTR(tg) and CFTR(delta508) induced genes encoding heat shock proteins and other chaperones but did not activate the endoplasmic reticulum-associated degradation pathway. RNAs encoding proteins that directly interact with CFTR were identified in each of the CFTR mouse models, supporting the hypothesis that CFTR functions within a multiprotein complex whose members interact at the level of protein-protein interactions and gene expression. Promoters of genes influenced by CFTR shared common regulatory elements, suggesting that their co-expression may be mediated by shared regulatory mechanisms. Genes and pathways involved in the response to CFTR may be of interest as modifiers of CF.

  13. Does extensive genotyping and nasal potential difference testing clarify the diagnosis of cystic fibrosis among patients with single-organ manifestations of cystic fibrosis?

    PubMed

    Ooi, Chee Y; Dupuis, Annie; Ellis, Lynda; Jarvi, Keith; Martin, Sheelagh; Ray, Peter N; Steele, Leslie; Kortan, Paul; Gonska, Tanja; Dorfman, Ruslan; Solomon, Melinda; Zielenski, Julian; Corey, Mary; Tullis, Elizabeth; Durie, Peter

    2014-03-01

    The phenotypic spectrum of cystic fibrosis (CF) has expanded to include patients affected by single-organ diseases. Extensive genotyping and nasal potential difference (NPD) testing have been proposed to assist in the diagnosis of CF when sweat testing is inconclusive. However, the diagnostic yield of extensive genotyping and NPD and the concordance between NPD and the sweat test have not been carefully evaluated. We evaluated the diagnostic outcomes of genotyping (with 122 mutations included as disease causing), sweat testing and NPD in a prospectively ascertained cohort of undiagnosed patients who presented with chronic sino-pulmonary disease (RESP), chronic/recurrent pancreatitis (PANC) or obstructive azoospermia (AZOOSP). 202 patients (68 RESP, 42 PANC and 92 AZOOSP) were evaluated; 17.3%, 22.8% and 59.9% had abnormal, borderline and normal sweat chloride results, respectively. Only 17 (8.4%) patients were diagnosable as having CF by genotyping. Compared to sweat testing, NPD identified more patients as having CF (33.2%) with fewer borderline results (18.8%). The level of agreement according to kappa statistics (and the observed percentage of agreement) between sweat chloride and NPD in RESP, PANC and AZOOSP subjects was 'moderate' (65% observed agreement), 'poor' (33% observed agreement) and 'fair' (28% observed agreement), respectively. The degree of agreement only improved marginally when subjects with borderline sweat chloride results were excluded from the analysis. The diagnosis of CF or its exclusion is not always straightforward and may remain elusive even with comprehensive evaluation, particularly among individuals who present at an older age with single-organ manifestations suggestive of CF.

  14. Transmembrane helical interactions in the CFTR channel pore.

    PubMed

    Das, Jhuma; Aleksandrov, Andrei A; Cui, Liying; He, Lihua; Riordan, John R; Dokholyan, Nikolay V

    2017-06-01

    Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene affect CFTR protein biogenesis or its function as a chloride channel, resulting in dysregulation of epithelial fluid transport in the lung, pancreas and other organs in cystic fibrosis (CF). Development of pharmaceutical strategies to treat CF requires understanding of the mechanisms underlying channel function. However, incomplete 3D structural information on the unique ABC ion channel, CFTR, hinders elucidation of its functional mechanism and correction of cystic fibrosis causing mutants. Several CFTR homology models have been developed using bacterial ABC transporters as templates but these have low sequence similarity to CFTR and are not ion channels. Here, we refine an earlier model in an outward (OWF) and develop an inward (IWF) facing model employing an integrated experimental-molecular dynamics simulation (200 ns) approach. Our IWF structure agrees well with a recently solved cryo-EM structure of a CFTR IWF state. We utilize cysteine cross-linking to verify positions and orientations of residues within trans-membrane helices (TMHs) of the OWF conformation and to reconstruct a physiologically relevant pore structure. Comparison of pore profiles of the two conformations reveal a radius sufficient to permit passage of hydrated Cl- ions in the OWF but not the IWF model. To identify structural determinants that distinguish the two conformations and possible rearrangements of TMHs within them responsible for channel gating, we perform cross-linking by bifunctional reagents of multiple predicted pairs of cysteines in TMH 6 and 12 and 6 and 9. To determine whether the effects of cross-linking on gating observed are the result of switching of the channel from open to close state, we also treat the same residue pairs with monofunctional reagents in separate experiments. Both types of reagents prevent ion currents indicating that pore blockage is primarily responsible.

  15. Non-neoplastic cystic and cystic-like lesions of the pancreas: may mimic pancreatic cystic neoplasms.

    PubMed

    Goh, Brian K P; Tan, Yu-Meng; Chung, Yaw-Fui A; Chow, Pierce K H; Ong, Hock-Soo; Lim, Dennis T H; Wong, Wai-Keong; Ooi, London L P J

    2006-05-01

    Cystic lesions of the pancreas consist of a broad range of pathological entities. With the exception of the pancreatic pseudocyst, these are usually caused by pancreatic cystic neoplasms. Non-neoplastic pancreatic cystic and cystic-like lesions are extremely rare. In the present article, the surgical experience with these unusual entities over a 14-year period is reported. Between 1991 and 2004, all patients who underwent surgical exploration for a cystic lesion of the pancreas were retrospectively reviewed. Patients with a pancreatic pseudocyst were excluded. There were 106 patients of whom 8 (7.5%) had a final pathological diagnosis consistent with a non-neoplastic pancreatic cystic or cystic-like lesion, including 3 patients with a benign epithelial cyst, 2 with a pancreatic abscess (one tuberculous and one foreign body), 2 with mucous retention cysts and 1 with a mucinous non-neoplastic cyst. These eight patients are the focus of this study. There were six female and two male patients with a median age of 61.5 years (range, 41-71 years). All the patients were of Asian origin including seven Chinese and one Indian. Four of the patients were asymptomatic and their pancreatic cysts were discovered incidentally on radiological imaging for other indications. All the patients underwent preoperative radiological investigations, including ultrasonography, computed tomography or magnetic resonance imaging, which showed a cystic lesion of the pancreas. Three patients, all of whom were symptomatic, were diagnosed preoperatively with a malignant cystic neoplasm on the basis of radiological imaging. Two patients were eventually found to have a pancreatic abscess, one tuberculous and the other, secondary to foreign body perforation. The third patient was found on final histology to have chronic pancreatitis with retention cysts. The remaining five patients had a preoperative diagnosis of an indeterminate cyst; on pathological examination, they were found to have a benign epithelial (congenital) cyst (n = 3), retention cyst (n = 1) and mucinous non-neoplastic cyst (n = 1). At a median follow up of 20 months (range, 3-34 months), none of the patients had any evidence of recurrent disease. Non-neoplastic cystic and cystic-like lesions of the pancreas are rare causes of pancreatic cystic lesions that are generally benign and do not require surgery when asymptomatic. However, despite advances in diagnostic investigations such as endoscopic ultrasound with fluid aspirate and magnetic resonance imaging, the preoperative diagnosis remains unreliable. Hence, the challenge for all clinicians is to recognize these lesions preoperatively and to avoid 'unnecessary' surgery.

  16. A new mutation in the CFTR gene, composed of two adjacent DNA alterations, is a common cause of cystic fibrosis among Georgian Jews

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shoshani, T.; Berkun, Y.; Yahav, Y.

    Five Jewish cystic fibrosis (CF) patients from four unrelated families, all of whom emigrated from what was Soviet Georgia were studied. The parents in two of the families are first-degree relatives. The clinical phenotype of the patients seems to be associated with a severe disease, as reflected by early age of diagnosis (before the age of 1 year), high sweat chloride level (105-140 meq/liter), and pancreatic insufficiency. The pulmonary function and nutritional status of these patients are normal. These patients were tested for [Delta]F508 by analysis of heteroduplex DNA (4). None of the CF chromosomes was found to carry themore » [Delta]F508 mutation. Subsequently, PCR-amplified genomic DNA samples from two of these patients were subjected to direct sequencing (5) of regions containing exons 7, 9-12, an 19-21 of the CF gene using the oligonucleotides previously described (3, 6). In exon 7, two DNA alterations 3 bp apart were identified in both patients. The first alteration in a C [yields] A transversion at nucleotide position 1207, changing the glutamine codon to lysine (Q359K). The second DNA alteration is a C [yields] A transversion at nucleotide position 1211 changing the threonine codon to lysine (T360K). The two DNA alterations cause nonconservative amino acid substitutions, changing each of the two uncharged polar amino acids (glutamine and threonine) to a basic amino acid, lysine. The Q359K substitution destroys an Rsal recognition site and can be detected by PCR amplification of exon 7 using 7i-5 and 7i-3 oligonucleotides (6), followed by Rsal digestion and electrophoresis on 10% polyacrylamide gels. Two Rsal sites are found in a normal amplified DNA fragment, resulting in three restriction fragments of 292, 68, and 50 bp. Digestion of the PCR fragment of an individual homozygous for this substitution resulted in only two fragments of 342 and 68 bp. 6 refs., 3 figs.« less

  17. Radiological analysis of cystic lesion in osteonecrosis of the femoral head.

    PubMed

    Gao, Fuqiang; Han, Jun; He, Zike; Li, Zirong

    2018-04-27

    Cystic lesions are a common complication in osteonecrosis of the femoral head (ONFH). This study will discuss the cause of cystic lesion formation and the feature of cystic lesion distribution in ONFH. According to the feature of cystic lesion in ONFH, we will discuss the possible mechanisms of cystic lesions and their  influence on collapse of the femoral head. We retrospectively gathered 102 ONFH patients (168 hips) from November in 2015 to August in 2016 on China-Japan Friendship Hospital. Three categories of patients' medical information were collected: demographic characteristics, bone cystic lesion location, and pathological finding on CT and MRI imaging (microfracture, collapse, crescent sign). On mid-coronal and mid-axial CT section, the femoral head was divided into four quadrants for locating the cystic lesion. And we classified the location relationship of cystic lesion and sclerosis rim as G1 type, G2 type, and G3 type on coronal CT section. A significant difference was found between ONFH group with cystic lesion and ONFH group without cystic lesion in terms of microfracture (P < 0.001), collapse (P < 0.001), and crescent sign (P < 0.001). Forty-four cystic lesions (70%) are located in anterior hip area and 19 cystic lesions (30%) are located in posterior hip area. There were 14, 24, and seven cystic lesions (31, 53, 16%) locating in lateral, central, and medial pillars of the femoral head. G2 type was the most common pattern of location relationship between cystic lesion and sclerosis rim. Cystic lesions are often found near sclerosis rim in ONFH. The femoral head with osteonecrosis complicating by cystic lesions is more likely to accompany microfracture, collapse, and crescent sign which indicate structural instability in the femoral head. Cystic lesion in ONFH plays an important role in aggravating the progression of femoral head collapse. The peak stress from sclerosis rim may be a main factor inducing the formation of cystic lesion in ONFH via an OA-like mechanism.

  18. Site Specific Incorporation of Amino Acid Analogues into Protiens In Vivo

    DTIC Science & Technology

    2004-01-14

    suffering from Xeroderma pigmentosum and cystic fibrosis. The fibroblast cell line has an ochre mutation in the hRAD30 gene coding for a DNA polymerase... Xeroderma pigmentosum . As a first step in these studies, we have used the highly sensitive luciferase reporter gene to determine the reagents and

  19. Cystic adventitial degeneration: ectopic ganglia from adjacent joint capsules.

    PubMed

    Ortmann, J; Widmer, M K; Gretener, S; Do, D D; Willenberg, T; Daliri, A; Baumgartner, I

    2009-11-01

    Cystic adventitial degeneration is a rare non-atherosclerotic cause of peripheral arterial occlusive disease, mainly seen in young men without other evidence of vascular disease. Diagnosis will be established by clinical findings and by ultrasound or angiography and can be treated by excision or enucleation of the affected arterial segment or by percutaneous ultrasound-guided aspiration. However, the etiology of adventitial cysts remains unknown. We report a case of cystic adventitial degeneration showing a connection between the joint capsule and the adventitial cyst, supporting the theory that cystic adventitial degeneration may represent ectopic ganglia from adjacent joint capsules.

  20. Fatal Disseminated Aspergillus penicillioides Infection in a 3-Month-Old Infant with Suspected Cystic Fibrosis: Autopsy Case Report with Review of Literature.

    PubMed

    Gupta, Kirti; Gupta, Parikshaa; Mathew, Joseph L; Bansal, Arun; Singh, Gangandeep; Singh, Meenu; Chakrabarti, Arunaloke

    Patients with cystic fibrosis (CF) often are colonized by Aspergillus species in their respiratory tract, but invasive aspergillosis is a rare complication. We describe the autopsy findings of an infant with cystic fibrosis who had fatal disseminated aspergillosis. The causative agent was identified as A. penicillioides by molecular technique. To our knowledge, this is the first report of disseminated aspergillosis caused by A. penicillioides in any type of patient. The literature on invasive aspergillosis in patients with cystic fibrosis also is reviewed.

  1. Disease-modifying genetic factors in cystic fibrosis.

    PubMed

    Marson, Fernando A L

    2018-05-01

    To compile data from the past 10 years regarding the role of modifying genes in cystic fibrosis (CF). CF is a model disease for understanding of the action of modifying genes. Although it is a monogenic (CFTR) autosomal recessive disease, CF presents with wide phenotypic variability. In CF, variability occurs with different intensity among patients by each organ, being organ-specific, resulting from the mutual interaction of environmental and genetic factors, including CFTR mutations and various other genes, most of which are associated with inflammatory processes. In individuals, using precision medicine, gene modification studies have revealed individualized responses to drugs depending on particular CFTR mutations and modifying genes, most of which are alternative ion channels. Studies of modifying genes in CF allow: understanding of clinical variability among patients with the same CFTR genotype; evaluation of precision medicine; understanding of environmental and genetic effects at the organ level; understanding the involvement of genetic variants in inflammatory responses; improvements in genetic counseling; understanding the involvement of genetic variants in inflammatory responses in lung diseases, such as asthma; and understanding the individuality of the person with the disease.

  2. Analysis of some polymorphic markers of the CFTR gene in cystic fibrosis patients and healthy donors from the Moscow region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Amosenko, F.A.; Sazonova, M.A.; Kapranov, N.I.

    1995-04-01

    Allelic frequencies of three polymorphic markers in the CFTR gene were estimated on chromosomes derived from cystic fibrosis (CF) patients and healthy donors from Moscow and the Moscow region. These polymorphic markers are tetranucleotide tandem repeats GATT in intron 6B, M470V in exon 10, and T854T in exon 14 (fragment A). Frequencies at allele 1 of the M470V marker, along with allele 2 of GATT and T854T, are two times higher for CF patients without {Delta}F508 mutation than for healthy donors, and there is linkage disequilibrium of these alleles of the polymorphic markers analyzed with the CF gene. Allele 1more » of M470V and T854T markers, as well as allele 2 of the GATT marker (six repeats), are absolutely linked to mutation F508 of the CFTR gene. Using the polymorphic markers studied, family analysis of CF was carried out in two families. 10 refs., 1 fig., 1 tab.« less

  3. The impact of a national population carrier screening program on cystic fibrosis birth rate and age at diagnosis: Implications for newborn screening.

    PubMed

    Stafler, Patrick; Mei-Zahav, Meir; Wilschanski, Michael; Mussaffi, Huda; Efrati, Ori; Lavie, Moran; Shoseyov, David; Cohen-Cymberknoh, Malena; Gur, Michal; Bentur, Lea; Livnat, Galit; Aviram, Micha; Alkrinawi, Soliman; Picard, Elie; Prais, Dario; Steuer, Guy; Inbar, Ori; Kerem, Eitan; Blau, Hannah

    2016-07-01

    Population carrier screening (PCS) has been available in Israel since 1999 and universally subsidized since 2008. We sought to evaluate its impact. A retrospective review of governmental databanks, the national CF registry and CF centers. CF rate per 100,000 live births has decreased from 14.5 in 1990 to 6 in 2011. From 2004-2011 there were 95 CF births: 22 utilized PCS; 68 (72%) had 2 known CFTR mutations; 37% were pancreatic sufficient. At diagnosis, age was 6 (0-98) months; 53/95 had respiratory symptoms, 41/95 failure to thrive and 19/95 pseudomonas. Thirty-four (36%) were Arabs and 19 (20%) orthodox Jews, compared to 20% and 8% respectively, in the general population. PCS markedly reduced CF birth rates with a shift towards milder mutations, but was often avoided for cultural reasons. As children regularly have significant disease at diagnosis, we suggest a balanced approach, utilizing both PCS and newborn screening. Copyright © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  4. A new role for bicarbonate secretion in cervico-uterine mucus release.

    PubMed

    Muchekehu, Ruth W; Quinton, Paul M

    2010-07-01

    Cervical mucus thinning and release during the female reproductive cycle is thought to rely mainly on fluid secretion. However, we now find that mucus released from the murine reproductive tract critically depends upon concurrent bicarbonate (HCO(3)(-)) secretion. Prostaglandin E(2) (PGE(2))- and carbachol-stimulated mucus release was severely inhibited in the absence of serosal HCO(3)(-), HCO(3)(-) transport, or functional cystic fibrosis transmembrane conductance regulator (CFTR). In contrast to mucus release, PGE(2)- and carbachol-stimulated fluid secretion was not dependent on bicarbonate or on CFTR, but was completely blocked by niflumic acid. We found stimulated mucus release was severely impaired in the cystic fibrosis F508 reproductive tract, even though stimulated fluid secretion was preserved. Thus, CFTR mutations and/or poor bicarbonate secretion may be associated with reduced female fertility associated with abnormal mucus and specifically, may account for the increased viscosity and lack of cyclical changes in cervical mucus long noted in women with cystic fibrosis.

  5. A new role for bicarbonate secretion in cervico-uterine mucus release

    PubMed Central

    Muchekehu, Ruth W; Quinton, Paul M

    2010-01-01

    Cervical mucus thinning and release during the female reproductive cycle is thought to rely mainly on fluid secretion. However, we now find that mucus released from the murine reproductive tract critically depends upon concurrent bicarbonate (HCO3−) secretion. Prostaglandin E2 (PGE2)- and carbachol-stimulated mucus release was severely inhibited in the absence of serosal HCO3−, HCO3− transport, or functional cystic fibrosis transmembrane conductance regulator (CFTR). In contrast to mucus release, PGE2- and carbachol-stimulated fluid secretion was not dependent on bicarbonate or on CFTR, but was completely blocked by niflumic acid. We found stimulated mucus release was severely impaired in the cystic fibrosis ΔF508 reproductive tract, even though stimulated fluid secretion was preserved. Thus, CFTR mutations and/or poor bicarbonate secretion may be associated with reduced female fertility associated with abnormal mucus and specifically, may account for the increased viscosity and lack of cyclical changes in cervical mucus long noted in women with cystic fibrosis. PMID:20478977

  6. Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy.

    PubMed

    Sobczyńska-Tomaszewska, Agnieszka; Ołtarzewski, Mariusz; Czerska, Kamila; Wertheim-Tysarowska, Katarzyna; Sands, Dorota; Walkowiak, Jarosław; Bal, Jerzy; Mazurczak, Tadeusz

    2013-04-01

    Newborn screening for cystic fibrosis (NBS CF) in Poland was started in September 2006. Summary from 4 years' experience is presented in this study. The immunoreactive trypsin/DNA sequencing strategy was implemented. The group of 1,212,487 newborns were screened for cystic fibrosis during the programme. We identified a total of 221 CF cases during this period, including, 4 CF cases were reported to be omitted by NBS CF. Disease incidence in Poland based on the programme results was estimated as 1/4394 and carrier frequency as 1/33. The frequency of the F508del was similar (62%) to population data previously reported. This strategy allowed us to identify 29 affected infants with rare genotypes. The frequency of some mutations (eg, 2184insA, K710X) was assessed in Poland for the first time. Thus, sequencing assay seems to be accurate method for screening programme using blood spots in the Polish population.

  7. Multilocus amplicon sequencing of Pseudomonas aeruginosa cystic fibrosis airways isolates collected prior to and after early antipseudomonal chemotherapy.

    PubMed

    Fischer, Sebastian; Greipel, Leonie; Klockgether, Jens; Dorda, Marie; Wiehlmann, Lutz; Cramer, Nina; Tümmler, Burkhard

    2017-05-01

    Early antimicrobial chemotherapy can prevent or at least delay chronic cystic fibrosis (CF) airways infections with Pseudomonas aeruginosa. During a 10-year study period P. aeruginosa was detected for the first time in 54 CF patients regularly seen at the CF centre Hannover. Amplicon sequencing of 34 loci of the P. aeruginosa core genome was performed in baseline and post-treatment isolates of the 15 CF patients who had remained P. aeruginosa - positive after the first round of antipseudomonal chemotherapy. Deep sequencing uncovered coexisting alternative nucleotides at in total 33 of 55,284 examined genome positions including six non-synonymous polymorphisms in the lasR gene, a key regulator of quorum sensing. After early treatment 42 of 50 novel nucleotide substitutions had emerged in exopolysaccharide biosynthesis, efflux pump and porin genes. Early treatment selects pathoadaptive mutations in P. aeruginosa that are typical for chronic infections of CF lungs. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  8. Giant multilocular cystadenoma of the prostate: a rare cause of huge cystic pelvic mass.

    PubMed

    Olgun, Deniz Cebi; Onal, Bulent; Mihmanli, Ismail; Kantarci, Fatih; Durak, Haydar; Demir, Hale; Cetinel, Bulent

    2012-03-01

    Giant multilocular prostatic cystadenoma is a rare benign tumor that evolves from the prostate gland. Obstructive voiding symptoms occur in all reported cases. These lesions do not invade adjacent structures. Preoperative radiologic evaluation can define the benign nature of the lesion. Here we report a case of large cystic lesions identified by magnetic resonance imaging and sonographic findings that caused an extensive mass effect in the pelvis. When retrovesical, huge cystic lesions fill the pelvis completely in young men, with high levels of serum prostate-specific antigen, giant multilocular prostatic cystadenoma should be considered as a differential diagnosis. To our knowledge, this is the youngest case of prostatic cystadenoma reported in the literature.

  9. Pharmacological treatment of the ion transport defect in cystic fibrosis.

    PubMed

    Roomans, G M

    2001-01-01

    Cystic fibrosis (CF) is a lethal monogenetic disease characterised by impaired water and ion transport over epithelia. The lung pathology is fatal and causes death in 95% of CF patients. The genetic basis of the disease is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR), a cAMP-regulated chloride channel. The most common mutation, DeltaF508, results in a protein that cannot properly be folded in the endoplasmic reticulum, is destroyed and hence does not reach the apical cell membrane. This paper will discuss those pharmacological approaches that are directed at correcting the defect in ion transport. At present, no clinically effective drug is available, although research has defined areas in which progress might be made. These are the following: (1) the drug 4-phenylbutyrate (4PBA) increases the expression of DeltaF508-CFTR in the cell membrane, probably by breaking the association between DeltaF508-CFTR and a chaperone; (2) a number of xanthines, in particular 8-cyclopentyl-1, 3-dipropylxanthine (CPX), are effective in activating CFTR, presumably by direct binding and also possibly by correcting the trafficking defect; (3) the isoflavone genistein can activate both wild-type and mutant CFTR, probably through direct binding to the channel; (4) purinergic agonists (ATP and UTP) can stimulate chloride secretion via a Ca(2+)-dependent chloride channel and in this way compensate for the defect in CFTR, but stable analogues will be required before this type of treatment has clinical significance; (5) treatment with inhaled amiloride may correct the excessive absorption of Na(+) ions and water by airway epithelial cells that appears connected to the defect in CFTR; although clinical tests have not been very successful so far, amiloride analogues with a longer half-life may give better results. The role of CFTR in bicarbonate secretion has not yet been established with certainty, but correction of the defect in bicarbonate secretion may be important in clinical treatment of the disease. Currently, major efforts are directed at developing a pharmacological treatment of the ion transport defect in CF, but much basic research remains to be done, in particular, with regard to the mechanism by which defective CFTR is removed in the endoplasmic reticulum by the ubiquitin-proteasome pathway, which is a central pathway in protein production and of significance for several other diseases apart from CF.

  10. Diabetes in cystic fibrosis.

    PubMed

    Bridges, Nicola

    2013-05-01

    Cystic fibrosis related diabetes (CFRD) is a common complication of cystic fibrosis, caused by a fall in insulin secretion with age in individuals with pancreatic insufficiency. CFRD is associated with worse clinical status and increased mortality. Treatment of CFRD with insulin results in sustained improvements in lung function and nutrition. While clinical experience with insulin treatment in CF has increased, the selection of who to treat and glycaemic targets remain unclear. Copyright © 2013. Published by Elsevier Ltd.

  11. A synonymous codon change alters the drug sensitivity of ΔF508 cystic fibrosis transmembrane conductance regulator

    PubMed Central

    Bali, Vedrana; Lazrak, Ahmed; Guroji, Purushotham; Fu, Lianwu; Matalon, Sadis; Bebok, Zsuzsanna

    2016-01-01

    Synonymous mutations, such as I507-ATC→ATT, in deletion of Phe508 in cystic fibrosis transmembrane conductance regulator (ΔF508 CFTR), the most frequent disease-associated mutant of CFTR, may affect protein biogenesis, structure, and function and contribute to an altered disease phenotype. Small-molecule drugs are being developed to correct ΔF508 CFTR. To understand correction mechanisms and the consequences of synonymous mutations, we analyzed the effect of mechanistically distinct correctors, corrector 4a (C4) and lumacaftor (VX-809), on I507-ATT and I507-ATC ΔF508 CFTR biogenesis and function. C4 stabilized I507-ATT ΔF508 CFTR band B, but without considerable biochemical and functional correction. VX-809 biochemically corrected ∼10% of both of the variants, leading to stable, forskolin+3-isobutyl-1-methylxanthine (IBMX)-activated whole-cell currents in the presence of the corrector. Omitting VX-809 during whole-cell recordings led to a spontaneous decline of the currents, suggesting posttranslational stabilization by VX-809. Treatment of cells with the C4+VX-809 combination resulted in enhanced rescue and 2-fold higher forskolin+IBMX–activated currents of both I507-ATT and I507-ATC ΔF508 CFTR, compared with VX-809 treatment alone. The lack of an effect of C4 on I507-ATC ΔF508 CFTR, but its additive effect in combination with VX-809, implies that C4 acted on VX-809–modified I507-ATC ΔF508 CFTR. Our results suggest that binding of C4 and VX-809 to ΔF508 CFTR is conformation specific and provide evidence that synonymous mutations can alter the drug sensitivity of proteins.—Bali, V., Lazrak, A., Guroji, P., Fu, L., Matalon, S., Bebok, Z. A synonymous codon change alters the drug sensitivity of ΔF508 cystic fibrosis transmembrane conductance regulator. PMID:26336913

  12. Screening for F508del as a first step in the molecular diagnosis of cystic fibrosis.

    PubMed

    Marson, Fernando Augusto de Lima; Bertuzzo, Carmen Silvia; Ribeiro, Maria Ângela Gonçalves de Oliveira; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu

    2013-01-01

    To determine the relevance of screening for the F508del mutation of the cystic fibrosis transmembrane conductance regulator gene as a first step in the genetic diagnosis of cystic fibrosis (CF) by associating the genotype with various clinical variables. We evaluated 180 CF patients regarding the F508del mutation. The clinical data were obtained from the medical records of the patients and from interviews with their parents or legal guardians. Of the 180 patients studied, 65 (36.1%) did not carry the F508del mutation (group 0 [G0]), 67 (37.2%) were F508del heterozygous (G1), and 48 (26.7%) were F508del homozygous (G2). All three groups showed associations with the clinical variables. Homozygosis was associated with younger patients, younger age at CF diagnosis, and younger age at the first isolation of Pseudomonas aeruginosa (PA), as well as with higher prevalence of pancreatic insufficiency (PI) and non-mucoid PA (NMPA) colonization. In comparison with G1+G2 patients, G0 patients were older; first experienced clinical symptoms, digestive disease, and pulmonary disease at an older age; were older at CF diagnosis and at first PA isolation; and had a lower prevalence of PI and meconium ileus, as well as of colonization by NMPA, mucoid PA, and Burkholderia cepacia. In G1 patients, values were intermediate for age at CF diagnosis; age at first PA isolation, first pulmonary symptoms, and first clinical manifestations; MPA colonization; and OR for PI. The identification of F508del in 63.9% of the patients studied showed that this can be a useful tool as a first step in the genetic diagnosis of CF. The F508del genotype was associated with clinical severity of the disease, especially with the variables related to CF onset.

  13. Antibiotic Resistance in Burkholderia Species

    PubMed Central

    Rhodes, Katherine A.; Schweizer, Herbert P.

    2016-01-01

    The genus Burkholderia comprises metabolically diverse and adaptable Gram-negative bacteria, which thrive in often adversarial environments. A few members of the genus are prominent opportunistic pathogens. These include B. mallei and B. pseudomallei of the B. pseudomallei complex, which cause glanders and melioidosis, respectively. B. cenocepacia, B. multivorans, and B. vietnamiensis belong to the B. cepacia complex and affect mostly cystic fibrosis patients. Infections caused by these bacteria are difficult to treat because of significant antibiotic resistance. The first line of defense against antimicrobials in Burkholderia species is the outer membrane penetration barrier. Most Burkholderia contain a modified lipopolysaccharide that causes intrinsic polymyxin resistance. Contributing to reduced drug penetration are restrictive porin proteins. Efflux pumps of the resistance nodulation cell division family are major players in Burkholderia multidrug resistance. Third and fourth generation β-lactam antibiotics are seminal for treatment of Burkholderia infections, but therapeutic efficacy is compromised by expression of several β-lactamases and ceftazidime target mutations. Altered DNA gyrase and dihydrofolate reductase targets cause fluoroquinolone and trimethoprim resistance, respectively. Although antibiotic resistance hampers therapy of Burkholderia infections, the characterization of resistance mechanisms lags behind other non-enteric Gram-negative pathogens, especially ESKAPE bacteria such as Acinetobacter baumannii, Klebsiella pneumoniae and Pseudomonas aeruginosa. PMID:27620956

  14. Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1.

    PubMed

    Yang, Zhengrong; Hildebrandt, Ellen; Jiang, Fan; Aleksandrov, Andrei A; Khazanov, Netaly; Zhou, Qingxian; An, Jianli; Mezzell, Andrew T; Xavier, Bala M; Ding, Haitao; Riordan, John R; Senderowitz, Hanoch; Kappes, John C; Brouillette, Christie G; Urbatsch, Ina L

    2018-05-01

    The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is an ABC transporter containing two transmembrane domains forming a chloride ion channel, and two nucleotide binding domains (NBD1 and NBD2). CFTR has presented a formidable challenge to obtain monodisperse, biophysically stable protein. Here we report a comprehensive study comparing effects of single and multiple NBD1 mutations on stability of both the NBD1 domain alone and on purified full length human CFTR. Single mutations S492P, A534P, I539T acted additively, and when combined with M470V, S495P, and R555K cumulatively yielded an NBD1 with highly improved structural stability. Strategic combinations of these mutations strongly stabilized the domain to attain a calorimetric T m  > 70 °C. Replica exchange molecular dynamics simulations on the most stable 6SS-NBD1 variant implicated fluctuations, electrostatic interactions and side chain packing as potential contributors to improved stability. Progressive stabilization of NBD1 directly correlated with enhanced structural stability of full-length CFTR protein. Thermal unfolding of the stabilized CFTR mutants, monitored by changes in intrinsic fluorescence, demonstrated that Tm could be shifted as high as 67.4 °C in 6SS-CFTR, more than 20 °C higher than wild-type. H1402S, an NBD2 mutation, conferred CFTR with additional thermal stability, possibly by stabilizing an NBD-dimerized conformation. CFTR variants with NBD1-stabilizing mutations were expressed at the cell surface in mammalian cells, exhibited ATPase and channel activity, and retained these functions to higher temperatures. The capability to produce enzymatically active CFTR with improved structural stability amenable to biophysical and structural studies will advance mechanistic investigations and future cystic fibrosis drug development. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Coexistence and Within-Host Evolution of Diversified Lineages of Hypermutable Pseudomonas aeruginosa in Long-term Cystic Fibrosis Infections

    PubMed Central

    Feliziani, Sofía; Moyano, Alejandro J.; Di Rienzo, Julio A.; Krogh Johansen, Helle; Molin, Søren; Smania, Andrea M.

    2014-01-01

    The advent of high-throughput sequencing techniques has made it possible to follow the genomic evolution of pathogenic bacteria by comparing longitudinally collected bacteria sampled from human hosts. Such studies in the context of chronic airway infections by Pseudomonas aeruginosa in cystic fibrosis (CF) patients have indicated high bacterial population diversity. Such diversity may be driven by hypermutability resulting from DNA mismatch repair system (MRS) deficiency, a common trait evolved by P. aeruginosa strains in CF infections. No studies to date have utilized whole-genome sequencing to investigate within-host population diversity or long-term evolution of mutators in CF airways. We sequenced the genomes of 13 and 14 isolates of P. aeruginosa mutator populations from an Argentinian and a Danish CF patient, respectively. Our collection of isolates spanned 6 and 20 years of patient infection history, respectively. We sequenced 11 isolates from a single sample from each patient to allow in-depth analysis of population diversity. Each patient was infected by clonal populations of bacteria that were dominated by mutators. The in vivo mutation rate of the populations was ∼100 SNPs/year–∼40-fold higher than rates in normo-mutable populations. Comparison of the genomes of 11 isolates from the same sample showed extensive within-patient genomic diversification; the populations were composed of different sub-lineages that had coexisted for many years since the initial colonization of the patient. Analysis of the mutations identified genes that underwent convergent evolution across lineages and sub-lineages, suggesting that the genes were targeted by mutation to optimize pathogenic fitness. Parallel evolution was observed in reduction of overall catabolic capacity of the populations. These findings are useful for understanding the evolution of pathogen populations and identifying new targets for control of chronic infections. PMID:25330091

  16. Genetic deletion of keratin 8 corrects the altered bone formation and osteopenia in a mouse model of cystic fibrosis.

    PubMed

    Le Henaff, Carole; Faria Da Cunha, Mélanie; Hatton, Aurélie; Tondelier, Danielle; Marty, Caroline; Collet, Corinne; Zarka, Mylène; Geoffroy, Valérie; Zatloukal, Kurt; Laplantine, Emmanuel; Edelman, Aleksander; Sermet-Gaudelus, Isabelle; Marie, Pierre J

    2016-04-01

    Patients with cystic fibrosis (CF) display low bone mass and alterations in bone formation. Mice carrying the F508del genetic mutation in the cystic fibrosis conductance regulator (Cftr) gene display reduced bone formation and decreased bone mass. However, the underlying molecular mechanisms leading to these skeletal defects are unknown, which precludes the development of an efficient anti-osteoporotic therapeutic strategy. Here we report a key role for the intermediate filament protein keratin 8 (Krt8), in the osteoblast dysfunctions in F508del-Cftr mice. We found that murine and human osteoblasts express Cftr and Krt8 at low levels. Genetic studies showed that Krt8 deletion (Krt8(-/-)) in F508del-Cftr mice increased the levels of circulating markers of bone formation, corrected the expression of osteoblast phenotypic genes, promoted trabecular bone formation and improved bone mass and microarchitecture. Mechanistically, Krt8 deletion in F508del-Cftr mice corrected overactive NF-κB signaling and decreased Wnt-β-catenin signaling induced by the F508del-Cftr mutation in osteoblasts. In vitro, treatment with compound 407, which specifically disrupts the Krt8-F508del-Cftr interaction in epithelial cells, corrected the abnormal NF-κB and Wnt-β-catenin signaling and the altered phenotypic gene expression in F508del-Cftr osteoblasts. In vivo, short-term treatment with 407 corrected the altered Wnt-β-catenin signaling and bone formation in F508del-Cftr mice. Collectively, the results show that genetic or pharmacologic targeting of Krt8 leads to correction of osteoblast dysfunctions, altered bone formation and osteopenia in F508del-Cftr mice, providing a therapeutic strategy targeting the Krt8-F508del-CFTR interaction to correct the abnormal bone formation and bone loss in cystic fibrosis. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Ordering molecular genetic tests and reporting results: practices in laboratory and clinical settings.

    PubMed

    Lubin, Ira M; Caggana, Michele; Constantin, Carolyn; Gross, Susan J; Lyon, Elaine; Pagon, Roberta A; Trotter, Tracy L; Wilson, Jean Amos; McGovern, Margaret M

    2008-09-01

    Previous studies have suggested that patient care may be compromised as a consequence of poor communication between clinicians and laboratory professionals in cases in which molecular genetic test results are reported. To understand better the contributing factors to such compromised care, we investigated both pre- and postanalytical processes using cystic fibrosis mutation analysis as our model. We found that although the majority of test requisition forms requested patient/family information that was necessary for the proper interpretation of test results, in many cases, these data were not provided by the individuals filling out the forms. We found instances in which result reports for simulated diagnostic testing described individuals as carriers where only a single mutation was found with no comment pertaining to a diagnosis of cystic fibrosis. Similarly, reports based on simulated scenarios for carrier testing were problematic when no mutations were identified, and the patient's race/ethnicity and family history were not discussed in reference to residual risk of disease. Remarkably, a pilot survey of obstetrician-gynecologists revealed that office staff, including secretaries, often helped order genetic tests and reported test results to patients, raising questions about what efforts are undertaken to ensure personnel competency. These findings are reviewed in light of what efforts should be taken to improve the quality of test-ordering and result-reporting practices.

  18. Next generation diagnostics of cystic fibrosis and CFTR-related disorders by targeted multiplex high-coverage resequencing of CFTR.

    PubMed

    Trujillano, D; Ramos, M D; González, J; Tornador, C; Sotillo, F; Escaramis, G; Ossowski, S; Armengol, L; Casals, T; Estivill, X

    2013-07-01

    Here we have developed a novel and much more efficient strategy for the complete molecular characterisation of the cystic fibrosis (CF) transmembrane regulator (CFTR) gene, based on multiplexed targeted resequencing. We have tested this approach in a cohort of 92 samples with previously characterised CFTR mutations and polymorphisms. After enrichment of the pooled barcoded DNA libraries with a custom NimbleGen SeqCap EZ Choice array (Roche) and sequencing with a HiSeq2000 (Illumina) sequencer, we applied several bioinformatics tools to call mutations and polymorphisms in CFTR. The combination of several bioinformatics tools allowed us to detect all known pathogenic variants (point mutations, short insertions/deletions, and large genomic rearrangements) and polymorphisms (including the poly-T and poly-thymidine-guanine polymorphic tracts) in the 92 samples. In addition, we report the precise characterisation of the breakpoints of seven genomic rearrangements in CFTR, including those of a novel deletion of exon 22 and a complex 85 kb inversion which includes two large deletions affecting exons 4-8 and 12-21, respectively. This work is a proof-of-principle that targeted resequencing is an accurate and cost-effective approach for the genetic testing of CF and CFTR-related disorders (ie, male infertility) amenable to the routine clinical practice, and ready to substitute classical molecular methods in medical genetics.

  19. [The ABC transporters of Saccharomyces cerevisiae].

    PubMed

    Wawrzycka, Donata

    2011-01-01

    The ABC transporters (ATP Binding Cassette) compose one of the bigest protein family with the great medical, industrial and economical impact. They are found in all organism from bacteria to man. ABC proteins are responsible for resistance of microorganism to antibiotics and fungicides and multidrug resistance of cancer cells. Mutations in ABC transporters genes cause seriuos deseases like cystic fibrosis, adrenoleucodystrophy or ataxia. Transport catalized by ABC proteins is charged with energy from the ATP hydrolysis. The ABC superfamily contains transporters, canals, receptors. Analysis of the Saccharomyces cerevisiae genome allowed to distinguish 30 potential ABC proteins which are classified into 6 subfamilies. The structural and functional similarity of the yeast and human ABC proteins allowes to use the S. cerevisiae as a model organism for ABC transporters characterisation. In this work the present state of knowleadge on yeast S. cerevisiae ABC proteins was summarised.

  20. Laser Desorption Mass Spectrometry for DNA Sequencing and Analysis

    NASA Astrophysics Data System (ADS)

    Chen, C. H. Winston; Taranenko, N. I.; Golovlev, V. V.; Isola, N. R.; Allman, S. L.

    1998-03-01

    Rapid DNA sequencing and/or analysis is critically important for biomedical research. In the past, gel electrophoresis has been the primary tool to achieve DNA analysis and sequencing. However, gel electrophoresis is a time-consuming and labor-extensive process. Recently, we have developed and used laser desorption mass spectrometry (LDMS) to achieve sequencing of ss-DNA longer than 100 nucleotides. With LDMS, we succeeded in sequencing DNA in seconds instead of hours or days required by gel electrophoresis. In addition to sequencing, we also applied LDMS for the detection of DNA probes for hybridization LDMS was also used to detect short tandem repeats for forensic applications. Clinical applications for disease diagnosis such as cystic fibrosis caused by base deletion and point mutation have also been demonstrated. Experimental details will be presented in the meeting. abstract.

  1. Vitamin A supplementation for cystic fibrosis.

    PubMed

    Bonifant, Catherine M; Shevill, Elizabeth; Chang, Anne B

    2012-08-15

    People with cystic fibrosis and pancreatic insufficiency are at risk of fat soluble vitamin deficiency as these vitamins (A, D, E and K) are co-absorbed with fat. Thus, some cystic fibrosis centres routinely administer these vitamins as supplements but the centres vary in their approach of addressing the possible development of deficiencies in these vitamins. Vitamin A deficiency causes predominantly eye and skin problems while supplementation of vitamin A to excessive levels may cause harm to the respiratory and skeletal systems in children. Thus a systematic review on vitamin A supplementation in people with cystic fibrosis would help guide clinical practice. To determine if vitamin A supplementation in children and adults with CF: 1. reduces the frequency of vitamin A deficiency disorders; 2. improves general and respiratory health; 3. increases the frequency of vitamin A toxicity. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Trials Register which comprises of references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search of the Group's Cystic Fibrosis Trials Register: 23 May 2012. All randomised or quasi-randomised controlled trials comparing all preparations of oral vitamin A used as a supplement compared to either no supplementation (or placebo) at any dose and for any duration, in children or adults with cystic fibrosis (defined by sweat tests or genetic testing) with and without pancreatic insufficiency. No relevant studies for inclusion were identified in the search. No studies were included in this review. As there were no randomised or quasi-randomised controlled trials identified, we cannot draw any conclusions on the benefits (or otherwise) of regular administration of vitamin A in people with cystic fibrosis. Until further data are available, country or region specific guidelines on the use of vitamin A in people with cystic fibrosis should be followed.

  2. Overexpression of HER2 in the pancreas promotes development of intraductal papillary mucinous neoplasms in mice.

    PubMed

    Shibata, Wataru; Kinoshita, Hiroto; Hikiba, Yohko; Sato, Takeshi; Ishii, Yasuaki; Sue, Soichiro; Sugimori, Makoto; Suzuki, Nobumi; Sakitani, Kosuke; Ijichi, Hideaki; Mori, Ryutaro; Endo, Itaru; Maeda, Shin

    2018-04-18

    Pancreatic ductal adenocarcinoma (PDA) has a 5-year survival rate of less than 5% and is the sixth leading cause of cancer death. Although KRAS mutations are one of the major driver mutations in PDA, KRAS mutation alone is not sufficient to induce invasive pancreatic cancer in mice model. HER2, also known as ERBB2, is a receptor tyrosine kinase, and overexpression of HER2 is associated with poor clinical outcomes in pancreatic cancer. However, no report has shown whether HER2 and its downstream signaling contributes to the pancreatic cancer development. By immunohistochemical analysis in human cases, HER2 protein expression was detected in 40% of PDAs and 29% of intraductal papillary mucinous carcinomas, another type of pancreatic cancer. In a mouse model, we showed overexpression of activated HER2 (HER2 NT ) in the pancreas, in which cystic neoplastic lesions resembling intraductal papillary mucinous neoplasm-like lesions in humans had developed. We also found that HER2 NT cooperated with oncogenic Kras to accelerate the development of pancreatic intraepithelial neoplasms. In addition, using pancreatic organoids in 3D cultures, we found that organoids cultured from HER2 NT /Kras double transgenic mice showed proliferative potential and tumorigenic ability cooperatively. HER2-signaling inhibition was suggested to be an new therapeutic target in some types of PDAs.

  3. Analysis of cystic fibrosis gener product (CFTR) function in patients with pancreas divisum and recurrent acute pancreatitis.

    PubMed

    Gelrud, Andres; Sheth, Sunil; Banerjee, Subhas; Weed, Deborah; Shea, Julie; Chuttani, Ram; Howell, Douglas A; Telford, Jennifer J; Carr-Locke, David L; Regan, Meredith M; Ellis, Lynda; Durie, Peter R; Freedman, Steven D

    2004-08-01

    The mechanism by which pancreas divisum may lead to recurrent episodes of acute pancreatitis in a subset of individuals is unknown. Abnormalities of the cystic fibrosis gene product (CFTR) have been implicated in the genesis of idiopathic chronic pancreatitis. The aim of this study was to determine if CFTR function is abnormal in patients with pancreas divisum and recurrent acute pancreatitis (PD/RAP). A total of 69 healthy control subjects, 12 patients with PD/RAP, 16 obligate heterozygotes with a single CFTR mutation, and 95 patients with cystic fibrosis were enrolled. CFTR function was analyzed by nasal transepithelial potential difference testing in vivo. The outcomes of the PD/RAP patients following endoscopic and surgical treatments were concomitantly analyzed. Direct measurement of CFTR function in nasal epithelium in response to isoproterenol demonstrated that the values for PD/RAP were intermediate between those observed for healthy controls and cystic fibrosis patients. The median value was 13 mV for PD/RAP subjects, which was statistically different from healthy controls (22 mV, p= 0.001) and cystic fibrosis pancreatic sufficient (-1 mV, p < 0.0001) and pancreatic insufficient (-3 mV, p < 0.0001) patients. These results suggest a link between CFTR dysfunction and recurrent acute pancreatitis in patients with pancreas divisum and may explain why a subset of patients with pancreas divisum develops recurrent acute pancreatitis. Copyright 2004 American College of Gastroenterology

  4. Laser desorption mass spectrometry for molecular diagnosis

    NASA Astrophysics Data System (ADS)

    Chen, C. H. Winston; Taranenko, N. I.; Zhu, Y. F.; Allman, S. L.; Tang, K.; Matteson, K. J.; Chang, L. Y.; Chung, C. N.; Martin, Steve; Haff, Lawrence

    1996-04-01

    Laser desorption mass spectrometry has been used for molecular diagnosis of cystic fibrosis. Both 3-base deletion and single-base point mutation have been successfully detected by clinical samples. This new detection method can possibly speed up the diagnosis by one order of magnitude in the future. It may become a new biotechnology technique for population screening of genetic disease.

  5. CFTR rescue with VX-809 and VX-770 favors the repair of primary airway epithelial cell cultures from patients with class II mutations in the presence of Pseudomonas aeruginosa exoproducts.

    PubMed

    Adam, Damien; Bilodeau, Claudia; Sognigbé, Laura; Maillé, Émilie; Ruffin, Manon; Brochiero, Emmanuelle

    2018-04-13

    Progressive airway damage due to bacterial infections, especially with Pseudomonas aeruginosa remains the first cause of morbidity and mortality in CF patients. Our previous work revealed a repair delay in CF airway epithelia compared to non-CF. This delay was partially prevented after CFTR correction (with VRT-325) in the absence of infection. Our goals were now to evaluate the effect of the Orkambi combination (CFTR VX-809 corrector + VX-770 potentiator) on the repair of CF primary airway epithelia, in infectious conditions. Primary airway epithelial cell cultures from patients with class II mutations were mechanically injured and wound healing rates and transepithelial resistances were monitored after CFTR rescue, in the absence and presence of P. aeruginosa exoproducts. Our data revealed that combined treatment with VX-809 and VX-770 elicited a greater beneficial impact on airway epithelial repair than VX-809 alone, in the absence of infection. The treatment with Orkambi was effective not only in airway epithelial cell cultures from patients homozygous for the F508del mutation but also from heterozygous patients carrying F508del and another class II mutation (N1303 K, I507del). The stimulatory effect of the Orkambi treatment was prevented by CFTR inhibition with GlyH101. Finally, Orkambi combination elicited a slight but significant improvement in airway epithelial repair and transepithelial resistance, despite the presence of P. aeruginosa exoproducts. Our findings indicate that Orkambi may favor airway epithelial integrity in CF patients with class II mutations. Complementary approaches would however be needed to further improve CFTR rescue and airway epithelial repair. Copyright © 2018 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  6. Genetics Home Reference: medullary cystic kidney disease type 1

    MedlinePlus

    ... They lead to the production of an altered protein. It is unclear how this change causes kidney disease. ... cystic kidney disease type 1 lie in a large VNTR in MUC1 missed by massively parallel sequencing. Nat Genet. 2013 Mar;45(3):299-303. ...

  7. Distal intestinal obstruction syndrome and colonic pathologies in cystic fibrosis.

    PubMed

    Canny, J D; Brookes, A; Bowley, D B

    2017-01-02

    The management of abdominal pain in cystic fibrosis can be complicated. Distal intestinal obstruction syndrome is a common cause of pain and obstruction in these patients. Knowledge of the diagnosis and management and of similar presenting symptoms is essential for the hospital doctor.

  8. Epithelial IgG and its relationship to the loss of F508 in the common mutant form of the cystic fibrosis transmembrane conductance regulator.

    PubMed

    Treharne, Kate J; Cassidy, Diane; Goddard, Catharine; Colledge, William H; Cassidy, Andrew; Mehta, Anil

    2009-08-06

    The most debilitating feature of cystic fibrosis (CF) disease is uncontrolled inflammation of respiratory epithelium. The relationship between the commonest mutated form of CFTR (F508del or DeltaF508) and inflammation has not yet been elucidated. Here, we present a new paradigm suggesting that CFTR can interact with intra-epithelial IgG, establishing a direct link between normal CFTR and the immune system. Further, our data show that the amino-acid sequence local to F508 can bind IgG with high affinity, dependent on F508, such that loss of F508 abolishes this link both in vitro and in the intact cell.

  9. Expression of the cystic fibrosis transmembrane conductance regulator gene in the respiratory tract of normal individuals and individuals with cystic fibrosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trapnell, B.C.; Chinshyan Chu; Paakko, P.K.

    1991-08-01

    The most common mutation of the cystic fibrosis transmembrane conductance regulator gene, CFTR, associated with the clinical disorder cystic fibrosis (CF) is called {Delta}Phe{sup 508}, a triple-base deletion resulting in loss of phenylalanine at residue 508 of the predicted 1480-amino acid CFTR protein. In the context that the lung is the major site of morbidity and mortality in CF, the authors evaluated airway epithelial cells for CFTR mRNA transcripts in normal individuals, normal-{Delta}Phe{sup 508} heterozygotes, and {Delta}Phe{sup 508} homozygotes to determine if the normal and {Delta}Phe{sup 508} CFTR alleles are expressed in the respiratory epithelium, to what extent they aremore » expressed, and whether there are relative differences in the expression of the normal and abnormal alleles at the mRNA level. Respiratory tract epithelial cells recovered by fiberoptic bronchoscopy with a cytology brush demonstrated CFTR mRNA transcripts with sequences appropriately reflecting the normal and {Delta}Phe{sup 508} CFTR alleles of the various study groups. CFTR gene expression quantified by limited polymerase chain reaction amplification showed that in normal individuals, CFTR mRNA transcripts are expressed in nasal, tracheal, and bronchial epithelial cells.« less

  10. Gain-of-Function Mutation W493R in the Epithelial Sodium Channel Allosterically Reconfigures Intersubunit Coupling*♦

    PubMed Central

    Shobair, Mahmoud; Dagliyan, Onur; Kota, Pradeep; Dang, Yan L.; He, Hong; Stutts, M. Jackson; Dokholyan, Nikolay V.

    2016-01-01

    Sodium absorption in epithelial cells is rate-limited by the epithelial sodium channel (ENaC) activity in lung, kidney, and the distal colon. Pathophysiological conditions, such as cystic fibrosis and Liddle syndrome, result from water-electrolyte imbalance partly due to malfunction of ENaC regulation. Because the quaternary structure of ENaC is yet undetermined, the bases of pathologically linked mutations in ENaC subunits α, β, and γ are largely unknown. Here, we present a structural model of heterotetrameric ENaC α1βα2γ that is consistent with previous cross-linking results and site-directed mutagenesis experiments. By using this model, we show that the disease-causing mutation αW493R rewires structural dynamics of the intersubunit interfaces α1β and α2γ. Changes in dynamics can allosterically propagate to the channel gate. We demonstrate that cleavage of the γ-subunit, which is critical for full channel activation, does not mediate activation of ENaC by αW493R. Our molecular dynamics simulations led us to identify a channel-activating electrostatic interaction between α2Arg-493 and γGlu-348 at the α2γ interface. By neutralizing a sodium-binding acidic patch at the α1β interface, we reduced ENaC activation of αW493R by more than 2-fold. By combining homology modeling, molecular dynamics, cysteine cross-linking, and voltage clamp experiments, we propose a dynamics-driven model for the gain-of-function in ENaC by αW493R. Our integrated computational and experimental approach advances our understanding of structure, dynamics, and function of ENaC in its disease-causing state. PMID:26668308

  11. A Combination of Molecular Markers and Clinical Features Improve the Classification of Pancreatic Cysts

    PubMed Central

    Springer, Simeon; Wang, Yuxuan; Molin, Marco Dal; Masica, David L.; Jiao, Yuchen; Kinde, Isaac; Blackford, Amanda; Raman, Siva P.; Wolfgang, Christopher L.; Tomita, Tyler; Niknafs, Noushin; Douville, Christopher; Ptak, Janine; Dobbyn, Lisa; Allen, Peter J.; Klimstra, David S.; Schattner, Mark A.; Schmidt, C. Max; Yip-Schneider, Michele; Cummings, Oscar W.; Brand, Randall E.; Zeh, Herbert J.; Singhi, Aatur D.; Scarpa, Aldo; Salvia, Roberto; Malleo, Giuseppe; Zamboni, Giuseppe; Falconi, Massimo; Jang, Jin-Young; Kim, Sun-Whe; Kwon, Wooil; Hong, Seung-Mo; Song, Ki-Byung; Kim, Song Cheol; Swan, Niall; Murphy, Jean; Geoghegan, Justin; Brugge, William; Fernandez-Del Castillo, Carlos; Mino-Kenudson, Mari; Schulick, Richard; Edil, Barish H.; Adsay, Volkan; Paulino, Jorge; van Hooft, Jeanin; Yachida, Shinichi; Nara, Satoshi; Hiraoka, Nobuyoshi; Yamao, Kenji; Hijioka, Susuma; van der Merwe, Schalk; Goggins, Michael; Canto, Marcia Irene; Ahuja, Nita; Hirose, Kenzo; Makary, Martin; Weiss, Matthew J.; Cameron, John; Pittman, Meredith; Eshleman, James R.; Diaz, Luis A.; Papadopoulos, Nickolas; Kinzler, Kenneth W.; Karchin, Rachel; Hruban, Ralph H.; Vogelstein, Bert; Lennon, Anne Marie

    2016-01-01

    Background & Aims The management of pancreatic cysts poses challenges to both patients and their physicians. We investigated whether a combination of molecular markers and clinical information could improve the classification of pancreatic cysts and management of patients. Methods We performed a multi-center, retrospective study of 130 patients with resected pancreatic cystic neoplasms (12 serous cystadenomas, 10 solid-pseudopapillary neoplasms, 12 mucinous cystic neoplasms, and 96 intraductal papillary mucinous neoplasms). Cyst fluid was analyzed to identify subtle mutations in genes known to be mutated in pancreatic cysts (BRAF, CDKN2A, CTNNB1, GNAS, KRAS, NRAS, PIK3CA, RNF43, SMAD4, TP53 and VHL); to identify loss of heterozygozity at CDKN2A, RNF43, SMAD4, TP53, and VHL tumor suppressor loci; and to identify aneuploidy. The analyses were performed using specialized technologies for implementing and interpreting massively parallel sequencing data acquisition. An algorithm was used to select markers that could classify cyst type and grade. The accuracy of the molecular markers were compared with that of clinical markers, and a combination of molecular and clinical markers. Results We identified molecular markers and clinical features that classified cyst type with 90%–100% sensitivity and 92%–98% specificity. The molecular marker panel correctly identified 67 of the 74 patients who did not require surgery, and could therefore reduce the number of unnecessary operations by 91%. Conclusions We identified a panel of molecular markers and clinical features that show promise for the accurate classification of cystic neoplasms of the pancreas and identification of cysts that require surgery. PMID:26253305

  12. Loss of Cystic Fibrosis Transmembrane Conductance Regulator Function Enhances Activation of p38 and ERK MAPKs, Increasing Interleukin-6 Synthesis in Airway Epithelial Cells Exposed to Pseudomonas aeruginosa*

    PubMed Central

    Bérubé, Julie; Roussel, Lucie; Nattagh, Leila; Rousseau, Simon

    2010-01-01

    In cystic fibrosis (CF), the absence of functional cystic fibrosis transmembrane conductance regulator (CFTR) translates into chronic bacterial infection, excessive inflammation, tissue damage, impaired lung function and eventual death. Understanding the mechanisms underlying this vicious circle of inflammation is important to design better therapies for CF. We found in CF lung biopsies increased immunoreactivity for p38 MAPK activity markers. Moreover, when compared with their non-CF counterpart, airway epithelial cells expressing the most common mutation in CF (CFTRΔF508) were more potent at inducing neutrophil chemotaxis through increased interleukin (IL)-6 synthesis when challenged with Pseudomonas aeruginosa diffusible material. We then discovered that in CFTRΔF508 cells, the p38 and ERK MAPKs are hyperactivated in response to P. aeruginosa diffusible material, leading to increased IL-6 mRNA expression and stability. Moreover, although TLR5 contributes to p38 MAPK activation upon P. aeruginosa challenge, it only played a weak role in IL-6 synthesis. Instead, we found that the production of reactive oxygen species is essential for IL-6 synthesis in response to P. aeruginosa diffusible material. Finally, we uncovered that in CFTRΔF508 cells, the extracellular glutathione levels are decreased, leading to a greater sensitivity to reactive oxygen species, providing an explanation for the hyperactivation of the p38 and ERK MAPKs and increased IL-6 synthesis. Taken together, our study has characterized a mechanism whereby the CFTRΔF508 mutation in airway epithelial cells contributes to increase inflammation of the airways. PMID:20460375

  13. Aspergillus fumigatus Preexposure Worsens Pathology and Improves Control of Mycobacterium abscessus Pulmonary Infection in Mice.

    PubMed

    Monin, Leticia; Mehta, Shail; Elsegeiny, Waleed; Gopal, Radha; McAleer, Jeremy P; Oury, Tim D; Kolls, Jay; Khader, Shabaana A

    2018-03-01

    Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. Mutations in this chloride channel lead to mucus accumulation, subsequent recurrent pulmonary infections, and inflammation, which, in turn, cause chronic lung disease and respiratory failure. Recently, rates of nontuberculous mycobacterial (NTM) infections in CF patients have been increasing. Of particular relevance is infection with Mycobacterium abscessus , which causes a serious, life-threatening disease and constitutes one of the most antibiotic-resistant NTM species. Interestingly, an increased prevalence of NTM infections is associated with worsening lung function in CF patients who are also coinfected with Aspergillus fumigatus We established a new mouse model to investigate the relationship between A. fumigatus and M. abscessus pulmonary infections. In this model, animals exposed to A. fumigatus and coinfected with M. abscessus exhibited increased lung inflammation and decreased mycobacterial burden compared with those of mice infected with M. abscessus alone. This increased control of M. abscessus infection in coinfected mice was mucus independent but dependent on both transcription factors T-box 21 (Tbx21) and retinoic acid receptor (RAR)-related orphan receptor gamma t (RORγ-t), master regulators of type 1 and type 17 immune responses, respectively. These results implicate a role for both type 1 and type 17 responses in M. abscessus control in A. fumigatus -coinfected lungs. Our results demonstrate that A. fumigatus , an organism found commonly in CF patients with NTM infection, can worsen pulmonary inflammation and impact M. abscessus control in a mouse model. Copyright © 2018 American Society for Microbiology.

  14. A CFTR potentiator in patients with cystic fibrosis and the G551D mutation.

    PubMed

    Ramsey, Bonnie W; Davies, Jane; McElvaney, N Gerard; Tullis, Elizabeth; Bell, Scott C; Dřevínek, Pavel; Griese, Matthias; McKone, Edward F; Wainwright, Claire E; Konstan, Michael W; Moss, Richard; Ratjen, Felix; Sermet-Gaudelus, Isabelle; Rowe, Steven M; Dong, Qunming; Rodriguez, Sally; Yen, Karl; Ordoñez, Claudia; Elborn, J Stuart

    2011-11-03

    Increasing the activity of defective cystic fibrosis transmembrane conductance regulator (CFTR) protein is a potential treatment for cystic fibrosis. We conducted a randomized, double-blind, placebo-controlled trial to evaluate ivacaftor (VX-770), a CFTR potentiator, in subjects 12 years of age or older with cystic fibrosis and at least one G551D-CFTR mutation. Subjects were randomly assigned to receive 150 mg of ivacaftor every 12 hours (84 subjects, of whom 83 received at least one dose) or placebo (83, of whom 78 received at least one dose) for 48 weeks. The primary end point was the estimated mean change from baseline through week 24 in the percent of predicted forced expiratory volume in 1 second (FEV(1)). The change from baseline through week 24 in the percent of predicted FEV(1) was greater by 10.6 percentage points in the ivacaftor group than in the placebo group (P<0.001). Effects on pulmonary function were noted by 2 weeks, and a significant treatment effect was maintained through week 48. Subjects receiving ivacaftor were 55% less likely to have a pulmonary exacerbation than were patients receiving placebo, through week 48 (P<0.001). In addition, through week 48, subjects in the ivacaftor group scored 8.6 points higher than did subjects in the placebo group on the respiratory-symptoms domain of the Cystic Fibrosis Questionnaire-revised instrument (a 100-point scale, with higher numbers indicating a lower effect of symptoms on the patient's quality of life) (P<0.001). By 48 weeks, patients treated with ivacaftor had gained, on average, 2.7 kg more weight than had patients receiving placebo (P<0.001). The change from baseline through week 48 in the concentration of sweat chloride, a measure of CFTR activity, with ivacaftor as compared with placebo was -48.1 mmol per liter (P<0.001). The incidence of adverse events was similar with ivacaftor and placebo, with a lower proportion of serious adverse events with ivacaftor than with placebo (24% vs. 42%). Ivacaftor was associated with improvements in lung function at 2 weeks that were sustained through 48 weeks. Substantial improvements were also observed in the risk of pulmonary exacerbations, patient-reported respiratory symptoms, weight, and concentration of sweat chloride. (Funded by Vertex Pharmaceuticals and others; VX08-770-102 ClinicalTrials.gov number, NCT00909532.).

  15. Is acute recurrent pancreatitis in children a precursor of chronic pancreatitis? A long-term follow-up study of 93 cases.

    PubMed

    Poddar, Ujjal; Yachha, Surender K; Borkar, Vibhor; Srivastava, Anshu

    2017-07-01

    In view of paucity of literature we analyzed our experience of acute recurrent pancreatitis (ARP) to study clinical profile and long-term outcome. Over 13 years, 93 consecutive children (≤18 years) diagnosed to have ARP were included in this study. Magnetic resonance cholangiopancreatography was done at baseline and on follow-up. Common mutations for serine-protease-inhibitor (SPINK1 N34S), protease inhibitor (PRSS1 R122S) and cystic fibrosis transmembrane conductance regulator (CFTR deltaF508, 5T) were studied in 22 idiopathic cases. The median age of the children with ARP was 13 (10-14.5) years, 53 were males. Etiology included biliary in 14 (15%), pancreas divisum in 6 (7%), others in 3 (3.5%) and idiopathic in the remaining 70 (75%). SPINK1 mutation was found in 10/22 (45%) cases. Over a median follow-up of 25.5 (8.25-48) months, 37 (42%) of 88 (5 lost to follow-up) developed chronic pancreatitis (CP). On multivariate analysis idiopathic etiology (p<0.03), presence of SPINK1 mutation (p=0.01), longer follow-up (p<0.001) were associated with progression to CP. Biliopancreatic structural/obstructive causes should always be looked for. It seems ARP is a precursor of CP and progression is associated with idiopathic etiology and presence of genetic mutations. Hence, patients with ARP should be kept on regular follow-up to detect CP. Copyright © 2017 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  16. Prenatal diagnosis of Wolf-Hirschhorn syndrome (4p-) in association with congenital diaphragmatic hernia, cystic hygroma and IUGR.

    PubMed

    Basgul, A; Kavak, Z N; Akman, I; Basgul, A; Gokaslan, H; Elcioglu, N

    2006-01-01

    Wolf-Hirschhorn syndrome (WHS) is a rare distinct clinical entity caused by a deletion of the short arm of chromosome 4. We report a case in which intrauterine growth restriction (IUGR), severe oligohydramnios, left-sided congenital diaphragmtic hernia (CDH), and cystic hygroma were detected by prenatal ultrasound examination at 27 weeks of gestation. A 29-year-old gravida 3, para 2, woman was referred at 26 weeks' gestation with suspicion of IUGR and cystic hygroma. Sonographic examination revealed IUGR with severe oligohydramnios, increased nuchal fold with cystic hygroma (left-sided diaphragmatic defect of Bochdalek type), and congenital diaphragmatic hernia. Chromosome analysis revealed a 46, XX, del(4)(p15.2) karyotype. Autopsy confirmed the ultrasound findings. Congenital diaphragmatic hernia (CDH) has rarely been described to be associated with WHS. CDH and cystic hygroma can lead to a diagnosis of this syndrome very early in life. We recommend genetic evaluation of a fetus with cystic hygroma, IUGR and CDH taking into consideration 4p deletion syndrome.

  17. Intrinsic pro-angiogenic status of cystic fibrosis airway epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Verhaeghe, Catherine; Tabruyn, Sebastien P.; Oury, Cecile

    Cystic fibrosis is a common genetic disorder characterized by a severe lung inflammation and fibrosis leading to the patient's death. Enhanced angiogenesis in cystic fibrosis (CF) tissue has been suggested, probably caused by the process of inflammation, as similarly described in asthma and chronic bronchitis. The present study demonstrates an intrinsic pro-angiogenic status of cystic fibrosis airway epithelial cells. Microarray experiments showed that CF airway epithelial cells expressed several angiogenic factors such as VEGF-A, VEGF-C, bFGF, and PLGF at higher levels than control cells. These data were confirmed by real-time quantitative PCR and, at the protein level, by ELISA. Conditionedmore » media of these cystic fibrosis cells were able to induce proliferation, migration and sprouting of cultured primary endothelial cells. This report describes for the first time that cystic fibrosis epithelial cells have an intrinsic angiogenic activity. Since excess of angiogenesis is correlated with more severe pulmonary disease, our results could lead to the development of new therapeutic applications.« less

  18. Chronic Rhinovirus Infection in an Adult with Cystic Fibrosis

    PubMed Central

    Bright-Thomas, Rowland J.; Tilston, Peter; Mutton, Kenneth J.; Guiver, Malcolm; Webb, A. Kevin; Jones, Andrew M.

    2013-01-01

    Rhinovirus is a common cause of exacerbations of cystic fibrosis (CF) and is usually considered a self-limiting infection. We report a case of chronic infection with rhinovirus A type 33 in a 43-year-old male with CF which has persisted for over 2 years. PMID:23966488

  19. Detection of Hot-Spot Mutations in Circulating Cell-Free DNA From Patients With Intraductal Papillary Mucinous Neoplasms of the Pancreas.

    PubMed

    Berger, Andreas W; Schwerdel, Daniel; Costa, Ivan G; Hackert, Thilo; Strobel, Oliver; Lam, Sandra; Barth, Thomas F; Schröppel, Bernd; Meining, Alexander; Büchler, Markus W; Zenke, Martin; Hermann, Patrick C; Seufferlein, Thomas; Kleger, Alexander

    2016-08-01

    Intraductal papillary mucinous neoplasms (IPMNs) are the most frequent cystic pancreatic tumors. Little is known about their molecular alterations, but mutations in GNAS have been reported to promote IPMN formation. A tumor-derived fraction of circulating cell-free DNA (cfDNA), isolated from blood samples, contains many of the same mutations as the primary tumor, and could be a tool for noninvasive disease monitoring. We found that the total amount of cfDNA can discriminate between individuals without pancreatic lesions (controls) and patients with Fukuoka-negative branch-duct IPMN or pancreatic cancer. Furthermore, we detected GNAS mutations in cfDNA from patients with IPMN, but not in patients with serous cystadenoma or controls. Analyses of cfDNA might therefore be used in the diagnosis of patients with IPMN or in monitoring disease progression. Copyright © 2016 AGA Institute. Published by Elsevier Inc. All rights reserved.

  20. Air trapping and airflow obstruction in newborn cystic fibrosis piglets.

    PubMed

    Adam, Ryan J; Michalski, Andrew S; Bauer, Christian; Abou Alaiwa, Mahmoud H; Gross, Thomas J; Awadalla, Maged S; Bouzek, Drake C; Gansemer, Nicholas D; Taft, Peter J; Hoegger, Mark J; Diwakar, Amit; Ochs, Matthias; Reinhardt, Joseph M; Hoffman, Eric A; Beichel, Reinhard R; Meyerholz, David K; Stoltz, David A

    2013-12-15

    Air trapping and airflow obstruction are being increasingly identified in infants with cystic fibrosis. These findings are commonly attributed to airway infection, inflammation, and mucus buildup. To learn if air trapping and airflow obstruction are present before the onset of airway infection and inflammation in cystic fibrosis. On the day they are born, piglets with cystic fibrosis lack airway infection and inflammation. Therefore, we used newborn wild-type piglets and piglets with cystic fibrosis to assess air trapping, airway size, and lung volume with inspiratory and expiratory X-ray computed tomography scans. Micro-computed tomography scanning was used to assess more distal airway sizes. Airway resistance was determined with a mechanical ventilator. Mean linear intercept and alveolar surface area were determined using stereologic methods. On the day they were born, piglets with cystic fibrosis exhibited air trapping more frequently than wild-type piglets (75% vs. 12.5%, respectively). Moreover, newborn piglets with cystic fibrosis had increased airway resistance that was accompanied by luminal size reduction in the trachea, mainstem bronchi, and proximal airways. In contrast, mean linear intercept length, alveolar surface area, and lung volume were similar between both genotypes. The presence of air trapping, airflow obstruction, and airway size reduction in newborn piglets with cystic fibrosis before the onset of airway infection, inflammation, and mucus accumulation indicates that cystic fibrosis impacts airway development. Our findings suggest that early airflow obstruction and air trapping in infants with cystic fibrosis might, in part, be caused by congenital airway abnormalities.

  1. Conserved Allosteric Hot Spots in the Transmembrane Domains of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Channels and Multidrug Resistance Protein (MRP) Pumps*

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Chauvet, Sylvain; Guo, Jingyu; Hartman, John L.; Kirk, Kevin L.

    2014-01-01

    ATP-binding cassette (ABC) transporters are an ancient family of transmembrane proteins that utilize ATPase activity to move substrates across cell membranes. The ABCC subfamily of the ABC transporters includes active drug exporters (the multidrug resistance proteins (MRPs)) and a unique ATP-gated ion channel (cystic fibrosis transmembrane conductance regulator (CFTR)). The CFTR channel shares gating principles with conventional ligand-gated ion channels, but the allosteric network that couples ATP binding at its nucleotide binding domains (NBDs) with conformational changes in its transmembrane helices (TMs) is poorly defined. It is also unclear whether the mechanisms that govern CFTR gating are conserved with the thermodynamically distinct MRPs. Here we report a new class of gain of function (GOF) mutation of a conserved proline at the base of the pore-lining TM6. Multiple substitutions of this proline promoted ATP-free CFTR activity and activation by the weak agonist, 5′-adenylyl-β,γ-imidodiphosphate (AMP-PNP). TM6 proline mutations exhibited additive GOF effects when combined with a previously reported GOF mutation located in an outer collar of TMs that surrounds the pore-lining TMs. Each TM substitution allosterically rescued the ATP sensitivity of CFTR gating when introduced into an NBD mutant with defective ATP binding. Both classes of GOF mutations also rescued defective drug export by a yeast MRP (Yor1p) with ATP binding defects in its NBDs. We conclude that the conserved TM6 proline helps set the energy barrier to both CFTR channel opening and MRP-mediated drug efflux and that CFTR channels and MRP pumps utilize similar allosteric mechanisms for coupling conformational changes in their translocation pathways to ATP binding at their NBDs. PMID:24876383

  2. Conserved allosteric hot spots in the transmembrane domains of cystic fibrosis transmembrane conductance regulator (CFTR) channels and multidrug resistance protein (MRP) pumps.

    PubMed

    Wei, Shipeng; Roessler, Bryan C; Chauvet, Sylvain; Guo, Jingyu; Hartman, John L; Kirk, Kevin L

    2014-07-18

    ATP-binding cassette (ABC) transporters are an ancient family of transmembrane proteins that utilize ATPase activity to move substrates across cell membranes. The ABCC subfamily of the ABC transporters includes active drug exporters (the multidrug resistance proteins (MRPs)) and a unique ATP-gated ion channel (cystic fibrosis transmembrane conductance regulator (CFTR)). The CFTR channel shares gating principles with conventional ligand-gated ion channels, but the allosteric network that couples ATP binding at its nucleotide binding domains (NBDs) with conformational changes in its transmembrane helices (TMs) is poorly defined. It is also unclear whether the mechanisms that govern CFTR gating are conserved with the thermodynamically distinct MRPs. Here we report a new class of gain of function (GOF) mutation of a conserved proline at the base of the pore-lining TM6. Multiple substitutions of this proline promoted ATP-free CFTR activity and activation by the weak agonist, 5'-adenylyl-β,γ-imidodiphosphate (AMP-PNP). TM6 proline mutations exhibited additive GOF effects when combined with a previously reported GOF mutation located in an outer collar of TMs that surrounds the pore-lining TMs. Each TM substitution allosterically rescued the ATP sensitivity of CFTR gating when introduced into an NBD mutant with defective ATP binding. Both classes of GOF mutations also rescued defective drug export by a yeast MRP (Yor1p) with ATP binding defects in its NBDs. We conclude that the conserved TM6 proline helps set the energy barrier to both CFTR channel opening and MRP-mediated drug efflux and that CFTR channels and MRP pumps utilize similar allosteric mechanisms for coupling conformational changes in their translocation pathways to ATP binding at their NBDs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Prevalence and characterization of azole-resistant Aspergillus fumigatus in patients with cystic fibrosis: a prospective multicentre study in Germany.

    PubMed

    Seufert, R; Sedlacek, L; Kahl, B; Hogardt, M; Hamprecht, A; Haase, G; Gunzer, F; Haas, A; Grauling-Halama, S; MacKenzie, C R; Essig, A; Stehling, F; Sutharsan, S; Dittmer, S; Killengray, D; Schmidt, D; Eskandarian, N; Steinmann, E; Buer, J; Hagen, F; Meis, J F; Rath, P-M; Steinmann, J

    2018-04-19

    Aspergillus fumigatus is the most prevalent filamentous fungus in the respiratory tract of patients with cystic fibrosis (CF). The aim of this prospective multicentre study was to investigate the prevalence of azole-resistant A. fumigatus (ARAF) in respiratory secretions from CF patients across Germany and to characterize ARAF isolates by phenotypic and molecular methods. Twelve tertiary care centres from Germany participated in the study. In total, 2888 A. fumigatus isolates from 961 CF patients were screened for ARAF by using azole-containing agar plates. Antifungal susceptibility testing of isolates was performed by broth microdilution according to EUCAST guidelines. Analysis of mutations mediating resistance was performed using PCR and sequencing of the cyp51A gene. Furthermore, genotyping by microsatellite PCR was performed. Of a total of 2888 A. fumigatus isolates, 101 isolates from 51 CF patients were found to be azole resistant (prevalence per patient 5.3%). The Essen centre had the highest prevalence (9.1%) followed by Munich (7.8%), Münster (6.0%) and Hannover (5.2%). Most ARAF isolates (n = 89) carried the TR34/L98H mutation followed by eight G54E/R, one TR46/Y121F/T289A and one F219S mutation. In two isolates no mutation was found. Genotyping results showed no major clustering. Forty-five percent of CF patients with ARAF had previously received azole therapy. This is the first multicentre study analysing the prevalence of ARAF isolates in German CF patients. Because of a resistance rate of up to 9%, susceptibility testing of A. fumigatus isolates from CF patients receiving antifungal treatment should be part of standard diagnostic work-up.

  4. Aspergillus sensitization or carriage in cystic fibrosis patients.

    PubMed

    Fillaux, Judith; Brémont, François; Murris, Marlène; Cassaing, Sophie; Tétu, Laurent; Segonds, Christine; Pipy, Bernard; Magnaval, Jean-François

    2014-07-01

    Aspergillus fumigatus (Af) sensitization and persistent carriage are deleterious to lung function, but no consensus has been reached defining these medical entities. This work aimed to identify possible predictive factors for patients who become sensitized to Af, compared with a control group of non-sensitized Af carriers. Between 1995 and 2007, 117 pediatric patients were evaluated. Demographic data, CFTR gene mutations, body mass index and FEV1 were recorded. The presence of Af in sputum, the levels of Af-precipitin, total IgE (t-IgE) and specific IgE to Af (Af-IgE) were determined. Patients were divided into 2 groups: (1) "sensitization": level of Af-IgE > 0.35 IU/mL with t-IgE level < 500 IU/mL and (2) "persistent or transient carriage": Af-IgE level ≤ 0.35 IU/mL with either an Af transient or persistent positive culture. A survival analysis was performed with the appearance of Af-IgE in serum as an outcome variable. Severe mutation (hazard ratio = 3.2), FEV1 baseline over 70% of theoretical value (hazard ratio = 4.9), absence of Pa colonization, catalase activity and previous azithromycin administration (hazard ratio = 9.8, 4.1 and 1.9, respectively) were predictive factors for sensitization. We propose a timeline of the biological events and a tree diagram for risk calculation. Two profiles of cystic fibrosis patients can be envisaged: (1) patients with nonsevere mutation but low FEV1 baselines are becoming colonized with Af or (2) patients with high FEV1 baselines who present with severe mutation are more susceptible to the Af sensitization and then to the presentation of an allergic bronchopulmonary aspergillosis event.

  5. CC2D2A Is Mutated in Joubert Syndrome and Interacts with the Ciliopathy-Associated Basal Body Protein CEP290

    PubMed Central

    Gorden, Nicholas T.; Arts, Heleen H.; Parisi, Melissa A.; Coene, Karlien L.M.; Letteboer, Stef J.F.; van Beersum, Sylvia E.C.; Mans, Dorus A.; Hikida, Abigail; Eckert, Melissa; Knutzen, Dana; Alswaid, Abdulrahman F.; Özyurek, Hamit; Dibooglu, Sel; Otto, Edgar A.; Liu, Yangfan; Davis, Erica E.; Hutter, Carolyn M.; Bammler, Theo K.; Farin, Frederico M.; Dorschner, Michael; Topçu, Meral; Zackai, Elaine H.; Rosenthal, Phillip; Owens, Kelly N.; Katsanis, Nicholas; Vincent, John B.; Hildebrandt, Friedhelm; Rubel, Edwin W.; Raible, David W.; Knoers, Nine V.A.M.; Chance, Phillip F.; Roepman, Ronald; Moens, Cecilia B.; Glass, Ian A.; Doherty, Dan

    2008-01-01

    Joubert syndrome and related disorders (JSRD) are primarily autosomal-recessive conditions characterized by hypotonia, ataxia, abnormal eye movements, and intellectual disability with a distinctive mid-hindbrain malformation. Variable features include retinal dystrophy, cystic kidney disease, and liver fibrosis. JSRD are included in the rapidly expanding group of disorders called ciliopathies, because all six gene products implicated in JSRD (NPHP1, AHI1, CEP290, RPGRIP1L, TMEM67, and ARL13B) function in the primary cilium/basal body organelle. By using homozygosity mapping in consanguineous families, we identify loss-of-function mutations in CC2D2A in JSRD patients with and without retinal, kidney, and liver disease. CC2D2A is expressed in all fetal and adult tissues tested. In ciliated cells, we observe localization of recombinant CC2D2A at the basal body and colocalization with CEP290, whose cognate gene is mutated in multiple hereditary ciliopathies. In addition, the proteins can physically interact in vitro, as shown by yeast two-hybrid and GST pull-down experiments. A nonsense mutation in the zebrafish CC2D2A ortholog (sentinel) results in pronephric cysts, a hallmark of ciliary dysfunction analogous to human cystic kidney disease. Knockdown of cep290 function in sentinel fish results in a synergistic pronephric cyst phenotype, revealing a genetic interaction between CC2D2A and CEP290 and implicating CC2D2A in cilium/basal body function. These observations extend the genetic spectrum of JSRD and provide a model system for studying extragenic modifiers in JSRD and other ciliopathies. PMID:18950740

  6. CFTR DeltaF508 mutation detection from dried blood samples in the first trimester of pregnancy: a possible routine prenatal screening strategy for cystic fibrosis?

    PubMed

    Konialis, Christopher P; Hagnefelt, Birgitta; Kazamia, Constantina; Karapanou, Sophia; Pangalos, Constantinos

    2007-01-01

    The implementation and evaluation of a proposed wide-scale prenatal screening strategy, based on DNA isolated from dried blood spots in the first trimester of pregnancy, for the early detection of pregnancies at risk for cystic fibrosis (CF). The screening was performed in conjunction with routine biochemical marker screening for Down's syndrome risk in the first trimester of pregnancy. DNA was isolated from 1,233 dried blood spots and analyzed for the presence of the CF transmembrane regulator DeltaF508 mutation. Women carriers were offered and accepted the option for additional full testing of their partners in order to assess the risk for the fetus. All 1,233 samples were successfully analyzed, identifying 23 DeltaF508 carriers, corresponding to a DeltaF508 carrier rate of approximately 1/55 (1.8%). All partners of the women carriers were further tested without revealing any need for further prenatal testing in this group. This study reveals the relatively high frequency of the DeltaF508 CF mutation in the Greek population. More importantly, we demonstrate that the proposed prenatal screening strategy, based on the ease and cost-effectiveness of the analysis for the detection of a single common mutation, can be considered as a feasible and practical approach for wide-scale prenatal screening for CF, following the sequential model. It is applied early on in pregnancy, allowing for the timely management of families at risk for the corresponding genetic disorders. Finally, it can easily be extended to include screening for other common genetic disorders in specific population groups.

  7. Combined effects of VX-770 and VX-809 on several functional abnormalities of F508del-CFTR channels.

    PubMed

    Kopeikin, Z; Yuksek, Z; Yang, H-Y; Bompadre, S G

    2014-09-01

    The most common cystic fibrosis-associated mutation, the deletion of phenylalanine 508 (F508del), results in channels with poor membrane expression and impaired function. VX-770, a clinically approved drug for treatment of CF patients carrying the G551D mutation, and VX-809, a corrector shown in vitro to increase membrane expression of mutant channels, are currently undergoing clinical trials, but functional data at the molecular level is still lacking. The effect of VX-770 and VX-809 on the multiple functional defects of F508del-CFTR was assessed via excised inside-out patch-clamp experiments. VX-770 completely restores the low opening-rate of F508del-CFTR, with smaller open-time increase, in temperature-corrected and VX-809-treated channels. The shorter locked-open time of hydrolysis-deficient F508del-CFTR is also prolonged by VX-770. VX-809 does not improve channel function by itself as previously reported. The results from these studies can be interpreted as an equilibrium shift toward the open-channel conformation of F508del-CFTR channels. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  8. Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

    PubMed Central

    Prada, Anne E.

    2014-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation analysis has been implemented for Cystic Fibrosis (CF) carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD). Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM) curve analysis, allele-specific PCR (AS-PCR) and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing. PMID:25071991

  9. Cystic fibrosis mutations in North American populations of French ancestry: Analysis of Quebec French-Canadian and Louisiana Acadian families

    PubMed Central

    Rozen, Rima; Schwartz, Robert H.; Hilman, Bettina C.; Stanislovitis, Pat; Horn, Glenn T.; Klinger, Katherine; Daigneault, Jocelyne; De Braekeleer, Marc; Kerem, Bat-sheva; Tsui, Lap-Chee; Fujiwara, T. Mary; Morgan, Kenneth

    1990-01-01

    A 3-bp deletion (ΔF508) in the cystic fibrosis (CF) gene is the mutation on the majority of CF chromosomes. We studied 112 CF families from North American populations of French ancestry: French-Canadian families referred from hospitals in three cities in Quebec and from the Saguenay-Lac St. Jean region of northeastern Quebec and Acadian families living in Louisiana. ΔF508 was present on 71%, 55%, and 70% of the CF chromosomes from the major-urban Quebec, Saguenay-Lac St. Jean, and Louisiana Acadian families, respectively. A weighted estimate of the proportion of ΔF508 in the French-Canadian patient population of Quebec was 70%. We found that 95% of the CF chromosomes with ΔF508 had D7S23 haplotype B, the most frequent haplotype on CF chromosomes. In the Saguenay-Lac St. Jean families, 86% of the CF chromosomes without ΔF508 had the B haplotype, compared with 31% for the major-urban Quebec and Louisiana Acadian families. The incidence of CF in the Saguenay-Lac St. Jean population was 1/895 live-born infants. PMID:2220803

  10. Laparoscopic resection of adult colon duplication causing intussusception

    PubMed Central

    Kyo, Kennoki; Azuma, Masaki; Okamoto, Kazuya; Nishiyama, Motohiro; Shimamura, Takahiro; Maema, Atsushi; Shirakawa, Motoaki; Nakamura, Toshio; Koda, Kenji; Yokoyama, Hidetaro

    2016-01-01

    Gastrointestinal duplications are uncommon congenital malformations that can occur anywhere along the gastrointestinal tract. Most cases are recognized before the age of 2 years, and those encountered in adults are rare. We describe here a case of ascending colon duplication in a 20-year-old male that caused intussusception and was treated laparoscopically. Although computed tomography revealed a cystic mass filled with stool-like material, the preoperative diagnosis was a submucosal tumor of the ascending colon. We performed a laparoscopic right colectomy, and the postoperative pathological diagnosis was duplication of the ascending colon, both cystic and tubular components. We conclude that gastrointestinal duplications, although rare, should be considered in the differential diagnosis of all abdominal and submucosal cystic lesions and that laparoscopy is a preferred approach for the surgical treatment of gastrointestinal duplications. PMID:26900303

  11. Induction of ovarian cystic follicles in sheep.

    PubMed

    Christman, S A; Bailey, M T; Head, W A; Wheaton, J E

    2000-10-01

    Cystic follicles are a significant cause of infertility in women, dairy cattle and sheep. Sheep were used as a model to identify factors that may elicit formation of cystic follicles. Insulin resistance and elevated LH activity were tested in overweight ewes because of associations among these factors and the formation of cystic follicles. Sheep were synchronized using a progesterone-releasing pessary and insulin resistance was induced during the synchronization period through administration of bovine somatotropin. Following removal of pessaries follicular growth was stimulated by treatment with eCG or eCG and hCG (PG-600). Follicular growth was monitored via daily transrectal ultrasonography and blood samples were collected for hormonal analyses. Six of 18 ewes had a subnormal or absent preovulatory gonadotropin surge and developed cystic follicles. Neither insulin resistance nor elevated LH activity were associated with formation of cystic follicles. Ewes that developed cystic follicles were heavier (93 +/- 4 kg) than ewes that ovulated (81 +/- 3 kg; P = 0.02). Furthermore, following pessary removal and initiation of daily ultrasonography, ewes that developed cystic follicles lost body weight (-3 +/- 1%), while ovulatory ewes continued to gain body weight (1 +/- 1%; P = 0.005). It is speculated that in heavy ewes metabolic factors associated with acute body weight loss inhibit the positive feedback of estradiol and thereby suppress the preovulatory gonadotropin surge leading to formation of cystic follicles.

  12. Exfoliative cytologic findings of primary pulmonary adenoid cystic carcinom: a report of 2 cases with a review of the cytologic features.

    PubMed

    Daneshbod, Yahya; Modjtahedi, Ebrahim; Atefi, Sohrab; Bedayat, Gholam Reza; Daneshbod, Khosrow

    2007-01-01

    Adenoid cystic carcinoma is a very rare primary pulmonary neoplasm. Cytologic findings of pulmonary washing and brushing in 2 cases of primary bronchial adenoid cystic carcinoma with special histologic features are described, with an emphasis on some points that have not been reported previously, together with the diagnostic pitfalls. Two cases of primary adenoid cystic carcinoma of the lung were diagnosed on exfoliative cytology. The patients' ages were 55 and 65 years old. Cytologic findings included large and small clusters of small cells in both 2 and 3 dimensions with occasional cystlike spaces containing mucoid material. The cells were arranged in spherical, cylindrical, basaloid and rosettelike arrangements. There were also abundant small and large mucoid globules, cylinders of homogeneous, acellular, mucous material and "cannon balls." Cytoplasmic and intranuclear round inclusions were noted in case 1. Rare findings of nuclear molding were noted. In case 2, chondromyxoid material and a bimorphic population of tumor cells caused diagnostic confusion with other salivary gland-type tumors of the lung. These cases showed characteristic cytologic findings of adenoid cystic carcinoma together with rare findings of intracellular and extracellular inclusionlike bodies, myxochondroid material, bimorphic populations and nuclear molding, which can cause diagnostic confusion with other lung tumors.

  13. Heritability of Lung Disease Severity in Cystic Fibrosis

    PubMed Central

    Vanscoy, Lori L.; Blackman, Scott M.; Collaco, Joseph M.; Bowers, Amanda; Lai, Teresa; Naughton, Kathleen; Algire, Marilyn; McWilliams, Rita; Beck, Suzanne; Hoover-Fong, Julie; Hamosh, Ada; Cutler, Dave; Cutting, Garry R.

    2007-01-01

    Rationale: Obstructive lung disease, the major cause of mortality in cystic fibrosis (CF), is poorly correlated with mutations in the disease-causing gene, indicating that other factors determine severity of lung disease. Objectives: To quantify the contribution of modifier genes to variation in CF lung disease severity. Methods: Pulmonary function data from patients with CF living with their affected twin or sibling were converted into reference values based on both healthy and CF populations. The best measure of FEV1 within the last year was used for cross-sectional analysis. FEV1 measures collected over at least 4 years were used for longitudinal analysis. Genetic contribution to disease variation (i.e., heritability) was estimated in two ways: by comparing similarity of lung function in monozygous (MZ) twins (∼ 100% gene sharing) with that of dizygous (DZ) twins/siblings (∼ 50% gene sharing), and by comparing similarity of lung function measures for related siblings to similarity for all study subjects. Measurements and Main Results: Forty-seven MZ twin pairs, 10 DZ twin pairs, and 231 sibling pairs (of a total of 526 patients) with CF were studied. Correlations for all measures of lung function for MZ twins (0.82–0.91, p < 0.0001) were higher than for DZ twins and siblings (0.50–0.64, p < 0.001). Heritability estimates from both methods were consistent for each measure of lung function and ranged from 0.54 to 1.0. Heritability estimates generally increased after adjustment for differences in nutritional status (measured as body mass index z-score). Conclusions: Our heritability estimates indicate substantial genetic control of variation in CF lung disease severity, independent of CFTR genotype. PMID:17332481

  14. Intra-cystic concentrations of albendazole-sulphoxide in human cystic echinococcosis: a systematic review and analysis of individual patient data.

    PubMed

    Lötsch, Felix; Naderer, Judith; Skuhala, Tomislava; Groger, Mirjam; Auer, Herbert; Kaczirek, Klaus; Waneck, Fredrik; Ramharter, Michael

    2016-08-01

    Cystic echinococcosis (CE) is a widespread zoonosis caused by the species complex Echinococcus granulosus. Albendazole (ABZ)-the first-line anthelminthic drug for medical treatment of CE-is metabolized in vivo to the active derivative ABZ-sulphoxide (ABZ-SO). Target-site ABZ-SO concentrations in the hydatid cyst mediate the anthelminthic effect in CE. Primary outcome of this systematic review of individual patient data was the intra-cystic ABZ-SO concentration stratified by cyst size, location, calcification status and use of praziquantel. Studies reporting intra-cystic ABZ-SO concentrations in humans were identified by a systematic search. A pooled analysis of individual patient data was performed to assess intra-cystic concentrations. Pharmacokinetic data of 121 individual cysts were analysed. There was no correlation between plasma and intra-cystic ABZ-SO concentrations (rho = -0.03, p = 0.76). Intra-cystic drug concentrations were also not associated with sex and treatment duration. Use of praziquantel in combination with ABZ was associated with higher plasma (median 540 vs. 240 μg/L; p = 0.04) but not intra-cystic ABZ-SO concentrations (median 220 vs. 199 μg/L; p = 0.36). Relative drug concentrations in hepatic cysts were higher than in other cysts (0.8 vs. 0.4; p = 0.05). Intra-cystic concentrations were higher in calcified than non-calcified cysts (median 897 vs. 245 μg/L; p = 0.03). There was a trend towards higher intra-cystic concentrations in smaller sized cysts (β = -17.2 μg/L/cm; 95th CI, -35.9 to 1.6; p = 0.07). This study demonstrates that mean intra-cystic drug concentrations are similar to plasma concentrations on a population level. However, in individual patients plasma concentrations are not directly predictive for intra-cystic concentrations. The use of booster drugs was not associated with higher intra-cystic ABZ-SO concentrations in this analysis.

  15. Possible familial case of Birt-Hogg-Dubé syndrome complicated with lung cancer: A possible link between these two disease entities.

    PubMed

    Nishida, Chinatsu; Yatera, Kazuhiro; Yamasaki, Kei; Torii, Ryo; Kawanami, Yukiko; Kawanami, Toshinori; Ishimoto, Hiroshi; Shibuya, Ryo; Takenaka, Masaru; Yamada, Sohusuke; Kasai, Takahiko; Tanaka, Fumihiro; Mukae, Hiroshi

    2015-07-01

    A 65-year-old Japanese woman was introduced to our hospital for an examination of multiple pulmonary cystic lesions and a pulmonary nodule in the left lower lobe. She had a smoking history of 25 pack-years, and her two younger brothers had suffered from pneumothorax; one of them additionally had lung cancer with pulmonary multiple cystic lesions. A surgical biopsy specimen obtained from her left lower lobe revealed adenocarcinoma surrounded by a single epithelial layer that was covered with collagen fibers. The pathological features were compatible with the findings of the cystic lesions in the patients with Birt-Hogg-Dubé syndrome (BHDS). A diagnosis of BHDS was eventually made according to the detection of a folliculin gene mutation. This is the first report of a possible familial case of BHDS complicated with primary lung cancer. We herein reviewed the previously reported cases of BHDS with lung cancer and other tumors and discussed a potential mechanism of tumorigenesis and carcinogenesis in the lung in the patients with BHDS. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. A rare connexin 26 mutation in a patient with a forme fruste of keratitis-ichthyosis-deafness (KID) syndrome.

    PubMed

    Neoh, Ching Yin; Chen, Huijia; Ng, See Ket; Lane, Ellen Birgitte; Common, John Edmund Armourer

    2009-10-01

    Keratitis-ichthyosis-deafness (KID) syndrome is a rare ectodermal dysplasia characterized by generalized erythrokeratotic plaques, sensorineural hearing loss, and vascularizing keratitis. Cutaneous changes and hearing loss typically present in early childhood, whereas ocular symptoms present later. Mutations in the connexin (Cx) 26 gene, GJB2, are now established to underlie many of the affected cases, with the majority of patients harboring the p.D50N mutation. A rare patient demonstrating features of incomplete KID syndrome associated with an uncommon Cx26 gene mutation is described. The patient presented late in adolescence with partial features of KID syndrome. There was limited cutaneous involvement and the rare association of cystic acne. Both hearing impairment and ophthalmic involvement were mild in severity. Genetic mutation analysis revealed a previously described, rare mutation in GJB2, resulting in a glycine to arginine change at codon 12 (p.G12R). This report describes a patient exhibiting characteristics suggestive of a late-onset, incomplete form of KID syndrome with the GJB2 mutation (p.G12R). The p.G12R mutation has only been described in one other patient with KID syndrome, whose clinical presentation was not characterized.

  17. A Case of New Familiar Genetic Variant of Autosomal Dominant Polycystic Kidney Disease-2: A Case Study.

    PubMed

    Litvinchuk, Tetiana; Tao, Yunxia; Singh, Ruchi; Vasylyeva, Tetyana L

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is characterized by renal cyst formation due to mutations in genes coding for polycystin-1 [PKD1 (85-90% of cases), on ch 16p13.3] and polycystin-2 [PKD2 (10-15% of cases), on ch 4q13-23] and PKD3 gene (gene unmapped). It is also associated with TSC2/PKD1 contiguous gene syndrome. ADPKD is usually inherited, but new mutations without a family history occur in approximately 10% of the cases. A 17-year-old boy was followed up for bilateral cystic kidney disease, hypertension, and obesity since he was 13 years old. The diagnosis was an accidental finding during abdominal CT at age 13 to rule out appendicitis. A renal ultrasonogram also demonstrated a multiple bilateral cysts. Because of parental history of bilateral renal cysts, PKD1 and PKD2, genetic testing was ordered. Results showed, PKD2 variant 1:3 bp deletion of TGT; nucleotide position: 1602-1604; codon position: 512-513; mRNA reading frame maintained. The same mutation was later identified in his father. A smaller number of patients have a defect in the PKD2 locus on chromosome 4 (resulting in PKD2 disease). There are no known published cases on this familiar genetic variant of ADPKD-2 cystic kidney disease. In this case, the disease is present unusually early in life.

  18. Personalized Drug Therapy in Cystic Fibrosis: From Fiction to Reality.

    PubMed

    de Lima Marson, Fernando Augusto; Bertuzzo, Carmen Silvia; Ribeiro, Jose Dirceu

    2015-01-01

    Personalized drug therapy for cystic fibrosis (CF) is a long-term dream for CF patients, caregivers, physicians and researchers. After years of study, the fiction of personalized treatment has turned to hope. Basic information about CFTR mutations classes and new treatments is needed if we are to deal properly with the new CF era. The problems involved in this issue, however, should be evaluated with greater care and attention. VX-770 is a new drug available to treat CF patients with some class III CFTR mutations and other drugs are being studied regarding other classes. The scientific literature has constantly given information about each therapy, both in vitro and in vivo. The hope is increasing. Nevertheless the "scientific world" still lacks information about patients' reality and daily health related practical needs. Clinical trials have showed good evaluation of some drugs so far, but clinical response is a wide spectrum yet to be analyzed: CFTR mutations spectrum, costs related to the treatment with new drugs (for VX-770 therapy), variability of CF clinical expression, limitations to test in vitro drugs, absence of good clinical markers to evaluate drug response, absence of long-term studies and with patients below six years old, multidrug treatment used to improve the expression response, and finally, the most important problem, who will benefit from the new drugs therapy, are issues that constitute a barrier that should be overcome. Personalized drug therapy may not be a fiction anymore, but it is not yet a reality for all CF patients.

  19. Forecasting US ivacaftor outcomes and cost in cystic fibrosis patients with the G551D mutation.

    PubMed

    Dilokthornsakul, Piyameth; Hansen, Ryan N; Campbell, Jonathan D

    2016-06-01

    Ivacaftor, a breakthrough treatment for cystic fibrosis (CF) patients with the G551D genetic mutation, lacks long-term clinical and cost projections. This study forecasted outcomes and cost by comparing ivacaftor plus usual care versus usual care alone.A lifetime Markov model was conducted from a US payer perspective. The model consisted of five health states: 1) forced expiratory volume in 1 s (FEV1) % pred ≥70%, 2) 40%≤ FEV1 % pred <70%, 3) FEV1 % pred <40%, 4) lung transplantation and 5) death. All inputs were extracted from published literature. Budget impact was also estimated. We estimated ivacaftor's improvement in outcomes compared with a non-CF referent population.Ivacaftor was associated with 18.25 (95% credible interval (CrI) 13.71-22.20) additional life-years and 15.03 (95% CrI 11.13-18.73) additional quality-adjusted life-years (QALYs). Ivacaftor was associated with improvements in survival and QALYs equivalent to 68% and 56%, respectively, for the survival and QALY gaps between CF usual care and their non-CF peers. The incremental lifetime cost was $3 374 584. The budget impact was $0.087 per member per month.Ivacaftor increased life-years and QALYs in CF patients with the G551D mutation, and moved morbidity and mortality closer to that of their non-CF peers. Ivacaftor costs much more than usual care, but comes at a relatively limited budget impact. Copyright ©ERS 2016.

  20. Forecasting the Long-Term Clinical and Economic Outcomes of Lumacaftor/Ivacaftor in Cystic Fibrosis Patients with Homozygous phe508del Mutation.

    PubMed

    Dilokthornsakul, Piyameth; Patidar, Mausam; Campbell, Jonathan D

    2017-12-01

    To forecast lifetime outcomes and cost of lumacaftor/ivacaftor combination therapy in patients with cystic fibrosis (CF) with homozygous phe508del mutation from the US payer perspective. A lifetime Markov model was developed from a US payer perspective. The model included five health states: 1) mild lung disease (percent predicted forced expiratory volume in 1 second [FEV 1 ] >70%), 2) moderate lung disease (40% ≤ FEV 1 ≤ 70%), 3) severe lung disease (FEV 1 < 40%), 4) lung transplantation, and 5) death. All inputs were derived from published literature. We estimated lumacaftor/ivacaftor's improvement in outcomes compared with a non-CF referent population as well as CF-specific mortality estimates. Lumacaftor/ivacaftor was associated with additional 2.91 life-years (95% credible interval 2.55-3.56) and additional 2.42 quality-adjusted life-years (QALYs) (95% credible interval 2.10-2.98). Lumacaftor/ivacaftor was associated with improvements in survival and QALYs equivalent to 27.6% and 20.7%, respectively, for the survival and QALY gaps between CF usual care and their non-CF peers. The incremental lifetime cost was $2,632,249. Lumacaftor/ivacaftor increased life-years and QALYs in CF patients with the homozygous phe508del mutation and moved morbidity and mortality closer to that of their non-CF peers but it came with higher cost. Copyright © 2017 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

Top