Mutation analysis of 28 gaucher disease patients: The Australasian experience

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis, B.D.; Nelson, P.V.; Robertson, E.F.

1994-01-15

Gaucher disease is the most common lysomal storage disease. It is an autosomal recessive disorder that results from a deficiency of {beta}-glucocerrebrosidase. Three clinical phenotypes have been described: non-neuronopathic, acute neuronopathic, and subacuteneuronopathic. Genomic DNA from 28 Australasian patients of diverse ethnic origin with Gaucher disease was screened for 3 common mutations (1226G, 1448C and 84GG) using the amplification refractory mutation system (ARMS), and one uncommon mutation (1504T) by restriction enzyme digestion. Thirty-eight of the 56 independent alleles in these patients were characterized, with 1448C present in 42% and 1226G in 28% of the alleles. The 1226G mutation was associatedmore » only with the nonneuronopathic phenotype and 7 of the 15 patients who carried the 1448C mutation developed neuronopathic disease. Three infants who died in the neonatal period following a rapidly progressive neurodegenerative course carried no identifiable mutations. The 84GG mutation was carried by 2 Jewish patients and 1504T was present in one patient. It is now possible to rapidly identify the common Gaucher mutations using ARMS and restriction enzyme digestion, and our findings confirm the heterogeneity of mutations in Gaucher disease. It is also possible to predict in part the phenotypic outcome when screening patients for these mutations. The authors consider mutation analysis to be of most use in prenatal diagnosis and for carrier detection within affected families. 27 refs., 2 figs., 2 tabs.« less

Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

PubMed Central

Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

2014-01-01

Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

EGFR mutation status of paired cerebrospinal fluid and plasma samples in EGFR mutant non-small cell lung cancer with leptomeningeal metastases.

PubMed

Zhao, Jing; Ye, Xin; Xu, Yan; Chen, Minjiang; Zhong, Wei; Sun, Yun; Yang, Zhenfan; Zhu, Guanshan; Gu, Yi; Wang, Mengzhao

2016-12-01

Central nervous system (CNS) is the prevalent site for metastases in epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI)-relapsed NSCLC patients. To understand the EGFR mutation status in paired cerebrospinal fluid (CSF) and plasma samples after EGFR-TKI treatment failure might be useful to guide the treatment of intra- and extracranial tumors in those patients. Paired CSF and plasma samples were collected from seven NSCLC patients with CNS metastases after EGFR-TKI failure. EGFR mutations were tested by amplification refractory mutation system (ARMS) and droplet digital PCR (ddPCR) methods. Gefitinib concentrations were evaluated by high-performance liquid chromatography-mass spectrometry (HPLC-MS/MS). EGFR mutations were detected in all seven CSF samples, including three of E19-Del, three of L858R and one of E19-Del&T790M by both methods. On the other hand, majority of the matched plasma samples (5/7) were negative for EGFR mutations by both methods. The other two plasma samples were positive for E19-Del&T790M by ddPCR, and one of them had undetectable T790M by ARMS. Gefitinib concentration in CSF was much lower than that in plasma (mean CSF/plasma ratio: 1.8 %). After EGFR-TKI failure, majority of the NSCLC patients with CNS metastases remained positive detection of EGFR sensitive mutations in CSF, but much less detection in the matched plasma. Significantly low exposure of gefitinib in CSF might explain the intracranial protection of the EGFR sensitive mutation positive tumor cells.

Arm-specific cleavage and mutation during reverse transcription of 2΄,5΄-branched RNA by Moloney murine leukemia virus reverse transcriptase

PubMed Central

Döring, Jessica

2017-01-01

Abstract Branchpoint nucleotides of intron lariats induce pausing of DNA synthesis by reverse transcriptases (RTs), but it is not known yet how they direct RT RNase H activity on branched RNA (bRNA). Here, we report the effects of the two arms of bRNA on branchpoint-directed RNA cleavage and mutation produced by Moloney murine leukemia virus (M-MLV) RT during DNA polymerization. We constructed a long-chained bRNA template by splinted-ligation. The bRNA oligonucleotide is chimeric and contains DNA to identify RNA cleavage products by probe hybridization. Unique sequences surrounding the branchpoint facilitate monitoring of bRNA purification by terminal-restriction fragment length polymorphism analysis. We evaluate the M-MLV RT-generated cleavage and mutational patterns. We find that cleavage of bRNA and misprocessing of the branched nucleotide proceed arm-specifically. Bypass of the branchpoint from the 2΄-arm causes single-mismatch errors, whereas bypass from the 3΄-arm leads to deletion mutations. The non-template arm is cleaved when reverse transcription is primed from the 3΄-arm but not from the 2΄-arm. This suggests that RTs flip ∼180° at branchpoints and RNases H cleave the non-template arm depending on its accessibility. Our observed interplay between M-MLV RT and bRNA would be compatible with a bRNA-mediated control of retroviral and related retrotransposon replication. PMID:28160599

Prenatal diagnosis of beta-thalassaemia: experience in a developing country.

PubMed

Saxena, R; Jain, P K; Thomas, E; Verma, I C

1998-01-01

We present our experience with the amplification refractory mutation system (ARMS) for the prenatal diagnosis of beta-thalassaemia in 415 pregnancies of 360 women. Five mutations of the beta-thalassaemia gene common in Asian Indians accounted for 89.2 per cent and rare mutations for 7.2 per cent of all mutant chromosomes, while 3.3 per cent of chromosomes remained uncharacterized. Identical mutations were present in both parents in 43.2 per cent of cases, due to caste-based marriages in India. A confirmed diagnosis was given in 401 (98.3 per cent) cases, of which a complete diagnosis (whether the fetus was normal, a carrier, or homozygous) was possible in 391 (94.2 per cent) of the cases. In 15 couples, the mutation was identified in only one parent. In nine of these, the identified mutation was not present in the fetus, predicting normal/carrier status, while in five the identified mutation was present in the fetus, suggesting carrier/affected status. The abortion rate was 3.9 per cent. Pitfalls in diagnosis were failure of oligonucleotides to work, maternal contamination, and false paternity. The ARMS provides an inexpensive, robust and non-isotopic method for the prenatal diagnosis of beta-thalassaemia in India. Recommendations are outlined for establishing a prenatal diagnostic service in developing countries.

Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

PubMed

Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

2007-08-31

Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

An ARMS-based technique for sex determination of red panda (Ailurus fulgens).

PubMed

Li, Yuzhi; Xu, Xiao; Zhang, Liang; Zhang, Zhihe; Shen, Fujun; Zhang, Wenping; Yue, Bisong

2011-03-01

Molecular sexing is a key component in the investigation of wild populations. In this study, we developed a fast, accurate and reliable amplification refractory mutation system (ARMS) technique for sex determination of red panda based on the exon 4 of the ZFX/ZFY gene. The amplicons were distinguished simply by agarose gel electrophoresis, exhibiting one fragment in females (X: 300 bp) and two in males (X: 300 bp, Y: 166 bp). Robustness of this ARMS system was confirmed by testing both 43 captive red pandas using DNA samples with known-sex and 10 wild red pandas using faecal DNA samples with unknown sex. © 2010 Blackwell Publishing Ltd.

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

PubMed Central

Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

2014-01-01

A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

Neratinib, an irreversible pan-ErbB receptor tyrosine kinase inhibitor: results of a phase II trial in patients with advanced non-small-cell lung cancer.

PubMed

Sequist, Lecia V; Besse, Benjamin; Lynch, Thomas J; Miller, Vincent A; Wong, Kwok K; Gitlitz, Barbara; Eaton, Keith; Zacharchuk, Charles; Freyman, Amy; Powell, Christine; Ananthakrishnan, Revathi; Quinn, Susan; Soria, Jean-Charles

2010-06-20

Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have had a significant impact on non-small-cell lung cancer (NSCLC) outcomes, particularly for patients with EGFR mutations. Resistance emerges after 9 to 12 months, primarily mediated by the T790M resistance mutation. We studied neratinib, an irreversible pan-ErbB TKI that may overcome T790M. Patients with advanced NSCLC underwent EGFR sequencing of available tumor tissue at enrollment. Those with > or = 12 weeks of prior TKI therapy were placed in arm A if they were EGFR mutation positive or arm B if they were wild-type. Arm C included TKI-naïve patients with adenocarcinoma and light smoking histories (< or = 20 pack-years). All patients received daily oral neratinib, initially at 320 mg but subsequently reduced to 240 mg because of excessive diarrhea. The primary end point was objective response rate (RR). One-hundred sixty-seven patients were treated: 91 in arm A, 48 in arm B, and 28 in arm C. Diarrhea was the most common toxicity; grade 3 incidence was 50% at 320 mg but improved to 25% after dose reduction. The RR was 3% in arm A and zero in arms B and C. No patients with known T790M responded. Notably, three of four patients with an exon 18 G719X EGFR mutation had a partial response and the fourth had stable disease lasting 40 weeks. Neratinib had low activity in patients with prior benefit from TKIs and in TKI-naïve patients, potentially because of insufficient bioavailability from diarrhea-imposed dose limitation. Responses were seen in patients with the rare G719X EGFR mutation, highlighting the importance of obtaining comprehensive genetic information on trials of targeted agents.

Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

PubMed Central

Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.

2014-01-01

New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428

Efficacy and safety of nilotinib in patients with KIT-mutated metastatic or inoperable melanoma: final results from the global, single-arm, phase II TEAM trial.

PubMed

Guo, J; Carvajal, R D; Dummer, R; Hauschild, A; Daud, A; Bastian, B C; Markovic, S N; Queirolo, P; Arance, A; Berking, C; Camargo, V; Herchenhorn, D; Petrella, T M; Schadendorf, D; Sharfman, W; Testori, A; Novick, S; Hertle, S; Nourry, C; Chen, Q; Hodi, F S

2017-06-01

The single-arm, phase II Tasigna Efficacy in Advanced Melanoma (TEAM) trial evaluated the KIT-selective tyrosine kinase inhibitor nilotinib in patients with KIT-mutated advanced melanoma without prior KIT inhibitor treatment. Forty-two patients with KIT-mutated advanced melanoma were enrolled and treated with nilotinib 400 mg twice daily. TEAM originally included a comparator arm of dacarbazine (DTIC)-treated patients; the design was amended to a single-arm trial due to an observed low number of KIT-mutated melanomas. Thirteen patients were randomized to DTIC before the protocol amendment removing this study arm. The primary endpoint was objective response rate (ORR), determined according to Response Evaluation Criteria In Solid Tumors. ORR was 26.2% (n = 11/42; 95% CI, 13.9%-42.0%), sufficient to reject the null hypothesis (ORR ≤10%). All observed responses were partial responses (PRs; median response duration, 7.1 months). Twenty patients (47.6%) had stable disease and 10 (23.8%) had progressive disease; 1 (2.4%) response was unknown. Ten of the 11 responding patients had exon 11 mutations, four with an L576P mutation. The median progression-free survival and overall survival were 4.2 and 18.0 months, respectively. Three of the 13 patients on DTIC achieved a PR, and another patient had a PR following switch to nilotinib. Nilotinib activity in patients with advanced KIT-mutated melanoma was similar to historical data from imatinib-treated patients. DTIC treatment showed potential activity, although the low patient number limits interpretation. Similar to previously reported results with imatinib, nilotinib showed greater activity among patients with an exon 11 mutation, including L576P, suggesting that nilotinib may be an effective treatment option for patients with specific KIT mutations. ClinicalTrials.gov, NCT01028222. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Incorporating Erlotinib or Irinotecan Plus Cisplatin into Chemoradiotherapy for Stage III Non-small Cell Lung Cancer According to EGFR Mutation Status.

PubMed

Lee, Youngjoo; Han, Ji-Youn; Moon, Sung Ho; Nam, Byung-Ho; Lim, Kun Young; Lee, Geon Kook; Kim, Heung Tae; Yun, Tak; An, Hye Jin; Lee, Jin Soo

2017-10-01

Concurrent chemoradiotherapy (CCRT) is the standard care for stage III non-small cell lung cancer (NSCLC) patients; however, a more effective regimen is needed to improve the outcome by better controlling occult metastases. We conducted two parallel randomized phase II studies to incorporate erlotinib or irinotecan-cisplatin (IP) into CCRT for stage III NSCLC depending on epidermal growth factor receptor (EGFR) mutation status. Patients with EGFR-mutant tumors were randomized to receive three cycles of erlotinib first and then either CCRT with erlotinib followed by erlotinib (arm A) or CCRT with IP only (arm B). Patients with EGFR unknown or wild-type tumors were randomized to receive either three cycles of IP before (arm C) or after CCRT with IP (arm D). Seventy-three patients were screened and the study was closed early because of slow accrual after 59 patients were randomized. Overall, there were seven patients in arm A, five in arm B, 22 in arm C, and 25 in arm D. The response rate was 71.4% and 80.0% for arm A and B, and 70.0% and 73.9% for arm C and D. The median overall survival (OS) was 39.3 months versus 31.2 months for arm A and B (p=0.442), and 16.3 months versus 25.3 months for arm C and D (p=0.050). Patients with sensitive EGFR mutations had significantly longer OS than EGFR-wild patients (74.8 months vs. 25.3 months, p=0.034). There were no unexpected toxicities. Combined-modality treatment by molecular diagnostics is feasible in stage III NSCLC. EGFR-mutant patients appear to be a distinct subset with longer survival.

ARMS depletion facilitates UV irradiation induced apoptotic cell death in melanoma.

PubMed

Liao, Yi-Hua; Hsu, Su-Ming; Huang, Pei-Hsin

2007-12-15

Tumor cells often aberrantly reexpress molecules that mediate proper embryonic development for advantageous growth or survival. Here, we report that ankyrin repeat-rich membrane spanning (ARMS), a transmembrane protein abundant in the developing and adult neural tissues, is overexpressed in melanoma, a tumor ontogenetically originating from neural crest. Immunohistochemical study of 79 melanocytic lesions showed significantly increased expression of ARMS in primary malignant melanomas (92.9%) and metastatic melanoma (60.0%) in comparison with benign nevocellular nevi (26.7%). To investigate the role of ARMS in melanoma formation, murine B16F0 melanoma cells with stable knockdown of ARMS were established by RNA interference. Down-regulation of ARMS resulted in significant inhibition of anchorage-independent growth in soft agar and restrictive growth of melanoma in severe combined immunodeficient mice. Importantly, depletion of ARMS facilitated UVB-induced apoptosis in melanoma cells through inactivation of mitogen-activated protein kinase/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK. Addition of MEK inhibitor PD98059 further sensitized ARMS-depleted melanoma cells to UVB-induced apoptosis, whereas constitutively active MEK rescued ARMS-depleted cells from apoptosis. We further showed that BRAF, a downstream signaling molecule of ARMS in ERK pathway, is not mutated as a constitutively active form in acral lentiginous melanoma; in contrast, BRAF(T1799A) mutation, which leads to constitutive activation of ERK signaling, was detected in 57.1% of superficial spreading melanoma. Our study suggests that overexpression of ARMS per se serves as one mechanism to promote melanoma formation by preventing stress-induced apoptotic death mediated by the MEK/ERK signaling pathway, especially in acral lentiginous melanoma, most of which does not harbor BRAF mutation.

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

PubMed

Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

2006-10-01

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

[Mutations of amyloid precursor protein in early-onset familial Alzheimer's disease].

PubMed

Naruse, S; Tsuji, S; Miyatake, T

1992-09-01

Genetic linkage studies of familial Alzheimer's disease (FAD) have suggested that some form of early-onset FAD is linked to proximal long arm of chromosome 21. It has been also suggested that some form of late-onset FAD is linked to long arm of chromosome 19. Goate et al have identified a mis-sense mutation (Val to Ile) in exon 17 of the amyloid precursor protein (APP) gene in 2 of 16 early-onset FAD families, and have shown that the FAD locus in an FAD family is tightly linked to the mis-sense mutation. To determine if the mis-sense mutation is observed in different ethnic origine, we have studied some early-onset FAD families. Two early-onset FAD families showed the existence of the mutation. As the mutation has been identified in different ethnic origine and the mutation has not been observed in normal individuals, it strengthen hypothesis that the mutation is pathogenic. Recently, Val to Phe and Val to Gly mutations have been also identified at the same codon (Codon 717) of the APP gene.

Genomic and Functional Approaches to Understanding Cancer Aneuploidy.

PubMed

Taylor, Alison M; Shih, Juliann; Ha, Gavin; Gao, Galen F; Zhang, Xiaoyang; Berger, Ashton C; Schumacher, Steven E; Wang, Chen; Hu, Hai; Liu, Jianfang; Lazar, Alexander J; Cherniack, Andrew D; Beroukhim, Rameen; Meyerson, Matthew

2018-04-09

Aneuploidy, whole chromosome or chromosome arm imbalance, is a near-universal characteristic of human cancers. In 10,522 cancer genomes from The Cancer Genome Atlas, aneuploidy was correlated with TP53 mutation, somatic mutation rate, and expression of proliferation genes. Aneuploidy was anti-correlated with expression of immune signaling genes, due to decreased leukocyte infiltrates in high-aneuploidy samples. Chromosome arm-level alterations show cancer-specific patterns, including loss of chromosome arm 3p in squamous cancers. We applied genome engineering to delete 3p in lung cells, causing decreased proliferation rescued in part by chromosome 3 duplication. This study defines genomic and phenotypic correlates of cancer aneuploidy and provides an experimental approach to study chromosome arm aneuploidy. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

LRRC6 Mutation Causes Primary Ciliary Dyskinesia with Dynein Arm Defects

PubMed Central

Horani, Amjad; Ferkol, Thomas W.; Shoseyov, David; Wasserman, Mollie G.; Oren, Yifat S.; Kerem, Batsheva; Amirav, Israel; Cohen-Cymberknoh, Malena; Dutcher, Susan K.; Brody, Steven L.; Elpeleg, Orly; Kerem, Eitan

2013-01-01

Despite recent progress in defining the ciliome, the genetic basis for many cases of primary ciliary dyskinesia (PCD) remains elusive. We evaluated five children from two unrelated, consanguineous Palestinian families who had PCD with typical clinical features, reduced nasal nitric oxide concentrations, and absent dynein arms. Linkage analyses revealed a single common homozygous region on chromosome 8 and one candidate was conserved in organisms with motile cilia. Sequencing revealed a single novel mutation in LRRC6 (Leucine-rich repeat containing protein 6) that fit the model of autosomal recessive genetic transmission, leading to a change of a highly conserved amino acid from aspartic acid to histidine (Asp146His). LRRC6 was localized to the cytoplasm and was up-regulated during ciliogenesis in human airway epithelial cells in a Foxj1-dependent fashion. Nasal epithelial cells isolated from affected individuals and shRNA-mediated silencing in human airway epithelial cells, showed reduced LRRC6 expression, absent dynein arms, and slowed cilia beat frequency. Dynein arm proteins were either absent or mislocalized to the cytoplasm in airway epithelial cells from a primary ciliary dyskinesia subject. These findings suggest that LRRC6 plays a role in dynein arm assembly or trafficking and when mutated leads to primary ciliary dyskinesia with laterality defects. PMID:23527195

Clonal selection prevents tragedy of the commons when neighbors compete in a rock-paper-scissors game

NASA Astrophysics Data System (ADS)

Juul, Jeppe; Sneppen, Kim; Mathiesen, Joachim

2012-06-01

The rock-paper-scissors game is a model example of the ongoing cyclic turnover typical of many ecosystems, ranging from the terrestrial and aquatic to the microbial. Here we explore the evolution of a rock-paper-scissors system where three species compete for space. The species are allowed to mutate and change the speed by which they invade one another. In the case when all species have similar mutation rates, we observe a perpetual arms race where no single species prevails. When only two species mutate, their aggressions increase indefinitely until the ecosystem collapses and only the nonmutating species survives. Finally we show that when only one species mutates, group selection removes individual predators with the fastest growth rates, causing the growth rate of the species to stabilize. We explain this group selection quantitatively.

Molecular Profiling and Targeted Therapy for Advanced Thoracic Malignancies: A Biomarker-Derived, Multiarm, Multihistology Phase II Basket Trial

PubMed Central

Lopez-Chavez, Ariel; Thomas, Anish; Rajan, Arun; Raffeld, Mark; Morrow, Betsy; Kelly, Ronan; Carter, Corey Allan; Guha, Udayan; Killian, Keith; Lau, Christopher C.; Abdullaev, Zied; Xi, Liqiang; Pack, Svetlana; Meltzer, Paul S.; Corless, Christopher L.; Sandler, Alan; Beadling, Carol; Warrick, Andrea; Liewehr, David J.; Steinberg, Seth M.; Berman, Arlene; Doyle, Austin; Szabo, Eva; Wang, Yisong; Giaccone, Giuseppe

2015-01-01

Purpose We conducted a basket clinical trial to assess the feasibility of such a design strategy and to independently evaluate the effects of multiple targeted agents against specific molecular aberrations in multiple histologic subtypes concurrently. Patients and Methods We enrolled patients with advanced non–small-cell lung cancer (NSCLC), small-cell lung cancer, and thymic malignancies who underwent genomic characterization of oncogenic drivers. Patients were enrolled onto a not-otherwise-specified arm and treated with standard-of-care therapies or one of the following five biomarker-matched treatment groups: erlotinib for EGFR mutations; selumetinib for KRAS, NRAS, HRAS, or BRAF mutations; MK2206 for PIK3CA, AKT, or PTEN mutations; lapatinib for ERBB2 mutations or amplifications; and sunitinib for KIT or PDGFRA mutations or amplification. Results Six hundred forty-seven patients were enrolled, and 88% had their tumors tested for at least one gene. EGFR mutation frequency was 22.1% in NSCLC, and erlotinib achieved a response rate of 60% (95% CI, 32.3% to 83.7%). KRAS mutation frequency was 24.9% in NSCLC, and selumetinib failed to achieve its primary end point, with a response rate of 11% (95% CI, 0% to 48%). Completion of accrual to all other arms was not feasible. In NSCLC, patients with EGFR mutations had the longest median survival (3.51 years; 95% CI, 2.89 to 5.5 years), followed by those with ALK rearrangements (2.94 years; 95% CI, 1.66 to 4.61 years), those with KRAS mutations (2.3 years; 95% CI, 2.3 to 2.17 years), those with other genetic abnormalities (2.17 years; 95% CI, 1.3 to 2.74 years), and those without an actionable mutation (1.85 years; 95% CI, 1.61 to 2.13 years). Conclusion This basket trial design was not feasible for many of the arms with rare mutations, but it allowed the study of the genetics of less common malignancies. PMID:25667274

Rapid detection of 21-hydroxylase deficiency mutations by allele-specific in vitro amplification and capillary zone electrophoresis.

PubMed

Carrera, P; Barbieri, A M; Ferrari, M; Righetti, P G; Perego, M; Gelfi, C

1997-11-01

A quick diagnosis of the classic form of 21-hydroxylase deficiency (simple virilizing and salt wasting) is of great importance, especially for prenatal diagnosis and treatment in pregnancies at risk. A method for simultaneous detection of common point mutations in the P450c21 B gene is here proposed by combining a nested PCR amplification refractory mutation system (ARMS) with capillary zone electrophoresis (CZE) in sieving liquid polymers. In the first PCR, B genes are selectively amplified. In the nested reaction, ARMS-detected wild-type and mutated alleles are separately pooled and resolved by CZE. CZE is performed in coated capillaries in the presence of 30 g/L hydroxyethyl cellulose in the background electrolyte for size separation of the DNA analytes. For high-sensitivity detection the electrophoresis buffer contains the fluorescent dye SYBR Green I. Laser-induced fluorescence detection is obtained by excitation at 488 nm and signal collection at 520 nm. Specificity and reproducibility of the protocols were established by using samples from 75 Italian families with 21-hydroxylase deficiency already genotyped by allele-specific oligonucleotide hybridization or direct sequencing. Whereas dot-blot is time consuming because of the high number of hybridizations with radioactive probes, this present protocol is more rapid, giving sufficient separation on CZE after PCR reactions without preconcentration or desalting of samples.

Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

PubMed

Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

2002-12-01

The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

Evidence for a founder effect for the IVS4 +4 A{r_arrow}T mutation in the Fanconi anemia gene FACC in a Jewish population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Verlander, P.C.; Kaporis, A.G.; Qian, L.

1994-09-01

Fanconi anemia (FA) is a genetically heterogeneous autosomal recessive disorder defined by hypersensitivity of cells to DNA cross-linking agents; a gene for complementation group C(FACC) has been cloned. Two common mutations, IVS4 +4 A{r_arrow}T and 322delG, and several rare mutations have recently been reported in affected individuals. We now report the development of amplification refractory mutation system (ARMS) assays for rapid, non-radioactive detection of these known mutations in FACC. Primer pairs specific for variant sequences were designed, with the 3{prime} terminal base of one primer matching the variant base. PCR products are separated by electrophoresis on 2.5% agarose gels; mutationsmore » are indicated by the presence of a band of a specific size. These ARMS assays can be multiplexed to allow screening for all known mutations in two PCR reactions. We have used these assays for detection of FACC mutations in affected individuals in the International Fanconi Anemia Registry (IFAR), and for carrier detection FACC families. IVS4 +4 A{r_arrow}T is the only FACC mutation found in Jewish FA patients and their families, of both Ashkenazi and Sephardic ancestry. This mutation was not found in any affected individual of non-Jewish origin. In addition, DNA samples from 1596 healthy Jewish individuals primarily of Ashkenazi ancestry were supplied to us by Dor Yeshorim. These samples, ascertained for carrier screening for Tay Sachs, cystic fibrosis, and other genetic diseases with a high frequency in the religious Jewish community served by this organization, were tested for both IVS4 +4 A{r_arrow}T and 322delG mutations; seventeen IVS4 +4 A{r_arrow}T are of Sephardic Jewish ancestry. We hypothesize that IVS4 +4 A{r_arrow}T is a very old mutation, predating the divergence of the Ashkenazi and Sephardic populations. Haplotype analysis with microsatellite markers is in progress.« less

The association of factor V leiden mutation with recurrent pregnancy loss.

PubMed

Kashif, Sumreen; Kashif, Muhammad Ali; Saeed, Anjum

2015-11-01

To determine the association of factor V Leiden mutation with recurrent pregnancy loss. The case-control study was conducted at the Department of Haematology, Armed Forces Institute of Pathology, Rawalpindi, Pakistan, from January to June 2012, and comprised women of 18 to 45 years of age who had a history of recurrent pregnancy loss, and controls with no history of pregnancy loss. All the subjects belonged to Punjabi ethnic group. Three ml blood was taken from cases and controls and deoxyribonucleic acid was extracted. In order to identify Factor V Leiden mutation, polymerase chain reaction method was utilised combined with the amplification refractory mutation system. Data was analysed using SPSS 17. Of the 112 subjects, 56(50%) were in each of the two groups. The presence of factor V Leiden mutation among the cases was 3(5.4%) while it was absent among the controls. The mutation was significantly associated with recurrent pregnancy loss (p=0.017).Recurrent pregnancy loss was higher in cases than controls (p=0.001). Factor V Leiden mutation, Recurrent pregnancy loss, PCR (Polymerase chain reaction).

Coevolution of CRISPR bacteria and phage in 2 dimensions

NASA Astrophysics Data System (ADS)

Han, Pu; Deem, Michael

2014-03-01

CRISPR (cluster regularly interspaced short palindromic repeats) is a newly discovered adaptive, heritable immune system of prokaryotes. It can prevent infection of prokaryotes by phage. Most bacteria and almost all archae have CRISPR. The CRISPR system incorporates short nucleotide sequences from viruses. These incorporated sequences provide a historical record of the host and predator coevolution. We simulate the coevolution of bacteria and phage in 2 dimensions. Each phage has multiple proto-spacers that the bacteria can incorporate. Each bacterium can store multiple spacers in its CRISPR. Phages can escape recognition by the CRISPR system via point mutation or recombination. We will discuss the different evolutionary consequences of point mutation or recombination on the coevolution of bacteria and phage. We will also discuss an intriguing ``dynamic phase transition'' in the number of phage as a function of time and mutation rate. We will show that due to the arm race between phages and bacteria, the frequency of spacers and proto-spacers in a population can oscillate quite rapidly.

Coevolved Mutations Reveal Distinct Architectures for Two Core Proteins in the Bacterial Flagellar Motor

PubMed Central

Pandini, Alessandro; Kleinjung, Jens; Rasool, Shafqat; Khan, Shahid

2015-01-01

Switching of bacterial flagellar rotation is caused by large domain movements of the FliG protein triggered by binding of the signal protein CheY to FliM. FliG and FliM form adjacent multi-subunit arrays within the basal body C-ring. The movements alter the interaction of the FliG C-terminal (FliGC) “torque” helix with the stator complexes. Atomic models based on the Salmonella entrovar C-ring electron microscopy reconstruction have implications for switching, but lack consensus on the relative locations of the FliG armadillo (ARM) domains (amino-terminal (FliGN), middle (FliGM) and FliGC) as well as changes during chemotaxis. The generality of the Salmonella model is challenged by the variation in motor morphology and response between species. We studied coevolved residue mutations to determine the unifying elements of switch architecture. Residue interactions, measured by their coevolution, were formalized as a network, guided by structural data. Our measurements reveal a common design with dedicated switch and motor modules. The FliM middle domain (FliMM) has extensive connectivity most simply explained by conserved intra and inter-subunit contacts. In contrast, FliG has patchy, complex architecture. Conserved structural motifs form interacting nodes in the coevolution network that wire FliMM to the FliGC C-terminal, four-helix motor module (C3-6). FliG C3-6 coevolution is organized around the torque helix, differently from other ARM domains. The nodes form separated, surface-proximal patches that are targeted by deleterious mutations as in other allosteric systems. The dominant node is formed by the EHPQ motif at the FliMMFliGM contact interface and adjacent helix residues at a central location within FliGM. The node interacts with nodes in the N-terminal FliGc α-helix triad (ARM-C) and FliGN. ARM-C, separated from C3-6 by the MFVF motif, has poor intra-network connectivity consistent with its variable orientation revealed by structural data. ARM-C could be the convertor element that provides mechanistic and species diversity. PMID:26561852

Prognostic value of plasma EGFR ctDNA in NSCLC patients treated with EGFR-TKIs.

PubMed

Zhang, Chengjuan; Wei, Bing; Li, Peng; Yang, Ke; Wang, Zhizhong; Ma, Jie; Guo, Yongjun

2017-01-01

Epidermal growth factor receptor (EGFR) specific mutations have been known to improve survival of patients with non-small-cell lung carcinoma (NSCLC). However, whether there are any changes of EGFR mutations after targeted therapy and its clinical significance is unclear. This study was to identify the status of EGFR mutations after targeted therapy and predict the prognostic significance for NSCLC patients. A total of forty-five (45) NSCLC patients who received EGFR-TKI therapy were enrolled. We identified the changes of EGFR mutations in plasma ctDNA by Amplification Refractory Mutation System (ARMS) PCR technology. In the 45 cases of NSCLC with EGFR mutations, the EGFR mutation status changed in 26 cases, in which, 12 cases (26.7%) from positive to negative, and 14 cases (31.1%) from T790M mutation negative to positive after TKI targeted therapy. The T790M occurance group had a shorter Progression -Free-Survival (PFS) than the groups of EGFR mutation undetected and EGFR mutation turned out to have no change after EGFR-TKI therapy (p < 0.05). According to this study, it's necessary to closely monitor EGFR mutations during follow-up to predict the prognosis of NSCLC patients who are to receive the TKI targeted therapy.

Evaluation of digital PCR for detecting low-level EGFR mutations in advanced lung adenocarcinoma patients: a cross-platform comparison study

PubMed Central

Liu, Bing; Li, Lei; Huang, Lixia; Li, Shaoli; Rao, Guanhua; Yu, Yang; Zhou, Yanbin

2017-01-01

Emerging evidence has indicated that circulating tumor DNA (ctDNA) from plasma could be used to analyze EGFR mutation status for NSCLC patients; however, due to the low level of ctDNA in plasma, highly sensitive approaches are required to detect low frequency mutations. In addition, the cutoff for the mutation abundance that can be detected in tumor tissue but cannot be detected in matched ctDNA is still unknown. To assess a highly sensitive method, we evaluated the use of digital PCR in the detection of EGFR mutations in tumor tissue from 47 advanced lung adenocarcinoma patients through comparison with NGS and ARMS. We determined the degree of concordance between tumor tissue DNA and paired ctDNA and analyzed the mutation abundance relationship between them. Digital PCR and Proton had a high sensitivity (96.00% vs. 100%) compared with that of ARMS in the detection of mutations in tumor tissue. Digital PCR outperformed Proton in identifying more low abundance mutations. The ctDNA detection rate of digital PCR was 87.50% in paired tumor tissue with a mutation abundance above 5% and 7.59% in paired tumor tissue with a mutation abundance below 5%. When the DNA mutation abundance of tumor tissue was above 3.81%, it could identify mutations in paired ctDNA with a high sensitivity. Digital PCR will help identify alternative methods for detecting low abundance mutations in tumor tissue DNA and plasma ctDNA. PMID:28978074

Fludarabine and cytarabine versus high-dose cytarabine in consolidation treatment of t(8; 21) acute myeloid leukemia: A prospective, randomized study.

PubMed

Li, Ruiqi; Hu, Xiaoxia; Wang, Libing; Cheng, Hui; Lv, Shuqing; Zhang, Weiping; Wang, Jianmin; Yang, Jianmin; Song, Xianmin

2017-01-01

Acute myeloid leukemia (AML) patients with t(8;21) aberration often have favorable outcomes, however, relapse still occurs in 30-40% patients, with only 50-60% of patients with t(8;21) AML cured with regimens containing high-dose cytarabine (HD-Ara-C). To evaluate the effects of fludarabine and cytarabine (FA) consolidation therapy for t(8;21) AML patients, a prospective randomized study was performed. A total of 45 patients with t(8;21) AML after achieving complete remission (CR) were randomly assigned to receive four course consolidation with FA (n = 23) or HD-Ara-C (n = 22). Our study showed that at 36-months, relapse-free survival (RFS) was 81.73% in the FA arm and 50.73% in the HD-Ara-C arm (P = 0.04), overall survival (OS) was 91.1% and 48.4% (P = 0.01) in the FA arm and in the HD-Ara-C arm respectively; whereas cumulative incidence of relapse (CIR) was 18.27% and 47.39%, in the FA arm and in the HD-Ara-C arm respectively (P = 0.05). In our study, treatment with FA, MRD2 status (reduction ≥ 3-log) and absence of c-kit mutations were identified as independent prognostic factors for lower risk of relapse, improved RFS and OS. We also found RFS for patients without c-kit mutations was 100% in FA arm, and 57.8% in HD-Ara-C arm at 36 months (P = 0.005); OS of both groups at 36 months was 100% and 51.4%, respectively (P = 0.004), suggesting a benefit of consolidation therapy with FA for t(8;21) AML patients, especially, those without c-kit mutations (Clinicaltrials.org ID NCT# 02024308). Am. J. Hematol. 92:12-17, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Serotonin–mushroom body circuit modulating the formation of anesthesia-resistant memory in Drosophila

PubMed Central

Lee, Pei-Tseng; Lin, Hsuan-Wen; Chang, Yu-Hsuan; Fu, Tsai-Feng; Dubnau, Josh; Hirsh, Jay; Lee, Tzumin; Chiang, Ann-Shyn

2011-01-01

Pavlovian olfactory learning in Drosophila produces two genetically distinct forms of intermediate-term memories: anesthesia-sensitive memory, which requires the amnesiac gene, and anesthesia-resistant memory (ARM), which requires the radish gene. Here, we report that ARM is specifically enhanced or inhibited in flies with elevated or reduced serotonin (5HT) levels, respectively. The requirement for 5HT was additive with the memory defect of the amnesiac mutation but was occluded by the radish mutation. This result suggests that 5HT and Radish protein act on the same pathway for ARM formation. Three supporting lines of evidence indicate that ARM formation requires 5HT released from only two dorsal paired medial (DPM) neurons onto the mushroom bodies (MBs), the olfactory learning and memory center in Drosophila: (i) DPM neurons were 5HT-antibody immunopositive; (ii) temporal inhibition of 5HT synthesis or release from DPM neurons, but not from other serotonergic neurons, impaired ARM formation; (iii) knocking down the expression of d5HT1A serotonin receptors in α/β MB neurons, which are innervated by DPM neurons, inhibited ARM formation. Thus, in addition to the Amnesiac peptide required for anesthesia-sensitive memory formation, the two DPM neurons also release 5HT acting on MB neurons for ARM formation. PMID:21808003

Role and Mechanism of Structural Variation in Progression of Breast Cancer

DTIC Science & Technology

2013-09-01

mutations that occurred throughout tumor evolution, we identified 9 early nonsynonymous point mutations that occurred in cancer genes . Only five of...identified, are mutations in the TP53 gene suggesting its role as a driver mutation   5   • Our data also suggests that in the case of this one patient...generated by breakage-fusion- bridge cycles that promote repeated rounds of mutation within a chromosome arm, or from progressive amplification of genes that

Multiplex picoliter-droplet digital PCR for quantitative assessment of EGFR mutations in circulating cell-free DNA derived from advanced non-small cell lung cancer patients.

PubMed

Yu, Qian; Huang, Fei; Zhang, Meilin; Ji, Haiying; Wu, Shenchao; Zhao, Ying; Zhang, Chunyan; Wu, Jiong; Wang, Beili; Pan, Baisheng; Zhang, Xin; Guo, Wei

2017-08-01

To explore the possible diagnostic value of liquid biopsy, two multiplex panels using picoliter-droplet digital polymerase chain reaction (ddPCR) were established to quantitatively assess the epidermal growth factor receptor (EGFR) mutations in cell‑free DNA (cfDNA) extracted from the plasma of advanced non‑small cell lung cancer (NSCLC) patients. Plasma samples derived from 22 patients with stage IIIB/IV NSCLC harboring EGFR mutations in matched tumor tissues confirmed by amplification refractory mutation system (ARMS) analysis were subjected to two multiplex ddPCR panels to assess the abundance of tyrosine kinase inhibitor (TKI) ‑sensitive (19DEL, L858R) and TKI‑resistant (T790 M) mutations. Fluctuations in EGFR mutant abundance were monitored by either of the multiplex ddPCR panels for three patients undergoing EGFR‑TKI treatment, with serial plasma sample collections over 2 months. The multiplex ddPCR panels applied to plasma cfDNA from advanced NSCLC patients achieved a total concordance rate of 80% with the EGFR mutation profiles obtained by ARMS from matched biopsy tumor specimens (90% for 19DEL, 95% for L858R, 95% for T790M, respectively) and revealed additional mutant alleles in two subjects. The respective sensitivity and specificity were 90.9 and 88.9% for 19DEL, 87.5 and 100% for L858R, 100 and 93.8% for T790M. The fluctuations of EGFR mutant abundance in serial plasma cfDNA were in accordance with the changes in tumor size as assessed by imaging scans. The authors demonstrated the utility of multiplex ddPCR panels with ultra‑sensitivity for quantitative analysis of EGFR mutations in plasma cfDNA and obtained promising usefulness in EGFR‑TKI decision‑making for advanced NSCLC patients.

Multiplex picoliter-droplet digital PCR for quantitative assessment of EGFR mutations in circulating cell-free DNA derived from advanced non-small cell lung cancer patients

PubMed Central

Yu, Qian; Huang, Fei; Zhang, Meilin; Ji, Haiying; Wu, Shenchao; Zhao, Ying; Zhang, Chunyan; Wu, Jiong; Wang, Beili; Pan, Baisheng; Zhang, Xin; Guo, Wei

2017-01-01

To explore the possible diagnostic value of liquid biopsy, two multiplex panels using picoliter-droplet digital polymerase chain reaction (ddPCR) were established to quantitatively assess the epidermal growth factor receptor (EGFR) mutations in cell-free DNA (cfDNA) extracted from the plasma of advanced non-small cell lung cancer (NSCLC) patients. Plasma samples derived from 22 patients with stage IIIB/IV NSCLC harboring EGFR mutations in matched tumor tissues confirmed by amplification refractory mutation system (ARMS) analysis were subjected to two multiplex ddPCR panels to assess the abundance of tyrosine kinase inhibitor (TKI) -sensitive (19DEL, L858R) and TKI-resistant (T790 M) mutations. Fluctuations in EGFR mutant abundance were monitored by either of the multiplex ddPCR panels for three patients undergoing EGFR-TKI treatment, with serial plasma sample collections over 2 months. The multiplex ddPCR panels applied to plasma cfDNA from advanced NSCLC patients achieved a total concordance rate of 80% with the EGFR mutation profiles obtained by ARMS from matched biopsy tumor specimens (90% for 19DEL, 95% for L858R, 95% for T790M, respectively) and revealed additional mutant alleles in two subjects. The respective sensitivity and specificity were 90.9 and 88.9% for 19DEL, 87.5 and 100% for L858R, 100 and 93.8% for T790M. The fluctuations of EGFR mutant abundance in serial plasma cfDNA were in accordance with the changes in tumor size as assessed by imaging scans. The authors demonstrated the utility of multiplex ddPCR panels with ultra-sensitivity for quantitative analysis of EGFR mutations in plasma cfDNA and obtained promising usefulness in EGFR-TKI decision-making for advanced NSCLC patients. PMID:29067441

The BATTLE-2 Study: A Biomarker-Integrated Targeted Therapy Study in Previously Treated Patients With Advanced Non-Small-Cell Lung Cancer.

PubMed

Papadimitrakopoulou, Vassiliki; Lee, J Jack; Wistuba, Ignacio I; Tsao, Anne S; Fossella, Frank V; Kalhor, Neda; Gupta, Sanjay; Byers, Lauren Averett; Izzo, Julie G; Gettinger, Scott N; Goldberg, Sarah B; Tang, Ximing; Miller, Vincent A; Skoulidis, Ferdinandos; Gibbons, Don L; Shen, Li; Wei, Caimiao; Diao, Lixia; Peng, S Andrew; Wang, Jing; Tam, Alda L; Coombes, Kevin R; Koo, Ja Seok; Mauro, David J; Rubin, Eric H; Heymach, John V; Hong, Waun Ki; Herbst, Roy S

2016-08-01

By applying the principles of real-time biopsy, biomarker-based, adaptively randomized studies in non-small-cell lung cancer (NSCLC) established by the Biomarker-Integrated Approaches of Targeted Therapy for Lung Cancer Elimination (BATTLE) trial, we conducted BATTLE-2 (BATTLE-2 Program: A Biomarker-Integrated Targeted Therapy Study in Previously Treated Patients With Advanced Non-Small Cell Lung Cancer), an umbrella study to evaluate the effects of targeted therapies focusing on KRAS-mutated cancers. Patients with advanced NSCLC (excluding sensitizing EGFR mutations and ALK gene fusions) refractory to more than one prior therapy were randomly assigned, stratified by KRAS status, to four arms: (1) erlotinib, (2) erlotinib plus MK-2206, (3) MK-2206 plus AZD6244, or (4) sorafenib. Tumor gene expression profiling-targeted next-generation sequencing was performed to evaluate predictive and prognostic biomarkers. Two hundred patients, 27% with KRAS-mutated (KRAS mut+) tumors, were adaptively randomly assigned to erlotinib (n = 22), erlotinib plus MK-2206 (n = 42), MK-2206 plus AZD6244 (n = 75), or sorafenib (n = 61). In all, 186 patients were evaluable, and the primary end point of an 8-week disease control rate (DCR) was 48% (arm 1, 32%; arm 2, 50%; arm 3, 53%; and arm 4, 46%). For KRAS mut+ patients, DCR was 20%, 25%, 62%, and 44% whereas for KRAS wild-type patients, DCR was 36%, 57%, 49%, and 47% for arms 1, 2, 3, and 4, respectively. Median progression-free survival was 2.0 months, not different by KRAS status, 1.8 months for arm 1, and 2.5 months for arms 2 versus arms 3 and 4 in KRAS mut+ patients (P = .04). Median overall survival was 6.5 months, 9.0 and 5.1 months for arms 1 and 2 versus arms 3 and 4 in KRAS wild-type patients (P = .03). Median overall survival was 7.5 months in mesenchymal versus 5 months in epithelial tumors (P = .02). Despite improved progression-free survival on therapy that did not contain erlotinib for KRAS mut+ patients and improved prognosis for mesenchymal tumors, better biomarker-driven treatment strategies are still needed. © 2016 by American Society of Clinical Oncology.

The BATTLE-2 Study: A Biomarker-Integrated Targeted Therapy Study in Previously Treated Patients With Advanced Non–Small-Cell Lung Cancer

PubMed Central

Lee, J. Jack; Wistuba, Ignacio I.; Tsao, Anne S.; Fossella, Frank V.; Kalhor, Neda; Gupta, Sanjay; Byers, Lauren Averett; Izzo, Julie G.; Gettinger, Scott N.; Goldberg, Sarah B.; Tang, Ximing; Miller, Vincent A.; Skoulidis, Ferdinandos; Gibbons, Don L.; Shen, Li; Wei, Caimiao; Diao, Lixia; Peng, S. Andrew; Wang, Jing; Tam, Alda L.; Coombes, Kevin R.; Koo, Ja Seok; Mauro, David J.; Rubin, Eric H.; Heymach, John V.; Hong, Waun Ki; Herbst, Roy S.

2016-01-01

Purpose By applying the principles of real-time biopsy, biomarker-based, adaptively randomized studies in non–small-cell lung cancer (NSCLC) established by the Biomarker-Integrated Approaches of Targeted Therapy for Lung Cancer Elimination (BATTLE) trial, we conducted BATTLE-2 (BATTLE-2 Program: A Biomarker-Integrated Targeted Therapy Study in Previously Treated Patients With Advanced Non-Small Cell Lung Cancer), an umbrella study to evaluate the effects of targeted therapies focusing on KRAS-mutated cancers. Patients and Methods Patients with advanced NSCLC (excluding sensitizing EGFR mutations and ALK gene fusions) refractory to more than one prior therapy were randomly assigned, stratified by KRAS status, to four arms: (1) erlotinib, (2) erlotinib plus MK-2206, (3) MK-2206 plus AZD6244, or (4) sorafenib. Tumor gene expression profiling–targeted next-generation sequencing was performed to evaluate predictive and prognostic biomarkers. Results Two hundred patients, 27% with KRAS-mutated (KRAS mut+) tumors, were adaptively randomly assigned to erlotinib (n = 22), erlotinib plus MK-2206 (n = 42), MK-2206 plus AZD6244 (n = 75), or sorafenib (n = 61). In all, 186 patients were evaluable, and the primary end point of an 8-week disease control rate (DCR) was 48% (arm 1, 32%; arm 2, 50%; arm 3, 53%; and arm 4, 46%). For KRAS mut+ patients, DCR was 20%, 25%, 62%, and 44% whereas for KRAS wild-type patients, DCR was 36%, 57%, 49%, and 47% for arms 1, 2, 3, and 4, respectively. Median progression-free survival was 2.0 months, not different by KRAS status, 1.8 months for arm 1, and 2.5 months for arms 2 versus arms 3 and 4 in KRAS mut+ patients (P = .04). Median overall survival was 6.5 months, 9.0 and 5.1 months for arms 1 and 2 versus arms 3 and 4 in KRAS wild-type patients (P = .03). Median overall survival was 7.5 months in mesenchymal versus 5 months in epithelial tumors (P = .02). Conclusion Despite improved progression-free survival on therapy that did not contain erlotinib for KRAS mut+ patients and improved prognosis for mesenchymal tumors, better biomarker-driven treatment strategies are still needed. PMID:27480147

Delay-dependent working memory impairment in young-adult and aged 5-HT1BKO mice as assessed in a radial-arm water maze.

PubMed

Wolff, Mathieu; Benhassine, Narimane; Costet, Pierre; Hen, Rene; Segu, Louis; Buhot, Marie-Christine

2003-01-01

Serotonin (5-HT) plays a modulatory role in mnemonic functions, especially by interacting with the cholinergic system. The 5-HT1B receptor is a key target of this interaction. The 5-HT1B receptor knockout mice were found previously to exhibit a facilitation in hippocampal-dependent spatial reference memory learning. In the present study, we submitted mice to a delayed spatial working memory task, allowing the introduction of various delays between an exposure trial and a test trial. The 5-HT1BKO and wild-type mice learned the task in a radial-arm water maze (returning to the most recent presented arm containing the escape platform), and exhibited a high level of performance at delays of 0 and 5 min. However, at the delay of 60 min, only 5-HT1BKO mice exhibited an impairment. At a delay of 90 min, all mice were impaired. Treatment by scopolamine (0.8 mg/kg) induced the same pattern of performance in wild type as did the mutation for short (5 min, no impairment) and long (60 min, impairment) delays. The 22-month-old wild-type and knockout mice exhibited an impairment at short delays (5 and 15 min). The effect of the mutation affected both young-adult and aged mice at delays of 15, 30, and 60 min. Neurobiological data show that stimulation of the 5-HT1B receptor inhibits the release of acetylcholine in the hippocampus, but stimulates this in the frontal cortex. This dual function might, at least in part, explain the opposite effect of the mutation on reference memory (facilitation) and delay-dependent working memory (impairment). These results support the idea that cholinergic-serotonergic interactions play an important role in memory processes.

Mutation abundance affects the therapeutic efficacy of EGFR-TKI in patients with advanced lung adenocarcinoma: A retrospective analysis.

PubMed

Wang, Huijuan; Zhang, Mina; Tang, Wanyu; Ma, Jie; Wei, Bing; Niu, Yuanyuan; Zhang, Guowei; Li, Peng; Yan, Xiangtao; Ma, Zhiyong

2018-03-22

To investigate the influence of mutation abundance and sites of epidermal growth factor receptor (EGFR) on therapeutic efficacies of EGFR-tyrosine kinase inhibitor (EGFR-TKIs) treatments of patients with advanced non-small cell lung carcinoma (NSCLC). EGFR mutational sites and mutation abundance were analyzed by amplification refractory mutation system (ARMS) in paraffin-embedded tissue sections taken from primary or metastatic tumors of 194 NSCLC patients. The median progression-free survival (PFS) time of the enrolled patients was 9.3 months (95% CI, 8.2-10.8 months). The PFS was significantly different with EGFR gene mutation abundance after EGFR-TKI therapy (P = 0.014). The median PFS was significantly longer when the cut-off value of EGFR mutation abundance of exon 19 or exon 21, and solely exon 19 was > 26.7% and 61.8%, respectively. For patients who received EGFR-TKI as first-line treatment, the median PFS was significantly longer in the high mutation abundance group than in the low mutation abundance group (12.7 vs 8.7 months, P = 0.002). The PFS benefits were greater in patients with a higher abundance of exon 19 deletion mutations in the EGFR gene after EGFR-TKI treatment and first line EGFR-TKI treatment led to improved PFS in high mutation abundance patients.

Impact of family history of cancer on the incidence of mutation in epidermal growth factor receptor gene in non-small cell lung cancer patients.

PubMed

He, Yayi; Li, Shuai; Ren, Shengxiang; Cai, Weijing; Li, Xuefei; Zhao, Chao; Li, Jiayu; Chen, Xiaoxia; Gao, Guanghui; Li, Wei; Zhou, Fei; Zhou, Caicun

2013-08-01

Epidermal growth factor receptor (EGFR) activating mutation is an important predictive biomarker of EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer (NSCLC), while family history of cancer also plays an important role in the neoplasia of lung cancer. This study aimed to investigate the association between family history of cancer and EGFR mutation status in NSCLC population. From February 2008 to May 2012, 538 consecutive NSCLC patients with known EGFR mutation status were included into this study. Amplification refractory mutation system (ARMS) method was used to detect EGFR mutation. The associations between EGFR mutation and family history of cancer were evaluated using logistic regression models. EGFR activating mutation was found in 220 patients and 117 patients had family cancer histories among first-degree relatives. EGFR mutation was more frequently detected in adenocarcinoma patients (p < 0.001), never-smoker (p < 0.001) and with family history of cancer (p = 0.031), especially who had family history of lung cancer (p = 0.008). In multivariate analysis, the association of EGFR mutation with family history of cancer also existed (p = 0.027). NSCLC patients with family history of cancer, especially family history of lung cancer, might have a significantly higher incidence of EGFR activating mutation. Crown Copyright © 2013. Published by Elsevier Ireland Ltd. All rights reserved.

Low frequency of c-MPL gene mutations in Iranian patients with Philadelphia-negative myeloproliferative disorders.

PubMed

Ghotaslou, A; Nadali, F; Chahardouli, B; Alizad Ghandforosh, N; Rostami, S H; Alimoghaddam, K; Ghavamzadeh, A

2015-01-01

Myeloproliferative disorders are a group of diseases characterized by increased proliferation of myeloid lineage. In addition to JAK2V617F mutation, several mutations in the c-MPL gene have been reported in patients with philadelphia-negative chronic myeloproliferative disorders that could be important in the pathogenesis of diseases. The aim of the present study was to investigate the frequency of c-MPL and JAK2V617F mutations in Iranian patients with Philadelphia-negativemyeloproliferative disorders. Peripheral blood samples were collected from 60 patients with Philadelphia-negative MPD) Subgroups ET and PMF) and 25 healthy subjects as control group. The mutation status of c-MPL and Jak2V617F were investigated by using Amplification-refractory mutation system (ARMS) and Allele-Specific PCR (AS-PCR), respectively. The results were confirmed by sequencing. Among 60 patients, 34 (56.6%) and 1(1.7%) had Jak2V617F and c-MPL mutation, respectively. Patients with Jak2V617F mutation had higher WBC counts and hemoglobin concentration than those without the mutation (p= 0.005, p=0.003). In addition, for all healthy subjects in control group, mutations were negative. The present study revealed that the c-MPL mutations unlike the Jak2V617F mutations are rare in Iranian patients with Ph-negative MPNs and the low mutation rate should be considered in the design of screening strategies of MPD patients.

Low frequency of c-MPL gene mutations in Iranian patients with Philadelphia-negative myeloproliferative disorders

PubMed Central

Ghotaslou, A; Nadali, F; Chahardouli, B; Alizad Ghandforosh, N; Rostami, SH; Alimoghaddam, K; Ghavamzadeh, A

2015-01-01

Background Myeloproliferative disorders are a group of diseases characterized by increased proliferation of myeloid lineage. In addition to JAK2V617F mutation, several mutations in the c-MPL gene have been reported in patients with philadelphia-negative chronic myeloproliferative disorders that could be important in the pathogenesis of diseases. The aim of the present study was to investigate the frequency of c-MPL and JAK2V617F mutations in Iranian patients with Philadelphia-negativemyeloproliferative disorders. Material and Methods Peripheral blood samples were collected from 60 patients with Philadelphia-negative MPD) Subgroups ET and PMF) and 25 healthy subjects as control group. The mutation status of c-MPL and Jak2V617F were investigated by using Amplification-refractory mutation system (ARMS) and Allele-Specific PCR (AS-PCR), respectively. The results were confirmed by sequencing. Results Among 60 patients, 34 (56.6%) and 1(1.7%) had Jak2V617F and c-MPL mutation, respectively. Patients with Jak2V617F mutation had higher WBC counts and hemoglobin concentration than those without the mutation (p= 0.005, p=0.003). In addition, for all healthy subjects in control group, mutations were negative. Conclusions The present study revealed that the c-MPL mutations unlike the Jak2V617F mutations are rare in Iranian patients with Ph-negative MPNs and the low mutation rate should be considered in the design of screening strategies of MPD patients. PMID:25914801

Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

PubMed

Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

2005-01-01

Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

First-line gefitinib in Caucasian EGFR mutation-positive NSCLC patients: a phase-IV, open-label, single-arm study

PubMed Central

Douillard, J-Y; Ostoros, G; Cobo, M; Ciuleanu, T; McCormack, R; Webster, A; Milenkova, T

2014-01-01

Background: Phase-IV, open-label, single-arm study (NCT01203917) to assess efficacy and safety/tolerability of first-line gefitinib in Caucasian patients with stage IIIA/B/IV, epidermal growth factor receptor (EGFR) mutation-positive non-small-cell lung cancer (NSCLC). Methods: Treatment: gefitinib 250 mg day−1 until progression. Primary endpoint: objective response rate (ORR). Secondary endpoints: disease control rate (DCR), progression-free survival (PFS), overall survival (OS) and safety/tolerability. Pre-planned exploratory objective: EGFR mutation analysis in matched tumour and plasma samples. Results: Of 1060 screened patients with NSCLC (859 known mutation status; 118 positive, mutation frequency 14%), 106 with EGFR sensitising mutations were enrolled (female 70.8% adenocarcinoma 97.2% never-smoker 64.2%). At data cutoff: ORR 69.8% (95% confidence interval (CI) 60.5–77.7), DCR 90.6% (95% CI 83.5–94.8), median PFS 9.7 months (95% CI 8.5–11.0), median OS 19.2 months (95% CI 17.0–NC; 27% maturity). Most common adverse events (AEs; any grade): rash (44.9%), diarrhoea (30.8%); CTC (Common Toxicity Criteria) grade 3/4 AEs: 15% SAEs: 19%. Baseline plasma 1 samples were available in 803 patients (784 known mutation status; 82 positive; mutation frequency 10%). Plasma 1 EGFR mutation test sensitivity: 65.7% (95% CI 55.8–74.7). Conclusion: First-line gefitinib was effective and well tolerated in Caucasian patients with EGFR mutation-positive NSCLC. Plasma samples could be considered for mutation analysis if tumour tissue is unavailable. PMID:24263064

Type III Effector Diversification via Both Pathoadaptation and Horizontal Transfer in Response to a Coevolutionary Arms Race

PubMed Central

Ma, Wenbo; Dong, Frederick F. T; Stavrinides, John; Guttman, David S

2006-01-01

The concept of the coevolutionary arms race holds a central position in our understanding of pathogen–host interactions. Here we identify the molecular mechanisms and follow the stepwise progression of an arms race in a natural system. We show how the evolution and function of the HopZ family of type III secreted effector proteins carried by the plant pathogen Pseudomonas syringae are influenced by a coevolutionary arms race between pathogen and host. We surveyed 96 isolates of P. syringae and identified three homologs (HopZ1, HopZ2, and HopZ3) distributed among ∼45% of the strains. All alleles were sequenced and their expression was confirmed. Evolutionary analyses determined that the diverse HopZ1 homologs are ancestral to P. syringae, and have diverged via pathoadaptive mutational changes into three functional and two degenerate forms, while HopZ2 and HopZ3 have been brought into P. syringae via horizontal transfer from other ecologically similar bacteria. A PAML selection analysis revealed that the C terminus of HopZ1 is under strong positive selection. Despite the extensive genetic variation observed in this family, all three homologs have cysteine–protease activity, although their substrate specificity may vary. The introduction of the ancestral hopZ1 allele into strains harboring alternate alleles results in a resistance protein-mediated defense response in their respective hosts, which is not observed with the endogenous allele. These data indicate that the P. syringae HopZ family has undergone allelic diversification via both pathoadaptive mutational changes and horizontal transfer in response to selection imposed by the host defense system. This genetic diversity permits the pathogen to avoid host defenses while still maintaining a virulence-associated protease, thereby allowing it to thrive on its current host, while simultaneously impacting its host range. PMID:17194219

Maternal segmental disomy in Leigh syndrome with cytochrome c oxidase deficiency caused by homozygous SURF1 mutation.

PubMed

van Riesen, A K J; Antonicka, H; Ohlenbusch, A; Shoubridge, E A; Wilichowski, E K G

2006-04-01

Cytochrome c oxidase deficiency (COX) is the most frequent cause of Leigh syndrome (LS), a mitochondrial subacute necrotizing encephalomyelopathy. Most of these LS (COX-) patients show mutations in SURF1 on chromosome 9 (9q34), which encodes a protein essential for the assembly of the COX complex. We describe a family whose first-born boy developed characteristic features of LS. Severe COX deficiency in muscle was caused by a novel homozygous nonsense mutation in SURF1. Segregation analysis of this mutation in the family was incompatible with autosomal recessive inheritance but consistent with a maternal disomy. Haplotype analysis of microsatellite markers confirmed isodisomy involving nearly the complete long arm of chromosome 9 (9q21-9tel). No additional physical abnormalities were present in the boy, suggesting that there are no imprinted genes on the long arm of chromosome 9 which are crucial for developmental processes. This case of segmental isodisomy illustrates that genotyping of parents is crucial for correct genetic counseling.

Designing and Validation of One-Step T-ARMS-PCR for Genotyping the eNOS rs1799983 SNP

PubMed Central

Heidar, Mohammad Mehdi; Khatami, Mehri

2017-01-01

Background: The transversion of G to T (G894T) in human endothelial nitric oxide synthase (eNOS) gene has profound effects such as male infertility, recurrent miscarriage, multiple sclerosis and cardiovascular diseases. Objectives: Development of a new Multiplex Tetra-Primer Amplification Refractory Mutation System - Polymerase Chain Reaction (T-ARMS-PCR) for detection of rs1799983 (G894T) in the human eNOS was sought. Materials and Methods: A T-ARMS-PCR for rs1799983 polymorphism in a single-step PCR was carried out, and the results were confirmed by PCR-RFLP technique in 82 infertile men with varicocele. Results: The results showed that GG (varicocele infertile men), GT and TT genotypes appear to be 53.65%, 34.14%, and 12.19%, respectively. Full accordance between PCR-RFLP and T-ARMS-PCR methods for genotyping of rs1799983 polymorphism was found. Conclusions: This is the first work that describes a rapid, relatively cheap, high throughput detection of G894T polymorphism in eNOS that can be used in large scale clinical studies. PMID:29845071

Designing and Validation of One-Step T-ARMS-PCR for Genotyping the eNOS rs1799983 SNP.

PubMed

Heidar, Mohammad Mehdi; Khatami, Mehri

2017-01-01

Background: The transversion of G to T (G894T) in human endothelial nitric oxide synthase ( eNOS ) gene has profound effects such as male infertility, recurrent miscarriage, multiple sclerosis and cardiovascular diseases. Objectives: Development of a new Multiplex Tetra-Primer Amplification Refractory Mutation System - Polymerase Chain Reaction (T-ARMS-PCR) for detection of rs1799983 (G894T) in the human eNOS was sought. Materials and Methods: A T-ARMS-PCR for rs1799983 polymorphism in a single-step PCR was carried out, and the results were confirmed by PCR-RFLP technique in 82 infertile men with varicocele. Results: The results showed that GG (varicocele infertile men), GT and TT genotypes appear to be 53.65%, 34.14%, and 12.19%, respectively. Full accordance between PCR-RFLP and T-ARMS-PCR methods for genotyping of rs1799983 polymorphism was found. Conclusions: This is the first work that describes a rapid, relatively cheap, high throughput detection of G894T polymorphism in eNOS that can be used in large scale clinical studies.

Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

PubMed

Moorchung, Nikhil; Phillip, Joseph; Sarkar, Ravi Shankar; Prasad, Rupesh; Dutta, Vibha

2013-01-01

Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC) is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR)-based allele-specific Amplification Refractory Mutation System (ARMS). Molecular analysis for the sickle cell mutation was done by standard methods. The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23%) of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS) because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

Structures of the APC–ARM domain in complexes with discrete Amer1/WTX fragments reveal that it uses a consensus mode to recognize its binding partners

PubMed Central

Zhang, Zhenyi; Akyildiz, Senem; Xiao, Yafei; Gai, Zhongchao; An, Ying; Behrens, Jürgen; Wu, Geng

2015-01-01

The tumor suppressor APC employs its conserved armadillo repeat (ARM) domain to recognize many of its binding partners, including Amer1/WTX, which is mutated in Wilms' tumor and bone overgrowth syndrome. The APC–Amer1 complex has important roles in regulating Wnt signaling and cell adhesion. Three sites A1, A2, and A3 of Amer1 have been reported to mediate its interaction with APC-ARM. In this study, crystal structures of APC–ARM in complexes with Amer1-A1, -A2, and -A4, which is newly identified in this work, were determined. Combined with our GST pull-down, yeast two-hybrid, and isothermal titration calorimetry (ITC) assay results using mutants of APC and Amer1 interface residues, our structures demonstrate that Amer1-A1, -A2, and -A4, as well as other APC-binding proteins such as Asef and Sam68, all employ a common recognition pattern to associate with APC–ARM. In contrast, Amer1-A3 binds to the C-terminal side of APC–ARM through a bipartite interaction mode. Composite mutations on either APC or Amer1 disrupting all four interfaces abrogated their association in cultured cells and impaired the membrane recruitment of APC by Amer1. Our study thus comprehensively elucidated the recognition mechanism between APC and Amer1, and revealed a consensus recognition sequence employed by various APC–ARM binding partners. PMID:27462415

Structures of the APC-ARM domain in complexes with discrete Amer1/WTX fragments reveal that it uses a consensus mode to recognize its binding partners.

PubMed

Zhang, Zhenyi; Akyildiz, Senem; Xiao, Yafei; Gai, Zhongchao; An, Ying; Behrens, Jürgen; Wu, Geng

2015-01-01

The tumor suppressor APC employs its conserved armadillo repeat (ARM) domain to recognize many of its binding partners, including Amer1/WTX, which is mutated in Wilms' tumor and bone overgrowth syndrome. The APC-Amer1 complex has important roles in regulating Wnt signaling and cell adhesion. Three sites A1, A2, and A3 of Amer1 have been reported to mediate its interaction with APC-ARM. In this study, crystal structures of APC-ARM in complexes with Amer1-A1, -A2, and -A4, which is newly identified in this work, were determined. Combined with our GST pull-down, yeast two-hybrid, and isothermal titration calorimetry (ITC) assay results using mutants of APC and Amer1 interface residues, our structures demonstrate that Amer1-A1, -A2, and -A4, as well as other APC-binding proteins such as Asef and Sam68, all employ a common recognition pattern to associate with APC-ARM. In contrast, Amer1-A3 binds to the C-terminal side of APC-ARM through a bipartite interaction mode. Composite mutations on either APC or Amer1 disrupting all four interfaces abrogated their association in cultured cells and impaired the membrane recruitment of APC by Amer1. Our study thus comprehensively elucidated the recognition mechanism between APC and Amer1, and revealed a consensus recognition sequence employed by various APC-ARM binding partners.

Quantification and Dynamic Monitoring of EGFR T790M in Plasma Cell-Free DNA by Digital PCR for Prognosis of EGFR-TKI Treatment in Advanced NSCLC

PubMed Central

Wang, Zhijie; Chen, Rui; Wang, Shuhang; Zhong, Jia; Wu, Meina; Zhao, Jun; Duan, Jianchun; Zhuo, Minglei; An, Tongtong; Wang, Yuyan; Bai, Hua; Wang, Jie

2014-01-01

Background Among advanced non-small cell lung cancer (NSCLC) patients with an acquired resistance to epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKI), about 50% carry the T790M mutation, but this frequency in EGFR-TKI-naïve patients and dynamic change during therapy remains unclear. This study investigated the quantification and dynamic change of T790M mutation in plasma cell-free DNA (cf-DNA) of advanced NSCLC patients to assess the clinical outcomes of EGFR-TKI therapy. Materials and Methods We retrospectively investigated 135 patients with advanced NSCLC who obtained progression-free survival (PFS) after EGFR-TKI for >6 months for their EGFR sensitive mutations and T790M mutation in matched pre- and post-TKI plasma samples, using denaturing high-performance liquid chromatography (DHPLC), amplification refractory mutation system (ARMS), and digital-PCR (D-PCR). Real-time PCR was performed to measure c-MET amplification. Results Detection limit of D-PCR in assessing the T790M mutation was approximately 0.03%. D-PCR identified higher frequency of T790M than ARMS in pre-TKI (31.3% vs. 5.5%) and post-TKI (43.0% vs. 25.2%) plasma samples. Patients with pre-TKI T790M showed inferior PFS (8.9 vs. 12.1 months, p = 0.007) and overall survival (OS, 19.3 vs. 31.9 months, p = 0.001) compared with those without T790M. In patients harboring EGFR sensitive mutation, high quantities of pre-TKI T790M predicted poorer PFS (p = 0.001) on EGFR-TKI than low ones. Moreover, patients who experienced increased quantity of T790M during EGFR-TKI treatment showed superior PFS and OS compared with those with decreased changes (p = 0.044 and p = 0.015, respectively). Conclusion Qualitative and quantitative T790M in plasma cf-DNA by D-PCR provided a non-invasive and sensitive assay to predict EGFR-TKI prognosis. PMID:25405807

Juvenile-onset Sporadic Amyotrophic Lateral Sclerosis with a Frameshift FUS Gene Mutation Presenting Unique Neuroradiological Findings and Cognitive Impairment.

PubMed

Hirayanagi, Kimitoshi; Sato, Masayuki; Furuta, Natsumi; Makioka, Kouki; Ikeda, Yoshio

2016-01-01

A 24-year-old Japanese woman developed anterocollis, weakness of the proximal arms, and subsequent cognitive impairment. A neurological examination revealed amyotrophic lateral sclerosis (ALS) without a family history. Systemic muscle atrophy progressed rapidly. Cerebral MRI clearly exhibited high signal intensities along the bilateral pyramidal tracts. An analysis of the FUS gene revealed a heterozygous two-base pair deletion, c.1507-1508delAG (p.G504WfsX515). A subset of juvenile-onset familial/sporadic ALS cases with FUS gene mutations reportedly demonstrates mental retardation or learning difficulty. Our study emphasizes the importance of conducting a FUS gene analysis in juvenile-onset ALS cases, even when no family occurrence is confirmed.

Rb1 loss modifies but does not initiate alveolar rhabdomyosarcoma

PubMed Central

2013-01-01

Background Alveolar rhabdomyosarcoma (aRMS) is a myogenic childhood sarcoma frequently associated with a translocation-mediated fusion gene, Pax3:Foxo1a. Methods We investigated the complementary role of Rb1 loss in aRMS tumor initiation and progression using conditional mouse models. Results Rb1 loss was not a necessary and sufficient mutational event for rhabdomyosarcomagenesis, nor a strong cooperative initiating mutation. Instead, Rb1 loss was a modifier of progression and increased anaplasia and pleomorphism. Whereas Pax3:Foxo1a expression was unaltered, biomarkers of aRMS versus embryonal rhabdomyosarcoma were both increased, questioning whether these diagnostic markers are reliable in the context of Rb1 loss. Genome-wide gene expression in Pax3:Foxo1a,Rb1 tumors more closely approximated aRMS than embryonal rhabdomyosarcoma. Intrinsic loss of pRb function in aRMS was evidenced by insensitivity to a Cdk4/6 inhibitor regardless of whether Rb1 was intact or null. This loss of function could be attributed to low baseline Rb1, pRb and phospho-pRb expression in aRMS tumors for which the Rb1 locus was intact. Pax3:Foxo1a RNA interference did not increase pRb or improve Cdk inhibitor sensitivity. Human aRMS shared the feature of low and/or heterogeneous tumor cell pRb expression. Conclusions Rb1 loss from an already low pRb baseline is a significant disease modifier, raising the possibility that some cases of pleomorphic rhabdomyosarcoma may in fact be Pax3:Foxo1a-expressing aRMS with Rb1 or pRb loss of function. PMID:24274149

A novel cell line generated using the CRISPR/Cas9 technology as universal quality control material for KRAS G12V mutation testing.

PubMed

Jia, Shiyu; Zhang, Rui; Lin, Guigao; Peng, Rongxue; Gao, Peng; Han, Yanxi; Fu, Yu; Ding, Jiansheng; Wu, Qisheng; Zhang, Kuo; Xie, Jiehong; Li, Jinming

2018-06-01

KRAS mutations are the key indicator for EGFR monoclonal antibody-targeted therapy and acquired drug resistance, and their accurate detection is critical to the clinical decision-making of colorectal cancer. However, no proper quality control material is available for the current detection methods, particularly next-generation sequencing (NGS). The ideal quality control material for NGS needs to provide both the tumor mutation gene and the matched background genomic DNA, which is uncataloged in public databases, to accurately distinguish germline polymorphisms and somatic mutations. We developed a novel KRAS G12V mutant cell line using the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) technique to make up for the deficiencies in existing quality control material and further validated the feasibility of the cell line as quality control material by amplification refractory mutation system (ARMS), Sanger sequencing, digital PCR (dPCR), and NGS. We verified that the edited cell line specifically had the G12V mutation, and the validation results presented a high consistency among the four methods of detection. The three cell lines screened contained the G12V mutation and the mutation allele fractions of G12V-1, G12V-2, and G12V-3 were 52.01%, 82.06%, and 17.29%, respectively. The novel KRAS G12V cell line generated using the CRISPR/Cas9 gene editing system is suitable as a quality control material for all current detection methods and provides a new direction in the development of quality control material. © 2018 Wiley Periodicals, Inc.

[Molecular characterization of heterozygous beta-thalassemia in Lanzarote, Spain].

PubMed

Calvo-Villas, José Manuel; de la Iglesia Iñigo, Silvia; Ropero Gradilla, Paloma; Zapata Ramos, María Francisca; Cuesta Tovar, Jorge; Sicilia Guillén, Francisco

2008-04-05

The aim of this study was to determine the molecular defects of heterozygous beta thalassaemia and to ascertain their distribution in Lanzarote. Molecular characterization was achieved by real time polymerase chain reaction (RT-PCR LightCycler, Roche), PCR-ARMS (PCR-amplification reaction mutations system) and DNA sequencing on an automated DNA sequencer. Two hundred forty-three heterozygous beta thalassaemia carriers were included between July 1991 and February 2007. RT-PCR detected the molecular defect in 81% of the beta thalassaemia chromosomes analyzed [113 codon CD 39 (C --> T); 41 IVS-1-nt-110 (G --> A), 25 IVS 1-nt-1 (G --> A) and 19 IVS 1-nt-6 (T --> C)]. The remaining 12 molecular defects included the deletion 619 bp (7.8%) and the mutations -28 (A --> G), IVS1-nt-2 (T --> G), CD 41/42 (-TTCT), CD 8/9 (+G), CD 51 (-C), CD 22 (G --> T) and CD 24 (T --> A), CD 67 (-TG) and the novel mutation CD 20/21-TGGA. The distribution of the mutations is similar to that found in the Mediterranean area. The increasing migratory flow received in the Canary Islands may explain the emergence of new mutations not reported before in our area.

Risk assessment of maternally inherited SDHD paraganglioma and phaeochromocytoma.

PubMed

Burnichon, Nelly; Mazzella, Jean-Michaël; Drui, Delphine; Amar, Laurence; Bertherat, Jérôme; Coupier, Isabelle; Delemer, Brigitte; Guilhem, Isabelle; Herman, Philippe; Kerlan, Véronique; Tabarin, Antoine; Wion, Nelly; Lahlou-Laforet, Khadija; Favier, Judith; Gimenez-Roqueplo, Anne-Paule

2017-02-01

Germline mutations in the SDHD tumour suppressor gene (11q23.1) predispose to phaeochromocytomas and paragangliomas (PPGL) mainly on a paternal transmission. However, PPGL have been recently reported in three carriers of a maternally inherited SDHD mutation. To assess the risk of PPGL occurrence on maternal transmission of SDHD mutation. Pedigrees of 80 SDHD-related families have been reviewed. 35 asymptomatic subjects carrying a maternally transmitted SDHD mutation were identified. 20 of them accepted to benefit from a PPGL imaging screening. A unique histologically proven biochemically negative phaeochromocytoma has been diagnosed in a 35-year-old woman. Molecular investigations carried out on tumour tissue revealed that the loss of heterozygosity encompassed the paternally derived q arm and the maternally derived p arm of chromosome 11. This study demonstrates that the risk of developing PPGL for a subject carrying a germline SDHD mutation on the maternal allele remains a rare scenario but does exist. Our data suggest an adjustment of current genetic counselling and clinical care recommendations for at-risk subjects. A targeted familial genetic test should be proposed from the age of 18 years to every subject having a mother carrying a germline SDHD mutation and a first medical workup, including imaging, should be recommended to SDHD-positive mutation carriers. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Screening for germline mutations in the neurofibromatosis type 2 (NF2) gene in NF2 patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andermann, A.A.; Ruttledge, M.H.; Rangaratnam, A.

Neurofibromatosis type 2 (NF2) is an autosomal dominant disease with over 95% penetrance which predisposes gene carriers to develop multiple tumors of the central nervous system. The NF2 gene is a putative tumor suppressor gene which was previously mapped to the long arm of chromosome 22, and has recently been identified, using positional cloning techniques. The gene encodes a protein, schwannomin (SCH), which is highly homologous to the band 4.1 protein family. In an attempt to identify and characterize mutations which lead to the manifestation of the disease, we have used single strand conformation analysis (SSCA) to screen for germlinemore » mutations in all 17 exons of the NF2 gene in 59 unrelated NF2 patients, representing both familial and new mutations. A total of 27 migration abnormalities was found in 26 patients. Using direct sequencing analysis, the majority of these variants were found to result in nonsense, splice-site or frameshift mutations. Mutations identified in familial NF2 patients segregate in the family, and may prove to be useful tools for a simple and direct SSCA-based technique of presymptomatic or prenatal diagnosis in relatives of patients with NF2. This may be of particular importance in children of patients who have new mutations in the NF2 gene, where linkage analysis may not be feasible.« less

Mutations in ZMYND10, a Gene Essential for Proper Axonemal Assembly of Inner and Outer Dynein Arms in Humans and Flies, Cause Primary Ciliary Dyskinesia

PubMed Central

Moore, Daniel J.; Onoufriadis, Alexandros; Shoemark, Amelia; Simpson, Michael A.; zur Lage, Petra I.; de Castro, Sandra C.; Bartoloni, Lucia; Gallone, Giuseppe; Petridi, Stavroula; Woollard, Wesley J.; Antony, Dinu; Schmidts, Miriam; Didonna, Teresa; Makrythanasis, Periklis; Bevillard, Jeremy; Mongan, Nigel P.; Djakow, Jana; Pals, Gerard; Lucas, Jane S.; Marthin, June K.; Nielsen, Kim G.; Santoni, Federico; Guipponi, Michel; Hogg, Claire; Antonarakis, Stylianos E.; Emes, Richard D.; Chung, Eddie M.K.; Greene, Nicholas D.E.; Blouin, Jean-Louis; Jarman, Andrew P.; Mitchison, Hannah M.

2013-01-01

Primary ciliary dyskinesia (PCD) is a ciliopathy characterized by airway disease, infertility, and laterality defects, often caused by dual loss of the inner dynein arms (IDAs) and outer dynein arms (ODAs), which power cilia and flagella beating. Using whole-exome and candidate-gene Sanger resequencing in PCD-affected families afflicted with combined IDA and ODA defects, we found that 6/38 (16%) carried biallelic mutations in the conserved zinc-finger gene BLU (ZMYND10). ZMYND10 mutations conferred dynein-arm loss seen at the ultrastructural and immunofluorescence level and complete cilia immotility, except in hypomorphic p.Val16Gly (c.47T>G) homozygote individuals, whose cilia retained a stiff and slowed beat. In mice, Zmynd10 mRNA is restricted to regions containing motile cilia. In a Drosophila model of PCD, Zmynd10 is exclusively expressed in cells with motile cilia: chordotonal sensory neurons and sperm. In these cells, P-element-mediated gene silencing caused IDA and ODA defects, proprioception deficits, and sterility due to immotile sperm. Drosophila Zmynd10 with an equivalent c.47T>G (p.Val16Gly) missense change rescued mutant male sterility less than the wild-type did. Tagged Drosophila ZMYND10 is localized primarily to the cytoplasm, and human ZMYND10 interacts with LRRC6, another cytoplasmically localized protein altered in PCD. Using a fly model of PCD, we conclude that ZMYND10 is a cytoplasmic protein required for IDA and ODA assembly and that its variants cause ciliary dysmotility and PCD with laterality defects. PMID:23891471

Population-Based Genetic Study of β-Thalassemia Mutations in Mardan Division, Khyber Pakhtunkhwa Province, Pakistan.

PubMed

Muhammad, Raj; Shakeel, Muhammad; Rehman, Shoaib U; Lodhi, Muhammad A

2017-03-01

β-Thalassemia (β-thal) is the most prevalent hereditary blood disorder in Pakistan with a carrier rate of 5.0-8.0%. The homozygous affected children require frequent blood transfusions for their survival. This autosomal recessive disease can only be prevented through awareness programs, carrier screening, mutation detection, genetic counseling and prenatal diagnosis (PND). The present study aimed to determine the prevalence of various mutations causing β-thal and also to detect carriers of these mutations in families living in the Mardan Division, Khyber Pakhtunkhwa (KP) Province, Pakistan. The study was conducted at the Department of Biochemistry, Abdul Wali Khan University Mardan, Pakistan. Blood samples of β-thalassemic families were collected from various transfusion centers in Mardan Division. Using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) technique, all samples were analyzed for the six most common mutations causing β-thal in this area. Six different mutant primers for the detection of different mutations were used. The most common mutations detected in thalassemic patients were frameshift codons (FSC) 8/9 (+G) (HBB: c.27_28insG), codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), and IVS-I-5 (G>C) (HBB: c.92+5G>C). The predominant mutation for carrying the mutant genes for β-thal were FSC 8/9, IVS-I-5, codons 41/42, IVS-I-1. It was also found that 66.7% of marriages were consanguineous. The FSC 8/9 mutation was found to be the most common β-thal mutation with a frequency of 44.4%. This research project provides a strong incentive for the establishment of large scale mutation detection and PND services in the Mardan Division.

PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

PubMed Central

Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes

2009-01-01

Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non-specific amplification in non-stringent amplification conditions. The PIRA-PCR assay is able to detect both the codons for the phenylalanine mutation at kdr locus, i.e., TTT and TTC, in a single assay, although the latter codon was not found in the population genotyped. PMID:19594947

Detection of low-level DNA mutation by ARMS-blocker-Tm PCR.

PubMed

Qu, Shoufang; Liu, Licheng; Gan, Shuzhen; Feng, Huahua; Zhao, Jingyin; Zhao, Jing; Liu, Qi; Gao, Shangxiang; Chen, Weijun; Wang, Mengzhao; Jiang, Yongqiang; Huang, Jie

2016-02-01

Low-level DNA mutations play important roles in cancer prognosis and treatment. However, most existing methods for the detection of low-level DNA mutations are insufficient for clinical applications because of the high background of wild-type DNA. In this study, a novel assay based on Tm-dependent inhibition of wild type template amplification was developed. The defining characteristic of this assay is an additional annealing step was introduced into the ARMS-blocker PCR. The temperature of this additional annealing step is equal to the Tm of the blocker. Due to this additional annealing step, the blocker can preferentially and specifically bind the wild-type DNA. Thus, the inhibition of wild type template is realized and the mutant DNA is enriched. The sensitivity of this assay was between 10(-4) and 10(-5), which is approximately 5 to 10 times greater than the sensitivity of the assay without the additional annealing step. To evaluate the performance of this assay in detecting K-ras mutation, we analyzed 100 formalin-fixed paraffin-embedded (FFPE) specimens from colorectal cancer patients using this new assay and Sanger sequencing. Of the clinical samples, 27 samples were positive for K-ras mutation by both methods. Our results indicated that this new assay is a highly selective, convenient, and economical method for detecting rare mutations in the presence of higher concentrations of wild-type DNA. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

PubMed

Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

2015-09-01

Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Prospective evaluation of gene mutations and minimal residual disease in patients with core binding factor acute myeloid leukemia.

PubMed

Jourdan, Eric; Boissel, Nicolas; Chevret, Sylvie; Delabesse, Eric; Renneville, Aline; Cornillet, Pascale; Blanchet, Odile; Cayuela, Jean-Michel; Recher, Christian; Raffoux, Emmanuel; Delaunay, Jacques; Pigneux, Arnaud; Bulabois, Claude-Eric; Berthon, Céline; Pautas, Cécile; Vey, Norbert; Lioure, Bruno; Thomas, Xavier; Luquet, Isabelle; Terré, Christine; Guardiola, Philippe; Béné, Marie C; Preudhomme, Claude; Ifrah, Norbert; Dombret, Hervé

2013-03-21

Not all patients with core binding factor acute myeloid leukemia (CBF-AML) display a good outcome. Modern risk factors include KIT and/or FLT3 gene mutations and minimal residual disease (MRD) levels, but their respective values have never been prospectively assessed. A total of 198 CBF-AML patients were randomized between a reinforced and a standard induction course, followed by 3 high-dose cytarabine consolidation courses. MRD levels were monitored prospectively. Gene mutations were screened at diagnosis. Despite a more rapid MRD decrease after reinforced induction, induction arm did not influence relapse-free survival (RFS) (64% in both arms; P = .91). Higher WBC, KIT, and/or FLT3-ITD/TKD gene mutations, and a less than 3-log MRD reduction after first consolidation, were associated with a higher specific hazard of relapse, but MRD remained the sole prognostic factor in multivariate analysis. At 36 months, cumulative incidence of relapse and RFS were 22% vs 54% (P < .001) and 73% vs 44% (P < .001) in patients who achieved 3-log MRD reduction vs the others. These results suggest that MRD, rather than gene mutations, should be used for future treatment stratifications in CBF-AML patients. This trial was registered at EudraCT as #2006-005163-26 and at www.clinicaltrials.gov as #NCT 00428558.

Analysis of drug resistance during HIV RNA viraemia in the MONET trial of darunavir/ritonavir monotherapy.

PubMed

Pulido, Federico; Arribas, José R; Hill, Andrew; Van Delft, Yvon; Moecklinghoff, Christiane

2011-01-01

When patients have HIV RNA suppressed to <50 copies/ml on current treatment, switching to darunavir (DRV)/ritonavir (DRV/r) monotherapy could prevent the development of resistance to other drug classes. In the MONET trial, 256 patients with HIV RNA<50 copies/ml on current highly active antiretroviral therapy (57% with protease inhibitors [PIs] and 43% with non-nucleoside reverse transcriptase inhibitors) and no history of virological failure were randomized to DRV/r 800/100 mg once daily, either as monotherapy (monotherapy arm) or with two nucleoside reverse transcriptase inhibitors (NRTIs; triple therapy arm). All samples with HIV RNA ≥ 50 copies/ml were genotyped, and a virtual phenotype was calculated (VircoType HIV-1 assays; Virco BVBA, Mechelen, Belgium). A total of 63 patients had ≥ 1 HIV RNA result ≥ 50 copies/ml, of whom 38 were successfully genotyped. Most HIV RNA increases were transient and in the range of 50-200 copies/ml. Overall, 36 of the 38 (95%) successfully genotyped patients showed no International AIDS Society-USA major PI mutations, DRV mutations or NRTI mutations. Two patients showed some evidence of PI resistance during transient HIV RNA elevations: one patient in the monotherapy arm had a single DRV mutation (L33F) when HIV RNA was 63 copies/ml (the virus was phenotypically sensitive to DRV [fold change 0.8]) and one PI pretreated patient taking tenofovir disoproxil fumarate/emtricitabine/DRV/r had re-emergence of pre-existing NRTI (M184V) and PI (V82I and L90M) mutations after a short treatment interruption (this virus remained phenotypically sensitive to DRV/r). Both patients showed sustained HIV RNA suppression to week 48 remaining with the same treatment. Emergence of drug resistance after changing a suppressive triple antiretroviral therapy to DRV/r with or without nucleoside analogues is uncommon.

Assessment of cytology based molecular analysis to guide targeted therapy in advanced non-small-cell lung cancer.

PubMed

Li, Wenbin; Zhang, Zhihui; Guo, Lei; Qiu, Tian; Ling, Yun; Cao, Jian; Guo, Huiqin; Zhao, Huan; Li, Lin; Ying, Jianming

2016-02-16

To investigate the use of molecular testing on cytological specimens in selecting advanced non-small cell lung cancer (NSCLC) patients who are adequate for targeted treatment, a total of 137 NSCLC cases were analyzed by fluorescence in situ hybridization (FISH) for anaplastic lymphoma kinase (ALK) rearrangements, and Epidermal growth factor receptor (EGFR), kirsten rat sarcoma viral oncogene homolog (KRAS) mutations were evaluated by quantitative real-time PCR (qRT-PCR) platform combining amplification refractory mutation system (ARMS) primers and TaqMan probes. Cytological specimens included 91 fine-needle aspirates, 5 fibreoptic bronchoscopic derived samples and 41 pleural effusions. Among 137 NSCLCs analyzed for ALK FISH, 16 (11.7%, of 137) were detected to harbor ALK rearrangement. FISH positive cases were all defined as adenocarcinoma (ADC) histologic subtype and the FNA samples showed the highest ALK positive rate (13.2%, 12/91). Of the 9 ALK FISH positive patients who received crizotinib treatment, 8 (88.9%) patients exhibited tumor regression. In addition, 60 (44.8%, of 134) cases were found to harbor EGFR mutations and 22 patients with EGFR sensitive mutations who received gefitinib or erlotinib treatment showed a median PFS of 16.0 months. Mutations of KRAS occurred in 8 (6.0%, of 134) cases and this was mutually exclusive from EGFR mutation. Our results demonstrated that ALK FISH and EGFR, KRAS mutational analysis on cytological specimens are sensitive methods for screening advanced stage NSCLC patients who are adequate for targeted treatment.

[Influence of Different Therapies on EGFR Mutants by Circulating Cell-free DNA of Lung Adenocarcinoma and Prognosis].

PubMed

Su, Fei; Zheng, Ke; Fu, Yiyun; Wu, Qian; Tang, Yuan; Wang, Weiya; Jiang, Lili

2018-05-20

Epidermal growth factor receptor (EGFR) gene mutation is closely related to the EGFR-TKI target treatment and prognosis of lung adenocarcinoma patients. The mutation status of EGFR is limited by tissue detection. The purpose of this study was to investigate the difference of EGFR mutants in plasmacirculating cell-free DNA (cfDNA) obtained from patients with non-small cell lung cancer (NSCLC) in three groups: pre-therapy, after traditional chemotherapy and targeted therapy. The aim of this study was to analyze whether the plasma cfDNA could effectively determine the EGFR mutations and monitor the drug resistant gene T790M, as well as its prognostic prediction value in patients with targeted therapy. ARMS (amplification refractory mutation system)-PCR was used to detect EGFR mutations in 107 (50 of pre-therapy, 29 after traditional chemotherapy and 28 after targeted therapy) cases of paired plasma and tumor tissue specimens, followed by comparing their concordance. The sensitivity, specificity and the prognostic value of plasma cfDNA detection were also observed. The total rate of EGFR mutation was 56% (60/107) in all plasma samples and 77.6% (83/107) in corresponding tumor tissues. Completely the same mutants and wild-type EGFR were found in 68.2% cases of paired specimens. The sensitivity of plasma cfDNA detection was 72.3% and the specificity was up to 100%. Patients were sub-categorized according to therapy. The results showed that the highest consistent rate of cfDNA and tumor tissues was found in the group of pre-therapy (74%, 37/50). Whereas, the lowest consistent rate was observed in the targeted therapy group (57.1%, 16/28). It indicated that the targeted treatment could change the EGFR status in plasma cfDNA. Further analyses on inconsistent cases in this group revealed that 50% of them were compound EGFR mutations with T790M. Thereby, it suggested that targeted therapy might induce the emergence of drug resistance gene T790M. This speculation was confirmed by survival analyses. Based on plasma cfDNA results, patients with T790M mutant had significantly worse progression-free survival (PFS) and overall survival (OS). For EGFR testing, ARMS-PCR on plasma cfDNA is a promising methodology with the highest specificity and effective sensitivity. It is useful for EGFR testing in patients before treatment, especially the late-stage patients. Simultaneously, plasma cfDNA could be used to monitor the drug resistant mutation, T790M status and predict prognosis after targeted therapy.

X-linked primary ciliary dyskinesia due to mutations in the cytoplasmic axonemal dynein assembly factor PIH1D3

PubMed Central

Olcese, Chiara; Patel, Mitali P.; Shoemark, Amelia; Kiviluoto, Santeri; Legendre, Marie; Williams, Hywel J.; Vaughan, Cara K.; Hayward, Jane; Goldenberg, Alice; Emes, Richard D.; Munye, Mustafa M.; Dyer, Laura; Cahill, Thomas; Bevillard, Jeremy; Gehrig, Corinne; Guipponi, Michel; Chantot, Sandra; Duquesnoy, Philippe; Thomas, Lucie; Jeanson, Ludovic; Copin, Bruno; Tamalet, Aline; Thauvin-Robinet, Christel; Papon, Jean- François; Garin, Antoine; Pin, Isabelle; Vera, Gabriella; Aurora, Paul; Fassad, Mahmoud R.; Jenkins, Lucy; Boustred, Christopher; Cullup, Thomas; Dixon, Mellisa; Onoufriadis, Alexandros; Bush, Andrew; Chung, Eddie M. K.; Antonarakis, Stylianos E.; Loebinger, Michael R.; Wilson, Robert; Armengot, Miguel; Escudier, Estelle; Hogg, Claire; Al-Turki, Saeed; Anderson, Carl; Antony, Dinu; Barroso, Inês; Beales, Philip L.; Bentham, Jamie; Bhattacharya, Shoumo; Carss, Keren; Chatterjee, Krishna; Cirak, Sebahattin; Cosgrove, Catherine; Allan, Daly; Durbin, Richard; Fitzpatrick, David; Floyd, Jamie; Foley, A. Reghan; Franklin, Chris; Futema, Marta; Humphries, Steve E.; Hurles, Matt; McCarthy, Shane; Muddyman, Dawn; Muntoni, Francesco; Parker, Victoria; Payne, Felicity; Plagnol, Vincent; Raymond, Lucy; Savage, David B.; Scambler, Peter J.; Schmidts, Miriam; Semple, Robert; Serra, Eva; Stalker, Jim; van Kogelenberg, Margriet; Vijayarangakannan, Parthiban; Walter, Klaudia; Amselem, Serge; Sun, Zhaoxia; Bartoloni, Lucia; Blouin, Jean-Louis; Mitchison, Hannah M.

2017-01-01

By moving essential body fluids and molecules, motile cilia and flagella govern respiratory mucociliary clearance, laterality determination and the transport of gametes and cerebrospinal fluid. Primary ciliary dyskinesia (PCD) is an autosomal recessive disorder frequently caused by non-assembly of dynein arm motors into cilia and flagella axonemes. Before their import into cilia and flagella, multi-subunit axonemal dynein arms are thought to be stabilized and pre-assembled in the cytoplasm through a DNAAF2–DNAAF4–HSP90 complex akin to the HSP90 co-chaperone R2TP complex. Here, we demonstrate that large genomic deletions as well as point mutations involving PIH1D3 are responsible for an X-linked form of PCD causing disruption of early axonemal dynein assembly. We propose that PIH1D3, a protein that emerges as a new player of the cytoplasmic pre-assembly pathway, is part of a complementary conserved R2TP-like HSP90 co-chaperone complex, the loss of which affects assembly of a subset of inner arm dyneins. PMID:28176794

X-linked primary ciliary dyskinesia due to mutations in the cytoplasmic axonemal dynein assembly factor PIH1D3.

PubMed

Olcese, Chiara; Patel, Mitali P; Shoemark, Amelia; Kiviluoto, Santeri; Legendre, Marie; Williams, Hywel J; Vaughan, Cara K; Hayward, Jane; Goldenberg, Alice; Emes, Richard D; Munye, Mustafa M; Dyer, Laura; Cahill, Thomas; Bevillard, Jeremy; Gehrig, Corinne; Guipponi, Michel; Chantot, Sandra; Duquesnoy, Philippe; Thomas, Lucie; Jeanson, Ludovic; Copin, Bruno; Tamalet, Aline; Thauvin-Robinet, Christel; Papon, Jean-François; Garin, Antoine; Pin, Isabelle; Vera, Gabriella; Aurora, Paul; Fassad, Mahmoud R; Jenkins, Lucy; Boustred, Christopher; Cullup, Thomas; Dixon, Mellisa; Onoufriadis, Alexandros; Bush, Andrew; Chung, Eddie M K; Antonarakis, Stylianos E; Loebinger, Michael R; Wilson, Robert; Armengot, Miguel; Escudier, Estelle; Hogg, Claire; Amselem, Serge; Sun, Zhaoxia; Bartoloni, Lucia; Blouin, Jean-Louis; Mitchison, Hannah M

2017-02-08

By moving essential body fluids and molecules, motile cilia and flagella govern respiratory mucociliary clearance, laterality determination and the transport of gametes and cerebrospinal fluid. Primary ciliary dyskinesia (PCD) is an autosomal recessive disorder frequently caused by non-assembly of dynein arm motors into cilia and flagella axonemes. Before their import into cilia and flagella, multi-subunit axonemal dynein arms are thought to be stabilized and pre-assembled in the cytoplasm through a DNAAF2-DNAAF4-HSP90 complex akin to the HSP90 co-chaperone R2TP complex. Here, we demonstrate that large genomic deletions as well as point mutations involving PIH1D3 are responsible for an X-linked form of PCD causing disruption of early axonemal dynein assembly. We propose that PIH1D3, a protein that emerges as a new player of the cytoplasmic pre-assembly pathway, is part of a complementary conserved R2TP-like HSP90 co-chaperone complex, the loss of which affects assembly of a subset of inner arm dyneins.

Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

PubMed

Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

2016-12-01

Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

The MONET trial: darunavir/ritonavir with or without nucleoside analogues, for patients with HIV RNA below 50 copies/ml.

PubMed

Arribas, Jose R; Horban, Andrzej; Gerstoft, Jan; Fätkenheuer, Gerdt; Nelson, Mark; Clumeck, Nathan; Pulido, Federico; Hill, Andrew; van Delft, Yvon; Stark, Thomas; Moecklinghoff, Christiane

2010-01-16

In virologically suppressed patients, darunavir-ritonavir (DRV/r) monotherapy could maintain virological suppression similarly to DRV/r and two nucleosides. Two hundred and fifty-six patients with HIV RNA less than 50 copies/ml for over 24 weeks on current antiretrovirals [non-nucleoside reverse transcriptase inhibitor (NNRTI)-based (43%), or protease inhibitor-based (57%)], switched to DRV/r 800/100 mg once daily, either as monotherapy (n = 127) or with two nucleoside reverse transcriptase inhibitors (NRTIs) (n = 129). Treatment failure was defined as two consecutive HIV RNA levels above 50 copies/ml (TLOVR) by week 48, or switches off study treatment. The trial had 80% power to show noninferiority for the monotherapy arm (delta = -12%). Patients were 81% male and 91% Caucasian, with mean age 44 years, and CD4 cell count of 574 cells/microl. In the primary efficacy analysis, HIV RNA less than 50 copies/ml by week 48 (per protocol) was 86.2 versus 87.8% in the monotherapy and triple therapy arms; by intent-to-treat switch equals failure, efficacy was 84.3 versus 85.3%; by a switch-included analysis, efficacy was 93.5 versus 95.1%: all three comparisons showed noninferior efficacy for DRV/r monotherapy. CD4 cell counts remained stable during the trial in both arms. One patient per arm showed at least one protease inhibitor mutation, and one patient in the triple therapy arm showed an NRTI mutation. Nine patients per arm discontinued randomized treatment for either adverse events or other reasons. No new or unexpected safety signals were detected. In this study for patients with HIV RNA less than 50 copies/ml on other antiretrovirals at baseline, switching to DRV/r monotherapy showed noninferior efficacy versus triple antiretroviral therapy.

Management of diffuse low-grade gliomas in adults - use of molecular diagnostics.

PubMed

Buckner, Jan; Giannini, Caterina; Eckel-Passow, Jeanette; Lachance, Daniel; Parney, Ian; Laack, Nadia; Jenkins, Robert

2017-06-01

Diffuse WHO grade II gliomas are histologically and genetically heterogeneous. The 2016 WHO classification redefines grade II gliomas with respect to morphological and molecular tumour alterations: grade II oligodendrogliomas are defined by the presence of whole-arm codeletion in chromosomal arms 1p/19q, whereas isocitrate dehydrogenase (IDH) mutations define subclasses of astrocytoma. Although histological grade remains useful, the prognoses of patients with glioma are more tightly associated with molecular alterations than with grade, and chromosomal and gene array technologies are becoming increasingly beneficial in understanding tumour genetic heterogeneity. The indolent nature of the disease often creates subtle neurological symptoms that can be overlooked or misunderstood, resulting in delayed diagnosis. Seizures often herald the diagnosis, especially in patients who have IDH mutations, which are associated with an increased production of 2-hydroxyglutarate. Treatment paradigms have shifted, owing to new diagnostic criteria and new clinical trial evidence. Patients benefit more from chemoradiation than radiation alone, especially those with tumour IDH1 Arg132His mutations; gross total resection of the tumour, including tumours with IDH mutations, is associated with prolonged survival. Initial observation remains appropriate in patients whose rate of disease growth is not yet completely defined; such patients could include those with completely resected disease and those with 1p/19q codeleted tumours.

Is MPP a good prognostic factor in stage III lung adenocarcinoma with EGFR exon 19 mutation?

PubMed

Zhang, Tian; Wang, Jing; Su, Yanjun; Chen, Xi; Yan, Qingna; Li, Qi; Sun, Leina; Wang, Yuwen; Er, Puchun; Pang, Qingsong; Wang, Ping

2017-06-20

Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein encoded by a gene located in the short arm of chromosome 7. This study aimed to investigate the clinicopathologic characteristics of classic EGFR exon mutation in Chinese patients with TMN stage III lung adenocarcinoma who received radical surgery. A total of 1,801 lung adenocarcinomas were analyzed for mutations in EGFR; 35% exhibited mutation of classic EGFR exons. Clinical and pathologic characteristics of patients with EGFR exon 19 mutation were compared with those who harbored EGFR exon 21 mutation. Patients with EGFR exon 19 mutation had a higher overall survival (OS, p=0.023) than those harboring EGFR exon 21 mutation. Our results demonstrated that patients with a micropapillary pattern (MPP) pathologic type in EGFR exon 19 mutation had a higher OS (p=0.022), and patients with exon 19 mutation were more sensitive to EGFR-tyrosine kinase inhibitors (p=0.032). The results of the current study can be used in decision-making regarding the treatment of patients with classic EGFR exon mutations.

Phase II and Biomarker Study of the Dual MET/VEGFR2 Inhibitor Foretinib in Patients With Papillary Renal Cell Carcinoma

PubMed Central

Choueiri, Toni K.; Vaishampayan, Ulka; Rosenberg, Jonathan E.; Logan, Theodore F.; Harzstark, Andrea L.; Bukowski, Ronald M.; Rini, Brian I.; Srinivas, Sandy; Stein, Mark N.; Adams, Laurel M.; Ottesen, Lone H.; Laubscher, Kevin H.; Sherman, Laurie; McDermott, David F.; Haas, Naomi B.; Flaherty, Keith T.; Ross, Robert; Eisenberg, Peter; Meltzer, Paul S.; Merino, Maria J.; Bottaro, Donald P.; Linehan, W. Marston; Srinivasan, Ramaprasad

2013-01-01

Purpose Foretinib is an oral multikinase inhibitor targeting MET, VEGF, RON, AXL, and TIE-2 receptors. Activating mutations or amplifications in MET have been described in patients with papillary renal cell carcinoma (PRCC). We aimed to evaluate the efficacy and safety of foretinib in patients with PRCC. Patients and Methods Patients were enrolled onto the study in two cohorts with different dosing schedules of foretinib: cohort A, 240 mg once per day on days 1 through 5 every 14 days (intermittent arm); cohort B, 80 mg daily (daily dosing arm). Patients were stratified on the basis of MET pathway activation (germline or somatic MET mutation, MET [7q31] amplification, or gain of chromosome 7). The primary end point was overall response rate (ORR). Results Overall, 74 patients were enrolled, with 37 in each dosing cohort. ORR by Response Evaluation Criteria in Solid Tumors (RECIST) 1.0 was 13.5%, median progression-free survival was 9.3 months, and median overall survival was not reached. The presence of a germline MET mutation was highly predictive of a response (five of 10 v five of 57 patients with and without germline MET mutations, respectively). The most frequent adverse events of any grade associated with foretinib were fatigue, hypertension, gastrointestinal toxicities, and nonfatal pulmonary emboli. Conclusion Foretinib demonstrated activity in patients with advanced PRCC with a manageable toxicity profile and a high response rate in patients with germline MET mutations. PMID:23213094

Primary and acquired EGFR T790M-mutant NSCLC patients identified by routine mutation testing show different characteristics but may both respond to osimertinib treatment.

PubMed

Li, Weihua; Qiu, Tian; Guo, Lei; Ling, Yun; Gao, Yibo; Ying, Jianming; He, Jie

2018-06-01

Primary EGFR T790M mutation is occasionally identified by routine mutation testing in tyrosine kinase inhibitor (TKI)-naive patients with non-small cell lung cancer (NSCLC). We herein aimed to compare the characteristics of primary and acquired T790M mutations in NSCLC patients, and their response to osimertinib. Using amplification refractory mutation system (ARMS) detection, primary T790M was identified in 0.5% (46/8723) of TKI-naive patients, whereas acquired T790M was detected in 49.7% (71/143) of TKI-relapsed patients. T790M always coexisted with a sensitizing EGFR mutation. Primary T790M more commonly coexisted with L858R, whereas acquired T790M was more likely to coexist with exon 19 deletions. Moreover, next-generation sequencing (NGS) showed that concomitant sensitizing EGFR and primary T790M mutant allele frequencies (MAFs) were highly concordant, but acquired T790M MAFs were significantly lower than the sensitizing EGFR MAFs. Sixteen acquired T790M-mutant patients received osimertinib. The median progression-free survival (PFS) was 8.1 months. Four primary T790M-mutant patients received osimertinib and the median PFS was 8.0 months. Together, our study demonstrates that primary and acquired T790M-mutant patients show distinct differences in some clinical and molecular characteristics, but may both respond to osimertinib treatment. Copyright © 2018 Elsevier B.V. All rights reserved.

Optimal number of spacers in CRISPR arrays

PubMed Central

Severinov, Konstantin; Ispolatov, Iaroslav

2017-01-01

Prokaryotic organisms survive under constant pressure of viruses. CRISPR-Cas system provides its prokaryotic host with an adaptive immune defense against viruses that have been previously encountered. It consists of two components: Cas-proteins that cleave the foreign DNA and CRISPR array that suits as a virus recognition key. CRISPR array consists of a series of spacers, short pieces of DNA that originate from and match the corresponding parts of viral DNA called protospacers. Here we estimate the number of spacers in a CRISPR array of a prokaryotic cell which maximizes its protection against a viral attack. The optimality follows from a competition between two trends: too few distinct spacers make host vulnerable to an attack by a virus with mutated corresponding protospacers, while an excessive variety of spacers dilutes the number of the CRISPR complexes armed with the most recent and thus most useful spacers. We first evaluate the optimal number of spacers in a simple scenario of an infection by a single viral species and later consider a more general case of multiple viral species. We find that depending on such parameters as the concentration of CRISPR-Cas interference complexes and its preference to arm with more recently acquired spacers, the rate of viral mutation, and the number of viral species, the predicted optimal number of spacers lies within a range that agrees with experimentally-observed values. PMID:29253874

Summary of compliant and multi-arm control at NASA. Langley Research Center

NASA Technical Reports Server (NTRS)

Harrison, Fenton W.

1992-01-01

The topics are presented in viewgraph form and include the: single arm system, single arm axis system, single arm control systems, single arm hand controller axis system, single arm position axis system, single arm vision axis system, single arm force axis system, multi-arm system, multi-arm axis system, and the dual arm hand control axis system with control signals.

Potential for Cell-Mediated Immune Responses in Mouse Models of Pelizaeus-Merzbacher Disease

PubMed Central

Southwood, Cherie M.; Fykkolodziej, Bozena; Dachet, Fabien; Gow, Alexander

2013-01-01

Although activation of the innate and adaptive arms of the immune system are undoubtedly involved in the pathophysiology of neurodegenerative diseases, it is unclear whether immune system activation is a primary or secondary event. Increasingly, published studies link primary metabolic stress to secondary inflammatory responses inside and outside of the nervous system. In this study, we show that the metabolic stress pathway known as the unfolded protein response (UPR) leads to secondary activation of the immune system. First, we observe innate immune system activation in autopsy specimens from Pelizaeus-Merzbacher disease (PMD) patients and mouse models stemming from PLP1 gene mutations. Second, missense mutations in mildly- and severely-affected Plp1-mutant mice exhibit immune-associated expression profiles with greater disease severity causing an increasingly proinflammatory environment. Third, and unexpectedly, we find little evidence for dysregulated expression of major antioxidant pathways, suggesting that the unfolded protein and oxidative stress responses are separable. Together, these data show that UPR activation can precede innate and/or adaptive immune system activation and that neuroinflammation can be titrated by metabolic stress in oligodendrocytes. Whether or not such activation leads to autoimmune disease in humans is unclear, but the case report of steroid-mitigated symptoms in a PMD patient initially diagnosed with multiple sclerosis lends support. PMID:24575297

Mutating the converter-relay interface of Drosophila myosin perturbs ATPase activity, actin motility, myofibril stability and flight ability.

PubMed

Kronert, William A; Melkani, Girish C; Melkani, Anju; Bernstein, Sanford I

2010-05-21

We used an integrative approach to probe the significance of the interaction between the relay loop and converter domain of the myosin molecular motor from Drosophila melanogaster indirect flight muscle. During the myosin mechanochemical cycle, ATP-induced twisting of the relay loop is hypothesized to reposition the converter, resulting in cocking of the contiguous lever arm into the pre-power stroke configuration. The subsequent movement of the lever arm through its power stroke generates muscle contraction by causing myosin heads to pull on actin filaments. We generated a transgenic line expressing myosin with a mutation in the converter domain (R759E) at a site of relay loop interaction. Molecular modeling suggests that the interface between the relay loop and converter domain of R759E myosin would be significantly disrupted during the mechanochemical cycle. The mutation depressed calcium as well as basal and actin-activated MgATPase (V(max)) by approximately 60% compared to wild-type myosin, but there is no change in apparent actin affinity (K(m)). While ATP or AMP-PNP (adenylyl-imidodiphosphate) binding to wild-type myosin subfragment-1 enhanced tryptophan fluorescence by approximately 15% or approximately 8%, respectively, enhancement does not occur in the mutant. This suggests that the mutation reduces lever arm movement. The mutation decreases in vitro motility of actin filaments by approximately 35%. Mutant pupal indirect flight muscles display normal myofibril assembly, myofibril shape, and double-hexagonal arrangement of thick and thin filaments. Two-day-old fibers have occasional "cracking" of the crystal-like array of myofilaments. Fibers from 1-week-old adults show more severe cracking and frayed myofibrils with some disruption of the myofilament lattice. Flight ability is reduced in 2-day-old flies compared to wild-type controls, with no upward mobility but some horizontal flight. In 1-week-old adults, flight capability is lost. Thus, altered myosin function permits myofibril assembly, but results in a progressive disruption of the myofilament lattice and flight ability. We conclude that R759 in the myosin converter domain is essential for normal ATPase activity, in vitro motility and locomotion. Our results provide the first mutational evidence that intramolecular signaling between the relay loop and converter domain is critical for myosin function both in vitro and in muscle. (c) 2010 Elsevier Ltd. All rights reserved.

Skin Barrier Function and Staphylococcus aureus Colonization in Vestibulum Nasi and Fauces in Healthy Infants and Infants with Eczema: A Population-Based Cohort Study.

PubMed

Berents, Teresa Løvold; Carlsen, Karin Cecilie Lødrup; Mowinckel, Petter; Skjerven, Håvard Ove; Kvenshagen, Bente; Rolfsjord, Leif Bjarte; Bradley, Maria; Lieden, Agne; Carlsen, Kai-Håkon; Gaustad, Peter; Gjersvik, Petter

2015-01-01

Atopic eczema (AE) is associated with Staphylococcus aureus (S. aureus) colonization and skin barrier dysfunction, often measured by increased transepidermal water loss (TEWL). In the present study, the primary aim was to see whether S. aureus colonization in the vestibulum nasi and/or fauces was associated with increased TEWL in infants with healthy skin and infants with eczema. Secondarily, we aimed to investigate whether TEWL measurements on non-lesional skin on the lateral upper arm is equivalent to volar forearm in infants. In 167 of 240 infants, recruited from the general population, TEWL measurements on the lateral upper arm and volar forearm, using a DermaLab USB, fulfilled our environmental requirements. The mean of three TEWL measurements from each site was used for analysis. The infants were diagnosed with no eczema (n = 110), possible AE (n = 28) or AE (n = 29). DNA samples were analysed for mutations in the filaggrin gene (FLG). Bacterial cultures were reported positive with the identification of at least one culture with S. aureus from vestibulum nasi and/or fauces. S. aureus colonization, found in 89 infants (53%), was not associated with increased TEWL (i.e. TEWL in the upper quartile), neither on the lateral upper arm or volar forearm (p = 0.08 and p = 0.98, respectively), nor with AE (p = 0.10) or FLG mutation (p = 0.17). TEWL was significantly higher on both measuring sites in infants with AE compared to infants with possible AE and no eczema. FLG mutation was significantly associated with increased TEWL, with a 47% difference in TEWL. We conclude that S. aureus in vestibulum nasi and/or fauces was not associated with TEWL, whereas TEWL measurements on the lateral upper arm and volar forearm appear equally appropriate in infants.

Directly administered antiretroviral therapy for HIV-infected drug users does not have an impact on antiretroviral resistance: results from a randomized controlled trial.

PubMed

Maru, Duncan Smith-Rohrberg; Kozal, Michael J; Bruce, R Douglas; Springer, Sandra A; Altice, Frederick L

2007-12-15

Directly administered antiretroviral therapy (DAART) is an effective intervention that improves clinical outcomes among HIV-infected drug users. Its effects on antiretroviral drug resistance, however, are unknown. We conducted a community-based, prospective, randomized controlled trial of DAART compared with self-administered therapy (SAT). We performed a modified intention-to-treat analysis among 115 subjects who provided serum samples for HIV genotypic resistance testing at baseline and at follow-up. The main outcomes measures included total genotypic sensitivity score, future drug options, number of new drug resistance mutations (DRMs), and number of new major International AIDS Society (IAS) mutations. The adjusted probability of developing at least 1 new DRM did not differ between the 2 arms (SAT: 0.41 per person-year [PPY], DAART: 0.49 PPY; adjusted relative risk [RR] = 1.04; P = 0.90), nor did the number of new mutations (SAT: 0.76 PPY, DAART: 0.83 PPY; adjusted RR = 0.99; P = 0.99) or the probability of developing new major IAS new drug mutations (SAT: 0.30 PPY, DAART: 0.33 PPY; adjusted RR = 1.12; P = 0.78). On measures of GSS and FDO, the 2 arms also did not differ. In this trial, DAART provided on-treatment virologic benefit for HIV-infected drug users without affecting the rate of development of antiretroviral medication resistance.

Effects of mutations at amino acid 61 in the arm of TF1 on its DNA-binding properties.

PubMed

Sayre, M H; Geiduschek, E P

1990-12-20

Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of bacterial DNA-binding proteins that includes Escherichia coli HU and integration host factor (IHF). We have initiated a mutational analysis of the TF1 molecule to understand better its unique DNA-binding properties and to investigate its physiological function. We report here the consequences of mutating the putative DNA-binding "arms" of TF1. At position 61 in its primary sequence, TF1 contains a Phe residue in place of the Arg residue found in all other known members of the HU family. Substituting polar, uncharged residues for Phe61 substantially reduced the DNA-binding affinity and site-selectivity of TF1 in vitro, whereas the substitution of Tyr had no effect. Substituting Trp or Arg for Phe61 had little effect on the affinity of TF1 for SPO1 DNA, but altered the electrophoretic mobilities of protein-DNA complexes in non-denaturing gels. The Arg61 substitution increased the affinity of the protein for non-specific sites on thymine-containing DNA, thus reducing the natural preference of TF1 for (5-hydroxymethyluracil)-containing DNA. The Phe61-to-Arg mutation was also correlated with decreased phage yield and aberrant regulation of viral protein synthesis in vivo.

Extended follow-up and impact of high-risk prognostic factors from the phase 3 RESONATE study in patients with previously treated CLL/SLL

PubMed Central

Brown, J R; Hillmen, P; O’Brien, S; Barrientos, J C; Reddy, N M; Coutre, S E; Tam, C S; Mulligan, S P; Jaeger, U; Barr, P M; Furman, R R; Kipps, T J; Cymbalista, F; Thornton, P; Caligaris-Cappio, F; Delgado, J; Montillo, M; DeVos, S; Moreno, C; Pagel, J M; Munir, T; Burger, J A; Chung, D; Lin, J; Gau, L; Chang, B; Cole, G; Hsu, E; James, D F; Byrd, J C

2018-01-01

In the phase 3 RESONATE study, ibrutinib demonstrated superior progression-free survival (PFS), overall survival (OS) and overall response rate (ORR) compared with ofatumumab in relapsed/refractory CLL patients with high-risk prognostic factors. We report updated results from RESONATE in these traditionally chemotherapy resistant high-risk genomic subgroups at a median follow-up of 19 months. Mutations were detected by Foundation One Heme Panel. Baseline mutations in the ibrutinib arm included TP53 (51%), SF3B1 (31%), NOTCH1 (28%), ATM (19%) and BIRC3 (14%). Median PFS was not reached, with 74% of patients randomized to ibrutinib alive and progression-free at 24 months. The improved efficacy of ibrutinib vs ofatumumab continues in all prognostic subgroups including del17p and del11q. No significant difference within the ibrutinib arm was observed for PFS across most genomic subtypes, although a subset carrying both TP53 mutation and del17p had reduced PFS compared with patients with neither abnormality. Reduced PFS or OS was not evident in patients with only del17p. PFS was significantly better for ibrutinib-treated patients in second-line vs later lines of therapy. The robust clinical activity of ibrutinib continues to show ongoing efficacy and acceptable safety consistent with prior reports, independent of various known high-risk mutations. PMID:28592889

Mutational Profiling of Non-Small-Cell Lung Cancer Resistant to Osimertinib Using Next-Generation Sequencing in Chinese Patients.

PubMed

Nie, Keke; Jiang, Haiping; Zhang, Chunling; Geng, Chuanxin; Xu, Xiajuan; Zhang, Ling; Zhang, Hao; Zhang, Zhongfa; Lan, Ketao; Ji, Youxin

2018-01-01

To identify the somatic mutated genes for optimal targets of non-small-cell lung cancer after resistance to osimertinib treatment. Study patients all had advanced lung adenocarcinoma and acquired resistance to osimertinib as a second- or third-line treatment. These patients had harboring EGFR T790M mutation before osimertinib treatment, which was confirmed by Amplification Refractory Mutation System (ARMS) PCR or Next-Generation Sequencing (NGS). After resistance to osimertinib treatment, tumor tissue was collected by core needle biopsy. DNA was extracted from 15 × 5 um sliced section of formalin-fixed paraffin-embedded (FFPE) material and NGS was done. The genetic changes were analyzed. A total of 9 Chinese patients were studied, 5 females and 4 males, age 51-89 years. After progression with osimertinib treatment, core needle biopsy was performed and next-generation sequencing was performed. Nine patients had harboring 62 point mutations, 2 altered gene copies, 2 amplifications, and 1 EML4-ALK gene fusion. No MET or HER2 amplification was found in this cohort study. Nine patients still maintained initial EGFR 19 del or L858R activating mutations, while 7 of them kept EGFR T790M mutations. Among the 7 patients, 5 had secondary EGFR C797S and/or C797G mutations, which all happened in the same allele with T790M mutation. All patients were treated with targets therapies, chemotherapy, or best supportive care (BSC) in accordance with NGS genetic results and patients' performance status; 7 of them are still alive and 2 of them died of disease progression at last follow-up. EGFR C797S/G mutation and the same one presented on the same allele with EGFR T790M mutation were the most common mutation feature and played a key role in resistance to osimertinib in Chinese patients with NSCLC. Tumor cells losing T790M mutation and maintaining EGFR activating mutation might benefit from first-generation EGFR-TKI treatment.

Loss-of-Function Mutations in a Human Gene Related to Chlamydomonas reinhardtii Dynein IC78 Result in Primary Ciliary Dyskinesia

PubMed Central

Pennarun, Gaëlle; Escudier, Estelle; Chapelin, Catherine; Bridoux, Anne-Marie; Cacheux, Valère; Roger, Gilles; Clément, Annick; Goossens, Michel; Amselem, Serge; Duriez, Bénédicte

1999-01-01

Summary Primary ciliary dyskinesia (PCD) is a group of heterogeneous disorders of unknown origin, usually inherited as an autosomal recessive trait. Its phenotype is characterized by axonemal abnormalities of respiratory cilia and sperm tails leading to bronchiectasis and sinusitis, which are sometimes associated with situs inversus (Kartagener syndrome) and male sterility. The main ciliary defect in PCD is an absence of dynein arms. We have isolated the first gene involved in PCD, using a candidate-gene approach developed on the basis of documented abnormalities of immotile strains of Chlamydomonas reinhardtii, which carry axonemal ultrastructural defects reminiscent of PCD. Taking advantage of the evolutionary conservation of genes encoding axonemal proteins, we have isolated a human sequence (DNAI1) related to IC78, a C. reinhardtii gene encoding a dynein intermediate chain in which mutations are associated with the absence of outer dynein arms. DNAI1 is highly expressed in trachea and testis and is composed of 20 exons located at 9p13-p21. Two loss-of-function mutations of DNAI1 have been identified in a patient with PCD characterized by immotile respiratory cilia lacking outer dynein arms. In addition, we excluded linkage between this gene and similar PCD phenotypes in five other affected families, providing a clear demonstration of locus heterogeneity. These data reveal the critical role of DNAI1 in the development of human axonemal structures and open up new means for identification of additional genes involved in related developmental defects. PMID:10577904

[Colorectal oncogenesis].

PubMed

Laurent-Puig, P; Agostini, J; Maley, K

2010-11-01

Recent progress in the field of molecular biology has allowed us to identify at least two different molecular mechanisms implicated in colorectal carcinogenesis (CRC): chromosomal instability (CIN) and genetic instability. Even though the two molecular mechanisms differ, their signalling pathways, implicated in malignant transformation of colonic epithelial cells, appear to be similar. The most frequent group of CRC, which represents 80% of sporadic CRC, is characterized by allelic losses on the short arm of chromosome 17 and 8 and on the long arm of chromosome 5, 18 and 22. These allelic losses are associated with mutations in TP53, APC, SMAD2 and SMAD4 genes. All of these alterations are grouped under the phenotype CIN. A genetic instability termed MSI (microsatellite instability), which results from a mismatch repair (MMR) deficiency, appears in 12-15% of CRC cases. The presence of MMR deficiency leads to the accumulation of mutations in genes controlling cell cycle and apoptosis (TGFBRII, BAX or CASPASE5). More recently, the existence of a third phenotype was suggested. The main alteration associated with this group of tumors is the hypermethylation of the promoter region of numerous genes, leading to their inactivation. An activating mutation of BRAF is frequently associated with this phenotype. As described above, CRC shows genetic heterogeneity, however the consequences in terms of signalling pathway alterations are similar. For example, the activation of Wnt signalling pathways can result from the inactivation of the APC gene in the CIN phenotype or from an activating mutation in the β-catenin gene in MSI tumors. The inactivation of TGFβ pathways is also present in both tumor types and is driven by SMAD4, and more rarely by a SMAD2 inactivating mutation in CIN tumors, or by the existence of a frame-shift mutation occurring in a polyG coding track of the TGFβ (transforming growth factor) receptor type II in MSI tumors. The RAS-MAP kinase pathway is activated by KRAS mutations in CIN tumors or by BRAF mutations in MSI tumors. The p53 pathway is inactivated by TP53 inactivation in CIN tumors or by BAX inactivating mutations in MSI tumors.

Role and evolution of viral tropism in patients with advanced HIV disease receiving intensified initial regimen in the ANRS 130 APOLLO trial.

PubMed

Charpentier, Charlotte; Joly, Véronique; Larrouy, Lucile; Fagard, Catherine; Visseaux, Benoit; de Verdière, Nathalie Colin; Raffi, François; Yeni, Patrick; Descamps, Diane

2013-03-01

The aims of the study were to assess in patients with advanced HIV disease receiving antiretroviral therapy (ART) intensification with enfuvirtide (i) resistance at virological failure (VF), (ii) impact of baseline tropism on immunovirological response, and (iii) HIV-1 DNA tropism evolution during ART. The ANRS 130 APOLLO randomized trial evaluated in naive patients the immunovirological impact of standard ART without (control arm) or with enfuvirtide. Tropism was determined on RNA and DNA by V3-loop sequencing interpreted using the Geno2Pheno algorithm. At baseline the median CD4 cell count was 30 cells/mm(3). Among the 170 patients assessable in this virological substudy, HIV-1 RNA tropism was as follows: 60% of viruses were R5 and 40% were R5X4/X4. HIV-1 DNA tropism was as follows: 54% were R5 and 46% were R5X4/X4. At week 24, 39% and 49% of patients experienced VF in the enfuvirtide and control arms, respectively. In the enfuvirtide arm, only resistance-associated mutations to enfuvirtide were detected. In the control arm, two patients displayed drug-resistant viruses at the time of VF. No impact of baseline tropism was observed on immunovirological response, regardless of the study arm. Among the 25 patients experiencing DNA tropism switch between baseline and week 24, 16 (64%) switched from R5 to R5X4/X4. These latter were mostly successfully suppressed patients receiving enfuvirtide and exhibiting poorer immunological response. Baseline RNA tropism had no impact on the immunovirological response. Drug resistance mutations were only detected for the fusion inhibitor. Finally, the mechanism of replenishment of the viral cellular reservoir with X4 viruses observed needs to be further analysed.

[Evaluation of Consistency in detection of epidermal growth factor receptor gene T790M mutation in plasma and tumor specimens of patients with lung adenocarcinoma].

PubMed

Du, J; Wang, Z; Yang, L; Di, J; Zhang, J G; Wang, T Y; Liu, D G

2018-01-23

Objective: To evaluate the consistency in detection of T790M mutation of epidermal growth factor receptor gene (EGFR) in plasma and tumor samples of patients with lung adenocarcinoma. Methods: The tumor tissues or cytological specimens of 12 patients with operable lung adenocarcinoma(stage Ⅰ-ⅢA) and 100 patients with advanced stage ⅢB-Ⅳ lung adenocarcinoma were collected, among which 11 patients showed acquired resistance for gefitinib (11/100). In the same period, peripheral blood samples were collected from all patients and 50 healthy volunteers. Amplification refractory mutation system (ARMS) was used to detect EGFR mutations in tumor specimens. Next Generation Sequencing(NGS) based circulating single-molecule amplification and resequencing technology (cSMART)was performed to quantitatively detect the EGFR mutations in circulating tumor DNA (ctDNA) from plasma specimens. Results: The sensitivity, specificity and concordance rate of EGFR T790M mutation between plasma and tissue specimens from 100 advanced stage patients were 50.0%, 72.9% and 72.0%, respectively. For L858R mutation and exon 19 deletion mutations, the above mentioned sensitivity, specificity and concordance rate were 91.7%, 100.0%, and 98.0%, as well as 79.2%, 100.0% and 95.0%, respectively. The L858R mutation and exon 19 deletion mutations were not detected in plasma of 50 healthy volunteers, whereasT790M mutation(1.0±0.0 copies) was found in 7 individuals(7/50, 14.0%). Similarly, in 12 resectable patients, 4 (4/12, 33.3%) T790M mutations were found in plasma (1.2±0.2 copies), but no L858R mutation and 19 exon deletion mutations. In comparison, 28.0% of patients with advanced lung adenocarcinoma (28/100)had detectable T790M mutation in plasma with copy numbers (34.0±22.7 copies). Furthermore, the copy numbers of T790M were 268.2±119.9 in plasma of 5 cases with acquired gefitinib-resistance. Conclusions: In patients with advanced stages of lung adenocarcinoma, the detection of T790M mutation in plasma and tumor specimens is low. The T790M mutation also exists in the plasma of some healthy controls, suggesting that T790M mutation participates in EGFR signaling pathway and it might function in healthy population.

Simultaneous Genotyping of the rs4762 and rs699 Polymorphisms in Angiotensinogen Gene and Correlation with Iranian CAD Patients with Novel Hexa-primer ARMS-PCR

PubMed Central

KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud

2017-01-01

Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324

Genetics of dioecy and causal sex chromosomes in plants.

PubMed

Kumar, Sushil; Kumari, Renu; Sharma, Vishakha

2014-04-01

Dioecy (separate male and female individuals) ensures outcrossing and is more prevalent in animals than in plants. Although it is common in bryophytes and gymnosperms, only 5% of angiosperms are dioecious. In dioecious higher plants, flowers borne on male and female individuals are, respectively deficient in functional gynoecium and androecium. Dioecy is inherited via three sex chromosome systems: XX/XY, XX/X0 and WZ/ZZ, such that XX or WZ is female and XY, X0 or ZZ are males. The XX/XY system generates the rarer XX/X0 and WZ/ZZ systems. An autosome pair begets XY chromosomes. A recessive loss-of-androecium mutation (ana) creates X chromosome and a dominant gynoecium-suppressing (GYS) mutation creates Y chromosome. The ana/ANA and gys/GYS loci are in the sex-determining region (SDR) of the XY pair. Accumulation of inversions, deleterious mutations and repeat elements, especially transposons, in the SDR of Y suppresses recombination between X and Y in SDR, making Y labile and increasingly degenerate and heteromorphic from X. Continued recombination between X and Y in their pseudoautosomal region located at the ends of chromosomal arms allows survival of the degenerated Y and of the species. Dioecy is presumably a component of the evolutionary cycle for the origin of new species. Inbred hermaphrodite species assume dioecy. Later they suffer degenerate-Y-led population regression. Cross-hybridization between such extinguishing species and heterologous species, followed by genome duplication of segregants from hybrids, give rise to new species.

Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9

PubMed Central

Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu

2015-01-01

ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037

[The genotype analysis of glucose-6-phosphate dehydrogenase deficiency in Yunnan province].

PubMed

Yang, Z; Chu, J; Ban, G; Huang, X; Xu, S; Li, M

2001-08-01

To identify glucose-6-phosphate dehydrogenase (G6PD) gene mutations in 23 patients with G6PD deficiency and to gain further understanding of the molecular and genetic background of G6PD gene in Yunnan province, China. The mutations located in exons 2-12 and in parts of introns of G6PD gene were analyzed by amplification refractory mutation system(ARMS), natural and mis-match primer PCR/restrict enzyme, polymerase chain reaction-single strand conformation polymorphism(PCR-SSCP ) analysis and automatic DNA sequencing. Among these 23 samples, 5 different point mutations in G6PD gene were identified, and they constituted 5 genotypes. There were 7 Han and 3 Dai patients with G487A mutation, 7 cases with both intron 11 T93C and C1311T mutations, 4 cases with intron 5 636 or 637 T-->del mutation, 1 case with G871A mutation, and 1 case with G487A/T93C/C1311T mutation. Two haplotypes, 93C/1311T and 93C/1311T/487A were identified in Yunnan. A strong association was observed between C1311T and the Nla III restriction site produced by intron 11 T93C. The findings of the investigators on IVS-5 636 or 637T-->del in Chinese, on G871A in mainland of China, and on G487A in the Han people of Yunnan have not been reported previously. G6PD deficiency is very heterogenous in Yunnan; G487A is one of the common mutations in that province and may be of different origins. Possibly IVS-11 T93C mutation is of non-African origin. IVS-11 T93C and C1311T might jointly result in G6PD deficiency. The above data on G6PD gene mutation types could be useful for clinical diagnosis, prevention of G6PD deficiency, and researches in the origin and migration of minorities in Yunnan or other regions.

Current molecular genetics strategies for the diagnosis of lysosomal storage disorders.

PubMed

Giugliani, Roberto; Brusius-Facchin, Ana-Carolina; Pasqualim, Gabriela; Leistner-Segal, Sandra; Riegel, Mariluce; Matte, Ursula

2016-01-01

Lysosomal storage disorders (LSDs) are a group of almost 50 monogenic diseases characterized by mutations causing deficiency of lysosomal enzymes or non-enzyme proteins involved in transport across the lysosomal membrane, protein maturation or lysosomal biogenesis. Usually, affected patients are normal at birth and have a progressive and severe disease with high morbidity and reduced life expectancy. The overall incidence of LSDs is usually estimated as 1:5000, but newborn screening studies are indicating that it could be much higher. Specific therapies were already developed for selected LSDs, making the timely and correct diagnosis very important for successful treatment and also for genetic counseling. In most LSD cases the biochemical techniques provide a reliable diagnosis. However, the identification of pathogenic mutations by genetic analysis is being increasingly recommended to provide additional information. In this paper we discuss the conventional methods for genetic analysis used in the LSDs [restriction fragment length polymorphism (RFLP), amplification-refractory mutation system (ARMS), single strand conformation polymorphism (SSCP), denaturing high performance liquid chromatography (dHPLC), real-time polymerase chain reaction, high resolution melting (HRM), multiplex ligation-dependent probe amplification (MLPA), Sanger sequencing] and also the newer approaches [massive parallel sequencing, array comparative genomic hybridization (CGH)].

Molecular methods for the detection of mutations.

PubMed

Monteiro, C; Marcelino, L A; Conde, A R; Saraiva, C; Giphart-Gassler, M; De Nooij-van Dalen, A G; Van Buuren-van Seggelen, V; Van der Keur, M; May, C A; Cole, J; Lehmann, A R; Steinsgrimsdottir, H; Beare, D; Capulas, E; Armour, J A

2000-01-01

We report the results of a collaborative study aimed at developing reliable, direct assays for mutation in human cells. The project used common lymphoblastoid cell lines, both with and without mutagen treatment, as a shared resource to validate the development of new molecular methods for the detection of low-level mutations in the presence of a large excess of normal alleles. As the "gold standard, " hprt mutation frequencies were also measured on the same samples. The methods under development included i) the restriction site mutation (RSM) assay, in which mutations lead to the destruction of a restriction site; ii) minisatellite length-change mutation, in which mutations lead to alleles containing new numbers of tandem repeat units; iii) loss of heterozygosity for HLA epitopes, in which antibodies can be used to direct selection for mutant cells; iv) multiple fluorescence-based long linker arm nucleotides assay (mf-LLA) technology, for the detection of substitutional mutations; v) detection of alterations in the TP53 locus using a (CA) array as the target for the screening; and vi) PCR analysis of lymphocytes for the presence of the BCL2 t(14:18) translocation. The relative merits of these molecular methods are discussed, and a comparison made with more "traditional" methods.

Prodomain–growth factor swapping in the structure of pro-TGF-β1

PubMed Central

Xu, Shutong; Dong, Xianchi; Lu, Chafen; Springer, Timothy A.

2018-01-01

TGF-β is synthesized as a proprotein that dimerizes in the endoplasmic reticulum. After processing in the Golgi to cleave the N-terminal prodomain from the C-terminal growth factor (GF) domain in each monomer, pro-TGF-β is secreted and stored in latent complexes. It is unclear which prodomain and GF monomer are linked before proprotein convertase cleavage and how much conformational change occurs following cleavage. We have determined a structure of pro-TGF-β1 with the proprotein convertase cleavage site mutated to mimic the structure of the TGF-β1 proprotein. Structure, mutation, and model building demonstrate that the prodomain arm domain in one monomer is linked to the GF that interacts with the arm domain in the other monomer in the dimeric structure (i.e. the prodomain arm domain and GF domain in each monomer are swapped). Swapping has important implications for the mechanism of biosynthesis in the TGF-β family and is relevant to the mechanism for preferential formation of heterodimers over homodimers for some members of the TGF-β family. Our structure, together with two previous ones, also provides insights into which regions of the prodomain–GF complex are highly structurally conserved and which are perturbed by crystal lattice contacts. PMID:29109152

Gentamicin induces functional type VII collagen in recessive dystrophic epidermolysis bullosa patients

PubMed Central

Woodley, David T.; Cogan, Jon; Hou, Yingping; Lyu, Chao; Marinkovich, M. Peter; Keene, Douglas

2017-01-01

BACKGROUND. Recessive dystrophic epidermolysis bullosa (RDEB) is an incurable disease caused by mutations in the gene encoding type VII collagen, the major component of anchoring fibrils (AF). We previously demonstrated that gentamicin produced functional type VII collagen in RDEB cells harboring nonsense mutations. Herein, we determined whether topical or intradermal gentamicin administration induces type VII collagen and AFs in RDEB patients. METHODS. A double-blind, placebo-controlled pilot trial assessed safety and efficacy of topical and intradermal gentamicin in 5 RDEB patients with nonsense mutations. The topical arm tested 0.1% gentamicin ointment or placebo application 3 times daily at 2 open erosion sites for 2 weeks. The intradermal arm tested daily intradermal injection of gentamicin solution (8 mg) or placebo into 2 intact skin sites for 2 days in 4 of 5 patients. Primary outcomes were induction of type VII collagen and AFs at the test sites and safety assessment. A secondary outcome assessed wound closure of topically treated erosions. RESULTS. Both topical and intradermal gentamicin administration induced type VII collagen and AFs at the dermal-epidermal junction of treatment sites. Newly created type VII collagen varied from 20% to 165% of that expressed in normal human skin and persisted for 3 months. Topical gentamicin corrected dermal-epidermal separation, improved wound closure, and reduced blister formation. There were no untoward side effects from gentamicin treatments. Type VII collagen induction did not generate anti–type VII collagen autoantibodies in patients’ blood or skin. CONCLUSION. Topical and intradermal gentamicin suppresses nonsense mutations and induces type VII collagen and AFs in RDEB patients. Gentamicin therapy may provide a readily available treatment for RDEB patients with nonsense mutations. TRIAL REGISTRATION. ClinicalTrials.gov NCT02698735. FUNDING. Epidermolysis Bullosa Research Partnership, Epidermolysis Bullosa Medical Research Foundation, NIH, and VA Merit Award. PMID:28691931

Rare discrepancies in a driver gene alteration within histologically heterogeneous primary lung cancers.

PubMed

Zhong, Wen-zhao; Su, Jian; Xu, Fang-ping; Zhai, Hao-ran; Zhang, Xu-chao; Yang, Xue-ning; Chen, Zhi-yong; Chen, Zhi-hong; Li, Wei; Dong, Song; Zhou, Qing; Yang, Jin-ji; Liu, Yan-hui; Wu, Yi-long

2015-11-01

Most lung adenocarcinomas consist of mixtures of histological subtypes harboring different frequencies of driver gene mutations. However, little is known about intratumoral heterogeneity(ITH) within histologically heterogeneous primary lung cancers. Investigating key driver genes in respective morphological pattern is crucial to personalized treatment. Morphologically different areas within the same surgically resected adenocarcinomas were extracted from tissues to analyze gene status in each growth pattern. Driver genes, epidermal growth factor receptor (EGFR), KRAS and EML4-ALK, were assessed by assays with different sensitivities. Seventy-nine consecutive eligible patients harboring a driver gene (EGFR=65; KRAS=10; EML4-ALK=4) were enrolled. For EGFR mutations, ITH occurred in 13.3% (8/60) by direct sequencing (DS) and 1.7% (1/60) by amplification refractory mutation system (ARMS) (P=0.016) among adenocarcinomas, but consistent within five adeno-squamous cell carcinomas by both methods. ITH among KRAS mutations were detected in 20% (2/10) by DS, whereas consistent (10/10) by high resolution melting. No discrepancies in EML4-ALK rearrangements existed according to fluorescence in situ hybridization. Rare ITHs of EGFR/KRAS/EML4-ALK alterations within histologically heterogeneous primary lung adenocarcinomas existed by methods with higher sensitivity. Discrepancies might be due to abundance of mutant tumor cells and detection assays. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

[Molecular characterization of 71 cases of glucose-6-phosphate dehydrogenase deficiency in Hainan province].

PubMed

Huang, Dong-Ai; Wang, Xiao-Ying; Wang, Zheng; Zhou, Dai-Feng; Cai, Wang-Wei

2007-04-01

To molecularly analyze in Han and Li individuals of glucose-6-phosphate dehydrogenase deficiency in Hainan, China. The amplification refractory mutation system (ARMS) was employed to detect G1376T, G1388A and A95G mutations. The coding regions and flanking intronic regions from the second to the thirteenth exons of G6PD gene was analyzed by DNA sequencing to characterize the gene mutations in samples without G1376T, G1388A and A95G mutations. Among 29 Han cases of G6PD deficiency, 11 had G1376T (37.9%), 2 G1388A (6.9%), 1 G1376T and G1388A (3.4%) and 1 G1376T and A95G (3.4%) were identified. Mutations of G1376T, G1388A, A95G and their complex accounted for 51.7% of G6PD deficiency in the Han individuals. Among 42 Li cases of G6PD deficiency, 25 had G1376T (59.5%), 6 G1388A (14.3%), 2 A95G (4.8%), 4 G1376T and G1388A (9.5%), 1 G1376T and A95G (2.4% )were identified. These mutations accounted for 90.5% of the Li individuals. Gene mutation of 18 cases (14 Han and 4 Li individuals) remained unknown. Sequencing results of the 18 samples indicated that one case had a single base of T deletion at nucleotide 636 or 637 in the 5th intron (IVS-5 636 or 637 T del) and two cases had C1311T with IVS-11 T93C mutation. G6PD G1376T and G1388A are the most common mutations in the populations of the Han and Li nationalities in Hainan. The IVS-5 636 or 637 T del mutation is first reported in Chinese, and the complex mutation of G1376T/A95G is first found in the Li nationality.

Characterization of genomic instability in Saccharomyces cerevisiae and engaging teaching strategies described in two curricula

NASA Astrophysics Data System (ADS)

Keller, Alexandra P.

Cancer arises through an accumulation of mutations in the genome. In cancer cells, mutations are frequently caused by DNA rearrangements, which include chromosomal breakages, deletions, insertions, and translocations. Such events contribute to genomic instability, a known hallmark of cancer. To study cycles of chromosomal instability, we are using baker's yeast as a model organism. In yeast, a ChrVII system was previously developed (Admire et al., 2006), in which a disomic yeast strain was used to identify regions of instability on ChrVII. Using this system, a fragile site on the left arm of ChrVII (Admire et al., 2006) was identified and characterized. This study led to insight into mechanisms involved in chromosomal rearrangements and mutations that arise from them as well as to an understanding of mechanisms involved in genomic instability. To further our understanding of genomic instability, I devised a strategy to study instability on a different chromosome (ChrV) (Figure 3), so that we could determine whether lessons learned from the ChrVII system are applicable to other chromosomes, and/or whether other mechanisms of instability could be identified. A suitable strain was generated and analyzed, and our findings suggest that frequencies of instability on the right arm of ChrV are similar to those found in ChrVII. The results from the work in ChrV described in this paper support the idea that the instability found on ChrVII is not an isolated occurrence. My research was supported by an NSF GK-12 grant. The aim of this grant is to improve science education in middle schools, and as part of my participation in this program, I studied and practiced effective science communication methodologies. In attempts to explain my research to middle school students, I collaborated with others to develop methods for explaining genetics and the most important techniques I used in my research. While developing these methods, I learned more about what motivates people to learn. I became interested in creating learning environments that encourage students to make interdisciplinary connections in a way that provides comprehensible learning experiences that they can relate to their daily lives. Resulting from these studies, I developed an interdisciplinary, stories-based curriculum that is described in chapter four of this thesis.

The effect of referral for genetic counseling on genetic testing and surgical prevention in women at high risk for ovarian cancer: Results from a randomized controlled trial.

PubMed

Drescher, Charles W; Beatty, J David; Resta, Robert; Andersen, M Robyn; Watabayashi, Kate; Thorpe, Jason; Hawley, Sarah; Purkey, Hannah; Chubak, Jessica; Hanson, Nancy; Buist, Diana S M; Urban, Nicole

2016-07-22

Guidelines recommend genetic counseling and testing for women who have a pedigree suggestive of an inherited susceptibility for ovarian cancer. The authors evaluated the effect of referral to genetic counseling on genetic testing and prophylactic oophorectomy in a randomized controlled trial. Data from an electronic mammography reporting system identified 12,919 women with a pedigree that included breast cancer, of whom 625 were identified who had a high risk for inherited susceptibility to ovarian cancer using a risk-assessment questionnaire. Of these, 458 women provided informed consent and were randomized 1:1 to intervention consisting of a genetic counseling referral (n = 228) or standard clinical care (n = 230). Participants were predominantly aged 45 to 65 years, and 30% and 20% reported a personal history of breast cancer or a family history of ovarian cancer, respectively. Eighty-five percent of women in the intervention group participated in a genetic counseling session. Genetic testing was reported by 74 (33%) and 20 (9%) women in the intervention and control arms (P < .005), respectively. Five women in the intervention arm and 2 in the control arm were identified as germline mutation carriers. Ten women in the intervention arm and 3 in the control arm underwent prophylactic bilateral salpingo-oophorectomy (P < .05). Routine referral of women at high risk for ovarian cancer to genetic counseling promotes genetic testing and prophylactic surgery. The findings from the current randomized controlled trial demonstrate the value of implementing strategies that target women at high risk for ovarian cancer to ensure they are offered access to recommended care. CA Cancer J Clin 2016. © 2016 American Cancer Society, Inc. © 2016 American Cancer Society.

The clinical and molecular genetic features of idiopathic infantile periodic alternating nystagmus

PubMed Central

Thomas, Mervyn G.; Crosier, Moira; Lindsay, Susan; Kumar, Anil; Thomas, Shery; Araki, Masasuke; Talbot, Chris J.; McLean, Rebecca J.; Surendran, Mylvaganam; Taylor, Katie; Leroy, Bart P.; Moore, Anthony T.; Hunter, David G.; Hertle, Richard W.; Tarpey, Patrick; Langmann, Andrea; Lindner, Susanne; Brandner, Martina

2011-01-01

Periodic alternating nystagmus consists of involuntary oscillations of the eyes with cyclical changes of nystagmus direction. It can occur during infancy (e.g. idiopathic infantile periodic alternating nystagmus) or later in life. Acquired forms are often associated with cerebellar dysfunction arising due to instability of the optokinetic-vestibular systems. Idiopathic infantile periodic alternating nystagmus can be familial or occur in isolation; however, very little is known about the clinical characteristics, genetic aetiology and neural substrates involved. Five loci (NYS1-5) have been identified for idiopathic infantile nystagmus; three are autosomal (NYS2, NYS3 and NYS4) and two are X-chromosomal (NYS1 and NYS5). We previously identified the FRMD7 gene on chromosome Xq26 (NYS1 locus); mutations of FRMD7 are causative of idiopathic infantile nystagmus influencing neuronal outgrowth and development. It is unclear whether the periodic alternating nystagmus phenotype is linked to NYS1, NYS5 (Xp11.4-p11.3) or a separate locus. From a cohort of 31 X-linked families and 14 singletons (70 patients) with idiopathic infantile nystagmus we identified 10 families and one singleton (21 patients) with periodic alternating nystagmus of which we describe clinical phenotype, genetic aetiology and neural substrates involved. Periodic alternating nystagmus was not detected clinically but only on eye movement recordings. The cycle duration varied from 90 to 280 s. Optokinetic reflex was not detectable horizontally. Mutations of the FRMD7 gene were found in all 10 families and the singleton (including three novel mutations). Periodic alternating nystagmus was predominantly associated with missense mutations within the FERM domain. There was significant sibship clustering of the phenotype although in some families not all affected members had periodic alternating nystagmus. In situ hybridization studies during mid-late human embryonic stages in normal tissue showed restricted FRMD7 expression in neuronal tissue with strong hybridization signals within the afferent arms of the vestibulo-ocular reflex consisting of the otic vesicle, cranial nerve VIII and vestibular ganglia. Similarly within the afferent arm of the optokinetic reflex we showed expression in the developing neural retina and ventricular zone of the optic stalk. Strong FRMD7 expression was seen in rhombomeres 1 to 4, which give rise to the cerebellum and the common integrator site for both these reflexes (vestibular nuclei). Based on the expression and phenotypic data, we hypothesize that periodic alternating nystagmus arises from instability of the optokinetic-vestibular systems. This study shows for the first time that mutations in FRMD7 can cause idiopathic infantile periodic alternating nystagmus and may affect neuronal circuits that have been implicated in acquired forms. PMID:21303855

Loss of heterozygosity at 7q22 and mutation analysis of the CDP gene in human epithelial ovarian tumors.

PubMed

Neville, P J; Thomas, N; Campbell, I G

2001-02-01

Many tumor types including that of the ovary show loss of heterozygosity (LOH) on chromosome arm 7q, which suggests the existence of at least one tumor suppressor gene (TSG) on this chromosome arm. We have studied the region surrounding the putative tumor suppressor gene CUTL1 at 7q22 in 127 epithelial ovarian tumors. LOH was found across 7q22 in 31% of malignant and 14% of benign ovarian tumors. In 16% of the tumors the LOH appeared to be centered on the CUTL1 gene. This gene has been implicated previously as a TSG in both uterine leiomyomas and breast carcinoma. However, mutation analysis of the CUTL1 gene in 47 tumors with 7q22 LOH failed to identify any somatic alterations in the coding regions. This finding suggests that CUTL1 may not be the target of the 7q22 LOH in ovarian cancers.

Clinical and Genetic Aspects of Primary Ciliary Dyskinesia / Kartagener Syndrome

PubMed Central

Leigh, Margaret W.; Pittman, Jessica E.; Carson, Johnny L.; Ferkol, Thomas W.; Dell, Sharon D.; Davis, Stephanie D.; Knowles, Michael R.; Zariwala, Maimoona A.

2013-01-01

Primary ciliary dyskinesia (PCD) is a genetically heterogeneous disorder of motile cilia. Most of the disease-causing mutations identified to date involve the heavy (DNAH5) or intermediate (DNAI1) chain dynein genes in ciliary outer dynein arms, although a few mutations have been noted in other genes. Clinical molecular genetic testing for PCD is available for the most common mutations. The respiratory manifestations of PCD (chronic bronchitis leading to bronchiectasis, chronic rhino-sinusitis and chronic otitis media) reflect impaired mucociliary clearance owing to defective axonemal structure. Ciliary ultrastructural analysis in most patients (>80%) reveals defective dynein arms, although defects in other axonemal components have also been observed. Approximately 50% of PCD patients have laterality defects (including situs inversus totalis and, less commonly, heterotaxy and congenital heart disease), reflecting dysfunction of embryological nodal cilia. Male infertility is common and reflects defects in sperm tail axonemes. Most PCD patients have a history of neonatal respiratory distress, suggesting that motile cilia play a role in fluid clearance during the transition from a fetal to neonatal lung. Ciliopathies involving sensory cilia, including autosomal dominant or recessive polycystic kidney disease, Bardet-Biedl syndrome, and Alstrom syndrome, may have chronic respiratory symptoms and even bronchiectasis suggesting clinical overlap with PCD. PMID:19606528

Parkinsonism Associated with Glucocerebrosidase Mutation

PubMed Central

Sunwoo, Mun-Kyung; Kim, Seung-Min; Lee, Sarah

2011-01-01

Background Gaucher's disease is an autosomal recessive, lysosomal storage disease caused by mutations of the β-glucocerebrosidase gene (GBA). There is increasing evidence that GBA mutations are a genetic risk factor for the development of Parkinson's disease (PD). We report herein a family of Koreans exhibiting parkinsonism-associated GBA mutations. Case Report A 44-year-old woman suffering from slowness and paresthesia of the left arm for the previous 1.5years, visited our hospital to manage known invasive ductal carcinoma. During a preoperative evaluation, she was diagnosed with Gaucher's disease and double mutations of S271G and R359X in GBA. Parkinsonian features including low amplitude postural tremors, rigidity, bradykinesia and shuffling gait were observed. Genetic analysis also revealed that her older sister, who had also been diagnosed with PD and had been taking dopaminergic drugs for 8-years, also possessed a heterozygote R359X mutation in GBA. 18F-fluoropropylcarbomethoxyiodophenylnortropane positron-emission tomography in these patients revealed decreased uptake of dopamine transporter in the posterior portion of the bilateral putamen. Conclusions This case study demonstrates Korean familial cases of PD with heterozygote mutation of GBA, further supporting the association between PD and GBA mutation. PMID:21779299

Comprehensive profiling and quantitation of oncogenic mutations in non small-cell lung carcinoma using single molecule amplification and re-sequencing technology

PubMed Central

Jiang, Hong; Wang, Limin; Xu, Rujun; Shi, Yanbin; Zhang, Jianguang; Xu, Mengnan; Cram, David S.; Ma, Shenglin

2016-01-01

Activating and resistance mutations in the tyrosine kinase domain of several oncogenes are frequently associated with non-small cell lung carcinoma (NSCLC). In this study we assessed the frequency, type and abundance of EGFR, KRAS, BRAF, TP53 and ALK mutations in tumour specimens from 184 patients with early and late stage disease using single molecule amplification and re-sequencing technology (SMART). Based on modelling of EGFR mutations, the detection sensitivity of the SMART assay was at least 0.1%. Benchmarking EGFR mutation detection against the gold standard ARMS-PCR assay, SMART assay had a sensitivity and specificity of 98.7% and 99.0%. Amongst the 184 samples, EGFR mutations were the most prevalent (59.9%), followed by KRAS (16.9%), TP53 (12.7%), EML4-ALK fusions (6.3%) and BRAF (4.2%) mutations. The abundance and types of mutations in tumour specimens were extremely heterogeneous, involving either monoclonal (51.6%) or polyclonal (12.6%) mutation events. At the clinical level, although the spectrum of tumour mutation(s) was unique to each patient, the overall patterns in early or advanced stage disease were relatively similar. Based on these findings, we propose that personalized profiling and quantitation of clinically significant oncogenic mutations will allow better classification of patients according to tumour characteristics and provide clinicians with important ancillary information for treatment decision-making. PMID:27409166

Comprehensive profiling and quantitation of oncogenic mutations in non small-cell lung carcinoma using single molecule amplification and re-sequencing technology.

PubMed

Zhang, Shirong; Xia, Bing; Jiang, Hong; Wang, Limin; Xu, Rujun; Shi, Yanbin; Zhang, Jianguang; Xu, Mengnan; Cram, David S; Ma, Shenglin

2016-08-02

Activating and resistance mutations in the tyrosine kinase domain of several oncogenes are frequently associated with non-small cell lung carcinoma (NSCLC). In this study we assessed the frequency, type and abundance of EGFR, KRAS, BRAF, TP53 and ALK mutations in tumour specimens from 184 patients with early and late stage disease using single molecule amplification and re-sequencing technology (SMART). Based on modelling of EGFR mutations, the detection sensitivity of the SMART assay was at least 0.1%. Benchmarking EGFR mutation detection against the gold standard ARMS-PCR assay, SMART assay had a sensitivity and specificity of 98.7% and 99.0%. Amongst the 184 samples, EGFR mutations were the most prevalent (59.9%), followed by KRAS (16.9%), TP53 (12.7%), EML4-ALK fusions (6.3%) and BRAF (4.2%) mutations. The abundance and types of mutations in tumour specimens were extremely heterogeneous, involving either monoclonal (51.6%) or polyclonal (12.6%) mutation events. At the clinical level, although the spectrum of tumour mutation(s) was unique to each patient, the overall patterns in early or advanced stage disease were relatively similar. Based on these findings, we propose that personalized profiling and quantitation of clinically significant oncogenic mutations will allow better classification of patients according to tumour characteristics and provide clinicians with important ancillary information for treatment decision-making.

β-Globin chain abnormalities with coexisting α-thalassemia mutations

PubMed Central

Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

2012-01-01

Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075

Staying green postharvest: how three mutations in the Arabidopsis chlorophyll b reductase gene NYC1 delay degreening by distinct mechanisms.

PubMed

Jibran, Rubina; Sullivan, Kerry L; Crowhurst, Ross; Erridge, Zoe A; Chagné, David; McLachlan, Andrew R G; Brummell, David A; Dijkwel, Paul P; Hunter, Donald A

2015-11-01

Stresses such as energy deprivation, wounding and water-supply disruption often contribute to rapid deterioration of harvested tissues. To uncover the genetic regulation behind such stresses, a simple assessment system was used to detect senescence mutants in conjunction with two rapid mapping techniques to identify the causal mutations. To demonstrate the power of this approach, immature inflorescences of Arabidopsis plants that contained ethyl methanesulfonate-induced lesions were detached and screened for altered timing of dark-induced senescence. Numerous mutant lines displaying accelerated or delayed timing of senescence relative to wild type were discovered. The underlying mutations in three of these were identified using High Resolution Melting analysis to map to a chromosomal arm followed by a whole-genome sequencing-based mapping method, termed 'Needle in the K-Stack', to identify the causal lesions. All three mutations were single base pair changes and occurred in the same gene, NON-YELLOW COLORING1 (NYC1), a chlorophyll b reductase of the short-chain dehydrogenase/reductase (SDR) superfamily. This was consistent with the mutants preferentially retaining chlorophyll b, although substantial amounts of chlorophyll b were still lost. The single base pair mutations disrupted NYC1 function by three distinct mechanisms, one by producing a termination codon, the second by interfering with correct intron splicing and the third by replacing a highly conserved proline with a non-equivalent serine residue. This non-synonymous amino acid change, which occurred in the NADPH binding domain of NYC1, is the first example of such a mutation in an SDR protein inhibiting a physiological response in plants. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Effect of a myosin regulatory light chain mutation K104E on actin-myosin interactions.

PubMed

Duggal, D; Nagwekar, J; Rich, R; Huang, W; Midde, K; Fudala, R; Das, H; Gryczynski, I; Szczesna-Cordary, D; Borejdo, J

2015-05-15

Familial hypertrophic cardiomyopathy (FHC) is the most common cause of sudden cardiac death in young individuals. Molecular mechanisms underlying this disorder are largely unknown; this study aims at revealing how disruptions in actin-myosin interactions can play a role in this disorder. Cross-bridge (XB) kinetics and the degree of order were examined in contracting myofibrils from the ex vivo left ventricles of transgenic (Tg) mice expressing FHC regulatory light chain (RLC) mutation K104E. Because the degree of order and the kinetics are best studied when an individual XB makes a significant contribution to the overall signal, the number of observed XBs in an ex vivo ventricle was minimized to ∼20. Autofluorescence and photobleaching were minimized by labeling the myosin lever arm with a relatively long-lived red-emitting dye containing a chromophore system encapsulated in a cyclic macromolecule. Mutated XBs were significantly better ordered during steady-state contraction and during rigor, but the mutation had no effect on the degree of order in relaxed myofibrils. The K104E mutation increased the rate of XB binding to thin filaments and the rate of execution of the power stroke. The stopped-flow experiments revealed a significantly faster observed dissociation rate in Tg-K104E vs. Tg-wild-type (WT) myosin and a smaller second-order ATP-binding rate for the K104E compared with WT myosin. Collectively, our data indicate that the mutation-induced changes in the interaction of myosin with actin during the contraction-relaxation cycle may contribute to altered contractility and the development of FHC. Copyright © 2015 the American Physiological Society.

[Correlation of clinicopathologic features and driver gene mutation in non-small cell lung cancer].

PubMed

Chen, L F; Chen, X Y; Yu, X B

2016-04-08

To study the relationship between mutations of well-known driver genes and clinicopathologic characteristics of non-small cell lung cancers (NSCLC). Scorpions amplification refractory mutation system (scorpions ARMS) fluorescence quantitative PCR was performed to investigate 205 driver gene mutation status in NSCLC in correlation with clinicopathological characteristics of the patients. Driver gene mutations were detected in 146 of 205 (71.2%) patients with NSCLC, including 81.7%(138/169) adenocarcinomas, in which mutations of nine genes were found: EGFR (63.3%, 107/169), KRAS (5.9%, 10/169), PIK3CA (4.1%, 7/169), ALK (4.1%, 7/169), ROS1 (3.0%, 5/169), RET (3.6%, 6/169), HER2 (1.8%, 3/169), NRAS (0.6%, 1/169) and BRAF (0.6%, 1/169). The frequencies of driver gene mutations were higher in adenocarcinomas, female patients and non-smokers (P<0.01, P=0.003, P<0.01, respectively). Driver gene mutation status showed no correlation with either the age or the clinical stage (P=0.281, P=0.490, respectively). However, EGFR mutations tended to occur in adenocarcinoma, female, non-smokers, and patients of ≥62 years of age (P<0.01, P<0.01, P=0.002, P=0.012, respectively). The frequency of EGFR mutation was positively correlated with the tumor histology of lepidic, acinar, papillary and micropapillary predominant growth patterns. There was no relationship between EGFR mutation and the clinical stage (P=0.237). The frequency of KRAS mutation was higher in solid predominant and invasive mucinous adenocarcinomas (P=0.015); that of PIK3CA mutation was higher in patients of ≥62 years of age, invasive mucinous adenocarcinoma and fetal adenocarcinoma (P=0.015, P=0.006, respectively). ALK, ROS1 or RET mutation positive NSCLC tended to occur in nonsmokers and have solid predominant tumors and invasive mucinous adenocarcinoma (P=0.012, P=0.017 respectively). The frequency of EML4-ALK mutation was higher in the early stage patients with solid predominant tumors and invasive mucinous adenocarcinomas (P=0.025, P=0.014, respectively); that of ROS1 rearrangement was higher in invasive mucinous adenocarcinomas (P=0.049). NRAS, BRAF and HER2 gene mutations were infrequent and their clinical significance remained to be elucidated. The relationship between mutations of well-known driver genes and clinicopathological characteristics in patients with NSCLC has diversity, the rate of mutations is higher in non-smoking female patients with adenocarcinoma.

Mutation rates at 42 Y chromosomal short tandem repeats in Chinese Han population in Eastern China.

PubMed

Wu, Weiwei; Ren, Wenyan; Hao, Honglei; Nan, Hailun; He, Xin; Liu, Qiuling; Lu, Dejian

2018-01-31

Mutation analysis of 42 Y chromosomal short tandem repeats (Y-STRs) loci was performed using a sample of 1160 father-son pairs from the Chinese Han population in Eastern China. The results showed that the average mutation rate across the 42 Y-STR loci was 0.0041 (95% CI 0.0036-0.0047) per locus per generation. The locus-specific mutation rates varied from 0.000 to 0.0190. No mutation was found at DYS388, DYS437, DYS448, DYS531, and GATA_H4. DYS627, DYS570, DYS576, and DYS449 could be classified as rapidly mutating Y-STRs, with mutation rates higher than 1.0 × 10 -2 . DYS458, DYS630, and DYS518 were moderately mutating Y-STRs, with mutation rates ranging from 8 × 10 -3 to 1 × 10 -2 . Although the characteristics of the Y-STR mutations were consistent with those in previous studies, mutation rate differences between our data and previous published data were found at some rapidly mutating Y-STRs. The single-copy loci located on the short arm of the Y chromosome (Yp) showed relatively higher mutation rates more frequently than the multi-copy loci. These results will not only extend the data for Y-STR mutations but also be important for kinship analysis, paternal lineage identification, and family relationship reconstruction in forensic Y-STR analysis.

Prevalence of Thalassemia and Glucose-6-Phosphate Dehydrogenase Deficiency in Newborns and Adults at the Ramathibodi Hospital, Bangkok, Thailand.

PubMed

Banyatsuppasin, Wansa; Jindadamrongwech, Sumalee; Limrungsikul, Anchalee; Butthep, Punnee

Thalassemias and glucose-6-phosphate dehydrogenase (G6PD) deficiency are the most common inherited blood disorders. They are distributed among populations living in malaria endemic regions resulting in survival advantage from severe malaria disease. The aims of this study were to analyze the prevalence of thalassemias and G6PD deficiency at the Ramathibodi Hospital, Bangkok, Thailand. A total of 616 adult and 174 cord blood samples were collected and analyzed for red blood cell (RBC) parameters, hemoglobin (Hb) typing and DNA analysis for G6PD mutations and α-thalassemia (α-thal). The two most prominent types of thalassemia were heterozygous Hb E (HBB: c.79G>A), (19.5% in newborns and 35.6% in adults) followed by heterozygous α-thal-2 [-α 3.7 (rightward) deletion] at 18.7% in newborns and 19.5% in adults. After performing G6PD genotyping using multiplex amplification refractory mutation system-polymerase chain reaction (multiplex ARMS-PCR) for 10 G6PD mutations, the prevalence of G6PD mutation was found in 12.0% of newborns and 11.7% of adults. The G6PD Viangchan [871 (G>A)] is the most common G6PD mutation in newborns (42.9%) and adults (52.8%). In addition, coinheritance of various types of thalassemia with G6PD deficiency were found. The results indicated that heterozygous Hb E and G6PD Viangchan are predominant both in newborns and adults in this study.

A screen to identify Drosophila genes required for integrin-mediated adhesion.

PubMed Central

Walsh, E P; Brown, N H

1998-01-01

Drosophila integrins have essential adhesive roles during development, including adhesion between the two wing surfaces. Most position-specific integrin mutations cause lethality, and clones of homozygous mutant cells in the wing do not adhere to the apposing surface, causing blisters. We have used FLP-FRT induced mitotic recombination to generate clones of randomly induced mutations in the F1 generation and screened for mutations that cause wing blisters. This phenotype is highly selective, since only 14 lethal complementation groups were identified in screens of the five major chromosome arms. Of the loci identified, 3 are PS integrin genes, 2 are blistered and bloated, and the remaining 9 appear to be newly characterized loci. All 11 nonintegrin loci are required on both sides of the wing, in contrast to integrin alpha subunit genes. Mutations in 8 loci only disrupt adhesion in the wing, similar to integrin mutations, while mutations in the 3 other loci cause additional wing defects. Mutations in 4 loci, like the strongest integrin mutations, cause a "tail-up" embryonic lethal phenotype, and mutant alleles of 1 of these loci strongly enhance an integrin mutation. Thus several of these loci are good candidates for genes encoding cytoplasmic proteins required for integrin function. PMID:9755209

Novel Mutations in PSENEN Gene in Two Chinese Acne Inversa Families Manifested as Familial Multiple Comedones and Dowling-Degos Disease

PubMed Central

Zhou, Cheng; Wen, Guang-Dong; Soe, Lwin Myint; Xu, Hong-Jun; Du, Juan; Zhang, Jian-Zhong

2016-01-01

Background: Acne inversa (AI), also called hidradenitis suppurativa, is a chronic, inflammatory, recurrent skin disease of the hair follicle. Familial AI shows autosomal-dominant inheritance caused by mutations in the γ-secretase genes. This study was aimed to identify the specific mutations in the γ-secretase genes in two Chinese families with AI. Methods: In this study, two Chinese families with AI were investigated. All the affected individuals in the two families mainly manifested with multiple comedones, pitted scars, and a few inflammatory nodules on their face, neck, trunk, axilla, buttocks, upper arms, and thighs. Reticulate pigmentation in the flexures areas resembled Dowling-Degos disease clinically and pathologically. In addition, one of the affected individuals developed anal canal squamous cell carcinoma. Molecular mutation analysis of γ-secretase genes including PSENEN, PSEN1, and NCSTN was performed by polymerase chain reaction and direct DNA sequencing. Results: Two novel mutations of PSENEN gene were identified, including a heterozygous missense mutation c.194T>G (p.L65R) and a splice site mutation c.167-2A>G. Conclusions: The identification of the two mutations could expand the spectrum of mutations in the γ-secretase genes underlying AI and provide valuable information for further study of genotype-phenotype correlations. PMID:27900998

Clinical outcomes of EGFR-TKI treatment and genetic heterogeneity in lung adenocarcinoma patients with EGFR mutations on exons 19 and 21.

PubMed

Yu, Jiang-Yong; Yu, Si-Fan; Wang, Shu-Hang; Bai, Hua; Zhao, Jun; An, Tong-Tong; Duan, Jian-Chun; Wang, Jie

2016-03-21

Epidermal growth factor receptor (EGFR) mutations, including a known exon 19 deletion (19 del) and exon 21 L858R point mutation (L858R mutation), are strong predictors of the response to EGFR tyrosine kinase inhibitor (EGFR-TKI) treatment in lung adenocarcinoma. However, whether patients carrying EGFR 19 del and L858R mutations exhibit different responsiveness to EGFR-TKIs and what are the potential mechanism for this difference remain controversial. This study aimed to investigate the clinical outcomes of EGFR-TKI treatment in patients with EGFR 19 del and L858R mutations and explore the genetic heterogeneity of tumors with the two mutation subtypes. Of 1127 patients with advanced lung adenocarcinoma harboring EGFR 19 del or L858R mutations, 532 received EGFR-TKI treatment and were included in this study. EGFR 19 del and L858R mutations were detected by using denaturing high-performance liquid chromatography (DHPLC). T790M mutation, which is a common resistant mutation on exon 20 of EGFR, was detected by amplification refractory mutation system (ARMS). Next-generation sequencing (NGS) was used to explore the genetic heterogeneity of tumors with EGFR 19 del and L858R mutations. Of the 532 patients, 319 (60.0%) had EGFR 19 del, and 213 (40.0%) had L858R mutations. The patients with EGFR 19 del presented a significantly higher overall response rate (ORR) for EGFR-TKI treatment (55.2% vs. 43.7%, P = 0.017) and had a longer progression-free survival (PFS) after first-line EGFR-TKI treatment (14.4 vs. 11.4 months, P = 0.034) compared with those with L858R mutations. However, no statistically significant difference in overall survival (OS) was observed between the two groups of patients. T790M mutation status was analyzed in 88 patients before EGFR-TKI treatment and 134 after EGFR-TKI treatment, and there was no significant difference in the co-existence of T790M mutation with EGFR 19 del and L858R mutations before EGFR-TKI treatment (5.6% vs. 8.8%, P = 0.554) or after treatment (24.4% vs. 35.4%, P = 0.176). In addition, 24 patients with EGFR 19 del and 19 with L858R mutations were analyzed by NGS, and no significant difference in the presence of multiple somatic mutations was observed between the two genotypes. Patients with EGFR 19 del exhibit longer PFS and higher ORR compared with those with L858R mutations. Whether the heterogeneity of tumors with EGFR 19 del and L858R mutations contribute to a therapeutic response difference needs further investigation.

Stress-induced loss of heterozygosity in Candida: a possible missing link in the ability to evolve.

PubMed

Rosenberg, Susan M

2011-01-01

Diploid organisms are buffered against the effects of mutations by carrying two sets of each gene, which allows compensation if one is mutated. But recombination between "mom" and "dad" chromosomes causes loss of heterozygosity (LOH), stretches of "mom-only" or "dad-only" DNA sequence, suddenly revealing effects of mutations accumulated in entire chromosome arms. LOH creates new phenotypes from old mutations, drives cancer development and evolution, and, in a new study by Forche et al., is shown to be induced by stress in Candida albicans [Forche A, et al, mBio 2(4):e00129-11, 2011]. Stress-induced LOH could speed evolution of Candida specifically when it is poorly adapted to its environment. Moreover, the findings may provide a missing link between recombination-dependent mutagenesis in bacteria and yeast, suggesting that both might be stress induced, both maximizing genetic variation when populations could benefit most from diversity.

Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

PubMed

Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

2002-08-01

Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

Risk of Drug Resistance Among Persons Acquiring HIV Within a Randomized Clinical Trial of Single- or Dual-Agent Preexposure Prophylaxis

PubMed Central

Lehman, Dara A.; Baeten, Jared M.; McCoy, Connor O.; Weis, Julie F.; Peterson, Dylan; Mbara, Gerald; Donnell, Deborah; Thomas, Katherine K.; Hendrix, Craig W.; Marzinke, Mark A.; Frenkel, Lisa; Ndase, Patrick; Mugo, Nelly R.; Celum, Connie; Overbaugh, Julie; Matsen, Frederick A.; Celum, Connie; Baeten, Jared M.; Donnell, Deborah; Coombs, Robert W.; Frenkel, Lisa; Hendrix, Craig W.; Marzinke, Mark A.; Lingappa, Jairam; McElrath, M. Juliana; Fife, Kenneth; Were, Edwin; Tumwesigye, Elioda; Ndase, Patrick; Katabira, Elly; Katabira, Elly; Ronald, Allan; Bukusi, Elizabeth; Cohen, Craig; Wangisi, Jonathan; Campbell, James; Tappero, Jordan; Kiarie, James; Farquhar, Carey; John-Stewart, Grace; Mugo, Nelly Rwamba; Campbell, James; Tappero, Jordan; Wangisi, Jonathan

2015-01-01

Background. Preexposure prophylaxis (PrEP) with emtricitabine plus tenofovir disoproxil fumarate (FTC/TDF) or TDF alone reduces the risk of human immunodeficiency virus (HIV) acquisition. Understanding the risk of antiretroviral resistance selected by PrEP during breakthrough infections is important because of the risk of treatment failure during subsequent antiretroviral use. Methods. Within the largest randomized trial of FTC/TDF versus TDF as PrEP, plasma samples were tested for HIV with resistance mutations associated with FTC (K65R and M184IV) and TDF (K65R and K70E), using 454 sequencing. Results. Of 121 HIV seroconverters, 25 received FTC/TDF, 38 received TDF, and 58 received placebo. Plasma drug levels in 26 individuals indicated PrEP use during or after HIV acquisition, of which 5 had virus with resistance mutations associated with their PrEP regimen. Among those with PrEP drug detected during infection, resistance was more frequent in the FTC/TDF arm (4 of 7 [57%]), compared with the TDF arm (1 of 19 [5.3%]; P = .01), owing to the FTC-associated mutation M184IV. Of these cases, 3 had unrecognized acute infection at PrEP randomization, and 2 were HIV negative at enrollment. Conclusions. These results suggest that resistance selected by PrEP is rare but can occur both with PrEP initiation during acute seronegative HIV infection and in PrEP breakthrough infections and that FTC is associated with a greater frequency of resistance mutations than TDF. PMID:25587020

Factors affecting differential sweet corn sensitivity to HPPD-inhibiting herbicides

USDA-ARS?s Scientific Manuscript database

Mutation of a cytochrome P450 (CYP) allele on the short arm of chromosome five affects sensitivity in sweet corn to mesotrione and tembotrione+isoxadifen applied POST. Hybrids that are homozygous for the functional allele (i.e. CYPCYP) are tolerant of both herbicides and rarely injured at registered...

Explanation of the Differences in Sweet Corn Hybrid Sensitivity to HPPD-inhibitors

USDA-ARS?s Scientific Manuscript database

Mutation of a cytochrome P450 (CYP) allele on the short arm of chromosome 5 affects sensitivity in sweet corn to mesotrione and tembotrione applied postemergence. Hybrids that are homozygous for the functional allele (CYPCYP) are tolerant of both herbicides and rarely injured at recommended use rat...

Evolving artificial metalloenzymes via random mutagenesis

NASA Astrophysics Data System (ADS)

Yang, Hao; Swartz, Alan M.; Park, Hyun June; Srivastava, Poonam; Ellis-Guardiola, Ken; Upp, David M.; Lee, Gihoon; Belsare, Ketaki; Gu, Yifan; Zhang, Chen; Moellering, Raymond E.; Lewis, Jared C.

2018-03-01

Random mutagenesis has the potential to optimize the efficiency and selectivity of protein catalysts without requiring detailed knowledge of protein structure; however, introducing synthetic metal cofactors complicates the expression and screening of enzyme libraries, and activity arising from free cofactor must be eliminated. Here we report an efficient platform to create and screen libraries of artificial metalloenzymes (ArMs) via random mutagenesis, which we use to evolve highly selective dirhodium cyclopropanases. Error-prone PCR and combinatorial codon mutagenesis enabled multiplexed analysis of random mutations, including at sites distal to the putative ArM active site that are difficult to identify using targeted mutagenesis approaches. Variants that exhibited significantly improved selectivity for each of the cyclopropane product enantiomers were identified, and higher activity than previously reported ArM cyclopropanases obtained via targeted mutagenesis was also observed. This improved selectivity carried over to other dirhodium-catalysed transformations, including N-H, S-H and Si-H insertion, demonstrating that ArMs evolved for one reaction can serve as starting points to evolve catalysts for others.

IDH1 Mutation in Brain Stem Glioma: Case Report and Review of Literature.

PubMed

Javadi, Seyed Amirhossein; Hartmann, Christian; Walter, Gerhard Franz; Banan, Roozbeh; Samii, Amir

2018-01-01

The role of isocitrate dehydrogenase 1 (IDH1) mutation in brain stem glioma is not clear. To the best of our knowledge, six cases of brain stem gliomas carrying IDH1/2 mutations are currently reported in the literature. One case of diffuse brain stem glioma with IDH1 mutation, which was followed for 2 years, is presented and compared with IDH1 negative tumors. A 22-year-old lady was referred with diplopia and left arm palsy. Neuroimaging detected a nonenhancing, nonhomogeneous diffuse infiltrating brain stem tumor extending from pons to medulla. Microsurgical debulking was performed. Microscopic evaluation of the tissue specimen and immunohistochemistry revealed an astrocytoma WHO Grade II with proliferation rate of 3% and glial fibrillary acidic protein (GFAP)-positive tumor cells. Interestingly, the tumor cells expressed mutated IDH1 R132H protein. The patient underwent adjuvant radiation and chemotherapy. The primary and 2 years' clinical/radiological characteristics did not indicate any significant difference from other cases without IDH1 mutation. the prognostic value of IDH1/2 mutation in brain stem glioma is unclear. Brain stem biopsies may allow determination of a tissue-based tumor diagnosis for further investigations.

Molecular Inversion Probe Analysis of Gene Copy Alterations Reveals Distinct Categories of Colorectal Carcinoma

PubMed Central

Ji, Hanlee; Kumm, Jochen; Zhang, Michael; Farnam, Kyle; Salari, Keyan; Faham, Malek; Ford, James M.; Davis, Ronald W.

2006-01-01

Genomic instability is a major feature of neoplastic development in colorectal carcinoma and other cancers. Specific genomic instability events, such as deletions in chromosomes and other alterations in gene copy number, have potential utility as biologically relevant prognostic biomarkers. For example, genomic deletions on chromosome arm 18q are an indicator of colorectal carcinoma behavior and potentially useful as a prognostic indicator. Adapting a novel genomic technology called molecular inversion probes which can determine gene copy alterations, such as genomic deletions, we designed a set of probes to interrogate several hundred individual exons of >200 cancer genes with an overall distribution covering all chromosome arms. In addition, >100 probes were designed in close proximity of microsatellite markers on chromosome arm 18q. We analyzed a set of colorectal carcinoma cell lines and primary colorectal tumor samples for gene copy alterations and deletion mutations in exons. Based on clustering analysis, we distinguished the different categories of genomic instability among the colorectal cancer cell lines. Our analysis of primary tumors uncovered several distinct categories of colorectal carcinoma, each with specific patterns of 18q deletions and deletion mutations in specific genes. This finding has potential clinical ramifications given the application of 18q loss of heterozygosity events as a potential indicator for adjuvant treatment in stage II colorectal carcinoma. PMID:16912164

Phase II trial of temozolomide and sorafenib in advanced melanoma patients with or without brain metastases

PubMed Central

Amaravadi, Ravi K.; Schuchter, Lynn M.; McDermott, David F.; Kramer, Amy; Giles, Lydia; Gramlich, Kristi; Carberry, Mary; Troxel, Andrea B.; Letrero, Richard; Nathanson, Katherine L.; Atkins, Michael B.; O’Dwyer, Peter J.; Flaherty, Keith T.

2009-01-01

Purpose The combination of the oral alkylating agent temozolomide and the oral multi-kinase inhibitor sorafenib was evaluated in advanced melanoma patients. Patients and Methods Patients with metastatic melanoma (N=167) were treated on four arms. All patients received sorafenib at 400 mg orally twice daily without interruption. Patients without brain metastases or prior temozolomide were randomized between Arm A: extended dosing of temozolomide (EDT; 75 mg/m2 temozolomide daily for 6/8 weeks) and Arm B: standard dosing (SDT; 150 mg/m2 temozolomide daily for 5/28 days). Patients previously treated with temozolomide were enrolled on Arm C: EDT. Patients with brain metastases and no prior temozolomide were assigned to Arm D: SDT. The primary endpoint was 6-month progression-free survival (PFS) rate. Secondary endpoints included response rate, toxicity rates, and the rates of BRAF or NRAS mutations. Results The 6-month PFS rate for arms A, B, C, and D were 50%, 40%, 11%, and 23%. The median PFS for patients on arm A, B, C, and D was 5.9, 4.2, 2.2, and 3.5 months, respectively. No significant differences were observed between Arms A and B in 6-month PFS rate, median PFS, or response rates. Treatment was well tolerated in all arms. No significant differences in toxicity were observed between arms A and B except for more grade 3–4 lymphopenia in arm A. Conclusion Temozolomide plus sorafenib was well tolerated and demonstrated activity in melanoma patients without prior history of temozolomide. The activity of this combination regimen warrants further investigation. PMID:19996224

High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

PubMed

Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

2018-05-15

The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

Week 96 efficacy of lopinavir/ritonavir monotherapy in virologically suppressed patients with HIV: a randomized non-inferiority trial (ANRS 140 DREAM).

PubMed

Meynard, Jean-Luc; Moinot, Laetitia; Landman, Roland; Morand-Joubert, Laurence; Besseghir, Amel; Kolta, Sami; Spire, Bruno; Todesco, Eve; Bouchaud, Olivier; Fagard, Catherine; Chene, Geneviève; Girard, Pierre-Marie

2018-06-01

Sparing of antiretroviral drug classes could reduce the toxicity and cost of maintenance treatment for HIV infection. To evaluate the non-inferiority of efficacy and the safety of lopinavir/ritonavir (r) monotherapy versus a single-tablet regimen of efavirenz, emtricitabine and tenofovir (EFV/FTC/TDF) over 2 years. Adults on stable ART with plasma HIV-1 RNA viral load <50 copies/mL for the past 12 months and no documented treatment failure were randomized to receive either lopinavir/r or EFV/FTC/TDF for 2 years. The primary endpoint was the proportion of patients without treatment failure at week 96 (viral load <50 copies/mL at week 96, confirmed at week 98), without study treatment discontinuation, a new AIDS-defining illness, or death. In the ITT analysis, the primary endpoint was reached by, respectively, 64% and 71% of patients in the lopinavir/r (n = 98) and EFV/FTC/TDF arms (n = 97), yielding a difference of -6.8% (lower limit of the 95% two-sided CI: -19.9%). Sanger and UltraDeep sequencing showed the occurrence of PI mutations in the lopinavir/r arm (n = 4) and of NNRTI and/or NRTI mutations in the EFV/FTC/TDF arm (n = 2). No unexpected serious clinical events occurred. Lopinavir/r monotherapy cannot be considered non-inferior to EFV/FTC/TDF. PI resistance rarely emerged in the lopinavir/r arm and did not undermine future PI options. Two years of lopinavir/r monotherapy had no deleterious clinical impact when compared with EFV/FTC/TDF.

Genetic hurdles limit the arms race between Prochlorococcus and the T7-like podoviruses infecting them

PubMed Central

Schwartz, Daniel A; Lindell, Debbie

2017-01-01

Phages and hosts coexist in nature with a high degree of population diversity. This is often explained through coevolutionary models, such as the arms race or density-dependent fluctuating selection, which differ in assumptions regarding the emergence of phage mutants that overcome host resistance. Previously, resistance in the abundant marine cyanobacterium, Prochlorococcus, was found to occur frequently. However, little is known about the ability of phages to overcome this resistance. Here we report that, in some cases, T7-like cyanophage mutants emerge to infect resistant Prochlorococcus strains. These resistance-breaking phages retained the ability to infect the wild-type host. However, fitness of the mutant phages differed on the two hosts. Furthermore, in one case, resistance-breaking was accompanied by costs of decreased fitness on the wild-type host and decreased adsorption specificity, relative to the wild-type phage. In two other cases, fitness on the wild-type host increased. Whole-genome sequencing revealed mutations in probable tail-related genes. These were highly diverse in isolates and natural populations of T7-like cyanophages, suggesting that antagonistic coevolution enhances phage genome diversity. Intriguingly, most interactions did not yield resistance-breaking phages. Thus, resistance mutations raise genetic barriers to continuous arms race cycles and are indicative of an inherent asymmetry in coevolutionary capacity, with hosts having the advantage. Nevertheless, phages coexist with hosts, which we propose relies on combined, parallel action of a limited arms race, fluctuating selection and passive host-switching within diverse communities. Together, these processes generate a constantly changing network of interactions, enabling stable coexistence between hosts and phages in nature. PMID:28440802

Genetic hurdles limit the arms race between Prochlorococcus and the T7-like podoviruses infecting them.

PubMed

Schwartz, Daniel A; Lindell, Debbie

2017-08-01

Phages and hosts coexist in nature with a high degree of population diversity. This is often explained through coevolutionary models, such as the arms race or density-dependent fluctuating selection, which differ in assumptions regarding the emergence of phage mutants that overcome host resistance. Previously, resistance in the abundant marine cyanobacterium, Prochlorococcus, was found to occur frequently. However, little is known about the ability of phages to overcome this resistance. Here we report that, in some cases, T7-like cyanophage mutants emerge to infect resistant Prochlorococcus strains. These resistance-breaking phages retained the ability to infect the wild-type host. However, fitness of the mutant phages differed on the two hosts. Furthermore, in one case, resistance-breaking was accompanied by costs of decreased fitness on the wild-type host and decreased adsorption specificity, relative to the wild-type phage. In two other cases, fitness on the wild-type host increased. Whole-genome sequencing revealed mutations in probable tail-related genes. These were highly diverse in isolates and natural populations of T7-like cyanophages, suggesting that antagonistic coevolution enhances phage genome diversity. Intriguingly, most interactions did not yield resistance-breaking phages. Thus, resistance mutations raise genetic barriers to continuous arms race cycles and are indicative of an inherent asymmetry in coevolutionary capacity, with hosts having the advantage. Nevertheless, phages coexist with hosts, which we propose relies on combined, parallel action of a limited arms race, fluctuating selection and passive host-switching within diverse communities. Together, these processes generate a constantly changing network of interactions, enabling stable coexistence between hosts and phages in nature.

FDA approval summary: vemurafenib for treatment of unresectable or metastatic melanoma with the BRAFV600E mutation.

PubMed

Kim, Geoffrey; McKee, Amy E; Ning, Yang-Min; Hazarika, Maitreyee; Theoret, Marc; Johnson, John R; Xu, Qiang Casey; Tang, Shenghui; Sridhara, Rajeshwari; Jiang, Xiaoping; He, Kun; Roscoe, Donna; McGuinn, W David; Helms, Whitney S; Russell, Anne Marie; Miksinski, Sarah Pope; Zirkelbach, Jeanne Fourie; Earp, Justin; Liu, Qi; Ibrahim, Amna; Justice, Robert; Pazdur, Richard

2014-10-01

On August 17, 2011, the U.S. Food and Drug Administration (FDA) approved vemurafenib tablets (Zelboraf, Hoffmann-LaRoche Inc.) for the treatment of patients with unresectable or metastatic melanoma with the BRAF(V600E) mutation as detected by an FDA-approved test. The cobas 4800 BRAF V600 Mutation Test (Roche Molecular Systems, Inc.) was approved concurrently. An international, multicenter, randomized, open-label trial in 675 previously untreated patients with BRAF(V600E) mutation-positive unresectable or metastatic melanoma allocated 337 patients to receive vemurafenib, 960 mg orally twice daily, and 338 patients to receive dacarbazine, 1,000 mg/m(2) intravenously every 3 weeks. Overall survival was significantly improved in patients receiving vemurafenib [HR, 0.44; 95% confidence interval (CI), 0.33-0.59; P < 0.0001]. Progression-free survival was also significantly improved in patients receiving vemurafenib (HR, 0.26; 95% CI, 0.20-0.33; P < 0.0001). Overall response rates were 48.4% and 5.5% in the vemurafenib and dacarbazine arms, respectively. The most common adverse reactions (≥30%) in patients treated with vemurafenib were arthralgia, rash, alopecia, fatigue, photosensitivity reaction, and nausea. Cutaneous squamous cell carcinomas or keratoacanthomas were detected in approximately 24% of patients treated with vemurafenib. Other adverse reactions included hypersensitivity, Stevens-Johnson syndrome, toxic epidermal necrolysis, uveitis, QT prolongation, and liver enzyme laboratory abnormalities. ©2014 American Association for Cancer Research.

Primary Ciliary Dyskinesia Caused by Homozygous Mutation in DNAL1, Encoding Dynein Light Chain 1

PubMed Central

Mazor, Masha; Alkrinawi, Soliman; Chalifa-Caspi, Vered; Manor, Esther; Sheffield, Val C.; Aviram, Micha; Parvari, Ruti

2011-01-01

In primary ciliary dyskinesia (PCD), genetic defects affecting motility of cilia and flagella cause chronic destructive airway disease, randomization of left-right body asymmetry, and, frequently, male infertility. The most frequent defects involve outer and inner dynein arms (ODAs and IDAs) that are large multiprotein complexes responsible for cilia-beat generation and regulation, respectively. Although it has long been suspected that mutations in DNAL1 encoding the ODA light chain1 might cause PCD such mutations were not found. We demonstrate here that a homozygous point mutation in this gene is associated with PCD with absent or markedly shortened ODA. The mutation (NM_031427.3: c.449A>G; p.Asn150Ser) changes the Asn at position150, which is critical for the proper tight turn between the β strand and the α helix of the leucine-rich repeat in the hydrophobic face that connects to the dynein heavy chain. The mutation reduces the stability of the axonemal dynein light chain 1 and damages its interactions with dynein heavy chain and with tubulin. This study adds another important component to understanding the types of mutations that cause PCD and provides clinical information regarding a specific mutation in a gene not yet known to be associated with PCD. PMID:21496787

Genotyping non-small cell lung cancer (NSCLC) in Latin America.

PubMed

Arrieta, Oscar; Cardona, Andrés Felipe; Federico Bramuglia, Guillermo; Gallo, Aly; Campos-Parra, Alma D; Serrano, Silvia; Castro, Marcelo; Avilés, Alejandro; Amorin, Edgar; Kirchuk, Ricardo; Cuello, Mauricio; Borbolla, José; Riemersma, Omar; Becerra, Henry; Rosell, Rafael

2011-11-01

Frequency of mutations in EGFR and KRAS in non-small cell lung cancer (NSCLC) is different between ethnic groups; however, there is no information in Latin-American population. A total of 1150 biopsies of NSCLC patients from Latin America (Argentina, Colombia, Peru, and Mexico) were used extracting genomic DNA to perform direct sequencing of EGFR gene (exons 18 and 21) and KRAS gene in 650 samples. In Mexico, Scorpions ARMS was also used to obtain a genetic profile. We report the frequency of mutations in EGFR and KRAS genes in four Latin-American countries (n = 1150). Frequency of EGFR mutations in NSCLC was 33.2% (95% confidence interval [CI] 30.5-35.9) (Argentina 19.3%, Colombia 24.8%, Mexico 31.2%, and Peru 67%). The frequency of KRAS mutations was 16.6% (95% CI 13.8-19.4). EGFR mutations were independently associated with adenocarcinoma histology, older age, nonsmokers, and absence of KRAS mutations. Overall response rate to tyrosine kinase inhibitors in EGFR-mutated patients (n = 56) was 62.5% (95% CI 50-75) with a median overall survival of 16.5 months (95% CI 12.4-20.6). Our findings suggest that the frequency of EGFR mutations in Latin America lies between that of Asian and Caucasian populations and therefore support the genetic heterogeneity of NSCLC around the world.

Clinical and genetic aspects of primary ciliary dyskinesia/Kartagener syndrome.

PubMed

Leigh, Margaret W; Pittman, Jessica E; Carson, Johnny L; Ferkol, Thomas W; Dell, Sharon D; Davis, Stephanie D; Knowles, Michael R; Zariwala, Maimoona A

2009-07-01

Primary ciliary dyskinesia is a genetically heterogeneous disorder of motile cilia. Most of the disease-causing mutations identified to date involve the heavy (dynein axonemal heavy chain 5) or intermediate(dynein axonemal intermediate chain 1) chain dynein genes in ciliary outer dynein arms, although a few mutations have been noted in other genes. Clinical molecular genetic testing for primary ciliary dyskinesia is available for the most common mutations. The respiratory manifestations of primary ciliary dyskinesia (chronic bronchitis leading to bronchiectasis, chronic rhino-sinusitis, and chronic otitis media)reflect impaired mucociliary clearance owing to defective axonemal structure. Ciliary ultrastructural analysis in most patients (>80%) reveals defective dynein arms, although defects in other axonemal components have also been observed. Approximately 50% of patients with primary ciliary dyskinesia have laterality defects (including situs inversus totalis and, less commonly, heterotaxy, and congenital heart disease),reflecting dysfunction of embryological nodal cilia. Male infertility is common and reflects defects in sperm tail axonemes. Most patients with primary ciliary dyskinesia have a history of neonatal respiratory distress, suggesting that motile cilia play a role in fluid clearance during the transition from a fetal to neonatal lung. Ciliopathies involving sensory cilia, including autosomal dominant or recessive polycystic kidney disease, Bardet-Biedl syndrome, and Alstrom syndrome, may have chronic respiratory symptoms and even bronchiectasis suggesting clinical overlap with primary ciliary dyskinesia.

[Relationship of Ghrelin gene polymorphism with congenital anorectal malformation and Hirschsprung disease].

PubMed

Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin

2015-07-01

To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.

FDA Benefit-Risk Assessment of Osimertinib for the Treatment of Metastatic Non-Small Cell Lung Cancer Harboring Epidermal Growth Factor Receptor T790M Mutation.

PubMed

Odogwu, Lauretta; Mathieu, Luckson; Goldberg, Kirsten B; Blumenthal, Gideon M; Larkins, Erin; Fiero, Mallorie H; Rodriguez, Lisa; Bijwaard, Karen; Lee, Eunice Y; Philip, Reena; Fan, Ingrid; Donoghue, Martha; Keegan, Patricia; McKee, Amy; Pazdur, Richard

2018-03-01

On March 30, 2017, the U.S. Food and Drug Administration (FDA) approved osimertinib for the treatment of patients with metastatic, epidermal growth factor receptor (EGFR) T790M mutation-positive, non-small cell lung cancer (NSCLC), as detected by an FDA-approved test, whose disease has progressed following EGFR tyrosine kinase inhibitor (TKI) therapy. Approval was based on demonstration of a statistically significant difference in the primary endpoint of progression-free survival (PFS) when comparing osimertinib with chemotherapy in an international, multicenter, open-label, randomized trial (AURA3). In this confirmatory trial, which enrolled 419 patients, the PFS hazard ratio for osimertinib compared with chemotherapy per investigator assessment was 0.30 (95% confidence interval 0.23-0.41), p  < .001, with median PFS of 10.1 months in the osimertinib arm and 4.4 months in the chemotherapy arm. Supportive efficacy data included PFS per blinded independent review committee demonstrating similar PFS results and an improved confirmed objective response rate per investigator assessment of 65% and 29%, with estimated median durations of response of 11.0 months and 4.2 months, in the osimertinib and chemotherapy arms, respectively. Patients received osimertinib 80 mg once daily and had a median duration of exposure of 8 months. The toxicity profile of osimertinib compared favorably with the profile of other approved EGFR TKIs and chemotherapy. The most common adverse drug reactions (>20%) in patients treated with osimertinib were diarrhea, rash, dry skin, nail toxicity, and fatigue. Herein, we review the benefit-risk assessment of osimertinib that led to regular approval, for patients with metastatic NSCLC harboring EGFR TKI whose disease has progressed on or after EGFR TKI therapy. Osimertinib administered to metastatic non-small cell lung cancer (NSCLC) patients harboring an EGFR T790M mutation, who have progressed on or following EGFR TKI therapy, demonstrated a substantial improvement over platinum-based doublet chemotherapy as well as durable intracranial responses. The ability to test for the T790M mutation in plasma using the FDA-approved cobas EGFR Mutation Test v2 (Roche, Basel, Switzerland) identifies patients with NSCLC tumors not amenable to biopsy. Since a 40% false-negative rate has been observed with the circulating tumor DNA test, re-evaluation of the feasibility of tissue biopsy is recommended to identify patients with a false-negative plasma test result who may benefit from osimertinib. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Network-based analysis of oligodendrogliomas predicts novel cancer gene candidates within the region of the 1p/19q co-deletion.

PubMed

Gladitz, Josef; Klink, Barbara; Seifert, Michael

2018-06-11

Oligodendrogliomas are primary human brain tumors with a characteristic 1p/19q co-deletion of important prognostic relevance, but little is known about the pathology of this chromosomal mutation. We developed a network-based approach to identify novel cancer gene candidates in the region of the 1p/19q co-deletion. Gene regulatory networks were learned from gene expression and copy number data of 178 oligodendrogliomas and further used to quantify putative impacts of differentially expressed genes of the 1p/19q region on cancer-relevant pathways. We predicted 8 genes with strong impact on signaling pathways and 14 genes with strong impact on metabolic pathways widespread across the region of the 1p/19 co-deletion. Many of these candidates (e.g. ELTD1, SDHB, SEPW1, SLC17A7, SZRD1, THAP3, ZBTB17) are likely to push, whereas others (e.g. CAP1, HBXIP, KLK6, PARK7, PTAFR) might counteract oligodendroglioma development. For example, ELTD1, a functionally validated glioblastoma oncogene located on 1p, was overexpressed. Further, the known glioblastoma tumor suppressor SLC17A7 located on 19q was underexpressed. Moreover, known epigenetic alterations triggered by mutated SDHB in paragangliomas suggest that underexpressed SDHB in oligodendrogliomas may support and possibly enhance the epigenetic reprogramming induced by the IDH-mutation. We further analyzed rarely observed deletions and duplications of chromosomal arms within oligodendroglioma subcohorts identifying putative oncogenes and tumor suppressors that possibly influence the development of oligodendroglioma subgroups. Our in-depth computational study contributes to a better understanding of the pathology of the 1p/19q co-deletion and other chromosomal arm mutations. This might open opportunities for functional validations and new therapeutic strategies.

Virions at the gates: receptors and the host-virus arms race.

PubMed

Coffin, John M

2013-01-01

All viruses need to bind to specific receptor molecules on the surface of target cells to initiate infection. Virus-receptor binding is highly specific, and this specificity determines both the species and the cell type that can be infected by a given virus. In some well-studied cases, the virus-binding region on the receptor has been found to be unrelated to the receptor's normal cellular function. Resistance to virus infection can thus evolve by selection of mutations that alter amino acids in the binding region with minimal effect on normal function. This sort of positive selection can be used to infer the history of the host-virus "arms race" during their coevolution. In a new study, Demogines et al. use a combination of phylogenetic, structural, and virological analysis to infer the history and significance of positive selection on the transferrin receptor TfR1, a housekeeping protein required for iron uptake and the cell surface receptor for at least three different types of virus. The authors show that only two parts of the rodent TfR1 molecule have been subject to positive selection and that these correspond to the binding sites for two of these viruses-the mouse mammary tumor virus (a retrovirus) and Machupo virus (an arenavirus). They confirmed this result by introducing the inferred binding site mutations into the wild-type protein and testing for receptor function. Related arenaviruses are beginning to spread in human populations in South America as the cause of often fatal hemorrhagic fevers, and, although Demogines et al. could find no evidence of TfR1 mutations in this region that might have been selected as a consequence of human infection, the authors identified one such mutation in Asian populations that affects infection with these viruses.

Dystonia in Ashkenazi Jews: clinical characterization of a founder mutation.

PubMed

Bressman, S B; de Leon, D; Kramer, P L; Ozelius, L J; Brin, M F; Greene, P E; Fahn, S; Breakefield, X O; Risch, N J

1994-11-01

A gene (DYT1) for idiopathic torsion dystonia maps to chromosome 9q34 in Ashkenazi Jewish families with early onset of symptoms. Further, there is linkage disequilibrium between DYT1 and a particular haplotype of alleles at 9q34 loci in this population. This implies that a large proportion of early-onset idiopathic torsion dystonia in Ashkenazi Jews is due to a founder mutation in DYT1. To characterize the phenotypic range of this mutation, we studied 174 Ashkenazi Jewish individuals affected with idiopathic torsion dystonia. We used GT(n) markers on chromosome 9q34 (D9S62, D9S63, and ASS) and classified individuals as having ("carriers"), not having ("noncarriers"), or being ambiguous with respect to a DYT1-associated haplotype. We assessed clinical features and found marked clinical differences between haplotype carriers and noncarriers. There were 90 carriers, 70 noncarriers, and 14 ambiguous individuals. The mean age at onset of symptoms was significantly lower in carriers than in noncarriers (12.5 +/- 8.2 vs 36.5 +/- 16.4 years). In 94% of carriers, symptoms began in a limb (arm or leg equally); rarely the disorder started in the neck (3.3%) or larynx (2.2%). In contrast, the neck, larynx, and other cranial muscles were the sites of onset in 79% of noncarriers; onset in the arms occurred in 21% and onset in the legs never occurred. Limb onset, leg involvement in the course of disease, and age at onset distinguished haplotype carriers from noncarriers with 90% accuracy. In conclusion, there are clinical differences between Ashkenazi Jewish individuals with idiopathic torsion dystonia who do or do not have a unique DYT1 mutation, as determined by a DYT1-associated haplotype of 9q34 alleles.(ABSTRACT TRUNCATED AT 250 WORDS)

Clinical impact of gene mutations and lesions detected by SNP-array karyotyping in acute myeloid leukemia patients in the context of gemtuzumab ozogamicin treatment: Results of the ALFA-0701 trial

PubMed Central

Chevret, Sylvie; Nibourel, Olivier; Cheok, Meyling; Pautas, Cécile; Duléry, Rémy; Boyer, Thomas; Cayuela, Jean-Michel; Hayette, Sandrine; Raffoux, Emmanuel; Farhat, Hassan; Boissel, Nicolas; Terre, Christine

2014-01-01

We recently showed that the addition of fractionated doses of gemtuzumab ozogamicin (GO) to standard chemotherapy improves clinical outcome of acute myeloid leukemia (AML) patients. In the present study, we performed mutational analysis of 11 genes (FLT3, NPM1, CEBPA, MLL, WT1, IDH1/2, RUNX1, ASXL1, TET2, DNMT3A), EVI1 overexpression screening, and 6.0 single-nucleotide polymorphism array (SNP-A) analysis in diagnostic samples of the 278 AML patients enrolled in the ALFA-0701 trial. In cytogenetically normal (CN) AML (n = 146), 38% of the patients had at least 1 SNP-A lesion and 89% of the patients had at least 1 molecular alteration. In multivariate analysis, the independent predictors of higher cumulative incidence of relapse were unfavorable karyotype (P = 0.013) and randomization in the control arm (P = 0.007) in the whole cohort, and MLL partial tandem duplications (P = 0.014) and DNMT3A mutations (P = 0.010) in CN-AML. The independent predictors of shorter overall survival (OS) were unfavorable karyotype (P < 0.001) and SNP-A lesion(s) (P = 0.001) in the whole cohort, and SNP-A lesion(s) (P = 0.006), DNMT3A mutations (P = 0.042) and randomization in the control arm (P = 0.043) in CN-AML. Interestingly, CN-AML patients benefited preferentially more from GO treatment as compared to AML patients with abnormal cytogenetics (hazard ratio for death, 0.52 versus 1.14; test for interaction, P = 0.04). Although the interaction test was not statistically significant, the OS benefit associated with GO treatment appeared also more pronounced in FLT3 internal tandem duplication positive than in negative patients. PMID:24659740

Clinical impact of gene mutations and lesions detected by SNP-array karyotyping in acute myeloid leukemia patients in the context of gemtuzumab ozogamicin treatment: results of the ALFA-0701 trial.

PubMed

Renneville, Aline; Abdelali, Raouf Ben; Chevret, Sylvie; Nibourel, Olivier; Cheok, Meyling; Pautas, Cécile; Duléry, Rémy; Boyer, Thomas; Cayuela, Jean-Michel; Hayette, Sandrine; Raffoux, Emmanuel; Farhat, Hassan; Boissel, Nicolas; Terre, Christine; Dombret, Hervé; Castaigne, Sylvie; Preudhomme, Claude

2014-02-28

We recently showed that the addition of fractionated doses of gemtuzumab ozogamicin (GO) to standard chemotherapy improves clinical outcome of acute myeloid leukemia (AML) patients. In the present study, we performed mutational analysis of 11 genes (FLT3, NPM1, CEBPA, MLL, WT1, IDH1/2, RUNX1, ASXL1, TET2, DNMT3A), EVI1 overexpression screening, and 6.0 single-nucleotide polymorphism array (SNP-A) analysis in diagnostic samples of the 278 AML patients enrolled in the ALFA-0701 trial. In cytogenetically normal (CN) AML (n=146), 38% of the patients had at least 1 SNP-A lesion and 89% of the patients had at least 1 molecular alteration. In multivariate analysis, the independent predictors of higher cumulative incidence of relapse were unfavorable karyotype (P = 0.013) and randomization in the control arm (P = 0.007) in the whole cohort, and MLL partial tandem duplications (P = 0.014) and DNMT3A mutations (P = 0.010) in CN-AML. The independent predictors of shorter overall survival (OS) were unfavorable karyotype (P <0.001) and SNP-A lesion(s) (P = 0.001) in the whole cohort, and SNP-A lesion(s) (P = 0.006), DNMT3A mutations (P = 0.042) and randomization in the control arm (P = 0.043) in CN-AML. Interestingly, CN-AML patients benefited preferentially more from GO treatment as compared to AML patients with abnormal cytogenetics (hazard ratio for death, 0.52 versus 1.14; test for interaction, P = 0.04). Although the interaction test was not statistically significant, the OS benefit associated with GO treatment appeared also more pronounced in FLT3 internal tandem duplication positive than in negative patients.

Identification of A Novel Missense Mutation in The Norrie Disease Gene: The First Molecular Genetic Analysis and Prenatal Diagnosis of Norrie Disease in An Iranian Family.

PubMed

Talebi, Farah; Ghanbari Mardasi, Farideh; Mohammadi Asl, Javad; Lashgari, Ali; Farhadi, Freidoon

2018-07-01

Norrie disease (ND) is a rare X-linked recessive disorder, which is characterized by congenital blindness and, in several cases, accompanied with mental retardation and deafness. ND is caused by mutations in NDP, located on the proximal short arm of the X chromosome (Xp11.3). The disease has been observed in many ethnic groups worldwide, however, no such case has been reported from Iran. In this study, we present the molecular analysis of two patients with ND and the subsequent prenatal diagnosis. Screening of NDP identified a hemizygous missense mutation (p.Ser133Cys) in the affected male siblings of the family. The mother was the carrier for the mutation (p.Ser133Cys). In a subsequent chorionic amniotic pregnancy, we carried out prenatal diagnosis by sequencing NDP in the chorionic villi sample at 11 weeks of gestation. The fetus was carrying the mutation and thus unaffected. This is the first mutation report and prenatal diagnosis of an Iranian family with ND, and highlights the importance of prenatal diagnostic screening of this congenital disorder and relevant genetic counseling. Copyright© by Royan Institute. All rights reserved.

A Japanese Family with Central Hypothyroidism Caused by a Novel IGSF1 Mutation.

PubMed

Nishigaki, Satsuki; Hamazaki, Takashi; Fujita, Keinosuke; Morikawa, Shuntaro; Tajima, Toshihiro; Shintaku, Haruo

2016-12-01

Hemizygous mutations in the immunoglobulin superfamily member 1 (IGSF1) gene have been demonstrated to cause congenital central hypothyroidism in males. This study reports a family with a novel mutation in the IGSF1 gene located on the long arm of the X chromosome. A two-month-old boy was diagnosed with central hypothyroidism because of prolonged jaundice. A thyrotropin-releasing hormone (TRH) stimulation test indicated dysfunction in both the hypothalamus and the pituitary gland, and prompted the IGSF1 gene to be analyzed. The patient had a novel nonsense variant, c.2713C>T (p.Q905X), in exon 14 of the IGSF1 gene. Studies of the family revealed that the patient's sister and mother were heterozygous carriers of the IGSF1 mutation. The patient's maternal uncle carried the same mutation as the proband but had no overt symptoms. The mother and uncle started levothyroxine supplementation because of subclinical hypothyroidism. A novel mutation (c.2713C>T, p.Q905X) of the IGSF1 gene was identified that causes congenital central hypothyroidism in a Japanese family. The findings further expand the clinical heterogeneity of this entity.

Common mutations in the fibroblast growth factor receptor 3 (FGFR 3) gene account for achondroplasia, hypochondroplasia, and thanatophoric dwarfism.

PubMed

Bonaventure, J; Rousseau, F; Legeai-Mallet, L; Le Merrer, M; Munnich, A; Maroteaux, P

1996-05-03

The mapping of the achondroplasia locus to the short arm of chromosome 4 and the subsequent identification of a recurrent missense mutation (G380R) in the fibroblast growth factor receptor 3 (FGFR-3) gene has been followed by the detection of common FGFR-3 mutations in two clinically related disorders: thanatophoric dwarfism (types I and II) and hypochondroplasia. The relative clinical homogeneity of achondroplasia was substantiated by demonstration of its genetic homogeneity as more than 98% of all patients hitherto reported exhibit mutations in the transmembrane receptor domain. Although most hypochondroplasia cases were accounted for by a recurrent missense substitution (N540K) in the first tyrosine kinase (TK 1) domain of the receptor, a significant proportion (40%) of our patients did not harbor the N540K mutation and three hypochondroplasia families were not linked to the FGFR-3 locus, thus supporting clinical heterogeneity of this condition. In thanatophoric dwarfism (TD), a recurrent FGFR-3 mutation located in the second tyrosine kinase (TK 2) domain of the receptor was originally detected in 100% of TD II cases, our series seven distinct mutations in three different protein domains were identified in 25 of 26 TD I patients, suggesting that TD, like achondroplasia, is a genetically homogenous skeletal disorder.

[Arms racing between human beings and pathogens: NDM-1 and superbugs].

PubMed

Sun, Mingwei; Zheng, Beiwen; Gao, George F; Zhu, Baoli

2010-11-01

Throughout human history, pandemic bacterial diseases such as the plague and tuberculosis have posed an enormous threat to human beings. The discovery of antibiotics has provided us with powerful arsenal for the defense against bacterial infections. However, bacteria are acquiring more and more resistance genes to shield off antibiotics through mutation and horizontal gene transfer. Therefore, novel antibiotics must be produced and the arms race between bacterial pathogens and antibiotics is becoming increasingly intense. Recently, researchers have found that plasmids carrying a new metallo-beta-lactamase gene, blaNDM-1, and many other antibiotics resistance genes can easily spread through bacterial populations and confer recipient stains resistance to nearly all of the current antibiotics. It is a threat to the human health and a great challenge for our medical science, which we are facing. We need to find new ways to fight and win this arms racing.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komaki, Ritsuko, E-mail: rkomaki@mdanderson.org; Allen, Pamela K.; Wei, Xiong

Purpose: To test, in a single-arm, prospective, phase 2 trial, whether adding the epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor erlotinib to concurrent chemoradiotherapy for previously untreated, locally advanced, inoperable non-small cell lung cancer would improve survival and disease control without increasing toxicity. Methods and Materials: Forty-eight patients with previously untreated non-small cell lung cancer received intensity modulated radiation therapy (63 Gy/35 fractions) on Monday through Friday, with chemotherapy (paclitaxel 45 mg/m², carboplatin area under the curve [AUC] = 2) on Mondays, for 7 weeks. All patients also received the EGFR tyrosine kinase inhibitor erlotinib (150 mg orally 1/d) on Tuesday-Sunday for 7 weeks, followedmore » by consolidation paclitaxel–carboplatin. The primary endpoint was time to progression; secondary endpoints were overall survival (OS), toxicity, response, and disease control and whether any endpoint differed by EGFR mutation status. Results: Of 46 patients evaluable for response, 40 were former or never-smokers, and 41 were evaluable for EGFR mutations (37 wild-type [WT] and 4 mutated [all adenocarcinoma]). Median time to progression was 14.0 months and did not differ by EGFR status. Toxicity was acceptable (no grade 5, 1 grade 4, 11 grade 3). Twelve patients (26%) had complete responses (10 WT, 2 mutated), 27 (59%) partial (21 WT, 2 mutated, 4 unknown), and 7 (15%) none (6 WT, 2 mutated, 1 unknown) (P=.610). At 37.0 months' follow-up (range, 3.6-76.5 months) for all patients, median OS time was 36.5 months, and 1-, 2-, and 5-year OS rates were 82.6%, 67.4%, and 35.9%, respectively; none differed by mutation status. Twelve patients had no progression, and 34 had local and/or distant failure. Eleven of 27 distant failures were in the brain (7 WT, 3 mutated, 1 unknown). Conclusions: Toxicity and OS were promising, but time to progression did not meet expectations. The prevalence of distant failures underscores the need for effective systemic therapy.« less

Antiretroviral resistance at virological failure in the NEAT 001/ANRS 143 trial: raltegravir plus darunavir/ritonavir or tenofovir/emtricitabine plus darunavir/ritonavir as first-line ART.

PubMed

Lambert-Niclot, S; George, E C; Pozniak, A; White, E; Schwimmer, C; Jessen, H; Johnson, M; Dunn, D; Perno, C F; Clotet, B; Plettenberg, A; Blaxhult, A; Palmisano, L; Wittkop, L; Calvez, V; Marcelin, A G; Raffi, F

2016-04-01

To describe the pattern of drug resistance at virological failure in the NEAT001/ANRS143 trial (first-line treatment with ritonavir-boosted darunavir plus either tenofovir/emtricitabine or raltegravir). Genotypic testing was performed at baseline for reverse transcriptase (RT) and protease genes and for RT, protease and integrase (IN) genes for patients with a confirmed viral load (VL) >50 copies/mL or any single VL >500 copies/mL during or after week 32. A resistance test was obtained for 110/805 (13.7%) randomized participants qualifying for resistance analysis (61/401 of participants in the raltegravir arm and 49/404 of participants in the tenofovir/emtricitabine arm). No resistance-associated mutation (RAM) was observed in the tenofovir/emtricitabine plus darunavir/ritonavir arm, and all further analyses were limited to the raltegravir plus darunavir arm. In this group, 15/55 (27.3%) participants had viruses with IN RAMs (12 N155H alone, 1 N155H + Q148R, 1 F121Y and 1 Y143C), 2/53 (3.8%) with nucleotide analogue RT inhibitor RAMs (K65R, M41L) and 1/57 (1.8%) with primary protease RAM (L76V). The frequency of IN mutations at failure was significantly associated with baseline VL: 7.1% for a VL of <100,000 copies/mL, 25.0% for a VL of ≥100,000 copies/mL and <500,000 copies/mL and 53.8% for a VL of ≥500,000 copies/mL (PTREND = 0.007). Of note, 4/15 participants with IN RAM had a VL < 200 copies/mL at time of testing. In the NEAT001/ANRS143 trial, there was no RAM at virological failure in the standard tenofovir/emtricitabine plus darunavir/ritonavir regimen, contrasting with a rate of 29.5% (mostly IN mutations) in the raltegravir plus darunavir/ritonavir NRTI-sparing regimen. The cumulative risk of IN RAM after 96 weeks of follow-up in participants initiating ART with raltegravir plus darunavir/ritonavir was 3.9%. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Wnt Signaling Cross-Talks with JH Signaling by Suppressing Met and gce Expression

PubMed Central

Abdou, Mohamed; Peng, Cheng; Huang, Jianhua; Zyaan, Ola; Wang, Sheng; Li, Sheng; Wang, Jian

2011-01-01

Juvenile hormone (JH) plays key roles in controlling insect growth and metamorphosis. However, relatively little is known about the JH signaling pathways. Until recent years, increasing evidence has suggested that JH modulates the action of 20-hydroxyecdysone (20E) by regulating expression of broad (br), a 20E early response gene, through Met/Gce and Kr-h1. To identify other genes involved in JH signaling, we designed a novel Drosophila genetic screen to isolate mutations that derepress JH-mediated br suppression at early larval stages. We found that mutations in three Wnt signaling negative regulators in Drosophila, Axin (Axn), supernumerary limbs (slmb), and naked cuticle (nkd), caused precocious br expression, which could not be blocked by exogenous JHA. A similar phenotype was observed when armadillo (arm), the mediator of Wnt signaling, was overexpressed. qRT-PCR revealed that Met, gce and Kr-h1expression was suppressed in the Axn, slmb and nkd mutants as well as in arm gain-of-function larvae. Furthermore, ectopic expression of gce restored Kr-h1 expression but not Met expression in the arm gain-of-function larvae. Taken together, we conclude that Wnt signaling cross-talks with JH signaling by suppressing transcription of Met and gce, genes that encode for putative JH receptors. The reduced JH activity further induces down-regulation of Kr-h1expression and eventually derepresses br expression in the Drosophila early larval stages. PMID:22087234

Comparison of Radiation Exposure during Endovascular Treatment of Peripheral Arterial Disease with Flat-Panel Detectors on Mobile C-arm versus Fixed Systems.

PubMed

Guillou, Marie; Maurel, Blandine; Necib, Hatem; Vent, Pierre-Alexandre; Costargent, Alain; Chaillou, Philippe; Gouëffic, Yann; Kaladji, Adrien

2018-02-01

Flat-panel detectors on mobile C-arm (MC-arm) systems are currently challenging fixed C-arm (FC-arm) systems used in hybrid operating rooms. MC-arm systems offer an alternative to FC-arm systems in the endovascular treatment of peripheral arterial disease (PAD) but their efficiency has not been evaluated comparatively. Two series of patients undergoing arteriography with intention to treat were included. Each series consisted of 2 nonrandomized groups: an MC-arm group and an FC-arm group. Series 1 evaluated exposure to the patient (MC-arm, n = 113; FC-arm, n = 206) while series 2 evaluated exposure to patients and also health care personnel (MC-arm, n = 24; FC-arm, n = 76). The primary end points for evaluating exposure were air kerma (AK, in mGy) for patients and effective dose for health care personnel (in μSv). After adjustment for the effect of body mass index (analysis of covariance test), AK was found to be lower in the MC-arm group than in the FC-arm group (124.1 ± 142 vs. 173.3 ± 248.7, P = 0.025). There was no difference between the groups with regard to effective dose recorded for senior surgeons or for operating room nurses. However, a higher effective dose was recorded by the MC-arm group external dosimeter for the trainee resident and for nurse anesthetists. In endovascular treatment of lower limb PAD, use of an FC-arm system is associated with more radiation exposure to the patient than an MC-arm system. However, this type of imaging system does not appear to affect exposure to health care personnel. Copyright © 2017 Elsevier Inc. All rights reserved.

Primary ciliary dyskinesia caused by homozygous mutation in DNAL1, encoding dynein light chain 1.

PubMed

Mazor, Masha; Alkrinawi, Soliman; Chalifa-Caspi, Vered; Manor, Esther; Sheffield, Val C; Aviram, Micha; Parvari, Ruti

2011-05-13

In primary ciliary dyskinesia (PCD), genetic defects affecting motility of cilia and flagella cause chronic destructive airway disease, randomization of left-right body asymmetry, and, frequently, male infertility. The most frequent defects involve outer and inner dynein arms (ODAs and IDAs) that are large multiprotein complexes responsible for cilia-beat generation and regulation, respectively. Although it has long been suspected that mutations in DNAL1 encoding the ODA light chain1 might cause PCD such mutations were not found. We demonstrate here that a homozygous point mutation in this gene is associated with PCD with absent or markedly shortened ODA. The mutation (NM_031427.3: c.449A>G; p.Asn150Ser) changes the Asn at position150, which is critical for the proper tight turn between the β strand and the α helix of the leucine-rich repeat in the hydrophobic face that connects to the dynein heavy chain. The mutation reduces the stability of the axonemal dynein light chain 1 and damages its interactions with dynein heavy chain and with tubulin. This study adds another important component to understanding the types of mutations that cause PCD and provides clinical information regarding a specific mutation in a gene not yet known to be associated with PCD. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

The SHOX region and its mutations.

PubMed

Capone, L; Iughetti, L; Sabatini, S; Bacciaglia, A; Forabosco, A

2010-06-01

The short stature homeobox-containing (SHOX) gene lies in the pseudoautosomal region 1 (PAR1) that comprises 2.6 Mb of the short-arm tips of both the X and Y chromosomes. It is known that its heterozygous mutations cause Leri-Weill dyschondrosteosis (LWD) (OMIM #127300), while its homozygous mutations cause a severe form of dwarfism known as Langer mesomelic dysplasia (LMD) (OMIM #249700). The analysis of 238 LWD patients between 1998 and 2007 by multiple authors shows a prevalence of deletions (46.4%) compared to point mutations (21.2%). On the whole, deletions and point mutations account for about 67% of LWD patients. SHOX is located within a 1000 kb desert region without genes. The comparative genomic analysis of this region between genomes of different vertebrates has led to the identification of evolutionarily conserved non-coding DNA elements (CNE). Further functional studies have shown that one of these CNE downstream of the SHOX gene is necessary for the expression of SHOX; this is considered to be typical "enhancer" activity. Including the enhancer, the overall mutation of the SHOX region in LWD patients does not hold in 100% of cases. Various authors have demonstrated the existence of other CNE both downstream and upstream of SHOX regions. The resulting conclusion is that it is necessary to reanalyze all LWD/LMD patients without SHOX mutations for the presence of mutations in the 5'- and 3'-flanking SHOX regions.

Mice Deficient in the Axonemal Protein Tektin-t Exhibit Male Infertility and Immotile-Cilium Syndrome Due to Impaired Inner Arm Dynein Function

PubMed Central

Tanaka, Hiromitsu; Iguchi, Naoko; Toyama, Yoshiro; Kitamura, Kouichi; Takahashi, Tohru; Kaseda, Kazuhiro; Maekawa, Mamiko; Nishimune, Yoshitake

2004-01-01

The haploid germ cell-specific Tektin-t protein is a member of the Tektin family of proteins that form filaments in flagellar, ciliary, and axonemal microtubules. To investigate the physiological role of Tektin-t, we generated mice with a mutation in the tektin-t gene. The homozygous mutant males were infertile, while the females were fully fertile. Sperm morphology and function were abnormal, with frequent bending of the sperm flagella and marked defects in motility. In vitro fertilization assays showed that the defective spermatozoa were able to fertilize eggs. Electron microscopic examination showed that the dynein inner arm structure was disrupted in the sperm flagella of tektin-t-deficient mice. Furthermore, homozygous mutant mice had functionally defective tracheal cilia, as evidenced by altered dynein arm morphology. These results indicate that Tektin-t participates in dynein inner arm formation or attachment and that the loss of Tektin-t results in impaired motility of both flagella and cilia. Therefore, the tektin-t gene is one of the causal genes for immotile-cilium syndrome/primary ciliary dyskinesia. PMID:15340058

Adjusted Indirect Comparison Using Propensity Score Matching of Osimertinib to Platinum-Based Doublet Chemotherapy in Patients with EGFRm T790M NSCLC Who Have Progressed after EGFR-TKI.

PubMed

Mann, Helen; Andersohn, Frank; Bodnar, Carolyn; Mitsudomi, Tetsuya; Mok, Tony S K; Yang, James Chih-Hsin; Hoyle, Christopher

2018-04-01

An adjusted indirect comparison was conducted to assess efficacy outcomes, particularly overall survival (OS), of osimertinib versus platinum-based doublet chemotherapy in patients with epidermal growth factor receptor-mutated (EGFRm) T790M mutation-positive non-small-cell lung cancer (NSCLC) who had progressed following an EGFR tyrosine kinase inhibitor (TKI). Analysis of treatment effect from two separate trials had the potential to more accurately estimate the magnitude of OS benefit due to absence of confounding due to treatment switching from the control arm to the osimertinib arm of the ongoing randomized control trial, AURA3. Two non-randomized individual datasets were compared: pooled patients from the AURA extension and AURA2 trials (osimertinib 80 mg, n = 405, with a confirmed T790M mutation using tissue samples), and patients from the control arm of the IMPRESS study (platinum-based doublet chemotherapy, n = 61, with a confirmed T790M mutation using plasma circulating tumour DNA [ctDNA]). A propensity score-based approach was used to account for differences in baseline demographics and disease characteristics. After adjustment for baseline differences between the two groups, osimertinib demonstrated a statistically significant improvement in progression-free survival (PFS) versus platinum-based doublet chemotherapy (hazard ratio [HR] = 0.278, 95% confidence interval [CI] 0.188-0.409, p < 0.0001; median PFS 10.9 vs. 5.3 months). Improvements were also observed for objective response rate (ORR) and disease control rate (DCR) (ORR: 64.3 vs. 33.3%; odds ratio [OR] = 5.31, 95% CI 2.47-11.40, p < 0.001; DCR: 92.1 vs. 75.0%; OR = 4.72, 95% CI 1.92-11.58, p < 0.001). Similar results were obtained for patients who received osimertinib as second-line treatment only. A statistically significant improvement in OS was observed for the osimertinib group (HR = 0.412, 95% CI 0.273-0.622, p < 0.0001). Median OS for osimertinib was not reached. In this indirect comparison, osimertinib showed a statistically significant improvement in efficacy outcomes versus platinum-based doublet chemotherapy in patients with EGFRm T790M NSCLC who had progressed after EGFR-TKI therapy.

Cytogenetic Analysis of Chromosome 3 in DROSOPHILA MELANOGASTER: Mapping of the Proximal Portion of the Right Arm

PubMed Central

Duncan, Ian W.; Kaufman, Thomas C.

1975-01-01

In order to define more precisely the most proximal portion of chromosome 3R in Drosophila melanogaster, several new chromosome aberrations involving this region have been recovered and analyzed. These new arrangements were recovered as induced reversions of two dominant mutations, AntpNs and dsxD, located in the region of interest. The results of the analysis have allowed the localization of several existing mutations, have further elucidated the complex homoeotic locus which resides in this region, and have confirmed the efficacy of this type of screen in the analysis of specific chromosome regions. PMID:811500

Tetra-primer ARMS-PCR identifies the novel genetic variations of bovine HNF-4α gene associating with growth traits.

PubMed

Wang, Zi-nian; Li, Mi-jie; Lan, Xian-yong; Li, Ming-xun; Lei, Chu-zhao; Chen, Hong

2014-08-10

Hepatocyte nuclear factor-4α (HNF-4α), a member of the hepatocyte nuclear factor family, plays an important role in regulating the expression of genes involved in the development, differentiation and normal function of liver and pancreatic β cells, as well as the maintenance of glucose homeostasis. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) is a new method offering fast detection and extreme simplicity at a negligible cost for SNP genotyping. In this paper, we characterize the polymorphisms of the bovine HNF-4α gene in three Chinese indigenous cattle breeds (n=660). Six novel SNPs were identified including 1 mutation in the coding region and others in introns. The statistical analyses indicated that 4 SNPs (g.T53729C, g.A53861G, g.A65188C and g.T65444C) affected growth traits markedly (P<0.05) in Qinchuan cattle (2 years after birth). Besides, haplotypes involving these 4 SNP sites in the bovine HNF-4α gene were identified and their effects on growth traits were also analyzed. The results showed that haplotypes 2, 7, 9 and 11 were predominant and accounted for 73.2%, 59.6%, and 67.1% in Qinchuan, Nanyang and Jiaxian cattle breeds, respectively. Hap9 (TAAT) was extremely predominant in all test populations, which suggested that individuals with Hap9 were more adapted to the environment. Furthermore, 4 combined haplotypes were constructed to guarantee the reliability of analysis results in Qinchuan cattle. There were also significant differences in body length (P<0.05). These findings will benefit for the application of DNA marker related to the growth traits on marker-assisted selection (MAS), and improve the performance of beef cattle. Copyright © 2014 Elsevier B.V. All rights reserved.

Nutritional aspects of Noonan syndrome and Noonan-related disorders.

PubMed

da Silva, Fernanda Marchetto; Jorge, Alexander Augusto; Malaquias, Alexandra; da Costa Pereira, Alexandre; Yamamoto, Guilherme Lopes; Kim, Chong Ae; Bertola, Debora

2016-06-01

Rasopathies are a group of rare disorders characterized by neurocardiofaciocutaneous involvement, and caused by mutations in several genes of the RAS/MAPK pathway. In the present study, we characterized growth parameters, body composition, and nutritional aspects of children and adults (n = 62) affected by these disorders, mainly Noonan syndrome, using an indirect method-anthropometry-and a 24-hr recall questionnaire. The growth parameters in our cohort showed short stature, especially in individuals with RAF1 and SHOC2 mutations, lower obesity rates compared to the control population, and BMI scores highest in individuals with BRAF mutations and lowest in individuals with SHOC2. Body composition showed a compromise in the upper arm muscle circumference, with a statistically significant difference in the z-score of triceps skinfold (P = 0.0204) and upper arm fat area (P = 0.0388) between BRAF and SHOC2 groups and in the z-score of triceps skinfold between RAF1 and SHOC2 (P = 0.0218). The pattern of macronutrient consumption was similar to the control population. Our study is the first to address body composition in RASopathy individuals and the data indicate a compromise not only in adipose tissue, but also in muscle mass. Studies using different techniques, such as dual-energy X-ray absorptiometry or imaging studies, which give a more precise delineation of fat and non-fat mass, are required to confirm our results, ultimately causing an impact on management strategies. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

High precision detector robot arm system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shu, Deming; Chu, Yong

A method and high precision robot arm system are provided, for example, for X-ray nanodiffraction with an X-ray nanoprobe. The robot arm system includes duo-vertical-stages and a kinematic linkage system. A two-dimensional (2D) vertical plane ultra-precision robot arm supporting an X-ray detector provides positioning and manipulating of the X-ray detector. A vertical support for the 2D vertical plane robot arm includes spaced apart rails respectively engaging a first bearing structure and a second bearing structure carried by the 2D vertical plane robot arm.

Addition of cetuximab to oxaliplatin-based first-line combination chemotherapy for treatment of advanced colorectal cancer: results of the randomised phase 3 MRC COIN trial

PubMed Central

Maughan, Timothy S; Adams, Richard A; Smith, Christopher G; Meade, Angela M; Seymour, Matthew T; Wilson, Richard H; Idziaszczyk, Shelley; Harris, Rebecca; Fisher, David; Kenny, Sarah L; Kay, Edward; Mitchell, Jenna K; Madi, Ayman; Jasani, Bharat; James, Michelle D; Bridgewater, John; Kennedy, M John; Claes, Bart; Lambrechts, Diether; Kaplan, Richard; Cheadle, Jeremy P

2011-01-01

Summary Background In the Medical Research Council (MRC) COIN trial, the epidermal growth factor receptor (EGFR)-targeted antibody cetuximab was added to standard chemotherapy in first-line treatment of advanced colorectal cancer with the aim of assessing effect on overall survival. Methods In this randomised controlled trial, patients who were fit for but had not received previous chemotherapy for advanced colorectal cancer were randomly assigned to oxaliplatin and fluoropyrimidine chemotherapy (arm A), the same combination plus cetuximab (arm B), or intermittent chemotherapy (arm C). The choice of fluoropyrimidine therapy (capecitabine or infused fluouroracil plus leucovorin) was decided before randomisation. Randomisation was done centrally (via telephone) by the MRC Clinical Trials Unit using minimisation. Treatment allocation was not masked. The comparison of arms A and C is described in a companion paper. Here, we present the comparison of arm A and B, for which the primary outcome was overall survival in patients with KRAS wild-type tumours. Analysis was by intention to treat. Further analyses with respect to NRAS, BRAF, and EGFR status were done. The trial is registered, ISRCTN27286448. Findings 1630 patients were randomly assigned to treatment groups (815 to standard therapy and 815 to addition of cetuximab). Tumour samples from 1316 (81%) patients were used for somatic molecular analyses; 565 (43%) had KRAS mutations. In patients with KRAS wild-type tumours (arm A, n=367; arm B, n=362), overall survival did not differ between treatment groups (median survival 17·9 months [IQR 10·3–29·2] in the control group vs 17·0 months [9·4–30·1] in the cetuximab group; HR 1·04, 95% CI 0·87–1·23, p=0·67). Similarly, there was no effect on progression-free survival (8·6 months [IQR 5·0–12·5] in the control group vs 8·6 months [5·1–13·8] in the cetuximab group; HR 0·96, 0·82–1·12, p=0·60). Overall response rate increased from 57% (n=209) with chemotherapy alone to 64% (n=232) with addition of cetuximab (p=0·049). Grade 3 and higher skin and gastrointestinal toxic effects were increased with cetuximab (14 vs 114 and 67 vs 97 patients in the control group vs the cetuximab group with KRAS wild-type tumours, respectively). Overall survival differs by somatic mutation status irrespective of treatment received: BRAF mutant, 8·8 months (IQR 4·5–27·4); KRAS mutant, 14·4 months (8·5–24·0); all wild-type, 20·1 months (11·5–31·7). Interpretation This trial has not confirmed a benefit of addition of cetuximab to oxaliplatin-based chemotherapy in first-line treatment of patients with advanced colorectal cancer. Cetuximab increases response rate, with no evidence of benefit in progression-free or overall survival in KRAS wild-type patients or even in patients selected by additional mutational analysis of their tumours. The use of cetuximab in combination with oxaliplatin and capecitabine in first-line chemotherapy in patients with widespread metastases cannot be recommended. Funding Cancer Research UK, Cancer Research Wales, UK Medical Research Council, Merck KGgA. PMID:21641636

Cortical Spiking Network Interfaced with Virtual Musculoskeletal Arm and Robotic Arm.

PubMed

Dura-Bernal, Salvador; Zhou, Xianlian; Neymotin, Samuel A; Przekwas, Andrzej; Francis, Joseph T; Lytton, William W

2015-01-01

Embedding computational models in the physical world is a critical step towards constraining their behavior and building practical applications. Here we aim to drive a realistic musculoskeletal arm model using a biomimetic cortical spiking model, and make a robot arm reproduce the same trajectories in real time. Our cortical model consisted of a 3-layered cortex, composed of several hundred spiking model-neurons, which display physiologically realistic dynamics. We interconnected the cortical model to a two-joint musculoskeletal model of a human arm, with realistic anatomical and biomechanical properties. The virtual arm received muscle excitations from the neuronal model, and fed back proprioceptive information, forming a closed-loop system. The cortical model was trained using spike timing-dependent reinforcement learning to drive the virtual arm in a 2D reaching task. Limb position was used to simultaneously control a robot arm using an improved network interface. Virtual arm muscle activations responded to motoneuron firing rates, with virtual arm muscles lengths encoded via population coding in the proprioceptive population. After training, the virtual arm performed reaching movements which were smoother and more realistic than those obtained using a simplistic arm model. This system provided access to both spiking network properties and to arm biophysical properties, including muscle forces. The use of a musculoskeletal virtual arm and the improved control system allowed the robot arm to perform movements which were smoother than those reported in our previous paper using a simplistic arm. This work provides a novel approach consisting of bidirectionally connecting a cortical model to a realistic virtual arm, and using the system output to drive a robotic arm in real time. Our techniques are applicable to the future development of brain neuroprosthetic control systems, and may enable enhanced brain-machine interfaces with the possibility for finer control of limb prosthetics.

The Dynein Gene Family in Chlamydomonas Reinhardtii

PubMed Central

Porter, M. E.; Knott, J. A.; Myster, S. H.; Farlow, S. J.

1996-01-01

To correlate dynein heavy chain (Dhc) genes with flagellar mutations and gain insight into the function of specific dynein isoforms, we placed eight members of the Dhc gene family on the genetic map of Chlamydomonas. Using a PCR-based strategy, we cloned 11 Dhc genes from Chlamydomonas. Comparisons with other Dhc genes indicate that two clones correspond to genes encoding the alpha and beta heavy chains of the outer dynein arm. Alignment of the predicted amino acid sequences spanning the nucleotide binding site indicates that the remaining nine clones can be subdivided into three groups that are likely to include representatives of the inner-arm Dhc isoforms. Gene-specific probes reveal that each clone represents a single-copy gene that is expressed as a transcript of the appropriate size (>13 kb) sufficient to encode a high molecular weight Dhc polypeptide. The expression of all nine genes is upregulated in response to deflagellation, suggesting a role in axoneme assembly or motility. Restriction fragment length polymorphisms between divergent C. reinhardtii strains have been used to place each Dhc gene on the genetic map of Chlamydomonas. These studies lay the groundwork for correlating defects in different Dhc genes with specific flagellar mutations. PMID:8889521

Localization of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and the short arms of acrocentric chromosomes.

PubMed

McDowell, T L; Gibbons, R J; Sutherland, H; O'Rourke, D M; Bickmore, W A; Pombo, A; Turley, H; Gatter, K; Picketts, D J; Buckle, V J; Chapman, L; Rhodes, D; Higgs, D R

1999-11-23

ATRX is a member of the SNF2 family of helicase/ATPases that is thought to regulate gene expression via an effect on chromatin structure and/or function. Mutations in the hATRX gene cause severe syndromal mental retardation associated with alpha-thalassemia. Using indirect immunofluorescence and confocal microscopy we have shown that ATRX protein is associated with pericentromeric heterochromatin during interphase and mitosis. By coimmunofluorescence, ATRX localizes with a mouse homologue of the Drosophila heterochromatic protein HP1 in vivo, consistent with a previous two-hybrid screen identifying this interaction. From the analysis of a trap assay for nuclear proteins, we have shown that the localization of ATRX to heterochromatin is encoded by its N-terminal region, which contains a conserved plant homeodomain-like finger and a coiled-coil domain. In addition to its association with heterochromatin, at metaphase ATRX clearly binds to the short arms of human acrocentric chromosomes, where the arrays of ribosomal DNA are located. The unexpected association of a putative transcriptional regulator with highly repetitive DNA provides a potential explanation for the variability in phenotype of patients with identical mutations in the ATRX gene.

Scalable and Versatile Genome Editing Using Linear DNAs with Microhomology to Cas9 Sites in Caenorhabditis elegans

PubMed Central

Paix, Alexandre; Wang, Yuemeng; Smith, Harold E.; Lee, Chih-Yung S.; Calidas, Deepika; Lu, Tu; Smith, Jarrett; Schmidt, Helen; Krause, Michael W.; Seydoux, Geraldine

2014-01-01

Homology-directed repair (HDR) of double-strand DNA breaks is a promising method for genome editing, but is thought to be less efficient than error-prone nonhomologous end joining in most cell types. We have investigated HDR of double-strand breaks induced by CRISPR-associated protein 9 (Cas9) in Caenorhabditis elegans. We find that HDR is very robust in the C. elegans germline. Linear repair templates with short (∼30–60 bases) homology arms support the integration of base and gene-sized edits with high efficiency, bypassing the need for selection. Based on these findings, we developed a systematic method to mutate, tag, or delete any gene in the C. elegans genome without the use of co-integrated markers or long homology arms. We generated 23 unique edits at 11 genes, including premature stops, whole-gene deletions, and protein fusions to antigenic peptides and GFP. Whole-genome sequencing of five edited strains revealed the presence of passenger variants, but no mutations at predicted off-target sites. The method is scalable for multi-gene editing projects and could be applied to other animals with an accessible germline. PMID:25249454

Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells.

PubMed

Byrne, Susan M; Ortiz, Luis; Mali, Prashant; Aach, John; Church, George M

2015-02-18

Sequence-specific nucleases such as TALEN and the CRISPR/Cas9 system have so far been used to disrupt, correct or insert transgenes at precise locations in mammalian genomes. We demonstrate efficient 'knock-in' targeted replacement of multi-kilobase genes in human induced pluripotent stem cells (iPSC). Using a model system replacing endogenous human genes with their mouse counterpart, we performed a comprehensive study of targeting vector design parameters for homologous recombination. A 2.7 kilobase (kb) homozygous gene replacement was achieved in up to 11% of iPSC without selection. The optimal homology arm length was around 2 kb, with homology length being especially critical on the arm not adjacent to the cut site. Homologous sequence inside the cut sites was detrimental to targeting efficiency, consistent with a synthesis-dependent strand annealing (SDSA) mechanism. Using two nuclease sites, we observed a high degree of gene excisions and inversions, which sometimes occurred more frequently than indel mutations. While homozygous deletions of 86 kb were achieved with up to 8% frequency, deletion frequencies were not solely a function of nuclease activity and deletion size. Our results analyzing the optimal parameters for targeting vector design will inform future gene targeting efforts involving multi-kilobase gene segments, particularly in human iPSC. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Dual redundant arm system operational quality measures and their applications - Static measures

NASA Technical Reports Server (NTRS)

Lee, Sukhan; Kim, Sungbok

1990-01-01

The authors present dual-arm system static operational quality measures which quantify the efficiency and capability of a dual-arm system in generating Cartesian velocities and static forces. First, they define and analyze the kinematic interactions between the two arms incurred by the various modes of dual-arm cooperation, such as transport, assembly, and grasping modes of cooperation, and specify the kinematic constraints imposed on individual arms in Cartesian space due to the kinematic interactions. Dual-arm static manipulability is presented. Finally, dual-arm operational quality is scaled by a task-oriented operational quality measure (TOQs) obtained by the comparison between the desired and actual static manipulabilities. TOQs is used in the optimization of dual-arm joint configurations. Simulation results are shown.

Evolution of robotic arms.

PubMed

Moran, Michael E

2007-01-01

The foundation of surgical robotics is in the development of the robotic arm. This is a thorough review of the literature on the nature and development of this device with emphasis on surgical applications. We have reviewed the published literature and classified robotic arms by their application: show, industrial application, medical application, etc. There is a definite trend in the manufacture of robotic arms toward more dextrous devices, more degrees-of-freedom, and capabilities beyond the human arm. da Vinci designed the first sophisticated robotic arm in 1495 with four degrees-of-freedom and an analog on-board controller supplying power and programmability. von Kemplen's chess-playing automaton left arm was quite sophisticated. Unimate introduced the first industrial robotic arm in 1961, it has subsequently evolved into the PUMA arm. In 1963 the Rancho arm was designed; Minsky's Tentacle arm appeared in 1968, Scheinman's Stanford arm in 1969, and MIT's Silver arm in 1974. Aird became the first cyborg human with a robotic arm in 1993. In 2000 Miguel Nicolalis redefined possible man-machine capacity in his work on cerebral implantation in owl-monkeys directly interfacing with robotic arms both locally and at a distance. The robotic arm is the end-effector of robotic systems and currently is the hallmark feature of the da Vinci Surgical System making its entrance into surgical application. But, despite the potential advantages of this computer-controlled master-slave system, robotic arms have definite limitations. Ongoing work in robotics has many potential solutions to the drawbacks of current robotic surgical systems.

Primary reaction control system/remote manipulator system interaction with loaded arm. Space shuttle engineering and operations support

NASA Technical Reports Server (NTRS)

Taylor, E. C.; Davis, J. D.

1978-01-01

A study of the interaction between the orbiter primary reaction control system (PRCS) and the remote manipulator system (RMS) with a loaded arm is documented. This analysis was performed with the Payload Deployment and Retrieval Systems Simulation (PDRSS) program with the passive arm bending option. The passive-arm model simulates the arm as massless elastic links with locked joints. The study was divided into two parts. The first part was the evaluation of the response of the arm to step inputs (i.e. constant jet torques) about each of the orbiter body axes. The second part of the study was the evaluation of the response of the arm to minimum impulse primary RCS jet firings with both single pulse and pulse train inputs.

Birefringence insensitive optical coherence domain reflectometry system

DOEpatents

Everett, Matthew J.; Davis, Joseph G.

2002-01-01

A birefringence insensitive fiber optic optical coherence domain reflectometry (OCDR) system is provided containing non-polarization maintaining (non-PM) fiber in the sample arm and the reference arm without suffering from signal degradation caused by birefringence. The use of non-PM fiber significantly reduces the cost of the OCDR system and provides a disposable or multiplexed section of the sample arm. The dispersion in the reference arm and sample arm of the OCDR system are matched to achieve high resolution imaging. This system is useful in medical applications or for non-medical in situ probes. The disposable section of non-PM fiber in the sample arm can be conveniently replaced when contaminated by a sample or a patient.

Distribution and Coexistence of Myoclonus and Dystonia as Clinical Predictors of SGCE Mutation Status: A Pilot Study.

PubMed

Zutt, Rodi; Dijk, Joke M; Peall, Kathryn J; Speelman, Hans; Dreissen, Yasmine E M; Contarino, Maria Fiorella; Tijssen, Marina A J

2016-01-01

Myoclonus-dystonia (M-D) is a young onset movement disorder typically involving myoclonus and dystonia of the upper body. A proportion of the cases are caused by mutations to the autosomal dominantly inherited, maternally imprinted, epsilon-sarcoglycan gene (SGCE). Despite several sets of diagnostic criteria, identification of patients most likely to have an SGCE mutation remains difficult. Forty consecutive patients meeting pre-existing diagnostic clinical criteria for M-D underwent a standardized clinical examination (20 SGCE mutation positive and 20 negative). Each video was reviewed and systematically scored by two assessors blinded to mutation status. In addition, the presence and coexistence of myoclonus and dystonia was recorded in four body regions (neck, arms, legs, and trunk) at rest and with action. Thirty-nine patients were included in the study (one case was excluded owing to insufficient video footage). Based on previously proposed diagnostic criteria, patients were subdivided into 24 "definite," 5 "probable," and 10 "possible" M-D. Motor symptom severity was higher in the SGCE mutation-negative group. Myoclonus and dystonia were most commonly observed in the neck and upper limbs of both groups. Truncal dystonia with action was significantly seen more in the mutation-negative group (p < 0.05). Coexistence of myoclonus and dystonia in the same body part with action was more commonly seen in the mutation-negative cohort (p < 0.05). Truncal action dystonia and coexistence of myoclonus and dystonia in the same body part with action might suggest the presence of an alternative mutation in patients with M-D.

An MR-compatible gyroscope-based arm movement tracking system.

PubMed

Shirinbayan, S Iman; Rieger, Jochem W

2017-03-15

Functional magnetic resonance imaging is well suited to link neural population activation with movement parameters of complex natural arm movements. However, currently existing MR-compatible arm tracking devices are not constructed to measure arm joint movement parameters of unrestricted movements. Therefore, to date most research focuses on simple arm movements or includes very little knowledge about the actual movement kinematics. We developed a low cost gyroscope-based arm movement tracking system (GAMTS) that features MR-compatibility. The system consists of dual-axis analogue gyroscopes that measure rotations of upper and lower arm joints. After MR artifact reduction, the rotation angles of the individual arm joints are calculated and used to animate a realistic arm model that is implemented in the OpenSim platform. The OpenSim platform can then provide the kinematics of any point on the arm model. In order to demonstrate the capabilities of the system, we first assessed the quality of reconstructed wrist movements in a low-noise environment where typical MR-related problems are absent and finally, we validated the reconstruction in the MR environment. The system provides the kinematics of the whole arm when natural unrestricted arm movements are performed inside the MR-scanner. The GAMTS is reliably capable of reconstructing the kinematics of trajectories and the reconstruction error is small in comparison with the movement induced variation of speed, displacement, and rotation. Moreover, the system can be used to probe brain areas for their correlation with movement kinematics. Copyright © 2017 Elsevier B.V. All rights reserved.

The Frequency of MEFV Gene Mutations and Genotypes in Sanliurfa Province, South-Eastern Region of Turkey, after the Syrian Civil War by Using Next Generation Sequencing and Report of a Novel Exon 4 Mutation (I423T).

PubMed

Gumus, Evren

2018-05-07

Familial Mediterranean Fever (FMF) is a genetic disorder characterized by recurrent episodes of fever and abdominal pain. Mutations in the Mediterranean fever (MEFV) gene are localized on the p arm of chromosome 16. Over 333 MEFV sequence variants have been identified so far in FMF patients, which occur mostly in the 2nd and 10th exons of the gene. In this study, 296 unrelated patients with clinical suspicion of FMF, which were admitted during January⁻December 2017, were retrospectively reviewed to identify the frequency of MEFV gene mutations by using next generation sequencing. Eighteen different mutations, 45 different genotypes and a novel exon 4 (I423T) mutation were identified in this study. This mutation is the fourth mutation identified in exon 4.The most frequent mutation was R202Q, followed by M694V, E148Q, M680I, R761H, V726A and R354W. One of the most important aims of this study is to investigate the MEFV mutation type and genotype of migrants coming to Sanliurfa after the civil war of Syria. This study also examines the effect of the condition on the region’s gene pool and the distribution of different types of mutations. Our results indicated that MEFV mutations are highly heterogeneous in our patient population, which is consistent with the findings of other studies in our region. Previously used methods, such as Restriction Fragment Length Polymorphism (RFLP), do not define uncommon or especially novel mutations. Therefore, Next Generation Sequencing (NGS) analysis of the MEFV gene could be useful for finding novel mutations, except for those located on exon 2 and 10.

TP53 mutation and survival in aggressive B cell lymphoma.

PubMed

Zenz, Thorsten; Kreuz, Markus; Fuge, Maxi; Klapper, Wolfram; Horn, Heike; Staiger, Annette M; Winter, Doris; Helfrich, Hanne; Huellein, Jennifer; Hansmann, Martin-Leo; Stein, Harald; Feller, Alfred; Möller, Peter; Schmitz, Norbert; Trümper, Lorenz; Loeffler, Markus; Siebert, Reiner; Rosenwald, Andreas; Ott, German; Pfreundschuh, Michael; Stilgenbauer, Stephan

2017-10-01

TP53 is mutated in 20-25% of aggressive B-cell lymphoma (B-NHL). To date, no studies have addressed the impact of TP53 mutations in prospective clinical trial cohorts. To evaluate the impact of TP53 mutation to current risk models in aggressive B-NHL, we investigated TP53 gene mutations within the RICOVER-60 trial. Of 1,222 elderly patients (aged 61-80 years) enrolled in the study and randomized to six or eight cycles of CHOP-14 with or without Rituximab (NCT00052936), 265 patients were analyzed for TP53 mutations. TP53 mutations were demonstrated in 63 of 265 patients (23.8%). TP53 mutation was associated with higher LDH (65% vs. 37%; p < 0.001), higher international prognostic index-Scores (IPI 4/5 27% vs. 12%; p = 0.025) and B-symptoms (41% vs. 24%; p = 0.011). Patients with TP53 mutation were less likely to obtain a complete remission CR/CRu (CR unconfirmed) 61.9% (mut) vs. 79.7% (wt) (p = 0.007). TP53 mutations were associated with decreased event-free (EFS), progression-free (PFS) and overall survival (OS) (median observation time of 40.2 months): the 3 year EFS, PFS and OS were 42% (vs. 60%; p = 0.012), 42% (vs. 67.5%; p < 0.001) and 50% (vs. 76%; p < 0.001) for the TP53 mutation group. In a Cox proportional hazard analysis adjusting for IPI-factors and treatment arms, TP53 mutation was shown to be an independent predictor of EFS (HR 1.5), PFS (HR 2.0) and OS (HR 2.3; p < 0.001). TP53 mutations are independent predictors of survival in untreated patients with aggressive CD20+ lymphoma. TP53 mutations should be considered for risk models in DLBCL and strategies to improve outcome for patients with mutant TP53 must be developed. © 2017 UICC.

Robust coordinated control of a dual-arm space robot

NASA Astrophysics Data System (ADS)

Shi, Lingling; Kayastha, Sharmila; Katupitiya, Jay

2017-09-01

Dual-arm space robots are more capable of implementing complex space tasks compared with single arm space robots. However, the dynamic coupling between the arms and the base will have a serious impact on the spacecraft attitude and the hand motion of each arm. Instead of considering one arm as the mission arm and the other as the balance arm, in this work two arms of the space robot perform as mission arms aimed at accomplishing secure capture of a floating target. The paper investigates coordinated control of the base's attitude and the arms' motion in the task space in the presence of system uncertainties. Two types of controllers, i.e. a Sliding Mode Controller (SMC) and a nonlinear Model Predictive Controller (MPC) are verified and compared with a conventional Computed-Torque Controller (CTC) through numerical simulations in terms of control accuracy and system robustness. Both controllers eliminate the need to linearly parameterize the dynamic equations. The MPC has been shown to achieve performance with higher accuracy than CTC and SMC in the absence of system uncertainties under the condition that they consume comparable energy. When the system uncertainties are included, SMC and CTC present advantageous robustness than MPC. Specifically, in a case where system inertia increases, SMC delivers higher accuracy than CTC and costs the least amount of energy.

Association of the type of 5q loss with complex karyotype, clonal evolution, TP53 mutation status, and prognosis in acute myeloid leukemia and myelodysplastic syndrome.

PubMed

Volkert, Sarah; Kohlmann, Alexander; Schnittger, Susanne; Kern, Wolfgang; Haferlach, Torsten; Haferlach, Claudia

2014-05-01

We analyzed 1,200 patients with acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS) harboring a 5q deletion in order to clarify whether the type of 5q loss is associated with other biological markers and prognosis. We investigated all patients by chromosome banding analysis, FISH with a probe for EGR1 (5q31) and, if necessary, to resolve complex karyotypes with 24-color-FISH. Moreover, 420 patients were analyzed for mutations in the TP53 gene. The patient cohort was subdivided based on type of 5q loss: Patients with interstitial deletions and patients with 5q loss due to unbalanced rearrangements or monosomy 5. Loss of the long arm of chromosome 5 due to an unbalanced rearrangement occurred more often in AML (286/627; 45.6%) than MDS (188/573; 32.8%; P < 0.001). In both entities, patients with 5q loss due to unbalanced translocations showed complex karyotypes more frequently (MDS: 179/188; 95.2% vs. 124/385; 32.2%; P < 0.001; AML: 274/286; 95.8% vs. 256/341; 75.1%; P < 0.001). Moreover, in MDS unbalanced 5q translocations were associated with clonal evolution (109/188; 58.0% vs. 124/385; 32.2%; P < 0.001), mutation of TP53 (64/67; 95.5% vs. 40/120; 40.0%; P < 0.001), and shorter survival (15.3 months vs. not reached; P < 0.001). In MDS, complex karyotype was an independent adverse prognostic factor (HR = 5.34; P = 0.032), whereas in AML presence of TP53 mutations was the strongest adverse prognostic factor (HR = 2.21; P = 0.026). In conclusion, in AML and MDS, loss of the long arm of chromosome 5 due to unbalanced translocations is associated with complex karyotype and in MDS, moreover, with clonal evolution, mutations in the TP53 gene and adverse prognosis. Copyright © 2014 Wiley Periodicals, Inc.

Paternal uniparental heterodisomy with partial isodisomy of chromosome 1 in a patient with retinitis pigmentosa without hearing loss and a missense mutation in the Usher syndrome type II gene USH2A.

PubMed

Rivolta, Carlo; Berson, Eliot L; Dryja, Thaddeus P

2002-11-01

To evaluate a form of nonmendelian inheritance in a patient with retinitis pigmentosa (RP). Direct DNA sequencing of the USH2A coding region and microsatellite analysis of polymorphic markers from chromosome 1 and other chromosomes. A patient with RP without hearing loss caused by the homozygous mutation Cys759Phe in the USH2A gene on chromosome 1q was found to be the daughter of a noncarrier mother and a father who was heterozygous for this change. Further evaluation with microsatellite markers revealed that the patient had inherited 2 copies of chromosome 1 from her father and none from her mother. The paternally derived chromosome 1's were heteroallelic from the centromere of chromosome 1 to the proximal short and long arms. The distal regions of the short and long arms of chromosome 1 were homoallelic, including the region of 1q with the mutant USH2A allele. This genetic pattern is compatible with a phenomenon of uniparental primary heterodisomy with regions of homozygosity arising through a nondisjunction event during paternal meiosis I and subsequent trisomy rescue or gamete complementation. A paternal second cousin of the patient also had RP and also had an identical heterozygous mutation in the USH2A gene in the same codon. However, the analysis of an isocoding polymorphism 20 base pairs away and closely linked microsatellite markers in the patient and family members indicated that the 2 mutant alleles are unlikely to be identical by descent and that the 2 relatives fortuitously had RP and a mutation in the same codon of the USH2A gene. This family illustrates that recessive RP without hearing loss can rarely be inherited from only 1 unaffected carrier parent in a nonmendelian manner. The genetic counseling of families with recessively inherited eye diseases must take into consideration the possibility that an unaffected heterozygous carrier can have an affected offspring homozygous for the same mutation, even if the carrier's spouse has wild-type alleles at the disease locus.

Cortical Spiking Network Interfaced with Virtual Musculoskeletal Arm and Robotic Arm

PubMed Central

Dura-Bernal, Salvador; Zhou, Xianlian; Neymotin, Samuel A.; Przekwas, Andrzej; Francis, Joseph T.; Lytton, William W.

2015-01-01

Embedding computational models in the physical world is a critical step towards constraining their behavior and building practical applications. Here we aim to drive a realistic musculoskeletal arm model using a biomimetic cortical spiking model, and make a robot arm reproduce the same trajectories in real time. Our cortical model consisted of a 3-layered cortex, composed of several hundred spiking model-neurons, which display physiologically realistic dynamics. We interconnected the cortical model to a two-joint musculoskeletal model of a human arm, with realistic anatomical and biomechanical properties. The virtual arm received muscle excitations from the neuronal model, and fed back proprioceptive information, forming a closed-loop system. The cortical model was trained using spike timing-dependent reinforcement learning to drive the virtual arm in a 2D reaching task. Limb position was used to simultaneously control a robot arm using an improved network interface. Virtual arm muscle activations responded to motoneuron firing rates, with virtual arm muscles lengths encoded via population coding in the proprioceptive population. After training, the virtual arm performed reaching movements which were smoother and more realistic than those obtained using a simplistic arm model. This system provided access to both spiking network properties and to arm biophysical properties, including muscle forces. The use of a musculoskeletal virtual arm and the improved control system allowed the robot arm to perform movements which were smoother than those reported in our previous paper using a simplistic arm. This work provides a novel approach consisting of bidirectionally connecting a cortical model to a realistic virtual arm, and using the system output to drive a robotic arm in real time. Our techniques are applicable to the future development of brain neuroprosthetic control systems, and may enable enhanced brain-machine interfaces with the possibility for finer control of limb prosthetics. PMID:26635598

Cloning and Characterization of a Critical Regulator for Preharvest Sprouting in Wheat

PubMed Central

Liu, Shubing; Sehgal, Sunish K.; Li, Jiarui; Lin, Meng; Trick, Harold N.; Yu, Jianming; Gill, Bikram S.; Bai, Guihua

2013-01-01

Sprouting of grains in mature spikes before harvest is a major problem in wheat (Triticum aestivum) production worldwide. We cloned and characterized a gene underlying a wheat quantitative trait locus (QTL) on the short arm of chromosome 3A for preharvest sprouting (PHS) resistance in white wheat using comparative mapping and map-based cloning. This gene, designated TaPHS1, is a wheat homolog of a MOTHER OF FLOWERING TIME (TaMFT)-like gene. RNA interference-mediated knockdown of the gene confirmed that TaPHS1 positively regulates PHS resistance. We discovered two causal mutations in TaPHS1 that jointly altered PHS resistance in wheat. One GT-to-AT mutation generates a mis-splicing site, and the other A-to-T mutation creates a premature stop codon that results in a truncated nonfunctional transcript. Association analysis of a set of wheat cultivars validated the role of the two mutations on PHS resistance. The molecular characterization of TaPHS1 is significant for expediting breeding for PHS resistance to protect grain yield and quality in wheat production. PMID:23821595

A novel mutation in PNPLA2 causes neutral lipid storage disease with myopathy and triglyceride deposit cardiomyovasculopathy: a case report and literature review.

PubMed

Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi

2014-07-01

Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.

[Mechanism of mutant induction in the ade2 gene of diploid Saccharomyces cerevisiae yeasts by ultraviolet rays].

PubMed

Gordenin, D A; Inge-Vechtomov, S G

1981-01-01

Ultraviolet light (UV) at 3000 ergs/mm-2 induces ade2 mutants with a frequency about 10(-4) in wild-type haploid strains of yeast and about 10(-5) in diploid wild-type strains. UV irradiation effectively induced mitotic segregation of ade2 in the heterozygous diploid (the frequency of segregation is 6%). Interallelic complementation and localization spectra are similar for mutations induced both in haploids and diploids. The occurrence of ade2 mutants in diploids correlated with mitotic segregation of the marker his8 which is situated in the same arm of XY chromosome as ade2 is, distal to the centromere. Our data about the frequency of ade2 mutants in diploids and haploids, the frequency of ade2 mitotic segregation, mitotic segregation of other markers and genetic characteristics of ade2 mutations confirm the suggestion that the major mechanism of diploid ade2 mutants appearance is mutation in one of the two ADE2 alleles and consequent mitotic homozygotisation of mutation as a result of mitotic crossingover between ade2 and the centromere.

Tumors in von Hippel-Lindau Syndrome: From Head to Toe-Comprehensive State-of-the-Art Review.

PubMed

Ganeshan, Dhakshinamoorthy; Menias, Christine O; Pickhardt, Perry J; Sandrasegaran, Kumaresan; Lubner, Meghan G; Ramalingam, Preetha; Bhalla, Sanjeev

2018-01-01

Von Hippel-Lindau syndrome (VHL) is an autosomal-dominant hereditary tumor disease that arises owing to germline mutations in the VHL gene, located on the short arm of chromosome 3. Patients with VHL may develop multiple benign and malignant tumors involving various organ systems, including retinal hemangioblastomas (HBs), central nervous system (CNS) HBs, endolymphatic sac tumors, pancreatic neuroendocrine tumors, pancreatic cystadenomas, pancreatic cysts, clear cell renal cell carcinomas, renal cysts, pheochromocytomas, paragangliomas, and epididymal and broad ligament cystadenomas. The VHL/hypoxia-inducible factor pathway is believed to play a key role in the pathogenesis of VHL-related tumors. The diagnosis of VHL can be made clinically when the characteristic clinical history and findings have manifested, such as the presence of two or more CNS HBs. Genetic testing for heterozygous germline VHL mutation may also be used to confirm the diagnosis of VHL. Imaging plays an important role in the diagnosis and surveillance of patients with VHL. Familiarity with the clinical and imaging manifestations of the various VHL-related tumors is important for early detection and guiding appropriate management. The purpose of this article is to discuss the molecular cytogenetics and clinical manifestations of VHL, review the characteristic multimodality imaging features of the various VHL-related tumors affecting multiple organ systems, and discuss the latest advances in management of VHL, including current recommendations for surveillance and screening. © RSNA, 2018 An earlier incorrect version of this article appeared online. This article was corrected on April 9, 2018.

Specific Armadillo Repeat Sequences Facilitate β-Catenin Nuclear Transport in Live Cells via Direct Binding to Nucleoporins Nup62, Nup153, and RanBP2/Nup358*

PubMed Central

Sharma, Manisha; Jamieson, Cara; Johnson, Michael; Molloy, Mark P.; Henderson, Beric R.

2012-01-01

β-Catenin transduces the Wnt signal from the membrane to nucleus, and certain gene mutations trigger its nuclear accumulation leading to cell transformation and cancer. β-Catenin shuttles between the nucleus and cytoplasm independent of classical Ran/transport receptor pathways, and this movement was previously hypothesized to involve the central Armadillo (Arm) domain. Fluorescence recovery after photobleaching (FRAP) assays were used to delineate functional transport regions of the Arm domain in living cells. The strongest nuclear import/export activity was mapped to Arm repeats R10–12 using both in vivo FRAP and in vitro export assays. By comparison, Arm repeats R3–8 of β-catenin were highly active for nuclear import but displayed a comparatively weak export activity. We show for the first time using purified components that specific Arm sequences of β-catenin interact directly in vitro with the FG repeats of the nuclear pore complex (NPC) components Nup62, Nup98, and Nup153, indicating an independent ability of β-catenin to traverse the NPC. Moreover, a proteomics screen identified RanBP2/Nup358 as a binding partner of Arm R10–12, and β-catenin was confirmed to interact with endogenous and ectopic forms of Nup358. We further demonstrate that knock-down of endogenous Nup358 and Nup62 impeded the rate of nuclear import/export of β-catenin to a greater extent than that of importin-β. The Arm R10–12 sequence facilitated transport even when β-catenin was bound to the Arm-binding partner LEF-1, and its activity was stimulated by phosphorylation at Tyr-654. These findings provide functional evidence that the Arm domain contributes to regulated β-catenin transport through direct interaction with the NPC. PMID:22110128

Plastome-wide comparison reveals new SNV resources for the authentication of Dendrobium huoshanense and its corresponding medicinal slice (Huoshan Fengdou).

PubMed

Niu, Zhitao; Pan, Jiajia; Xue, Qingyun; Zhu, Shuying; Liu, Wei; Ding, Xiaoyu

2018-05-01

Dendrobium species and their corresponding medicinal slices have been extensively used as traditional Chinese medicine (TCM) in many Asian countries. However, it is extremely difficult to identify Dendrobium species based on their morphological and chemical features. In this study, the plastomes of D. huoshanense were used as a model system to investigate the hypothesis that plastomic mutational hotspot regions could provide a useful single nucleotide variants (SNVs) resource for authentication studies. We surveyed the plastomes of 17 Dendrobium species, including the newly sequenced plastome of D. huoshanense . A total of 19 SNVs that could be used for the authentication of D. huoshanense were detected. On the basis of this comprehensive comparison, we identified the four most informative hotspot regions in the Dendrobium plastome that encompass ccsA to ndhF , matK to 3'trnG , rpoB to psbD, and trnT to rbcL . Furthermore, to established a simple and accurate method for the authentication of D. huoshanense and its medicinal slices, a total of 127 samples from 20 Dendrobium species including their corresponding medicinal slices (Fengdous) were used in this study. Our results suggest that D. huoshanense and its medicinal slices can be rapidly and unequivocally identified using this method that combines real-time PCR with the amplification refractory mutation system (ARMS).

Genetic interrelations in the actinomycin biosynthetic gene clusters of Streptomyces antibioticus IMRU 3720 and Streptomyces chrysomallus ATCC11523, producers of actinomycin X and actinomycin C

PubMed Central

Crnovčić, Ivana; Rückert, Christian; Semsary, Siamak; Lang, Manuel; Kalinowski, Jörn; Keller, Ullrich

2017-01-01

Sequencing the actinomycin (acm) biosynthetic gene cluster of Streptomyces antibioticus IMRU 3720, which produces actinomycin X (Acm X), revealed 20 genes organized into a highly similar framework as in the bi-armed acm C biosynthetic gene cluster of Streptomyces chrysomallus but without an attached additional extra arm of orthologues as in the latter. Curiously, the extra arm of the S. chrysomallus gene cluster turned out to perfectly match the single arm of the S. antibioticus gene cluster in the same order of orthologues including the the presence of two pseudogenes, scacmM and scacmN, encoding a cytochrome P450 and its ferredoxin, respectively. Orthologues of the latter genes were both missing in the principal arm of the S. chrysomallus acm C gene cluster. All orthologues of the extra arm showed a G +C-contents different from that of their counterparts in the principal arm. Moreover, the similarities of translation products from the extra arm were all higher to the corresponding translation products of orthologue genes from the S. antibioticus acm X gene cluster than to those encoded by the principal arm of their own gene cluster. This suggests that the duplicated structure of the S. chrysomallus acm C biosynthetic gene cluster evolved from previous fusion between two one-armed acm gene clusters each from a different genetic background. However, while scacmM and scacmN in the extra arm of the S. chrysomallus acm C gene cluster are mutated and therefore are non-functional, their orthologues saacmM and saacmN in the S. antibioticus acm C gene cluster show no defects seemingly encoding active enzymes with functions specific for Acm X biosynthesis. Both acm biosynthetic gene clusters lack a kynurenine-3-monooxygenase gene necessary for biosynthesis of 3-hydroxy-4-methylanthranilic acid, the building block of the Acm chromophore, which suggests participation of a genome-encoded relevant monooxygenase during Acm biosynthesis in both S. chrysomallus and S. antibioticus. PMID:28435299

Genetic interrelations in the actinomycin biosynthetic gene clusters of Streptomyces antibioticus IMRU 3720 and Streptomyces chrysomallus ATCC11523, producers of actinomycin X and actinomycin C.

PubMed

Crnovčić, Ivana; Rückert, Christian; Semsary, Siamak; Lang, Manuel; Kalinowski, Jörn; Keller, Ullrich

2017-01-01

Sequencing the actinomycin ( acm ) biosynthetic gene cluster of Streptomyces antibioticus IMRU 3720, which produces actinomycin X (Acm X), revealed 20 genes organized into a highly similar framework as in the bi-armed acm C biosynthetic gene cluster of Streptomyces chrysomallus but without an attached additional extra arm of orthologues as in the latter. Curiously, the extra arm of the S. chrysomallus gene cluster turned out to perfectly match the single arm of the S. antibioticus gene cluster in the same order of orthologues including the the presence of two pseudogenes, scacmM and scacmN , encoding a cytochrome P450 and its ferredoxin, respectively. Orthologues of the latter genes were both missing in the principal arm of the S. chrysomallus acm C gene cluster. All orthologues of the extra arm showed a G +C-contents different from that of their counterparts in the principal arm. Moreover, the similarities of translation products from the extra arm were all higher to the corresponding translation products of orthologue genes from the S. antibioticus acm X gene cluster than to those encoded by the principal arm of their own gene cluster. This suggests that the duplicated structure of the S. chrysomallus acm C biosynthetic gene cluster evolved from previous fusion between two one-armed acm gene clusters each from a different genetic background. However, while scacmM and scacmN in the extra arm of the S. chrysomallus acm C gene cluster are mutated and therefore are non-functional, their orthologues saacmM and saacmN in the S. antibioticus acm C gene cluster show no defects seemingly encoding active enzymes with functions specific for Acm X biosynthesis. Both acm biosynthetic gene clusters lack a kynurenine-3-monooxygenase gene necessary for biosynthesis of 3-hydroxy-4-methylanthranilic acid, the building block of the Acm chromophore, which suggests participation of a genome-encoded relevant monooxygenase during Acm biosynthesis in both S. chrysomallus and S. antibioticus .

P06.19 TERT promoter mutation is an independent prognostic factor in 1p/19q co-deleted oligodendrogliomas: a POLA network study

PubMed Central

Alentorn, A.; Carpentier, C.; Labreche, K.; Ducray, F.; Dehais, C.; Mokhtari, K.; Uro-Coste, E.; Figarella-Branger, D.; Delattre, J.; Idbaih, A.

2016-01-01

Abstract Background: Overall, gliomas harboring 1p19q co-deletion (oligodendrogliomas in the future WHO classification) have better prognosis and better response to treatments compared to their non 1p/19q co-deleted counterparts. However, some of these tumors have disconcerting poor outcome. We have recently shown that chromosome arm 9p loss of heterozygosity (9pLOH) participates to identify some but not all oligodendrogliomas with an aggressive clinical behavior. In parallel, TERT promoter (TERTp) mutations have been recently described as the most frequent mutations in oligodendrogliomas. Objectives: We sought to study the potential clinical significance of TERTp mutational status in oligodendrogliomas. Material and methods: 224 anaplastic oligodendrogliomas (AO) from the POLA network, were included in the present study. TERT mutational status was obtained using Sanger sequencing and SNP-array. 121 lower grade gliomas exhibiting 1p/19q co-deletion, from the TCGA dataset, were used as the validation cohort. In this latter series, level of TERT expression, obtained by RNA-sequencing, was used as a surrogate marker of TERTp mutation. 1p/19q co-deletion was defined as loss of whole-chromosome arms 1p and 19q using allelic-specific copy number analysis. Overall survivals (OS) were compared using log-rank test in univariate analysis. All covariates with p-value < 0.2 were included in a Cox’s proportional hazard ratio model for multivariate analysis. Statistical tests were two-sided and p-values < 0.05 were interpreted as statistically significant. Results: TERTp was wild-type (wt) in 14/224 AO (6.25%) in POLA cohort and in 8/121 (6.6%) in TCGA dataset. TERTp wt is associated with poor OS in univariate analysis in POLA and TCGA cohorts (p=0.032 and p=0.035, respectively). Interestingly, after adjusting for allelic 9p LOH, age (<50 vs. ≥ 50 years), treatment (chemotherapy and radiotherapy versus other treatments) and WHO grade (II vs III), TERTp mutation was an independent favorable prognostic factor in the POLA cohort (p=0.037, HR=3.7 (1.1–13)) and in the TCGA dataset (p=0.01, HR=9.8 (1.6–60)). Conclusion: This study identifies TERTp mutation as a novel independent prognostic biomarker in oligodendrogliomas toward a better stratification of this tumor type. Acknowledgements: The results shown here are in whole or part based upon data generated by the TCGA Research Network: http://cancergenome.nih.gov/. La Ligue Nationale Contre La Cancer. The Institut Universitaire de Cancérologie (IUC). The program Investissements d’avenir” ANR-10-IAIHU-06. POLA network is supported by Institut National du Cancer.

FDA Benefit‐Risk Assessment of Osimertinib for the Treatment of Metastatic Non‐Small Cell Lung Cancer Harboring Epidermal Growth Factor Receptor T790M Mutation

PubMed Central

Odogwu, Lauretta; Mathieu, Luckson; Goldberg, Kirsten B.; Blumenthal, Gideon M.; Larkins, Erin; Fiero, Mallorie H.; Rodriguez, Lisa; Bijwaard, Karen; Lee, Eunice Y.; Philip, Reena; Fan, Ingrid; Donoghue, Martha; Keegan, Patricia; McKee, Amy; Pazdur, Richard

2017-01-01

Abstract On March 30, 2017, the U.S. Food and Drug Administration (FDA) approved osimertinib for the treatment of patients with metastatic, epidermal growth factor receptor (EGFR) T790M mutation‐positive, non‐small cell lung cancer (NSCLC), as detected by an FDA‐approved test, whose disease has progressed following EGFR tyrosine kinase inhibitor (TKI) therapy. Approval was based on demonstration of a statistically significant difference in the primary endpoint of progression‐free survival (PFS) when comparing osimertinib with chemotherapy in an international, multicenter, open‐label, randomized trial (AURA3). In this confirmatory trial, which enrolled 419 patients, the PFS hazard ratio for osimertinib compared with chemotherapy per investigator assessment was 0.30 (95% confidence interval 0.23–0.41), p < .001, with median PFS of 10.1 months in the osimertinib arm and 4.4 months in the chemotherapy arm. Supportive efficacy data included PFS per blinded independent review committee demonstrating similar PFS results and an improved confirmed objective response rate per investigator assessment of 65% and 29%, with estimated median durations of response of 11.0 months and 4.2 months, in the osimertinib and chemotherapy arms, respectively. Patients received osimertinib 80 mg once daily and had a median duration of exposure of 8 months. The toxicity profile of osimertinib compared favorably with the profile of other approved EGFR TKIs and chemotherapy. The most common adverse drug reactions (>20%) in patients treated with osimertinib were diarrhea, rash, dry skin, nail toxicity, and fatigue. Herein, we review the benefit‐risk assessment of osimertinib that led to regular approval, for patients with metastatic NSCLC harboring EGFR TKI whose disease has progressed on or after EGFR TKI therapy. Implications for Practice. Osimertinib administered to metastatic non‐small cell lung cancer (NSCLC) patients harboring an EGFR T790M mutation, who have progressed on or following EGFR TKI therapy, demonstrated a substantial improvement over platinum‐based doublet chemotherapy as well as durable intracranial responses. The ability to test for the T790M mutation in plasma using the FDA‐approved cobas EGFR Mutation Test v2 (Roche, Basel, Switzerland) identifies patients with NSCLC tumors not amenable to biopsy. Since a 40% false‐negative rate has been observed with the circulating tumor DNA test, re‐evaluation of the feasibility of tissue biopsy is recommended to identify patients with a false‐negative plasma test result who may benefit from osimertinib. PMID:29242281

The loss-of-allele assay for ES cell screening and mouse genotyping.

PubMed

Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

2010-01-01

Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Design method of ARM based embedded iris recognition system

NASA Astrophysics Data System (ADS)

Wang, Yuanbo; He, Yuqing; Hou, Yushi; Liu, Ting

2008-03-01

With the advantages of non-invasiveness, uniqueness, stability and low false recognition rate, iris recognition has been successfully applied in many fields. Up to now, most of the iris recognition systems are based on PC. However, a PC is not portable and it needs more power. In this paper, we proposed an embedded iris recognition system based on ARM. Considering the requirements of iris image acquisition and recognition algorithm, we analyzed the design method of the iris image acquisition module, designed the ARM processing module and its peripherals, studied the Linux platform and the recognition algorithm based on this platform, finally actualized the design method of ARM-based iris imaging and recognition system. Experimental results show that the ARM platform we used is fast enough to run the iris recognition algorithm, and the data stream can flow smoothly between the camera and the ARM chip based on the embedded Linux system. It's an effective method of using ARM to actualize portable embedded iris recognition system.

Regulatory light chain mutants linked to heart disease modify the cardiac myosin lever arm.

PubMed

Burghardt, Thomas P; Sikkink, Laura A

2013-02-19

Myosin is the chemomechanical energy transducer in striated heart muscle. The myosin cross-bridge applies impulsive force to actin while consuming ATP chemical energy to propel myosin thick filaments relative to actin thin filaments in the fiber. Transduction begins with ATP hydrolysis in the cross-bridge driving rotary movement of a lever arm converting torque into linear displacement. Myosin regulatory light chain (RLC) binds to the lever arm and modifies its ability to translate actin. Gene sequencing implicated several RLC mutations in heart disease, and three of them are investigated here using photoactivatable GFP-tagged RLC (RLC-PAGFP) exchanged into permeabilized papillary muscle fibers. A single-lever arm probe orientation is detected in the crowded environment of the muscle fiber by using RLC-PAGFP with dipole orientation deduced from the three-spatial dimension fluorescence emission pattern of the single molecule. Symmetry and selection rules locate dipoles in their half-sarcomere, identify those at the minimal free energy, and specify active dipole contraction intermediates. Experiments were performed in a microfluidic chamber designed for isometric contraction, total internal reflection fluorescence detection, and two-photon excitation second harmonic generation to evaluate sarcomere length. The RLC-PAGFP reports apparently discretized lever arm orientation intermediates in active isometric fibers that on average produce the stall force. Disease-linked mutants introduced into RLC move intermediate occupancy further down the free energy gradient, implying lever arms rotate more to reach stall force because mutant RLC increases lever arm shear strain. A lower free energy intermediate occupancy involves a lower energy conversion efficiency in the fiber relating a specific myosin function modification to the disease-implicated mutant.

Analysis of nevirapine (NVP) resistance in Ugandan infants who were HIV infected despite receiving single-Dose (SD) NVP versus SD NVP plus daily NVP up to 6 weeks of age to prevent HIV vertical transmission.

PubMed

Church, Jessica D; Omer, Saad B; Guay, Laura A; Huang, Wei; Lidstrom, Jessica; Musoke, Philippa; Mmiro, Francis; Jackson, J Brooks; Eshleman, Susan H

2008-10-01

Single-dose nevirapine (SD NVP) at birth plus NVP prophylaxis for the infant up to 6 weeks of age is superior to SD NVP alone for prevention of vertical transmission of human immunodeficiency virus (HIV) through breastfeeding. We analyzed NVP resistance in HIV-infected Ugandan infants who received either SD NVP or extended NVP prophylaxis. We tested plasma HIV by using a genotyping assay (ViroSeq; Celera Diagnostics), a phenotypic resistance assay (PhenoSense; Monogram Biosciences), and sensitive point mutation assay (LigAmp, for K103N, Y181C, and G190A). When infants were 6 weeks old, ViroSeq detected NVP resistance in a higher proportion of infants in the extended NVP arm than in the SD NVP arm (21 of 25 [84%] vs. 12 of 24 [50%]; P = .01). Similar results were obtained with LigAmp and PhenoSense. In both study arms, infants who were HIV infected at birth frequently had NVP resistance detected. In contrast, infants in the extended NVP arm who were HIV infected after birth were more likely to have resistance detected at 6 weeks, compared with infants in the SD NVP arm. The use of extended NVP prophylaxis was also associated with detection of NVP resistance by ViroSeq at 6 months (7 of 7 [100%] infants in the extended NVP arm had resistance detected, compared with 1 of 6 [16.7%] infants in the SD NVP arm; P = .005). The use of extended NVP prophylaxis was associated with increased selection for and persistence of NVP resistance in HIV-infected Ugandan infants.

Genetics of Iranian Alpha-Thalassemia Patients: A Comprehensive Original Study.

PubMed

Keikhaei, Bijan; Slehi-Fard, Pejman; Shariati, Gholamreza; Khosravi, Abbas

2018-04-07

Alpha thalassemia is the most prevalent monogenic gene disorder in the world, especially in Mediterranean countries. In the current hematological phenotype of patients with different genotypes, the effects of missense mutations on the protein function and also stability were evaluated in a large cohort study. A total of 1,560 subjects were enrolled in the study and divided into two groups: 259 normal subjects; and 1301 alpha-thalassemia carriers. Genomic DNA was extracted and analyzed using ARMS PCR, Multiplex Gap, and direct sequencing. The effects of single nucleotide change on the protein function and stability were predicted by freely available databases of human polymorphisms. Sixty-three different genotypes were seen in the patients. The more prevalent was heterozygote form of -α3.7 (41.4%) followed by -α3.7 homozygote (11.6%) and -MED (3.8%). The significant differences were seen in mean hemoglobin level [F = 20.5, p < 0.001] between the Alpha-globin genotypes, when adjusted for gender. Moreover, 28 different mutations were found in our study. A significant relationship was seen between ethnicity and the alpha-globin mutation frequency χ 2 (df;8) = 38.36, p < 0.0001). Different genotypes could display as different phenotypes. The mutation frequency distributions in our region are different from those of other parts of Iran. Significant differences are seen in the spectrum of mutation frequency among various ethnicities. Finally, some missense mutations might not have considerable effect on the proteins, and they could be neutral mutations.

The immunological and clinical effects of mutated ras peptide vaccine in combination with IL-2, GM-CSF, or both in patients with solid tumors.

PubMed

Rahma, Osama E; Hamilton, J Michael; Wojtowicz, Malgorzata; Dakheel, Omar; Bernstein, Sarah; Liewehr, David J; Steinberg, Seth M; Khleif, Samir N

2014-02-24

Mutant Ras oncogenes produce proteins that are unique to cancer cells and represent attractive targets for vaccine therapy. We have shown previously that vaccinating cancer patients with mutant ras peptides is feasible and capable of inducing a specific immune response against the relevant mutant proteins. Here, we tested the mutant ras peptide vaccine administered in combination with low dose interleukin-2 (IL-2) or/and granulocyte-macrophage colony-stimulating factor (GM-CSF) in order to enhance the vaccine immune response. 5000 μg of the corresponding mutant ras peptide was given subcutaneously (SQ) along with IL-2 (Arm A), GM-CSF (Arm B) or both (Arm C). IL-2 was given SQ at 6.0 million IU/m²/day starting at day 5, 5 days/week for 2 weeks. GM-CSF was given SQ in a dose of 100 μg/day one day prior to each ras peptide vaccination for 4 days. Vaccines were repeated every 5 weeks on arm A and C, and every 4 weeks on arm B, for a maximum of 15 cycles or until disease progression. We treated 53 advanced cancer patients (38 with colorectal, 11 with pancreatic, 1 with common bile duct and 3 with lung) on 3 different arms (16 on arm A, 18 on arm B, and 19 on arm C). The median progression free survival (PFS) and overall survival (OS) was 3.6 and 16.9 months, respectively, for all patients evaluable for clinical response (n = 48). There was no difference in PFS or OS between the three arms (P = 0.73 and 0.99, respectively). Most adverse events were grade 1-2 toxicities and resolved spontaneously. The vaccine induced an immune response to the relevant ras peptide in a total of 20 out of 37 evaluable patients (54%) by ELISPOT, proliferative assay, or both. While 92.3% of patients on arm B had a positive immune response, only 31% of patients on arm A and 36% of patients on arm C had positive immune responses (P = 0.003, Fisher's exact test). The reported data showed that IL-2 might have a negative effect on the specific immune response induced by the relevant mutant ras vaccine in patients with advanced cancer. This observation deserves further investigations. NCI97C0141.

Tetra-primer ARMS-PCR identified four pivotal genetic variations in bovine PNPLA3 gene and its expression patterns.

PubMed

Wang, Zi-nian; Cai, Han-fang; Li, Ming-xun; Cao, Xiu-kai; Lan, Xian-yong; Lei, Chu-zhao; Chen, Hong

2016-01-10

Patatin-like phospholipase domain-containing protein 3 (PNPLA3), a member of the patatin like phospholipase domain-containing (PNPLA) family, plays an important role in energy balance, fat metabolism regulation, glucose metabolism and fatty liver disease. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) is a new method offering fast detection and extreme simplicity at a negligible cost for SNP genotyping. In this paper, we investigated the genetic variations at different ages of 660 Chinese indigenous cattle belonging to three breeds (QC, NY, JX) and applied T-ARMS-PCR and PCR-RFLP methods to genotype four SNPs, SNP1: g.A2980G, SNP2: g.A2996T, SNP3: g.A36718G, SNP4: g.G36850A. The statistical analyses indicated that these 4 SNPs affected growth traits markedly (P<0.05) in QC population, whereas combined haplotypes were not (P>0.05). The qPCR (quantitative PCR) indicated that bovine PNPLA3 gene was exclusively expressed in fat tissues. Besides, the analysis between SNP and mRNA expression revealed that, in SNP1, the expression of AG was much higher than AA and GG (P<0.05), which was in accordance with the results of growth traits association analysis, while the results of SNP4 was not. These results supported high potential that SNPs of bovine PNPLA3 gene might be utilized as genetic markers in marker-assisted selection (MAS) for Chinese cattle breeding programs. Copyright © 2015 Elsevier B.V. All rights reserved.

Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease

PubMed Central

Heidari, Mohammad Mehdi; Soheilyfar, Sorour

2016-01-01

Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

ASP8273 tolerability and antitumor activity in TKI-naive Japanese patients with EGFR mutation-positive non-small cell lung cancer.

PubMed

Azuma, Koichi; Nishio, Makoto; Hayashi, Hidetoshi; Kiura, Katsuyuki; Satouchi, Miyako; Sugawara, Shunichi; Hida, Toyoaki; Iwamoto, Yasuo; Inoue, Akira; Takeda, Koji; Ikeda, Satoshi; Nakagawa, Tomoki; Takeda, Kentaro; Asahina, Seitaro; Komatsu, Kanji; Morita, Satoshi; Fukuoka, Masahiro; Nakagawa, Kazuhiko

2018-05-28

Epidermal growth factor receptor (EGFR) activating mutations occur in approximately 50% of East Asian patients with non-small cell lung cancer (NSCLC) and confer sensitivity to tyrosine kinase inhibitors (TKI). ASP8273 is an orally administered, irreversible EGFR-TKI that inhibits EGFR activating mutations and has demonstrated clinical activity in patients with EGFR mutation-positive NSCLC. EGFR-TKI-naïve Japanese adult patients (≥20 years) with NSCLC harboring EGFR mutations were enrolled in this open-label, single-arm, Phase 2 study (NCT02500927). Patients received ASP8273 300mg once daily until discontinuation criteria were met. The primary endpoint was to determine the safety of ASP8273 300mg; secondary endpoint was antitumor activity defined by RECIST v1.1. Thirty-one patients (12M/19F; median age 64 years [range: 31-82]) with EGFR mutation-positive NSCLC were enrolled; as of 23 February 2016, 25 patients (81%) were still on study. Of the 31 patients, 27 (87%) had an ex19del (n=13, 42%) or a L858R (n=14, 45%) EGFR activating mutation; 2 (7%) had L861Q mutation and 5 (16%) had other EGFR activating mutations, two had an activating mutation and the T790M resistance mutation. The most commonly reported treatment-emergent adverse event was diarrhea [n=24, 77%]. All patients had at least 1 post-baseline scan; 1 patient (3%) achieved a confirmed complete response, 13 (42%) had a confirmed partial response, and 15 (48%) had confirmed stable disease (disease control rate: 94% [n=29/31]) per investigator assessment. Once-daily ASP8273 300 mg was generally well tolerated and demonstrated antitumor activity in TKI-naïve Japanese patients with EGFR mutation-positive NSCLC. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Identification of a single ancestral CYP1B1 mutation in Slovak Gypsies (Roms) affected with primary congenital glaucoma.

PubMed

Plásilová, M; Stoilov, I; Sarfarazi, M; Kádasi, L; Feráková, E; Ferák, V

1999-04-01

Primary congenital glaucoma (PCG) is an autosomal recessive eye disease that occurs at an unusually high frequency in the ethnic isolate of Roms (Gypsies) in Slovakia. Recently, we linked the disease in this population to the GLC3A locus on 2p21. At this locus, mutations in the cytochrome P4501B1 (CYP1B1) gene have been identified as a molecular basis for this condition. Here, we report the results of CYP1B1 mutation screening of 43 PCG patients from 26 Slovak Rom families. A homozygous G-->A transition at nucleotide 1505 in the highly conserved region of exon 3 was detected in all families. This mutation results in the E387K substitution, which affects the conserved K helix region of the cytochrome P450 molecule. Determination of the CYP1B1 polymorphic background showed a common DNA haplotype in all patients, thus indicating that the E387K mutation in Roms has originated from a single ancestral mutational event. The Slovak Roms represent the first population in which PCG is found to result from a single mutation in the CYP1B1 gene, so that a founder effect is the most plausible explanation of its increased incidence. An ARMS-PCR assay has been developed for fast detection of this mutation, thus allowing direct DNA based prenatal diagnosis as well as gene carrier detection in this particular population. Screening of 158 healthy Roms identified 17 (10.8%) mutation carriers, indicating that the frequency of PCG in this population may be even higher than originally estimated.

A Novel Alpha Cardiac Actin (ACTC1) Mutation Mapping to a Domain in Close Contact with Myosin Heavy Chain Leads to a Variety of Congenital Heart Defects, Arrhythmia and Possibly Midline Defects.

PubMed

Augière, Céline; Mégy, Simon; El Malti, Rajae; Boland, Anne; El Zein, Loubna; Verrier, Bernard; Mégarbané, André; Deleuze, Jean-François; Bouvagnet, Patrice

2015-01-01

A Lebanese Maronite family presented with 13 relatives affected by various congenital heart defects (mainly atrial septal defects), conduction tissue anomalies and midline defects. No mutations were found in GATA4 and NKX2-5. A set of 399 poly(AC) markers was used to perform a linkage analysis which peaked at a 2.98 lod score on the long arm of chromosome 15. The haplotype analysis delineated a 7.7 meganucleotides genomic interval which included the alpha-cardiac actin gene (ACTC1) among 36 other protein coding genes. A heterozygous missense mutation was found (c.251T>C, p.(Met84Thr)) in the ACTC1 gene which changed a methionine residue conserved up to yeast. This mutation was absent from 1000 genomes and exome variant server database but segregated perfectly in this family with the affection status. This mutation and 2 other ACTC1 mutations (p.(Glu101Lys) and p.(Met125Val)) which result also in congenital heart defects are located in a region in close apposition to a myosin heavy chain head region by contrast to 3 other alpha-cardiac actin mutations (p.(Ala297Ser),p.(Asp313His) and p.(Arg314His)) which result in diverse cardiomyopathies and are located in a totally different interaction surface. Alpha-cardiac actin mutations lead to congenital heart defects, cardiomyopathies and eventually midline defects. The consequence of an ACTC1 mutation may in part be dependent on the interaction surface between actin and myosin.

Hypofractionated accelerated radiotherapy (HART) with concurrent and adjuvant temozolomide in newly diagnosed glioblastoma: a phase II randomized trial (HART-GBM trial).

PubMed

Mallick, Supriya; Kunhiparambath, Haresh; Gupta, Subhash; Benson, Rony; Sharma, Seema; Laviraj, M A; Upadhyay, Ashish Datt; Julka, Pramod Kumar; Sharma, Dayanand; Rath, Goura Kishor

2018-06-23

Maximal safe surgical resection followed by adjuvant chemoradiation has been standard for newly diagnosed glioblastoma multiforme (GBM). Hypofractionated accelerated radiotherapy (HART) has the potential to improve outcome as it reduces the overall treatment time and increases the biological effective dose. Between October 2011 and July 2017, a total of 89 newly diagnosed GBM patients were randomized to conventional fractionated radiotherapy (CRT) or HART. Radiotherapy was delivered in all patients with a three-dimensional conformal radiotherapy technique in CRT arm (60 Gy in 30 fractions over 6 weeks @ 2 Gy/per fraction) or simultaneous integrated boost intensity modulated radiotherapy in HART arm (60 Gy in 20 fractions over 4 weeks @ 3 Gy/per fraction to high-risk planning target volume (PTV) and 50 Gy in 20 fractions over 4 weeks @ 2.5 Gy/per fraction to low-risk PTV). The primary endpoint of the trial was overall survival (OS). After a median follow-up of 11.4 months (Range: 2.9-42.5 months), 26 patients died and 39 patients had progression of the disease. Median OS for the entire cohort was 23.4 months. Median OS in the CRT and HART arms were 18.07 months (95% CI 14.52-NR) and 25.18 months (95% CI 12.89-NR) respectively, p = 0.3. Median progression free survival (PFS) for the entire cohort was 13.5 months (Range: 11.7-15.7 months). In multivariate analysis patients younger than 40 years of age, patients with a gross total resection of tumor and a mutated IDH-1 had significantly better OS. PFS was significantly better for patients with a gross total resection of tumor and a mutated IDH-1. All patients included in the trial completed the planned course of radiation. Only two patients required hospital admission for features of raised intracranial tension. One patient in the HART arm required treatment interruption. HART is comparable to CRT in terms of survival outcome. HART arm had no excess treatment interruption and minimal toxicity. Dose escalation, reduction in overall treatment time, is the advantages with use of HART.

Neoadjuvant FOLFOX 4 versus FOLFOX 4 with Cetuximab versus immediate surgery for high-risk stage II and III colon cancers: a multicentre randomised controlled phase II trial--the PRODIGE 22--ECKINOXE trial.

PubMed

Karoui, Mehdi; Rullier, Anne; Luciani, Alain; Bonnetain, Franck; Auriault, Marie-Luce; Sarran, Antony; Monges, Geneviève; Trillaud, Hervé; Le Malicot, Karine; Leroy, Karen; Sobhani, Iradj; Bardier, Armelle; Moreau, Marie; Brindel, Isabelle; Seitz, Jean François; Taieb, Julien

2015-07-10

In patients with high risk stage II and stage III colon cancer (CC), curative surgery followed by adjuvant FOLFOX-4 chemotherapy has become the standard of care. However, for 20 to 30% of these patients, the current curative treatment strategy of surgical excision followed by adjuvant chemotherapy fails either to clear locoregional spread or to eradicate distant micrometastases, leading to disease recurrence. Preoperative chemotherapy is an attractive concept for these CCs and has the potential to impact upon both of these causes of failure. Optimum systemic therapy at the earliest possible opportunity may be more effective at eradicating distant metastases than the same treatment given after the delay and immunological stress of surgery. Added to this, shrinking the primary tumor before surgery may reduce the risk of incomplete surgical excision, and the risk of tumor cell shedding during surgery. PRODIGE 22--ECKINOXE is a multicenter randomized phase II trial designed to evaluate efficacy and feasibility of two chemotherapy regimens (FOLFOX-4 alone and FOLFOX-4 + Cetuximab) in a peri-operative strategy in patients with bulky CCs. Patients with CC deemed as high risk T3, T4 and/or N2 on initial abdominopelvic CT scan are randomized to either colectomy and adjuvant chemotherapy (control arm), or 4 cycles of neoadjuvant chemotherapy with FOLFOX-4 (for RAS mutated patients). In RAS wild-type patients a third arm testing FOLFOX+ cetuximab has been added prior to colectomy. Patients in the neoadjuvant chemotherapy arms will receive postoperative treatment for 4 months (8 cycles) to complete their therapeutic schedule. The primary endpoint of the study is the histological Tumor Regression Grade (TRG) as defined by Ryan. The secondary endpoints are: treatment strategy safety (toxicity, primary tumor related complications under chemotherapy, peri-operative morbidity), disease-free and recurrence free survivals at 3 years, quality of life, carcinologic quality and completeness of the surgery, initial radiological staging and radiological response to neoadjuvant chemotherapy, and the correlation between histopathological and radiological response. Taking into account a 50% prevalence of CC without RAS mutation, accrual of 165 patients is needed for this Phase II trial. NCT01675999 (ClinicalTrials.gov).

Genotype–phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis

PubMed Central

Traivaree, Chanchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Prasertsin, Warakorn; Boonyawat, Boonchai

2018-01-01

Introduction Beta-thalassemia is a group of inherited hemolytic anemias and one of the most common genetic disorders in Thailand. The clinical spectrum of beta-thalassemia disease ranges from mild to severe clinical symptoms including mild beta-thalassemia intermedia (TI) and severe beta-thalassemia major (TM). Objective This study aimed to determine the correlation between beta-globin gene (HBB) mutations and their phenotypic manifestations by evaluating patients’ clinical characteristics, transfusion requirements, growth and hematologic parameters, and hemoglobin typing among pediatric patients treated at Phramongkutklao Hospital. Materials and methods Seventy beta-thalassemia patients, including 63 with beta-thalassemia/hemoglobin E (HbE) and 7 with either homozygous or compound heterozygous beta-thalassemia, were enrolled in this study. Their clinical presentation, growth parameters and laboratory findings were reviewed and analyzed. The mean follow-up time was 10.52±5.62 years. Mutation analysis in each individual was performed using multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene and gap PCR for 3.4 kb deletion detection. Results All 7 homozygous and compound heterozygous beta-thalassemia patients were classified in TM. Among 63 patients with beta-thalassemia/HbE, 58 were classified in TM and 4 were classified in TI. Mean age at diagnosis was 0.8±0.49 years for homozygous or compound heterozygous beta-thalassemia and 3.43±3.5 years for beta-thalassemia/HbE. The most common HBB mutation was HBB:c.126_129delCTTT [codon 41/42 (-TCTT)] found in 34 alleles (48.6%). The height for age was also lower in homozygous beta-thalassemia patients (<3rd percentile) compared to compound heterozygous beta-thalassemia patients (25–50th percentile). Conclusion This study revealed a genotype–phenotype correlation of the most prevalent beta-thalassemia in Thai children using diagnostic capacity in genotypic analysis of HBB mutation. Our findings can provide a better prediction of clinical manifestation and severity by early identification of the type of the HBB mutations. PMID:29695942

Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.

PubMed

Miri-Moghaddam, Ebrahim; Bahrami, Sara; Naderi, Majid; Bazi, Ali; Karimipoor, Morteza

2016-06-01

Inheritance of mild mutations within the β-globin gene and coinheritance of α-thalassemia (α-thal) are known as two important genetic modifiers in β-thalassemia (β-thal) intermedia (β-TI). We aimed to evaluate the spectrum of β- and α-thal mutations in β-TI patients in Southeast Iran. Common β- and α-globin gene mutations were detected by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and multiplex gap-PCR, respectively. There were 26 male (57.8%) and 19 female (42.2%) patients. HBB: c.92 + 5T > C [IVS-I-5 (G > C)] and HBB: c.-138C + 1G > A [IVS-II-I (G > A)] represented the prevalent alleles with respective frequencies of 60.0 and 10.0%. Other β-globin mutations included HBB: c.-138C > T [-88 (C > T)], HBB: c.27_28insG [frameshift codons (FSC) 8/9 (+G)], HBB: c.46delT [codon 15 (-T)], HBB: c.93-22_95del (IVS-I, 25 del), and the 619 bp deletion (NG_000007.3: g.71609_72227del619). The predominant genotypic combinations were β(0)/β(0) (68.9%), β(0)/β(+ )(8.9%) and β(+)/β(+ )(2.2%). Coinheritance of α-thal was observed in 33.0% of the patients, with the -α(3.7) (rightward) (NG_000006.1: g.34164_37967del3804) as the most common deletion (86.0%). One patient was diagnosed with the -α(4.2) (leftward) (AF221717) and one with the - -(MED) (g.24664_41064del16401) deletions, while no patients carried the -(α)(20.5) (g.15164_37864del22701), α(-5 nt) (HBA2: c.95 + 2_95_6delTGAGG) or codon 19 (-G) (HBA2: c.56delG) mutations. The alleviating molecular mechanism was not explainable by β(+ )or concurrent α-thal in more than half of our β-TI patients. This encourages conducting more studies to identify other contributing factors, especially Hb F-inducing genetic modifiers.

Pyrethroid insecticides maintain repellent effect on knock-down resistant populations of Aedes aegypti mosquitoes.

PubMed

Bowman, Natalie M; Akialis, Kristin; Cave, Grayson; Barrera, Roberto; Apperson, Charles S; Meshnick, Steven R

2018-01-01

Pyrethroid-treated clothing is commonly worn for protection against mosquitoes; pyrethroids are both insecticides and repellents. Pyrethroid resistance has become increasingly common in Aedes aegypti, the vector of dengue, Zika, and other arboviruses, but it is not clear whether resistance is associated with reductions in repellency. In order to determine whether long-lasting permethrin impregnated (LLPI) clothing is protective, we used Aedes aegypti from New Orleans, LA (pyrethroid-sensitive) and San Juan, PR (resistant) to measure both lethality and repellency. PCR and Sanger sequencing were used to confirm resistance status by detecting mutations in the kdr gene at positions 1016 and 1534. Arm-in-cage trials of 100 Aedes aegypti females from both populations were performed for 10 minutes to bare arm or an arm clothed in untreated military camouflage or military camouflage impregnated with deltamethrin, permethrin, or etofenprox. Trials were repeated 4-5 times on different days. Number of landings, number of blood meals, and immediate and 24-hour mortality were recorded. Mortality was extremely low in all trials. Compared to untreated cloth, mosquitoes demonstrated a trend towards a 2%-63% reduction in landings and a statistically significant 78-100% reduction in blood feeding on pyrethroid-treated cloth for most insecticides. Effects were observed in both pyrethroid-sensitive and pyrethroid-resistant mosquito populations. Our data show that kdr mutations are associated with pyrethroid resistance but are likely not the only contributors. Pyrethroids appear to maintain repellent effect against resistant mosquitoes. This finding suggests that even in places where pyrethroid resistance is widespread, permethrin still has a role for use as a repellent on clothing to protect against mosquito bites.

Association between allelic variation at the Phytoene synthase 1 gene and yellow pigment content in the wheat grain.

PubMed

Zhang, W; Dubcovsky, J

2008-03-01

A better understanding of the genetic factors controlling grain yellow pigment content (GYPC) is important for both pasta (high GYPC) and bread wheat (low GYPC) quality improvement. Quantitative trait loci (QTL) for GYPC have been mapped repeatedly on the distal regions of chromosome arms 7AL and 7BL in wheat, and the Phytoene synthase 1 (PSY-1) gene located in this region has been proposed as a candidate gene. We show here that PSY-E1, the tall wheatgrass orthologue, is completely linked to differences in GYPC, and that selection for white endosperm mutants in recombinant lines carrying this gene resulted in the identification of a mutation in a conserved amino acid of PSY-E1. These results, together with the association between GYPC and allelic differences in PSY-1 in hexaploid wheat, suggest that this gene plays an important role in the determination of GYPC. However, a second white endosperm mutant previously mapped to chromosome arm 7EL showed no mutations in PSY-E1 suggesting the existence of additional gene(s) affecting GYPC in this chromosome region. This hypothesis was further supported by the mapping of QTL for GYPC on 7AL proximal to PSY-1 in a cross between pasta wheat varieties UC1113 and Kofa. Interestingly, the Kofa PSY-B1 allele showed unusually high levels of polymorphisms as a result of a conversion event involving the PSY-A1 allele. In summary, our results support the hypothesis that allelic differences in PSY-1 and at least one additional gene in the distal region of the long arm of homoeologous group 7L are associated with differences in GYPC.

Inactivation of Genes Encoding Subunits of the Peripheral and Membrane Arms of Neurospora Mitochondrial Complex I and Effects on Enzyme Assembly

PubMed Central

Duarte, M.; Sousa, R.; Videira, A.

1995-01-01

We have isolated and characterized the nuclear genes encoding the 12.3-kD subunit of the membrane arm and the 29.9-kD subunit of the peripheral arm of complex I from Neurospora crassa. The former gene was known to be located in linkage group I and the latter is now assigned to linkage group IV of the fungal genome. The genes were separately transformed into different N. crassa strains and transformants with duplicated DNA sequences were isolated. Selected transformants were then mated with other strains to generate repeat-induced point mutations in both copies of the genes present in the nucleus of the parental transformant. From the progeny of the crosses, we were then able to recover two individual mutants lacking the 12.3- and 29.9-kD proteins in their mitochondria, mutants nuo12.3 and nuo29.9, respectively. Several other subunits of complex I are present in the mutant organelles, although with altered stoichiometries as compared with those in the wild-type strain. Based on the analysis of Triton-solubilized mitochondrial complexes in sucrose gradients, neither mutant is able to fully assemble complex I. Our results indicate that mutant nuo12.3 separately assembles the peripheral arm and most of the membrane arm of the enzyme. Mutant nuo29.9 seems to accumulate the membrane arm of complex I and being devoid of the peripheral part. This implicates the 29.9-kD protein in an early step of complex I assembly. PMID:7768434

Diverse Roles of Axonemal Dyneins in Drosophila Auditory Neuron Function and Mechanical Amplification in Hearing.

PubMed

Karak, Somdatta; Jacobs, Julie S; Kittelmann, Maike; Spalthoff, Christian; Katana, Radoslaw; Sivan-Loukianova, Elena; Schon, Michael A; Kernan, Maurice J; Eberl, Daniel F; Göpfert, Martin C

2015-11-26

Much like vertebrate hair cells, the chordotonal sensory neurons that mediate hearing in Drosophila are motile and amplify the mechanical input of the ear. Because the neurons bear mechanosensory primary cilia whose microtubule axonemes display dynein arms, we hypothesized that their motility is powered by dyneins. Here, we describe two axonemal dynein proteins that are required for Drosophila auditory neuron function, localize to their primary cilia, and differently contribute to mechanical amplification in hearing. Promoter fusions revealed that the two axonemal dynein genes Dmdnah3 (=CG17150) and Dmdnai2 (=CG6053) are expressed in chordotonal neurons, including the auditory ones in the fly's ear. Null alleles of both dyneins equally abolished electrical auditory neuron responses, yet whereas mutations in Dmdnah3 facilitated mechanical amplification, amplification was abolished by mutations in Dmdnai2. Epistasis analysis revealed that Dmdnah3 acts downstream of Nan-Iav channels in controlling the amplificatory gain. Dmdnai2, in addition to being required for amplification, was essential for outer dynein arms in auditory neuron cilia. This establishes diverse roles of axonemal dyneins in Drosophila auditory neuron function and links auditory neuron motility to primary cilia and axonemal dyneins. Mutant defects in sperm competition suggest that both dyneins also function in sperm motility.

System For Research On Multiple-Arm Robots

NASA Technical Reports Server (NTRS)

Backes, Paul G.; Hayati, Samad; Tso, Kam S.; Hayward, Vincent

1991-01-01

Kali system of computer programs and equipment provides environment for research on distributed programming and distributed control of coordinated-multiple-arm robots. Suitable for telerobotics research involving sensing and execution of low level tasks. Software and configuration of hardware designed flexible so system modified easily to test various concepts in control and programming of robots, including multiple-arm control, redundant-arm control, shared control, traded control, force control, force/position hybrid control, design and integration of sensors, teleoperation, task-space description and control, methods of adaptive control, control of flexible arms, and human factors.

105KE Basin Area Radiation Monitor System (ARMS) Acceptance Test Procedure

DOE Office of Scientific and Technical Information (OSTI.GOV)

KINKEL, C.C.

1999-12-14

This procedure is intended for the Area Radiation Monitoring System, ARMS, that is replacing the existing Programmable Input-Output Processing System, PIOPS, radiation monitoring system in the 105KE basin. The new system will be referred to as the 105KE ARMS, 105KE Area Radiation Monitoring System. This ATP will ensure calibration integrity of the 105KE radiation detector loops. Also, this ATP will test and document the display, printing, alarm output, alarm acknowledgement, upscale check, and security functions. This ATP test is to be performed after completion of the 105KE ARMS installation. The alarm outputs of the 105KE ARMS will be connected tomore » the basin detector alarms, basin annunciator system, and security Alarm Monitoring System, AMS, located in the 200 area Central Alarm Station (CAS).« less

Design of the arm-wrestling robot's force acquisition system based on Qt

NASA Astrophysics Data System (ADS)

Huo, Zhixiang; Chen, Feng; Wang, Yongtao

2017-03-01

As a collection of entertainment and medical rehabilitation in a robot, the research on the arm-wrestling robot is of great significance. In order to achieve the collection of the arm-wrestling robot's force signals, the design and implementation of arm-wrestling robot's force acquisition system is introduced in this paper. The system is based on MP4221 data acquisition card and is programmed by Qt. It runs successfully in collecting the analog signals on PC. The interface of the system is simple and the real-time performance is good. The result of the test shows the feasibility in arm-wrestling robot.

[Detection of KRAS mutation in colorectal cancer patients' cfDNA with droplet digital PCR].

PubMed

Luo, Yuwen; Li, Yao

2018-03-25

This study aims to develop a new method for the detection of KRAS mutations related to colorectal cancer in cfDNA, and to evaluate the sensitivity and accuracy of the detection. We designed a method of cfDNA based KRAS detection by droplets digital PCR (ddPCR). The theoretical performance of the method is evaluated by reference standard and compared to the ARMS PCR method. Two methods, ddPCR and qPCR, were successfully established to detect KRAS wild type and 7 mutants. Both methods were validated using plasmid standards and actual samples. The results were evaluated by false positive rate, linearity, and limit of detection. Finally, 52 plasma cfDNA samples from patients and 20 samples from healthy people were tested, the clinical sensitivity is 97.64%, clinical specificity is 81.43%. ddPCR method shows higher performance than qPCR. The LOD of ddPCR method reached single digits of cfDNA copies, it can detect as low as 0.01% to 0.04% mutation abundance.

The role of LKB1 in lung cancer.

PubMed

Sanchez-Cespedes, Montse

2011-09-01

In humans, the LKB1 gene is located on the short arm of chromosome 19, which is frequently deleted in lung tumors. Unlike most cancers of sporadic origin, in non-small cell lung cancer (NSCLC) nearly half of the tumors harbor somatic and homozygous inactivating mutations in LKB1. In NSCLC, LKB1 inactivation strongly predominates in adenocarcinomas from smokers and coexists with mutations at other important cancer genes, including KRAS and TP53. Remarkably, LKB1 alterations frequently occur simultaneously with inactivation at another important tumor suppressor gene, BRG1 (also called SMARCA4), which is also located on chromosome 19p. The present review considers the frequency and pattern of LKB1 mutations in lung cancer and the distinct biological pathways in which the LKB1 protein is involved in the development of this type of cancer. Finally, the possible clinical applications in cancer management, especially in lung cancer treatment, associated with the presence of absence of LKB1 are discussed.

BRG1 and LKB1: tales of two tumor suppressor genes on chromosome 19p and lung cancer.

PubMed

Rodriguez-Nieto, Salvador; Sanchez-Cespedes, Montse

2009-04-01

Losses of heterozygosity (LOH) of the short arm of chromosome 19 are frequent in lung cancer, suggesting that one or more tumor suppressor genes are present in this region. The LKB1 gene, also called STK11, is somatically inactivated through point mutations and large deletions in lung tumors, demonstrating that LKB1 is a target of the LOH of this chromosomal arm. Data from several independent groups have provided information about the profiles of lung tumors with LKB1 inactivation and it is generally agreed that this alteration strongly predominates in non-small cell lung cancer, in particular adenocarcinomas, in smokers. The LKB1 protein has serine-threonine kinase activity and is involved in the regulation of the cell energetic checkpoint through the phosphorylation and activation of adenosine monophosphate-dependent kinase (AMPK). LKB1 is also involved in other processes such as cell polarization, probably through substrates other than AMPK. Interestingly, another gene on chromosome 19p, BRG1, encoding a component of the SWI/SNF chromatin-remodeling complex, has emerged as a tumor suppressor gene that is altered in lung tumors. Similar to LKB1, BRG1 is somatically inactivated by point mutations or large deletions in lung tumors featuring LOH of chromosome 19p. These observations suggest an important role for BRG1 in lung cancer and highlight the need to further our understanding of the function of Brahma/SWI2-related gene 1 (BRG1) in cancer. Finally, simultaneous mutations at LKB1 and BRG1 are common in lung cancer cells, which exemplifies how a single event, LOH of chromosome 19p in this instance, targets two different tumor suppressors.

[Hyperuricemia and gene mutations: a case report].

PubMed

Tattoli, Fabio; Falconi, Daniela; De Prisco, Ornella; Maurizio, Gherzi; Marazzi, Federico; Marengo, Marita; Serra, Ilaria; Tamagnone, Michela; Cordero di Montezemolo, Luca; Pasini, Barbara; Formica, Marco

2017-06-01

Hyperuricemia is frequently found in nephrology. The case presented may be useful to clarify some pathogenetic aspects. It is a patient of 18 years, hyperuricaemic. Non-consanguineous parents, hyperuricemia in the paternal line, not neuropsychiatric disorders in the family. Delay in neuromotor acquisitions, average intellectual disabilities, anxiety disorder, obsessive-compulsive personality traits. Normal renal function and renal ultrasound. Evidence of hyperuricemia in 2015. Never gouty episodes and / or lithiasis, initiated allopurinol 100 mg on alternate days, with no side effects, urea in the control range, slightly below normal uricuria. Given the complex clinical, he carried out a genetic analysis of array-CGH. He showed a deletion on the short arm of chromosome 3 (3p12.3) and a duplication of the long arm of chromosome 1 (19q13-42). The deletion 3p12.3 (paternal inheritance), involves the ROBO2 gene. Duplication 19q13.42, (maternal inheritance), includes NLRP12, DPRX, ZNF331 genes. The ROBO2 gene with its mutation, is associated with vesicoureteral reflux. The NLRP12 gene encodes proteins called "Nalps", forming a subfamily of proteins "CATERPILLAR". Many "Nalps" as well as the "Nalps 12" have an N-terminal domain (DYP) with a purin. Since uric acid is a byproduct of purine metabolism, considered the familiarity, we believe that we can hypothesize that the mutations found. In particular those concerning the NLRP-12 gene, may have a role in the presence of hyperuricemia. We believe that in patients with hyperuricemia, associated with a particular impairment of neurological picture, it is likely that there is a subtended common genetic deficiency. Copyright by Società Italiana di Nefrologia SIN, Rome, Italy.

Determination of the Inactivating Alterations in Two Mutant Alleles of the Neurospora Crassa Cross-Pathway Control Gene Cpc-1

PubMed Central

Paluh, J. L.; Plamann, M.; Kruger, D.; Barthelmess, I. B.; Yanofsky, C.; Perkins, D. D.

1990-01-01

cpc-1 is the locus specifying what is believed to be the major trans-activating transcription factor that regulates expression of amino acid biosynthetic genes subject to cross-pathway control in Neurospora crassa. Mutants altered at this locus are incapable of the global increase in gene expression normally seen in response to amino acid starvation. Using polymerase chain reaction methodology we have cloned and sequenced the inactive mutant allele, cpc-1 (CD15). The cpc-1 (CD15) mutation was found to be a single base pair deletion in codon 93 of the cpc-1 structural gene. A second, presumed lethal, allele, cpc-1 (j-5), also was investigated. Northern analyses with strains carrying the cpc-1 (j-5) allele revealed that no cpc-1 mRNA is produced. Southern and genetic analyses established that the cpc-1 (j-5) mutation involved a chromosomal rearrangement in which a break occurred within the cpc-1 locus, normally resident on linkage group VI; a small fragment from the left arm of linkage group VI, containing the cpc-1 promoter region and ylo-1, was translocated to the right arm of linkage group I. Other studies indicate that the cpc-1 locus itself is not essential for viability. Lethality previously attributed to the cpc-1 (j-5) mutation is due instead to the production of progeny that are deficient for essential genes in an adjoining segment of linkage group VI. Molecular characterization of cpc-1 (j-5) X ylo-1 pan-2 duplication progeny indicated that cpc-1 is normally transcribed towards the linkage group VI centromere. PMID:2138111

CD4-Negative Variant of Cutaneous Blastic Plasmacytoid Dendritic Cell Neoplasm With a Novel PBRM1 Mutation in an 11-Year-Old Girl.

PubMed

Yigit, Nuri; Suarez, Luisa Fernanda; Roth, Lisa Giulino; Orazi, Attilio; Tam, Wayne

2017-05-01

We report a rare case of CD4- cutaneous blastic plasmacytoid dendritic cell neoplasm (BPDCN) with a novel PBRM1 mutation. An 11-year-old girl presented with an enlarged mass on her left arm and underwent an incisional biopsy. Histopathologic examination and immunohistochemistry studies showed a monotonous proliferation of blasts that were CD4-, CD56+, and CD123+. There was no evidence of leukemic dissemination. Next-generation sequencing detected PBRM1 and CIC gene abnormalities. We confirmed and validated a novel PBRM1 mutation by conventional polymerase chain reaction and Sanger sequencing. CD4- variant of BPDCN may be mistaken for myeloid sarcoma or extramedullary lymphoblastic leukemia/lymphoma because of their overlapping morphologic and immunophenotypic features; thus, a careful clinicopathologic evaluation is essential to reach the correct diagnosis. PBRM1 mutation seems to be a driver event in this case. Our study underscores the importance of alterations in chromatin remodeling in the pathogenesis of BPDCN. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Mutations in the growth hormone releasing hormone receptor: a new form of dwarfism in humans.

PubMed

Baumann, G

1999-06-01

We describe a recently identified new form of dwarfism due to isolated growth hormone (GH) deficiency, secondary to inactivating mutations in the GH-releasing hormone receptor (GHRHR) gene. The identical nonsense mutations in the extracellular domain of the GHRHR (E72X or E50X, depending on whether the signal peptide is included in the numbering) has been independently described in three families residing on or originating from the Indian subcontinent (Pakistan, the Bombay region, and Delft near Sri Lanka). Another inactivating mutation, involving the donor splice site of intron 1, has been identified in a population in north-eastern Brazil. Genetic transmission is autosomal recessive; the gene is located on the short arm of chromosome 7. Affected subjects have severe isolated GH deficiency and postnatal growth failure, with a mean adult height of 130 cm for men and 114 cm for women (7-8 standard deviations below the norm). Dwarfism is proportional; a characteristic feature is relative microcephaly, which results in a 'miniaturized adult', eumorphic aspect. Bone age and puberty are delayed, but fertility appears normal. This new syndrome corresponds to the human homologue of the previously identified 'little mouse'.

OPTIMAL and ENSURE trials-based combined cost-effectiveness analysis of erlotinib versus chemotherapy for the first-line treatment of Asian patients with non-squamous non-small-cell lung cancer

PubMed Central

Zhang, Pengfei; Hutton, David; Li, Qiu

2018-01-01

Objectives Erlotinib, the first generation of epidermoid growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI), has been recommended as an essential treatment in patients with non-small-cell lung cancer (NSCLC) with EGFR mutation. Although it has improved progression-free survival (PFS), overall survival (OS) was limited and erlotinib can be expensive. This cost-effectiveness analysis compares erlotinib monotherapy with gemcitabine-included doublet chemotherapy. Setting First-line treatment of Asian patients with NSCLC with EGFR mutation. Methods A Markov model was created based on the results of the ENSURE (NCT01342965) and OPTIMAL (CTONG-0802) trials which evaluated erlotinib and chemotherapy. The model simulates cancer progression and all causes of death. All medical costs were calculated from the perspective of the Chinese healthcare system. Main outcome measures The primary outcomes are costs, quality-adjusted life years (QALYs) and incremental cost-effectiveness ratios (ICERs). Results The combined PFS was 11.81 months and 5.1 months for erlotinib and chemotherapy, respectively, while the OS was reversed at 24.68 months for erlotinib and 26.16 months for chemotherapy. The chemotherapy arm gained 0.13 QALYs compared with erlotinib monotherapy (1.17 QALYs vs 1.04 QALYs), while erlotinib had lower costs ($55 230 vs $77 669), resulting in an ICER of $174 808 per QALY for the chemotherapy arm, which exceeds three times the Chinese GDP per capita. The most influential factors were the health utility of PFS, the cost of erlotinib and the health utility of progressed disease. Conclusion Erlotinib monotherapy may be acceptable as a cost-effective first-line treatment for NSCLC compared with gemcitabine-based chemotherapy. The results were robust to changes in assumptions. Trial registration number NCT01342965 and CTONG-0802. PMID:29654023

Coordination of multiple robot arms

NASA Technical Reports Server (NTRS)

Barker, L. K.; Soloway, D.

1987-01-01

Kinematic resolved-rate control from one robot arm is extended to the coordinated control of multiple robot arms in the movement of an object. The structure supports the general movement of one axis system (moving reference frame) with respect to another axis system (control reference frame) by one or more robot arms. The grippers of the robot arms do not have to be parallel or at any pre-disposed positions on the object. For multiarm control, the operator chooses the same moving and control reference frames for each of the robot arms. Consequently, each arm then moves as though it were carrying out the commanded motions by itself.

Ten-Year Progression-Free and Overall Survival in Patients With Unresectable or Metastatic GI Stromal Tumors: Long-Term Analysis of the European Organisation for Research and Treatment of Cancer, Italian Sarcoma Group, and Australasian Gastrointestinal Trials Group Intergroup Phase III Randomized Trial on Imatinib at Two Dose Levels.

PubMed

Casali, Paolo G; Zalcberg, John; Le Cesne, Axel; Reichardt, Peter; Blay, Jean-Yves; Lindner, Lars H; Judson, Ian R; Schöffski, Patrick; Leyvraz, Serge; Italiano, Antoine; Grünwald, Viktor; Pousa, Antonio Lopez; Kotasek, Dusan; Sleijfer, Stefan; Kerst, Jan M; Rutkowski, Piotr; Fumagalli, Elena; Hogendoorn, Pancras; Litière, Saskia; Marreaud, Sandrine; van der Graaf, Winette; Gronchi, Alessandro; Verweij, Jaap

2017-05-20

Purpose To report on the long-term results of a randomized trial comparing a standard dose (400 mg/d) versus a higher dose (800 mg/d) of imatinib in patients with metastatic or locally advanced GI stromal tumors (GISTs). Patients and Methods Eligible patients with advanced CD117-positive GIST from 56 institutions in 13 countries were randomly assigned to receive either imatinib 400 mg or 800 mg daily. Patients on the 400-mg arm were allowed to cross over to 800 mg upon progression. Results Between February 2001 and February 2002, 946 patients were accrued. Median age was 60 years (range, 18 to 91 years). Median follow-up time was 10.9 years. Median progression-free survival times were 1.7 and 2.0 years in the 400- and 800-mg arms, respectively (hazard ratio, 0.91; P = .18), and median overall survival time was 3.9 years in both treatment arms. The estimated 10-year progression-free survival rates were 9.5% and 9.2% for the 400- and 800-mg arms, respectively, and the estimated 10-year overall survival rates were 19.4% and 21.5%, respectively. At multivariable analysis, age (< 60 years), performance status (0 v ≥ 1), size of the largest lesion (smaller), and KIT mutation (exon 11) were significant prognostic factors for the probability of surviving beyond 10 years. Conclusion This trial was carried out on a worldwide intergroup basis, at the beginning of the learning curve of the use of imatinib, in a large population of patients with advanced GIST. With a long follow-up, 6% of patients are long-term progression free and 13% are survivors. Among clinical prognostic factors, only performance status, KIT mutation, and size of largest lesion predicted long-term outcome, likely pointing to a lower burden of disease. Genomic and/or immune profiling could help understand long-term survivorship. Addressing secondary resistance remains a therapeutic challenge.

Phase III randomized study of radiation and temozolomide versus radiation and nitrosourea therapy for anaplastic astrocytoma: results of NRG Oncology RTOG 9813.

PubMed

Chang, Susan; Zhang, Peixin; Cairncross, J Gregory; Gilbert, Mark R; Bahary, Jean-Paul; Dolinskas, Carol A; Chakravarti, Arnab; Aldape, Kenneth D; Bell, Erica H; Schiff, David; Jaeckle, Kurt; Brown, Paul D; Barger, Geoffrey R; Werner-Wasik, Maria; Shih, Helen; Brachman, David; Penas-Prado, Marta; Robins, H Ian; Belanger, Karl; Schultz, Christopher; Hunter, Grant; Mehta, Minesh

2017-02-01

The primary objective of this study was to compare the overall survival (OS) of patients with anaplastic astrocytoma (AA) treated with radiotherapy (RT) and either temozolomide (TMZ) or a nitrosourea (NU). Secondary endpoints were time to tumor progression (TTP), toxicity, and the effect of IDH1 mutation status on clinical outcome. Eligible patients with centrally reviewed, histologically confirmed, newly diagnosed AA were randomized to receive either RT+TMZ (n = 97) or RT+NU (n = 99). The study closed early because the target accrual rate was not met. Median follow-up time for patients still alive was 10.1 years (1.9-12.6 y); 66% of the patients died. Median survival time was 3.9 years in the RT/TMZ arm (95% CI, 3.0-7.0) and 3.8 years in the RT/NU arm (95% CI, 2.2-7.0), corresponding to a hazard ratio (HR) of 0.94 (P = .36; 95% CI, 0.67-1.32). The differences in progression-free survival (PFS) and TTP between the 2 arms were not statistically significant. Patients in the RT+NU arm experienced more grade ≥3 toxicity (75.8% vs 47.9%, P < .001), mainly related to myelosuppression. Of the 196 patients, 111 were tested for IDH1-R132H status (60 RT+TMZ and 51 RT+NU). Fifty-four patients were IDH negative and 49 were IDH positive with a better OS in IDH-positive patients (median survival time 7.9 vs 2.8 y; P = .004, HR = 0.50; 95% CI, 0.31-0.81). RT+TMZ did not appear to significantly improve OS or TTP for AA compared with RT+ NU. RT+TMZ was better tolerated. IDH1-R132H mutation was associated with longer survival. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Genotype-phenotype correlations in THAP1 dystonia: molecular foundations and description of new cases

PubMed Central

LeDoux, Mark S.; Xiao, Jianfeng; Rudzińska, Monika; Bastian, Robert W.; Wszolek, Zbigniew K.; Van Gerpen, Jay A.; Puschmann, Andreas; Momčilović, Dragana; Vemula, Satya R.; Zhao, Yu

2012-01-01

An extensive variety of THAP1 sequence variants have been associated with focal, segmental and generalized dystonia with age of onset ranging from 3 to over 60 years. In previous work, we screened 1,114 subjects with mainly adult-onset primary dystonia (Neurology 2010;74:229-238) and identified 6 missense mutations in THAP1. For this report, we screened 750 additional subjects for mutations in coding regions of THAP1 and interrogated all published descriptions of THAP1 phenotypes (gender, age of onset, anatomical distribution of dystonia, family history and site of onset) to explore the possibility of THAP1 genotype-phenotype correlations and facilitate a deeper understanding of THAP1 pathobiology. We identified 5 additional missense mutations in THAP1 (p.A7D, p.K16E, p.S21C, p.R29Q, and p.I80V). Three of these variants are associated with appendicular tremors, which were an isolated or presenting sign in some of the affected subjects. Abductor laryngeal dystonia and mild blepharospasm can be manifestations of THAP1 mutations in some individuals. Overall, mean age of onset for THAP1 dystonia is 16.8 years and the most common sites of onset are the arm and neck, and the most frequently affected anatomical site is the neck. In addition, over half of patients exhibit either cranial or laryngeal involvement. Protein truncating mutations and missense mutations within the THAP domain of THAP1 tend to manifest at an earlier age and exhibit more extensive anatomical distributions than mutations localized to other regions of THAP1. PMID:22377579

Identification of eight novel mutations in a collaborative analysis of a part of the second transmembrane domain of the CFTR gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mercier, B.; Audrezet, M.P.; Guillermit, H.

Cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible, when mutated, for cystic fibrosis (CF), spans over 230 kb on the long arm of chromosome 7 and is composed of 27 exons. The most common mutation responsible for CF worldwide is the deletion of a phenylalanine amino acid at codon 508 in the first nucleotide-binding fold and accounts for approximately 70% of CF chromosomes studied. More than 250 other mutations have been reported through the CF Genetic Analysis Consortium. The majority of the mutations previously described lie in the two nucleotide-binding folds. To explore exhaustively other regions of the gene,more » particularly exons coding for transmembrane domains, the authors have initiated a collaborative study between different laboratories to screen 369 non-[Delta]F508 CF chromosomes of seven ethnic European populations (Belgian, French, Breton, Irish, Italian, Yugoslavian, Russian). Among these chromosomes carrying an unidentified mutation, 63 were from Brittany, 50 of various French origin, 45 of Irish origin, 56 of Italian origin, 41 of Belgian origin, 2 of Turkish origin, 38 of Yugoslavian origin, 22 of Russian origin, and 52 of Bulgarian origin. Diagnostic criteria for CF included at least one positive sweat test and pulmonary disease with or without pancreatic disease. Using a denaturing gradient gel electrophoresis (DGGE) assay, they have identified eight novel mutations in exon 17b coding for part of the second transmembrane domain of the CFTR and they describe them in this report. 8 refs., 1 fig., 1 tab.« less

Value of transmission electron microscopy for primary ciliary dyskinesia diagnosis in the era of molecular medicine: Genetic defects with normal and non-diagnostic ciliary ultrastructure.

PubMed

Shapiro, Adam J; Leigh, Margaret W

2017-01-01

Primary ciliary dyskinesia (PCD) is a genetic disorder causing chronic oto-sino-pulmonary disease. No single diagnostic test will detect all PCD cases. Transmission electron microscopy (TEM) of respiratory cilia was previously considered the gold standard diagnostic test for PCD, but 30% of all PCD cases have either normal ciliary ultrastructure or subtle changes which are non-diagnostic. These cases are identified through alternate diagnostic tests, including nasal nitric oxide measurement, high-speed videomicroscopy analysis, immunofluorescent staining of axonemal proteins, and/or mutation analysis of various PCD causing genes. Autosomal recessive mutations in DNAH11 and HYDIN produce normal TEM ciliary ultrastructure, while mutations in genes encoding for radial spoke head proteins result in some cross-sections with non-diagnostic alterations in the central apparatus interspersed with normal ciliary cross-sections. Mutations in nexin link and dynein regulatory complex genes lead to a collection of different ciliary ultrastructures; mutations in CCDC65, CCDC164, and GAS8 produce normal ciliary ultrastructure, while mutations in CCDC39 and CCDC40 cause absent inner dynein arms and microtubule disorganization in some ciliary cross-sections. Mutations in CCNO and MCIDAS cause near complete absence of respiratory cilia due to defects in generation of multiple cellular basal bodies; however, the scant cilia generated may have normal ultrastructure. Lastly, a syndromic form of PCD with retinal degeneration results in normal ciliary ultrastructure through mutations in the RPGR gene. Clinicians must be aware of these genetic causes of PCD resulting in non-diagnostic TEM ciliary ultrastructure and refrain from using TEM of respiratory cilia as a test to rule out PCD.

Cardiac muscle activation blunted by a mutation to the regulatory component, troponin T.

PubMed

Kobayashi, Minae; Debold, Edward P; Turner, Matthew A; Kobayashi, Tomoyoshi

2013-09-06

The striated muscle thin filament comprises actin, tropomyosin, and troponin. The Tn complex consists of three subunits, troponin C (TnC), troponin I (TnI), and troponin T (TnT). TnT may serve as a bridge between the Ca(2+) sensor (TnC) and the actin filament. In the short helix preceding the IT-arm region, H1(T2), there are known dilated cardiomyopathy-linked mutations (among them R205L). Thus we hypothesized that there is an element in this short helix that plays an important role in regulating the muscle contraction, especially in Ca(2+) activation. We mutated Arg-205 and several other amino acid residues within and near the H1(T2) helix. Utilizing an alanine replacement method to compare the effects of the mutations, the biochemical and mechanical impact on the actomyosin interaction was assessed by solution ATPase activity assay, an in vitro motility assay, and Ca(2+) binding measurements. Ca(2+) activation was markedly impaired by a point mutation of the highly conserved basic residue R205A, residing in the short helix H1(T2) of cTnT, whereas the mutations to nearby residues exhibited little effect on function. Interestingly, rigor activation was unchanged between the wild type and R205A TnT. In addition to the reduction in Ca(2+) sensitivity observed in Ca(2+) binding to the thin filament, myosin S1-ADP binding to the thin filament was significantly affected by the same mutation, which was also supported by a series of S1 concentration-dependent ATPase assays. These suggest that the R205A mutation alters function through reduction in the nature of cooperative binding of S1.

Dual redundant arm system operational quality measures and their applications - Dynamic measures

NASA Technical Reports Server (NTRS)

Lee, Sukhan; Kim, Sungbok

1990-01-01

Dual-arm dynamic operation quality measures are presented which quantify the efficiency and capability of generating Cartesian accelerations by two cooperative arms based on the analysis of dual-arm dynamic interactions. Dual-arm dynamic manipulability is defined as the efficiency of generating Cartesian accelerations under the dynamic and kinematic interactions between individual arms and an object under manipulation. The analysis of dual-arm dynamic interactions is based on the so-called Cartesian space agent model of an arm, which represents an individual arm as a force source acting upon a point mass with the effective Cartesian space arm dynamics and an environment or an object under manipulation. The Cartesian space agent model of an arm makes it possible to derive the dynamic and kinematic constraints involved in the transport, assembly and grasping modes of dual-arm cooperation. A task-oriented operational quality measure, (TOQd) is defined by evaluating dual-arm dynamic manipulability in terms of given task requirements. TOQd is used in dual-arm joint configuration optimization. Simulation results are shown. A complete set of forward dynamic equations for a dual-arm system is derived, and dual-arm dynamic operational quality measures for various modes of dual-arm cooperation allowing sliding contacts are established.

ZMYND10--Mutation Analysis in Slavic Patients with Primary Ciliary Dyskinesia.

PubMed

Kurkowiak, Małgorzata; Ziętkiewicz, Ewa; Greber, Agnieszka; Voelkel, Katarzyna; Wojda, Alina; Pogorzelski, Andrzej; Witt, Michał

2016-01-01

Primary ciliary dyskinesia (PCD) is a rare recessive disease with a prevalence of 1/10,000; its symptoms are caused by a kinetic dysfunction of motile cilia in the respiratory epithelium, flagella in spermatozoids, and primary cilia in the embryonic node. PCD is genetically heterogeneous: genotyping the already known PCD-related genes explains the genetic basis in 60-65% of the cases, depending on the population. While identification of new genes involved in PCD pathogenesis remains crucial, the search for new, population-specific mutations causative for PCD is equally important. The Slavs remain far less characterized in this respect compared to West European populations, which significantly limits diagnostic capability. The main goal of this study was to characterize the profile of causative genetic defects in one of the PCD-causing genes, ZMYND10, in the cohort of PCD patients of Slavic origin. The study was carried out using biological material from 172 unrelated PCD individuals of Polish origin, with no causative mutation found in nine major PCD genes. While none of the previously described mutations was found using the HRM-based screening, a novel frameshift mutation (c.367delC) in ZMYND10, unique for Slavic PCD population, was found in homozygous state in two unrelated PCD patients. Immunofluorescence analysis confirmed the absence of outer and inner dynein arms from the ciliary axoneme, consistent with the already published ZMYND10-mutated phenotype; cDNA analysis revealed the lack of ZMYND10 mRNA, indicating nonsense-mediated decay of the truncated transcript.

Patterns of motor activity in the isolated nerve cord of the octopus arm.

PubMed

Gutfreund, Yoram; Matzner, Henry; Flash, Tamar; Hochner, Binyamin

2006-12-01

The extremely flexible octopus arm provides a unique opportunity for studying movement control in a highly redundant motor system. We describe a novel preparation that allows analysis of the peripheral nervous system of the octopus arm and its interaction with the muscular and mechanosensory elements of the arm's intrinsic muscular system. First we examined the synaptic responses in muscle fibers to identify the motor pathways from the axial nerve cord of the arm to the surrounding musculature. We show that the motor axons project to the muscles via nerve roots originating laterally from the arm nerve cord. The motor field of each nerve is limited to the region where the nerve enters the arm musculature. The same roots also carry afferent mechanosensory information from the intrinsic muscle to the axial nerve cord. Next, we characterized the pattern of activity generated in the dorsal roots by electrically stimulating the axial nerve cord. The evoked activity, although far reaching and long lasting, cannot alone account for the arm extension movements generated by similar electrical stimulation. The mismatch between patterns of activity in the isolated cord and in an intact arm may stem from the involvement of mechanosensory feedback in natural arm extension.

Robotic system for retractable teleoperated arm within enclosed shell with capability of operating within a confined space

DOEpatents

Randolph, John David; Lloyd, Peter Downes; Love, Lonnie Joe; Kwon, Dong Soo; Blank, James Allen; Davis, Hurley Thomas

2001-01-01

An apparatus for performing a task in a confined space having an access port. The apparatus comprise: a confinement box securable to the access port of the confined space; a shell extending from the confinement box; a teleoperated arm movable between a retracted position, in which the teleoperated arm is disposed within the shell, and a deployed position, in which the teleoperated arm extends through the access port and into the confined space to perform the task; and a control system for commanding the teleoperated arm. The arm links and joint connectors of the teleoperated arm assembly are the conduits for the process

Conditional mutation of Smc5 in mouse embryonic stem cells perturbs condensin localization and mitotic progression.

PubMed

Pryzhkova, Marina V; Jordan, Philip W

2016-04-15

Correct duplication of stem cell genetic material and its appropriate segregation into daughter cells are requisites for tissue, organ and organism homeostasis. Disruption of stem cell genomic integrity can lead to developmental abnormalities and cancer. Roles of the Smc5/6 structural maintenance of chromosomes complex in pluripotent stem cell genome maintenance have not been investigated, despite its important roles in DNA synthesis, DNA repair and chromosome segregation as evaluated in other model systems. Using mouse embryonic stem cells (mESCs) with a conditional knockout allele of Smc5, we showed that Smc5 protein depletion resulted in destabilization of the Smc5/6 complex, accumulation of cells in G2 phase of the cell cycle and apoptosis. Detailed assessment of mitotic mESCs revealed abnormal condensin distribution and perturbed chromosome segregation, accompanied by irregular spindle morphology, lagging chromosomes and DNA bridges. Mutation of Smc5 resulted in retention of Aurora B kinase and enrichment of condensin on chromosome arms. Furthermore, we observed reduced levels of Polo-like kinase 1 at kinetochores during mitosis. Our study reveals crucial requirements of the Smc5/6 complex during cell cycle progression and for stem cell genome maintenance. © 2016. Published by The Company of Biologists Ltd.

Method and apparatus for hybrid position/force control of multi-arm cooperating robots

NASA Technical Reports Server (NTRS)

Hayati, Samad A. (Inventor)

1989-01-01

Two or more robotic arms having end effectors rigidly attached to an object to be moved are disclosed. A hybrid position/force control system is provided for driving each of the robotic arms. The object to be moved is represented as having a total mass that consists of the actual mass of the object to be moved plus the mass of the moveable arms that are rigidly attached to the moveable object. The arms are driven in a positive way by the hybrid control system to assure that each arm shares in the position/force applied to the object. The burden of actuation is shared by each arm in a non-conflicting way as the arm independently control the position of, and force upon, a designated point on the object.

Efficiency Improvement of Action Acquisition in Two-Link Robot Arm Using Fuzzy ART with Genetic Algorithm

NASA Astrophysics Data System (ADS)

Kotani, Naoki; Taniguchi, Kenji

An efficient learning method using Fuzzy ART with Genetic Algorithm is proposed. The proposed method reduces the number of trials by using a policy acquired in other tasks because a reinforcement learning needs a lot of the number of trials until an agent acquires appropriate actions. Fuzzy ART is an incremental unsupervised learning algorithm in responce to arbitrary sequences of analog or binary input vectors. Our proposed method gives a policy by crossover or mutation when an agent observes unknown states. Selection controls the category proliferation problem of Fuzzy ART. The effectiveness of the proposed method was verified with the simulation of the reaching problem for the two-link robot arm. The proposed method achieves a reduction of both the number of trials and the number of states.

A laboratory breadboard system for dual-arm teleoperation

NASA Technical Reports Server (NTRS)

Bejczy, A. K.; Szakaly, Z.; Kim, W. S.

1990-01-01

The computing architecture of a novel dual-arm teleoperation system is described. The novelty of this system is that: (1) the master arm is not a replica of the slave arm; it is unspecific to any manipulator and can be used for the control of various robot arms with software modifications; and (2) the force feedback to the general purpose master arm is derived from force-torque sensor data originating from the slave hand. The computing architecture of this breadboard system is a fully synchronized pipeline with unique methods for data handling, communication and mathematical transformations. The computing system is modular, thus inherently extendable. The local control loops at both sites operate at 100 Hz rate, and the end-to-end bilateral (force-reflecting) control loop operates at 200 Hz rate, each loop without interpolation. This provides high-fidelity control. This end-to-end system elevates teleoperation to a new level of capabilities via the use of sensors, microprocessors, novel electronics, and real-time graphics displays. A description is given of a graphic simulation system connected to the dual-arm teleoperation breadboard system. High-fidelity graphic simulation of a telerobot (called Phantom Robot) is used for preview and predictive displays for planning and for real-time control under several seconds communication time delay conditions. High fidelity graphic simulation is obtained by using appropriate calibration techniques.

Warfarin genotyping in a single PCR reaction for microchip electrophoresis.

PubMed

Poe, Brian L; Haverstick, Doris M; Landers, James P

2012-04-01

Warfarin is the most commonly prescribed oral anticoagulant medication but also is the second leading cause of emergency room visits for adverse drug reactions. Genetic testing for warfarin sensitivity may reduce hospitalization rates, but prospective genotyping is impeded in part by the turnaround time and costs of genotyping. Microfluidics-based assays can reduce reagent consumption and analysis time; however, no current assay has integrated multiplexed allele-specific PCR for warfarin genotyping with electrophoretic microfluidics hardware. Ideally, such an assay would use a single PCR reaction and, without further processing, a single microchip electrophoresis (ME) run to determine the 3 single-nucleotide polymorphisms (SNPs) affecting warfarin sensitivity [i.e., CYP2C9 (cytochrome P450, family 2, subfamily C, polypeptide 9) *2, CYP2C9 *3, and the VKORC1 (vitamin K epoxide reductase complex 1) A/B haplotype]. We designed and optimized primers for a fully multiplexed assay to examine 3 biallelic SNPs with the tetraprimer amplification refractory mutation system (T-ARMS). The assay was developed with conventional PCR equipment and demonstrated for microfluidic infrared-mediated PCR. Genotypes were determined by ME on the basis of the pattern of PCR products. Thirty-five samples of human genomic DNA were analyzed with this multiplex T-ARMS assay, and 100% of the genotype determinations agreed with the results obtained by other validated methods. The sample population included several genotypes conferring warfarin sensitivity, with both homozygous and heterozygous genotypes for each SNP. Total analysis times for the PCR and ME were approximately 75 min (1-sample run) and 90 min (12-sample run). This multiplexed T-ARMS assay coupled with microfluidics hardware constitutes a promising avenue for an inexpensive and rapid platform for warfarin genotyping.

Transforaminal lumbar interbody graft placement using an articulating delivery arm facilitates increased segmental lordosis with superior anterior and midline graft placement.

PubMed

Shau, David N; Parker, Scott L; Mendenhall, Stephen K; Zuckerman, Scott L; Godil, Saniya S; Devin, Clinton J; McGirt, Matthew J

2015-05-01

Transforaminal lumbar interbody fusion (TLIF) is a frequently performed method of lumbar arthrodesis in patients failing medical management of back and leg pain. Accurate placement of the interbody graft and restoration of lordosis has been shown to be crucial when performing lumbar fusion procedures. We performed a single-surgeon, prospective, randomized study to determine whether a novel articulating versus traditional straight graft delivery arm system allows for superior graft placement and increased lordosis for single-level TLIF. Thirty consecutive patients undergoing single-level TLIF were included and prospectively randomized to one of the 2 groups (articulated vs. straight delivery arm system). Three radiographic characteristics were evaluated at 6-week follow-up: (1) degree of segmental lumbar lordosis at the fused level; (2) the percent anterior location of the interbody graft in disk space; and (3) the distance (mm) off midline of the interbody graft placement. Randomization yielded 16 patients in the articulated delivery arm cohort and 14 in the straight delivery arm cohort. The articulating delivery arm system yielded an average of 14.7-degree segmental lordosis at fused level, 35% anterior location, and 3.6 mm off midline. The straight delivery arm system yielded an average of 10.7-degree segmental lordosis at fused level, 46% anterior location, and 7.0 mm off midline. All 3 comparisons were statistically significant (P<0.05). The study suggests that an articulating delivery arm system facilitates superior anterior and midline TLIF graft placement allowing for increased segmental lordosis compared with a traditional straight delivery arm system.

BRD4-targeted therapy induces Myc-independent cytotoxicity in Gnaq/11-mutatant uveal melanoma cells.

PubMed

Ambrosini, Grazia; Sawle, Ashley D; Musi, Elgilda; Schwartz, Gary K

2015-10-20

Uveal melanoma (UM) is an aggressive intraocular malignancy with limited therapeutic options. Both primary and metastatic UM are characterized by oncogenic mutations in the G-protein alpha subunit q and 11. Furthermore, nearly 40% of UM has amplification of the chromosomal arm 8q and monosomy of chromosome 3, with consequent anomalies of MYC copy number. Chromatin regulators have become attractive targets for cancer therapy. In particular, the bromodomain and extra-terminal (BET) inhibitor JQ1 has shown selective inhibition of c-Myc expression with antiproliferative activity in hematopoietic and solid tumors. Here we provide evidence that JQ1 had cytotoxic activity in UM cell lines carrying Gnaq/11 mutations, while in cells without the mutations had little effects. Using microarray analysis, we identified a large subset of genes modulated by JQ1 involved in the regulation of cell cycle, apoptosis and DNA repair. Further analysis of selected genes determined that the concomitant silencing of Bcl-xL and Rad51 represented the minimal requirement to mimic the apoptotic effects of JQ1 in the mutant cells, independently of c-Myc. In addition, administration of JQ1 to mouse xenograft models of Gnaq-mutant UM resulted in significant inhibition of tumor growth.Collectively, our results define BRD4 targeting as a novel therapeutic intervention against UM with Gnaq/Gna11 mutations.

The Red Queen in mitochondria: cyto-nuclear co-evolution, hybrid breakdown and human disease

PubMed Central

Chou, Jui-Yu; Leu, Jun-Yi

2015-01-01

Cyto-nuclear incompatibility, a specific form of Dobzhansky-Muller incompatibility caused by incompatible alleles between mitochondrial and nuclear genomes, has been suggested to play a critical role during speciation. Several features of the mitochondrial genome (mtDNA), including high mutation rate, dynamic genomic structure, and uniparental inheritance, make mtDNA more likely to accumulate mutations in the population. Once mtDNA has changed, the nuclear genome needs to play catch-up due to the intimate interactions between these two genomes. In two populations, if cyto-nuclear co-evolution is driven in different directions, it may eventually lead to hybrid incompatibility. Although cyto-nuclear incompatibility has been observed in a wide range of organisms, it remains unclear what type of mutations drives the co-evolution. Currently, evidence supporting adaptive mutations in mtDNA remains limited. On the other hand, it has been known that some mutations allow mtDNA to propagate more efficiently but compromise the host fitness (described as selfish mtDNA). Arms races between such selfish mtDNA and host nuclear genomes can accelerate cyto-nuclear co-evolution and lead to a phenomenon called the Red Queen Effect. Here, we discuss how the Red Queen Effect may contribute to the frequent observation of cyto-nuclear incompatibility and be the underlying driving force of some human mitochondrial diseases. PMID:26042149

Chemotherapeutics-resistance "arms" race: An update on mechanisms involved in resistance limiting EGFR inhibitors in lung cancer.

PubMed

Singh, Pankaj Kumar; Silakari, Om

2017-10-01

Clinical reports suggest that EGFR-mutated lung cancer usually respond significantly towards small molecule tyrosine kinase inhibitors. Same studies also report the eventual development of acquired resistance within a median time interval of 9 to 14months. One of the major mechanisms involved in this acquired resistance was found to be a secondary point mutation at gate-keeper residue, EGFR T790M. However, there are other recent studies which disclose the role of few other novel key players such as, ZEB1, TOPK etc., in the development of tolerance towards the EGFR TKI's, along with other commonly known mechanisms, such as amplification of signalling pathways such as, c-MET, Erbb2, AXL, additional acquired secondary mutations (PIK3CA, BRAF), or phenotypic transformation (small cell or epithelial to mesenchymal transitions). Interestingly, a recent study showed development of resistance via another point mutation, C797S, in case of tumors which were previously resistant and were administered agents capable of overcoming T790M gatekeeper mutation based resistance. Thus, raising serious concern over the direction of drug development involving tyrosine kinases such as EGFR. Current approaches focussing on development of third generation inhibitors, dual inhibitors or inhibitors of HSP90 have shown significant activity but do not answer the long term question of resistance. Copyright © 2017 Elsevier Inc. All rights reserved.

48 CFR 225.7703 - Acquisition of products or services other than small arms.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false Acquisition of products or services other than small arms. 225.7703 Section 225.7703 Federal Acquisition Regulations System DEFENSE... than small arms. ...

48 CFR 225.7703 - Acquisition of products or services other than small arms.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Acquisition of products or services other than small arms. 225.7703 Section 225.7703 Federal Acquisition Regulations System DEFENSE... than small arms. ...

48 CFR 225.7703 - Acquisition of products or services other than small arms.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false Acquisition of products or services other than small arms. 225.7703 Section 225.7703 Federal Acquisition Regulations System DEFENSE... than small arms. ...

Variability of sweat chloride concentration in subjects with cystic fibrosis and G551D mutations.

PubMed

Vermeulen, F; Le Camus, C; Davies, J C; Bilton, D; Milenković, D; De Boeck, K

2017-01-01

Sweat chloride concentration, a biomarker of CFTR function, is an appropriate outcome parameter in clinical trials aimed at correcting the basic CF defect. Although there is consensus on a cut-off value to diagnose CF, we have only limited information on the within subject variability of sweat chloride over time. Such information would be useful for sample size calculations in clinical trials. Therefore, we retrospectively analyzed repeated sweat chloride values obtained in patients with G551D mutation(s) assigned to placebo in an ivacaftor interventional trial. In subjects with G551D at least 12years of age, a pilocarpine sweat test using Macroduct collector was taken on both arms at 8 time points over 48weeks. We explored 1062 pilocarpine sweat test values obtained in 78 placebo patients of the VX08-770-102 trial. Mean overall sweat chloride value (all patients, all tests, n=1062) was 100.8mmol/L (SD 12.7mmol/L). Using a multilevel mixed model, the between-subject standard deviation (SD) for sweat chloride was 8.9mmol/L (95% CI 7.4-10.6) and within-subject SD was 8.1mmol/L (95% CI 7.5-8.7). Limits of repeatability for repeat measurements were -19.7 to +21.6mmol/L using values from one arm, and -13.3 to 11.8mmol/L using mean of values obtained at 4 test occasions. Sample size calculations showed that the minimal treatment effect on sweat chloride concentration that can be demonstrated for a group of 5 patients is around 15mmol/L, using a cross-over design and combinations of 4 tests for each phase of the trial. Although the sweat test is considered a robust measure, sweat chloride measurements in patients with CF and a G551D mutation had an inherent biological variability that is higher than commonly considered. Further analyses of placebo group data are crucial to learn more about the natural variability of this outcome parameter. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Dexterous Humanoid Robotic Wrist

NASA Technical Reports Server (NTRS)

Ihrke, Chris A. (Inventor); Bridgwater, Lyndon (Inventor); Reich, David M. (Inventor); Wampler, II, Charles W. (Inventor); Askew, Scott R. (Inventor); Diftler, Myron A. (Inventor); Nguyen, Vienny (Inventor)

2013-01-01

A humanoid robot includes a torso, a pair of arms, a neck, a head, a wrist joint assembly, and a control system. The arms and the neck movably extend from the torso. Each of the arms includes a lower arm and a hand that is rotatable relative to the lower arm. The wrist joint assembly is operatively defined between the lower arm and the hand. The wrist joint assembly includes a yaw axis and a pitch axis. The pitch axis is disposed in a spaced relationship to the yaw axis such that the axes are generally perpendicular. The pitch axis extends between the yaw axis and the lower arm. The hand is rotatable relative to the lower arm about each of the yaw axis and the pitch axis. The control system is configured for determining a yaw angle and a pitch angle of the wrist joint assembly.

RM-10A robotic manipulator system

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, J.R.; Coughlan, J.B.; Harvey, H.W.

1988-01-01

The REMOTE RM-10A is a man-replacement manipulator system that has been developed specifically for use in radioactive and other hazardous environments. It can be teleoperated, with man-in-the-loop, for unstructured tasks or programmed to perform routine tasks automatically much like robots in the automated manufacturing industry. The RM-10A is a servomanipulator utilizing a closed-loop, microprocessor-based control system. The system consists of a slave assembly, master control station, and interconnecting cabling. The slave assembly is the part of the system that enters the hostile environment. It is man-like is size and configuration with two identical arms attached to a torso structure. Eachmore » arm attaches to the torso using two captive screws and two guide pins. The guide pins position and stabilize an arm during removal and reinstallation and also align the two electrical connectors located in the arm support plate and torso. These features allow easy remote replacement of an arm, and commonality of the arms allow interchangeability. The water-resistant slave assembly is equipped with gaskets and O-ring seals in the torso and arm and camera assemblies. In addition, each slave arm's elbow, wrist, and tong are protected by replaceable polyurethane boots. An upper camera assembly, consisting of a color television (TV) camera, 6:1 zoom lens, and a pan/tilt unit, mount to the torso to provide remote viewing capability.« less

454 next generation-sequencing outperforms allele-specific PCR, Sanger sequencing, and pyrosequencing for routine KRAS mutation analysis of formalin-fixed, paraffin-embedded samples

PubMed Central

Altimari, Annalisa; de Biase, Dario; De Maglio, Giovanna; Gruppioni, Elisa; Capizzi, Elisa; Degiovanni, Alessio; D’Errico, Antonia; Pession, Annalisa; Pizzolitto, Stefano; Fiorentino, Michelangelo; Tallini, Giovanni

2013-01-01

Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen®) real-time polymerase chain reaction (PCR), pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA), evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03), percentage of mutation for pyrosequencing (P = 0.001), ratio for chip array hybridization (P = 0.003), and percentage of mutation for 454 next-generation sequencing (P = 0.004). Also, 454 next-generation sequencing showed the best cross correlation for quantification of mutation abundance compared with all the other methods (P < 0.001). Our comparison showed the superiority of next-generation sequencing over the other techniques in terms of sensitivity and specificity. Next-generation sequencing will replace Sanger sequencing as the reference technique for diagnostic detection of KRAS mutation in archival tumor tissues. PMID:23950653

Vector-algebra approach to extract Denavit-Hartenberg parameters of assembled robot arms

NASA Technical Reports Server (NTRS)

Barker, L. K.

1983-01-01

The Denavit-Hartenberg parameters characterize the joint axis systems in a robot arm and, naturally, appear in the transformation matrices from one joint axis system to another. These parameters are needed in the control of robot arms and in the passage of sensor information along the arm. This paper presents a vector algebra method to determine these parameters for any assembled robot arm. The idea is to measure the location of the robot hand (or extension) for different joint angles and then use these measurements to calculate the parameters.

Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

PubMed Central

Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

2009-01-01

SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

Molecular characterization of the breakpoints of a 12-kb deletion in the NF1 gene in a family showing germ-line mosaicism.

PubMed Central

Lázaro, C; Gaona, A; Lynch, M; Kruyer, H; Ravella, A; Estivill, X

1995-01-01

Neurofibromatosis type 1 (NF1) is caused by deletions, insertions, translocations, and point mutations in the NF1 gene, which spans 350 kb on the long arm of human chromosome 17. Although several point mutations have been described, large molecular abnormalities have rarely been characterized in detail. We describe here the molecular breakpoints of a 12-kb deletion of the NF1 gene, which is responsible for the NF1 phenotype in a kindred with two children affected because of germline mosaicism in the unaffected father, who has the mutation in 10% of his spermatozoa. The mutation spans introns 31-39, removing 12,021 nt and inserting 30 bp, of which 19 bp are a direct repetition of a sequence located in intron 31, just 4 bp before the 5' breakpoint. The 5' and 3' breakpoints contain the sequence TATTTTA, which could be involved in the generation of the deletion. The most plausible explanation for the mechanism involved in the generation of this 12-kb deletion is homologous/nonhomologous recombination. Since sperm of the father does not contain the corresponding insertion of the 12-kb deleted sequence, this deletion could have occurred within the NF1 chromosome through loop formation. RNA from lymphocytes of one of the NF1 patients showed similar levels of the mutated and normal transcripts, suggesting that the NF1-mRNA from mutations causing frame shifts of the reading frame or stop codons in this gene is not degraded during its processing. The mutation was not detected in fresh lymphocytes from the unaffected father by PCR analysis, supporting the case for true germ-line mosaicism. Images Figure 1 Figure 3 PMID:7485153

Efficacy of artesunate + sulphadoxine/pyrimethamine and artemether + lumefantrine and dhfr and dhps mutations in Somalia: evidence for updating the malaria treatment policy.

PubMed

Warsame, Marian; Hassan, Abdikarim Hussein; Hassan, Abdillahi Mohamed; Arale, Abdulkadir Mohamed; Jibril, Ali Mohamed; Mohamud, Said Abdulkadir; Barrette, Amy; Muse, Abdikarim Yusuf; Yusuf, Fahmi Essa; Nada, Rania A; Amran, Jamal Ghilan Hefzullah

2017-04-01

To determine the therapeutic efficacy of artesunate + sulphadoxine/pyrimethamine (AS + SP) and artemether + lumefantrine (AL), and to investigate the presence of molecular mutations associated with resistance, to inform national malaria treatment policy. One-arm prospective studies were conducted in three study sites in Somalia in 2013 and 2015 to evaluate the efficacy of AS + SP and AL among patients with uncomplicated falciparum malaria. Outcomes included clinical and parasitological response over 28 days, and the presence of dihydrofolate reductase (dfhr) and dihydropteroate synthase (dhps) and mutations. Among patients treated with AS + SP, the PCR-corrected treatment failure rate was 12.3%. The majority of patients (89%) carried either the quintuple mutations (51I/108N + 437G/540E/581G or 51I/59R/108N + 437G/540E) or the quadruple mutation (51I/108N + 437G/540E). All patients who failed treatment with AS + SP carried the quintuple mutation (51I/108N + 437G/540E/581G). In the studies of AL, the PCR-corrected treatment failure rate was <6%. All patients in both treatment groups cleared their parasitaemia by day 3. The findings demonstrate a failing first-line treatment (AS + SP), with a failure rate above the threshold (10%) for policy change, and a high prevalence of quintuple mutations. In contrast, AL was highly efficacious. Based on these findings and the results from a previous AS + SP study, AL was selected to replace AS + SP as the first-line treatment for uncomplicated malaria in Somalia in 2016. Dihydroartemisinin + piperaquine (DHA + PPQ) has been recommended as the second-line treatment. Routine monitoring of recommended ACTs should continue to inform treatment policy. © 2017 John Wiley & Sons Ltd.

A low-cost tracked C-arm (TC-arm) upgrade system for versatile quantitative intraoperative imaging.

PubMed

Amiri, Shahram; Wilson, David R; Masri, Bassam A; Anglin, Carolyn

2014-07-01

C-arm fluoroscopy is frequently used in clinical applications as a low-cost and mobile real-time qualitative assessment tool. C-arms, however, are not widely accepted for applications involving quantitative assessments, mainly due to the lack of reliable and low-cost position tracking methods, as well as adequate calibration and registration techniques. The solution suggested in this work is a tracked C-arm (TC-arm) which employs a low-cost sensor tracking module that can be retrofitted to any conventional C-arm for tracking the individual joints of the device. Registration and offline calibration methods were developed that allow accurate tracking of the gantry and determination of the exact intrinsic and extrinsic parameters of the imaging system for any acquired fluoroscopic image. The performance of the system was evaluated in comparison to an Optotrak[Formula: see text] motion tracking system and by a series of experiments on accurately built ball-bearing phantoms. Accuracies of the system were determined for 2D-3D registration, three-dimensional landmark localization, and for generating panoramic stitched views in simulated intraoperative applications. The system was able to track the center point of the gantry with an accuracy of [Formula: see text] mm or better. Accuracies of 2D-3D registrations were [Formula: see text] mm and [Formula: see text]. Three-dimensional landmark localization had an accuracy of [Formula: see text] of the length (or [Formula: see text] mm) on average, depending on whether the landmarks were located along, above, or across the table. The overall accuracies of the two-dimensional measurements conducted on stitched panoramic images of the femur and lumbar spine were 2.5 [Formula: see text] 2.0 % [Formula: see text] and [Formula: see text], respectively. The TC-arm system has the potential to achieve sophisticated quantitative fluoroscopy assessment capabilities using an existing C-arm imaging system. This technology may be useful to improve the quality of orthopedic surgery and interventional radiology.

49 CFR 234.223 - Gate arm.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 4 2013-10-01 2013-10-01 false Gate arm. 234.223 Section 234.223 Transportation... SYSTEMS Maintenance, Inspection, and Testing Maintenance Standards § 234.223 Gate arm. Each gate arm, when... maintained in a condition sufficient to be clearly viewed by approaching highway users. Each gate arm shall...

49 CFR 234.223 - Gate arm.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 4 2012-10-01 2012-10-01 false Gate arm. 234.223 Section 234.223 Transportation... SYSTEMS Maintenance, Inspection, and Testing Maintenance Standards § 234.223 Gate arm. Each gate arm, when... maintained in a condition sufficient to be clearly viewed by approaching highway users. Each gate arm shall...

49 CFR 234.223 - Gate arm.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 4 2014-10-01 2014-10-01 false Gate arm. 234.223 Section 234.223 Transportation... SYSTEMS Maintenance, Inspection, and Testing Maintenance Standards § 234.223 Gate arm. Each gate arm, when... maintained in a condition sufficient to be clearly viewed by approaching highway users. Each gate arm shall...

48 CFR 908.7111 - Arms and ammunition.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Arms and ammunition. 908.7111 Section 908.7111 Federal Acquisition Regulations System DEPARTMENT OF ENERGY COMPETITION ACQUISITION PLANNING REQUIRED SOURCES OF SUPPLIES AND SERVICES Acquisition of Special Items 908.7111 Arms and...

Incidence of the Hb E [β26(B8)Glu→Lys, GAG>AAG] variant in Totos, one of the smallest primitive tribes in the world.

PubMed

Bhattacharyya, Deboshree; Mukhopadhyay, Ashis; Chakraborty, Abhijit; Dasgupta, Swati; Mukhopadhyay, Soma; Pal, Nabamita; Basak, Jayasri

2013-01-01

Toto is one of the smallest tribes in the world. This primitive sub Himalayan, endogamous tribe lives in a small, isolated village called Totopara in the Jalpaiguri district of West Bengal in India. The tribal communities of West Bengal are vulnerable to various genetic disorders such as β-thalassemia (β-thal). We have studied 443 Totos to define their Hb E [β26(B8)Glu→Lys, GAG>AAG] status. Awareness and screening camps have been organized in various parts of Totopara during the last 2 years. We collected 3 mL peripheral blood from each individual aseptically on which to use the naked eye single tube red cell osmotic fragility test (NESTROFT); complete hemogram and high performance liquid chromatography (HPLC) were done to detect their carrier status. The Hb E variant had been found to be prevalent among the Totos. To confirm the codon 26 (GAG>AAG) mutation in the β-globin gene, amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) was performed. Restriction fragment length polymorphism (RFLP)-PCR was carried out with 44 Hb E alleles to construct the haplotype(s) of the Totos. Our extensive studies have revealed that 49.21% of Totos are Hb E heterozygotes and 19.19% Totos are Hb E homozygotes. The most prevalent haplotype linked with the codon 26 mutation in the Totos is [+ - - - - -] (HincII 5'ϵ, HindIII (G)γ, HindIII (A)γ, HincII 5'ψβ, HincII 3'ψβ and HinfI 3'β). Consanguineous marriages have resulted in a significant increase of the percentages of heterozygotes and homozygotes of Hb E in the Totos. Genetic counseling is essential and important to prevent the spread of this mutation and hence to save them from having any kind of clinically significant hemoglobinopathy in the future.

Evaluation of computational endomicroscopy architectures for minimally-invasive optical biopsy

NASA Astrophysics Data System (ADS)

Dumas, John P.; Lodhi, Muhammad A.; Bajwa, Waheed U.; Pierce, Mark C.

2017-02-01

We are investigating compressive sensing architectures for applications in endomicroscopy, where the narrow diameter probes required for tissue access can limit the achievable spatial resolution. We hypothesize that the compressive sensing framework can be used to overcome the fundamental pixel number limitation in fiber-bundle based endomicroscopy by reconstructing images with more resolvable points than fibers in the bundle. An experimental test platform was assembled to evaluate and compare two candidate architectures, based on introducing a coded amplitude mask at either a conjugate image or Fourier plane within the optical system. The benchtop platform consists of a common illumination and object path followed by separate imaging arms for each compressive architecture. The imaging arms contain a digital micromirror device (DMD) as a reprogrammable mask, with a CCD camera for image acquisition. One arm has the DMD positioned at a conjugate image plane ("IP arm"), while the other arm has the DMD positioned at a Fourier plane ("FP arm"). Lenses were selected and positioned within each arm to achieve an element-to-pixel ratio of 16 (230,400 mask elements mapped onto 14,400 camera pixels). We discuss our mathematical model for each system arm and outline the importance of accounting for system non-idealities. Reconstruction of a 1951 USAF resolution target using optimization-based compressive sensing algorithms produced images with higher spatial resolution than bicubic interpolation for both system arms when system non-idealities are included in the model. Furthermore, images generated with image plane coding appear to exhibit higher spatial resolution, but more noise, than images acquired through Fourier plane coding.

Research on the man in the loop control system of the robot arm based on gesture control

NASA Astrophysics Data System (ADS)

Xiao, Lifeng; Peng, Jinbao

2017-03-01

The Man in the loop control system of the robot arm based on gesture control research complex real-world environment, which requires the operator to continuously control and adjust the remote manipulator, as the background, completes the specific mission human in the loop entire system as the research object. This paper puts forward a kind of robot arm control system of Man in the loop based on gesture control, by robot arm control system based on gesture control and Virtual reality scene feedback to enhance immersion and integration of operator, to make operator really become a part of the whole control loop. This paper expounds how to construct a man in the loop control system of the robot arm based on gesture control. The system is a complex system of human computer cooperative control, but also people in the loop control problem areas. The new system solves the problems that the traditional method has no immersion feeling and the operation lever is unnatural, the adjustment time is long, and the data glove mode wears uncomfortable and the price is expensive.

21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

Code of Federal Regulations, 2012 CFR

2012-04-01

... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

Code of Federal Regulations, 2013 CFR

2013-04-01

... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

Code of Federal Regulations, 2011 CFR

2011-04-01

... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

Code of Federal Regulations, 2014 CFR

2014-04-01

... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

Correlation of somatic mutations and clinical outcome in melanoma patients treated with carboplatin, paclitaxel, and sorafenib

PubMed Central

Wilson, Melissa A.; Zhao, Fengmin; Letrero, Richard; D’Andrea, Kurt; Rimm, David L.; Kirkwood, John M.; Kluger, Harriet M.; Lee, Sandra J.; Schuchter, Lynn M.; Flaherty, Keith T.; Nathanson, Katherine L.

2014-01-01

Purpose Sorafenib is an inhibitor of VEGFR, PDGFR, and RAF kinases, amongst others. We assessed the association of somatic mutations with clinicopathologic features and clinical outcomes in patients with metastatic melanoma treated on E2603, comparing treatment with carboplatin, paclitaxel +/− sorafenib (CP vs. CPS). Experimental Design Pre-treatment tumor samples from 179 unique individuals enrolled on E2603 were analyzed. Genotyping was performed using a custom iPlex panel interrogating 74 mutations in 13 genes. Statistical analysis was performed using Fisher’s exact test, logistic regression, and Cox’s proportional-hazards models. Progression free survival and overall survival were estimated using Kaplan-Meier methods. Results BRAF and NRAS mutations were found at frequencies consistent with other metastatic melanoma cohorts. BRAF-mutant melanoma was associated with worse performance status, increased number of disease sites, and younger age at diagnosis; NRAS-mutant melanoma was associated with better performance status, fewer sites of disease, and female gender. BRAF and NRAS mutations were not significantly predictive of response or survival when treated with CPS vs. CP. However, patients with NRAS-mutant melanoma trended towards a worse response and PFS on CP than those with BRAF-mutant or WT/WT melanoma, an association that was reversed for this group on the CPS arm. Conclusions This study of somatic mutations in melanoma is the last prospectively collected phase III clinical trial population prior to the era of BRAF targeted therapy. A trend towards improved clinical response in patients with NRAS-mutant melanoma treated with CPS was observed, possibly due to sorafenib’s effect on CRAF. PMID:24714776

Structural and functional role of bases 32 and 33 in the anticodon loop of yeast mitochondrial tRNAIle

PubMed Central

Montanari, Arianna; De Luca, Cristina; Di Micco, Patrizio; Morea, Veronica; Frontali, Laura; Francisci, Silvia

2011-01-01

Previous work has demonstrated the usefulness of the yeast model to investigate the molecular mechanisms underlying defects due to base substitutions in mitochondrial tRNA genes, and to identify suppressing molecules endowed with potential clinical relevance. The present paper extends these investigations to two human equivalent yeast mutations located at positions 32 and 33 in the anticodon loop of tRNAIle. Notwithstanding the proximity of the two T>C base substitutions, the effects of these mutations have been found to be quite different in yeast, as they are in human. The T32C substitution has a very severe effect in yeast, consisting in a complete inhibition of growth on nonfermentable substrates. Conversely, respiratory defects caused by the T33C mutation could only be observed in a defined genetic context. Analyses of available sequences and selected tRNA three-dimensional structures were performed to provide explanations for the different behavior of these adjacent mutations. Examination of the effects of previously identified suppressors demonstrated that overexpression of the TUF1 gene did not rescue the defective phenotypes determined by either mutation, possibly as a consequence of the lack of interactions between EF-Tu and the tRNA anticodon arm in known structures. On the contrary, both the cognate IleRS and the noncognate LeuRS and ValRS are endowed with suppressing activities toward both mutations. This allows us to extend to the tRNAIle mutants the cross-suppression activity of aminoacyl-tRNA synthetases previously demonstrated for tRNALeu and tRNAVal mutants. PMID:21914842

Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.

PubMed

Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E

2016-04-07

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

The Genetics of a Small Chromosome Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. IV: Scutoid, an Antimorphic Mutation

PubMed Central

Ashburner, M.; Tsubota, S.; Woodruff, R. C.

1982-01-01

Exchange mapping locates the dominant mutation Scutoid to the right of Adh on chromosome arm 2L of D. melanogaster. However, deletion mapping indicates that Sco is to the left of Adh. The phenotype of Sco is sensitive to mutation, or deletion, of noc+ and of three genes, el, l(2)br22, and l(2)br29 mapping immediately distal to noc. The four contiguous loci, el, l(2)br22, l(2)br29 and noc, although separable by deletion end points, interact, because certain (or all) alleles of these four loci show partial failure of complementation, or even negative complementation. The simplest hypothesis is that Sco is a small reciprocal transposition, the genes noc, osp, and Adh exchanging places with three genes normally mapping proximal to them: l(2)br34, l(2)br35 and rd. The Sco phenotype is thought to result from a position effect at the newly created noc/l(2)br28 junction. PMID:6816673

Interactions of the innate and adaptive arms of the immune system in the pathogenesis of spondyloarthritis

PubMed Central

Stoll, Matthew L

2011-01-01

The immune system can be divided into the innate and adaptive arms. Historically, most of the research into the pathogenesis of spondyloarthritis (SpA) and other types of chronic arthritis focused on the adaptive immune system. Recently, the pendulum has shifted, and much current work in SpA focuses on innate immunity. Herein, I summarize evidence demonstrating that both the innate and the adaptive arms of the immune system are involved in the pathogenesis of SpA, propose a mechanism in which both arms interact to maintain chronic arthritis, and discuss potential research directions. PMID:21269576

In Vivo Orientation of Single Myosin Lever Arms in Zebrafish Skeletal Muscle

PubMed Central

Sun, Xiaojing; Ekker, Stephen C.; Shelden, Eric A.; Takubo, Naoko; Wang, Yihua; Burghardt, Thomas P.

2014-01-01

Cardiac and skeletal myosin assembled in the muscle lattice power contraction by transducing ATP free energy into the mechanical work of moving actin. Myosin catalytic/lever-arm domains comprise the transduction/mechanical coupling machinery that move actin by lever-arm rotation. In vivo, myosin is crowded and constrained by the fiber lattice as side chains are mutated and otherwise modified under normal, diseased, or aging conditions that collectively define the native myosin environment. Single-myosin detection uniquely defines bottom-up characterization of myosin functionality. The marriage of in vivo and single-myosin detection to study zebrafish embryo models of human muscle disease is a multiscaled technology that allows one-to-one registration of a selected myosin molecular alteration with muscle filament-sarcomere-cell-fiber-tissue-organ- and organism level phenotypes. In vivo single-myosin lever-arm orientation was observed at superresolution using a photoactivatable-green-fluorescent-protein (PAGFP)-tagged myosin light chain expressed in zebrafish skeletal muscle. By simultaneous observation of multiphoton excitation fluorescence emission and second harmonic generation from myosin, we demonstrated tag specificity for the lever arm. Single-molecule detection used highly inclined parallel beam illumination and was verified by quantized photoactivation and photobleaching. Single-molecule emission patterns from relaxed muscle in vivo provided extensive superresolved dipole orientation constraints that were modeled using docking scenarios generated for the myosin (S1) and GFP crystal structures. The dipole orientation data provided sufficient constraints to estimate S1/GFP coordination. The S1/GFP coordination in vivo is rigid and the lever-arm orientation distribution is well-ordered in relaxed muscle. For comparison, single myosins in relaxed permeabilized porcine papillary muscle fibers indicated slightly differently oriented lever arms and rigid S1/GFP coordination. Lever arms in both muscles indicated one preferred spherical polar orientation and widely distributed azimuthal orientations relative to the fiber symmetry axis. Cardiac myosin is more radially displaced from the fiber axis. Probe rigidity implies the PAGFP tag reliably indicates cross-bridge orientation in situ and in vivo. PMID:25229148

A randomized phase II study of the MEK1/MEK2 inhibitor trametinib (GSK1120212) compared with docetaxel in KRAS-mutant advanced non-small-cell lung cancer (NSCLC)†

PubMed Central

Blumenschein, G. R.; Smit, E. F.; Planchard, D.; Kim, D.-W.; Cadranel, J.; De Pas, T.; Dunphy, F.; Udud, K.; Ahn, M.-J.; Hanna, N. H.; Kim, J.-H.; Mazieres, J.; Kim, S.-W.; Baas, P.; Rappold, E.; Redhu, S.; Puski, A.; Wu, F. S.; Jänne, P. A.

2015-01-01

Background KRAS mutations are detected in 25% of non-small-cell lung cancer (NSCLC) and no targeted therapies are approved for this subset population. Trametinib, a selective allosteric inhibitor of MEK1/MEK2, demonstrated preclinical and clinical activity in KRAS-mutant NSCLC. We report a phase II trial comparing trametinib with docetaxel in patients with advanced KRAS-mutant NSCLC. Patients and methods Eligible patients with histologically confirmed KRAS-mutant NSCLC previously treated with one prior platinum-based chemotherapy were randomly assigned in a ratio of 2 : 1 to trametinib (2 mg orally once daily) or docetaxel (75 mg/m2 i.v. every 3 weeks). Crossover to the other arm after disease progression was allowed. Primary end point was progression-free survival (PFS). The study was prematurely terminated after the interim analysis of 92 PFS events, which showed the comparison of trametinib versus docetaxel for PFS crossed the futility boundary. Results One hundred and twenty-nine patients with KRAS-mutant NSCLC were randomized; of which, 86 patients received trametinib and 43 received docetaxel. Median PFS was 12 weeks in the trametinib arm and 11 weeks in the docetaxel arm (hazard ratio [HR] 1.14; 95% CI 0.75–1.75; P = 0.5197). Median overall survival, while the data are immature, was 8 months in the trametinib arm and was not reached in the docetaxel arm (HR 0.97; 95% CI 0.52–1.83; P = 0.934). There were 10 (12%) partial responses (PRs) in the trametinib arm and 5 (12%) PRs in the docetaxel arm (P = 1.0000). The most frequent adverse events (AEs) in ≥20% of trametinib patients were rash, diarrhea, nausea, vomiting, and fatigue. The most frequent grade 3 treatment-related AEs in the trametinib arm were hypertension, rash, diarrhea, and asthenia. Conclusion Trametinib showed similar PFS and a response rate as docetaxel in patients with previously treated KRAS-mutant-positive NSCLC. Clinicaltrials.gov registration number NCT01362296. PMID:25722381

The morbid anatomy of the human genome: chromosomal location of mutations causing disease.

PubMed Central

McKusick, V A; Amberger, J S

1993-01-01

Information is given in tabular form derived from a synopsis of the human gene map which has been updated continuously since 1973 as part of Mendelian Inheritance in Man (Johns Hopkins University Press, 10th ed, 1992) and of OMIM (Online Mendelian Inheritance in Man, available generally since 1987). The part of the synopsis reproduced here consists of chromosome by chromosome gene lists of loci for which there are associated disorders (table 1), a pictorial representation of this information (fig 1a-d), and an index of disorders for which the causative mutations have been mapped (table 2). In table 1, information on genes that have been located to specific chromosomal positions and are also the site of disease producing mutations is arranged by chromosome, starting with chromosome 1 and with the end of the short arm of the chromosome in each case. In table 2 an alphabetized list of these disorders and the chromosomal location of the mutation in each case are provided. Both in the 'Disorder' field of table 1 and in table 2, the numbers 1, 2, or 3 in parentheses after the name of the disorder indicate that its chromosomal location was determined by mapping of the wildtype gene (1), by mapping of the clinical phenotype (2), or by both strategies (3). PMID:8423603

A case of adult-onset reducing body myopathy presenting a novel clinical feature, asymmetrical involvement of the sternocleidomastoid and trapezius muscles.

PubMed

Fujii, Takayuki; Hayashi, Shintaro; Kawamura, Nobutoshi; Higuchi, Masa-Aki; Tsugawa, Jun; Ohyagi, Yasumasa; Hayashi, Yukiko K; Nishino, Ichizo; Kira, Jun-Ichi

2014-08-15

We herein report a 32-year-old woman with adult-onset reducing body myopathy (RBM) who had a mutation in the four-and-a-half LIM domain 1 gene (FHL1) and showed a marked asymmetrical involvement of sternocleidomastoid and trapezius muscles. At 30 years of age she noticed bilateral foot drop, and over the next two years developed difficulty raising her right arm. At 32 years of age she was admitted to our hospital for a diagnostic evaluation. Neurological examination showed moderate weakness and atrophy of her right sternocleidomastoid muscle, right trapezius muscle, and bilateral upper proximal muscles. There were severe weakness and atrophy of her bilateral tibialis anterior muscles. Her deep tendon reflexes were hypoactive in her upper extremities. Her serum creatine kinase level was mildly increased. Muscle biopsy specimens from the left tibialis anterior muscle revealed marked variation in fiber size, some necrotic or regenerating fibers, and reducing bodies. Gene analysis of FHL1 demonstrated a mutation: a heterozygous missense mutation of c.377G>A (p. C126T) in FHL1. Compared with previous adult-onset RBM cases harboring mutations in FHL1, our case was characterized by asymmetrical atrophy of the sternocleidomastoid and trapezius muscles. Copyright © 2014 Elsevier B.V. All rights reserved.

Gene Conversion Violates the Stepwise Mutation Model for Microsatellites in Y-Chromosomal Palindromic Repeats

PubMed Central

Balaresque, Patricia; King, Turi E; Parkin, Emma J; Heyer, Evelyne; Carvalho-Silva, Denise; Kraaijenbrink, Thirsa; de Knijff, Peter; Tyler-Smith, Chris; Jobling, Mark A

2014-01-01

The male-specific region of the human Y chromosome (MSY) contains eight large inverted repeats (palindromes), in which high-sequence similarity between repeat arms is maintained by gene conversion. These palindromes also harbor microsatellites, considered to evolve via a stepwise mutation model (SMM). Here, we ask whether gene conversion between palindrome microsatellites contributes to their mutational dynamics. First, we study the duplicated tetranucleotide microsatellite DYS385a,b lying in palindrome P4. We show, by comparing observed data with simulated data under a SMM within haplogroups, that observed heteroallelic combinations in which the modal repeat number difference between copies was large, can give rise to homoallelic combinations with zero-repeats difference, equivalent to many single-step mutations. These are unlikely to be generated under a strict SMM, suggesting the action of gene conversion. Second, we show that the intercopy repeat number difference for a large set of duplicated microsatellites in all palindromes in the MSY reference sequence is significantly reduced compared with that for nonpalindrome-duplicated microsatellites, suggesting that the former are characterized by unusual evolutionary dynamics. These observations indicate that gene conversion violates the SMM for microsatellites in palindromes, homogenizing copies within individual Y chromosomes, but increasing overall haplotype diversity among chromosomes within related groups. PMID:24610746

Phase 1 Gene Therapy for Duchenne Muscular Dystrophy Using a Translational Optimized AAV Vector

PubMed Central

Bowles, Dawn E; McPhee, Scott WJ; Li, Chengwen; Gray, Steven J; Samulski, Jade J; Camp, Angelique S; Li, Juan; Wang, Bing; Monahan, Paul E; Rabinowitz, Joseph E; Grieger, Joshua C; Govindasamy, Lakshmanan; Agbandje-McKenna, Mavis; Xiao, Xiao; Samulski, R Jude

2012-01-01

Efficient and widespread gene transfer is required for successful treatment of Duchenne muscular dystrophy (DMD). Here, we performed the first clinical trial using a chimeric adeno-associated virus (AAV) capsid variant (designated AAV2.5) derived from a rational design strategy. AAV2.5 was generated from the AAV2 capsid with five mutations from AAV1. The novel chimeric vector combines the improved muscle transduction capacity of AAV1 with reduced antigenic crossreactivity against both parental serotypes, while keeping the AAV2 receptor binding. In a randomized double-blind placebo-controlled phase I clinical study in DMD boys, AAV2.5 vector was injected into the bicep muscle in one arm, with saline control in the contralateral arm. A subset of patients received AAV empty capsid instead of saline in an effort to distinguish an immune response to vector versus minidystrophin transgene. Recombinant AAV genomes were detected in all patients with up to 2.56 vector copies per diploid genome. There was no cellular immune response to AAV2.5 capsid. This trial established that rationally designed AAV2.5 vector was safe and well tolerated, lays the foundation of customizing AAV vectors that best suit the clinical objective (e.g., limb infusion gene delivery) and should usher in the next generation of viral delivery systems for human gene transfer. PMID:22068425

Association of the Risk of Dental Caries and Polymorphism of MBL2 rs11003125 Gene in Iranian Adults.

PubMed

Mokhtari, Mohammad Javad; Koohpeima, Fatemeh; Hashemi-Gorji, Feyzollah

2018-06-14

This case-control study aimed to investigate the effect of rs11003125 in dental caries. For this purpose, a total number of 404 individuals - from Fars Province in Iran - were studied. The technique of this research was the tetra-primer amplification-refractory mutation system (ARMS)-PCR. Dental caries prevalence among the 404 individuals was assessed by counting the number of decayed, missing, and filled teeth. In this research, individuals were divided into two groups: cases (n = 238) and controls (n = 166), and the peripheral blood samples were used to extract the genomic DNA. For genotyping of DNA, the tetra-primer ARMS-PCR method was conducted using specific primer pairs. While examining MBL2 rs11003125 polymorphism, we found significant differences in the genotype frequencies between the case and the control group. The pooled estimates indicated that the GG and GC genotypes of MBL2 rs11003125 polymorphism significantly increased, and therefore caries risk (OR = 2.40, 95% CI = 1.31-4.40, p = 0.004) under the dominant model. These findings suggested that polymorphism in MBL2 gene was associated with dental caries in Iranian adults. Further verification is needed with more ethnic groups and larger sample sizes to determine whether rs11003125 polymorphism is related to dental caries in other regions or not. © 2018 S. Karger AG, Basel.

VAST 2010 Challenge: Arms Dealings and Pandemics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grinstein, Georges; Konecni, Shawn; Plaisant, Catherine

2010-10-23

The 5th VAST Challenge consisted of three mini-challenges that involved both intelligence analysis and bioinformatics. Teams could solve one, two or all three mini-challenges and assess the overall situation to enter the Grand Challenge. Mini-challenge one involved text reports about people and events giving information about arms dealers, situations in various countries and linkages between different countries. Mini-challenge two involved hospital admission and death records from various countries providing information about the spread of a world wide pandemic. Mini-challenge three involved genetic data to be used to identify the origin of the pandemic and the most dangerous viral mutations. Themore » Grand Challenge was to determine how these various mini-challenges were connected. As always the goal was to analyze the data and provide novel interactive visualizations useful in the analytic process. We received 58 submissions in total and gave 15 awards.« less

Isolation of a Breast Cancer Tumor Suppressor Gene from Chromosome 3p

DTIC Science & Technology

1997-10-01

and persistence of HPV infection and p53 mutation in cancer of the cervix uteri and the vulva. Int. J. Cancer . 63, 639-645. 17 Nancarrow, J.K., Holman...heterozygosity on the short arm of chromosome 3 in carcinoma of the uterine cervix . Cancer Res. 49, 3598-3601. 9. APPENDIX. Figure Legends: Figure 2. Map...uterine cervix . Cancer Asmssimilarities by 1Res., 49, 3598-3601.Assembled sequences were analyzed for database14. Cohen, A.J., Li, F.P., Berg, S

48 CFR 237.109 - Services of quasi-military armed forces.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Services of quasi-military armed forces. 237.109 Section 237.109 Federal Acquisition Regulations System DEFENSE ACQUISITION... Contracts-General 237.109 Services of quasi-military armed forces. See 237.102-70b for prohibition on...

Genomic copy number analysis of a spectrum of blue nevi identifies recurrent aberrations of entire chromosomal arms in melanoma ex blue nevus.

PubMed

Chan, May P; Andea, Aleodor A; Harms, Paul W; Durham, Alison B; Patel, Rajiv M; Wang, Min; Robichaud, Patrick; Fisher, Gary J; Johnson, Timothy M; Fullen, Douglas R

2016-03-01

Blue nevi may display significant atypia or undergo malignant transformation. Morphologic diagnosis of this spectrum of lesions is notoriously difficult, and molecular tools are increasingly used to improve diagnostic accuracy. We studied copy number aberrations in a cohort of cellular blue nevi, atypical cellular blue nevi, and melanomas ex blue nevi using Affymetrix's OncoScan platform. Cases with sufficient DNA were analyzed for GNAQ, GNA11, and HRAS mutations. Copy number aberrations were detected in 0 of 5 (0%) cellular blue nevi, 3 of 12 (25%) atypical cellular blue nevi, and 6 of 9 (67%) melanomas ex blue nevi. None of the atypical cellular blue nevi displayed more than one aberration, whereas complex aberrations involving four or more regions were seen exclusively in melanomas ex blue nevi. Gains and losses of entire chromosomal arms were identified in four of five melanomas ex blue nevi with copy number aberrations. In particular, gains of 1q, 4p, 6p, and 8q, and losses of 1p and 4q were each found in at least two melanomas. Whole chromosome aberrations were also common, and represented the sole finding in one atypical cellular blue nevus. When seen in melanomas, however, whole chromosome aberrations were invariably accompanied by partial aberrations of other chromosomes. Three melanomas ex blue nevi harbored aberrations, which were absent or negligible in their precursor components, suggesting progression in tumor biology. Gene mutations involving GNAQ and GNA11 were each detected in two of eight melanomas ex blue nevi. In conclusion, copy number aberrations are more common and often complex in melanomas ex blue nevi compared with cellular and atypical cellular blue nevi. Identification of recurrent gains and losses of entire chromosomal arms in melanomas ex blue nevi suggests that development of new probes targeting these regions may improve detection and risk stratification of these lesions.

Pathway level alterations rather than mutations in single genes predict response to HER2-targeted therapies in the neo-ALTTO trial.

PubMed

Shi, W; Jiang, T; Nuciforo, P; Hatzis, C; Holmes, E; Harbeck, N; Sotiriou, C; Peña, L; Loi, S; Rosa, D D; Chia, S; Wardley, A; Ueno, T; Rossari, J; Eidtmann, H; Armour, A; Piccart-Gebhart, M; Rimm, D L; Baselga, J; Pusztai, L

2017-01-01

We performed whole-exome sequencing of pretreatment biopsies and examined whether genome-wide metrics of overall mutational load, clonal heterogeneity or alterations at variant, gene, and pathway levels are associated with treatment response and survival. Two hundred and three biopsies from the NeoALTTO trial were analyzed. Mutations were called with MuTect, and Strelka, using pooled normal DNA. Associations between DNA alterations and outcome were evaluated by logistic and Cox-proportional hazards regression. There were no recurrent single gene mutations significantly associated with pathologic complete response (pCR), except PIK3CA [odds ratio (OR) = 0.42, P = 0.0185]. Mutations in 33 of 714 pathways were significantly associated with response, but different genes were affected in different individuals. PIK3CA was present in 23 of these pathways defining a ‘trastuzumab resistance-network’ of 459 genes. Cases with mutations in this network had low pCR rates to trastuzumab (2/50, 4%) compared with cases with no mutations (9/16, 56%), OR = 0.035; P < 0.001. Mutations in the ‘Regulation of RhoA activity’ pathway were associated with higher pCR rate to lapatinib (OR = 14.8, adjusted P = 0.001), lapatinib + trastuzumab (OR = 3.0, adjusted P = 0.09), and all arms combined (OR = 3.77, adjusted P = 0.02). Patients (n = 124) with mutations in the trastuzumab resistance network but intact RhoA pathway had 2% (1/41) pCR rate with trastuzumab alone (OR = 0.026, P = 0.001) but adding lapatinib increased pCR rate to 45% (17/38, OR = 1.68, P = 0.3). Patients (n = 46) who had no mutations in either gene set had 6% pCR rate (1/15) with lapatinib, but had the highest pCR rate, 52% (8/15) with trastuzumab alone. Mutations in the RhoA pathway are associated with pCR to lapatinib and mutations in a PIK3CA-related network are associated with resistance to trastuzumab. The combined mutation status of these two pathways could define patients with very low response rate to trastuzumab alone that can be augmented by adding lapatinib or substituting trastuzumab with lapatinib.

Tension Stiffened and Tendon Actuated Manipulator

NASA Technical Reports Server (NTRS)

Dorsey, John T. (Inventor); Mercer, Charles D. (Inventor); Ganoe, George G. (Inventor); Doggett, William R. (Inventor); King, Bruce D. (Inventor); Jones, Thomas C. (Inventor); Corbin, Cole K. (Inventor)

2015-01-01

A tension stiffened and tendon actuated manipulator is provided performing robotic-like movements when acquiring a payload. The manipulator design can be adapted for use in-space, lunar or other planetary installations as it is readily configurable for acquiring and precisely manipulating a payload in both a zero-g environment and in an environment with a gravity field. The manipulator includes a plurality of link arms, a hinge connecting adjacent link arms together to allow the adjacent link arms to rotate relative to each other and a cable actuation and tensioning system provided between adjacent link arms. The cable actuation and tensioning system includes a spreader arm and a plurality of driven and non-driven elements attached to the link arms and the spreader arm. At least one cable is routed around the driven and non-driven elements for actuating the hinge.

Hypoparathyroidism-retardation-dysmorphism syndrome in a girl: A new variant not caused by a TBCE mutation--clinical report and review.

PubMed

Courtens, Winnie; Wuyts, Wim; Poot, Martin; Szuhai, Karoly; Wauters, Jan; Reyniers, Edwin; Eleveld, Marc; Diaz, George; Nöthen, Markus M; Parvari, Ruti

2006-03-15

Hypoparathyroidism-retardation-dysmorphism (HRD) or Sanjad-Sakati syndrome (SSS) (OMIM 241410) is a rare autosomal recessive (AR) inherited condition, characterized by congenital hypoparathyroidism (hypoPTH), retardation, seizures, and a typical facial dysmorphism, consisting of prominent forehead, deep-set eyes, and abnormal external ears. This disorder has been mapped to the long arm of chromosome 1 (1q42-q43) and mutations in the gene coding for tubulin-specific chaperone E (TBCE) have been identified as the cause of the disease. Mutations in the same gene were also reported in patients with AR Kenny-Caffey syndrome (KCS). We report on a 41/2-year-old girl with congenital hypoPTH, seizures, developmental delay, and a facial dysmorphism, compatible with HRD syndrome. Mutation analyses revealed no mutations in the TBCE gene. In addition, normal TBCE protein and alpha-tubulin immunostaining were observed in a lymphoblastoid line derived from the patient, excluding the TBCE gene as the causative gene of the syndrome in this patient. A de novo microduplication of probe RP11-262I1 on 4q35 in the proposita was detected by microarray analyses, but this could not be confirmed by additional studies. We review and discuss the clinical findings of our case and those of the other reported cases with SSS and AR KCS. We conclude that a second gene locus for this disorder seems probable and that 4q35 needs further evaluation as a candidate region.

Modal analysis and control of flexible manipulator arms. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Neto, O. M.

1974-01-01

The possibility of modeling and controlling flexible manipulator arms was examined. A modal approach was used for obtaining the mathematical model and control techniques. The arm model was represented mathematically by a state space description defined in terms of joint angles and mode amplitudes obtained from truncation on the distributed systems, and included the motion of a two link two joint arm. Three basic techniques were used for controlling the system: pole allocation with gains obtained from the rigid system with interjoint feedbacks, Simon-Mitter algorithm for pole allocation, and sensitivity analysis with respect to parameter variations. An improvement in arm bandwidth was obtained. Optimization of some geometric parameters was undertaken to maximize bandwidth for various payload sizes and programmed tasks. The controlled system is examined under constant gains and using the nonlinear model for simulations following a time varying state trajectory.

Robots testing robots: ALAN-Arm, a humanoid arm for the testing of robotic rehabilitation systems.

PubMed

Brookes, Jack; Kuznecovs, Maksims; Kanakis, Menelaos; Grigals, Arturs; Narvidas, Mazvydas; Gallagher, Justin; Levesley, Martin

2017-07-01

Robotics is increasing in popularity as a method of providing rich, personalized and cost-effective physiotherapy to individuals with some degree of upper limb paralysis, such as those who have suffered a stroke. These robotic rehabilitation systems are often high powered, and exoskeletal systems can attach to the person in a restrictive manner. Therefore, ensuring the mechanical safety of these devices before they come in contact with individuals is a priority. Additionally, rehabilitation systems may use novel sensor systems to measure current arm position. Used to capture and assess patient movements, these first need to be verified for accuracy by an external system. We present the ALAN-Arm, a humanoid robotic arm designed to be used for both accuracy benchmarking and safety testing of robotic rehabilitation systems. The system can be attached to a rehabilitation device and then replay generated or human movement trajectories, as well as autonomously play rehabilitation games or activities. Tests of the ALAN-Arm indicated it could recreate the path of a generated slow movement path with a maximum error of 14.2mm (mean = 5.8mm) and perform cyclic movements up to 0.6Hz with low gain (<1.5dB). Replaying human data trajectories showed the ability to largely preserve human movement characteristics with slightly higher path length and lower normalised jerk.

48 CFR 37.109 - Services of quasi-military armed forces.

Code of Federal Regulations, 2010 CFR

2010-10-01

... armed forces. 37.109 Section 37.109 Federal Acquisition Regulations System FEDERAL ACQUISITION... quasi-military armed forces. Contracts with Pinkerton Detective Agencies or similar organizations are...-military armed forces for hire, or with their employees, regardless of the contract's character. An...

76 FR 43662 - 36(b)(1) Arms Sales Notification

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-21

... and control systems with modern technology. The new guidance and control system uses a mixture of... Issuance of Letter of Offer Pursuant to Section 36(b)(1) of the Arms Export Control Act, as amended (i... million TOTAL $86 million * as defined in Section 47(6) of the Arms Export Control Act. (iii) Description...

Temporal characterization of small arms muzzle flash in the broadband visible

NASA Astrophysics Data System (ADS)

Burke, Tom; Bratlie, Duane

2010-04-01

The authors have developed a simple system for characterizing the muzzle flash duration of common military small-arms ammunition as a feeder for system design configurations. This paper is a synopsis of the efforts and results of the effort to characterize the broadband optical signature of modern small arms.

Integrative rehabilitation of residents chronic post-stroke in skilled nursing facilities: the design and evaluation of the BrightArm Duo.

PubMed

House, G; Burdea, G; Polistico, K; Roll, D; Kim, J; Grampurohit, N; Damiani, F; Keeler, S; Hundal, J; Pollack, S

2016-11-01

To describe the novel BrightArm Duo bimanual upper extremity (UE) rehabilitation system; to determine its technology acceptance and clinical benefit for older hemiplegic participants. The system table tilted to adjust arm gravity loading. Participants wore arm supports that sensed grasp strength and wrist position on the table. Wrist weights further increased shoulder exertion. Games were designed to improve UE strength, motor function, cognition and emotive state and adapted automatically to each participant. The system underwent feasibility trials spanning 8 weeks in two skilled nursing facilities (SNFs). Participants were evaluated pre-therapy and post-therapy using standardized clinical measures. Computerized measures of supported arm reach, table tilt and number of arm repetitions were stored on a remote server. Seven participants had significant improvements in their active range of shoulder movement, supported arm reach, shoulder strength, grasp strength and their ability to focus. The group demonstrated higher arm function measured with FMA (p = 0.01) and CAHAI (p = 0.05), and had an improvement in depression (Becks Depression Inventory, II). BrightArm Duo technology was well accepted by participants with a rating of 4.4 out of 5 points. Given these findings, it will be beneficial to evaluate the BrightArm Duo application in SNF maintenance programs. Implications for Rehabilitation Integrative rehabilitation that addresses both physical and cognitive domains is promising for post-stroke maintenance in skilled nursing facilities. Simultaneous bilateral arm exercise may improve arm function in older hemiplegic patients several years after stroke. Virtual reality games that adapt to the patient can increase attention and working memory while decreasing depression in elderly.

Beam rider for an Articulated Robot Manipulator (ARM) accurate positioning of long flexible manipulators

NASA Technical Reports Server (NTRS)

Malachowski, M. J.

1990-01-01

Laser beam positioning and beam rider modules were incorporated into the long hollow flexible segment of an articulated robot manipulator (ARM). Using a single laser beam, the system determined the position of the distal ARM endtip, with millimetric precision, in six degrees of freedom, at distances of up to 10 meters. Preliminary designs, using space rated technology for the critical systems, of a two segmented physical ARM, with a single and a dual degree of freedom articulation, were developed, prototyped, and tested. To control the positioning of the physical ARM, an indirect adaptive controller, which used the mismatch between the position of the laser beam under static and dynamic conditions, was devised. To predict the behavior of the system and test the concept, a computer simulation model was constructed. A hierarchical artificially intelligent real time ADA operating system program structure was created. The software was designed for implementation on a dedicated VME bus based Intel 80386 administered parallel processing multi-tasking computer system.

Comprehensive, Integrative Genomic Analysis of Diffuse Lower-Grade Gliomas.

PubMed

Brat, Daniel J; Verhaak, Roel G W; Aldape, Kenneth D; Yung, W K Alfred; Salama, Sofie R; Cooper, Lee A D; Rheinbay, Esther; Miller, C Ryan; Vitucci, Mark; Morozova, Olena; Robertson, A Gordon; Noushmehr, Houtan; Laird, Peter W; Cherniack, Andrew D; Akbani, Rehan; Huse, Jason T; Ciriello, Giovanni; Poisson, Laila M; Barnholtz-Sloan, Jill S; Berger, Mitchel S; Brennan, Cameron; Colen, Rivka R; Colman, Howard; Flanders, Adam E; Giannini, Caterina; Grifford, Mia; Iavarone, Antonio; Jain, Rajan; Joseph, Isaac; Kim, Jaegil; Kasaian, Katayoon; Mikkelsen, Tom; Murray, Bradley A; O'Neill, Brian Patrick; Pachter, Lior; Parsons, Donald W; Sougnez, Carrie; Sulman, Erik P; Vandenberg, Scott R; Van Meir, Erwin G; von Deimling, Andreas; Zhang, Hailei; Crain, Daniel; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph; Penny, Robert; Shelton, Troy; Sherman, Mark; Yena, Peggy; Black, Aaron; Bowen, Jay; Dicostanzo, Katie; Gastier-Foster, Julie; Leraas, Kristen M; Lichtenberg, Tara M; Pierson, Christopher R; Ramirez, Nilsa C; Taylor, Cynthia; Weaver, Stephanie; Wise, Lisa; Zmuda, Erik; Davidsen, Tanja; Demchok, John A; Eley, Greg; Ferguson, Martin L; Hutter, Carolyn M; Mills Shaw, Kenna R; Ozenberger, Bradley A; Sheth, Margi; Sofia, Heidi J; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean Claude; Ayala, Brenda; Baboud, Julien; Chudamani, Sudha; Jensen, Mark A; Liu, Jia; Pihl, Todd; Raman, Rohini; Wan, Yunhu; Wu, Ye; Ally, Adrian; Auman, J Todd; Balasundaram, Miruna; Balu, Saianand; Baylin, Stephen B; Beroukhim, Rameen; Bootwalla, Moiz S; Bowlby, Reanne; Bristow, Christopher A; Brooks, Denise; Butterfield, Yaron; Carlsen, Rebecca; Carter, Scott; Chin, Lynda; Chu, Andy; Chuah, Eric; Cibulskis, Kristian; Clarke, Amanda; Coetzee, Simon G; Dhalla, Noreen; Fennell, Tim; Fisher, Sheila; Gabriel, Stacey; Getz, Gad; Gibbs, Richard; Guin, Ranabir; Hadjipanayis, Angela; Hayes, D Neil; Hinoue, Toshinori; Hoadley, Katherine; Holt, Robert A; Hoyle, Alan P; Jefferys, Stuart R; Jones, Steven; Jones, Corbin D; Kucherlapati, Raju; Lai, Phillip H; Lander, Eric; Lee, Semin; Lichtenstein, Lee; Ma, Yussanne; Maglinte, Dennis T; Mahadeshwar, Harshad S; Marra, Marco A; Mayo, Michael; Meng, Shaowu; Meyerson, Matthew L; Mieczkowski, Piotr A; Moore, Richard A; Mose, Lisle E; Mungall, Andrew J; Pantazi, Angeliki; Parfenov, Michael; Park, Peter J; Parker, Joel S; Perou, Charles M; Protopopov, Alexei; Ren, Xiaojia; Roach, Jeffrey; Sabedot, Thaís S; Schein, Jacqueline; Schumacher, Steven E; Seidman, Jonathan G; Seth, Sahil; Shen, Hui; Simons, Janae V; Sipahimalani, Payal; Soloway, Matthew G; Song, Xingzhi; Sun, Huandong; Tabak, Barbara; Tam, Angela; Tan, Donghui; Tang, Jiabin; Thiessen, Nina; Triche, Timothy; Van Den Berg, David J; Veluvolu, Umadevi; Waring, Scot; Weisenberger, Daniel J; Wilkerson, Matthew D; Wong, Tina; Wu, Junyuan; Xi, Liu; Xu, Andrew W; Yang, Lixing; Zack, Travis I; Zhang, Jianhua; Aksoy, B Arman; Arachchi, Harindra; Benz, Chris; Bernard, Brady; Carlin, Daniel; Cho, Juok; DiCara, Daniel; Frazer, Scott; Fuller, Gregory N; Gao, JianJiong; Gehlenborg, Nils; Haussler, David; Heiman, David I; Iype, Lisa; Jacobsen, Anders; Ju, Zhenlin; Katzman, Sol; Kim, Hoon; Knijnenburg, Theo; Kreisberg, Richard Bailey; Lawrence, Michael S; Lee, William; Leinonen, Kalle; Lin, Pei; Ling, Shiyun; Liu, Wenbin; Liu, Yingchun; Liu, Yuexin; Lu, Yiling; Mills, Gordon; Ng, Sam; Noble, Michael S; Paull, Evan; Rao, Arvind; Reynolds, Sheila; Saksena, Gordon; Sanborn, Zack; Sander, Chris; Schultz, Nikolaus; Senbabaoglu, Yasin; Shen, Ronglai; Shmulevich, Ilya; Sinha, Rileen; Stuart, Josh; Sumer, S Onur; Sun, Yichao; Tasman, Natalie; Taylor, Barry S; Voet, Doug; Weinhold, Nils; Weinstein, John N; Yang, Da; Yoshihara, Kosuke; Zheng, Siyuan; Zhang, Wei; Zou, Lihua; Abel, Ty; Sadeghi, Sara; Cohen, Mark L; Eschbacher, Jenny; Hattab, Eyas M; Raghunathan, Aditya; Schniederjan, Matthew J; Aziz, Dina; Barnett, Gene; Barrett, Wendi; Bigner, Darell D; Boice, Lori; Brewer, Cathy; Calatozzolo, Chiara; Campos, Benito; Carlotti, Carlos Gilberto; Chan, Timothy A; Cuppini, Lucia; Curley, Erin; Cuzzubbo, Stefania; Devine, Karen; DiMeco, Francesco; Duell, Rebecca; Elder, J Bradley; Fehrenbach, Ashley; Finocchiaro, Gaetano; Friedman, William; Fulop, Jordonna; Gardner, Johanna; Hermes, Beth; Herold-Mende, Christel; Jungk, Christine; Kendler, Ady; Lehman, Norman L; Lipp, Eric; Liu, Ouida; Mandt, Randy; McGraw, Mary; Mclendon, Roger; McPherson, Christopher; Neder, Luciano; Nguyen, Phuong; Noss, Ardene; Nunziata, Raffaele; Ostrom, Quinn T; Palmer, Cheryl; Perin, Alessandro; Pollo, Bianca; Potapov, Alexander; Potapova, Olga; Rathmell, W Kimryn; Rotin, Daniil; Scarpace, Lisa; Schilero, Cathy; Senecal, Kelly; Shimmel, Kristen; Shurkhay, Vsevolod; Sifri, Suzanne; Singh, Rosy; Sloan, Andrew E; Smolenski, Kathy; Staugaitis, Susan M; Steele, Ruth; Thorne, Leigh; Tirapelli, Daniela P C; Unterberg, Andreas; Vallurupalli, Mahitha; Wang, Yun; Warnick, Ronald; Williams, Felicia; Wolinsky, Yingli; Bell, Sue; Rosenberg, Mara; Stewart, Chip; Huang, Franklin; Grimsby, Jonna L; Radenbaugh, Amie J; Zhang, Jianan

2015-06-25

Diffuse low-grade and intermediate-grade gliomas (which together make up the lower-grade gliomas, World Health Organization grades II and III) have highly variable clinical behavior that is not adequately predicted on the basis of histologic class. Some are indolent; others quickly progress to glioblastoma. The uncertainty is compounded by interobserver variability in histologic diagnosis. Mutations in IDH, TP53, and ATRX and codeletion of chromosome arms 1p and 19q (1p/19q codeletion) have been implicated as clinically relevant markers of lower-grade gliomas. We performed genomewide analyses of 293 lower-grade gliomas from adults, incorporating exome sequence, DNA copy number, DNA methylation, messenger RNA expression, microRNA expression, and targeted protein expression. These data were integrated and tested for correlation with clinical outcomes. Unsupervised clustering of mutations and data from RNA, DNA-copy-number, and DNA-methylation platforms uncovered concordant classification of three robust, nonoverlapping, prognostically significant subtypes of lower-grade glioma that were captured more accurately by IDH, 1p/19q, and TP53 status than by histologic class. Patients who had lower-grade gliomas with an IDH mutation and 1p/19q codeletion had the most favorable clinical outcomes. Their gliomas harbored mutations in CIC, FUBP1, NOTCH1, and the TERT promoter. Nearly all lower-grade gliomas with IDH mutations and no 1p/19q codeletion had mutations in TP53 (94%) and ATRX inactivation (86%). The large majority of lower-grade gliomas without an IDH mutation had genomic aberrations and clinical behavior strikingly similar to those found in primary glioblastoma. The integration of genomewide data from multiple platforms delineated three molecular classes of lower-grade gliomas that were more concordant with IDH, 1p/19q, and TP53 status than with histologic class. Lower-grade gliomas with an IDH mutation either had 1p/19q codeletion or carried a TP53 mutation. Most lower-grade gliomas without an IDH mutation were molecularly and clinically similar to glioblastoma. (Funded by the National Institutes of Health.).

Acceptance test report (MI-74067-009-00). SVWS access arm (Serial number AA-09-03) (drawing 75M08129-13)

NASA Technical Reports Server (NTRS)

Hagood, J. T.

1973-01-01

Acceptance tests were conducted at Kennedy Space Center of the Saturn Vehicle Workshop Spacecraft Access Arm and related equipment. The tests were conducted to prove complete system capability to operate satisfactorily under conditions required to support spacecraft operations and activities. The SVWS Access Arm, serial number AA-09-03, is a Command Module Service Arm, S/A 9, which was removed from the mobile launcher and modified to support the SVWS operations. The C/M environmental chamber was removed and a completely new chamber was installed. The retract system was redesigned to remove the automatic/remote control capability and replaced with a local manual control. The SVWS Access Arm System was successfully tested and supported spacecraft processing without major problems.

The use of 'arms-length' organizations for health system change in Ontario, Canada: some observations by insiders.

PubMed

Pink, George H; Leatt, Peggy

2003-01-01

During the past decade, there has been substantial health system reform in the United States, United Kingdom, New Zealand, and many other countries. For the most part, Canada has not pursued 'big bang' health system change but rather a variety of strategies to achieve incremental change. In this paper, we present the ways in which three arms-length organizations have been used by government to effect incremental system change in Ontario during the past several years. We observe that, (1) the influence of politics and political interference can be reduced through an arms-length organization; (2) an arms-length organization with the power to make decisions entails more political risk for government and encounters more scrutiny and criticism by providers and the media than an organization with the power to recommend only; (3) an arms-length organization with a limited lifespan faces more delaying tactics by adversely affected parties than an organization without a limited lifespan; (4) an arms-length organization with perceived influence may attract causes that are not related to its mandate; (5) the importance and difficulty of communicating complex information about system change to a wide variety of audiences cannot be overstated; (6) system change informed by the use of expert opinion encounters less provider resistance and may result in better decisions; and (7) the reputation of the Chair and the perceived competence and experience of the CEO are critical success factors in the success of an arms-length organization.

Robotic Mirror Therapy System for Functional Recovery of Hemiplegic Arms.

PubMed

Beom, Jaewon; Koh, Sukgyu; Nam, Hyung Seok; Kim, Wonshik; Kim, Yoonjae; Seo, Han Gil; Oh, Byung-Mo; Chung, Sun Gun; Kim, Sungwan

2016-08-15

Mirror therapy has been performed as effective occupational therapy in a clinical setting for functional recovery of a hemiplegic arm after stroke. It is conducted by eliciting an illusion through use of a mirror as if the hemiplegic arm is moving in real-time while moving the healthy arm. It can facilitate brain neuroplasticity through activation of the sensorimotor cortex. However, conventional mirror therapy has a critical limitation in that the hemiplegic arm is not actually moving. Thus, we developed a real-time 2-axis mirror robot system as a simple add-on module for conventional mirror therapy using a closed feedback mechanism, which enables real-time movement of the hemiplegic arm. We used 3 Attitude and Heading Reference System sensors, 2 brushless DC motors for elbow and wrist joints, and exoskeletal frames. In a feasibility study on 6 healthy subjects, robotic mirror therapy was safe and feasible. We further selected tasks useful for activities of daily living training through feedback from rehabilitation doctors. A chronic stroke patient showed improvement in the Fugl-Meyer assessment scale and elbow flexor spasticity after a 2-week application of the mirror robot system. Robotic mirror therapy may enhance proprioceptive input to the sensory cortex, which is considered to be important in neuroplasticity and functional recovery of hemiplegic arms. The mirror robot system presented herein can be easily developed and utilized effectively to advance occupational therapy.

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

Anthropometric considerations for a 4-axis side-arm flight controller

NASA Technical Reports Server (NTRS)

Debellis, W. B.

1986-01-01

A data base on multiaxis side-arm flight controls was generated. The rapid advances in fly-by-light technology, automatic stability systems, and onboard computers have combined to create flexible flight control systems which could reduce the workload imposed on the operator by complex new equipment. This side-arm flight controller combines four controls into one unit and should simplify the pilot's task. However, the use of a multiaxis side-arm flight controller without complete cockpit integration may tend to increase the pilot's workload.

The apparent mass and mechanical impedance of the hand and the transmission of vibration to the fingers, hand, and arm

NASA Astrophysics Data System (ADS)

Concettoni, Enrico; Griffin, Michael

2009-08-01

Although hand-transmitted vibration causes injury and disease, most often evident in the fingers, the biodynamic responses of the fingers, hand, and arm are not yet well understood. A method of investigating the motion of the entire finger-hand-arm system, based on the simultaneous measurement of the biodynamic response at the driving point and the transmissibility to many points on the finger-hand-arm system, is illustrated. Fourteen male subjects participated in an experiment in which they pushed down on a vertically vibrating metal plate with their right forearm pronated and their elbow bent at 90°. The apparent mass and mechanical impedance of the finger-hand-arm system were measured for each of seven different contact conditions between the plate and the fingers and hand. Simultaneously, the vibration of the fingers, hand, and arm was measured at 41 locations using a scanning laser Doppler vibrometer. Transmissibilities showed how the vibration was transmitted along the arm and allowed the construction of spectral operating deflection shapes showing the vibration pattern of the fingers, hand, and arm for each of the seven contact conditions. The vibration patterns at critical frequencies for each contact condition have been used to explain features in the driving point biodynamic responses and the vibration behaviour of the hand-arm system. Spectral operating deflection shapes for the upper limb assist the interpretation of driving point biodynamic responses and help to advance understanding required to predict, explain, and control the various effects of hand-transmitted vibration.

Topological analysis of long-chain branching patterns in polyolefins.

PubMed

Bonchev, D; Markel, E; Dekmezian, A

2001-01-01

Patterns in molecular topology and complexity for long-chain branching are quantitatively described. The Wiener number, the topological complexity index, and a new index of 3-starness are used to quantify polymer structure. General formulas for these indices were derived for the cases of 3-arm star, H-shaped, and B-arm comb polymers. The factors affecting complexity in monodisperse polymer systems are ranked as follows: number of arms > arm length > arm central position approximately equal to arm clustering > total molecular weight approximately equal to backbone molecular weight. Topological indices change rapidly and then plateau as the molecular weight of branches on a polyolefin backbone increases from 0 to 5 kD. Complexity calculations relate 2-arm or 3-arm comb structures to the corresponding 3-arm stars of equivalent complexity but much higher molecular weight. In a subsequent paper, we report the application of topological analysis for developing structure/property relationships for monodisperse polymers. While the focus of the present work is on the description of monodisperse, well-defined architectures, the methods may be extended to the description of polydisperse systems.

The Effect of a Mechanical Arm System on Portable Grinder Vibration Emissions.

PubMed

McDowell, Thomas W; Welcome, Daniel E; Warren, Christopher; Xu, Xueyan S; Dong, Ren G

2016-04-01

Mechanical arm systems are commonly used to support powered hand tools to alleviate ergonomic stressors related to the development of workplace musculoskeletal disorders. However, the use of these systems can increase exposure times to other potentially harmful agents such as hand-transmitted vibration. To examine how these tool support systems affect tool vibration, the primary objectives of this study were to characterize the vibration emissions of typical portable pneumatic grinders used for surface grinding with and without a mechanical arm support system at a workplace and to estimate the potential risk of the increased vibration exposure time afforded by the use of these mechanical arm systems. This study also developed a laboratory-based simulated grinding task based on the ISO 28927-1 (2009) standard for assessing grinder vibrations; the simulated grinding vibrations were compared with those measured during actual workplace grinder operations. The results of this study demonstrate that use of the mechanical arm may provide a health benefit by reducing the forces required to lift and maneuver the tools and by decreasing hand-transmitted vibration exposure. However, the arm does not substantially change the basic characteristics of grinder vibration spectra. The mechanical arm reduced the average frequency-weighted acceleration by about 24% in the workplace and by about 7% in the laboratory. Because use of the mechanical arm system can increase daily time-on-task by 50% or more, the use of such systems may actually increase daily time-weighted hand-transmitted vibration exposures in some cases. The laboratory acceleration measurements were substantially lower than the workplace measurements, and the laboratory tool rankings based on acceleration were considerably different than those from the workplace. Thus, it is doubtful that ISO 28927-1 is useful for estimating workplace grinder vibration exposures or for predicting workplace grinder acceleration rank orders. Published by Oxford University Press on behalf of the British Occupational Hygiene Society 2015.

The Effect of a Mechanical Arm System on Portable Grinder Vibration Emissions

PubMed Central

McDowell, Thomas W.; Welcome, Daniel E.; Warren, Christopher; Xu, Xueyan S.; Dong, Ren G.

2016-01-01

Mechanical arm systems are commonly used to support powered hand tools to alleviate ergonomic stressors related to the development of workplace musculoskeletal disorders. However, the use of these systems can increase exposure times to other potentially harmful agents such as hand-transmitted vibration. To examine how these tool support systems affect tool vibration, the primary objectives of this study were to characterize the vibration emissions of typical portable pneumatic grinders used for surface grinding with and without a mechanical arm support system at a workplace and to estimate the potential risk of the increased vibration exposure time afforded by the use of these mechanical arm systems. This study also developed a laboratory-based simulated grinding task based on the ISO 28927-1 (2009) standard for assessing grinder vibrations; the simulated grinding vibrations were compared with those measured during actual workplace grinder operations. The results of this study demonstrate that use of the mechanical arm may provide a health benefit by reducing the forces required to lift and maneuver the tools and by decreasing hand-transmitted vibration exposure. However, the arm does not substantially change the basic characteristics of grinder vibration spectra. The mechanical arm reduced the average frequency-weighted acceleration by about 24% in the workplace and by about 7% in the laboratory. Because use of the mechanical arm system can increase daily time-on-task by 50% or more, the use of such systems may actually increase daily time-weighted hand-transmitted vibration exposures in some cases. The laboratory acceleration measurements were substantially lower than the workplace measurements, and the laboratory tool rankings based on acceleration were considerably different than those from the workplace. Thus, it is doubtful that ISO 28927-1 is useful for estimating workplace grinder vibration exposures or for predicting workplace grinder acceleration rank orders. PMID:26628522

Prevalence of ESR1 Mutations in Cell-Free DNA and Outcomes in Metastatic Breast Cancer: A Secondary Analysis of the BOLERO-2 Clinical Trial.

PubMed

Chandarlapaty, Sarat; Chen, David; He, Wei; Sung, Patricia; Samoila, Aliaksandra; You, Daoqi; Bhatt, Trusha; Patel, Parul; Voi, Maurizio; Gnant, Michael; Hortobagyi, Gabriel; Baselga, José; Moynahan, Mary Ellen

2016-10-01

Estrogen receptor α (ESR1) mutations found in metastatic breast cancer (MBC) promote ligand-independent receptor activation and resistance to estrogen-deprivation therapy in laboratory models. The prevalence of these mutations and their potential impact on clinical outcomes has not been established. To determine the prevalence of ESR1 mutations (Y537S and D538G) in estrogen receptor (ER)-positive MBC and determine whether mutation is associated with inferior outcomes. From December 16, 2014, to August 26, 2015, we analyzed cell-free DNA (cfDNA) from baseline plasma samples from participants in the BOLERO-2 double-blind phase 3 study that randomized patients from 189 centers in 24 countries with MBC to exemestane plus placebo or exemestane plus everolimus. The study enrolled postmenopausal women with a diagnosis of MBC and prior exposure to an aromatase inhibitor. Baseline plasma samples were available from 541 of 724 patients (74.7%). We assessed the effect of mutation on overall survival of the population and the effect of mutation on progression-free survival (PFS) by treatment arm. Patients were randomized to treatment with exemestane (25 mg oral daily) together with everolimus (10 mg oral daily) or with placebo. The 2 most frequent mutations in ESR1 (Y537S and D538G) were analyzed from cfDNA using droplet digital polymerase chain reaction and samples scored as wild-type, D538G, Y537S, or double mutant. Cox-proportional hazards model was used to assess PFS in patient subgroups defined by mutations, and the effect of each mutation on overall survival. Of 541 evaluable patients, 156 (28.8%) had ESR1 mutation D538G (21.1%) and/or Y537S (13.3%), and 30 had both. These mutations were associated with shorter overall survival (wild-type, 32.1 months [95% CI, 28.09-36.40 months]; D538G, 25.99 months [95% CI, 19.19-32.36 months]; Y537S, 19.98 months [13.01-29.31 months]; both mutations, 15.15 months [95% CI, 10.87-27.43 months]). The D538G group (hazard ratio, 0.34 [95% CI, 0.02-0.57]) derived a similar PFS benefit as wild type from addition of everolimus to exemestane. ESR1 mutations are prevalent in ER-positive aromatase inhibitor-treated MBC. Both Y537S and D538G mutations are associated with more aggressive disease biology. clinicaltrials.gov Identifier: NCT00863655.

Overcoming Robot-Arm Joint Singularities

NASA Technical Reports Server (NTRS)

Barker, L. K.; Houck, J. A.

1986-01-01

Kinematic equations allow arm to pass smoothly through singular region. Report discusses mathematical singularities in equations of robotarm control. Operator commands robot arm to move in direction relative to its own axis system by specifying velocity in that direction. Velocity command then resolved into individual-joint rotational velocities in robot arm to effect motion. However, usual resolved-rate equations become singular when robot arm is straightened.

[Expression of epidermal growth factor receptor mutation specific antibodies in lung adenocarcinoma: evaluation of sensitivity, specificity and relationship to histologic subtypes].

PubMed

Lai, Y M; Feng, Q; Sun, Y; Wang, P; Shi, Y F; Zhao, M; Wu, Q; Li, X H

2016-09-08

To evaluate the expression of epidermal growth factor receptor (EGFR) mutation specific antibodies in invasive lung adenocarcinomas, and their sensitivity, specificity, as well as relationship to histological subtypes. Immunostaining with EGFR mutation-specific antibodies, del E746-A750 in exon 19 and L858R in exon 21, was performed in tissue microarrays of 884 cases of resection specimens to study the relationship between the immunophenotypes and morphologic subtypes. The sensitivity and specificity of the stains were compared with gene mutations detected by amplified refractory mutation system-polymerase chain reaction (ARMS-PCR). Of the 884 cases, the expression of del E746-A750 in exon 19 was 3+ , 2+ , 1+ and 0 in 7 cases (0.79%), 38 cases (4.30%), 129 cases (14.59%) and 710 cases (80.32%), respectively. For L858R in exon 21, 3+ , 2+ , 1+ and 0 staining were seen in 82 cases (9.28%), 93 cases (10.52%), 82 cases (9.28%) and 627 cases (70.93%), respectively. For both antibodies, positive expression (1+ or more) was mainly observed in lepidic, acinar and papillary predominant subtypes, and rarely seen in solid subtype or invasive mucinous adenocarcinoma (P=0.014 and 0.016). If 1+ to 3+ expression was set as positive, the specificity of exon 19/exon 21 reached 98.59%/92.98%, while the sensitivity was relatively lower (62.86%/88.89%). If 2+ to 3+ expression was read as positive, the specificity and sensitivity were 99.30%/97.37% and 25.71%/74.60% for exon 19/exon 21. If only 3+ expression was considered positive, the specificity was 100.0% for both antibodies, with a low sensitivity (8.57% for exon 19 and 34.92% for exon 21). Of the 18 cases with E746-A750 del in exon 19 based on molecular detection, the sensitivity of immunohistochemistry for exon 19 was 88.89% if a positive cutoff value ≥1+ was used; in contrast, of the 8 cases harboring other deletions in exon 19, only two cases were positive as 1+ . Both the EGFR mutation specific antibodies del E746-A750 in exon 19 and L858R in exon 21 demonstrate high specificity and relatively low sensitivity, and are mostly expressed in lepidic, acinar and papillary predominant subtypes, but rarely in solid subtype or invasive mucinous adenocarcinoma. For cases with 3+ expression, a mutational statue for EGFR is likely. For the 2+ positive cases, the accuracy to predict mutation almost reaches 90%, but molecular detection for confirmation is desirable. For the 1+ and negative cases, DNA-based test is essential to avoid false negativity.

Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia

PubMed Central

La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J.; Mecucci, Cristina

2016-01-01

Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. PMID:27151989

Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia.

PubMed

La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J; Mecucci, Cristina

2016-08-01

Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. Copyright© Ferrata Storti Foundation.

A common neural element receiving rhythmic arm and leg activity as assessed by reflex modulation in arm muscles

PubMed Central

Tazoe, Toshiki; Nakajima, Tsuyoshi; Futatsubashi, Genki; Ohtsuka, Hiroyuki; Suzuki, Shinya; Zehr, E. Paul; Komiyama, Tomoyoshi

2016-01-01

Neural interactions between regulatory systems for rhythmic arm and leg movements are an intriguing issue in locomotor neuroscience. Amplitudes of early latency cutaneous reflexes (ELCRs) in stationary arm muscles are modulated during rhythmic leg or arm cycling but not during limb positioning or voluntary contraction. This suggests that interneurons mediating ELCRs to arm muscles integrate outputs from neural systems controlling rhythmic limb movements. Alternatively, outputs could be integrated at the motoneuron and/or supraspinal levels. We examined whether a separate effect on the ELCR pathways and cortico-motoneuronal excitability during arm and leg cycling is integrated by neural elements common to the lumbo-sacral and cervical spinal cord. The subjects performed bilateral leg cycling (LEG), contralateral arm cycling (ARM), and simultaneous contralateral arm and bilateral leg cycling (A&L), while ELCRs in the wrist flexor and shoulder flexor muscles were evoked by superficial radial (SR) nerve stimulation. ELCR amplitudes were facilitated by cycling tasks and were larger during A&L than during ARM and LEG. A low stimulus intensity during ARM or LEG generated a larger ELCR during A&L than the sum of ELCRs during ARM and LEG. We confirmed this nonlinear increase in single motor unit firing probability following SR nerve stimulation during A&L. Furthermore, motor-evoked potentials following transcranial magnetic and electrical stimulation did not show nonlinear potentiation during A&L. These findings suggest the existence of a common neural element of the ELCR reflex pathway that is active only during rhythmic arm and leg movement and receives convergent input from contralateral arms and legs. PMID:26961103

Cushing syndrome in a young woman due to primary pigmented nodular adrenal disease.

PubMed

Hackman, Kathryn L; Davis, Anna L; Curnow, Paul A; Serpell, Jonathan W; McLean, Catriona A; Topliss, Duncan J

2010-01-01

To report a case of Cushing syndrome due to apparently sporadic primary pigmented nodular adrenal disease in a young woman. We describe the clinical, biochemical, radiologic, and histologic findings of Cushing syndrome due to the rare condition of primary pigmented nodular adrenal disease. A 30-year-old woman presented with a 2-year history of worsening itch without rash over her shoulders and arms and weight gain, particularly around the abdomen and face. Careful questioning did not elicit any history of exogenous glucocorticoid use (systemic or topical), including hydrocortisone. On examination, the patient had a slightly rounded and plethoric face, a small buffalo hump, central adiposity, and thin skin with a few small striae on her inner thighs. No features of the Carney complex were observed. Investigations showed hypercortisolism with suppressed corticotropin and normal adrenal imaging despite documentation of enlarged adrenal glands at removal. High-dose dexamethasone administration was followed by a decrease in urinary free cortisol excretion rather than a paradoxical rise as previously reported in primary pigmented nodular adrenal disease. No mutations were detected in the PRKAR1A gene. Primary pigmented nodular adrenal disease should be suspected in patients with corticotropin-independent Cushing syndrome who have normal adrenal imaging. The role of genetic testing in apparently sporadic cases is not established, but cumulative experience may be helpful in defining the frequency of PRKAR1A mutations.

[Establishment of L-periaxin gene knock-out RSC96 cell line].

PubMed

Liang, Min; Peng, Tingting; Shi, Yawei

2016-12-25

Periaxin, a protein of noncompact myelin, is specifically expressed in the peripheral nervous system (PNS). There are two protein isoform L-periaxin and S-Periaxin by alternative splicing of periaxin gene, playing an important role in the initiation of myelin formation. So far, 18 different mutation sites in L-periaxin gene have been found to induce the peripheral demyelinating neurological charcot-marie-tooth diseases subtype 4F (CMT4F). The technique of activation of transcription activator-like effector nucleases (TALENS) was used to knock out the L-periaxin gene in RSC 96 cell line of Rattus. According to the design principle, the knock-out site of L-periaxin was assured to NLS domain of L-periaxin, which is target sequence of left and right arms of TALEN. The knock-out vectors of TALEN-L and TALEN-R were established and transfected into RSC96 cell. After puromycin screening, L-periaxin was knocked out successfully in RSC96 cell, which is confirmed by DNA sequence. The mutation efficiency is 21.6%. S-periaxin, not L-periaxin can be detected by Western blotting in L-periaxin gene knock-out RSC96 cell. The cell growth rate was decreased and the number of cells in G1 increased and decreased in S phase in L-periaxin gene knock-out RSC96 cell by flow cytometry and MTT assay.

48 CFR 227.675-1 - International Traffic in Arms Regulations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Arms Regulations. 227.675-1 Section 227.675-1 Federal Acquisition Regulations System DEFENSE... COPYRIGHTS Foreign License and Technical Assistance Agreements 227.675-1 International Traffic in Arms... Munitions List as arms, ammunition, or munitions of war. (The Munitions List and pertinent procedures are...

48 CFR 227.675-1 - International Traffic in Arms Regulations.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Arms Regulations. 227.675-1 Section 227.675-1 Federal Acquisition Regulations System DEFENSE... COPYRIGHTS Foreign License and Technical Assistance Agreements 227.675-1 International Traffic in Arms... Munitions List as arms, ammunition, or munitions of war. (The Munitions List and pertinent procedures are...

48 CFR 227.675-1 - International Traffic in Arms Regulations.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Arms Regulations. 227.675-1 Section 227.675-1 Federal Acquisition Regulations System DEFENSE... COPYRIGHTS Foreign License and Technical Assistance Agreements 227.675-1 International Traffic in Arms... Munitions List as arms, ammunition, or munitions of war. (The Munitions List and pertinent procedures are...

48 CFR 227.675-1 - International Traffic in Arms Regulations.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Arms Regulations. 227.675-1 Section 227.675-1 Federal Acquisition Regulations System DEFENSE... COPYRIGHTS Foreign License and Technical Assistance Agreements 227.675-1 International Traffic in Arms... Munitions List as arms, ammunition, or munitions of war. (The Munitions List and pertinent procedures are...

48 CFR 227.675-1 - International Traffic in Arms Regulations.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Arms Regulations. 227.675-1 Section 227.675-1 Federal Acquisition Regulations System DEFENSE... COPYRIGHTS Foreign License and Technical Assistance Agreements 227.675-1 International Traffic in Arms... Munitions List as arms, ammunition, or munitions of war. (The Munitions List and pertinent procedures are...

Genetic analysis of a Y-chromosome region that induces triplosterile phenotypes and is essential for spermatid individualization in Drosophila melanogaster.

PubMed Central

Timakov, B; Zhang, P

2000-01-01

The heterochromatic Y chromosome of Drosophila melanogaster contains approximately 40 Mb of DNA but has only six loci mutable to male sterility. Region h1-h9 on YL, which carries the kl-3 and kl-5 loci, induces male sterility when present in three copies. We show that three separate segments within the region are responsible for the triplosterility and have an additive effect on male fertility. The triplosterile males displayed pleiotropic defects, beginning at early postmeiotic stages. However, the triplosterility was unaffected by kl-3 or kl-5 alleles. These data suggest that region h1-h9 is complex and may contain novel functions in addition to those of the previously identified kl-3 and kl-5 loci. The kl-3 and kl-5 mutations as well as deficiencies within region h1-h9 result in loss of the spermatid axonemal outer dynein arms. Examination using fluorescent probes showed that males deficient for h1-h3 or h4-h9 displayed a postmeiotic lesion with disrupted individualization complexes scattered along the spermatid bundle. In contrast, the kl-3 and kl-5 mutations had no effect on spermatid individualization despite the defect in the axonemes. These results demonstrate that region h1-h9 carries genetically separable functions: one required for spermatid individualization and the other essential for assembling the axonemal dynein arms. PMID:10790393

ARM Unmanned Aerial Systems Implementation Plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schmid, Beat; Ivey, Mark

Recent advances in Unmanned Aerial Systems (UAS) coupled with changes in the regulatory environment for operations of UAS in the National Airspace increase the potential value of UAS to the U.S. Department of Energy (DOE) Atmospheric Radiation Measurement (ARM) Climate Research Facility. UAS include unmanned aerial vehicles (UAV) and tethered balloon systems (TBS). The roles UAVs and TBSs could play within the ARM Facility, particularly science questions they could help address, have been discussed in several workshops, reports, and vision documents, including: This document describes the implementation of a robust and vigorous program for use of UAV and TBS formore » the science missions ARM supports.« less

Photoelectric radar servo control system based on ARM+FPGA

NASA Astrophysics Data System (ADS)

Wu, Kaixuan; Zhang, Yue; Li, Yeqiu; Dai, Qin; Yao, Jun

2016-01-01

In order to get smaller, faster, and more responsive requirements of the photoelectric radar servo control system. We propose a set of core ARM + FPGA architecture servo controller. Parallel processing capability of FPGA to be used for the encoder feedback data, PWM carrier modulation, A, B code decoding processing and so on; Utilizing the advantage of imaging design in ARM Embedded systems achieves high-speed implementation of the PID algorithm. After the actual experiment, the closed-loop speed of response of the system cycles up to 2000 times/s, in the case of excellent precision turntable shaft, using a PID algorithm to achieve the servo position control with the accuracy of + -1 encoder input code. Firstly, This article carry on in-depth study of the embedded servo control system hardware to determine the ARM and FPGA chip as the main chip with systems based on a pre-measured target required to achieve performance requirements, this article based on ARM chip used Samsung S3C2440 chip of ARM7 architecture , the FPGA chip is chosen xilinx's XC3S400 . ARM and FPGA communicate by using SPI bus, the advantage of using SPI bus is saving a lot of pins for easy system upgrades required thereafter. The system gets the speed datas through the photoelectric-encoder that transports the datas to the FPGA, Then the system transmits the datas through the FPGA to ARM, transforms speed datas into the corresponding position and velocity data in a timely manner, prepares the corresponding PWM wave to control motor rotation by making comparison between the position data and the velocity data setted in advance . According to the system requirements to draw the schematics of the photoelectric radar servo control system and PCB board to produce specially. Secondly, using PID algorithm to control the servo system, the datas of speed obtained from photoelectric-encoder is calculated position data and speed data via high-speed digital PID algorithm and coordinate models. Finally, a large number of experiments verify the reliability of embedded servo control system's functions, the stability of the program and the stability of the hardware circuit. Meanwhile, the system can also achieve the satisfactory of user experience, to achieve a multi-mode motion, real-time motion status monitoring, online system parameter changes and other convenient features.

Visualization of tandem repeat mutagenesis in Bacillus subtilis.

PubMed

Dormeyer, Miriam; Lentes, Sabine; Ballin, Patrick; Wilkens, Markus; Klumpp, Stefan; Kohlheyer, Dietrich; Stannek, Lorena; Grünberger, Alexander; Commichau, Fabian M

2018-03-01

Mutations are crucial for the emergence and evolution of proteins with novel functions, and thus for the diversity of life. Tandem repeats (TRs) are mutational hot spots that are present in the genomes of all organisms. Understanding the molecular mechanism underlying TR mutagenesis at the level of single cells requires the development of mutation reporter systems. Here, we present a mutation reporter system that is suitable to visualize mutagenesis of TRs occurring in single cells of the Gram-positive model bacterium Bacillus subtilis using microfluidic single-cell cultivation. The system allows measuring the elimination of TR units due to growth rate recovery. The cultivation of bacteria carrying the mutation reporter system in microfluidic chambers allowed us for the first time to visualize the emergence of a specific mutation at the level of single cells. The application of the mutation reporter system in combination with microfluidics might be helpful to elucidate the molecular mechanism underlying TR (in)stability in bacteria. Moreover, the mutation reporter system might be useful to assess whether mutations occur in response to nutrient starvation. Copyright © 2018 Elsevier B.V. All rights reserved.

Validity of the Acti4 software using ActiGraph GT3X+accelerometer for recording of arm and upper body inclination in simulated work tasks.

PubMed

Korshøj, Mette; Skotte, Jørgen H; Christiansen, Caroline S; Mortensen, Pelle; Kristiansen, Jesper; Hanisch, Christiana; Ingebrigtsen, Jørgen; Holtermann, Andreas

2014-01-01

The validity of inclinometer measurements by ActiGraph GT3X+ (AG) accelerometer, when analysed with the Acti4 customised software, was examined by comparison of inclinometer measurements with a reference system (TrakStar) in a protocol with standardised arm movements and simulated working tasks. The sensors were placed at the upper arm (distal to the deltoid insertion) and at the spine (level of T1-T2) on eight participants. Root mean square errors (RMSEs) values of inclination between the two systems were low for the slow- and medium-speed standardised arm movements and in simulated working tasks. Fast arm movements caused the inclination estimated by the AG to deviate from the reference measurements (RMSE values up to ∼10°). Furthermore, it was found that AG positioned at the upper arm provided inclination data without bias compared to the reference system. These findings indicate that the AG provides valid estimates of arm and upper body inclination in working participants. Being inexpensive, small, water-resistant and without wires, ActiGraph GT3X+ seems to be a valid mean for direct long-term field measurements of arm and trunk inclinations when analysed by the Acti4 customised software.

Ergonomically neutral arm support system

DOEpatents

Siminovitch, Michael J; Chung, Jeffrey Y; Dellinges, Steven; Lafever, Robin E

2005-08-02

An ergonomic arm support system maintains a neutral position for the forearm. A mechanical support structure attached to a chair or other mounting structure supports the arms of a sitting or standing person. The system includes moving elements and tensioning elements to provide a dynamic balancing force against the forearms. The support structure is not fixed or locked in a rigid position, but is an active dynamic system that is maintained in equipoise by the continuous operation of the opposing forces. The support structure includes an armrest connected to a flexible linkage or articulated or pivoting assembly, which includes a tensioning element such as a spring. The pivoting assembly moves up and down, with the tensioning element providing the upward force that balances the downward force of the arm.

Imprints to the terrestrial environment at galactic arm crossings of the solar system

NASA Astrophysics Data System (ADS)

Fahr, H. J.; Fichtner, H.; Scherer, K.; Stawicki, O.

At its itinerary through our milky way galaxy the solar system moves through highly variable interstellar environments. Due to its orbital revolution around the galactic center, the solar system also crosses periodically the spiral arms of our galactic plane and thereby expe riences pronounced enviromental changes. Gas densities, magnetic fields and galactic cosmic ray intensities are substantially higher there compared to interarm conditions. Here we present theoretical calculations describing the SN-averaged galactic cosmic ray spectrum for regions inside and outside of galactic arms which then allow to predict how periodic passages of the solar system through galactic arms should be reflected by enhanced particle irradiations of the earth`s atmosphere and by correlated terrestrial Be-10 production rates.

A maintenance three-day-per-week schedule with the single tablet regimen efavirenz/emtricitabine/tenofovir disoproxil fumarate is effective and decreases sub-clinical toxicity: the A-TRI-WEEK pilot trial.

PubMed

Rojas, Jhon; Blanco, Jose L; Sanchez-Palomino, Sonsoles; Marcos, Maria A; Guardo, Alberto C; Gonzalez-Cordon, Ana; Lonca, Montserrat; Tricas, Amparo; Rodriguez, Ana; Romero, Anabel; Miro, Jose M; Mallolas, Josep; Gatell, Jose M; Plana, Montserrat; Martinez, Esteban

2018-05-09

Antiretroviral drugs contained in single tablet Atripla® have pharmacokinetic properties that could allow for longer than once-daily (OD) dosing. We hypothesized that simplifying Atripla® OD to 3-day per week would be feasible, able to maintain viral suppression and less toxic. Virologically suppressed (≥2 years) HIV+ adults on Atripla® OD, CD4 >350/mm at inclusion, and no prior documented virological failure or evidence of resistance mutations to efavirenz, tenofovir, or emtricitabine were randomized to maintain their OD regimen or to reduce it to 3 days (Mondays, Wednesdays, and Fridays) a week (3W). Primary end-point was the proportion of patients free of treatment failure (non-completer = failure) at 24 weeks. CD4 and CD8 cells, ultrasensitive HIV-1 RNA, Pittsburg Sleep Quality Index (PSQI), bone mineral density, plasma efavirenz levels, and fasting blood and urine chemistries were measured at baseline and 24 weeks. The study is registered at ClinicalTrials.gov, NCT01778413. Sixty-one patients were randomized. All patients in both arms remained free of treatment failure (estimated difference 0%; 95% confidence interval -14.1 to 14.1). Ultrasensitive plasma HIV-1 RNA below detection threshold showed no difference between arms (70% in the 3W arm vs. 71% in the OD arm, P = 0.933) at 24 weeks. Total cholesterol and femur T-score significantly increased, while PSQI, plasma efavirenz, albumin/creatinine and beta-2-microglobulin in urine significantly decreased in the 3W arm relative to OD arm. The A-TRI-WEEK study represents a proof of concept for the feasibility of three-day per week Atripla® maintenance that should be further confirmed in a larger, well-powered clinical trial.

Case Report: Whole exome sequencing helps in accurate molecular diagnosis in siblings with a rare co-occurrence of paternally inherited 22q12 duplication and autosomal recessive non-syndromic ichthyosis.

PubMed Central

Gupta, Aayush; Sharma, Yugal; Deo, Kirti; Vellarikkal, Shamsudheen; Jayarajan, Rijith; Dixit, Vishal; Verma, Ankit; Scaria, Vinod; Sivasubbu, Sridhar

2015-01-01

Lamellar ichthyosis (LI), considered an autosomal recessive monogenic genodermatosis, has an incidence of approximately 1 in 250,000. Usually associated with mutations in the transglutaminase gene ( TGM1), mutations in six other genes have, less frequently, been shown to be causative. Two siblings, born in a collodion membrane, presented with fish like scales all over the body. Karyotyping revealed duplication of the chromosome arm on 22q12+ in the father and two siblings. Whole exome sequencing revealed a homozygous p.Gly218Ser variation in TGM1; a variation reported earlier in an isolated Finnish population in association with autosomal recessive non-syndromic ichthyosis. This concurrence of a potentially benign 22q12+ duplication and LI, both rare individually, is reported here likely for the first time. PMID:26594337

Neuropathologic findings in an aged albino gorilla.

PubMed

Márquez, M; Serafin, A; Fernández-Bellon, H; Serrat, S; Ferrer-Admetlla, A; Bertranpetit, J; Ferrer, I; Pumarola, M

2008-07-01

Pallido-nigral spheroids associated with iron deposition have been observed in some aged clinically normal nonhuman primates. In humans, similar findings are observed in neurodegeneration with brain iron accumulation diseases, which, in some cases, show associated mutations in pantothenate kinase 2 gene (PANK2). Here we present an aged gorilla, 40 years old, suffering during the last 2 years of life from progressive tetraparesis, nystagmus, and dyskinesia of the arms, hands, and neck, with accompanying abnormal behavior. The postmortem neuropathologic examination revealed, in addition to aging-associated changes in the brain, numerous corpora amylacea in some brain areas, especially the substantia nigra, and large numbers of axonal spheroids associated with iron accumulation in the internal globus pallidus. Sequencing of the gorilla PANK2 gene failed to detect any mutation. The clinical, neuropathologic, and genetic findings in this gorilla point to an age-related pallido-nigral degeneration that presented PKAN-like neurologic deficits.

A dynamic model for generating actuator specifications for small arms barrel active stabilization

NASA Astrophysics Data System (ADS)

Pathak, Anupam; Brei, Diann; Luntz, Jonathan; Lavigna, Chris

2006-03-01

Due to stresses encountered in combat, it is known that soldier marksmanship noticeably decreases regardless of prior training. Active stabilization systems in small arms have potential to address this problem to increase soldier survivability and mission effectiveness. The key to success is proper actuator design, but this is highly dependent on proper specification which is challenging due to the human/weapon interaction. This paper presents a generic analytical dynamic model which is capable of defining the necessary actuation specifications for a wide range of small arms platforms. The model is unique because it captures the human interface--shoulder and arm--that introduces the jitter disturbance in addition to the geometry, inertial properties and active stabilization stiffness of the small arms platform. Because no data to date is available for actual shooter-induced disturbance in field conditions, a method is given using the model to back-solve from measured shooting range variability data the disturbance amplitude information relative to the input source (arm or shoulder). As examples of the applicability of the model to various small arms systems, two different weapon systems were investigated: the M24 sniper weapon and the M16 assault rifle. In both cases, model based simulations provided valuable insight into impact on the actuation specifications (force, displacement, phase, frequency) due to the interplay of the human-weapon-active stabilization interface including the effect of shooter-disturbance frequency, disturbance location (shoulder vs. arm), and system parameters (stiffness, barrel rotation).

The Chlamydomonas Dhc1 gene encodes a dynein heavy chain subunit required for assembly of the I1 inner arm complex.

PubMed Central

Myster, S H; Knott, J A; O'Toole, E; Porter, M E

1997-01-01

Multiple members of the dynein heavy chain (Dhc) gene family have been recovered in several organisms, but the relationships between these sequences and the Dhc isoforms that they encode are largely unknown. To identify Dhc loci and determine the specific functions of the individual Dhc isoforms, we have screened a collection of motility mutants generated by insertional mutagenesis in Chlamydomonas. In this report, we characterize one strain, pf9-3, in which the insertion event was accompanied by a deletion of approximately 13 kb of genomic DNA within the transcription unit of the Dhc1 gene. Northern blot analysis confirms that pf9-3 is a null mutation. Biochemical and structural studies of isolated axonemes demonstrate that the pf9-3 mutant fails to assemble the I1 inner arm complex, a two-headed dynein isoform composed of two Dhcs (1 alpha and 1 beta) and three intermediate chains. To determine if the Dhc1 gene product corresponds to one of the Dhcs of the I1 complex, antibodies were generated against a Dhc1-specific peptide sequence. Immunoblot analysis reveals that the Dhc1 gene encodes the 1 alpha Dhc subunit. These studies thus, identify the first inner arm Dhc locus to be described in any organism and further demonstrate that the 1 alpha Dhc subunit plays an essential role in the assembly of the I1 inner arm complex. Images PMID:9247642

No evidence for involvement of SDHD in neuroblastoma pathogenesis

PubMed Central

De Preter, Katleen; Vandesompele, Jo; Hoebeeck, Jasmien; Vandenbroecke, Caroline; Smet, Jöel; Nuyts, Annick; Laureys, Geneviève; Combaret, Valérie; Van Roy, Nadine; Roels, Frank; Van Coster, Rudy; Praet, Marleen; De Paepe, Anne; Speleman, Frank

2004-01-01

Background Deletions in the long arm of chromosome 11 are observed in a subgroup of advanced stage neuroblastomas with poor outcome. The deleted region harbours the tumour suppressor gene SDHD that is frequently mutated in paraganglioma and pheochromocytoma, which are, like neuroblastoma, tumours originating from the neural crest. In this study, we sought for evidence for involvement of SDHD in neuroblastoma. Methods SDHD was investigated on the genome, transcriptome and proteome level using mutation screening, methylation specific PCR, real-time quantitative PCR based homozygous deletion screening and mRNA expression profiling, immunoblotting, functional protein analysis and ultrastructural imaging of the mitochondria. Results Analysis at the genomic level of 67 tumour samples and 37 cell lines revealed at least 2 bona-fide mutations in cell lines without allelic loss at 11q23: a 4bp-deletion causing skip of exon 3 resulting in a premature stop codon in cell line N206, and a Y93C mutation in cell line NMB located in a region affected by germline SDHD mutations causing hereditary paraganglioma. No evidence for hypermethylation of the SDHD promotor region was observed, nor could we detect homozygous deletions. Interestingly, SDHD mRNA expression was significantly reduced in SDHD mutated cell lines and cell lines with 11q allelic loss as compared to both cell lines without 11q allelic loss and normal foetal neuroblast cells. However, protein analyses and assessment of mitochondrial morphology presently do not provide clues as to the possible effect of reduced SDHD expression on the neuroblastoma tumour phenotype. Conclusions Our study provides no indications for 2-hit involvement of SDHD in the pathogenesis of neuroblastoma. Also, although a haplo-insufficient mechanism for SDHD involvement in advanced stage neuroblastoma could be considered, the present data do not provide consistent evidence for this hypothesis. PMID:15331017

The Phenotypic Spectrum of DYT24 Due to ANO3 Mutations

PubMed Central

Stamelou, Maria; Charlesworth, Gavin; Cordivari, Carla; Schneider, Susanne A; Kägi, Georg; Sheerin, Una-Marie; Rubio-Agusti, Ignacio; Batla, Amit; Houlden, Henry; Wood, Nicholas W; Bhatia, Kailash P

2014-01-01

Genes causing primary dystonia are rare. Recently, pathogenic mutations in the anoctamin 3 gene (ANO3) have been identified to cause autosomal dominant craniocervical dystonia and have been assigned to the dystonia locus dystonia-24 (DYT24). Here, we expand on the phenotypic spectrum of DYT24 and provide demonstrative videos. Moreover, tremor recordings were performed, and back-averaged electroencephalography, sensory evoked potentials, and C-reflex studies were carried out in two individuals who carried two different mutations in ANO3. Ten patients from three families are described. The age at onset ranged from early childhood to the forties. Cervical dystonia was the most common site of onset followed by laryngeal dystonia. The characteristic feature in all affected individuals was the presence of tremor, which contrasts DYT24 from the typical DYT6 phenotype. Tremor was the sole initial manifestation in some individuals with ANO3 mutations, leading to misdiagnosis as essential tremor. Electrophysiology in two patients with two different mutations showed co-contraction of antagonist muscles, confirming dystonia, and a 6-Hz arm tremor at rest, which increased in amplitude during action. In one of the studied patients, clinically superimposed myoclonus was observed. The duration of the myoclonus was in the range of 250 msec at about 3 Hz, which is more consistent with subcortical myoclonus. In summary, ANO3 causes a varied phenotype of young-onset or adult-onset craniocervical dystonia with tremor and/or myoclonic jerks. Patients with familial cervical dystonia who also have myoclonus-dystonia as well as patients with prominent tremor and mild dystonia should be tested for ANO3 mutations. © 2014 The Authors. Movement Disorders published by International Parkinson and Movement Disorder Society PMID:24442708

48 CFR 908.7111 - Arms and ammunition.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Arms and ammunition. 908... ACQUISITION PLANNING REQUIRED SOURCES OF SUPPLIES AND SERVICES Acquisition of Special Items 908.7111 Arms and ammunition. Pursuant to 10 U.S.C. 4655, the Secretary of the Army is authorized to furnish arms, suitable...

48 CFR 908.7111 - Arms and ammunition.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Arms and ammunition. 908... ACQUISITION PLANNING REQUIRED SOURCES OF SUPPLIES AND SERVICES Acquisition of Special Items 908.7111 Arms and ammunition. Pursuant to 10 U.S.C. 4655, the Secretary of the Army is authorized to furnish arms, suitable...

48 CFR 908.7111 - Arms and ammunition.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Arms and ammunition. 908... ACQUISITION PLANNING REQUIRED SOURCES OF SUPPLIES AND SERVICES Acquisition of Special Items 908.7111 Arms and ammunition. Pursuant to 10 U.S.C. 4655, the Secretary of the Army is authorized to furnish arms, suitable...

48 CFR 908.7111 - Arms and ammunition.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Arms and ammunition. 908... ACQUISITION PLANNING REQUIRED SOURCES OF SUPPLIES AND SERVICES Acquisition of Special Items 908.7111 Arms and ammunition. Pursuant to 10 U.S.C. 4655, the Secretary of the Army is authorized to furnish arms, suitable...

Kinematically redundant arm formulations for coordinated multiple arm implementations

NASA Technical Reports Server (NTRS)

Bailey, Robert W.; Quiocho, Leslie J.; Cleghorn, Timothy F.

1990-01-01

Although control laws for kinematically redundant robotic arms were presented as early as 1969, redundant arms have only recently become recognized as viable solutions to limitations inherent to kinematically sufficient arms. The advantages of run-time control optimization and arm reconfiguration are becoming increasingly attractive as the complexity and criticality of robotic systems continues to progress. A generalized control law for a spatial arm with 7 or more degrees of freedom (DOF) based on Whitney's resolved rate formulation is given. Results from a simulation implementation utilizing this control law are presented. Furthermore, results from a two arm simulation are presented to demonstrate the coordinated control of multiple arms using this formulation.

Performance measurements of a dual-rotor arm mechanism for efficient flight transition of fixed-wing unmanned aerial vehicles

NASA Astrophysics Data System (ADS)

McGill, Karen Ashley Jean

Reconfigurable systems are a class of systems that can be transformed into different configurations, generally to perform unique functions or to maintain operational efficiency under distinct conditions. A UAV can be considered a reconfigurable system when coupled with various useful features such as vertical take-off and landing (VTOL), hover capability, long-range, and relatively large payload. Currently, a UAV having these capabilities is being designed by the UTSA Mechanical Engineering department. UAVs such as this one have the following potential uses: emergency response/disaster relief, hazard-critical missions, offshore oil rig/wind farm delivery, surveillance, etc. The goal of this thesis is to perform experimental thrust and power measurements for the propulsion system of this fixed-wing UAV. Focus was placed on a rotating truss arm supporting two brushless motors and rotors that will later be integrated to the ends of the UAV wing. These truss arms will rotate via a supporting shaft from 0° to 90° to transition the UAV between a vertical take-off, hover, and forward flight. To make this hover/transition possible, a relationship between thrust, arm angle, and power drawn was established by testing the performance of the arm/motor assembly at arm angles of 0°, 15°, 30°, 45°, 60°, 75°, and 90°. Universal equations for this system of thrust as a function of the arm angle were created by correlating data collected by a load cell. A Solidworks model was created and used to conduct fluid dynamics simulations of the streamlines over the arm/motor assembly.

Consequences of impact on arm (elbow and shoulder joints) caused by ball hitting, theoretical analysis

NASA Astrophysics Data System (ADS)

Negrea, Adina; Busuioceanu, Ioana Iuliana

2018-02-01

Present paper estimates the mechanics of the impact of a ball and a hand-arm, during the sports training using a classical model for the hand-arm system, avoiding the contribution of the coefficient of restitution. The results of this investigation are focused on the equations needed to find out theimpact reactions in elbow and shoulder joints, for different anthropometric data. Also, the computing of the position of mass centers and the moments of inertia for each constitutive part of hand-arm system is made.

Online geometrical calibration of a mobile C-arm using external sensors

NASA Astrophysics Data System (ADS)

Mitschke, Matthias M.; Navab, Nassir; Schuetz, Oliver

2000-04-01

3D tomographic reconstruction of high contrast objects such as contrast agent enhanced blood vessels or bones from x-ray images acquired by isocentric C-arm systems recently gained interest. For tomographic reconstruction, a sequence of images is captured during the C-arm rotation around the patient and the precise projection geometry has to be determined for each image. This is a difficult task, as C- arms usually do not provide accurate information about their projection geometry. Standard methods propose the use of an x-ray calibration phantom and an offline calibration, when the motion of the C-arm is supposed to be reproducible between calibration and patient run. However, mobile C-arms usually do not have this desirable property. Therefore, an online recovery of projection geometry is necessary. Here, we study the use of external tracking systems such as Polaris or Optotrak from Northern Digital, Inc., for online calibration. In order to use the external tracking system for recovery of x-ray projection geometry two unknown transformations have to be estimated. We describe our attempt to solve this calibration problem. These are the relations between x-ray imaging system and marker plate of the tracking system as well as worked and sensor coordinate system. Experimental result son anatomical data are presented and visually compared with the results of estimating the projection geometry with an x-ray calibration phantom.

A common neural element receiving rhythmic arm and leg activity as assessed by reflex modulation in arm muscles.

PubMed

Sasada, Syusaku; Tazoe, Toshiki; Nakajima, Tsuyoshi; Futatsubashi, Genki; Ohtsuka, Hiroyuki; Suzuki, Shinya; Zehr, E Paul; Komiyama, Tomoyoshi

2016-04-01

Neural interactions between regulatory systems for rhythmic arm and leg movements are an intriguing issue in locomotor neuroscience. Amplitudes of early latency cutaneous reflexes (ELCRs) in stationary arm muscles are modulated during rhythmic leg or arm cycling but not during limb positioning or voluntary contraction. This suggests that interneurons mediating ELCRs to arm muscles integrate outputs from neural systems controlling rhythmic limb movements. Alternatively, outputs could be integrated at the motoneuron and/or supraspinal levels. We examined whether a separate effect on the ELCR pathways and cortico-motoneuronal excitability during arm and leg cycling is integrated by neural elements common to the lumbo-sacral and cervical spinal cord. The subjects performed bilateral leg cycling (LEG), contralateral arm cycling (ARM), and simultaneous contralateral arm and bilateral leg cycling (A&L), while ELCRs in the wrist flexor and shoulder flexor muscles were evoked by superficial radial (SR) nerve stimulation. ELCR amplitudes were facilitated by cycling tasks and were larger during A&L than during ARM and LEG. A low stimulus intensity during ARM or LEG generated a larger ELCR during A&L than the sum of ELCRs during ARM and LEG. We confirmed this nonlinear increase in single motor unit firing probability following SR nerve stimulation during A&L. Furthermore, motor-evoked potentials following transcranial magnetic and electrical stimulation did not show nonlinear potentiation during A&L. These findings suggest the existence of a common neural element of the ELCR reflex pathway that is active only during rhythmic arm and leg movement and receives convergent input from contralateral arms and legs. Copyright © 2016 the American Physiological Society.

"Omics" of Selenium Biology: A Prospective Study of Plasma Proteome Network Before and After Selenized-Yeast Supplementation in Healthy Men.

PubMed

Sinha, Indu; Karagoz, Kubra; Fogle, Rachel L; Hollenbeak, Christopher S; Zea, Arnold H; Arga, Kazim Y; Stanley, Anne E; Hawkes, Wayne C; Sinha, Raghu

2016-04-01

Low selenium levels have been linked to a higher incidence of cancer and other diseases, including Keshan, Chagas, and Kashin-Beck, and insulin resistance. Additionally, muscle and cardiovascular disorders, immune dysfunction, cancer, neurological disorders, and endocrine function have been associated with mutations in genes encoding for selenoproteins. Selenium biology is complex, and a systems biology approach to study global metabolomics, genomics, and/or proteomics may provide important clues to examining selenium-responsive markers in circulation. In the current investigation, we applied a global proteomics approach on plasma samples collected from a previously conducted, double-blinded placebo controlled clinical study, where men were supplemented with selenized-yeast (Se-Yeast; 300 μg/day, 3.8 μmol/day) or placebo-yeast for 48 weeks. Proteomic analysis was performed by iTRAQ on 8 plasma samples from each arm at baseline and 48 weeks. A total of 161 plasma proteins were identified in both arms. Twenty-two proteins were significantly altered following Se-Yeast supplementation and thirteen proteins were significantly changed after placebo-yeast supplementation in healthy men. The differentially expressed proteins were involved in complement and coagulation pathways, immune functions, lipid metabolism, and insulin resistance. Reconstruction and analysis of protein-protein interaction network around selected proteins revealed several hub proteins. One of the interactions suggested by our analysis, PHLD-APOA4, which is involved in insulin resistance, was subsequently validated by Western blot analysis. Our systems approach illustrates a viable platform for investigating responsive proteomic profile in 'before and after' condition following Se-Yeast supplementation. The nature of proteins identified suggests that selenium may play an important role in complement and coagulation pathways, and insulin resistance.

Analysis of PRICKLE1 in human cleft palate and mouse development demonstrates rare and common variants involved in human malformations

PubMed Central

Yang, Tian; Jia, Zhonglin; Bryant-Pike, Whitney; Chandrasekhar, Anand; Murray, Jeffrey C; Fritzsch, Bernd; Bassuk, Alexander G

2014-01-01

Palate development is shaped by multiple molecular signaling pathways, including the Wnt pathway. In mice and humans, mutations in both the canonical and noncanonical arms of the Wnt pathway manifest as cleft palate, one of the most common human birth defects. Like the palate, numerous studies also link different Wnt signaling perturbations to varying degrees of limb malformation; for example, shortened limbs form in mutations of Ror2,Vangl2looptail and, in particular, Wnt5a. We recently showed the noncanonical Wnt/planar cell polarity (PCP) signaling molecule Prickle1 (Prickle like 1) also stunts limb growth in mice. We now expanded these studies to the palate and show that Prickle1 is also required for palate development, like Wnt5a and Ror2. Unlike in the limb, the Vangl2looptail mutation only aggravates palate defects caused by other mutations. We screened Filipino cleft palate patients and found PRICKLE1 variants, both common and rare, at an elevated frequency. Our results reveal that in mice and humans PRICKLE1 directs palate morphogenesis; our results also uncouple Prickle1 function from Vangl2 function. Together, these findings suggest mouse and human palate development is guided by PCP-Prickle1 signaling that is probably not downstream of Vangl2. PMID:24689077

Acanthosis nigricans in a Japanese boy with hypochondroplasia due to a K650T mutation in FGFR3

PubMed Central

Hirai, Hiroki; Hamada, Junpei; Hasegawa, Kosei; Ishii, Eiichi

2017-01-01

Abstract. Acanthosis nigricans (AN) is observed in some cases of skeletal dysplasia. However, AN has occasionally been reported in patients with hypochondroplasia (HCH), and a clinical diagnosis is sometimes difficult when its physical and radiological features are mild. Mutations in the gene encoding the fibroblast growth factor receptor 3 (FGFR3) have been identified as the cause of some types of skeletal dysplasia, which is diagnostically useful. Here, we report the case of a 3-yr-old Japanese boy who presented with AN. His height, weight, head circumference, and arm span were 91.7 cm (–1.95 SD), 16.3 kg, 54.0 cm (+2.6 SD), and 88.0 cm, respectively. In addition to the AN, he also exhibited a mild height deficit and macrocephaly, which prompted a search for FGFR3 mutations, although no skeletal disproportion, exaggerated lumbar lordosis, or facial dysmorphism was observed, and only slight radiological abnormalities were noted. A definitive diagnosis of HCH was made based on FGFR3 gene analysis, which detected a heterozygous K650T mutation. Insulin insensitivity was not found to have contributed to the development of AN. In individuals with AN, careful assessments for symptoms of HCH are important, regardless of the presence or absence of a short stature, and FGFR3 gene analysis is recommended in such cases. PMID:29026271

Screening of SHOX gene sequence variants in Saudi Arabian children with idiopathic short stature.

PubMed

Alharthi, Abdulla A; El-Hallous, Ehab I; Talaat, Iman M; Alghamdi, Hamed A; Almalki, Matar I; Gaber, Ahmed

2017-10-01

Short stature affects approximately 2%-3% of children, representing one of the most frequent disorders for which clinical attention is sought during childhood. Despite assumed genetic heterogeneity, mutations or deletions in the short stature homeobox-containing gene ( SHOX ) are frequently detected in subjects with short stature. Idiopathic short stature (ISS) refers to patients with short stature for various unknown reasons. The goal of this study was to screen all the exons of SHOX to identify related mutations. We screened all the exons of SHOX for mutations analysis in 105 ISS children patients (57 girls and 48 boys) living in Taif governorate, KSA using a direct DNA sequencing method. Height, arm span, and sitting height were recorded, and subischial leg length was calculated. A total of 30 of 105 ISS patients (28%) contained six polymorphic variants in exons 1, 2, 4, and 6. One mutation was found in the DNA domain binding region of exon 4. Three of these polymorphic variants were novel, while the others were reported previously. There were no significant differences in anthropometric measures in ISS patients with and without identifiable polymorphic variants in SHOX . In Saudi Arabia ISS patients, rather than SHOX , it is possible that new genes are involved in longitudinal growth. Additional molecular analysis is required to diagnose and understand the etiology of this disease.

49 CFR 236.22 - Semaphore signal arm; clearance to other objects.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Semaphore signal arm; clearance to other objects... Rules and Instructions: All Systems Roadway Signals and Cab Signals § 236.22 Semaphore signal arm; clearance to other objects. At least one-half inch clearance shall be provided between semaphore signal arm...

48 CFR 552.237-72 - Prohibition Regarding “Quasi-Military Armed Forces.”

Code of Federal Regulations, 2010 CFR

2010-10-01

...Quasi-Military Armed Forces.â 552.237-72 Section 552.237-72 Federal Acquisition Regulations System... Provisions and Clauses 552.237-72 Prohibition Regarding “Quasi-Military Armed Forces.” As prescribed in 537.110(b), insert the following clause: Prohibition Regarding “Quasi-Military Armed Forces” (SEP 1999...

49 CFR 236.22 - Semaphore signal arm; clearance to other objects.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 4 2012-10-01 2012-10-01 false Semaphore signal arm; clearance to other objects... Rules and Instructions: All Systems Roadway Signals and Cab Signals § 236.22 Semaphore signal arm; clearance to other objects. At least one-half inch clearance shall be provided between semaphore signal arm...

48 CFR 225.7702 - Acquisition of small arms.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false Acquisition of small arms... Operations in Iraq or Afghanistan 225.7702 Acquisition of small arms. (a) Except as provided in paragraph (b) of this section, when acquiring small arms for assistance to the Army of Iraq, the Army of...

49 CFR 236.22 - Semaphore signal arm; clearance to other objects.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 4 2014-10-01 2014-10-01 false Semaphore signal arm; clearance to other objects... Rules and Instructions: All Systems Roadway Signals and Cab Signals § 236.22 Semaphore signal arm; clearance to other objects. At least one-half inch clearance shall be provided between semaphore signal arm...

48 CFR 225.7702-1 - Acquisition of small arms.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false Acquisition of small arms... Operations in Afghanistan 225.7702-1 Acquisition of small arms. (a) Except as provided in paragraph (b) of this section, when acquiring small arms for assistance to the Army of Afghanistan, the Afghani Police...

48 CFR 225.7702 - Acquisition of small arms.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Acquisition of small arms... Operations in Iraq or Afghanistan 225.7702 Acquisition of small arms. (a) Except as provided in paragraph (b) of this section, when acquiring small arms for assistance to the Army of Iraq, the Army of...

49 CFR 236.22 - Semaphore signal arm; clearance to other objects.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 4 2011-10-01 2011-10-01 false Semaphore signal arm; clearance to other objects... Rules and Instructions: All Systems Roadway Signals and Cab Signals § 236.22 Semaphore signal arm; clearance to other objects. At least one-half inch clearance shall be provided between semaphore signal arm...

49 CFR 236.22 - Semaphore signal arm; clearance to other objects.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 4 2013-10-01 2013-10-01 false Semaphore signal arm; clearance to other objects... Rules and Instructions: All Systems Roadway Signals and Cab Signals § 236.22 Semaphore signal arm; clearance to other objects. At least one-half inch clearance shall be provided between semaphore signal arm...

48 CFR 225.7702-1 - Acquisition of small arms.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false Acquisition of small arms... Operations in Afghanistan 225.7702-1 Acquisition of small arms. (a) Except as provided in paragraph (b) of this section, when acquiring small arms for assistance to the Army of Afghanistan, the Afghani Police...

48 CFR 225.7702 - Acquisition of small arms.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false Acquisition of small arms... Operations in Iraq or Afghanistan 225.7702 Acquisition of small arms. (a) Except as provided in paragraph (b) of this section, when acquiring small arms for assistance to the Army of Iraq, the Army of...

Surface Energy Balance System (SEBS) Handbook

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, D. R.

2016-01-01

A Surface Energy Balance System (SEBS) has been installed collocated with each deployed Eddy Correlation Flux Measurement System (ECOR) at the Atmospheric Radiation Measurement (ARM) Climate Research Facility’s Southern Great Plains (SGP) site, North Slope of Alaska (NSA) site, first ARM Mobile Facility (AMF1), second ARM Mobile Facility (AMF2), and third ARM Mobile Facility (AMF3) at Oliktok Point (OLI). A SEBS was also deployed with the Tropical Western Pacific (TWP) site, before it was decommissioned. Data from these sites, including the retired TWP, are available in the ARM Data Archive. The SEBS consists of upwelling and downwelling solar and infraredmore » radiometers within one net radiometer, a wetness sensor, and soil measurements. The SEBS measurements allow the comparison of ECOR sensible and latent heat fluxes with the energy balance determined from the SEBS and provide information on wetting of the sensors for data quality purposes.« less

New nonlinear control algorithms for multiple robot arms

NASA Technical Reports Server (NTRS)

Tarn, T. J.; Bejczy, A. K.; Yun, X.

1988-01-01

Multiple coordinated robot arms are modeled by considering the arms as closed kinematic chains and as a force-constrained mechanical system working on the same object simultaneously. In both formulations, a novel dynamic control method is discussed. It is based on feedback linearization and simultaneous output decoupling technique. By applying a nonlinear feedback and a nonlinear coordinate transformation, the complicated model of the multiple robot arms in either formulation is converted into a linear and output decoupled system. The linear system control theory and optimal control theory are used to design robust controllers in the task space. The first formulation has the advantage of automatically handling the coordination and load distribution among the robot arms. In the second formulation, it was found that by choosing a general output equation it became possible simultaneously to superimpose the position and velocity error feedback with the force-torque error feedback in the task space.

Mutation of Dcdc2 in mice leads to impairments in auditory processing and memory ability.

PubMed

Truong, D T; Che, A; Rendall, A R; Szalkowski, C E; LoTurco, J J; Galaburda, A M; Holly Fitch, R

2014-11-01

Dyslexia is a complex neurodevelopmental disorder characterized by impaired reading ability despite normal intellect, and is associated with specific difficulties in phonological and rapid auditory processing (RAP), visual attention and working memory. Genetic variants in Doublecortin domain-containing protein 2 (DCDC2) have been associated with dyslexia, impairments in phonological processing and in short-term/working memory. The purpose of this study was to determine whether sensory and behavioral impairments can result directly from mutation of the Dcdc2 gene in mice. Several behavioral tasks, including a modified pre-pulse inhibition paradigm (to examine auditory processing), a 4/8 radial arm maze (to assess/dissociate working vs. reference memory) and rotarod (to examine sensorimotor ability and motor learning), were used to assess the effects of Dcdc2 mutation. Behavioral results revealed deficits in RAP, working memory and reference memory in Dcdc2(del2/del2) mice when compared with matched wild types. Current findings parallel clinical research linking genetic variants of DCDC2 with specific impairments of phonological processing and memory ability. © 2014 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Trial Development of a Mobile Feeding Assistive Robotic Arm for People with Physical Disabilities of the Extremities

NASA Astrophysics Data System (ADS)

Uehara, Hideyuki; Higa, Hiroki; Soken, Takashi; Namihira, Yoshinori

A mobile feeding assistive robotic arm for people with physical disabilities of the extremities has been developed in this paper. This system is composed of a robotic arm, microcontroller, and its interface. The main unit of the robotic arm can be contained in a laptop computer's briefcase. Its weight is 5kg, including two 12-V lead acid rechargeable batteries. This robotic arm can be also mounted on a wheelchair. To verify performance of the mobile robotic arm system, drinking tea task was experimentally performed by two able-bodied subjects as well as three persons suffering from muscular dystrophy. From the experimental results, it was clear that they could smoothly carry out the drinking task, and that the robotic arm could firmly grasp a commercially available 500-ml plastic bottle. The eating task was also performed by the two able-bodied subjects. The experimental results showed that they could eat porridge by using a spoon without any difficulty.

Thermal Nondestructive Evaluation Report: Inspection of the Refurbished Manipulator Arm System in the Manipulator Development Facility at Johnson Space Center 10-12 January 2001

NASA Technical Reports Server (NTRS)

Cramer, K. Elliott

2002-01-01

On 4 December 2002, a failure of the Refurbished Manipulator Arm System (RMAS) occurred in the Manipulator Development Facility (MDF) at Johnson Space Center. When the Test Director commanded a should pitch maneuver to lift the arm from its payload bay pedestal, the yaw controls failed. This, coupled with a gravitational forces (due to the angle of the shoulder joint with respect to vertical), resulted in uncontrolled arm motion. The shoulder yaw joint moved approximately 20 degrees, causing the extended arm to strike and severely damage the port side MDF catwalk handrails. The arm motion stopped after impact with the handrails. On 10-12 January 2001, inspections were performed on the port face of the lower and upper arms of the RMAS using a infrared thermography developed at Langley Research Center. This paper presents the results of those nondestructive inspections and provides a complete description of the anomalies found and their locations.

Lunar surface operations. Volume 3: Robotic arm for lunar surface vehicle

NASA Technical Reports Server (NTRS)

Shields, William; Feteih, Salah; Hollis, Patrick

1993-01-01

A robotic arm for a lunar surface vehicle that can help in handling cargo and equipment, and remove obstacles from the path of the vehicle is defined as a support to NASA's intention to establish a lunar based colony by the year 2010. Its mission would include, but not limited to the following: exploration, lunar sampling, replace and remove equipment, and setup equipment (e.g. microwave repeater stations). Performance objectives for the robotic arm include a reach of 3 m, accuracy of 1 cm, arm mass of 100 kg, and lifting capability of 50 kg. The end effectors must grip various sizes and shapes of cargo; push, pull, turn, lift, or lower various types of equipment; and clear a path on the lunar surface by shoveling, sweeping aside, or gripping the obstacle present in the desired path. The arm can safely complete a task within a reasonable amount of time; the actual time is dependent upon the task to be performed. The positioning of the arm includes a manual backup system such that the arm can be safely stored in case of failure. Remote viewing and proximity and positioning sensors are incorporated in the design of the arm. The following specific topic are addressed in this report: mission and requirements, system design and integration, mechanical structure, modified wrist, structure-to-end-effector interface, end-effectors, and system controls.

Genomic Characterization of Non–Small-Cell Lung Cancer in African Americans by Targeted Massively Parallel Sequencing

PubMed Central

Araujo, Luiz H.; Timmers, Cynthia; Bell, Erica Hlavin; Shilo, Konstantin; Lammers, Philip E.; Zhao, Weiqiang; Natarajan, Thanemozhi G.; Miller, Clinton J.; Zhang, Jianying; Yilmaz, Ayse S.; Liu, Tom; Coombes, Kevin; Amann, Joseph; Carbone, David P.

2015-01-01

Purpose Technologic advances have enabled the comprehensive analysis of genetic perturbations in non–small-cell lung cancer (NSCLC); however, African Americans have often been underrepresented in these studies. This ethnic group has higher lung cancer incidence and mortality rates, and some studies have suggested a lower incidence of epidermal growth factor receptor mutations. Herein, we report the most in-depth molecular profile of NSCLC in African Americans to date. Methods A custom panel was designed to cover the coding regions of 81 NSCLC-related genes and 40 ancestry-informative markers. Clinical samples were sequenced on a massively parallel sequencing instrument, and anaplastic lymphoma kinase translocation was evaluated by fluorescent in situ hybridization. Results The study cohort included 99 patients (61% males, 94% smokers) comprising 31 squamous and 68 nonsquamous cell carcinomas. We detected 227 nonsilent variants in the coding sequence, including 24 samples with nonoverlapping, classic driver alterations. The frequency of driver mutations was not significantly different from that of whites, and no association was found between genetic ancestry and the presence of somatic mutations. Copy number alteration analysis disclosed distinguishable amplifications in the 3q chromosome arm in squamous cell carcinomas and pointed toward a handful of targetable alterations. We also found frequent SMARCA4 mutations and protein loss, mostly in driver-negative tumors. Conclusion Our data suggest that African American ancestry may not be significantly different from European/white background for the presence of somatic driver mutations in NSCLC. Furthermore, we demonstrated that using a comprehensive genotyping approach could identify numerous targetable alterations, with potential impact on therapeutic decisions. PMID:25918285

APOA5 Q97X mutation identified through homozygosity mapping causes severe hypertriglyceridemia in a Chilean consanguineous family.

PubMed

Dussaillant, Catalina; Serrano, Valentina; Maiz, Alberto; Eyheramendy, Susana; Cataldo, Luis Rodrigo; Chavez, Matías; Smalley, Susan V; Fuentes, Marcela; Rigotti, Attilio; Rubio, Lorena; Lagos, Carlos F; Martinez, José Alfredo; Santos, José Luis

2012-11-15

Severe hypertriglyceridemia (HTG) has been linked to defects in LPL, APOC2, APOA5, LMF1 and GBIHBP1 genes. However, a number of severe HTG cases are probably caused by as yet unidentified mutations. Very high triglyceride plasma levels (>112 mmol/L at diagnosis) were found in two sisters of a Chilean consanguineous family, which is strongly suggestive of a recessive highly penetrant mutation. The aim of this study was to determine the genetic locus responsible for the severe HTG in this family. We carried out a genome-wide linkage study with nearly 300,000 biallelic markers (Illumina Human CytoSNP-12 panel). Using the homozygosity mapping strategy, we searched for chromosome regions with excess of homozygous genotypes in the affected cases compared to non-affected relatives. A large homozygous segment was found in the long arm of chromosome 11, with more than 2,500 consecutive homozygous SNP shared by the proband with her affected sister, and containing the APOA5/A4/C3/A1 cluster. Direct sequencing of the APOA5 gene revealed a known homozygous nonsense Q97X mutation (p.Gln97Ter) found in both affected sisters but not in non-affected relatives nor in a sample of unrelated controls. The Q97X mutation of the APOA5 gene in homozygous status is responsible for the severe hypertriglyceridemia in this family. We have shown that homozygosity mapping correctly pinpointed the genomic region containing the gene responsible for severe hypertriglyceridemia in this consanguineous Chilean family.

APOA5 Q97X Mutation Identified through homozygosity mapping causes severe hypertriglyceridemia in a Chilean consanguineous family

PubMed Central

2012-01-01

Background Severe hypertriglyceridemia (HTG) has been linked to defects in LPL, APOC2, APOA5, LMF1 and GBIHBP1 genes. However, a number of severe HTG cases are probably caused by as yet unidentified mutations. Very high triglyceride plasma levels (>112 mmol/L at diagnosis) were found in two sisters of a Chilean consanguineous family, which is strongly suggestive of a recessive highly penetrant mutation. The aim of this study was to determine the genetic locus responsible for the severe HTG in this family. Methods We carried out a genome-wide linkage study with nearly 300,000 biallelic markers (Illumina Human CytoSNP-12 panel). Using the homozygosity mapping strategy, we searched for chromosome regions with excess of homozygous genotypes in the affected cases compared to non-affected relatives. Results A large homozygous segment was found in the long arm of chromosome 11, with more than 2,500 consecutive homozygous SNP shared by the proband with her affected sister, and containing the APOA5/A4/C3/A1 cluster. Direct sequencing of the APOA5 gene revealed a known homozygous nonsense Q97X mutation (p.Gln97Ter) found in both affected sisters but not in non-affected relatives nor in a sample of unrelated controls. Conclusion The Q97X mutation of the APOA5 gene in homozygous status is responsible for the severe hypertriglyceridemia in this family. We have shown that homozygosity mapping correctly pinpointed the genomic region containing the gene responsible for severe hypertriglyceridemia in this consanguineous Chilean family. PMID:23151256

Altered activity-rest patterns in mice with a human autosomal-dominant nocturnal frontal lobe epilepsy mutation in the β2 nicotinic receptor

PubMed Central

Xu, Jian; Cohen, Bruce N.; Zhu, Yongling; Dziewczapolski, Gustavo; Panda, Satchidananda; Lester, Henry A.; Heinemann, Stephen F.; Contractor, Anis

2010-01-01

High-affinity nicotinic receptors containing beta2 subunits (β2*) are widely expressed in the brain, modulating many neuronal processes and contributing to neuropathologies such as Alzheimer’s disease, Parkinson’s disease and epilepsy. Mutations in both the α4 and β2 subunits are associated with a rare partial epilepsy, autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE). Here we introduced one such human missense mutation into the mouse genome to generate a knock-in strain carrying a valine-to-leucine mutation β2V287L.β2V287L mice were viable and born at an expected Mendelian ratio. Surprisingly, mice did not display an overt seizure phenotype; however homozygous mice did display significant alterations in their activity-rest patterns. This was manifest as an increase in activity during the light cycle suggestive of disturbances in the normal sleep patterns of mice; a parallel phenotype to that found in human ADNFLE patients. Consistent with the role of nicotinic receptors in reward pathways, we found that β2V287L mice did not develop a normal proclivity to voluntary wheel running, a model for natural reward. Anxiety-related behaviors were also affected by the V287L mutation. Mutant mice spent more time in the open arms on the elevated plus maze (EPM) suggesting that they had reduced levels of anxiety. Together, these findings emphasize several important roles of β2* nicotinic receptors in complex biological processes including the activity-rest cycle, natural reward, and anxiety. PMID:20603624

Autosomal dominant myopathy: missense mutation (Glu-706 --> Lys) in the myosin heavy chain IIa gene.

PubMed

Martinsson, T; Oldfors, A; Darin, N; Berg, K; Tajsharghi, H; Kyllerman, M; Wahlstrom, J

2000-12-19

We here report on a human myopathy associated with a mutation in a fast myosin heavy chain (MyHC) gene, and also the genetic defect in a hereditary inclusion body myopathy. The disorder has previously been described in a family with an "autosomal dominant myopathy, with joint contractures, ophthalmoplegia, and rimmed vacuoles." Linkage analysis and radiation hybrid mapping showed that the gene locus (Human Genome Map locus name: IBM3) is situated in a 2-Mb region of chromosome 17p13, where also a cluster of MyHC genes is located. These include the genes encoding embryonic, IIa, IIx/d, IIb, perinatal, and extraocular MyHCs. Morphological analysis of muscle biopsies from patients from the family indicated to us that the type 2A fibers frequently were abnormal, whereas other fiber types appeared normal. This observation prompted us to investigate the MyHC-IIa gene, since MyHC-IIa is the major isoform in type 2A fibers. The complete genomic sequence for this gene was deduced by using an "in silico" strategy. The gene, found to consist of 38 exons, was subjected to a complete mutation scan in patients and controls. We identified a missense mutation, Glu-706 --> Lys, which is located in a highly conserved region of the motor domain, the so-called SH1 helix region. By conformational changes this region communicates activity at the nucleotide-binding site to the neck region, resulting in the lever arm swing. The mutation in this region is likely to result in a dysfunctional myosin, compatible with the disorder in the family.

Design of mechanisms to lock/latch systems under rotational or translational motion

NASA Technical Reports Server (NTRS)

Billimoria, R. P.

1976-01-01

Bodies/systems need to be stopped and locked/latched at the end of their path. Some examples of these systems in the aerospace industry (including launch vehicle, spacecraft, and the ground support equipment) are the command module access arm, service arms, docking module of the ASTP and the orbiter access arm for the space shuttle. Two major aspects are covered: (1) various methods of latching and (2) selection of the optimum method for latching, depending on the application and the design requirement criteria.

Quantifying EGFR alterations in the lung cancer genome with nanofluidic digital PCR arrays.

PubMed

Wang, Jun; Ramakrishnan, Ramesh; Tang, Zhe; Fan, Weiwen; Kluge, Amy; Dowlati, Afshin; Jones, Robert C; Ma, Patrick C

2010-04-01

The EGFR [epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)] gene is known to harbor genomic alterations in advanced lung cancer involving gene amplification and kinase mutations that predict the clinical response to EGFR-targeted inhibitors. Methods for detecting such molecular changes in lung cancer tumors are desirable. We used a nanofluidic digital PCR array platform and 16 cell lines and 20 samples of genomic DNA from resected tumors (stages I-III) to quantify the relative numbers of copies of the EGFR gene and to detect mutated EGFR alleles in lung cancer. We assessed the relative number of EGFR gene copies by calculating the ratio of the number of EGFR molecules (measured with a 6-carboxyfluorescein-labeled Scorpion assay) to the number of molecules of the single-copy gene RPP30 (ribonuclease P/MRP 30kDa subunit) (measured with a 6-carboxy-X-rhodamine-labeled TaqMan assay) in each panel. To assay for the EGFR L858R (exon 21) mutation and exon 19 in-frame deletions, we used the ARMS and Scorpion technologies in a DxS/Qiagen EGFR29 Mutation Test Kit for the digital PCR array. The digital array detected and quantified rare gefitinib/erlotinib-sensitizing EGFR mutations (0.02%-9.26% abundance) that were present in formalin-fixed, paraffin-embedded samples of early-stage resectable lung tumors without an associated increase in gene copy number. Our results also demonstrated the presence of intratumor molecular heterogeneity for the clinically relevant EGFR mutated alleles in these early-stage lung tumors. The digital PCR array platform allows characterization and quantification of oncogenes, such as EGFR, at the single-molecule level. Use of this nanofluidics platform may provide deeper insight into the specific roles of clinically relevant kinase mutations during different stages of lung tumor progression and may be useful in predicting the clinical response to EGFR-targeted inhibitors.

Pathologic Findings at Risk-Reducing Salpingo-Oophorectomy: Primary Results From Gynecologic Oncology Group Trial GOG-0199

PubMed Central

Sherman, Mark E.; Piedmonte, Marion; Mai, Phuong L.; Ioffe, Olga B.; Ronnett, Brigitte M.; Van Le, Linda; Ivanov, Iouri; Bell, Maria C.; Blank, Stephanie V.; DiSilvestro, Paul; Hamilton, Chad A.; Tewari, Krishnansu S.; Wakeley, Katie; Kauff, Noah D.; Yamada, S. Diane; Rodriguez, Gustavo; Skates, Steven J.; Alberts, David S.; Walker, Joan L.; Minasian, Lori; Lu, Karen; Greene, Mark H.

2014-01-01

Purpose Risk-reducing salpingo-oophorectomy (RRSO) lowers mortality from ovarian/tubal and breast cancers among BRCA1/2 mutation carriers. Uncertainties persist regarding potential benefits of RRSO among high-risk noncarriers, optimal surgical age, and anatomic origin of clinically occult cancers detected at surgery. To address these topics, we analyzed surgical treatment arm results from Gynecologic Oncology Group Protocol-0199 (GOG-0199), the National Ovarian Cancer Prevention and Early Detection Study. Participants and Methods This analysis included asymptomatic high-risk women age ≥ 30 years who elected RRSO at enrollment. Women provided risk factor data and underwent preoperative cancer antigen 125 (CA-125) serum testing and transvaginal ultrasound (TVU). RRSO specimens were processed according to a standardized tissue processing protocol and underwent central pathology panel review. Research-based BRCA1/2 mutation testing was performed when a participant's mutation status was unknown at enrollment. Relationships between participant characteristics and diagnostic findings were assessed using univariable statistics and multivariable logistic regression. Results Invasive or intraepithelial ovarian/tubal/peritoneal neoplasms were detected in 25 (2.6%) of 966 RRSOs (BRCA1 mutation carriers, 4.6%; BRCA2 carriers, 3.5%; and noncarriers, 0.5%; P < .001). In multivariable models, positive BRCA1/2 mutation status (P = .0056), postmenopausal status (P = .0023), and abnormal CA-125 levels and/or TVU examinations (P < .001) were associated with detection of clinically occult neoplasms at RRSO. For 387 women with negative BRCA1/2 mutation testing and normal CA-125 levels, findings at RRSO were benign. Conclusion Clinically occult cancer was detected among 2.6% of high-risk women undergoing RRSO. BRCA1/2 mutation, postmenopausal status, and abnormal preoperative CA-125 and/or TVU were associated with cancer detection at RRSO. These data can inform management decisions among women at high risk of ovarian/tubal cancer. PMID:25199754

Control of octopus arm extension by a peripheral motor program.

PubMed

Sumbre, G; Gutfreund, Y; Fiorito, G; Flash, T; Hochner, B

2001-09-07

For goal-directed arm movements, the nervous system generates a sequence of motor commands that bring the arm toward the target. Control of the octopus arm is especially complex because the arm can be moved in any direction, with a virtually infinite number of degrees of freedom. Here we show that arm extensions can be evoked mechanically or electrically in arms whose connection with the brain has been severed. These extensions show kinematic features that are almost identical to normal behavior, suggesting that the basic motor program for voluntary movement is embedded within the neural circuitry of the arm itself. Such peripheral motor programs represent considerable simplification in the motor control of this highly redundant appendage.

Radiance Research Particle Soot/Absorption Photometer Instrument Handbook

DOE Office of Scientific and Technical Information (OSTI.GOV)

Springston, S. R.

2016-03-01

Radiance Research PSAPs as described in this Handbook are deployed in the second ARM Mobile Facility (AMF2) Aerosol Observing System (AOS), the third ARM Mobile Facility (AMF3) AOS, ENA AOS and Mobile Aerosol Observing System (MAOS)-A. An earlier version of the PSAP is currently operated in the ARM Aerial Facility and at SGP. The older SGP instrument is covered in a separate Handbook.

Selumetinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With Activating MAPK Pathway Mutations (A Pediatric MATCH Treatment Trial)

ClinicalTrials.gov

2018-06-25

Advanced Malignant Solid Neoplasm; Ann Arbor Stage III Childhood Non-Hodgkin Lymphoma; Ann Arbor Stage IV Childhood Non-Hodgkin Lymphoma; BRAF Gene Mutation; GNA11 Gene Mutation; GNAQ Gene Mutation; Histiocytosis; HRAS Gene Mutation; KRAS Gene Mutation; NF1 Gene Mutation; NRAS Gene Mutation; Recurrent Childhood Central Nervous System Neoplasm; Recurrent Childhood Non-Hodgkin Lymphoma; Recurrent Malignant Solid Neoplasm; Recurrent Neuroblastoma; Refractory Central Nervous System Neoplasm; Refractory Malignant Solid Neoplasm; Refractory Neuroblastoma; Refractory Non-Hodgkin Lymphoma

Local Treatment of Unresectable Colorectal Liver Metastases: Results of a Randomized Phase II Trial

PubMed Central

Van Coevorden, Frits; Punt, Cornelis J. A.; Pierie, Jean-Pierre E. N.; Borel-Rinkes, Inne; Ledermann, Jonathan A.; Poston, Graeme; Bechstein, Wolf; Lentz, Marie-Ange; Mauer, Murielle; Folprecht, Gunnar; Van Cutsem, Eric; Ducreux, Michel; Nordlinger, Bernard

2017-01-01

Background: Tumor ablation is often employed for unresectable colorectal liver metastases. However, no survival benefit has ever been demonstrated in prospective randomized studies. Here, we investigate the long-term benefits of such an aggressive approach. Methods: In this randomized phase II trial, 119 patients with unresectable colorectal liver metastases (n < 10 and no extrahepatic disease) received systemic treatment alone or systemic treatment plus aggressive local treatment by radiofrequency ablation ± resection. Previously, we reported that the primary end point (30-month overall survival [OS] > 38%) was met. We now report on long-term OS results. All statistical tests were two-sided. The analyses were according to intention to treat. Results: At a median follow up of 9.7 years, 92 of 119 (77.3%) patients had died: 39 of 60 (65.0%) in the combined modality arm and 53 of 59 (89.8%) in the systemic treatment arm. Almost all patients died of progressive disease (35 patients in the combined modality arm, 49 patients in the systemic treatment arm). There was a statistically significant difference in OS in favor of the combined modality arm (hazard ratio [HR] = 0.58, 95% confidence interval [CI] = 0.38 to 0.88, P = .01). Three-, five-, and eight-year OS were 56.9% (95% CI = 43.3% to 68.5%), 43.1% (95% CI = 30.3% to 55.3%), 35.9% (95% CI = 23.8% to 48.2%), respectively, in the combined modality arm and 55.2% (95% CI = 41.6% to 66.9%), 30.3% (95% CI = 19.0% to 42.4%), 8.9% (95% CI = 3.3% to 18.1%), respectively, in the systemic treatment arm. Median OS was 45.6 months (95% CI = 30.3 to 67.8 months) in the combined modality arm vs 40.5 months (95% CI = 27.5 to 47.7 months) in the systemic treatment arm. Conclusions: This phase II trial is the first randomized study demonstrating that aggressive local treatment can prolong OS in patients with unresectable colorectal liver metastases. PMID:28376151

Local Treatment of Unresectable Colorectal Liver Metastases: Results of a Randomized Phase II Trial.

PubMed

Ruers, Theo; Van Coevorden, Frits; Punt, Cornelis J A; Pierie, Jean-Pierre E N; Borel-Rinkes, Inne; Ledermann, Jonathan A; Poston, Graeme; Bechstein, Wolf; Lentz, Marie-Ange; Mauer, Murielle; Folprecht, Gunnar; Van Cutsem, Eric; Ducreux, Michel; Nordlinger, Bernard

2017-09-01

Tumor ablation is often employed for unresectable colorectal liver metastases. However, no survival benefit has ever been demonstrated in prospective randomized studies. Here, we investigate the long-term benefits of such an aggressive approach. In this randomized phase II trial, 119 patients with unresectable colorectal liver metastases (n < 10 and no extrahepatic disease) received systemic treatment alone or systemic treatment plus aggressive local treatment by radiofrequency ablation ± resection. Previously, we reported that the primary end point (30-month overall survival [OS] > 38%) was met. We now report on long-term OS results. All statistical tests were two-sided. The analyses were according to intention to treat. At a median follow up of 9.7 years, 92 of 119 (77.3%) patients had died: 39 of 60 (65.0%) in the combined modality arm and 53 of 59 (89.8%) in the systemic treatment arm. Almost all patients died of progressive disease (35 patients in the combined modality arm, 49 patients in the systemic treatment arm). There was a statistically significant difference in OS in favor of the combined modality arm (hazard ratio [HR] = 0.58, 95% confidence interval [CI] = 0.38 to 0.88, P = .01). Three-, five-, and eight-year OS were 56.9% (95% CI = 43.3% to 68.5%), 43.1% (95% CI = 30.3% to 55.3%), 35.9% (95% CI = 23.8% to 48.2%), respectively, in the combined modality arm and 55.2% (95% CI = 41.6% to 66.9%), 30.3% (95% CI = 19.0% to 42.4%), 8.9% (95% CI = 3.3% to 18.1%), respectively, in the systemic treatment arm. Median OS was 45.6 months (95% CI = 30.3 to 67.8 months) in the combined modality arm vs 40.5 months (95% CI = 27.5 to 47.7 months) in the systemic treatment arm. This phase II trial is the first randomized study demonstrating that aggressive local treatment can prolong OS in patients with unresectable colorectal liver metastases. © The Author 2017. Published by Oxford University Press.

A highly articulated robotic surgical system for minimally invasive surgery.

PubMed

Ota, Takeyoshi; Degani, Amir; Schwartzman, David; Zubiate, Brett; McGarvey, Jeremy; Choset, Howie; Zenati, Marco A

2009-04-01

We developed a novel, highly articulated robotic surgical system (CardioARM) to enable minimally invasive intrapericardial therapeutic delivery through a subxiphoid approach. We performed preliminary proof of concept studies in a porcine preparation by performing epicardial ablation. CardioARM is a robotic surgical system having an articulated design to provide unlimited but controllable flexibility. The CardioARM consists of serially connected, rigid cyclindrical links housing flexible working ports through which catheter-based tools for therapy and imaging can be advanced. The CardioARM is controlled by a computer-driven, user interface, which is operated outside the operative field. In six experimental subjects, the CardioARM was introduced percutaneously through a subxiphoid access. A commercial 5-French radiofrequency ablation catheter was introduced through the working port, which was then used to guide deployment. In all subjects, regional ("linear") left atrial ablation was successfully achieved without complications. Based on these preliminary studies, we believe that the CardioARM promises to enable deployment of a number of epicardium-based therapies. Improvements in imaging techniques will likely facilitate increasingly complex procedures.

Functional Architecture of the Outer Arm Dynein Conformational Switch*

PubMed Central

King, Stephen M.; Patel-King, Ramila S.

2012-01-01

Dynein light chain 1 (LC1/DNAL1) is one of the most highly conserved components of ciliary axonemal outer arm dyneins, and it associates with both a heavy chain motor unit and tubulin located within the A-tubule of the axonemal outer doublet microtubules. In a variety of model systems, lack of LC1 or expression of mutant forms leads to profound defects in ciliary motility, including the failure of the hydrodynamic coupling needed for ciliary metachronal synchrony, random stalling during the power/recovery stroke transition, an aberrant response to imposed viscous load, and in some cases partial failure of motor assembly. These phenotypes have led to the proposal that LC1 acts as part of a mechanical switch to control motor function in response to alterations in axonemal curvature. Here we have used NMR chemical shift mapping to define the regions perturbed by a series of mutations in the C-terminal domain that yield a range of phenotypic effects on motility. In addition, we have identified the subdomain of LC1 involved in binding microtubules and characterized the consequences of an Asn → Ser alteration within the terminal leucine-rich repeat that in humans causes primary ciliary dyskinesia. Together, these data define a series of functional subdomains within LC1 and allow us to propose a structural model for the organization of the dynein heavy chain-LC1-microtubule ternary complex that is required for the coordinated activity of dynein motors in cilia. PMID:22157010

Archetype relational mapping - a practical openEHR persistence solution.

PubMed

Wang, Li; Min, Lingtong; Wang, Rui; Lu, Xudong; Duan, Huilong

2015-11-05

One of the primary obstacles to the widespread adoption of openEHR methodology is the lack of practical persistence solutions for future-proof electronic health record (EHR) systems as described by the openEHR specifications. This paper presents an archetype relational mapping (ARM) persistence solution for the archetype-based EHR systems to support healthcare delivery in the clinical environment. First, the data requirements of the EHR systems are analysed and organized into archetype-friendly concepts. The Clinical Knowledge Manager (CKM) is queried for matching archetypes; when necessary, new archetypes are developed to reflect concepts that are not encompassed by existing archetypes. Next, a template is designed for each archetype to apply constraints related to the local EHR context. Finally, a set of rules is designed to map the archetypes to data tables and provide data persistence based on the relational database. A comparison study was conducted to investigate the differences among the conventional database of an EHR system from a tertiary Class A hospital in China, the generated ARM database, and the Node + Path database. Five data-retrieving tests were designed based on clinical workflow to retrieve exams and laboratory tests. Additionally, two patient-searching tests were designed to identify patients who satisfy certain criteria. The ARM database achieved better performance than the conventional database in three of the five data-retrieving tests, but was less efficient in the remaining two tests. The time difference of query executions conducted by the ARM database and the conventional database is less than 130 %. The ARM database was approximately 6-50 times more efficient than the conventional database in the patient-searching tests, while the Node + Path database requires far more time than the other two databases to execute both the data-retrieving and the patient-searching tests. The ARM approach is capable of generating relational databases using archetypes and templates for archetype-based EHR systems, thus successfully adapting to changes in data requirements. ARM performance is similar to that of conventionally-designed EHR systems, and can be applied in a practical clinical environment. System components such as ARM can greatly facilitate the adoption of openEHR architecture within EHR systems.

Design of mechanical arm for an automatic sorting system of recyclable cans

NASA Astrophysics Data System (ADS)

Resti, Y.; Mohruni, A. S.; Burlian, F.; Yani, I.; Amran, A.

2018-04-01

The use of a mechanical arm for an automatic sorting system of used cans should be designed carefully. The right design will result in a high precision sorting rate and a short sorting time. The design includes first; design manipulator,second; determine link and joint specifications, and third; build mechanical systems and control systems. This study aims to design the mechanical arm as a hardware system for automatic cans sorting system. The material used for the manipulator is the aluminum plate. The manipulator is designed using 6 links and 6 join where the 6th link is the end effectorand the 6th join is the gripper. As a driving motor used servo motor, while as a microcontroller used Arduino Uno which is connected with Matlab programming language. Based on testing, a mechanical arm designed for this recyclable canned recycling system has a precision sorting rate at 93%, where the average total time required for sorting is 10.82 seconds.

Deciphering the Hidden Informational Content of Protein Sequences

PubMed Central

Liu, Ming; Hua, Qing-xin; Hu, Shi-Quan; Jia, Wenhua; Yang, Yanwu; Saith, Sunil Evan; Whittaker, Jonathan; Arvan, Peter; Weiss, Michael A.

2010-01-01

Protein sequences encode both structure and foldability. Whereas the interrelationship of sequence and structure has been extensively investigated, the origins of folding efficiency are enigmatic. We demonstrate that the folding of proinsulin requires a flexible N-terminal hydrophobic residue that is dispensable for the structure, activity, and stability of the mature hormone. This residue (PheB1 in placental mammals) is variably positioned within crystal structures and exhibits 1H NMR motional narrowing in solution. Despite such flexibility, its deletion impaired insulin chain combination and led in cell culture to formation of non-native disulfide isomers with impaired secretion of the variant proinsulin. Cellular folding and secretion were maintained by hydrophobic substitutions at B1 but markedly perturbed by polar or charged side chains. We propose that, during folding, a hydrophobic side chain at B1 anchors transient long-range interactions by a flexible N-terminal arm (residues B1–B8) to mediate kinetic or thermodynamic partitioning among disulfide intermediates. Evidence for the overall contribution of the arm to folding was obtained by alanine scanning mutagenesis. Together, our findings demonstrate that efficient folding of proinsulin requires N-terminal sequences that are dispensable in the native state. Such arm-dependent folding can be abrogated by mutations associated with β-cell dysfunction and neonatal diabetes mellitus. PMID:20663888

A Conformational Transition in the Myosin VI Converter Contributes to the Variable Step Size

PubMed Central

Ovchinnikov, V.; Cecchini, M.; Vanden-Eijnden, E.; Karplus, M.

2011-01-01

Myosin VI (MVI) is a dimeric molecular motor that translocates backwards on actin filaments with a surprisingly large and variable step size, given its short lever arm. A recent x-ray structure of MVI indicates that the large step size can be explained in part by a novel conformation of the converter subdomain in the prepowerstroke state, in which a 53-residue insert, unique to MVI, reorients the lever arm nearly parallel to the actin filament. To determine whether the existence of the novel converter conformation could contribute to the step-size variability, we used a path-based free-energy simulation tool, the string method, to show that there is a small free-energy difference between the novel converter conformation and the conventional conformation found in other myosins. This result suggests that MVI can bind to actin with the converter in either conformation. Models of MVI/MV chimeric dimers show that the variability in the tilting angle of the lever arm that results from the two converter conformations can lead to step-size variations of ∼12 nm. These variations, in combination with other proposed mechanisms, could explain the experimentally determined step-size variability of ∼25 nm for wild-type MVI. Mutations to test the findings by experiment are suggested. PMID:22098742

Association of Lis1 with outer arm dynein is modulated in response to alterations in flagellar motility

PubMed Central

Rompolas, Panteleimon; Patel-King, Ramila S.; King, Stephen M.

2012-01-01

The cytoplasmic dynein regulatory factor Lis1, which induces a persistent tight binding to microtubules and allows for transport of cargoes under high-load conditions, is also present in motile cilia/flagella. We observed that Lis1 levels in flagella of Chlamydomonas strains that exhibit defective motility due to mutation of various axonemal substructures were greatly enhanced compared with wild type; this increase was absolutely dependent on the presence within the flagellum of the outer arm dynein α heavy chain/light chain 5 thioredoxin unit. To assess whether cells might interpret defective motility as a “high-load environment,” we reduced the flagellar beat frequency of wild-type cells through enhanced viscous load and by reductive stress; both treatments resulted in increased levels of flagellar Lis1, which altered the intrinsic beat frequency of the trans flagellum. Differential extraction of Lis1 from wild-type and mutant axonemes suggests that the affinity of outer arm dynein for Lis1 is directly modulated. In cytoplasm, Lis1 localized to two punctate structures, one of which was located near the base of the flagella. These data reveal that the cell actively monitors motility and dynamically modulates flagellar levels of the dynein regulatory factor Lis1 in response to imposed alterations in beat parameters. PMID:22855525

[Markerless DNA deletion based on Red recombination and in vivo I-Sec I endonuclease cleavage in Escherichia coli chromosome].

PubMed

Zhu, Meiqin; Yu, Jian; Zhou, Changlin; Fang, Hongqing

2016-01-01

Red-based recombineering has been widely used in Escherichia coli genome modification through electroporating PCR fragments into electrocompetent cells to replace target sequences. Some mutations in the PCR fragments may be brought into the homologous regions near the target. To solve this problem in markeless gene deletion we developed a novel method characterized with two-step recombination and a donor plasmid. First, generated by PCR a linear DNA cassette which comprises a I-Sec I site-containing marker gene and homologous arms was electroporated into cells for marker-substitution deletion of the target sequence. Second, after a donor plasmid carrying the I-Sec I site-containing fusion homologous arm was chemically transformed into the marker-containing cells, the fusion arms and the marker was simultaneously cleaved by I-Sec I endonuclease and the marker-free deletion was stimulated by double-strand break-mediated intermolecular recombination. Eleven nonessential regions in E. coli DH1 genome were sequentially deleted by our method, resulting in a 10.59% reduced genome size. These precise deletions were also verified by PCR sequencing and genome resequencing. Though no change in the growth rate on the minimal medium, we found the genome-reduced strains have some alteration in the acid resistance and for the synthesis of lycopene.

Dual-Arm Generalized Compliant Motion With Shared Control

NASA Technical Reports Server (NTRS)

Backes, Paul G.

1994-01-01

Dual-Arm Generalized Compliant Motion (DAGCM) primitive computer program implementing improved unified control scheme for two manipulator arms cooperating in task in which both grasp same object. Provides capabilities for autonomous, teleoperation, and shared control of two robot arms. Unifies cooperative dual-arm control with multi-sensor-based task control and makes complete task-control capability available to higher-level task-planning computer system via large set of input parameters used to describe desired force and position trajectories followed by manipulator arms. Some concepts discussed in "A Generalized-Compliant-Motion Primitive" (NPO-18134).

The RAndomized Placebo Phase Study Of Rilonacept in the Treatment of Systemic Juvenile Idiopathic Arthritis (RAPPORT)

PubMed Central

Ilowite, Norman T.; Prather, Kristi; Lokhnygina, Yuliya; Schanberg, Laura E.; Elder, Melissa; Milojevic, Diana; Verbsky, James W.; Spalding, Steven J.; Kimura, Yukiko; Imundo, Lisa F.; Punaro, Marilynn G.; Sherry, David D.; Tarvin, Stacey E.; Zemel, Lawrence S.; Birmingham, James D.; Gottlieb, Beth S.; Miller, Michael L.; O'Neil, Kathleen; Ruth, Natasha M.; Wallace, Carol A.; Singer, Nora G.; Sandborg, Christy I.

2015-01-01

Background Interleukin-1 plays a pivotal role in in the pathogenesis of systemic juvenile idiopathic arthritis (sJIA). We assessed the efficacy and safety of rilonacept (IL-1 trap), an IL-1 inhibitor, in a randomized, double-blind, placebo-controlled trial. Methods An initial 4-week double-blind placebo phase was incorporated into a 24-week randomized multi-center design, followed by an open label phase. We randomized 71 children with at least 2 active joints 1:1 to 2 arms of the study. Patients in the rilonacept arm received rilonacept (4.4mg/kg loading dose followed by 2.2mg/kg weekly, subcutaneously) from day 0; patients in the placebo arm received placebo for 4 weeks followed by a loading dose of rilonacept at week 4 followed by weekly maintenance doses. The primary endpoint was time to response, using adapted JIA ACR30 response criteria coupled with absence of fever and taper of systemic corticosteroids using pre-specified criteria. Results Time to response was shorter in the rilonacept arm than in the placebo arm (Chi-square 7.235, P=.007). Secondary analysis showed 20/35 (57%) of patients in the rilonacept arm responded at week 4 compared to 9/33 (27%) in the placebo arm (P=.016) using the same response criteria. Exacerbation of sJIA (4) was the most common SAE. More patients in the rilonacept arm had elevated liver transaminases, including more than three times the upper limits of normal, as compared to those in the placebo arm. Adverse events were similar in the two arms of the study. Conclusions Rilonacept was generally well tolerated and demonstrated efficacy in active sJIA. PMID:24839206

49 CFR 236.531 - Trip arm; height and distance from rail.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 4 2014-10-01 2014-10-01 false Trip arm; height and distance from rail. 236.531... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.531 Trip arm; height and distance from rail. Trip arm of automatic train stop device when in the stop position shall be...

49 CFR 236.531 - Trip arm; height and distance from rail.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 4 2011-10-01 2011-10-01 false Trip arm; height and distance from rail. 236.531... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.531 Trip arm; height and distance from rail. Trip arm of automatic train stop device when in the stop position shall be...

49 CFR 236.531 - Trip arm; height and distance from rail.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 4 2013-10-01 2013-10-01 false Trip arm; height and distance from rail. 236.531... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.531 Trip arm; height and distance from rail. Trip arm of automatic train stop device when in the stop position shall be...

49 CFR 236.531 - Trip arm; height and distance from rail.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Trip arm; height and distance from rail. 236.531... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.531 Trip arm; height and distance from rail. Trip arm of automatic train stop device when in the stop position shall be...

49 CFR 236.531 - Trip arm; height and distance from rail.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 4 2012-10-01 2012-10-01 false Trip arm; height and distance from rail. 236.531... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.531 Trip arm; height and distance from rail. Trip arm of automatic train stop device when in the stop position shall be...

Control and applications of cooperating disparate robotic manipulators relevant to nuclear waste management

NASA Technical Reports Server (NTRS)

Lew, Jae Young; Book, Wayne J.

1991-01-01

Remote handling in nuclear waste management requires a robotic system with precise motion as well as a large workspace. The concept of a small arm mounted on the end of a large arm may satisfy such needs. However, the performance of such a serial configuration lacks payload capacity which is a crucial factor for handling a massive object. Also, this configuration induces more flexibility on the structure. To overcome these problems, the topology of bracing the tip of the small arm (not the large arm) and having an end effector in the middle of the chain is proposed in this paper. Also, control of these cooperating disparate manipulators is accomplished in computer simulations. Thus, this robotic system can have the accuracy of the small arm, and at the same time, it can have the payload capacity and large workspace of the large arm.

Design and pilot evaluation of competitive and cooperative exercise games for arm rehabilitation at home.

PubMed

Gorsic, Maja; Novak, Domen

2016-08-01

People with chronic arm impairment should exercise intensely at home after completing their clinical rehabilitation program, but frequently lack motivation. To address this issue, we present a home rehabilitation system that motivates patients by allowing them to perform arm exercises together with friends or relatives in competitive and cooperative games. Inertial sensors are used to track the patient's arm and control the game. The system was tested with seven adults with arm impairment as well as their friends or spouses. They tested four exercise games (single-player, competitive and two different cooperative games) for 3 minutes each. Of the 7 participants, 4 preferred the competitive game, 2 preferred a cooperative game, and 1 preferred to exercise alone. Competition also increased exercise intensity (measured using inertial sensors) compared to exercising alone. Though preliminary, these results indicate that competitive exercise games could improve arm rehabilitation at home for survivors of neurological and orthopedic injuries.

Reprogramming the articulated robotic arm for glass handling by using Arduino microcontroller

NASA Astrophysics Data System (ADS)

Razali, Zol Bahri; Kader, Mohamed Mydin M. Abdul; Kadir, Mohd Asmadi Akmal; Daud, Mohd Hisam

2017-09-01

The application of articulated robotic arm in industries is raised due to the expansion of using robot to replace human task, especially for the harmful tasks. However a few problems happen with the program use to schedule the arm, Thus the purpose of this project is to design, fabricate and integrate an articulated robotic arm by using Arduino microcontroller for handling glass sorting system. This project was designed to segregate glass and non-glass waste which would be pioneer step for recycling. This robotic arm has four servo motors to operate as a whole; three for the body and one for holding mechanism. This intelligent system is controlled by Arduino microcontroller and build with optical sensor to provide the distinguish objects that will be handled. Solidworks model was used to produce the detail design of the robotic arm and make the mechanical properties analysis by using a CAD software.

ARM Radiosondes for National Polar-Orbiting Operational Environmental Satellite System Preparatory Project Validation Field Campaign Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borg, Lori; Tobin, David; Reale, Anthony

This IOP has been a coordinated effort involving the U.S. Department of Energy (DOE) Atmospheric Radiation (ARM) Climate Research Facility, the University of Wisconsin (UW)-Madison, and the JPSS project to validate SNPP NOAA Unique Combined Atmospheric Processing System (NUCAPS) temperature and moisture sounding products from the Cross-track Infrared Sounder (CrIS) and the Advanced Technology Microwave Sounder (ATMS). In this arrangement, funding for radiosondes was provided by the JPSS project to ARM. These radiosondes were launched coincident with the SNPP satellite overpasses (OP) at four of the ARM field sites beginning in July 2012 and running through September 2017. Combined withmore » other ARM data, an assessment of the radiosonde data quality was performed and post-processing corrections applied producing an ARM site Best Estimate (BE) product. The SNPP targeted radiosondes were integrated into the NOAA Products Validation System (NPROVS+) system, which collocated the radiosondes with satellite products (NOAA, National Aeronautics and Space Administration [NASA], European Organisation for the Exploitation of Meteorological Satellites [EUMETSAT], Geostationary Operational Environmental Satellite [GOES], Constellation Observing System for Meteorology, Ionosphere, and Climate [COSMIC]) and Numerical Weather Prediction (NWP forecasts for use in product assessment and algorithm development. This work was a fundamental, integral, and cost-effective part of the SNPP validation effort and provided critical accuracy assessments of the SNPP temperature and water vapor soundings.« less

Analyzing octopus movements using three-dimensional reconstruction.

PubMed

Yekutieli, Yoram; Mitelman, Rea; Hochner, Binyamin; Flash, Tamar

2007-09-01

Octopus arms, as well as other muscular hydrostats, are characterized by a very large number of degrees of freedom and a rich motion repertoire. Over the years, several attempts have been made to elucidate the interplay between the biomechanics of these organs and their control systems. Recent developments in electrophysiological recordings from both the arms and brains of behaving octopuses mark significant progress in this direction. The next stage is relating these recordings to the octopus arm movements, which requires an accurate and reliable method of movement description and analysis. Here we describe a semiautomatic computerized system for 3D reconstruction of an octopus arm during motion. It consists of two digital video cameras and a PC computer running custom-made software. The system overcomes the difficulty of extracting the motion of smooth, nonrigid objects in poor viewing conditions. Some of the trouble is explained by the problem of light refraction in recording underwater motion. Here we use both experiments and simulations to analyze the refraction problem and show that accurate reconstruction is possible. We have used this system successfully to reconstruct different types of octopus arm movements, such as reaching and bend initiation movements. Our system is noninvasive and does not require attaching any artificial markers to the octopus arm. It may therefore be of more general use in reconstructing other nonrigid, elongated objects in motion.

Journey to the center of the galaxy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chaisson, E.

1980-08-01

The solar system is a member of the Orion Arm of the Milky Way, far from the center of the Galaxy. This article takes the reader on a hypothetical journey from the solar system to the center of the Galaxy. Results from radio and infrared studies are used to suggest what such a journey might reveal. Traveling from the solar system toward the center, one crosses the Cygnus Arm, then the Sagittarius Arm, and then the so-called Three-kiloparsec Arm. The Arms contain a mixture of young stars as well as lots of gas and dust. Radio studies show that themore » Three-kiloparsec Arm is more like a ring than an arm. Inside this ring, is another ring composed of giant molecular clouds. Radio and infrared astronomers have discovered that the heart of the Galaxy is composed of matter in most perplexing states. There are three regions known within this innermost thousand light-years. First, there is a large zone of thin, hot ionized gas. Within this, there is a whirlpool of dense, warm matter. And further embedded, there seems to be a small supermassive object at the center. Possibly this object could be a blackhole. Researchers are continuing to examine, monitor, and model this mysterious region, the galactic nuclei. (SC)« less

Gas Sensors Based on Single-Arm Waveguide Interferometers

NASA Technical Reports Server (NTRS)

Sarkisov, Sergey; Curley, Michael; Diggs, Darnell; Adamovsky, Grigory

1998-01-01

Various optical technologies can be implemented in chemical sensing. Sensitive, rugged, and compact systems will be more likely built using interferometric waveguide sensors. Currently existing sensors comprise dual-arm systems with external reference arm, dual-arm devices with internal reference arm such as integrated Mach-Zehnder interferometer, and single-arm systems which employ the interference between different waveguide modes. These latter ones are the most compact and rugged but still sensitive enough to monitor volatile pollutants such as NH3 coming out of industrial refrigerators and fertilizer plants and stocks, NO, NO2, SO2, emitted by industrial burning processes. Single-arm devices in planar waveguide configuration most frequently use two orthogonally polarized modes TE (sub i) and TM (sub i) of the same order i. Sensing effect is based on the difference in propagation conditions for the modes caused by the environment. However, dual-mode single-order interferometers still have relatively low sensitivity with respect to the environment related changes in the waveguide core because of small difference between propagation constants of TE (sub i) and TM (sub i) modes of the same order. Substantial sensitivity improvement without significant complication can be achieved for planar waveguide interferometers using modes of different orders with much greater difference between propagation constants.

Utility of optical facial feature and arm movement tracking systems to enable text communication in critically ill patients who cannot otherwise communicate.

PubMed

Muthuswamy, M B; Thomas, B N; Williams, D; Dingley, J

2014-09-01

Patients recovering from critical illness especially those with critical illness related neuropathy, myopathy, or burns to face, arms and hands are often unable to communicate by writing, speech (due to tracheostomy) or lip reading. This may frustrate both patient and staff. Two low cost movement tracking systems based around a laptop webcam and a laser/optical gaming system sensor were utilised as control inputs for on-screen text creation software and both were evaluated as communication tools in volunteers. Two methods were used to control an on-screen cursor to create short sentences via an on-screen keyboard: (i) webcam-based facial feature tracking, (ii) arm movement tracking by laser/camera gaming sensor and modified software. 16 volunteers with simulated tracheostomy and bandaged arms to simulate communication via gross movements of a burned limb, communicated 3 standard messages using each system (total 48 per system) in random sequence. Ten and 13 minor typographical errors occurred with each system respectively, however all messages were comprehensible. Speed of sentence formation ranged from 58 to 120s with the facial feature tracking system, and 60-160s with the arm movement tracking system. The average speed of sentence formation was 81s (range 58-120) and 104s (range 60-160) for facial feature and arm tracking systems respectively, (P<0.001, 2-tailed independent sample t-test). Both devices may be potentially useful communication aids in patients in general and burns critical care units who cannot communicate by conventional means, due to the nature of their injuries. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

[Surgical Correction of Scoliosis: Does Intraoperative CT Navigation Prolong Operative Time?

PubMed

Skála-Rosenbaum, J; Ježek, M; Džupa, V; Kadeřábek, R; Douša, P; Rusnák, R; Krbec, M

2016-01-01

PURPOSE OF THE STUDY The aim of the study was to compare the duration of corrective surgery for scoliosis in relation to the intra-operative use of either fluoroscopic or CT navigation. MATERIAL AND METHODS The indication for surgery was adolescent idiopathic scoliosis in younger patients and degenerative scoliosis in middleage or elderly patients. In a retrospective study, treatment outcomes in 43 consecutive patients operated on between April 2011 and April 2014 were compared. Only patients undergoing surgical correction of five or more spinal segments (fixation of six and more vertebrae) were included. RESULTS Transpedicular screw fixation of six to 13 vertebrae was performed under C-arm fluoroscopy guidance in 22 patients, and transpedicular screws were inserted in six to 14 vertebrae using the O-arm imaging system in 21 patients. A total of 246 screws were placed using the C-arm system and 340 screws were inserted using the O-arm system (p < 0.001). The procedures with use of the O-arm system were more complicated and required an average operative time longer by 48% (measured from the first skin incision to the completion of skin suture). However, the mean time needed for one screw placement (the sum of all surgical procedures with the use of a navigation technique divided by the number of screws placed using this technique) was the same in both techniques (19 min). DISCUSSION With good teamwork (surgeons, anaesthesiologists and a radiologist attending to the O-arm system), the time required to obtain one intra-operative CT scan is 3 to 5 minutes. The study showed that the mean time for placement of one screw was identical in both techniques although the average operative time was longer in surgery with O-arm navigation. The 19- minute interval was not the real placement time per screw. It was the sum of all operative times of surgical procedures (from first incision to suture completion including the whole approach within the range of planned stabilization) which used the same navigation technique divided by the number of all screws inserted during the procedures. The longer average operative time in procedures using O-arm navigation was not related to taking intra-operative O-arm scans. The authors consider surgery with an O-arm imaging system to be a safer procedure and use it currently in surgical correction of scoliosis. CONCLUSIONS The study focused on the length of surgery to correct scoliosis performed using either conventional fluoroscopy (C-arm) or intra-operative CT scanning (O-arm) showed that the mean placement time for one screw was identical in both imaging techniques when six or more vertebrae were stabilised. The use of intra-operative CT navigation did not make the surgery longer, and the higher number of inserted screws provides evidence that this technique is safer and allows us to achieve good stability of the correction procedure. Key words: virtual CT guidance, O-arm, scoliosis, transpedicular screw.

AMF3 ARM's Research Facility and MAOS at Oliktok Point Alaska

NASA Astrophysics Data System (ADS)

Helsel, F.; Ivey, M.; Dexheimer, D.; Hardesty, J.; Lucero, D. A.; Roesler, E. L.

2016-12-01

Scientific Infrastructure To Support Atmospheric Science And Aerosol Science For The Department Of Energy's Atmospheric Radiation Measurement Programs Mobile Facility 3 Located At Oliktok Point, Alaska.The Atmospheric Radiation Measurement (ARM) Program's Mobile Facility 3 (AMF3) located at Oliktok Point, Alaska is a U.S. Department of Energy (DOE) site designed to collect data to determine the impact that clouds and aerosols have on solar radiation. The site provides a scientific infrastructure and data archives for the international Arctic research community. The infrastructure at Oliktok is designed to be mobile and it may be relocated in the future to support other ARM science missions. AMF3's present instruments include: scanning precipitation Radar-cloud radar, Raman Lidar, Eddy correlation flux systems, Ceilometer, Balloon sounding system, Atmospheric Emitted Radiance Interferometer (AERI), Micro-pulse Lidar (MPL), Millimeter cloud radar along with all the standard metrological measurements. A Mobile Aerosol Observing System (MAOS) has been added to AMF3 in 2016 more details of the instrumentation at www.arm.gov/sites/amf/mobile-aos. Data from these instruments are placed in the ARM data archives and are available to the international research community. This poster will discuss what instruments are at the ARM Program's AMF3 and highlight the newest addition to AMF3, the Mobile Aerosol Observing System (MAOS).

ARM Tethered Balloon System & AALCO Activities at AMF3 Site at Oliktok Point, AK

NASA Astrophysics Data System (ADS)

Hardesty, J.; Dexheimer, D.; Mei, F.; Roesler, E. L.; Longbottom, C.; Hillman, B. R.

2017-12-01

Sandia National Laboratories (SNL) has operated the Atmospheric Radiation Measurement program's (ARM) third ARM Mobile Facility (AMF3) and the restricted airspace associated with it at Oliktok Point, Alaska, since October 2013. The site hosts ground-based instrumentation which collects a variety of continuous atmospheric measurements as well as user-conducted unmanned aircraft and tethered balloon campaigns. SNL has operated ARM's tethered balloon system (TBS) as part of the Inaugural Campaigns for ARM Research using Unmanned Systems (ICARUS) since 2016. AALCO (Aerial Assessment of Liquid in Clouds at Oliktok), is an ARM Intensive Operations Period conducted by SNL at the AMF3 since 2016. The operation of the TBS during ICARUS and AALCO to altitudes above 4,000' AGL in a variety of seasons and conditions is addressed. A Distributed Temperature Sensing (DTS) system and supercooled liquid water content (SLWC) sensors have been deployed under both campaigns. The performance of these sensors is discussed and results are presented. DTS measurements and their relationship to concurrent temperature measurements from unmanned aircraft and radiosondes are shown. SLWC sensor in situ measurements are compared with microwave radiometer and radiosonde-derived measurements. Preliminary analysis of using Large Eddy Simulations to compare with the SLWC measurements reveals three-dimensional properties of the observed clouds.

Acute effects of vibration from a chipping hammer and a grinder on the hand-arm system.

PubMed Central

Kihlberg, S; Attebrant, M; Gemne, G; Kjellberg, A

1995-01-01

OBJECTIVES--The purpose of this study was to compare various effects on the hand-arm system of vibration exposure from a chipping hammer and a grinder with the same frequency weighted acceleration. Grip and push forces were measured and monitored during the exposure. The various effects were: muscle activity (measured with surface electrodes), discomfort ratings for different parts of the hand-arm system (made during and after exposure), and vibration perception threshold (for 10 minutes before and 10 minutes after the exposure). RESULTS--No increase in muscle activity due to exposure to vibration was found in the hand muscle studied. In the forearm, conversely, there was an increase in both muscle studied. For the upper arm the muscle activity only increased when exposed to impact vibration. Subjective ratings in the hand and shift in vibration perception threshold were effected more by the grinder than the hammer exposure. CONCLUSION--These results show that the reaction of the hand-arm system to vibration varies with frequency quantitatively as well as qualitatively. They do not support the notion that one single frequency weighted curve would be valid for the different health effects of hand-arm vibration (vascular, musculoskeletal, neurological, and psychophysiological). PMID:8535492

De novo 12q22.q23.3 duplication associated with temporal lobe epilepsy.

PubMed

Vari, Maria Stella; Traverso, Monica; Bellini, Tommaso; Madia, Francesca; Pinto, Francesca; Minetti, Carlo; Striano, Pasquale; Zara, Federico

2017-08-01

Temporal lobe epilepsy (TLE) is the most common form of focal epilepsy and may be associated with acquired central nervous system lesions or could be genetic. Various susceptibility genes and environmental factors are believed to be involved in the aetiology of TLE, which is considered to be a heterogeneous, polygenic, and complex disorder. Rare point mutations in LGI1, DEPDC5, and RELN as well as some copy number variations (CNVs) have been reported in families with TLE patients. We perform a genetic analysis by Array-CGH in a patient with dysmorphic features and temporal lobe epilepsy. We report a de novo duplication of the long arm of chromosome 12. We confirm that 12q22-q23.3 is a candidate locus for familial temporal lobe epilepsy with febrile seizures and highlight the role of chromosomal rearrangements in patients with epilepsy and intellectual disability. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Neurosurgical robotic arm drilling navigation system.

PubMed

Lin, Chung-Chih; Lin, Hsin-Cheng; Lee, Wen-Yo; Lee, Shih-Tseng; Wu, Chieh-Tsai

2017-09-01

The aim of this work was to develop a neurosurgical robotic arm drilling navigation system that provides assistance throughout the complete bone drilling process. The system comprised neurosurgical robotic arm navigation combining robotic and surgical navigation, 3D medical imaging based surgical planning that could identify lesion location and plan the surgical path on 3D images, and automatic bone drilling control that would stop drilling when the bone was to be drilled-through. Three kinds of experiment were designed. The average positioning error deduced from 3D images of the robotic arm was 0.502 ± 0.069 mm. The correlation between automatically and manually planned paths was 0.975. The average distance error between automatically planned paths and risky zones was 0.279 ± 0.401 mm. The drilling auto-stopping algorithm had 0.00% unstopped cases (26.32% in control group 1) and 70.53% non-drilled-through cases (8.42% and 4.21% in control groups 1 and 2). The system may be useful for neurosurgical robotic arm drilling navigation. Copyright © 2016 John Wiley & Sons, Ltd.

Continuous Evaluation of Fast Processes in Climate Models Using ARM Measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Zhijin; Sha, Feng; Liu, Yangang

2016-02-02

This five-year award supports the project “Continuous Evaluation of Fast Processes in Climate Models Using ARM Measurements (FASTER)”. The goal of this project is to produce accurate, consistent and comprehensive data sets for initializing both single column models (SCMs) and cloud resolving models (CRMs) using data assimilation. A multi-scale three-dimensional variational data assimilation scheme (MS-3DVAR) has been implemented. This MS-3DVAR system is built on top of WRF/GSI. The Community Gridpoint Statistical Interpolation (GSI) system is an operational data assimilation system at the National Centers for Environmental Prediction (NCEP) and has been implemented in the Weather Research and Forecast (WRF) model.more » This MS-3DVAR is further enhanced by the incorporation of a land surface 3DVAR scheme and a comprehensive aerosol 3DVAR scheme. The data assimilation implementation focuses in the ARM SGP region. ARM measurements are assimilated along with other available satellite and radar data. Reanalyses are then generated for a few selected period of time. This comprehensive data assimilation system has also been employed for other ARM-related applications.« less

A spatial registration method for navigation system combining O-arm with spinal surgery robot

NASA Astrophysics Data System (ADS)

Bai, H.; Song, G. L.; Zhao, Y. W.; Liu, X. Z.; Jiang, Y. X.

2018-05-01

The minimally invasive surgery in spinal surgery has become increasingly popular in recent years as it reduces the chances of complications during post-operation. However, the procedure of spinal surgery is complicated and the surgical vision of minimally invasive surgery is limited. In order to increase the quality of percutaneous pedicle screw placement, the O-arm that is a mobile intraoperative imaging system is used to assist surgery. The robot navigation system combined with O-arm is also increasing, with the extensive use of O-arm. One of the major problems in the surgical navigation system is to associate the patient space with the intra-operation image space. This study proposes a spatial registration method of spinal surgical robot navigation system, which uses the O-arm to scan a calibration phantom with metal calibration spheres. First, the metal artifacts were reduced in the CT slices and then the circles in the images based on the moments invariant could be identified. Further, the position of the calibration sphere in the image space was obtained. Moreover, the registration matrix is obtained based on the ICP algorithm. Finally, the position error is calculated to verify the feasibility and accuracy of the registration method.

Spatial Map of Synthesized Criteria for the Redundancy Resolution of Human Arm Movements.

PubMed

Li, Zhi; Milutinovic, Dejan; Rosen, Jacob

2015-11-01

The kinematic redundancy of the human arm enables the elbow position to rotate about the axis going through the shoulder and wrist, which results in infinite possible arm postures when the arm reaches to a target in a 3-D workspace. To infer the control strategy the human motor system uses to resolve redundancy in reaching movements, this paper compares five redundancy resolution criteria and evaluates their arm posture prediction performance using data on healthy human motion. Two synthesized criteria are developed to provide better real-time arm posture prediction than the five individual criteria. Of these two, the criterion synthesized using an exponential method predicts the arm posture more accurately than that using a least squares approach, and therefore is preferable for inferring the contributions of the individual criteria to motor control during reaching movements. As a methodology contribution, this paper proposes a framework to compare and evaluate redundancy resolution criteria for arm motion control. A cluster analysis which associates criterion contributions with regions of the workspace provides a guideline for designing a real-time motion control system applicable to upper-limb exoskeletons for stroke rehabilitation.

Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus

PubMed Central

2010-01-01

Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes. PMID:20534175

Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus.

PubMed

Chulakasian, Songkhla; Lee, Min-Shiuh; Wang, Chi-Young; Chiou, Shyan-Song; Lin, Kuan-Hsun; Lin, Fong-Yuan; Hsu, Tien-Huan; Wong, Min-Liang; Chang, Tien-Jye; Hsu, Wei-Li

2010-06-10

Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

Impact of DNA repair genes polymorphism (XPD and XRCC1) on the risk of breast cancer in Egyptian female patients.

PubMed

Hussien, Yousry Mostafa; Gharib, Amal F; Awad, Hanan A; Karam, Rehab A; Elsawy, Wael H

2012-02-01

The genes involved in DNA repair system play a crucial role in the protection against mutations. It has been hypothesized that functional deficiencies in highly conserved DNA repair processes resulting from polymorphic variation may increase genetic susceptibility to breast cancer (BC). The aim of the present study was to evaluate the association of genetic polymorphisms in 2 DNA repair genes, XPD (Asp312Asn) and XRCC1 (A399G), with BC susceptibility. We further investigated the potential combined effect of these DNA repair variants on BC risk. Both XPD (xeroderma pigmentosum group D) and XRCC1 (X-ray repair cross-complementing group 1) polymorphisms were characterized in 100 BC Egyptian females and 100 healthy women who had no history of any malignancy by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method and PCR with confronting two-pair primers (PCR-CTPP), using DNA from peripheral blood in a case control study. Our results revealed that the frequencies of AA genotype of XPD codon 312 polymorphism were significantly higher in the BC patients than in the normal individuals (P ≤ 0.003), and did not observe any association between the XRCC1 Arg399Gln polymorphism and risk of developing BC. Also, no association between both XPD Asp312Asn and XRCC1 A399G polymorphisms and the clinical characteristics of disease. Finally, the combination of AA(XPD) + AG(XRCC1) were significantly associated with BC risk. Our results suggested that, XPD gene is an important candidate gene for susceptibility to BC. Also, gene-gene interaction between XPD(AA) + XRCC1(AG) polymorphism may be associated with increased risk of BC in Egyptian women.

virtX - evaluation of a computer-based training system for mobile C-arm systems in trauma and orthopedic surgery.

PubMed

Bott, O J; Teistler, M; Duwenkamp, C; Wagner, M; Marschollek, M; Plischke, M; Raab, B W; Stürmer, K M; Pretschner, D P; Dresing, K

2008-01-01

Operating room personnel (ORP) operating mobile image intensifier systems (C-arms) need training to produce high quality radiographs with a minimum of time and X-ray exposure. Our study aims at evaluating acceptance, usability and learning effect of the CBT system virtX that simulates C-arm based X-ray imaging in the context of surgical case scenarios. Prospective, interventional study conducted during an ORP course with three groups: intervention group 1 (training on a PC using virtX), and 2 (virtX with a C-arm as input device), and a control group (training without virtX) - IV1, IV2 and CG. All participants finished training with the same exercise. Time needed to produce an image of sufficient quality was recorded and analyzed using One-Way-ANOVA and Dunnett post hoc test (alpha = .05). Acceptance and usability of virtX have been evaluated using a questionnaire. CG members (n = 21) needed more time for the exercise than those of IV2 (n = 20): 133 +/- 55 vs. 101 +/- 37 sec. (p = .03). IV1 (n = 12) also performed better than CG (128 +/- 48 sec.), but this was not statistically significant. Seventy-nine participants returned a questionnaire (81% female, age 34 +/- 9 years, professional experience 8.3 +/- 7.6 years; 77% regularly used a C-arm). 83% considered virtX a useful addition to conventional C-arm training. 91% assessed virtual radiography as helpful for understanding C-arm operation. Trainees experienced virtX as substantial enhancement of C-arm training. Training with virtX can reduce the time needed to perform an imaging task.

2D–3D radiograph to cone-beam computed tomography (CBCT) registration for C-arm image-guided robotic surgery

PubMed Central

Liu, Wen Pei; Otake, Yoshito; Azizian, Mahdi; Wagner, Oliver J.; Sorger, Jonathan M.; Armand, Mehran; Taylor, Russell H.

2015-01-01

Purpose C-arm radiographs are commonly used for intraoperative image guidance in surgical interventions. Fluoroscopy is a cost-effective real-time modality, although image quality can vary greatly depending on the target anatomy. Cone-beam computed tomography (CBCT) scans are sometimes available, so 2D–3D registration is needed for intra-procedural guidance. C-arm radiographs were registered to CBCT scans and used for 3D localization of peritumor fiducials during a minimally invasive thoracic intervention with a da Vinci Si robot. Methods Intensity-based 2D–3D registration of intraoperative radiographs to CBCT was performed. The feasible range of X-ray projections achievable by a C-arm positioned around a da Vinci Si surgical robot, configured for robotic wedge resection, was determined using phantom models. Experiments were conducted on synthetic phantoms and animals imaged with an OEC 9600 and a Siemens Artis zeego, representing the spectrum of different C-arm systems currently available for clinical use. Results The image guidance workflow was feasible using either an optically tracked OEC 9600 or a Siemens Artis zeego C-arm, resulting in an angular difference of Δθ : ~ 30°. The two C-arm systems provided TREmean ≤ 2.5 mm and TREmean ≤ 2.0 mm, respectively (i.e., comparable to standard clinical intraoperative navigation systems). Conclusions C-arm 3D localization from dual 2D–3D registered radiographs was feasible and applicable for intraoperative image guidance during da Vinci robotic thoracic interventions using the proposed workflow. Tissue deformation and in vivo experiments are required before clinical evaluation of this system. PMID:25503592

Affinity maturation in an HIV broadly neutralizing B-cell lineage through reorientation of variable domains.

PubMed

Fera, Daniela; Schmidt, Aaron G; Haynes, Barton F; Gao, Feng; Liao, Hua-Xin; Kepler, Thomas B; Harrison, Stephen C

2014-07-15

Rapidly evolving pathogens, such as human immunodeficiency and influenza viruses, escape immune defenses provided by most vaccine-induced antibodies. Proposed strategies to elicit broadly neutralizing antibodies require a deeper understanding of antibody affinity maturation and evolution of the immune response to vaccination or infection. In HIV-infected individuals, viruses and B cells evolve together, creating a virus-antibody "arms race." Analysis of samples from an individual designated CH505 has illustrated the interplay between an antibody lineage, CH103, and autologous viruses at various time points. The CH103 antibodies, relatively broad in their neutralization spectrum, interact with the CD4 binding site of gp120, with a contact dominated by CDRH3. We show by analyzing structures of progenitor and intermediate antibodies and by correlating them with measurements of binding to various gp120s that there was a shift in the relative orientation of the light- and heavy-chain variable domains during evolution of the CH103 lineage. We further show that mutations leading to this conformational shift probably occurred in response to insertions in variable loop 5 (V5) of the HIV envelope. The shift displaced the tips of the light chain away from contact with V5, making room for the inserted residues, which had allowed escape from neutralization by the progenitor antibody. These results, which document the selective mechanism underlying this example of a virus-antibody arms race, illustrate the functional significance of affinity maturation by mutation outside the complementarity determining region surface of the antibody molecule.

Establishment of one-axis vibration test system for measurement of biodynamic response of human hand-arm system.

PubMed

Shibata, Nobuyuki; Hosoya, Naoki; Maeda, Setsuo

2008-12-01

Prolonged exposure to hand-arm vibration (HAV) due to use of hand-held power tools leads to an increased occurrence of symptoms of disorders in the vascular, neurological, and osteo-articular systems of the upper limbs called hand-arm vibration syndrome (HAVS). Biodynamic responses of the hand-arm system to vibration can be suggestive parameters that give us better assessment of exposure to HAV and fundamental data for design of low-vibration-exposure power tools. Recently, a single axis hand-arm vibration system has been installed in the Japan National Institute of Occupational Safety and Health (NIOSH). The aims of this study were to obtain the fundamental dynamic characteristics of an instrumented handle and to validate the performance and measurement accuracy of the system applied to dynamic response measurement. A pseudo-random vibration signal with a frequency range of 5-1,250 Hz and a power spectrum density of 1.0 (m/s2)2/Hz was used in this study. First the dynamic response of the instrumented handle without any weight was measured. After this measurement, the dynamic response measurement of the handle with weights mounted on the handle was performed. The apparent mass of a weight itself was obtained by using the mass cancellation method. The mass of the measuring cap on the instrumented handle was well compensated by using the mass cancellation method. Based on the 10% error tolerance, this handle can reliably measure the dynamic response represented by an apparent mass with a minimum weight of 2.0 g in a frequency range of 10.0 to 1,000 Hz. A marked increase in the AM magnitude of the weights of 15 g and 20 g in frequency ranges greater than 800 Hz is attributed not to the fundamental resonance frequency of the handle with weights, but to the fixation of the weight to the measuring cap. In this aspect, the peak of the AM magnitude can be reduced and hence should not be an obstacle to the biodynamic response measurement of the human hand-arm system. On the basis of the results obtained in this study, we conclude that this hand-arm vibration test system can be used to measure biodynamic response parameters of the human hand-arm system.

Radial arm strike rail

DOEpatents

McKeown, Mark H.; Beason, Steven C.

1991-01-01

The radial arm strike rail assembly is a system for measurement of bearings, directions, and stereophotography for geologic mapping, particularly where magnetic compasses are not appropriate. The radial arm, pivoting around a shaft axis, provides a reference direction determination for geologic mapping and bearing or direction determination. The centerable and levelable pedestal provide a base for the radial arm strike rail and the telescoping camera pedestal. The telescoping feature of the radial arm strike rail allows positioning the end of the rail for strike direction or bearing measurement with a goniometer.

Jerk-level synchronous repetitive motion scheme with gradient-type and zeroing-type dynamics algorithms applied to dual-arm redundant robot system control

NASA Astrophysics Data System (ADS)

Chen, Dechao; Zhang, Yunong

2017-10-01

Dual-arm redundant robot systems are usually required to handle primary tasks, repetitively and synchronously in practical applications. In this paper, a jerk-level synchronous repetitive motion scheme is proposed to remedy the joint-angle drift phenomenon and achieve the synchronous control of a dual-arm redundant robot system. The proposed scheme is novelly resolved at jerk level, which makes the joint variables, i.e. joint angles, joint velocities and joint accelerations, smooth and bounded. In addition, two types of dynamics algorithms, i.e. gradient-type (G-type) and zeroing-type (Z-type) dynamics algorithms, for the design of repetitive motion variable vectors, are presented in detail with the corresponding circuit schematics. Subsequently, the proposed scheme is reformulated as two dynamical quadratic programs (DQPs) and further integrated into a unified DQP (UDQP) for the synchronous control of a dual-arm robot system. The optimal solution of the UDQP is found by the piecewise-linear projection equation neural network. Moreover, simulations and comparisons based on a six-degrees-of-freedom planar dual-arm redundant robot system substantiate the operation effectiveness and tracking accuracy of the robot system with the proposed scheme for repetitive motion and synchronous control.

"Atmospheric Radiation Measurement (ARM) Research Facility at Oliktok Point Alaska"

NASA Astrophysics Data System (ADS)

Helsel, F.; Ivey, M.; Hardesty, J.; Roesler, E. L.; Dexheimer, D.

2017-12-01

Scientific Infrastructure To Support Atmospheric Science, Aerosol Science and UAS's for The Department Of Energy's Atmospheric Radiation Measurement Programs At The Mobile Facility 3 Located At Oliktok Point, Alaska.The Atmospheric Radiation Measurement (ARM) Program's Mobile Facility 3 (AMF3) located at Oliktok Point, Alaska is a U.S. Department of Energy (DOE) site designed to collect data and help determine the impact that clouds and aerosols have on solar radiation. AMF3 provides a scientific infrastructure to support instruments and collect arctic data for the international arctic research community. The infrastructure at AMF3/Oliktok is designed to be mobile and it may be relocated in the future to support other ARM science missions. AMF3's present base line instruments include: scanning precipitation Radars, cloud Radar, Raman Lidar, Eddy correlation flux systems, Ceilometer, Balloon sounding system, Atmospheric Emitted Radiance Interferometer (AERI), Micro-pulse Lidar (MPL) Along with all the standard metrological measurements. In addition AMF3 provides aerosol measurements with a Mobile Aerosol Observing System (MAOS). Ground support for Unmanned Aerial Systems (UAS) and tethered balloon flights. Data from these instruments and systems are placed in the ARM data archives and are available to the international research community. This poster will discuss what instruments and systems are at the ARM Research Facility at Oliktok Point Alaska.

Single-camera visual odometry to track a surgical X-ray C-arm base.

PubMed

Esfandiari, Hooman; Lichti, Derek; Anglin, Carolyn

2017-12-01

This study provides a framework for a single-camera odometry system for localizing a surgical C-arm base. An application-specific monocular visual odometry system (a downward-looking consumer-grade camera rigidly attached to the C-arm base) is proposed in this research. The cumulative dead-reckoning estimation of the base is extracted based on frame-to-frame homography estimation. Optical-flow results are utilized to feed the odometry. Online positional and orientation parameters are then reported. Positional accuracy of better than 2% (of the total traveled distance) for most of the cases and 4% for all the cases studied and angular accuracy of better than 2% (of absolute cumulative changes in orientation) were achieved with this method. This study provides a robust and accurate tracking framework that not only can be integrated with the current C-arm joint-tracking system (i.e. TC-arm) but also is capable of being employed for similar applications in other fields (e.g. robotics).

Effects of biomotor structures on performance of competitive gymnastics elements in elementary school female sixth-graders.

PubMed

Delas, Suncica; Babin, Josip; Katić, Ratko

2007-12-01

In order to identify biomotor systems that determine performance of competitive gymnastics elements in elementary school female sixth-graders, factor structures of morphological characteristics and basic motor abilities were determined first, followed by relations of the morphological-motor system factors obtained with a set of criterion variables evaluating specific motor skills in competitive gymnastics in 126 female children aged 12 years +/- 3 months. Factor analysis of 17 morphological measures yielded three morphological factors: factor of mesoendomorphy and/or adipose body voluminosity; factor of longitudinal body dimensionality; and factor of transverse arm dimensionality. Factor analysis of 16 motor variables produced four motor factors: general motoricity factor (motor system); general speed factor; factor of explosive strength of throwing type (arm explosiveness); and factor of arm and leg flexibility. Three significant canonical correlations, i.e. linear combinations, explained the association between the set of seven latent variables of the morphological and basic motor system, and five variables evaluating the knowledge in competitive gymnastics. The first canonical linear combination was based on a favorable and predominant impact of the general motor factor (a system integrating whole body coordination, leg explosiveness, relative arm strength, arm movement frequency and body flexibility) on performance of gymnastics elements, cartwheel, handstand and backward pullover mount in particular, and to a lesser extent front scale and double leg pirouette for 180 degrees. The relation of the second pair of canonical factors additionally explained the role of transverse dimensionality of arm skeleton, arm flexibility and explosiveness in performing cartwheel and squat vault, whereas the relation of the third pair of canonical factors explained the unfavorable impact of adipose voluminosity on the performance of squat vault and backward pullover mount.

49 CFR 236.702 - Arm, semaphore.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 4 2014-10-01 2014-10-01 false Arm, semaphore. 236.702 Section 236.702 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., MAINTENANCE, AND REPAIR OF SIGNAL AND TRAIN CONTROL SYSTEMS, DEVICES, AND APPLIANCES Definitions § 236.702 Arm...

49 CFR 236.702 - Arm, semaphore.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 4 2013-10-01 2013-10-01 false Arm, semaphore. 236.702 Section 236.702 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., MAINTENANCE, AND REPAIR OF SIGNAL AND TRAIN CONTROL SYSTEMS, DEVICES, AND APPLIANCES Definitions § 236.702 Arm...

49 CFR 236.702 - Arm, semaphore.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 4 2011-10-01 2011-10-01 false Arm, semaphore. 236.702 Section 236.702 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., MAINTENANCE, AND REPAIR OF SIGNAL AND TRAIN CONTROL SYSTEMS, DEVICES, AND APPLIANCES Definitions § 236.702 Arm...

49 CFR 236.702 - Arm, semaphore.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 4 2012-10-01 2012-10-01 false Arm, semaphore. 236.702 Section 236.702 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., MAINTENANCE, AND REPAIR OF SIGNAL AND TRAIN CONTROL SYSTEMS, DEVICES, AND APPLIANCES Definitions § 236.702 Arm...

Addressing sexual dysfunction after risk-reducing salpingo-oophorectomy: effects of a brief, psychosexual intervention.

PubMed

Bober, Sharon L; Recklitis, Christopher J; Bakan, Jennifer; Garber, Judy E; Patenaude, Andrea F

2015-01-01

Women at high risk for ovarian cancer due to BRCA1 or BRCA2 mutation or family history are recommended to undergo risk-reducing salpingo-oophorectomy (RRSO) after age 35 or completion of childbearing. This potentially life-saving surgery leads to premature menopause, frequently resulting in distressing and unaddressed sexual dysfunction. To pilot a novel sexual health intervention for women with BRCA1/2 mutations who previously underwent RRSO a using a single-arm trial. Feasibility and primary outcomes including sexual dysfunction and psychological distress were assessed. This single-arm trial included a one-time, half-day educational session comprised of targeted sexual health education, body awareness and relaxation training, and mindfulness-based cognitive therapy strategies, followed by two sessions of tailored telephone counseling. Assessments were completed at baseline and 2 months postintervention. Study end points include feasibility and effectiveness as reported by the participant. Thirty-seven women completed baseline and postintervention assessments. At baseline, participants had a mean age of 44.4 (standard deviation [SD] = 3.9) years and mean duration of 3.8 (SD = 2.7) years since RRSO. Overall sexual functioning (P = 0.018), as well as desire (P = 0.003), arousal (P = 0.003), satisfaction (P = 0.028), and pain (P = 0.018), improved significantly. There were significant reductions in somatization (P = 0.029) and anxiety scores (P < 0.001), and, overall, for the Global Severity Index (P < 0.001) of the Brief Symptom Inventory. Sexual self-efficacy and sexual knowledge also improved significantly from baseline to postintervention (both P < 0.001). Women were highly satisfied with the intervention content and reported utilizing new skills to manage sexual dysfunction. This intervention integrates elements of cognitive behavioral therapy with sexual health education to address a much-neglected problem after RRSO. Results from this promising single-arm study provide preliminary data to move toward conducting a randomized, controlled trial. © 2014 International Society for Sexual Medicine.

Randomized Phase II Study of Azacitidine Alone or in Combination With Lenalidomide or With Vorinostat in Higher-Risk Myelodysplastic Syndromes and Chronic Myelomonocytic Leukemia: North American Intergroup Study SWOG S1117.

PubMed

Sekeres, Mikkael A; Othus, Megan; List, Alan F; Odenike, Olatoyosi; Stone, Richard M; Gore, Steven D; Litzow, Mark R; Buckstein, Rena; Fang, Min; Roulston, Diane; Bloomfield, Clara D; Moseley, Anna; Nazha, Aziz; Zhang, Yanming; Velasco, Mario R; Gaur, Rakesh; Atallah, Ehab; Attar, Eyal C; Cook, Elina K; Cull, Alyssa H; Rauh, Michael J; Appelbaum, Frederick R; Erba, Harry P

2017-08-20

Purpose Azacitidine is standard, first-line therapy in higher-risk myelodysplastic syndromes (MDS). Whether azacitidine-based combinations with lenalidomide or vorinostat produce superior overall response rates (ORRs) to azacitidine is not known. Patients and Methods North American Intergroup Study S1117 is a phase II/III trial that randomly assigned patients with higher-risk MDS and chronic myelomonocytic leukemia (CMML) 1:1:1 to azacitidine (75 mg/m 2 /day on days 1 to 7 of a 28-day cycle); azacitidine plus lenalidomide (10 mg/day on days 1 to 21); or azacitidine plus vorinostat (300 mg twice daily on days 3 to 9). The primary phase II end point was improved ORR. Results Of 277 patients from 90 centers, 92 received azacitidine, 93 received azacitidine plus lenalidomide, and 92 received azacitidine plus vorinostat. Median age was 70 years (range, 28 to 93 years), 85 patients (31%) were female, and 53 patients (19%) had CMML. Serious adverse events were similar across arms, although combination-arm patients were more likely to undergo nonprotocol-defined dose modifications ( P < .001).With a median follow-up of 23 months (range, 1 to 43 months), the ORR was 38% for patients receiving azacitidine, 49% for azacitidine plus lenalidomide ( P = .14 v azacitidine), and 27% for azacitidine plus vorinostat ( P = .16 v azacitidine). For patients with CMML, ORR was higher for azacitidine plus lenalidomide versus azacitidine (68% v 28%, P = .02) but similar for all arms across cytogenetic subgroups, as was remission duration and overall survival. ORR was higher with mutations in DNMT3A and lower for SRSF2, whereas ORR duration improved with fewer mutations. Lenalidomide dose reduction was associated with worse overall survival (hazard ratio, 1.30; P = .05). Conclusion Patients with higher-risk MDS treated with azacitidine-based combinations had similar ORR to azacitidine monotherapy, although patients with CMML benefitted from azacitidine plus lenalidomide. The efficacy of combination regimens may have been affected by dose modifications.

Data management and scientific integration within the Atmospheric Radiation Measurement Program

NASA Technical Reports Server (NTRS)

Gracio, Deborah K.; Hatfield, Larry D.; Yates, Kenneth R.; Voyles, Jimmy W.; Tichler, Joyce L.; Cederwall, Richard T.; Laufersweiler, Mark J.; Leach, Martin J.; Singley, Paul

1995-01-01

The Atmospheric Radiation Measurement (ARM) Program has been developed by the U.S. Department of Energy with the goal to improve the predictive capabilities of General Circulation Models (GCM's) in their treatment of clouds and radiative transfer effects. To achieve this goal, three experimental testbeds were designed for the deployment of instruments that will collect atmospheric data used to drive the GCM's. Each site, known as a Cloud and Radiation Testbed (CART), consists of a highly available, redundant data system for the collection of data from a variety of instrumentation. The first CART site was deployed in April 1992 in the Southern Great Plains (SGP), Lamont, Oklahoma, with the other two sites to follow in September 1995 in the Tropical Western Pacific and in 1997 on the North Slope of Alaska. Approximately 400 MB of data are transferred per day via the Internet from the SGP site to the ARM Experiment Center at Pacific Northwest Laboratory in Richland, Washington. The Experiment Center is central to the ARM data path and provides for the collection, processing, analysis, and delivery of ARM data. Data are received from the CART sites from a variety of instrumentation, observational systems, amd external data sources. The Experiment Center processes these data streams on a continuous basis to provide derived data products to the ARM Science Team in near real-time while providing a three-month running archive of data. A primary requirement of the ARM Program is to preserve and protect all data produced or acquired. This function is performed at Oak Ridge National Laboratory where leading edge technology is employed for the long-term storage of ARM data. The ARM Archive provides access to data for participation outside of the ARM Program. The ARM Program involves a collaborative effort by teams from various DOE National Laboratories, providing multi-disciplinary areas of expertise. This paper will discuss the collaborative methods in which the ARM teams translate the scientific goals of the Program into data products. By combining atmospheric scientists, systems engineers, and software engineers, the ARM Program has successfully designed and developed an environment where advances in understanding the parameterizations of GCM's can be made.

OBSS and RMS arm during a survey of the TPS during STS-115

NASA Image and Video Library

2006-09-09

S115-E-05307 (10 Sept. 2006) --- As in the case of the previous two shuttle missions, a tandem of the orbiter boom sensor system (OBSS) and the remote manipulator system (RMS) arm conducts a survey of the thermal protection system on the Space Shuttle Atlantis.

The Computerized Adaptive Testing System Development Project.

ERIC Educational Resources Information Center

McBride, James R.; Sympson, J. B.

The Computerized Adaptive Testing (CAT) project is a joint Armed Services coordinated effort to develop and evaluate a system for automated, adaptive administration of the Armed Services Vocational Aptitude Battery (ASVAB). The CAT is a system for administering personnel tests that differs from conventional test administration in two major…

An arm wearable haptic interface for impact sensing on unmanned aerial vehicles

NASA Astrophysics Data System (ADS)

Choi, Yunshil; Hong, Seung-Chan; Lee, Jung-Ryul

2017-04-01

In this paper, an impact monitoring system using fiber Bragg grating (FBG) sensors and vibro-haptic actuators has been introduced. The system is suggested for structural health monitoring (SHM) for unmanned aerial vehicles (UAVs), by making a decision with human-robot interaction. The system is composed with two major subsystems; an on-board system equipped on UAV and an arm-wearable interface for ground pilot. The on-board system acquires impact-induced wavelength changes and performs localization process, which was developed based on arrival time calculation. The arm-wearable interface helps ground pilots to make decision about impact location themselves by stimulating their tactile-sense with motor vibration.

Aerial Radiological Measuring System (ARMS): systems, procedures and sensitivity (1976)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyns, P K

1976-07-01

This report describes the Aerial Radiological Measuring System (ARMS) designed and operated by EG and G, Inc., for the Energy Research and Development Administration's (ERDA) Division of Operational Safety with the cooperation of the Nuclear Regulatory Commission. Designed to rapidly survey large areas for low-level man-made radiation, the ARMS has also proven extremely useful in locating lost radioactive sources of relatively low activity. The system consists of sodium iodide scintillation detectors, data formatting and recording equipment, positioning equipment, meteorological instruments, direct readout hardware, and data analysis equipment. The instrumentation, operational procedures, data reduction techniques and system sensitivities are described, togethermore » with their applications and sample results.« less

OPINION: Safe exponential manufacturing

NASA Astrophysics Data System (ADS)

Phoenix, Chris; Drexler, Eric

2004-08-01

In 1959, Richard Feynman pointed out that nanometre-scale machines could be built and operated, and that the precision inherent in molecular construction would make it easy to build multiple identical copies. This raised the possibility of exponential manufacturing, in which production systems could rapidly and cheaply increase their productive capacity, which in turn suggested the possibility of destructive runaway self-replication. Early proposals for artificial nanomachinery focused on small self-replicating machines, discussing their potential productivity and their potential destructiveness if abused. In the light of controversy regarding scenarios based on runaway replication (so-called 'grey goo'), a review of current thinking regarding nanotechnology-based manufacturing is in order. Nanotechnology-based fabrication can be thoroughly non-biological and inherently safe: such systems need have no ability to move about, use natural resources, or undergo incremental mutation. Moreover, self-replication is unnecessary: the development and use of highly productive systems of nanomachinery (nanofactories) need not involve the construction of autonomous self-replicating nanomachines. Accordingly, the construction of anything resembling a dangerous self-replicating nanomachine can and should be prohibited. Although advanced nanotechnologies could (with great difficulty and little incentive) be used to build such devices, other concerns present greater problems. Since weapon systems will be both easier to build and more likely to draw investment, the potential for dangerous systems is best considered in the context of military competition and arms control.

Spoken language and arm gestures are controlled by the same motor control system.

PubMed

Gentilucci, Maurizio; Dalla Volta, Riccardo

2008-06-01

Arm movements can influence language comprehension much as semantics can influence arm movement planning. Arm movement itself can be used as a linguistic signal. We reviewed neurophysiological and behavioural evidence that manual gestures and vocal language share the same control system. Studies of primate premotor cortex and, in particular, of the so-called "mirror system", including humans, suggest the existence of a dual hand/mouth motor command system involved in ingestion activities. This may be the platform on which a combined manual and vocal communication system was constructed. In humans, speech is typically accompanied by manual gesture, speech production itself is influenced by executing or observing transitive hand actions, and manual actions play an important role in the development of speech, from the babbling stage onwards. Behavioural data also show reciprocal influence between word and symbolic gestures. Neuroimaging and repetitive transcranial magnetic stimulation (rTMS) data suggest that the system governing both speech and gesture is located in Broca's area. In general, the presented data support the hypothesis that the hand motor-control system is involved in higher order cognition.

Pemetrexed-carboplatin with intercalated icotinib in the treatment of patient with advanced EGFR wild-type lung adenocarcinoma: A case report.

PubMed

Xu, Tongpeng; Wu, Hao; Jin, Shidai; Min, Huang; Zhang, Zhihong; Shu, Yongqian; Wen, Wei; Guo, Renhua

2017-08-01

Tyrosine kinase inhibitors (TKIs) are known to have greater efficacy in epidermal growth factor receptor (EGFR) mutation nonsmall cell lung cancer (NSCLC). However, about 10% of EGFR wild-type (wt) patients respond to TKIs. Several strategies to increase the efficacy of TKIs in wt NSCLC are the subjects of ongoing investigations. One of them is combining EGFR TKI with intercalated chemotherapy. We describe a patient with EGFR wt NSCLC, who was found with ovarian and lung metastasis, was treated with pemetrexed and intercalated icotinib. In this case, we reported the successful long-term maintenance treatment of a patient with EGFR wt NSCLC with pemetrexed and Icotinib. The patient (40-year-old female) was found with ovarian masses and lung masses. Pathological, immunohistochemical, and amplification refractory mutation system (ARMS) assay examinations of ovarian specimen suggested the expression of metastatic lung adenocarcinoma with wt EGFR. After failure treatment with paclitaxel-carboplatin, the patient received 4 cycles of pemetrexed plus platinum with intercalated icotinib and then remained on pemetrexed and icotinib. A partial response was achieved after the treatment. The patient's condition had remained stable on pemetrexed and icotinib for more than 20 months, with no evidence of progression. To our knowledge, this is the first report using the long-term maintenance treatment with pemetrexed and intercalated icotinib in EGFR wt patient. The therapeutic strategies warrant further exploration in selected populations of NSCLC.

Pemetrexed-carboplatin with intercalated icotinib in the treatment of patient with advanced EGFR wild-type lung adenocarcinoma

PubMed Central

Xu, Tongpeng; Wu, Hao; Jin, Shidai; Min, Huang; Zhang, Zhihong; Shu, Yongqian; Wen, Wei; Guo, Renhua

2017-01-01

Abstract Rationale: Tyrosine kinase inhibitors (TKIs) are known to have greater efficacy in epidermal growth factor receptor (EGFR) mutation nonsmall cell lung cancer (NSCLC). However, about 10% of EGFR wild-type (wt) patients respond to TKIs. Patient concerns: Several strategies to increase the efficacy of TKIs in wt NSCLC are the subjects of ongoing investigations. One of them is combining EGFR TKI with intercalated chemotherapy. Diagnoses: We describe a patient with EGFR wt NSCLC, who was found with ovarian and lung metastasis, was treated with pemetrexed and intercalated icotinib. Interventions: In this case, we reported the successful long-term maintenance treatment of a patient with EGFR wt NSCLC with pemetrexed and Icotinib. The patient (40-year-old female) was found with ovarian masses and lung masses. Pathological, immunohistochemical, and amplification refractory mutation system (ARMS) assay examinations of ovarian specimen suggested the expression of metastatic lung adenocarcinoma with wt EGFR. After failure treatment with paclitaxel-carboplatin, the patient received 4 cycles of pemetrexed plus platinum with intercalated icotinib and then remained on pemetrexed and icotinib. Outcomes: A partial response was achieved after the treatment. The patient's condition had remained stable on pemetrexed and icotinib for more than 20 months, with no evidence of progression. Lessons: To our knowledge, this is the first report using the long-term maintenance treatment with pemetrexed and intercalated icotinib in EGFR wt patient. The therapeutic strategies warrant further exploration in selected populations of NSCLC. PMID:28816950

Octopus-inspired multi-arm robotic swimming.

PubMed

Sfakiotakis, M; Kazakidi, A; Tsakiris, D P

2015-05-13

The outstanding locomotor and manipulation characteristics of the octopus have recently inspired the development, by our group, of multi-functional robotic swimmers, featuring both manipulation and locomotion capabilities, which could be of significant engineering interest in underwater applications. During its little-studied arm-swimming behavior, as opposed to the better known jetting via the siphon, the animal appears to generate considerable propulsive thrust and rapid acceleration, predominantly employing movements of its arms. In this work, we capture the fundamental characteristics of the corresponding complex pattern of arm motion by a sculling profile, involving a fast power stroke and a slow recovery stroke. We investigate the propulsive capabilities of a multi-arm robotic system under various swimming gaits, namely patterns of arm coordination, which achieve the generation of forward, as well as backward, propulsion and turning. A lumped-element model of the robotic swimmer, which considers arm compliance and the interaction with the aquatic environment, was used to study the characteristics of these gaits, the effect of various kinematic parameters on propulsion, and the generation of complex trajectories. This investigation focuses on relatively high-stiffness arms. Experiments employing a compliant-body robotic prototype swimmer with eight compliant arms, all made of polyurethane, inside a water tank, successfully demonstrated this novel mode of underwater propulsion. Speeds of up to 0.26 body lengths per second (approximately 100 mm s(-1)), and propulsive forces of up to 3.5 N were achieved, with a non-dimensional cost of transport of 1.42 with all eight arms and of 0.9 with only two active arms. The experiments confirmed the computational results and verified the multi-arm maneuverability and simultaneous object grasping capability of such systems.

Nearly automatic motion capture system for tracking octopus arm movements in 3D space.

PubMed

Zelman, Ido; Galun, Meirav; Akselrod-Ballin, Ayelet; Yekutieli, Yoram; Hochner, Binyamin; Flash, Tamar

2009-08-30

Tracking animal movements in 3D space is an essential part of many biomechanical studies. The most popular technique for human motion capture uses markers placed on the skin which are tracked by a dedicated system. However, this technique may be inadequate for tracking animal movements, especially when it is impossible to attach markers to the animal's body either because of its size or shape or because of the environment in which the animal performs its movements. Attaching markers to an animal's body may also alter its behavior. Here we present a nearly automatic markerless motion capture system that overcomes these problems and successfully tracks octopus arm movements in 3D space. The system is based on three successive tracking and processing stages. The first stage uses a recently presented segmentation algorithm to detect the movement in a pair of video sequences recorded by two calibrated cameras. In the second stage, the results of the first stage are processed to produce 2D skeletal representations of the moving arm. Finally, the 2D skeletons are used to reconstruct the octopus arm movement as a sequence of 3D curves varying in time. Motion tracking, segmentation and reconstruction are especially difficult problems in the case of octopus arm movements because of the deformable, non-rigid structure of the octopus arm and the underwater environment in which it moves. Our successful results suggest that the motion-tracking system presented here may be used for tracking other elongated objects.

Braking System for Wind Turbines

NASA Technical Reports Server (NTRS)

Krysiak, J. E.; Webb, F. E.

1987-01-01

Operating turbine stopped smoothly by fail-safe mechanism. Windturbine braking systems improved by system consisting of two large steel-alloy disks mounted on high-speed shaft of gear box, and brakepad assembly mounted on bracket fastened to top of gear box. Lever arms (with brake pads) actuated by spring-powered, pneumatic cylinders connected to these arms. Springs give specific spring-loading constant and exert predetermined load onto brake pads through lever arms. Pneumatic cylinders actuated positively to compress springs and disengage brake pads from disks. During power failure, brakes automatically lock onto disks, producing highly reliable, fail-safe stops. System doubles as stopping brake and "parking" brake.

Multi-arm multilateral haptics-based immersive tele-robotic system (HITS) for improvised explosive device disposal

NASA Astrophysics Data System (ADS)

Erickson, David; Lacheray, Hervé; Lai, Gilbert; Haddadi, Amir

2014-06-01

This paper presents the latest advancements of the Haptics-based Immersive Tele-robotic System (HITS) project, a next generation Improvised Explosive Device (IED) disposal (IEDD) robotic interface containing an immersive telepresence environment for a remotely-controlled three-articulated-robotic-arm system. While the haptic feedback enhances the operator's perception of the remote environment, a third teleoperated dexterous arm, equipped with multiple vision sensors and cameras, provides stereo vision with proper visual cues, and a 3D photo-realistic model of the potential IED. This decentralized system combines various capabilities including stable and scaled motion, singularity avoidance, cross-coupled hybrid control, active collision detection and avoidance, compliance control and constrained motion to provide a safe and intuitive control environment for the operators. Experimental results and validation of the current system are presented through various essential IEDD tasks. This project demonstrates that a two-armed anthropomorphic Explosive Ordnance Disposal (EOD) robot interface can achieve complex neutralization techniques against realistic IEDs without the operator approaching at any time.

Ophthalmic findings in a family with early-onset isolated ectopia lentis and the p.Arg62Cys mutation of the fibrillin-1 gene (FBN1).

PubMed

Zhao, Jun-Hong; Jin, Tian-Bo; Liu, Qing-Bo; Chen, Chao; Hu, Hai-Tao

2013-01-01

The purpose of this paper is to describe ophthalmic findings in a family with isolated ectopia lentis (EL) caused by a specific FBN1 mutation. Detailed family histories and clinical data were recorded for six isolated EL patients of 11 family members. The ophthalmological and systematic examinations were performed on patients and unaffected members of the investigated family. The detailed ocular examinations included visual acuity, anterior chamber depth, pupil size, lens location, optometry, central corneal thickness, keratometry, slitlamp examination, fundus examination, axial length, ocular B-ultrasound, gonioscope checking, ultrasound biomicroscopy (UBM) and intraocular pressure (IOP; Goldmann applanation tonometer). Systematic examinations included the measurement of echocardiogram, height, arm span, skull, face, jaw, tooth, breast bone, spinal column, and skin. Genomic DNA was extracted using the phenol-chloroform extraction method for all subjects, and sequencing was carried out on an ABI Prism 3730 Genetic Analyzer. A heterozygous mutation, c.184C>T (p.Arg62Cys) in exon 2 of FBN1 was identified in all affected members but was not found in any unaffected member of the family. Our study presented detailed clinical manifestations, including some novel ophthalmic findings, such as pupillary abnormality, different types of glaucoma, and progressive hyperopia. Ophthalmic findings and the p.Arg62Cys mutation of FBN1 gene were reported in a family with early-onset isolated ectopia lentis.

Preemptive Ethanol Lock Therapy in Pediatric Hematology/Oncology Patients With Catheter-Associated Bloodstream Infection: Impact on Length of Stay, Cost, and Catheter Salvage.

PubMed

McGrath, Eric; Du, Wei; Rajpurkar, Madhvi

2018-03-01

Ethanol lock therapy (ELT) with systemic antimicrobial therapy is a promising therapy for catheter-related infection (CRI). The impact of ELT timing on treatment efficacy and costs is unknown. A prospective study was conducted in the Hematology/Oncology Unit at the Children's Hospital of Michigan. Patients with suspected CRI were randomized to Preemptive ELT arm or Rescue ELT arm after positive culture. Five cases in Preemptive arm and 9 in Rescue arm had a confirmed CRI. All cases cleared infection with line salvage with no adverse events due to ELT or recurrence within 14 days. Our data showed a trend toward 36% reduction in average hospital costs and 40% reduction in average length of stay in Preemptive arm over Rescue arm. Although a small study, our data on preemptive ELT with systemic antimicrobial therapy suggest a potentially important treatment strategy in reducing length of stay as well as hospital costs.

Embodied prosthetic arm stabilizes body posture, while unembodied one perturbs it.

PubMed

Imaizumi, Shu; Asai, Tomohisa; Koyama, Shinichi

2016-10-01

Senses of ownership (this arm belongs to me) and agency (I am controlling this arm) originate from sensorimotor system. External objects can be integrated into the sensorimotor system following long-term use, and recognized as one's own body. We examined how an (un)embodied prosthetic arm modulates whole-body control, and assessed the components of prosthetic embodiment. Nine unilateral upper-limb amputees participated. Four frequently used their prosthetic arm, while the others rarely did. Their postural sway was measured during quiet standing with or without their prosthesis. The frequent users showed greater sway when they removed the prosthesis, while the rare users showed greater sway when they fitted the prosthesis. Frequent users reported greater everyday feelings of postural stabilization by prosthesis and a larger sense of agency over the prosthesis. We suggest that a prosthetic arm maintains or perturbs postural control, depending on the prosthetic embodiment, which involves sense of agency rather than ownership. Copyright © 2016 Elsevier Inc. All rights reserved.

A Decade of MWC 758 Disk Images: Where Are the Spiral-arm-driving Planets?

NASA Astrophysics Data System (ADS)

Ren, Bin; Dong, Ruobing; Esposito, Thomas M.; Pueyo, Laurent; Debes, John H.; Poteet, Charles A.; Choquet, Élodie; Benisty, Myriam; Chiang, Eugene; Grady, Carol A.; Hines, Dean C.; Schneider, Glenn; Soummer, Rémi

2018-04-01

Large-scale spiral arms have been revealed in scattered light images of a few protoplanetary disks. Theoretical models suggest that such arms may be driven by and corotate with giant planets, which has called for remarkable observational efforts to look for them. By examining the rotation of the spiral arms for the MWC 758 system over a 10 year timescale, we are able to provide dynamical constraints on the locations of their perturbers. We present reprocessed Hubble Space Telescope (HST)/NICMOS F110W observations of the target in 2005, and the new Keck/NIRC2 L‧-band observations in 2017. MWC 758's two well-known spiral arms are revealed in the NICMOS archive at the earliest observational epoch. With additional Very Large Telescope (VLT)/SPHERE data, our joint analysis leads to a pattern speed of 0\\buildrel{\\circ}\\over{.} {6}-0\\buildrel{\\circ\\over{.} 6}+3\\buildrel{\\circ\\over{.} 3} {yr}}-1 at 3σ for the two major spiral arms. If the two arms are induced by a perturber on a near-circular orbit, its best-fit orbit is at 89 au (0.″59), with a 3σ lower limit of 30 au (0.″20). This finding is consistent with the simulation prediction of the location of an arm-driving planet for the two major arms in the system.

Crizotinib resistance in acute myeloid leukemia with inv(2)(p23q13)/RAN binding protein 2 (RANBP2) anaplastic lymphoma kinase (ALK) fusion and monosomy 7.

PubMed

Takeoka, Kayo; Okumura, Atsuko; Maesako, Yoshitomo; Akasaka, Takashi; Ohno, Hitoshi

2015-03-01

This is the first report on the development of a p.G1269A mutation within the kinase domain (KD) of ALK after crizotinib treatment in RANBP2-ALK acute myeloid leukemia (AML). An elderly woman with AML with an inv(2)(p23q13)/RANBP2-ALK and monosomy 7 was treated with crizotinib. After a short-term hematological response and the restoration of normal hematopoiesis, she experienced a relapse of AML. Fluorescence in situ hybridization using the ALK break-apart probe confirmed the inv(2)(p23q13), while G-banded karyotyping revealed the deletion of a segment of the short arm of chromosome 1 [del(1)(p13p22)] after crizotinib therapy. The ALK gene carried a heterozygous mutation at the nucleotide position g.716751G>C within exon 25, causing the p.G1269A amino acid substitution within the ALK-KD. Reverse transcriptase PCR revealed that the mutated ALK allele was selectively transcribed and the mutation occurred in the ALK allele rearranged with RANBP2. As both the del(1)(p13p22) at the cytogenetic level and p.G1269A at the nucleotide level newly appeared after crizotinib treatment, it is likely that they were secondarily acquired alterations involved in crizotinib resistance. Although secondary genetic abnormalities in ALK are most frequently described in non-small cell lung cancers harboring an ALK alteration, this report suggests that an ALK-KD mutation can occur independently of the tumor cell type or fusion partner after crizotinib treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

True hermaphroditism in a 46, XY individual, caused by a postzygotic somatic point mutation in the male gonadal sex-determining locus (SRY): Molecular genetics and histological findings in a sporadic case

DOE Office of Scientific and Technical Information (OSTI.GOV)

Braun, A.; Kammerer, S.; Cleve, H.

1993-03-01

Recently, the gene for the determination of maleness has been identified in the sex-determining region on the short arm of the Y chromosome (SRY) between the Y-chromosomal pseudoautosomal boundary (PABY) and the ZFY gene locus. Experiments with transgenic mice confirmed that SRY is a part of the testis-determining factor (TDF). The authors describe a sporadic case of a patient with intersexual genitalia and the histological finding of ovotestes in the gonad, which resembles the mixed type of gonadal tissue without primordial follicle structures. The karyotype of the patient was 46,XY. By PCR amplification, they tested for the presence of SRYmore » by using DNA obtained from histological gonadal slices. The SRY products of both DNA preparations were further analyzed by direct sequencing. All three parts of the sex-determining region of the Y chromosome could be amplified from leukocytic DNA. The patient's and the father's SRY sequences were identical with the published sequence. In the SRY PCR product of gonadal DNA, the wild-type and two point mutations were present in the patient's sequence, simulating a heterozygous state of a Y-chromosomal gene: one of the mutations was silent, while the other encoded for a nonconservative amino acid substitution from leucine to histidine. Subcloning procedures showed that the two point mutations always occurred together. The origin of the patient's intersexuality is a postzygotic mutation of the SRY occurring in part of the gonadal tissue. This event caused the loss of the testis-determining function in affected cells. 37 refs., 6 figs.« less

Chromosomal mutations and chromosome loss measured in a new human-hamster hybrid cell line, ALC: studies with colcemid, ultraviolet irradiation, and 137Cs gamma-rays

NASA Technical Reports Server (NTRS)

Kraemer, S. M.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

1997-01-01

Small mutations, megabase deletions, and aneuploidy are involved in carcinogenesis and genetic defects, so it is important to be able to quantify these mutations and understand mechanisms of their creation. We have previously quantified a spectrum of mutations, including megabase deletions, in human chromosome 11, the sole human chromosome in a hamster-human hybrid cell line AL. S1- mutants have lost expression of a human cell surface antigen, S1, which is encoded by the M1C1 gene at 11p13 so that mutants can be detected via a complement-mediated cytotoxicity assay in which S1+ cells are killed and S1- cells survive. But loss of genes located on the tip of the short arm of 11 (11p15.5) is lethal to the AL hybrid, so that mutants that have lost the entire chromosome 11 die and escape detection. To circumvent this, we fused AL with Chinese hamster ovary (CHO) cells to produce a new hybrid, ALC, in which the requirement for maintaining 11p15.5 is relieved, allowing us to detect mutations events involving loss of 11p15.5. We evaluated the usefulness of this hybrid by conducting mutagenesis studies with colcemid, 137Cs gamma-radiation and UV 254 nm light. Colcemid induced 1000 more S1- mutants per unit dose in ALC than in AL; the increase for UV 254 nm light was only two-fold; and the increase for 137Cs gamma-rays was 12-fold. The increase in S1- mutant fraction in ALC cells treated with colcemid and 137Cs gamma-rays were largely due to chromosome loss and 11p deletions often containing a breakpoint within the centromeric region.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chan, R.K.; Otte, C.A.

Eight independently isolated mutants which are supersensitive (Sst/sup -/) to the G1 arrest induced by the tridecapeptide pheromone ..cap alpha.. factor were identified by screening mutagenized Saccharomyces cerevisiae MATa cells on solid medium for increased growth inhibition by ..cap alpha.. factor. These mutants carries lesions in two complementation groups, sst1 and sst2. Mutations at the sst1 locus were mating type specific: MATa sst1 cells were supersensitive to ..cap alpha.. factor, but MAT..cap alpha.. sst1 cells were not supersensitive to a factor. In contrast, mutations at the sst2 locus conferred supersensitivity to the pheromones of the opposite mating type on bothmore » MATa and MAT..cap alpha.. cells. Even in the absence of added ..cap alpha.. pheromone, about 10% of the cells in exponentially growing cultures of MATa strains carrying any of three different alleles of sst2 (including the ochre mutation sst2-4) had the aberrant morphology (''shmoo'' shape) that normally develops only after MATa cells are exposed to ..cap alpha.. factor. This ''self-shmooing'' phenotype was genetically linked to the sst2 mutations, although the leakiest allele isolated (sst2-3) did not display this characteristic. Normal MATa/MAT..cap alpha.. diploids do not respond to pheromones; diploids homozygous for an sst2 mutation (MATa/MAT..cap alpha.. sst2-1/sst2-1) were still insensitive to ..cap alpha.. factor. The sst1 gene was mapped to within 6.9 centimorgans of his6 on chromosome IX. The sst2 gene was unlinked to sst1, was not centromere linked, and was shown to be neither linked nor centromere distal to MAT on the right arm of chromosome III.« less

BRCAsearch: written pre-test information and BRCA1/2 germline mutation testing in unselected patients with newly diagnosed breast cancer.

PubMed

Nilsson, Martin P; Törngren, Therese; Henriksson, Karin; Kristoffersson, Ulf; Kvist, Anders; Silfverberg, Barbro; Borg, Åke; Loman, Niklas

2018-02-01

To evaluate a simplified method of pre-test information and germline BRCA1/2 mutation testing. In a prospective, single-arm study, comprehensive BRCA1/2 testing was offered to unselected patients with newly diagnosed breast cancer at three hospitals in south Sweden (BRCAsearch, ClinicalTrials.gov Identifier: NCT02557776). Pre-test information was provided by a standardized invitation letter, but the patients could contact a genetic counselor for telephone genetic counseling if they felt a need for that. Noncarriers were informed about the test result through a letter. Mutation carriers were contacted and offered an appointment for in-person post-test genetic counseling. During the period Feb 2, 2015-Aug 26, 2016, eight hundred and eighteen patients were invited to participate in the study. Through Jan 31, 2017, five hundred and forty-two (66.2%) of them consented to analysis of BRCA1 and BRCA2. Eleven pathogenic mutations were found (BRCA1, n = 2; BRCA2, n = 9), corresponding to a mutation prevalence of 2.0%. Six out of 11 fulfilled the Swedish BRCA testing criteria, and 9 out of 11 fulfilled the NCCN testing criteria. None of the BRCA-associated tumors were of the luminal A-like subtype. Very few patients contacted us for telephone genetic counseling or practical questions, suggesting that a majority felt that the written pre-test information was sufficient for them to make a decision on testing. Streamlining the process of pre-test information, genetic testing, and delivery of test results was feasible and was associated with an uptake of genetic testing in 2/3 of the breast cancer patients.

New paradigms for BRCA1/BRCA2 testing in women with ovarian cancer: results of the Genetic Testing in Epithelial Ovarian Cancer (GTEOC) study

PubMed Central

Plaskocinska, Inga; Shipman, Hannah; Drummond, James; Thompson, Edward; Buchanan, Vanessa; Newcombe, Barbara; Hodgkin, Charlotte; Barter, Elisa; Ridley, Paul; Ng, Rita; Miller, Suzanne; Dann, Adela; Licence, Victoria; Webb, Hayley; Tan, Li Tee; Daly, Margaret; Ayers, Sarah; Rufford, Barnaby; Earl, Helena; Parkinson, Christine; Duncan, Timothy; Jimenez-Linan, Mercedes; Sagoo, Gurdeep S; Abbs, Stephen; Hulbert-Williams, Nicholas; Pharoah, Paul; Crawford, Robin; Brenton, James D; Tischkowitz, Marc

2016-01-01

Background Over recent years genetic testing for germline mutations in BRCA1/BRCA2 has become more readily available because of technological advances and reducing costs. Objective To explore the feasibility and acceptability of offering genetic testing to all women recently diagnosed with epithelial ovarian cancer (EOC). Methods Between 1 July 2013 and 30 June 2015 women newly diagnosed with EOC were recruited through six sites in East Anglia, UK into the Genetic Testing in Epithelial Ovarian Cancer (GTEOC) study. Eligibility was irrespective of patient age and family history of cancer. The psychosocial arm of the study used self-report, psychometrically validated questionnaires (Depression Anxiety and Stress Scale (DASS-21); Impact of Event Scale (IES)) and cost analysis was performed. Results 232 women were recruited and 18 mutations were detected (12 in BRCA1, 6 in BRCA2), giving a mutation yield of 8%, which increased to 12% in unselected women aged <70 years (17/146) but was only 1% in unselected women aged ≥70 years (1/86). IES and DASS-21 scores in response to genetic testing were significantly lower than equivalent scores in response to cancer diagnosis (p<0.001). Correlation tests indicated that although older age is a protective factor against any traumatic impacts of genetic testing, no significant correlation exists between age and distress outcomes. Conclusions The mutation yield in unselected women diagnosed with EOC from a heterogeneous population with no founder mutations was 8% in all ages and 12% in women under 70. Unselected genetic testing in women with EOC was acceptable to patients and is potentially less resource-intensive than current standard practice. PMID:27208206

Inactivation of Smad4 in gastric carcinomas.

PubMed

Powell, S M; Harper, J C; Hamilton, S R; Robinson, C R; Cummings, O W

1997-10-01

Allelic loss of chromosome 18q has been noted in intestinal type gastric adenocarcinomas. Smad4 is a gene located at 18q that was recently cloned in humans and found to be significantly altered in pancreatic cancers. We sought to determine whether Smad4 genetic alterations played a significant role in gastric tumorigenesis by studying 35 gastric adenocarcinomas of all histopathological types and pathological stages. Microdissected specimens were used for mutational analysis of Smad4 at the nucleotide level, including the entire coding region and intron/exon boundaries. Allelic imbalance was also analyzed at the Smad4 locus using two nearby microsatellite markers. One case of apparent biallelic inactivation of Smad4 was found in our study of 35 gastric carcinomas. A nonsense point mutation at codon 334 was demonstrated, which, similar to other Smad4 mutations, is predicted to truncate the conserved COOH-terminal domain of this protein. This Smad4 C to T transition mutation was proven to be somatically acquired. Allelic loss was also noted on chromosome 18q at a marker near Smad4 in this mutated gastric cancer, apparently producing complete inactivation of Smad4 in this tumor. Significant 18q allelic loss (56% of 34 informative cases) was noted in our gastric carcinomas using microsatellite markers near the Smad4 locus, regardless of histological subtype or pathological stage. Additionally, three cases of microsatellite instability were observed. Thus, Smad4 inactivation was noted in our gastric carcinomas; however, this event was rare. The frequent loss of chromosomal arm 18q observed in gastric cancers suggests the presence of other tumor suppressor genes in this region that are involved in gastric tumorigenesis. Further studies are needed to identify these other targets of inactivation during gastric cancer development.

The Development of the Speaker Independent ARM Continuous Speech Recognition System

DTIC Science & Technology

1992-01-01

spokeTi airborne reconnaissance reports u-ing a speech recognition system based on phoneme-level hidden Markov models (HMMs). Previous versions of the ARM...will involve automatic selection from multiple model sets, corresponding to different speaker types, and that the most rudimen- tary partition of a...The vocabulary size for the ARM task is 497 words. These words are related to the phoneme-level symbols corresponding to the models in the model set

Filtering sensory information with XCSF: improving learning robustness and robot arm control performance.

PubMed

Kneissler, Jan; Stalph, Patrick O; Drugowitsch, Jan; Butz, Martin V

2014-01-01

It has been shown previously that the control of a robot arm can be efficiently learned using the XCSF learning classifier system, which is a nonlinear regression system based on evolutionary computation. So far, however, the predictive knowledge about how actual motor activity changes the state of the arm system has not been exploited. In this paper, we utilize the forward velocity kinematics knowledge of XCSF to alleviate the negative effect of noisy sensors for successful learning and control. We incorporate Kalman filtering for estimating successive arm positions, iteratively combining sensory readings with XCSF-based predictions of hand position changes over time. The filtered arm position is used to improve both trajectory planning and further learning of the forward velocity kinematics. We test the approach on a simulated kinematic robot arm model. The results show that the combination can improve learning and control performance significantly. However, it also shows that variance estimates of XCSF prediction may be underestimated, in which case self-delusional spiraling effects can hinder effective learning. Thus, we introduce a heuristic parameter, which can be motivated by theory, and which limits the influence of XCSF's predictions on its own further learning input. As a result, we obtain drastic improvements in noise tolerance, allowing the system to cope with more than 10 times higher noise levels.

Research on the relationship of the probe system for the swing arm profilometer based on the point source microscope

NASA Astrophysics Data System (ADS)

Gao, Mingxing; Jing, Hongwei; Cao, Xuedong; Chen, Lin; Yang, Jie

2015-08-01

When using the swing arm profilometer (SAP) to measure the aspheric mirror and the off-axis aspheric mirror, the error of the effective arm length of the SAP has an obvious influence on the measurement result. In order to reduce the influence of the effective arm length and increase the measurement accuracy of the SAP, the laser tracker is adopted to measure the effective arm length. Because the space position relationship of the probe system for the SAP is needed to measured before using the laser tracker, the point source microscope (PSM) is used to measure the space positional relationship. The measurement principle of the PSM and other applications are introduced; the accuracy and repeatability of this technology are analysed; the advantages and disadvantages of this technology are summarized.

Polycythaemia-inducing mutations in the erythropoietin receptor (EPOR): mechanism and function as elucidated by epidermal growth factor receptor-EPOR chimeras.

PubMed

Gross, Mor; Ben-Califa, Nathalie; McMullin, Mary F; Percy, Melanie J; Bento, Celeste; Cario, Holger; Minkov, Milen; Neumann, Drorit

2014-05-01

Primary familial and congenital polycythaemia (PFCP) is a disease characterized by increased red blood cell mass, and can be associated with mutations in the intracellular region of the erythropoietin (EPO) receptor (EPOR). Here we explore the mechanisms by which EPOR mutations induce PFCP, using an experimental system based on chimeric receptors between epidermal growth factor receptor (EGFR) and EPOR. The design of the chimeras enabled EPOR signalling to be triggered by EGF binding. Using this system we analysed three novel EPOR mutations discovered in PFCP patients: a deletion mutation (Del1377-1411), a nonsense mutation (C1370A) and a missense mutation (G1445A). Three different chimeras, bearing these mutations in the cytosolic, EPOR region were generated; Hence, the differences in the chimera-related effects are specifically attributed to the mutations. The results show that the different mutations affect various aspects related to the signalling and metabolism of the chimeric receptors. These include slower degradation rate, higher levels of glycan-mature chimeric receptors, increased sensitivity to low levels of EGF (replacing EPO in this system) and extended signalling cascades. This study provides a novel experimental system to study polycythaemia-inducing mutations in the EPOR, and sheds new light on underlying mechanisms of EPOR over-activation in PFCP patients. © 2014 John Wiley & Sons Ltd.

Highly specific salt bridges govern bacteriophage P22 icosahedral capsid assembly: identification of the site in coat protein responsible for interaction with scaffolding protein.

PubMed

Cortines, Juliana R; Motwani, Tina; Vyas, Aashay A; Teschke, Carolyn M

2014-05-01

Icosahedral virus assembly requires a series of concerted and highly specific protein-protein interactions to produce a proper capsid. In bacteriophage P22, only coat protein (gp5) and scaffolding protein (gp8) are needed to assemble a procapsid-like particle, both in vivo and in vitro. In scaffolding protein's coat binding domain, residue R293 is required for procapsid assembly, while residue K296 is important but not essential. Here, we investigate the interaction of scaffolding protein with acidic residues in the N-arm of coat protein, since this interaction has been shown to be electrostatic. Through site-directed mutagenesis of genes 5 and 8, we show that changing coat protein N-arm residue 14 from aspartic acid to alanine causes a lethal phenotype. Coat protein residue D14 is shown by cross-linking to interact with scaffolding protein residue R293 and, thus, is intimately involved in proper procapsid assembly. To a lesser extent, coat protein N-arm residue E18 is also implicated in the interaction with scaffolding protein and is involved in capsid size determination, since a cysteine mutation at this site generated petite capsids. The final acidic residue in the N-arm that was tested, E15, is shown to only weakly interact with scaffolding protein's coat binding domain. This work supports growing evidence that surface charge density may be the driving force of virus capsid protein interactions. Bacteriophage P22 infects Salmonella enterica serovar Typhimurium and is a model for icosahedral viral capsid assembly. In this system, coat protein interacts with an internal scaffolding protein, triggering the assembly of an intermediate called a procapsid. Previously, we determined that there is a single amino acid in scaffolding protein required for P22 procapsid assembly, although others modulate affinity. Here, we identify partners in coat protein. We show experimentally that relatively weak interactions between coat and scaffolding proteins are capable of driving correctly shaped and sized procapsids and that the lack of these proper protein-protein interfaces leads to aberrant structures. The present work represents an important contribution supporting the hypothesis that virus capsid assembly is governed by seemingly simple interactions. The highly specific nature of the subunit interfaces suggests that these could be good targets for antivirals.

On the Value of Estimating Human Arm Stiffness during Virtual Teleoperation with Robotic Manipulators

PubMed Central

Buzzi, Jacopo; Ferrigno, Giancarlo; Jansma, Joost M.; De Momi, Elena

2017-01-01

Teleoperated robotic systems are widely spreading in multiple different fields, from hazardous environments exploration to surgery. In teleoperation, users directly manipulate a master device to achieve task execution at the slave robot side; this interaction is fundamental to guarantee both system stability and task execution performance. In this work, we propose a non-disruptive method to study the arm endpoint stiffness. We evaluate how users exploit the kinetic redundancy of the arm to achieve stability and precision during the execution of different tasks with different master devices. Four users were asked to perform two planar trajectories following virtual tasks using both a serial and a parallel link master device. Users' arm kinematics and muscular activation were acquired and combined with a user-specific musculoskeletal model to estimate the joint stiffness. Using the arm kinematic Jacobian, the arm end-point stiffness was derived. The proposed non-disruptive method is capable of estimating the arm endpoint stiffness during the execution of virtual teleoperated tasks. The obtained results are in accordance with the existing literature in human motor control and show, throughout the tested trajectory, a modulation of the arm endpoint stiffness that is affected by task characteristics and hand speed and acceleration. PMID:29018319

Integrative rehabilitation of elderly stroke survivors: the design and evaluation of the BrightArm™.

PubMed

Rabin, Bryan A; Burdea, Grigore C; Roll, Doru T; Hundal, Jasdeep S; Damiani, Frank; Pollack, Simcha

2012-07-01

To describe the development of the BrightArm upper extremity rehabilitation system, and to determine its clinical feasibility with older hemiplegic patients. The BrightArm adjusted arm gravity loading through table tilting. Patients wore an arm support that sensed grasp strength and communicated wirelessly with a personal computer. Games were written to improve cognitive, psychosocial and the upper extremity motor function and adapted automatically to each patient. The system underwent feasibility trials spanning 6 weeks. Participants were evaluated pre-therapy, post-therapy, and at 6 weeks follow-up using standardized clinical measures. Computerized measures of supported arm reach and game performance were stored on a remote server. Five participants had clinically significant improvements in their active range of shoulder movement, shoulder strength, grasp strength, and their ability to focus. Several participants demonstrated substantially higher arm function (measured with the Fugl-Meyer test) and two were less-depressed (measured with the Becks Depression Inventory, Second Edition). The BrightArm technology was well-accepted by the participants, who gave it an overall subjective rating of 4.1 on a 5 point Likert scale. Given these preliminary findings, it will be beneficial to evaluate the BrightArm through controlled clinical trials and to investigate its application to other clinical populations.

Integrative rehabilitation of elderly stroke survivors: The design and evaluation of the BrightArm™

PubMed Central

Rabin, Bryan A.; Burdea, Grigore C.; Roll, Doru T.; Hundal, Jasdeep S.; Damiani, Frank; Pollack, Simcha

2011-01-01

Purpose To describe the development of the BrightArm upper extremity rehabilitation system, and to determine its clinical feasibility with older hemiplegic patients. Method The BrightArm adjusted arm gravity loading through table tilting. Patients wore an arm support that sensed grasp strength and communicated wirelessly with a personal computer. Games were written to improve cognitive, psychosocial and the upper extremity motor function and adapted automatically to each patient. The system underwent feasibility trials spanning 6 weeks. Participants were evaluated pre-therapy, post-therapy, and at 6 weeks follow-up using standardized clinical measures. Computerized measures of supported arm reach and game performance were stored on a remote server. Results Five participants had clinically significant improvements in their active range of shoulder movement, shoulder strength, grasp strength, and their ability to focus. Several participants demonstrated substantially higher arm function (measured with the Fugl-Meyer test) and two were less-depressed (measured with the Becks Depression Inventory, Second Edition). The BrightArm technology was well-accepted by the participants, who gave it an overall subjective rating of 4.1 on a 5 point Likert scale. Conclusions Given these preliminary findings, it will be beneficial to evaluate the BrightArm through controlled clinical trials and to investigate its application to other clinical populations. PMID:22107353

Report: Basic Facts About Military Service.

ERIC Educational Resources Information Center

High School News Service (DOD), Great Lakes, IL.

The purpose of the report is to inform students, through counselors and advisers, of opportunities and responsibilities in the Armed Forces. The topics covered are: missions of the Armed Forces, the selective service system, enlistment programs, reserve components, commissioning programs, auxiliary benefits, women in the Armed Forces, and basic…

Design criteria for the light duty utility arm system end effectors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pardini, A.F.; Kiebel, G.R.

1995-12-01

The purpose of this document is to provide criteria for the design of end effectors that will be used as part of the Light Duty Utility Arm (LDUA) System. Actual component design, fabrication, testing, and inspection will be performed by various DOE laboratories, industry, and academia. This document augments WHC-SD-TD-FRD-003, `Functions and Requirements for the Light Duty Utility Arm Integrated System` (F). All requirements dictated in the F shall also be applicable in this document. Whenever conflicts arise between this document and the F, this document shall take precedence.

Clinical significance of acquired somatic mutations in aplastic anaemia.

PubMed

Marsh, J C W; Mufti, G J

2016-08-01

Aplastic anaemia (AA) is frequently associated with other disorders of clonal haemopoiesis such as paroxysmal nocturnal haemoglobinuria (PNH), myelodysplastic syndrome (MDS) and T-large granular lymphocytosis. Certain clones may escape the immune attack within the bone marrow environment and proliferate and attain a survival advantage over normal haemopoietic stem cells, such as trisomy 8, loss of heterozygosity of short arm of chromosome 6 and del13q clones. Recently acquired somatic mutations (SM), excluding PNH clones, have been reported in around 20-25 % of patients with AA, which predispose to a higher risk of later malignant transformation to MDS/acute myeloid leukaemia. Furthermore, certain SM, such as ASXL1 and DNMT3A are associated with poor survival following immunosuppressive therapy, whereas PIGA, BCOR/BCORL1 predict for good response and survival. Further detailed and serial analysis of the immune signature in AA is needed to understand the pathogenetic basis for the presence of clones with SM in a significant proportion of patients.

SHOX Haploinsufficiency as a Cause of Syndromic and Nonsyndromic Short Stature

PubMed Central

Fukami, Maki; Seki, Atsuhito; Ogata, Tsutomu

2016-01-01

SHOX in the short arm pseudoautosomal region (PAR1) of sex chromosomes is one of the major growth genes in humans. SHOX haploinsufficiency results in idiopathic short stature and Léri-Weill dyschondrosteosis and is associated with the short stature of patients with Turner syndrome. The SHOX protein likely controls chondrocyte apoptosis by regulating multiple target genes including BNP,Fgfr3, Agc1, and Ctgf. SHOX haploinsufficiency frequently results from deletions and duplications in PAR1 involving SHOX exons and/or the cis-acting enhancers, while exonic point mutations account for a small percentage of cases. The clinical severity of SHOX haploinsufficiency reflects hormonal conditions rather than mutation types. Growth hormone treatment seems to be beneficial for cases with SHOX haploinsufficiency, although the long-term outcomes of this therapy require confirmation. Future challenges in SHOX research include elucidating its precise function in the developing limbs, identifying additional cis-acting enhancers, and determining optimal therapeutic strategies for patients. PMID:27194967

Snapshot of the equilibrium dynamics of a drug bound to HIV-1 reverse transcriptase

NASA Astrophysics Data System (ADS)

Kuroda, Daniel G.; Bauman, Joseph D.; Challa, J. Reddy; Patel, Disha; Troxler, Thomas; Das, Kalyan; Arnold, Eddy; Hochstrasser, Robin M.

2013-03-01

The anti-AIDS drug rilpivirine undergoes conformational changes to bind HIV-1 reverse transcriptase (RT), which is an essential enzyme for the replication of HIV. These changes allow it to retain potency against mutations that otherwise would render the enzyme resistant. Here we report that water molecules play an essential role in this binding process. Femtosecond experiments and theory expose the molecular level dynamics of rilpivirine bound to HIV-1 RT. Two nitrile substituents, one on each arm of the drug, are used as vibrational probes of the structural dynamics within the binding pocket. Two-dimensional vibrational echo spectroscopy reveals that one nitrile group is unexpectedly hydrogen-bonded to a mobile water molecule, not identified in previous X-ray structures. Ultrafast nitrile-water dynamics are confirmed by simulations. A higher (1.51 Å) resolution X-ray structure also reveals a water-drug interaction network. Maintenance of a crucial anchoring hydrogen bond may help retain the potency of rilpivirine against pocket mutations despite the structural variations they cause.

Cloning-free CRISPR

PubMed Central

Arbab, Mandana; Srinivasan, Sharanya; Hashimoto, Tatsunori; Geijsen, Niels; Sherwood, Richard I.

2015-01-01

Summary We present self-cloning CRISPR/Cas9 (scCRISPR), a technology that allows for CRISPR/Cas9-mediated genomic mutation and site-specific knockin transgene creation within several hours by circumventing the need to clone a site-specific single-guide RNA (sgRNA) or knockin homology construct for each target locus. We introduce a self-cleaving palindromic sgRNA plasmid and a short double-stranded DNA sequence encoding the desired locus-specific sgRNA into target cells, allowing them to produce a locus-specific sgRNA plasmid through homologous recombination. scCRISPR enables efficient generation of gene knockouts (∼88% mutation rate) at approximately one-sixth the cost of plasmid-based sgRNA construction with only 2 hr of preparation for each targeted site. Additionally, we demonstrate efficient site-specific knockin of GFP transgenes without any plasmid cloning or genome-integrated selection cassette in mouse and human embryonic stem cells (2%–4% knockin rate) through PCR-based addition of short homology arms. scCRISPR substantially lowers the bar on mouse and human transgenesis. PMID:26527385

Non-invasive detection of urothelial cancer through the analysis of driver gene mutations and aneuploidy

PubMed Central

Li, Lu; Douville, Christopher; Wang, Yuxuan; Cohen, Joshua David; Taheri, Diana; Silliman, Natalie; Schaefer, Joy; Ptak, Janine; Dobbyn, Lisa; Papoli, Maria; Kinde, Isaac; Afsari, Bahman; Tregnago, Aline C; Bezerra, Stephania M; VandenBussche, Christopher; Fujita, Kazutoshi; Ertoy, Dilek; Cunha, Isabela W; Yu, Lijia; Bivalacqua, Trinity J; Grollman, Arthur P; Diaz, Luis A; Karchin, Rachel; Danilova, Ludmila; Huang, Chao-Yuan; Shun, Chia-Tung; Turesky, Robert J; Yun, Byeong Hwa; Rosenquist, Thomas A; Pu, Yeong-Shiau; Hruban, Ralph H; Tomasetti, Cristian; Papadopoulos, Nickolas; Kinzler, Ken W

2018-01-01

Current non-invasive approaches for detection of urothelial cancers are suboptimal. We developed a test to detect urothelial neoplasms using DNA recovered from cells shed into urine. UroSEEK incorporates massive parallel sequencing assays for mutations in 11 genes and copy number changes on 39 chromosome arms. In 570 patients at risk for bladder cancer (BC), UroSEEK was positive in 83% of those who developed BC. Combined with cytology, UroSEEK detected 95% of patients who developed BC. Of 56 patients with upper tract urothelial cancer, 75% tested positive by UroSEEK, including 79% of those with non-invasive tumors. UroSEEK detected genetic abnormalities in 68% of urines obtained from BC patients under surveillance who demonstrated clinical evidence of recurrence. The advantages of UroSEEK over cytology were evident in low-grade BCs; UroSEEK detected 67% of cases whereas cytology detected none. These results establish the foundation for a new non-invasive approach for detection of urothelial cancer. PMID:29557778

Novel SNP array analysis and exome sequencing detect a homozygous exon 7 deletion of MEGF10 causing early onset myopathy, areflexia, respiratory distress and dysphagia (EMARDD)

PubMed Central

Pierson, Tyler Mark; Markello, Thomas; Accardi, John; Wolfe, Lynne; Adams, David; Sincan, Murat; Tarazi, Noor M.; Fajardo, Karin Fuentes; Cherukuri, Praveen F.; Bajraktari, Ilda; Meilleur, Katy G.; Donkervoort, Sandra; Jain, Mina; Hu, Ying; Lehky, Tanya J.; Cruz, Pedro; Mullikin, James C.; Bonnemann, Carsten; Gahl, William A.; Boerkoel, Cornelius F.; Tifft, Cynthia J.

2013-01-01

Early-onset myopathy, areflexia, respiratory distress and dysphagia (EMARDD) is a myopathic disorder associated with mutations in MEGF10. By novel analysis of SNP array hybridization and exome sequence coverage, we diagnosed a 10-year old girl with EMARDD following identification of a novel homozygous deletion of exon 7 in MEGF10. In contrast to previously reported EMARDD patients, her weakness was more prominent proximally than distally, and involved her legs more than her arms. MRI of her pelvis and thighs showed muscle atrophy and fatty replacement. Ultrasound of several muscle groups revealed dense homogenous increases in echogenicity. Cloning and sequencing of the deletion breakpoint identified features suggesting the mutation arose by fork stalling and template switching. These findings constitute the first genomic deletion causing EMARDD, expand the clinical phenotype, and provide new insight into the pattern and histology of its muscular pathology. PMID:23453856

Gorlin-Goltz Syndrome

PubMed Central

Pandeshwar, Padma; Jayanthi, K.; Mahesh, D.

2012-01-01

The Gorlin-Goltz syndrome (GGS) (the nevoid basal cell carcinoma syndrome—NBCCS) is a rare autosomal dominant syndrome caused due to mutations in the PTCH (patched) gene found on chromosome arm 9q. The syndrome, characterized by increased predisposition to develop basal cell carcinoma and associated multiorgan anomalies, has a high level of penetrance and variable expressiveness. GGS is a multidisciplinary problem, early diagnosis of which allows introduction of secondary prophylaxis and following an appropriate treatment to delay the progress of the syndrome. The following report emphasizes the need for awareness of the diagnostic criteria of this syndrome in cases with no typical skin lesions. PMID:23082255

Gorlin-goltz syndrome.

PubMed

Pandeshwar, Padma; Jayanthi, K; Mahesh, D

2012-01-01

The Gorlin-Goltz syndrome (GGS) (the nevoid basal cell carcinoma syndrome-NBCCS) is a rare autosomal dominant syndrome caused due to mutations in the PTCH (patched) gene found on chromosome arm 9q. The syndrome, characterized by increased predisposition to develop basal cell carcinoma and associated multiorgan anomalies, has a high level of penetrance and variable expressiveness. GGS is a multidisciplinary problem, early diagnosis of which allows introduction of secondary prophylaxis and following an appropriate treatment to delay the progress of the syndrome. The following report emphasizes the need for awareness of the diagnostic criteria of this syndrome in cases with no typical skin lesions.

Development of a Stereo Vision Measurement System for a 3D Three-Axial Pneumatic Parallel Mechanism Robot Arm

PubMed Central

Chiang, Mao-Hsiung; Lin, Hao-Ting; Hou, Chien-Lun

2011-01-01

In this paper, a stereo vision 3D position measurement system for a three-axial pneumatic parallel mechanism robot arm is presented. The stereo vision 3D position measurement system aims to measure the 3D trajectories of the end-effector of the robot arm. To track the end-effector of the robot arm, the circle detection algorithm is used to detect the desired target and the SAD algorithm is used to track the moving target and to search the corresponding target location along the conjugate epipolar line in the stereo pair. After camera calibration, both intrinsic and extrinsic parameters of the stereo rig can be obtained, so images can be rectified according to the camera parameters. Thus, through the epipolar rectification, the stereo matching process is reduced to a horizontal search along the conjugate epipolar line. Finally, 3D trajectories of the end-effector are computed by stereo triangulation. The experimental results show that the stereo vision 3D position measurement system proposed in this paper can successfully track and measure the fifth-order polynomial trajectory and sinusoidal trajectory of the end-effector of the three- axial pneumatic parallel mechanism robot arm. PMID:22319408

A compensation method of lever arm effect for tri-axis hybrid inertial navigation system based on fiber optic gyro

NASA Astrophysics Data System (ADS)

Liu, Zengjun; Wang, Lei; Li, Kui; Gao, Jiaxin

2017-05-01

Hybrid inertial navigation system (HINS) is a new kind of inertial navigation system (INS), which combines advantages of platform INS, strap-down INS and rotational INS. HINS has a physical platform to isolate the angular motion as platform INS does, HINS also uses strap-down attitude algorithms and applies rotation modulation technique. Tri-axis HINS has three gimbals to isolate the angular motion in the dynamic base, in which way the system can reduce the effects of angular motion and improve the positioning precision. However, the angular motion will affect the compensation of some error parameters, especially for the lever arm effect. The lever arm effect caused by position errors between the accelerometers and rotation center cannot be ignored due to the rapid rotation of inertial measurement unit (IMU) and it will cause fluctuation and stage in velocity in HINS. The influences of angular motion on the lever arm effect compensation are analyzed firstly in this paper, and then the compensation method of lever arm effect based on the photoelectric encoders in dynamic base is proposed. Results of experiments on turntable show that after compensation, the fluctuations and stages in velocity curve disappear.

Maximizing Use of Robot-Arm No. 3 in Da Vinci–Assisted Thoracic Surgery

PubMed Central

Kajiwara, Naohiro; Maeda, Junichi; Yoshida, Koichi; Kato, Yasufumi; Hagiwara, Masaru; Kakihana, Masatoshi; Ohira, Tatsuo; Kawate, Norihiko; Ikeda, Norihiko

2015-01-01

We have previously reported on the importance of appropriate robot-arm settings and replacement of instrument ports in robot-assisted thoracic surgery, because the thoracic cavity requires a large space to access all lesions in various areas of the thoracic cavity from the apex to the diaphragm and mediastinum and the chest wall.1–3 Moreover, it can be difficult to manipulate the da Vinci Surgical System using only arms No. 1 and No. 2 depending on the tumor location. However, arm No. 3 is usually positioned on the same side as arm No. 2, and sometimes it is only used as an assisting-arm to avoid conflict with other arms (Fig. 1). In this report, we show how robot-arm No. 3 can be used with maximum effectiveness in da Vinci-assisted thoracic surgery. PMID:26011219

Design and testing of a model CELSS chamber robot

NASA Astrophysics Data System (ADS)

Davis, Mark; Dezego, Shawn; Jones, Kinzy; Kewley, Christopher; Langlais, Mike; McCarthy, John; Penny, Damon; Bonner, Tom; Funderburke, C. Ashley; Hailey, Ruth

1994-08-01

A robot system for use in an enclosed environment was designed and tested. The conceptual design will be used to assist in research performed by the Controlled Ecological Life Support System (CELSS) project. Design specifications include maximum load capacity, operation at specified environmental conditions, low maintenance, and safety. The robot system must not be hazardous to the sealed environment, and be capable of stowing and deploying within a minimum area of the CELSS chamber facility. This design consists of a telescoping robot arm that slides vertically on a shaft positioned in the center of the CELSS chamber. The telescoping robot arm consists of a series of links which can be fully extended to a length equal to the radius of the working envelope of the CELSS chamber. The vertical motion of the robot arm is achieved through the use of a combination ball screw/ball spline actuator system. The robot arm rotates cylindrically about the vertical axis through use of a turntable bearing attached to a central mounting structure fitted to the actuator shaft. The shaft is installed in an overhead rail system allowing the entire structure to be stowed and deployed within the CELSS chamber. The overhead rail system is located above the chamber's upper lamps and extends to the center of the CELSS chamber. The mounting interface of the actuator shaft and rail system allows the entire actuator shaft to be detached and removed from the CELSS chamber. When the actuator shaft is deployed, it is held fixed at the bottom of the chamber by placing a square knob on the bottom of the shaft into a recessed square fitting in the bottom of the chamber floor. A support boot ensures the rigidity of the shaft. Three student teams combined into one group designed a model of the CELSS chamber robot that they could build. They investigated materials, availability, and strength in their design. After the model arm and stand were built, the class performed pre-tests on the entire system. A stability pre-test was used to determine whether the model robot arm would tip over on the stand when it was fully extended. Results showed the stand tipped when 50 Newtons were applied horizontally to the top of the vertical shaft while the arm was fully extended.

Design and testing of a model CELSS chamber robot

NASA Technical Reports Server (NTRS)

Davis, Mark; Dezego, Shawn; Jones, Kinzy; Kewley, Christopher; Langlais, Mike; Mccarthy, John; Penny, Damon; Bonner, Tom; Funderburke, C. Ashley; Hailey, Ruth

1994-01-01

A robot system for use in an enclosed environment was designed and tested. The conceptual design will be used to assist in research performed by the Controlled Ecological Life Support System (CELSS) project. Design specifications include maximum load capacity, operation at specified environmental conditions, low maintenance, and safety. The robot system must not be hazardous to the sealed environment, and be capable of stowing and deploying within a minimum area of the CELSS chamber facility. This design consists of a telescoping robot arm that slides vertically on a shaft positioned in the center of the CELSS chamber. The telescoping robot arm consists of a series of links which can be fully extended to a length equal to the radius of the working envelope of the CELSS chamber. The vertical motion of the robot arm is achieved through the use of a combination ball screw/ball spline actuator system. The robot arm rotates cylindrically about the vertical axis through use of a turntable bearing attached to a central mounting structure fitted to the actuator shaft. The shaft is installed in an overhead rail system allowing the entire structure to be stowed and deployed within the CELSS chamber. The overhead rail system is located above the chamber's upper lamps and extends to the center of the CELSS chamber. The mounting interface of the actuator shaft and rail system allows the entire actuator shaft to be detached and removed from the CELSS chamber. When the actuator shaft is deployed, it is held fixed at the bottom of the chamber by placing a square knob on the bottom of the shaft into a recessed square fitting in the bottom of the chamber floor. A support boot ensures the rigidity of the shaft. Three student teams combined into one group designed a model of the CELSS chamber robot that they could build. They investigated materials, availability, and strength in their design. After the model arm and stand were built, the class performed pre-tests on the entire system. A stability pre-test was used to determine whether the model robot arm would tip over on the stand when it was fully extended. Results showed the stand tipped when 50 Newtons were applied horizontally to the top of the vertical shaft while the arm was fully extended. This proved that it was stable. Another pre-test was the actuator slip test used to determine if there is an adequate coefficient of friction between the actuator drive wheels and drive cable to enable the actuator to fully extend and retract the arm. This pre-test revealed that the coefficient of friction was not large enough to prevent slippage. Sandpaper was glued to the drive wheel and this eliminated the slippage problem. The class preformed a fit test in the CELSS chamber to ensure that the completed robot arm is capable of reaching the entire working envelope. The robot was centered in the chamber and the arm was fully extended to the sides of the chamber. The arm was also able to retract to clear the drain pipes separating the upper and lower plant trays.

Qidong hepatitis B virus infection cohort: a 25-year prospective study in high risk area of primary liver cancer.

PubMed

Chen, Taoyang; Qian, Gengsun; Fan, Chunsun; Sun, Yan; Wang, Jinbing; Lu, Peixin; Xue, Xuefeng; Wu, Yan; Zhang, Qinan; Jin, Yan; Wu, Yiqian; Gan, Yu; Lu, Jianquan; Kensler, Thomas W; Groopman, John D; Tu, Hong

2018-01-01

Qidong hepatitis B virus (HBV) infection cohort (QBC) is a prospective community-based study designed to investigate causative factors of primary liver cancer (PLC) in Qidong, China, where both PLC and HBV infection are highly endemic. Residents aged 20-65 years, living in seven townships of Qidong, were surveyed using hepatitis B surface antigen (HBsAg) serum test and invited to participate in QBC from June 1991 to December 1991. A total of 852 and 786 participants were enrolled in HBsAg-positive and HBsAg-negative sub-cohorts in May 1992, respectively. All participants were actively followed up in person, received HBsAg, alanine aminotransferase (ALT), alpha-fetoprotein (AFP) tests and upper abdominal ultrasonic examination, and donated blood and urine samples once or twice a year. The total response rate was 99.6%, and the number of incident PLC was 201 till the end of February 2017. The ratio of incidence rates was 12.32 (95% confidence interval[CI]=7.16-21.21, P < 0.0001) in HBsAg-positive arm compared with HBsAg-negative arm. The relative risk of PLC was 13.25 (95% CI=6.67-26.33, P < 0.0001) and 28.05 (95% CI=13.87-56.73, P < 0.0001) in the HBsAg+/HBeAg- group and the HBsAg+/HBeAg+ group, respectively, as compared to the HBsAg-/HBeAg- group. A series of novel PLC-related mutations including A2159G, A2189C and G2203W at the C gene, A799G, A987G and T1055A at the P gene of HBV genome were identified by using samples from the cohort. The mutation in hepatitis B virus (HBV) basal core promoter region of HBV genome has an accumulative effect on the occurrence of PLC. In addition, the tripartite relationship of aflatoxin exposure, P53 mutation and PLC was also investigated. Dynamic prediction model for PLC risk by using its long-term follow-up information and serial blood samples for QBC was developed. This model is expected to improve the efficiency of PLC screening in HBV infection individuals.

Decoupling Identification for Serial Two-Link Two-Inertia System

NASA Astrophysics Data System (ADS)

Oaki, Junji; Adachi, Shuichi

The purpose of our study is to develop a precise model by applying the technique of system identification for the model-based control of a nonlinear robot arm, under taking joint-elasticity into consideration. We previously proposed a systematic identification method, called “decoupling identification,” for a “SCARA-type” planar two-link robot arm with elastic joints caused by the Harmonic-drive® reduction gears. The proposed method serves as an extension of the conventional rigid-joint-model-based identification. The robot arm is treated as a serial two-link two-inertia system with nonlinearity. The decoupling identification method using link-accelerometer signals enables the serial two-link two-inertia system to be divided into two linear one-link two-inertia systems. The MATLAB®'s commands for state-space model estimation are utilized in the proposed method. Physical parameters such as motor inertias, link inertias, joint-friction coefficients, and joint-spring coefficients are estimated through the identified one-link two-inertia systems using a gray-box approach. This paper describes accuracy evaluations using the two-link arm for the decoupling identification method under introducing closed-loop-controlled elements and varying amplitude-setup of identification-input. Experimental results show that the identification method also works with closed-loop-controlled elements. Therefore, the identification method is applicable to a “PUMA-type” vertical robot arm under gravity.

Control of a 7-DOF Robotic Arm System With an SSVEP-Based BCI.

PubMed

Chen, Xiaogang; Zhao, Bing; Wang, Yijun; Xu, Shengpu; Gao, Xiaorong

2018-04-12

Although robot technology has been successfully used to empower people who suffer from motor disabilities to increase their interaction with their physical environment, it remains a challenge for individuals with severe motor impairment, who do not have the motor control ability to move robots or prosthetic devices by manual control. In this study, to mitigate this issue, a noninvasive brain-computer interface (BCI)-based robotic arm control system using gaze based steady-state visual evoked potential (SSVEP) was designed and implemented using a portable wireless electroencephalogram (EEG) system. A 15-target SSVEP-based BCI using a filter bank canonical correlation analysis (FBCCA) method allowed users to directly control the robotic arm without system calibration. The online results from 12 healthy subjects indicated that a command for the proposed brain-controlled robot system could be selected from 15 possible choices in 4[Formula: see text]s (i.e. 2[Formula: see text]s for visual stimulation and 2[Formula: see text]s for gaze shifting) with an average accuracy of 92.78%, resulting in a 15 commands/min transfer rate. Furthermore, all subjects (even naive users) were able to successfully complete the entire move-grasp-lift task without user training. These results demonstrated an SSVEP-based BCI could provide accurate and efficient high-level control of a robotic arm, showing the feasibility of a BCI-based robotic arm control system for hand-assistance.

Tumor marker analyses from the phase III, placebo-controlled, FASTACT-2 study of intercalated erlotinib with gemcitabine/platinum in the first-line treatment of advanced non-small-cell lung cancer.

PubMed

Mok, Tony; Ladrera, Guia; Srimuninnimit, Vichien; Sriuranpong, Virote; Yu, Chong-Jen; Thongprasert, Sumitra; Sandoval-Tan, Jennifer; Lee, Jin Soo; Fuerte, Fatima; Shames, David S; Klughammer, Barbara; Truman, Matt; Perez-Moreno, Pablo; Wu, Yi-Long

2016-08-01

The FASTACT-2 study of intercalated erlotinib with chemotherapy in Asian patients found that EGFR mutations were the main driver behind the significant progression-free survival (PFS) benefit noted in the overall population. Further exploratory biomarker analyses were conducted to provide additional insight. This multicenter, randomized, placebo-controlled, double-blind, phase III study investigated intercalated first-line erlotinib or placebo with gemcitabine/platinum, followed by maintenance erlotinib or placebo, for patients with stage IIIB/IV non-small cell lung cancer (NSCLC). Provision of samples for biomarker analysis was encouraged but not mandatory. The following biomarkers were analyzed (in order of priority): EGFR mutation by cobas(®) test, KRAS mutation by cobas(®)KRAS test, HER2 by immunohistochemistry (IHC), HER3 by IHC, ERCC1 by IHC, EGFR gene copy number by fluorescence in-situ hybridization (FISH) and EGFR by IHC. All subgroups were assessed for PFS (primary endpoint), overall survival (OS), non-progression rate and objective response rate. Overall, 256 patients provided samples for analysis. Considerable overlap was noted among biomarkers, except for EGFR and KRAS mutations, which are mutually exclusive. Other than EGFR mutations (p<0.0001), no other biomarkers were significantly predictive of outcomes in a treatment-by-biomarker interaction test, although ERCC1 IHC-positive status was predictive of improved OS for the erlotinib arm versus placebo in EGFR wild-type patients (median 18.4 vs 9.5 months; hazard ratio [HR] HR=0.32, 95% confidence intervals [CI]: 0.14-0.69, p=0.0024). Activating EGFR mutations were predictive for improved treatment outcomes with a first-line intercalated regimen of chemotherapy and erlotinib in NSCLC. ERCC1 status may have some predictive value in EGFR wild-type disease, but requires further investigation. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Mutations in ATRX, encoding a SWI/SNF-like protein, cause diverse changes in the pattern of DNA methylation.

PubMed

Gibbons, R J; McDowell, T L; Raman, S; O'Rourke, D M; Garrick, D; Ayyub, H; Higgs, D R

2000-04-01

A goal of molecular genetics is to understand the relationship between basic nuclear processes, epigenetic changes and the numerous proteins that orchestrate these effects. One such protein, ATRX, contains a highly conserved plant homeodomain (PHD)-like domain, present in many chromatin-associated proteins, and a carboxy-terminal domain which identifies it as a member of the SNF2 family of helicase/ATPases. Mutations in ATRX give rise to characteristic developmental abnormalities including severe mental retardation, facial dysmorphism, urogenital abnormalities and alpha-thalassaemia. This circumstantial evidence suggests that ATRX may act as a transcriptional regulator through an effect on chromatin. We have recently shown that ATRX is localized to pericentromeric heterochromatin during interphase and mitosis, suggesting that ATRX might exert other chromatin-mediated effects in the nucleus. Moreover, at metaphase, some ATRX is localized at or close to the ribosomal DNA (rDNA) arrays on the short arms of human acrocentric chromosomes. Here we show that mutations in ATRX give rise to changes in the pattern of methylation of several highly repeated sequences including the rDNA arrays, a Y-specific satellite and subtelomeric repeats. Our findings provide a potential link between the processes of chromatin remodelling, DNA methylation and gene expression in mammalian development.

Partial isodisomy for maternal chromosome 7 and short stature in an individual with a mutation at the COL1A2 locus.

PubMed

Spotila, L D; Sereda, L; Prockop, D J

1992-12-01

Uniparental disomy for chromosome 7 has been described previously in two individuals with cystic fibrosis. Here, we describe a third case that was discovered because the proband was homozygous for a mutation in the COL1A2 gene for type I procollagen, although his mother was heterozygous and his father did not have the mutation. Phenotypically, the proband was similar to the two previously reported cases with uniparental disomy for chromosome 7, in that he was short in stature and growth retarded. Paternity was assessed with five polymorphic markers. Chromosome 7 inheritance in the proband was analyzed using 12 polymorphic markers distributed along the entire chromosome. Similar analysis of the proband's two brothers established the phase of the alleles at the various loci, assuming minimal recombination. The proband inherited only maternal alleles at five loci and was homozygous at all loci examined, except one. He was heterozygous for an RFLP at the IGBP-1 locus at 7p13-p12. The results suggest that the isodisomy was not complete because of a recombination event involving the proximal short arms of two maternal chromosomes. In addition, the phenotype of proportional dwarfism in the proband suggests imprinting of one or more growth-related genes on chromosome 7.

Personnel occupied woven envelope robot

NASA Technical Reports Server (NTRS)

Wessling, Francis; Teoh, William; Ziemke, M. Carl

1988-01-01

The Personnel Occupied Woven Envelope Robot (POWER) provides an alternative to extravehicular activity (EVA) of space suited astronauts and/or use of long slender manipulator arms such as are used in the Shuttle Remote Manipulator System. POWER provides the capability for a shirt sleeved astronaut to perform such work by entering a control pod through air locks at both ends of an inflated flexible bellows (access tunnel). The exoskeleton of the tunnel is a series of six degrees of freedom (Six-DOF) articulated links compressible to 1/6 of their fully extended length. The operator can maneuver the control pod to almost any location within about 50 m of the base attachment to the space station. POWER can be envisioned as a series of hollow Six-DOF manipulator segments or arms wherein each arm grasps the shoulder of the next arm. Inside the hollow arms ia a bellow-type access tunnel. The control pod is the fist of the series of linked hollow arms. The fingers of the fist are conventional manipulator arms under direct visual control of the nearby operator in the pod. The applications and progress to date of the POWER system is given.

The APPLE Trial: Feasibility and Activity of AZD9291 (Osimertinib) Treatment on Positive PLasma T790M in EGFR-mutant NSCLC Patients. EORTC 1613.

PubMed

Remon, Jordi; Menis, Jessica; Hasan, Baktiar; Peric, Aleksandra; De Maio, Eleonora; Novello, Silvia; Reck, Martin; Berghmans, Thierry; Wasag, Bartosz; Besse, Benjamin; Dziadziuszko, Rafal

2017-09-01

The AZD9291 (Osimertinib) Treatment on Positive PLasma T790M in EGFR-mutant NSCLC Patients (APPLE) trial is a randomized, open-label, multicenter, 3-arm, phase II study in advanced, epidermal growth factor receptor (EGFR)-mutant and EGFR tyrosine kinase inhibitor (TKI)-naive non-small-cell lung cancer (NSCLC) patients, to evaluate the best strategy for sequencing gefitinib and osimertinib treatment. Advanced EGFR-mutant NSCLC patients, with World Health Organization performance status 0-2 who are EGFR TKI treatment-naive and eligible to receive first-line treatment with EGFR TKI will be randomized to: In all arms, a plasmatic ctDNA T790M test will be performed by a central laboratory at the Medical University of Gdansk (Poland) but will be applied as a predictive marker for making treatment decisions only in arm B. The primary objective is to evaluate the best strategy for sequencing of treatment with gefitinib and osimertinib in advanced NSCLC patients with common EGFR mutations, and to understand the value of liquid biopsy for the decision-making process. The progression-free survival rate at 18 months is the primary end point of the trial. The activity of osimertinib versus gefitinib to prevent brain metastases will be evaluated. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Systems and methods for coating conduit interior surfaces utilizing a thermal spray gun with extension arm

DOEpatents

Moore, Karen A.; Zatorski, Raymond A.

2005-07-12

Systems and methods for applying a coating to an interior surface of a conduit. In one embodiment, a spray gun configured to apply a coating is attached to an extension arm which may be inserted into the bore of a pipe. The spray gun may be a thermal spray gun adapted to apply a powder coating. An evacuation system may be used to provide a volume area of reduced air pressure for drawing overspray out of the pipe interior during coating. The extension arm as well as the spray gun may be cooled to maintain a consistent temperature in the system, allowing for more consistent coating.

The ARM Data System and Archive

DOE PAGES

McCord, Raymond A.; Voyles, Jimmy W.

2016-07-05

Every observationally based research program needs a way to collect data from instruments, convert the data from its raw format into a more usable format, apply quality control, process it into higher-order data products, store the data, and make the data available to its scientific community. This data flow is illustrated pictorially in Fig. 11-1. These are the basic requirements of any scientific data system, and ARM’s data system would have to address these requirements and more. This research provides one view of the development of the ARM data system, which includes the ARM Data Archive, and some of themore » notable decisions that were made along the way.« less

Robot arm system for automatic satellite capture and berthing

NASA Technical Reports Server (NTRS)

Nishida, Shinichiro; Toriu, Hidetoshi; Hayashi, Masato; Kubo, Tomoaki; Miyata, Makoto

1994-01-01

Load control is one of the most important technologies for capturing and berthing free flying satellites by a space robot arm because free flying satellites have different motion rates. The performance of active compliance control techniques depend on the location of the force sensor and the arm's structural compliance. A compliance control technique for the robot arm's structural elasticity and a consideration for an end-effector appropriate for it are presented in this paper.

A robot arm simulation with a shared memory multiprocessor machine

NASA Technical Reports Server (NTRS)

Kim, Sung-Soo; Chuang, Li-Ping

1989-01-01

A parallel processing scheme for a single chain robot arm is presented for high speed computation on a shared memory multiprocessor. A recursive formulation that is derived from a virtual work form of the d'Alembert equations of motion is utilized for robot arm dynamics. A joint drive system that consists of a motor rotor and gears is included in the arm dynamics model, in order to take into account gyroscopic effects due to the spinning of the rotor. The fine grain parallelism of mechanical and control subsystem models is exploited, based on independent computation associated with bodies, joint drive systems, and controllers. Efficiency and effectiveness of the parallel scheme are demonstrated through simulations of a telerobotic manipulator arm. Two different mechanical subsystem models, i.e., with and without gyroscopic effects, are compared, to show the trade-off between efficiency and accuracy.

Genetic Screen in Drosophila Larvae Links ird1 Function to Toll Signaling in the Fat Body and Hemocyte Motility

PubMed Central

Schmid, Martin R.; Anderl, Ines; Vo, Hoa T. M.; Valanne, Susanna; Yang, Hairu; Kronhamn, Jesper; Rämet, Mika; Rusten, Tor Erik

2016-01-01

To understand how Toll signaling controls the activation of a cellular immune response in Drosophila blood cells (hemocytes), we carried out a genetic modifier screen, looking for deletions that suppress or enhance the mobilization of sessile hemocytes by the gain-of-function mutation Toll10b (Tl10b). Here we describe the results from chromosome arm 3R, where five regions strongly suppressed this phenotype. We identified the specific genes immune response deficient 1 (ird1), headcase (hdc) and possibly Rab23 as suppressors, and we studied the role of ird1 in more detail. An ird1 null mutant and a mutant that truncates the N-terminal kinase domain of the encoded Ird1 protein affected the Tl10b phenotype, unlike mutations that affect the C-terminal part of the protein. The ird1 null mutant suppressed mobilization of sessile hemocytes, but enhanced other Tl10b hemocyte phenotypes, like the formation of melanotic nodules and the increased number of circulating hemocytes. ird1 mutants also had blood cell phenotypes on their own. They lacked crystal cells and showed aberrant formation of lamellocytes. ird1 mutant plasmatocytes had a reduced ability to spread on an artificial substrate by forming protrusions, which may explain why they did not go into circulation in response to Toll signaling. The effect of the ird1 mutation depended mainly on ird1 expression in hemocytes, but ird1-dependent effects in other tissues may contribute. Specifically, the Toll receptor was translocated from the cell membrane to intracellular vesicles in the fat body of the ird1 mutant, and Toll signaling was activated in that tissue, partially explaining the Tl10b-like phenotype. As ird1 is otherwise known to control vesicular transport, we conclude that the vesicular transport system may be of particular importance during an immune response. PMID:27467079

HbA2 levels in β-thalassaemia carriers with the Filipino β0-deletion: are the levels higher than what is found with non-deletional forms of β0-thalassaemia?

PubMed

George, E; Teh, Lai Kuan; Tan, Jama; Lai, Mei I; Wong, Lily

2013-01-01

Classical carriers of β-thalassaemia are identified by a raised HbA2 level. Earlier studies indicated that the Filipino β-deletion has high raised HbA2 levels. The introduction of automated high performance liquid chromatography (HPLC) for thalassaemia screening is an important advance in technology for haematology laboratories. The BioRad Variant II Hb analyser is a common instrument used to quantify HbA2 levels in thalassaemia screening. This study aimed to determine HbA2 levels in carriers of Filipino β-mutation using the BioRad Variant II Hb analyser. The Filipino β-deletion was identified using gap-polymerase chain reaction (PCR) in the parents of transfusion dependent β-thalassaemia patients who were homozygous for the Filipino β-deletion in the indigenous population of Sabah, Malaysia. Hb subtypes were quantified on the BioRad Variant II Hb analyser. Concurrent α-thalassaemia was identified by multiplex gap-PCR for deletions and amplification refractory mutation system (ARMS)-PCR for non-deletional mutations. The mean HbA2 level for Filipino β-thalassaemia trait was 5.9 ± 0.47 and with coinheritance of α-thalassaemia was 6.3 ± 0.44 (-α heterozygous) and 6.7 ± 0.36 (-α homozygous). The HbA2 levels were all >4% in keeping with the findings of classical β-thalassaemia trait and significantly higher than levels seen in non-deletional forms of β-thalassaemia. The HbA2 level measured on the BioRad Variant II Hb analyser was lower than the level in the first description of the Filipino β-thalassaemia. β-thalassaemia trait with coinheritance of α-thalassaemia (-α) is associated with significantly higher HbA2 level.

Toward attenuating the impact of arm positions on electromyography pattern-recognition based motion classification in transradial amputees

PubMed Central

2012-01-01

Background Electromyography (EMG) pattern-recognition based control strategies for multifunctional myoelectric prosthesis systems have been studied commonly in a controlled laboratory setting. Before these myoelectric prosthesis systems are clinically viable, it will be necessary to assess the effect of some disparities between the ideal laboratory setting and practical use on the control performance. One important obstacle is the impact of arm position variation that causes the changes of EMG pattern when performing identical motions in different arm positions. This study aimed to investigate the impacts of arm position variation on EMG pattern-recognition based motion classification in upper-limb amputees and the solutions for reducing these impacts. Methods With five unilateral transradial (TR) amputees, the EMG signals and tri-axial accelerometer mechanomyography (ACC-MMG) signals were simultaneously collected from both amputated and intact arms when performing six classes of arm and hand movements in each of five arm positions that were considered in the study. The effect of the arm position changes was estimated in terms of motion classification error and compared between amputated and intact arms. Then the performance of three proposed methods in attenuating the impact of arm positions was evaluated. Results With EMG signals, the average intra-position and inter-position classification errors across all five arm positions and five subjects were around 7.3% and 29.9% from amputated arms, respectively, about 1.0% and 10% low in comparison with those from intact arms. While ACC-MMG signals could yield a similar intra-position classification error (9.9%) as EMG, they had much higher inter-position classification error with an average value of 81.1% over the arm positions and the subjects. When the EMG data from all five arm positions were involved in the training set, the average classification error reached a value of around 10.8% for amputated arms. Using a two-stage cascade classifier, the average classification error was around 9.0% over all five arm positions. Reducing ACC-MMG channels from 8 to 2 only increased the average position classification error across all five arm positions from 0.7% to 1.0% in amputated arms. Conclusions The performance of EMG pattern-recognition based method in classifying movements strongly depends on arm positions. This dependency is a little stronger in intact arm than in amputated arm, which suggests that the investigations associated with practical use of a myoelectric prosthesis should use the limb amputees as subjects instead of using able-body subjects. The two-stage cascade classifier mode with ACC-MMG for limb position identification and EMG for limb motion classification may be a promising way to reduce the effect of limb position variation on classification performance. PMID:23036049

Automating arm movement training following severe stroke: functional exercises with quantitative feedback in a gravity-reduced environment.

PubMed

Sanchez, Robert J; Liu, Jiayin; Rao, Sandhya; Shah, Punit; Smith, Robert; Rahman, Tariq; Cramer, Steven C; Bobrow, James E; Reinkensmeyer, David J

2006-09-01

An important goal in rehabilitation engineering is to develop technology that allows individuals with severe motor impairment to practice arm movement without continuous supervision from a rehabilitation therapist. This paper describes the development of such a system, called Therapy WREX or ("T-WREX"). The system consists of an orthosis that assists in arm movement across a large workspace, a grip sensor that detects hand grip pressure, and software that simulates functional activities. The arm orthosis is an instrumented, adult-sized version of the Wilmington Robotic Exoskeleton (WREX), which is a five degrees-of-freedom mechanism that passively counterbalances the weight of the arm using elastic bands. After providing a detailed design description of T-WREX, this paper describes two pilot studies of the system's capabilities. The first study demonstrated that individuals with chronic stroke whose arm function is compromised in a normal gravity environment can perform reaching and drawing movements while using T-WREX. The second study demonstrated that exercising the affected arm of five people with chronic stroke with T-WREX over an eight week period improved unassisted movement ability (mean change in Fugl-Meyer score was 5 points +/- 2 SD; mean change in range of motion of reaching was 10%, p < 0.001). These results demonstrate the feasibility of automating upper-extremity rehabilitation therapy for people with severe stroke using passive gravity assistance, a grip sensor, and simple virtual reality software.

Modified Denavit-Hartenberg parameters for better location of joint axis systems in robot arms

NASA Technical Reports Server (NTRS)

Barker, L. K.

1986-01-01

The Denavit-Hartenberg parameters define the relative location of successive joint axis systems in a robot arm. A recent justifiable criticism is that one of these parameters becomes extremely large when two successive joints have near-parallel rotational axes. Geometrically, this parameter then locates a joint axis system at an excessive distance from the robot arm and, computationally, leads to an ill-conditioned transformation matrix. In this paper, a simple modification (which results from constraining a transverse vector between successive joint rotational axes to be normal to one of the rotational axes, instead of both) overcomes this criticism and favorably locates the joint axis system. An example is given for near-parallel rotational axes of the elbow and shoulder joints in a robot arm. The regular and modified parameters are extracted by an algebraic method with simulated measurement data. Unlike the modified parameters, extracted values of the regular parameters are very sensitive to measurement accuracy.

KSC-04pd1672

NASA Image and Video Library

2004-08-23

KENNEDY SPACE CENTER, FLA. - The Remote Manipulator System (RMS), also known as the Canadian robotic arm, for the orbiter Discovery has arrived at KSC’s Vehicle Assembly Building Lab. Seen on the left end is the shoulder pitch joint. The wrist and shoulder joints on the RMS allow the basic structure of the arm to maneuver similar to a human arm. The RMS is used to deploy and retrieve payloads, provide a mobile extension ladder or foot restraints for crew members during extravehicular activities; and to aid the flight crew members in viewing surfaces of the orbiter or payloads through a television camera on the RMS. The arm is also serving as the base for the new Orbiter Boom Sensor System (OBSS), one of the safety measures for Return to Flight, equipping the Shuttle with cameras and laser systems to inspect the Shuttle’s Thermal Protection System while in space. Discovery is scheduled for a launch planning window of March 2005 on mission STS-114.

The effects of additional arm weights on arm-swing magnitude and gait patterns in Parkinson's disease.

PubMed

Yoon, Jiyeon; Park, Jinse; Park, Kunbo; Jo, Geunyeol; Kim, Haeyu; Jang, Wooyoung; Kim, Ji Sun; Youn, Jinyoung; Oh, Eung Seok; Kim, Hee-Tae; Youm, Chang Hong

2016-01-01

Recently, arm facilitation has been interested in gait rehabilitation. However, there have been few studies concerning arm facilitation in patients with Parkinson's disease (PD). The aim of our study was to investigate the effect of increasing arm weights on gait pattern in patients with PD. Twenty-seven patients with PD were enrolled, and they underwent gait analysis using a three-dimensional motion capture system. Sandbags were applied to the distal forearms in all participants. We compared gait parameters including arm swing, pelvic motion, spatiotemporal data, and relative rotational angle between the weighted and unweighted gaits. The total arm-swing amplitude and pelvic rotation were significantly higher when walking with additional arm weights than without arm weights. Cadence, walking speed, stride length, and swing phase were significantly higher, whereas stride time, double-support time, and stance phase were significantly lower, when walking with additional arm weights than without arm weights. We conclude that adding weights to the arm during walking may facilitate arm and pelvic movements, which results in changes to gait patterns. The therapeutic use of additional arm weights could be considered for gait rehabilitation in PD to improve gait impairment. Arm-swing facilitation using weight load improved gait in Parkinson's disease. Copyright © 2015 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.