Adult women with mitral valve prolapse are more flexible

PubMed Central

Araujo, C; Chaves, C

2005-01-01

Background: Mitral valve prolapse (MVP) is common in women. Other clinical features such as flexibility and hyperlaxity are often associated with MVP, as there is a common biochemical and histological basis for collagen tissue characteristics, range of joint motion, and mitral leaflet excursion. Objective: To confirm whether adult women with MVP are more flexible and hypermobile than those without. Methods: Data from 125 women (mean age 50 years), 31 of them with MVP, were retrospectively analysed with regard to clinical and kinanthropometric aspects. Passive joint motion was evaluated in 20 body movements using Flexitest and three laxity tests. Flexitest individual movements (0 to 4) and overall Flexindex scores were obtained in all subjects by the same investigator. Results: Women with MVP were lighter, less endomorphic and mesomorphic, and more linear. The Flexindex was significantly higher in the women with MVP, both absolute (48 (1.6) v 41 (1.3); p<0.01) and centile for age (67 v 42; p<0.01) values. In 13 out of 20 movements, the Flexitest scores were significantly higher for the women with MVP. Signs of hyperlaxity were about five times more common in these women: 74% v 16% (p<0.01). Scores of 0 and 1 in elbow extension, absence of hyperlaxity, and a Flexindex centile below 65 were almost never found in women with MVP. Conclusion: Flexitest, alone or combined with hyperlaxity tests, may be useful in the assessment of adult women with MVP. PMID:16183767

Multiscale virtual particle based elastic network model (MVP-ENM) for normal mode analysis of large-sized biomolecules.

PubMed

Xia, Kelin

2017-12-20

In this paper, a multiscale virtual particle based elastic network model (MVP-ENM) is proposed for the normal mode analysis of large-sized biomolecules. The multiscale virtual particle (MVP) model is proposed for the discretization of biomolecular density data. With this model, large-sized biomolecular structures can be coarse-grained into virtual particles such that a balance between model accuracy and computational cost can be achieved. An elastic network is constructed by assuming "connections" between virtual particles. The connection is described by a special harmonic potential function, which considers the influence from both the mass distributions and distance relations of the virtual particles. Two independent models, i.e., the multiscale virtual particle based Gaussian network model (MVP-GNM) and the multiscale virtual particle based anisotropic network model (MVP-ANM), are proposed. It has been found that in the Debye-Waller factor (B-factor) prediction, the results from our MVP-GNM with a high resolution are as good as the ones from GNM. Even with low resolutions, our MVP-GNM can still capture the global behavior of the B-factor very well with mismatches predominantly from the regions with large B-factor values. Further, it has been demonstrated that the low-frequency eigenmodes from our MVP-ANM are highly consistent with the ones from ANM even with very low resolutions and a coarse grid. Finally, the great advantage of MVP-ANM model for large-sized biomolecules has been demonstrated by using two poliovirus virus structures. The paper ends with a conclusion.

Mitral valve prolapse: an underestimated cause of sudden cardiac death—a current review of the literature

PubMed Central

Tzatzaki, Eleni; Spartalis, Eleftherios; Athanasiou, Antonios; Moris, Demetrios; Damaskos, Christos; Garmpis, Nikolaos; Voudris, Vassilis

2017-01-01

Mitral valve prolapse (MVP) is a common valve abnormality in general population. Despite the general belief of a benign disorder, several articles since the 1980s report sudden cardiac death (SCD) in MVP patients, with a substantial percentage of asymptomatic young individuals. The problem is to detect those patients at increased risk and implement methods that are suitable to prevent cardiac arrest. This review investigates the correlation between MVP and SCD, the understanding of the pathophysiology, the strategies for detecting those at risk and treatment options. A complete literature survey was performed using PubMed database search to gather available information regarding MVP and SCD. A total of 33 studies met selection criteria for inclusion in the review. MVP is an underrated cause of arrhythmic SCD. The subset of patients with malignant MVP who may be at greater risk for SCD is characterized by young women with bileaflet MVP, biphasic or inverted T waves in the inferior leads, and frequent complex ventricular ectopic activity with documented ventricular bigeminy or ventricular tachycardia (VT) and premature ventricular contractions (PVCs) configurations of outflow tract alternating with fascicular origin or papillary muscle. MVP is a common condition in the general population and is often encountered in asymptomatic individuals. The existing literature continues to generate significant controversy regarding the association of MVP with ventricular arrhythmias and SCD. Early echocardiography and cardiac magnetic resonance (CMR) are essential, as is a greater understanding of the potential electrophysiological processes of primary arrhythmogenesis and the evaluation of the genetic substrate. PMID:29312750

Mitral valve prolapse: an underestimated cause of sudden cardiac death-a current review of the literature.

PubMed

Spartalis, Michael; Tzatzaki, Eleni; Spartalis, Eleftherios; Athanasiou, Antonios; Moris, Demetrios; Damaskos, Christos; Garmpis, Nikolaos; Voudris, Vassilis

2017-12-01

Mitral valve prolapse (MVP) is a common valve abnormality in general population. Despite the general belief of a benign disorder, several articles since the 1980s report sudden cardiac death (SCD) in MVP patients, with a substantial percentage of asymptomatic young individuals. The problem is to detect those patients at increased risk and implement methods that are suitable to prevent cardiac arrest. This review investigates the correlation between MVP and SCD, the understanding of the pathophysiology, the strategies for detecting those at risk and treatment options. A complete literature survey was performed using PubMed database search to gather available information regarding MVP and SCD. A total of 33 studies met selection criteria for inclusion in the review. MVP is an underrated cause of arrhythmic SCD. The subset of patients with malignant MVP who may be at greater risk for SCD is characterized by young women with bileaflet MVP, biphasic or inverted T waves in the inferior leads, and frequent complex ventricular ectopic activity with documented ventricular bigeminy or ventricular tachycardia (VT) and premature ventricular contractions (PVCs) configurations of outflow tract alternating with fascicular origin or papillary muscle. MVP is a common condition in the general population and is often encountered in asymptomatic individuals. The existing literature continues to generate significant controversy regarding the association of MVP with ventricular arrhythmias and SCD. Early echocardiography and cardiac magnetic resonance (CMR) are essential, as is a greater understanding of the potential electrophysiological processes of primary arrhythmogenesis and the evaluation of the genetic substrate.

Increased frequency of mitral valve prolapse in patients with deviated nasal septum.

PubMed

Arslan, Hasan Huseyin; Aparci, Mustafa; Arslan, Zekeriya; Ozturk, Cengiz; Isilak, Zafer; Balta, Sevket; Celik, Turgay; Iyisoy, Atila

2015-07-01

Any abnormality of collagen may affect the tissues with higher collagen content, e.g., joints, heart valves, and great arteries. Mitral valve prolapse (MVP) is a characteristic of generalized collagen abnormality. Nasal septum (NS) is constituted by osseous and cartilaginous septums that are highly rich in collagen. We evaluated the co-existence of deviation of NS (DNS) in patients with MVP. We retrospectively evaluated the recordings of echocardiographic and nasal examinations of subjects with MVP and DNS. We analyzed the features of MVP and anatomical classification of DNS among subjects. Totally, 74 patients with DNS and 38 subjects with normal nasal passage were enrolled to the study. Presence of MVP was significantly higher in patients with DNS compared to normal subjects (63 vs 26%, p < 0.001). Prolapse of anterior, posterior and both leaflets was higher in patients with DNS. Thickness of anterior mitral leaflet was significantly increased in patients with DNS (3.57 ± 0.68 vs 4.59 ± 1.1 mm, p < 0.001) compared to normal subjects. Type I, II, and III, IV DNS were higher in frequency in patients with MVP while type V and VI were higher in normal subjects. DNS is highly co-existent with MVP and increased thickness of mitral anterior leaflet. Generalized abnormality of collagen which is the main component of mitral valves and nasal septum may be accounted for co-existence of MVP and DNS. Also co-existence of them may exaggerate the symptoms of patients with MVP due to limited airflow through the nasal passage.

A Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM) for the Surface of Mars: An Instrument for the Planetary Science Community

NASA Technical Reports Server (NTRS)

Edmunson, J.; Gaskin, J. A.; Danilatos, G.; Doloboff, I. J.; Effinger, M. R.; Harvey, R. P.; Jerman, G. A.; Klein-Schoder, R.; Mackie, W.; Magera, B.;

mvp - an open-source preprocessor for cleaning duplicate records and missing values in mass spectrometry data.

PubMed

Lee, Geunho; Lee, Hyun Beom; Jung, Byung Hwa; Nam, Hojung

2017-07-01

Mass spectrometry (MS) data are used to analyze biological phenomena based on chemical species. However, these data often contain unexpected duplicate records and missing values due to technical or biological factors. These 'dirty data' problems increase the difficulty of performing MS analyses because they lead to performance degradation when statistical or machine-learning tests are applied to the data. Thus, we have developed missing values preprocessor (mvp), an open-source software for preprocessing data that might include duplicate records and missing values. mvp uses the property of MS data in which identical chemical species present the same or similar values for key identifiers, such as the mass-to-charge ratio and intensity signal, and forms cliques via graph theory to process dirty data. We evaluated the validity of the mvp process via quantitative and qualitative analyses and compared the results from a statistical test that analyzed the original and mvp-applied data. This analysis showed that using mvp reduces problems associated with duplicate records and missing values. We also examined the effects of using unprocessed data in statistical tests and examined the improved statistical test results obtained with data preprocessed using mvp.

The social justice roots of the Mentors in Violence Prevention model and its application in a high school setting.

PubMed

Katz, Jackson; Heisterkamp, H Alan; Fleming, Wm Michael

2011-06-01

The social justice roots and theory of the Mentors in Violence Prevention (MVP) model is presented, followed by an empirical study examining the influence of MVP in high school settings. Findings reveal students exposed to the MVP model are more likely to see forms of violence as being wrong and are more likely to take actions to intervene than students not exposed to the program. Findings support the premises on which MVP is founded.

Cospectral budget of turbulence explains the bulk properties of smooth pipe flow.

PubMed

Katul, Gabriel G; Manes, Costantino

2014-12-01

Connections between the wall-normal turbulent velocity spectrum E(ww)(k) at wave number k and the mean velocity profile (MVP) are explored in pressure-driven flows confined within smooth walls at moderate to high bulk Reynolds numbers (Re). These connections are derived via a cospectral budget for the longitudinal (u') and wall-normal (w') velocity fluctuations, which include a production term due to mean shear interacting with E(ww)(k), viscous effects, and a decorrelation between u' and w' by pressure-strain effects [=π(k)]. The π(k) is modeled using a conventional Rotta-like return-to-isotropy closure but adjusted to include the effects of isotropization of the production term. The resulting cospectral budget yields a generalization of a previously proposed "spectral link" between the MVP and the spectrum of turbulence. The proposed cospectral budget is also shown to reproduce the measured MVP across the pipe with changing Re including the MVP shapes in the buffer and wake regions. Because of the links between E(ww)(k) and the MVP, the effects of intermittency corrections to inertial subrange scales and the so-called spectral bottleneck reported as k approaches viscous dissipation eddy sizes (η) on the MVP shapes are investigated and shown to be of minor importance. Inclusion of a local Reynolds number correction to a parameter associated with the spectral exponential cutoff as kη→1 appears to be more significant to the MVP shape in the buffer region. While the bulk shape of the MVP is reasonably reproduced in all regions of the pipe, the solution to the cospectral budget systematically underestimates the negative curvature of the MVP within the buffer layer.

Detection of lipid-induced structural changes of the Marburg virus matrix protein VP40 using hydrogen/deuterium exchange-mass spectrometry

PubMed Central

Wijesinghe, Kaveesha J.; Urata, Sarah; Bhattarai, Nisha; Kooijman, Edgar E.; Gerstman, Bernard S.; Chapagain, Prem P.; Li, Sheng; Stahelin, Robert V.

2017-01-01

Marburg virus (MARV) is a lipid-enveloped virus from the Filoviridae family containing a negative sense RNA genome. One of the seven MARV genes encodes the matrix protein VP40, which forms a matrix layer beneath the plasma membrane inner leaflet to facilitate budding from the host cell. MARV VP40 (mVP40) has been shown to be a dimeric peripheral protein with a broad and flat basic surface that can associate with anionic phospholipids such as phosphatidylserine. Although a number of mVP40 cationic residues have been shown to facilitate binding to membranes containing anionic lipids, much less is known on how mVP40 assembles to form the matrix layer following membrane binding. Here we have used hydrogen/deuterium exchange (HDX) mass spectrometry to determine the solvent accessibility of mVP40 residues in the absence and presence of phosphatidylserine and phosphatidylinositol 4,5-bisphosphate. HDX analysis demonstrates that two basic loops in the mVP40 C-terminal domain make important contributions to anionic membrane binding and also reveals a potential oligomerization interface in the C-terminal domain as well as a conserved oligomerization interface in the mVP40 N-terminal domain. Lipid binding assays confirm the role of the two basic patches elucidated with HD/X measurements, whereas molecular dynamics simulations and membrane insertion measurements complement these studies to demonstrate that mVP40 does not appreciably insert into the hydrocarbon region of anionic membranes in contrast to the matrix protein from Ebola virus. Taken together, we propose a model by which association of the mVP40 dimer with the anionic plasma membrane facilitates assembly of mVP40 oligomers. PMID:28167534

Detection of lipid-induced structural changes of the Marburg virus matrix protein VP40 using hydrogen/deuterium exchange-mass spectrometry.

PubMed

Wijesinghe, Kaveesha J; Urata, Sarah; Bhattarai, Nisha; Kooijman, Edgar E; Gerstman, Bernard S; Chapagain, Prem P; Li, Sheng; Stahelin, Robert V

2017-04-14

Marburg virus (MARV) is a lipid-enveloped virus from the Filoviridae family containing a negative sense RNA genome. One of the seven MARV genes encodes the matrix protein VP40, which forms a matrix layer beneath the plasma membrane inner leaflet to facilitate budding from the host cell. MARV VP40 (mVP40) has been shown to be a dimeric peripheral protein with a broad and flat basic surface that can associate with anionic phospholipids such as phosphatidylserine. Although a number of mVP40 cationic residues have been shown to facilitate binding to membranes containing anionic lipids, much less is known on how mVP40 assembles to form the matrix layer following membrane binding. Here we have used hydrogen/deuterium exchange (HDX) mass spectrometry to determine the solvent accessibility of mVP40 residues in the absence and presence of phosphatidylserine and phosphatidylinositol 4,5-bisphosphate. HDX analysis demonstrates that two basic loops in the mVP40 C-terminal domain make important contributions to anionic membrane binding and also reveals a potential oligomerization interface in the C-terminal domain as well as a conserved oligomerization interface in the mVP40 N-terminal domain. Lipid binding assays confirm the role of the two basic patches elucidated with HD/X measurements, whereas molecular dynamics simulations and membrane insertion measurements complement these studies to demonstrate that mVP40 does not appreciably insert into the hydrocarbon region of anionic membranes in contrast to the matrix protein from Ebola virus. Taken together, we propose a model by which association of the mVP40 dimer with the anionic plasma membrane facilitates assembly of mVP40 oligomers. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Mitral valve prolapse associated with celiac artery stenosis: a new ultrasonographic syndrome?

PubMed Central

Arcari, Luciano

2004-01-01

Background Celiac artery stenosis (CAS) may be caused by atherosclerotic degeneration or compression exerted by the arched ligament of the diaphragm. Mitral valve prolapse (MVP) is the most common valvular disorder. There are no reports on an association between CAS and MVP. Methods 1560 (41%) out of 3780 consecutive patients undergoing echocardiographic assessment of MVP, had Doppler sonography of the celiac tract to detect CAS. Results CAS was found in 57 (3.7%) subjects (23 males and 34 females) none of whom complained of symptoms related to visceral ischemia. MVP was observed in 47 (82.4%) subjects with and 118 (7.9%) without CAS (p < 0.001). The agreement between MVP and CAS was 39% (95% CI 32–49%). PSV (Peak Systolic Velocity) was the only predictor of CAS in MPV patients (OR 0.24, 95% CI 0.08–0.69) as selected in a multivariate logistic model. Conclusion CAS and MVP seem to be significantly associated in patients undergoing consecutive ultrasonographic screening. PMID:15588321

Conceptual Designing of a Reduced Moderation Pressurized Water Reactor by Use of MVP and MVP-BURN

NASA Astrophysics Data System (ADS)

Kugo, T.

A conceptual design of a seed-blanket assembly PWR core with a complicated geometry and a strong heterogeneity has been carried forward by use of the continuous-energy Monte Carlo method. Through parametric survey calculations by repeated use of MVP and a lattice burn-up calculation by MVP-BURN, a seed-blanket assembly configuration suitable for a concept of RMWR has been established, by evaluating precisely reactivity, a conversion ratio and a coolant void reactivity coefficient in a realistic computation time on a super computer.

CoSMoMVPA: Multi-Modal Multivariate Pattern Analysis of Neuroimaging Data in Matlab/GNU Octave.

PubMed

Oosterhof, Nikolaas N; Connolly, Andrew C; Haxby, James V

2016-01-01

Recent years have seen an increase in the popularity of multivariate pattern (MVP) analysis of functional magnetic resonance (fMRI) data, and, to a much lesser extent, magneto- and electro-encephalography (M/EEG) data. We present CoSMoMVPA, a lightweight MVPA (MVP analysis) toolbox implemented in the intersection of the Matlab and GNU Octave languages, that treats both fMRI and M/EEG data as first-class citizens. CoSMoMVPA supports all state-of-the-art MVP analysis techniques, including searchlight analyses, classification, correlations, representational similarity analysis, and the time generalization method. These can be used to address both data-driven and hypothesis-driven questions about neural organization and representations, both within and across: space, time, frequency bands, neuroimaging modalities, individuals, and species. It uses a uniform data representation of fMRI data in the volume or on the surface, and of M/EEG data at the sensor and source level. Through various external toolboxes, it directly supports reading and writing a variety of fMRI and M/EEG neuroimaging formats, and, where applicable, can convert between them. As a result, it can be integrated readily in existing pipelines and used with existing preprocessed datasets. CoSMoMVPA overloads the traditional volumetric searchlight concept to support neighborhoods for M/EEG and surface-based fMRI data, which supports localization of multivariate effects of interest across space, time, and frequency dimensions. CoSMoMVPA also provides a generalized approach to multiple comparison correction across these dimensions using Threshold-Free Cluster Enhancement with state-of-the-art clustering and permutation techniques. CoSMoMVPA is highly modular and uses abstractions to provide a uniform interface for a variety of MVP measures. Typical analyses require a few lines of code, making it accessible to beginner users. At the same time, expert programmers can easily extend its functionality. CoSMoMVPA comes with extensive documentation, including a variety of runnable demonstration scripts and analysis exercises (with example data and solutions). It uses best software engineering practices including version control, distributed development, an automated test suite, and continuous integration testing. It can be used with the proprietary Matlab and the free GNU Octave software, and it complies with open source distribution platforms such as NeuroDebian. CoSMoMVPA is Free/Open Source Software under the permissive MIT license. Website: http://cosmomvpa.org Source code: https://github.com/CoSMoMVPA/CoSMoMVPA.

CoSMoMVPA: Multi-Modal Multivariate Pattern Analysis of Neuroimaging Data in Matlab/GNU Octave

PubMed Central

Oosterhof, Nikolaas N.; Connolly, Andrew C.; Haxby, James V.

2016-01-01

Recent years have seen an increase in the popularity of multivariate pattern (MVP) analysis of functional magnetic resonance (fMRI) data, and, to a much lesser extent, magneto- and electro-encephalography (M/EEG) data. We present CoSMoMVPA, a lightweight MVPA (MVP analysis) toolbox implemented in the intersection of the Matlab and GNU Octave languages, that treats both fMRI and M/EEG data as first-class citizens. CoSMoMVPA supports all state-of-the-art MVP analysis techniques, including searchlight analyses, classification, correlations, representational similarity analysis, and the time generalization method. These can be used to address both data-driven and hypothesis-driven questions about neural organization and representations, both within and across: space, time, frequency bands, neuroimaging modalities, individuals, and species. It uses a uniform data representation of fMRI data in the volume or on the surface, and of M/EEG data at the sensor and source level. Through various external toolboxes, it directly supports reading and writing a variety of fMRI and M/EEG neuroimaging formats, and, where applicable, can convert between them. As a result, it can be integrated readily in existing pipelines and used with existing preprocessed datasets. CoSMoMVPA overloads the traditional volumetric searchlight concept to support neighborhoods for M/EEG and surface-based fMRI data, which supports localization of multivariate effects of interest across space, time, and frequency dimensions. CoSMoMVPA also provides a generalized approach to multiple comparison correction across these dimensions using Threshold-Free Cluster Enhancement with state-of-the-art clustering and permutation techniques. CoSMoMVPA is highly modular and uses abstractions to provide a uniform interface for a variety of MVP measures. Typical analyses require a few lines of code, making it accessible to beginner users. At the same time, expert programmers can easily extend its functionality. CoSMoMVPA comes with extensive documentation, including a variety of runnable demonstration scripts and analysis exercises (with example data and solutions). It uses best software engineering practices including version control, distributed development, an automated test suite, and continuous integration testing. It can be used with the proprietary Matlab and the free GNU Octave software, and it complies with open source distribution platforms such as NeuroDebian. CoSMoMVPA is Free/Open Source Software under the permissive MIT license. Website: http://cosmomvpa.org Source code: https://github.com/CoSMoMVPA/CoSMoMVPA PMID:27499741

Prevalence and Predictive Value of Microvascular Flow Abnormalities after Successful Contemporary Percutaneous Coronary Intervention in Acute ST-Segment Elevation Myocardial Infarction.

PubMed

Aggarwal, Sourabh; Xie, Feng; High, Robin; Pavlides, Gregory; Porter, Thomas R

2018-06-01

Although microvascular flow abnormalities have been observed following epicardial recanalization in acute ST-segment elevation myocardial infarction (STEMI), the prevalence and severity of these abnormalities in the current era of rapid percutaneous coronary intervention (PCI) has not been evaluated. The objective of this study was to assess microvascular perfusion (MVP) following successful primary PCI in patients with STEMI and how it affects clinical outcome. In this single-center, retrospective study, 170 patients who successfully underwent emergent PCI for STEMI were assessed using real-time myocardial contrast echocardiography using a continuous infusion of intravenous commercial microbubbles (3% Definity). Three patterns of myocardial contrast replenishment were observed following intermittent high-mechanical index impulses: infarct zone replenishment within 4 sec (normal MVP), delays in contrast replenishment but normal plateau intensity (delayed MVP [dMVP]), and both delays in replenishment and reduced plateau intensity (microvascular obstruction [MVO]). Changes in left ventricular ejection fraction at 6 months and clinical event rate at 12 months (death, recurrent infarction, need for defibrillator placement, or heart failure admission) were compared. Normal MVP was seen in 62 patients (36%), dMVP in 49 (29%), and MVO in 59 (35%). Left anterior descending coronary artery infarct location was the only parameter independently associated with dMVP or MVO, independent of age, cardiac risk factors, door-to-dilation time, pre-PCI Thrombolysis In Myocardial Infarction flow grade, and thrombus burden. A dMVP pattern had a similar reduction in left ventricular ejection fraction as MVO at hospital discharge but had recovery of left ventricular ejection fraction at 6 months and a greater than fourfold lower event rate than the MVO group (P < .001). MVO and dMVP are frequently seen following contemporary successful PCI for STEMI, especially following left anterior descending coronary artery infarction. Despite a similar area at risk, a dMVP pattern has better functional recovery and clinical outcome than MVO. Copyright © 2018 American Society of Echocardiography. Published by Elsevier Inc. All rights reserved.

Aversive Learning and Appetitive Motivation Toggle Feed-Forward Inhibition in the Drosophila Mushroom Body.

PubMed

Perisse, Emmanuel; Owald, David; Barnstedt, Oliver; Talbot, Clifford B; Huetteroth, Wolf; Waddell, Scott

2016-06-01

In Drosophila, negatively reinforcing dopaminergic neurons also provide the inhibitory control of satiety over appetitive memory expression. Here we show that aversive learning causes a persistent depression of the conditioned odor drive to two downstream feed-forward inhibitory GABAergic interneurons of the mushroom body, called MVP2, or mushroom body output neuron (MBON)-γ1pedc>α/β. However, MVP2 neuron output is only essential for expression of short-term aversive memory. Stimulating MVP2 neurons preferentially inhibits the odor-evoked activity of avoidance-directing MBONs and odor-driven avoidance behavior, whereas their inhibition enhances odor avoidance. In contrast, odor-evoked activity of MVP2 neurons is elevated in hungry flies, and their feed-forward inhibition is required for expression of appetitive memory at all times. Moreover, imposing MVP2 activity promotes inappropriate appetitive memory expression in food-satiated flies. Aversive learning and appetitive motivation therefore toggle alternate modes of a common feed-forward inhibitory MVP2 pathway to promote conditioned odor avoidance or approach. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Investigation of the Lipid Binding Properties of the Marburg Virus Matrix Protein VP40.

PubMed

Wijesinghe, Kaveesha J; Stahelin, Robert V

2015-12-30

Marburg virus (MARV), which belongs to the virus family Filoviridae, causes hemorrhagic fever in humans and nonhuman primates that is often fatal. MARV is a lipid-enveloped virus that during the replication process extracts its lipid coat from the plasma membrane of the host cell it infects. MARV carries seven genes, one of which encodes its matrix protein VP40 (mVP40), which regulates the assembly and budding of the virions. Currently, little information is available on mVP40 lipid binding properties. Here, we have investigated the in vitro and cellular mechanisms by which mVP40 associates with lipid membranes. mVP40 associates with anionic membranes in a nonspecific manner that is dependent upon the anionic charge density of the membrane. These results are consistent with recent structural determination of mVP40, which elucidated an mVP40 dimer with a flat and extensive cationic lipid binding interface. Marburg virus (MARV) is a lipid-enveloped filamentous virus from the family Filoviridae. MARV was discovered in 1967, and yet little is known about how its seven genes are used to assemble and form a new viral particle in the host cell it infects. The MARV matrix protein VP40 (mVP40) underlies the inner leaflet of the virus and regulates budding from the host cell plasma membrane. In vitro and cellular assays in this study investigated the mechanism by which mVP40 associates with lipids. The results demonstrate that mVP40 interactions with lipid vesicles or the inner leaflet of the plasma membrane are electrostatic but nonspecific in nature and are dependent on the anionic charge density of the membrane surface. Small molecules that can disrupt lipid trafficking or reduce the anionic charge of the plasma membrane interface may be useful in inhibiting assembly and budding of MARV. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

The MVP Model: Overview and Application

ERIC Educational Resources Information Center

Keller, John M.

2017-01-01

This chapter contains an overview of the MVP model that is used as a basis for the other chapters in this issue. It also contains a description of key steps in the ARCS-V design process that is derived from the MVP model and a summary of a design-based research study illustrating the application of the ARCS-V model.

Dimerization Controls Marburg Virus VP24-dependent Modulation of Host Antioxidative Stress Responses.

PubMed

Johnson, Britney; Li, Jing; Adhikari, Jagat; Edwards, Megan R; Zhang, Hao; Schwarz, Toni; Leung, Daisy W; Basler, Christopher F; Gross, Michael L; Amarasinghe, Gaya K

2016-08-28

Marburg virus (MARV), a member of the Filoviridae family that also includes Ebola virus (EBOV), causes lethal hemorrhagic fever with case fatality rates that have exceeded 50% in some outbreaks. Within an infected cell, there are numerous host-viral interactions that contribute to the outcome of infection. Recent studies identified MARV protein 24 (mVP24) as a modulator of the host antioxidative responses, but the molecular mechanism remains unclear. Using a combination of biochemical and mass spectrometry studies, we show that mVP24 is a dimer in solution that directly binds to the Kelch domain of Kelch-like ECH-associated protein 1 (Keap1) to regulate nuclear factor (erythroid-derived 2)-like 2 (Nrf2). This interaction between Keap1 and mVP24 occurs through the Kelch interaction loop (K-Loop) of mVP24 leading to upregulation of antioxidant response element transcription, which is distinct from other Kelch binders that regulate Nrf2 activity. N-terminal truncations disrupt mVP24 dimerization, allowing monomeric mVP24 to bind Kelch with higher affinity and stimulate higher antioxidative stress response element (ARE) reporter activity. Mass spectrometry-based mapping of the interface revealed overlapping binding sites on Kelch for mVP24 and the Nrf2 proteins. Substitution of conserved cysteines, C209 and C210, to alanine in the mVP24 K-Loop abrogates Kelch binding and ARE activation. Our studies identify a shift in the monomer-dimer equilibrium of MARV VP24, driven by its interaction with Keap1 Kelch domain, as a critical determinant that modulates host responses to pathogenic Marburg viral infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

Dimerization Controls Marburg Virus VP24-dependent Modulation of Host Antioxidative Stress Responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Britney; Li, Jing; Adhikari, Jagat

Marburg virus (MARV), a member of the Filoviridae family that also includes Ebola virus (EBOV), causes lethal hemorrhagic fever with case fatality rates that have exceeded 50% in some outbreaks. Within an infected cell, there are numerous host-viral interactions that contribute to the outcome of infection. Recent studies identified MARV protein 24 (mVP24) as a modulator of the host antioxidative responses, but the molecular mechanism remains unclear. Using a combination of biochemical and mass spectrometry studies, we show that mVP24 is a dimer in solution that directly binds to the Kelch domain of Kelch-like ECH-associated protein 1 (Keap1) to regulatemore » nuclear factor (erythroid-derived 2)-like 2 (Nrf2). This interaction between Keap1 and mVP24 occurs through the Kelch interaction loop (K-Loop) of mVP24 leading to upregulation of antioxidant response element transcription, which is distinct from other Kelch binders that regulate Nrf2 activity. N-terminal truncations disrupt mVP24 dimerization, allowing monomeric mVP24 to bind Kelch with higher affinity and stimulate higher antioxidative stress response element (ARE) reporter activity. Mass spectrometry-based mapping of the interface revealed overlapping binding sites on Kelch for mVP24 and the Nrf2 proteins. Substitution of conserved cysteines, C209 and C210, to alanine in the mVP24 K-Loop abrogates Kelch binding and ARE activation. Our studies identify a shift in the monomer-dimer equilibrium of MARV VP24, driven by its interaction with Keap1 Kelch domain, as a critical determinant that modulates host responses to pathogenic Marburg viral infections.« less

Detection of mitral valve abnormalities by carotid Doppler flow study: implications for the management of patients with cerebrovascular disease.

PubMed

Weinberger, J; Goldman, M

1985-01-01

Patients with symptoms of cerebral ischemia are often evaluated with non-invasive carotid artery testing. An abnormal carotid Doppler ultrasound frequency shift pattern of early systolic flutter (ESF) was demonstrated by auscultation and velocity wave form analysis in patients with normal carotid bifurcations. Ten of these patients were studied with echocardiography (echo) and eight had mitral valve prolapse (MVP). To evaluate the association between ESF and MVP, a prospective blinded study was performed, recording carotid Doppler frequency shift in 50 patients referred for routine echocardiography. A total of 18 patients had ESF: 9/12 patients with MVP by echocardiography had ESF. Nine additional patients without MVP had ESF (two with mitral regurgitation and two with redundant mitral valves). The association of ESF with MVP was significant (p less than 0.001). The findings of ESF with a normal carotid artery by non-invasive testing suggests a possible mitral valve origin for symptoms of cerebrovascular disease.

Atrial antitachycardia pacing and managed ventricular pacing in bradycardia patients with paroxysmal or persistent atrial tachyarrhythmias: the MINERVA randomized multicentre international trial.

PubMed

Boriani, Giuseppe; Tukkie, Raymond; Manolis, Antonis S; Mont, Lluis; Pürerfellner, Helmut; Santini, Massimo; Inama, Giuseppe; Serra, Paolo; de Sousa, João; Botto, Giovanni Luca; Mangoni, Lorenza; Grammatico, Andrea; Padeletti, Luigi

2014-09-14

Atrial fibrillation (AF) is a common comorbidity in bradycardia patients. Advanced pacemakers feature atrial preventive pacing and atrial antitachycardia pacing (DDDRP) and managed ventricular pacing (MVP), which minimizes unnecessary right ventricular pacing. We evaluated whether DDDRP and MVP might reduce mortality, morbidity, or progression to permanent AF when compared with standard dual-chamber pacing (Control DDDR). In a randomized, parallel, single-blind, multi-centre trial we enrolled 1300 patients with bradycardia and previous atrial tachyarrhythmias, in whom a DDDRP pacemaker had recently been implanted. History of permanent AF and third-degree atrioventricular block were exclusion criteria. After a 1-month run-in period, 1166 eligible patients, aged 74 ± 9 years, 50% females, were randomized to Control DDDR, DDDRP + MVP, or MVP. Analysis was intention-to-treat. The primary outcome, i.e. the 2-year incidence of a combined endpoint composed of death, cardiovascular hospitalizations, or permanent AF, occurred in 102/385 (26.5%) Control DDDR patients, in 76/383 (19.8%) DDDRP + MVP patients [hazard ratio (HR) = 0.74, 95% confidence interval 0.55-0.99, P = 0.04 vs. Control DDDR] and in 85/398 (21.4%) MVP patients (HR = 0.89, 95% confidence interval 0.77-1.03, P = 0.125 vs. Control DDDR). When compared with Control DDDR, DDDRP + MVP reduced the risk for AF longer than 1 day (HR = 0.66, 95% CI 0.52-0.85, P < 0.001), AF longer than 7 days (HR = 0.52, 95% CI 0.36-0.73, P < 0.001), and permanent AF (HR = 0.39, 95% CI 0.21-0.75, P = 0.004). In patients with bradycardia and atrial tachyarrhythmias, DDDRP + MVP is superior to standard dual-chamber pacing. The primary endpoint was significantly lowered through the reduction of the progression of atrial tachyarrhythmias to permanent AF. NCT00262119. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Cardiology.

The pseudo-Boolean optimization approach to form the N-version software structure

NASA Astrophysics Data System (ADS)

Kovalev, I. V.; Kovalev, D. I.; Zelenkov, P. V.; Voroshilova, A. A.

2015-10-01

The problem of developing an optimal structure of N-version software system presents a kind of very complex optimization problem. This causes the use of deterministic optimization methods inappropriate for solving the stated problem. In this view, exploiting heuristic strategies looks more rational. In the field of pseudo-Boolean optimization theory, the so called method of varied probabilities (MVP) has been developed to solve problems with a large dimensionality. Some additional modifications of MVP have been made to solve the problem of N-version systems design. Those algorithms take into account the discovered specific features of the objective function. The practical experiments have shown the advantage of using these algorithm modifications because of reducing a search space.

Recent advances and future prospects for Monte Carlo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, Forrest B

2010-01-01

The history of Monte Carlo methods is closely linked to that of computers: The first known Monte Carlo program was written in 1947 for the ENIAC; a pre-release of the first Fortran compiler was used for Monte Carlo In 1957; Monte Carlo codes were adapted to vector computers in the 1980s, clusters and parallel computers in the 1990s, and teraflop systems in the 2000s. Recent advances include hierarchical parallelism, combining threaded calculations on multicore processors with message-passing among different nodes. With the advances In computmg, Monte Carlo codes have evolved with new capabilities and new ways of use. Production codesmore » such as MCNP, MVP, MONK, TRIPOLI and SCALE are now 20-30 years old (or more) and are very rich in advanced featUres. The former 'method of last resort' has now become the first choice for many applications. Calculations are now routinely performed on office computers, not just on supercomputers. Current research and development efforts are investigating the use of Monte Carlo methods on FPGAs. GPUs, and many-core processors. Other far-reaching research is exploring ways to adapt Monte Carlo methods to future exaflop systems that may have 1M or more concurrent computational processes.« less

First results from the Mojave Volatiles Prospector (MVP) Field Campaign, a Lunar Polar Rover Mission Analog

NASA Astrophysics Data System (ADS)

Heldmann, J. L.; Colaprete, A.; Cook, A.; Deans, M. C.; Elphic, R. C.; Lim, D. S. S.; Skok, J. R.

2014-12-01

The Mojave Volatiles Prospector (MVP) project is a science-driven field program with the goal to produce critical knowledge for conducting robotic exploration of the Moon. MVP will feed science, payload, and operational lessons learned to the development of a real-time, short-duration lunar polar volatiles prospecting mission. MVP achieves these goals through a simulated lunar rover mission to investigate the composition and distribution of surface and subsurface volatiles in a natural and a priori unknown environment within the Mojave Desert, improving our understanding of how to find, characterize, and access volatiles on the Moon. The MVP field site is the Mojave Desert, selected for its low, naturally occurring water abundance. The Mojave typically has on the order of 2-6% water, making it a suitable lunar analog for this field test. MVP uses the Near Infrared and Visible Spectrometer Subsystem (NIRVSS), Neutron Spectrometer Subsystem (NSS), and a downward facing GroundCam camera on the KREX-2 rover to investigate the relationship between the distribution of volatiles and soil crust variation. Through this investigation, we mature robotic in situ instruments and concepts of instrument operations, improve ground software tools for real time science, and carry out publishable research on the water cycle and its connection to geomorphology and mineralogy in desert environments. A lunar polar rover mission is unlike prior space missions and requires a new concept of operations. The rover must navigate 3-5 km of terrain and examine multiple sites in in just ~6 days. Operational decisions must be made in real time, requiring constant situational awareness, data analysis and rapid turnaround decision support tools. This presentation will focus on the first science results and operational architecture findings from the MVP field deployment relevant to a lunar polar rover mission.

[Arrhythmias and heart blocks in flying personnel with mitral valve prolapses].

PubMed

Zakharov, V P; Karlov, V N; Bondareva, S V; Vlasov, V D

1999-01-01

Investigated were 76 pilots with ECG-verified mitral valve prolapses (MVP) of the 1st and 2nd degree (w/o profound regurgitation). There were various heart blocks and ECG repolarization changes in 35 cases. Comparison of results of the cardiovascular functional investigations of flyers with MVP displayed non-specific cardiac rhythm and conductance disturbances that were registered more often during ECG-monitoring or test loading. According to the data of this study, bicycle and treadmill ergometry revealed "pseudoischemic" shifts in ECG. Literary indications of a significant loss in human endurance of physical loads due to MVP combined with the strain-induced arrhythmia received the experimental confirmation. Probably, arrhythmias in flyers with diagnosed MVP are predominantly associated with electric instability of the myocardium against the autonomous dysfunction with prevailing adrenergic effects.

Using AI Planning Techniques to Automatically Generate Image Processing Procedures: A Preliminary Report

NASA Technical Reports Server (NTRS)

Chien, S.

1994-01-01

This paper describes work on the Multimission VICAR Planner (MVP) system to automatically construct executable image processing procedures for custom image processing requests for the JPL Multimission Image Processing Lab (MIPL). This paper focuses on two issues. First, large search spaces caused by complex plans required the use of hand encoded control information. In order to address this in a manner similar to that used by human experts, MVP uses a decomposition-based planner to implement hierarchical/skeletal planning at the higher level and then uses a classical operator based planner to solve subproblems in contexts defined by the high-level decomposition.

Arterial and venous plasma levels of bupivacaine following peripheral nerve blocks.

PubMed

Moore, D C; Mather, L E; Bridenbaugh, L D; Balfour, R I; Lysons, D F; Horton, W G

1976-01-01

Mean arterial plasma (MAP) and peripheral mean venous plasma (MVP) levels of bupivacaine were ascertained in 3 groups of 10 patients each for: (1) intercostal nerve block, 400 mg; (2) block of the sciatic, femoral, and lateral femoral cutaneous nerves, with or without block of the obturator nerve, 400 mg; and (3) supraclavicular brachial plexus block, 300 mg. MAP levels were consistently higher than simultaneously sampled MVP levels, the highest levels occurring from bilateral intercostal nerve block. No evidence of systemic toxicity was observed. The results suggest that bupivacaine has a much wider margin of safety in humans than is now stated.

Experiments With Magnetic Vector Potential

ERIC Educational Resources Information Center

Skinner, J. W.

1975-01-01

Describes the experimental apparatus and method for the study of magnetic vector potential (MVP). Includes a discussion of inherent errors in the calculations involved, precision of the results, and further applications of MVP. (GS)

ERMO3/MVP1/GOLD36 Is Involved in a Cell Type-Specific Mechanism for Maintaining ER Morphology in Arabidopsis thaliana

PubMed Central

Nakano, Ryohei Thomas; Matsushima, Ryo; Nagano, Atsushi J.; Fukao, Yoichiro; Fujiwara, Masayuki; Kondo, Maki; Nishimura, Mikio; Hara-Nishimura, Ikuko

2012-01-01

The endoplasmic reticulum (ER) has a unique, network-like morphology. The ER structures are composed of tubules, cisternae, and three-way junctions. This morphology is highly conserved among eukaryotes, but the molecular mechanism that maintains ER morphology has not yet been elucidated. In addition, certain Brassicaceae plants develop a unique ER-derived organelle called the ER body. This organelle accumulates large amounts of PYK10, a β-glucosidase, but its physiological functions are still obscure. We aimed to identify a novel factor required for maintaining the morphology of the ER, including ER bodies, and employed a forward-genetic approach using transgenic Arabidopsis thaliana (GFP-h) with fluorescently-labeled ER. We isolated and investigated a mutant (designated endoplasmic reticulum morphology3, ermo3) with huge aggregates and abnormal punctate structures of ER. ERMO3 encodes a GDSL-lipase/esterase family protein, also known as MVP1. Here, we showed that, although ERMO3/MVP1/GOLD36 was expressed ubiquitously, the morphological defects of ermo3 were specifically seen in a certain type of cells where ER bodies developed. Coimmunoprecipitation analysis combined with mass spectrometry revealed that ERMO3/MVP1/GOLD36 interacts with the PYK10 complex, a huge protein complex that is thought to be important for ER body-related defense systems. We also found that the depletion of transcription factor NAI1, a master regulator for ER body formation, suppressed the formation of ER-aggregates in ermo3 cells, suggesting that NAI1 expression plays an important role in the abnormal aggregation of ER. Our results suggest that ERMO3/MVP1/GOLD36 is required for preventing ER and other organelles from abnormal aggregation and for maintaining proper ER morphology in a coordinated manner with NAI1. PMID:23155454

Classification of microvascular patterns via cluster analysis reveals their prognostic significance in glioblastoma.

PubMed

Chen, Long; Lin, Zhi-Xiong; Lin, Guo-Shi; Zhou, Chang-Fu; Chen, Yu-Peng; Wang, Xing-Fu; Zheng, Zong-Qing

2015-01-01

There are limited researches focusing on microvascular patterns (MVPs) in human glioblastoma and their prognostic impact. We evaluated MVPs of 78 glioblastomas by CD34/periodic acid-Schiff dual staining and by cluster analysis of the percentage of microvascular area for distinct microvascular formations. The distribution of 5 types of basic microvascular formations, that is, microvascular sprouting (MS), vascular cluster (VC), vascular garland (VG), glomeruloid vascular proliferation (GVP), and vasculogenic mimicry (VM), was variable. Accordingly, cluster analysis classified MVPs into 2 types: type I MVP displayed prominent MSs and VCs, whereas type II MVP had numerous VGs, GVPs, and VMs. By analyzing the proportion of microvascular area for each type of formation, we determined that glioblastomas with few MSs and VCs had many GVPs and VMs, and vice versa. VG seemed to be a transitional type of formation. In case of type I MVP, expression of Ki-67 and p53 but not MGMT was significantly higher as compared with those of type II MVP (P < .05). Survival analysis showed that the type of MVPs presented as an independent prognostic factor of progression-free survival (PFS) and overall survival (OS) (both P < .001). Type II MVP had a more negative influence on PFS and OS than did type I MVP. We conclude that the heterogeneous MVPs in glioblastoma can be categorized properly by certain histopathologic and statistical analyses and may influence clinical outcome. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Mitomycin C plus vindesine plus etoposide (MEV) versus mitomycin C plus vindesine plus cisplatin (MVP) in stage IV non-small-cell lung cancer: A phase III multicentre randomised trial. The "Gruppo Oncologico Centro-Sud-Isole' (G.O.C.S.I.).

PubMed

Gridelli, C; Perrone, F; Palmeri, S; D'Aprile, M; Cognetti, F; Rossi, A; Gebbia, V; Pepe, R; Veltri, E; Airoma, G; Russo, A; Incoronato, P; Scinto, A F; Palazzolo, G; Natali, M; Leonardi, V; Gallo, C; De Placido, S; Bianco, A R

1996-10-01

To compare mitomycin C plus vindesine plus etoposide (MEV) vs. mitomycin C plus vindesine plus cisplatin (MVP) in the treatment of stage IV non-small-cell lung cancer. 204 patients were entered in a phase III multicentre randomised trial from June 1990 to December 1994 and stratified according to the ECOG performance status (0-1 vs. 2). MVP was given in the following dosages: mitomycin C 8 mg/m2+vindesine 3 mg/m2+cisplatin 100 mg/m2 i.v. day 1 and vindesine 3 mg/m2 i.v. day 8 with cycles repeated every 4 weeks. MEV was given in the following dosages: mitomycin C 8 mg/m2+vindesine 3 mg/ m2 i.v. day 1 and etoposide 100 mg/m2 i.v. days 1 to 3 with cycles repeated every 3 weeks. For both treatments a maximum of 6 cycles was planned. Response and toxicity were evaluated according to WHO. Subjective responses were assessed by numerical scales. Analyses were made on the basis of intent to treat. The objective response rate was 21.4% (1 CR + 21 PR among 103 patients) in the MEV and 28.7% (1 CR + 28 PR among 101 patients) in the MVP arm (P = 0.48). Symptoms were similar in the two arms. 196 patients progressed and 182 died. The median times to progression were 10 weeks (95% CI 9-12) and 12 weeks (95% CI 10-15) and median survivals were 29 weeks (95% CI 25-36) and 28 weeks (95% CI 25-35) in the MEV and MVP arms, respectively. The relative risks of progressing and of dying were 0.89 (95% CL 0.66-1.20) and 0.96 (95% CL 0.71-1.30), respectively, for patients receiving MVP as compared with those receiving MEV at multivariate analysis adjusted by sex, age, histologic type, number of metastatic sites, performance status at entry, and centre. In the present study, no significant differences were observed in response rate, survival or palliation of symptoms between the MEV and MVP regimens, while toxicity was significantly more frequent and severe with MVP. Thus, MEV should be considered a reasonable alternative to the MVP regimen in the treatment of stage IV NSCLC.

Programmable architecture for pixel level processing tasks in lightweight strapdown IR seekers

NASA Astrophysics Data System (ADS)

Coates, James L.

1993-06-01

Typical processing tasks associated with missile IR seeker applications are described, and a straw man suite of algorithms is presented. A fully programmable multiprocessor architecture is realized on a multimedia video processor (MVP) developed by Texas Instruments. The MVP combines the elements of RISC, floating point, advanced DSPs, graphics processors, display and acquisition control, RAM, and external memory. Front end pixel level tasks typical of missile interceptor applications, operating on 256 x 256 sensor imagery, can be processed at frame rates exceeding 100 Hz in a single MVP chip.

Is mitral valve repair superior to replacement for chronic ischemic mitral regurgitation with left ventricular dysfunction?

PubMed Central

2010-01-01

Background This study was undertaken to compare mitral valve repair and replacement as treatments for ischemic mitral regurgitation (IMR) with left ventricular dysfunction (LVD). Specifically, we sought to determine whether the choice of mitral valve procedure affected survival, and discover which patients were predicted to benefit from mitral valve repair and which from replacement. Methods A total of 218 consecutive patients underwent either mitral valve repair (MVP, n = 112) or mitral valve replacement (MVR, n = 106). We retrospectively reviewed the clinical material, operation methods, echocardiography check during operation and follow-up. Patients details and follow-up outcomes were compared using multivariate and Kaplan-Meier analyses. Results No statistical difference was found between the two groups in term of intraoperative data. Early mortality was 3.2% (MVP 2.7% and MVR 3.8%). At discharge, Left ventricular end-systolic and end-diastolic diameter and left ventricular ejection fraction (LVEF) were improved more in the MVP group than MVR group (P < 0.05), however, in follow-up no statistically significant difference was observed between the MVR and MVP group (P > 0.05). Follow-up mitral regurgitation grade was significantly improved in the MVR group compared with the MVP group (P < 0.05). The Kaplan-Meier survival estimates at 1, 3, and 5 years were simlar between MVP and MVR group. Logistic regression revealed poor survival was associated with old age(#75), preoperative renal insufficiency and low left ventricular ejection fraction (< 30%). Conclusion Mitral valve repair is the procedure of choice in the majority of patients having surgery for severe ischemic mitral regurgitation with left ventricular dysfunction. Early results of MVP treatment seem to be satisfactory, but several lines of data indicate that mitral valve repair provided less long-term benefit than mitral valve replacement in the LVD patients. PMID:21059216

Theoretical and numerical difficulties in 3-D vector potential methods in finite element magnetostatic computations

NASA Technical Reports Server (NTRS)

Demerdash, N. A.; Wang, R.

1990-01-01

This paper describes the results of application of three well known 3D magnetic vector potential (MVP) based finite element formulations for computation of magnetostatic fields in electrical devices. The three methods were identically applied to three practical examples, the first of which contains only one medium (free space), while the second and third examples contained a mix of free space and iron. The first of these methods is based on the unconstrained curl-curl of the MVP, while the second and third methods are predicated upon constraining the divergence of the MVP 10 zero (Coulomb's Gauge). It was found that the two latter methods cease to give useful and meaningful results when the global solution region contains a mix of media of high and low permeabilities. Furthermore, it was found that their results do not achieve the intended zero constraint on the divergence of the MVP.

Mitral valve disease in patients with Marfan syndrome undergoing aortic root replacement.

PubMed

Kunkala, Meghana R; Schaff, Hartzell V; Li, Zhuo; Volguina, Irina; Dietz, Harry C; LeMaire, Scott A; Coselli, Joseph S; Connolly, Heidi

2013-09-10

Cardiac manifestations of Marfan syndrome include aortic root dilation and mitral valve prolapse (MVP). Only scant data exist describing MVP in patients with Marfan syndrome undergoing aortic root replacement. We retrospectively analyzed data from 166 MFS patients with MVP who were enrolled in a prospective multicenter registry of patients who underwent aortic root aneurysm repair. Of these 166 patients, 9% had mitral regurgitation (MR) grade >2, and 10% had MR grade 2. The severity of MVP and MR was evaluated by echocardiography preoperatively and ≤ 3 years postoperatively. Forty-one patients (25%) underwent composite graft aortic valve replacement, and 125 patients (75%) underwent aortic valve-sparing procedures; both groups had similar prevalences of MR grade >2 (P=0.7). Thirty-three patients (20%) underwent concomitant mitral valve (MV) intervention (repair, n=29; replacement, n=4), including all 15 patients with MR grade >2. Only 1 patient required MV reintervention during follow-up (mean clinical follow-up, 31 ± 10 months). Echocardiography performed 21 ± 13 months postoperatively revealed MR >2 in only 3 patients (2%). One early death and 2 late deaths occurred. Although the majority of patients with Marfan syndrome who undergo elective aortic root replacement have MVP, only 20% have concomitant MV procedures. These concomitant procedures do not seem to increase operative risk. In patients with MR grade ≤ 2 who do not undergo a concomitant MV procedure, the short-term incidence of progressive MR is low; however, more follow-up is needed to determine whether patients with MVP and MR grade ≤ 2 would benefit from prophylactic MV intervention.

Population viability analysis for endangered Roanoke logperch

USGS Publications Warehouse

Roberts, James H.; Angermeier, Paul; Anderson, Gregory B.

2016-01-01

A common strategy for recovering endangered species is ensuring that populations exceed the minimum viable population size (MVP), a demographic benchmark that theoretically ensures low long-term extinction risk. One method of establishing MVP is population viability analysis, a modeling technique that simulates population trajectories and forecasts extinction risk based on a series of biological, environmental, and management assumptions. Such models also help identify key uncertainties that have a large influence on extinction risk. We used stochastic count-based simulation models to explore extinction risk, MVP, and the possible benefits of alternative management strategies in populations of Roanoke logperch Percina rex, an endangered stream fish. Estimates of extinction risk were sensitive to the assumed population growth rate and model type, carrying capacity, and catastrophe regime (frequency and severity of anthropogenic fish kills), whereas demographic augmentation did little to reduce extinction risk. Under density-dependent growth, the estimated MVP for Roanoke logperch ranged from 200 to 4200 individuals, depending on the assumed severity of catastrophes. Thus, depending on the MVP threshold, anywhere from two to all five of the logperch populations we assessed were projected to be viable. Despite this uncertainty, these results help identify populations with the greatest relative extinction risk, as well as management strategies that might reduce this risk the most, such as increasing carrying capacity and reducing fish kills. Better estimates of population growth parameters and catastrophe regimes would facilitate the refinement of MVP and extinction-risk estimates, and they should be a high priority for future research on Roanoke logperch and other imperiled stream-fish species.

Single photon ionization and chemical ionization combined ion source based on a vacuum ultraviolet lamp for orthogonal acceleration time-of-flight mass spectrometry.

PubMed

Hua, Lei; Wu, Qinghao; Hou, Keyong; Cui, Huapeng; Chen, Ping; Wang, Weiguo; Li, Jinghua; Li, Haiyang

2011-07-01

A novel combined ion source based on a vacuum ultraviolet (VUV) lamp with both single photon ionization (SPI) and chemical ionization (CI) capabilities has been developed for an orthogonal acceleration time-of-flight mass spectrometer (oaTOFMS). The SPI was accomplished using a commercial 10.6 eV krypton discharge lamp with a photon flux of about 10(11) photons s(-1), while the CI was achieved through ion-molecule reactions with O(2)(+) reactant ions generated by photoelectron ionization at medium vacuum pressure (MVP). To achieve high ionization efficiency, the ion source pressure was elevated to 0.3 mbar and the photoionization length was extended to 36 mm. As a result, limits of detection (LODs) down to 3, 4, and 6 ppbv were obtained for benzene, toluene, and p-xylene in MVP-SPI mode, and values of 8 and 10 ppbv were obtained for toluene and chloroform, respectively, in SPI-CI mode. As it is feasible to switch between MVP-SPI mode and SPI-CI mode rapidly, this system is capable of monitoring complex organic mixtures with a wide range of ionization energies (IEs). The analytical capacity of this system was demonstrated by measuring dehydrogenation products of long-chain paraffins to olefins through direct capillary sampling and drinking water disinfection byproducts from chlorine through a membrane interface.

The importance of using open source technologies and common standards for interoperability within eHealth: Perspectives from the Millennium Villages Project

PubMed Central

Borland, Rob; Barasa, Mourice; Iiams-Hauser, Casey; Velez, Olivia; Kaonga, Nadi Nina; Berg, Matt

2013-01-01

The purpose of this paper is to illustrate the importance of using open source technologies and common standards for interoperability when implementing eHealth systems and illustrate this through case studies, where possible. The sources used to inform this paper draw from the implementation and evaluation of the eHealth Program in the context of the Millennium Villages Project (MVP). As the eHealth Team was tasked to deploy an eHealth architecture, the Millennium Villages Global-Network (MVG-Net), across all fourteen of the MVP sites in Sub-Saharan Africa, the team recognized the need for standards and uniformity but also realized that context would be an important factor. Therefore, the team decided to utilize open source solutions. The MVP implementation of MVG-Net provides a model for those looking to implement informatics solutions across disciplines and countries. Furthermore, there are valuable lessons learned that the eHealth community can benefit from. By sharing lessons learned and developing an accessible, open-source eHealth platform, we believe that we can more efficiently and rapidly achieve the health-related and collaborative Millennium Development Goals (MDGs). PMID:22894051

From Keller's MVP Model to Faculty Development Practice

ERIC Educational Resources Information Center

Svinicki, Marilla D.

2017-01-01

As faculty and faculty developers, we sometimes forget that the principles of learning and motivation that we apply to students also apply to us. This chapter illustrates how the MVP model can be used to create effective faculty development activities.

The MVP Model as an Organizing Framework for Neuroscience Findings Related to Learning

ERIC Educational Resources Information Center

Zakrajsek, Todd M.

2017-01-01

This chapter describes the ways in which the MVP model relates to recent research on neuroscience and learning, and demonstrates how those relationships may be used to better understand physiological impacts on motivation, and to facilitate improved learning.

[Prospective randomized study of HMVP, MVP, and HVP regimens in treatment of advanced non-small cell lung cancer].

PubMed

Gao, Jian-Fei; Li, Chang-Sheng; Zhang, Bi-Cheng; Du, Guang-Zu; Zhang, Xin-Hua; Wang, Jun; Zhu, Yu-Ze; Ou, Wu-Ling; Yang, Bo

2004-04-01

Non-small cell lung cancer (NSCLC) is hyposensitive to the normal first and second-line chemotherapy regimens. Camptothecin derivative is becoming a hot point in the treatment of advanced NSCLC. The objective of this article was to evaluate the response, toxicity, and survival time of HMVP, MVP, and HVP regimens (detail in below) in the treatment of advanced NSCLC. A total of 134 cases with advanced NSCLC was randomized into three groups: HMVP group [46 patients, hydroxycamptothecin (HCPT) 12 mg/m(2) from d1 to d5, mitomycin C (MMC) 6 mg/m(2) d1, vindesine (VDS) 2.5-3 mg/m(2) d1 and d8, cisplatin (DDP) 50 mg/m(2) d2 and d3], MVP group (44 patients, MMC, VDS and DDP were the same as HMVP group) and HVP group (44 patients, HCPT, VDS, DDP were the same as HMVP group). The response rates were 39.54% (17/43), 35.57% (15/42), and 26.19% (11/42) in HMVP, MVP, and HVP groups, respectively; no significant difference was detected among the three groups (P >0.05). No significant difference was detected in the median time of remission, median survival time, and 1-, 2-year survival rates among the three groups. Moreover, no significant difference was detected in grade III-IV leukopenia, grade III-IV thrombocytopenia, grade III-IV nausea and vomiting and grade III-IV constipation among the three groups. The response rate of MVP regimen is slightly lower than that of HMVP regimen, but HMVP regimen do not show obvious superiority. It may increase toxicities such as leukopenia, nausea/vomiting, and constipation. The response rate of HVP regimen is slightly lower than that of MVP regimen.

Plasma membrane association facilitates conformational changes in the Marburg virus protein VP40 dimer.

PubMed

Bhattarai, Nisha; Gc, Jeevan B; Gerstman, Bernard S; Stahelin, Robert V; Chapagain, Prem P

2017-04-26

Filovirus infections cause hemorrhagic fever in humans and non-human primates that often results in high fatality rates. The Marburg virus is a lipid-enveloped virus from the Filoviridae family and is closely related to the Ebola virus. The viral matrix layer underneath the lipid envelope is formed by the matrix protein VP40 (VP40), which is also involved in other functions during the viral life-cycle. As in the Ebola virus VP40 (eVP40), the recently determined X-ray crystal structure of the Marburg virus VP40 (mVP40) features loops containing cationic residues that form a lipid binding basic patch. However, the mVP40 basic patch is significantly flatter with a more extended surface than in eVP40, suggesting the possibility of differences in the plasma membrane interactions and phospholipid specificity between the VP40 dimers. In this paper, we report on molecular dynamics simulations that investigate the roles of various residues and lipid types in PM association as well as the conformational changes of the mVP40 dimer facilitated by membrane association. We compared the structural changes of the mVP40 dimer with the mVP40 dimer in both lipid free and membrane associated conditions. Despite the significant structural differences in the crystal structure, the Marburg VP40 dimer is found to adopt a configuration very similar to the Ebola VP40 dimer after associating with the membrane. This conformational rearrangement upon lipid binding allows Marburg VP40 to localize and stabilize at the membrane surface in a manner similar to the Ebola VP40 dimer. Consideration of the structural information in its lipid-interacting condition may be important in targeting mVP40 for novel drugs to inhibit viral budding from the plasma membrane.

A Phase III randomized controlled trial comparing the efficacy, safety and tolerability of oral dydrogesterone versus micronized vaginal progesterone for luteal support in in vitro fertilization

PubMed Central

Tournaye, Herman; Sukhikh, Gennady T.; Griesinger, Georg

2017-01-01

Abstract STUDY QUESTION Is oral dydrogesterone 30 mg daily (10 mg three times daily [TID]) non-inferior to micronized vaginal progesterone (MVP) 600 mg daily (200 mg TID) for luteal support in in vitro fertilization (IVF), assessed by the presence of fetal heartbeats determined by transvaginal ultrasound at 12 weeks of gestation? SUMMARY ANSWER Non-inferiority of oral dydrogesterone versus MVP was demonstrated at 12 weeks of gestation, with a difference in pregnancy rate and an associated confidence interval (CI) that were both within the non-inferiority margin. WHAT IS KNOWN ALREADY MVP is routinely used in most clinics for luteal support in IVF, but it is associated with side effects, such as vaginal irritation and discharge, as well as poor patient acceptance. Dydrogesterone may be an alternative treatment due to its patient-friendly oral administration. STUDY DESIGN, SIZE, DURATION Lotus I was an international Phase III randomized controlled trial, performed across 38 sites, from August 2013 to March 2016. Subjects were premenopausal women (>18 to <42 years of age; body mass index (BMI) ≥18 to ≤30 kg/m2) with a documented history of infertility who were planning to undergo IVF. A centralized electronic system was used for randomization, and the study investigators, sponsor's study team, and subjects remained blinded throughout the study. PARTICIPANTS/MATERIALS, SETTING, METHODS In total, 1031 subjects were randomized to receive either oral dydrogesterone (n = 520) or MVP (n = 511). Luteal support was started on the day of oocyte retrieval and continued until 12 weeks of gestation (Week 10), if a positive pregnancy test was obtained at 2 weeks after embryo transfer. MAIN RESULTS AND THE ROLE OF CHANCE In the full analysis set (FAS), 497 and 477 subjects in the oral dydrogesterone and MVP groups, respectively, had an embryo transfer. Non-inferiority of oral dydrogesterone was demonstrated, with pregnancy rates at 12 weeks of gestation of 37.6% and 33.1% in the oral dydrogesterone and MVP treatment groups, respectively (difference 4.7%; 95% CI: −1.2–10.6%). Live birth rates of 34.6% (172 mothers with 213 newborns) and 29.8% (142 mothers with 158 newborns) were obtained in the dydrogesterone and MVP groups, respectively (difference 4.9%; 95% CI: −0.8–10.7%). Oral dydrogesterone was well tolerated and had a similar safety profile to MVP. LIMITATIONS, REASONS FOR CAUTION The analysis of the results was powered to consider the clinical pregnancy rate, but the live birth rate may be of greater clinical interest. Conclusions relating to the differences between treatments in live birth rate, observed in this study, should therefore be made with caution. WIDER IMPLICATIONS OF THE FINDINGS Oral dydrogesterone may replace MVP as the standard of care for luteal phase support in IVF, owing to the oral route being more patient-friendly than intravaginal administration, as well as it being a well tolerated and efficacious treatment. STUDY FUNDING/COMPETING INTEREST(S) Sponsored and supported by Abbott Established Pharmaceuticals Division. H.T.’s institution has received grants from Merck, MSD, Goodlife, Cook, Roche, Besins, Ferring and Mithra (now Allergan) and H.T. has received consultancy fees from Finox, Ferring, Abbott, ObsEva and Ovascience. G.S. has nothing to disclose. E.K. is an employee of Abbott GmbH. G.G. has received investigator fees from Abbott during the conduct of the study; outside of this submitted work, G.G. has received personal fees and non-financial support from MSD, Ferring, Merck-Serono, Finox, TEVA, Glycotope, as well as personal fees from VitroLife, NMC Healthcare LLC, ReprodWissen LLC and ZIVA LLC. TRIAL REGISTRATION NUMBER NCT01850030 (clinicaltrials.gov). TRIAL REGISTRATION DATE 19 April 2013. DATE OF FIRST PATIENT'S ENROLLMENT 23 August 2013. PMID:28333318

A Phase III randomized controlled trial comparing the efficacy, safety and tolerability of oral dydrogesterone versus micronized vaginal progesterone for luteal support in in vitro fertilization.

PubMed

Tournaye, Herman; Sukhikh, Gennady T; Kahler, Elke; Griesinger, Georg

2017-05-01

Is oral dydrogesterone 30 mg daily (10 mg three times daily [TID]) non-inferior to micronized vaginal progesterone (MVP) 600 mg daily (200 mg TID) for luteal support in in vitro fertilization (IVF), assessed by the presence of fetal heartbeats determined by transvaginal ultrasound at 12 weeks of gestation? Non-inferiority of oral dydrogesterone versus MVP was demonstrated at 12 weeks of gestation, with a difference in pregnancy rate and an associated confidence interval (CI) that were both within the non-inferiority margin. MVP is routinely used in most clinics for luteal support in IVF, but it is associated with side effects, such as vaginal irritation and discharge, as well as poor patient acceptance. Dydrogesterone may be an alternative treatment due to its patient-friendly oral administration. Lotus I was an international Phase III randomized controlled trial, performed across 38 sites, from August 2013 to March 2016. Subjects were premenopausal women (>18 to <42 years of age; body mass index (BMI) ≥18 to ≤30 kg/m2) with a documented history of infertility who were planning to undergo IVF. A centralized electronic system was used for randomization, and the study investigators, sponsor's study team, and subjects remained blinded throughout the study. In total, 1031 subjects were randomized to receive either oral dydrogesterone (n = 520) or MVP (n = 511). Luteal support was started on the day of oocyte retrieval and continued until 12 weeks of gestation (Week 10), if a positive pregnancy test was obtained at 2 weeks after embryo transfer. In the full analysis set (FAS), 497 and 477 subjects in the oral dydrogesterone and MVP groups, respectively, had an embryo transfer. Non-inferiority of oral dydrogesterone was demonstrated, with pregnancy rates at 12 weeks of gestation of 37.6% and 33.1% in the oral dydrogesterone and MVP treatment groups, respectively (difference 4.7%; 95% CI: -1.2-10.6%). Live birth rates of 34.6% (172 mothers with 213 newborns) and 29.8% (142 mothers with 158 newborns) were obtained in the dydrogesterone and MVP groups, respectively (difference 4.9%; 95% CI: -0.8-10.7%). Oral dydrogesterone was well tolerated and had a similar safety profile to MVP. The analysis of the results was powered to consider the clinical pregnancy rate, but the live birth rate may be of greater clinical interest. Conclusions relating to the differences between treatments in live birth rate, observed in this study, should therefore be made with caution. Oral dydrogesterone may replace MVP as the standard of care for luteal phase support in IVF, owing to the oral route being more patient-friendly than intravaginal administration, as well as it being a well tolerated and efficacious treatment. Sponsored and supported by Abbott Established Pharmaceuticals Division. H.T.'s institution has received grants from Merck, MSD, Goodlife, Cook, Roche, Besins, Ferring and Mithra (now Allergan) and H.T. has received consultancy fees from Finox, Ferring, Abbott, ObsEva and Ovascience. G.S. has nothing to disclose. E.K. is an employee of Abbott GmbH. G.G. has received investigator fees from Abbott during the conduct of the study; outside of this submitted work, G.G. has received personal fees and non-financial support from MSD, Ferring, Merck-Serono, Finox, TEVA, Glycotope, as well as personal fees from VitroLife, NMC Healthcare LLC, ReprodWissen LLC and ZIVA LLC. NCT01850030 (clinicaltrials.gov). 19 April 2013. 23 August 2013. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

Treatment of severe mitral regurgitation caused by lesions in both leaflets using multiple mitral valve plasty techniques in a small dog

PubMed Central

Yokoyama, Satoko; Kanemoto, Isamu; Mihara, Kippei; Ando, Takanori; Kawase, Koudai; Sahashi, Yasuaki; Iguchi, Kazuhito

2017-01-01

Mitral valve plasty (MVP) is preferred over mitral valve replacement (MVR) for mitral regurgitation in humans because of its favorable effect on quality of life. In small dogs, it is difficult to repair multiple lesions in both leaflets using MVP. Herein, we report a case of severe mitral regurgitation caused by multiple severe lesions in the posterior leaflet (PL) in a mixed Chihuahua. Initially, we had planned MVR with an artificial valve. However, MVP combined with artificial chordal reconstruction of both leaflets, semicircular suture annuloplasty, and valvuloplasty using a newly devised direct scallop suture for the PL was attempted in this dog. The dog recovered well and showed no adverse cardiac signs, surviving two major operations. The dog died 4 years and 10 months after the MVP due to non-cardiovascular disease. Our additional technique of using a direct scallop suture seemed useful for PL repair involving multiple scallops in a small dog. PMID:29201662

Glass Effect in Inbreeding-Avoidance Systems: Minimum Viable Population for Outbreeders

NASA Astrophysics Data System (ADS)

Tainaka, Kei-ichi; Itoh, Yoshiaki

1996-10-01

Many animals, birds and plants have evolved mechanisms to avoid inbreeding between close relatives.Such mating systems may have developed several methods for restricting mate choice.If fragmentation of habitats becomes serious, these methods may lead to a lack of acceptable mates. We call this “glass effect”which is a generalization of the so-called Allee effect.We present two inbreeding-avoidance (outbreeding) models.Both models show that outbreeders have a high risk infragmented environments.We thus obtain the minimum viable population (MVP). It is found that the value of MVP amounts to the range from several hundred to several thousand individuals.While this value is much larger than thoseobtained by the previous demographic theories,it is consistent with recent empirical estimations.Moreover, we find that the glass effect is caused bydynamically induced clusters of relatives.This suggests that genetic variation will be decreased by the outbreeding in a highly fragmented environment.

Astrionic system optimization and modular astrionics for NASA missions after 1974. Preliminary definition of astrionic system for space tug Mission Vehicle Payload (MVP)

NASA Technical Reports Server (NTRS)

1970-01-01

Results of preliminary studies to define the space tug astrionic system, subsystems, and components to meet requirements for a variety of missions are reported. Emphasis is placed on demonstration of the modular astrionics approach in the design of the space tug astrionic system.

Sparsely-distributed organization of face and limb activations in human ventral temporal cortex

PubMed Central

Weiner, Kevin S.; Grill-Spector, Kalanit

2011-01-01

Functional magnetic resonance imaging (fMRI) has identified face- and body part-selective regions, as well as distributed activation patterns for object categories across human ventral temporal cortex (VTC), eliciting a debate regarding functional organization in VTC and neural coding of object categories. Using high-resolution fMRI, we illustrate that face- and limb-selective activations alternate in a series of largely nonoverlapping clusters in lateral VTC along the inferior occipital gyrus (IOG), fusiform gyrus (FG), and occipitotemporal sulcus (OTS). Both general linear model (GLM) and multivoxel pattern (MVP) analyses show that face- and limb-selective activations minimally overlap and that this organization is consistent across experiments and days. We provide a reliable method to separate two face-selective clusters on the middle and posterior FG (mFus and pFus), and another on the IOG using their spatial relation to limb-selective activations and retinotopic areas hV4, VO-1/2, and hMT+. Furthermore, these activations show a gradient of increasing face selectivity and decreasing limb selectivity from the IOG to the mFus. Finally, MVP analyses indicate that there is differential information for faces in lateral VTC (containing weakly- and highly-selective voxels) relative to non-selective voxels in medial VTC. These findings suggest a sparsely-distributed organization where sparseness refers to the presence of several face- and limb-selective clusters in VTC, and distributed refers to the presence of different amounts of information in highly-, weakly-, and non-selective voxels. Consequently, theories of object recognition should consider the functional and spatial constraints of neural coding across a series of nonoverlapping category-selective clusters that are themselves distributed. PMID:20457261

MVP and Instructional Systems Design in Online Courses

ERIC Educational Resources Information Center

Franklin, Jennifer L.

2017-01-01

This chapter is based on three premises. The first premise is that the use of instructional systems design (ISD) methods is important in online as well as traditional classroom settings. A second premise is that improving the motivational design of instruction brings benefits to teachers and learners alike. The third premise, specific to this…

Design and burn-up analyses of new type holder for silicon neutron transmutation doping.

PubMed

Komeda, Masao; Arai, Masaji; Tamai, Kazuo; Kawasaki, Kozo

2016-07-01

We have developed a new silicon irradiation holder with a neutron filter to increase the irradiation efficiency. The neutron filter is made of an alloy of aluminum and B4C particles. We fabricated a new holder based on the results of design analyses. This filter has limited use in applications requiring prolonged use due to a decrease in the amount of (10)B in B4C particles. We investigated the influence of (10)B reduction on doping distribution in a silicon ingot by using the Monte Carlo Code MVP. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effects of enhanced pacing modalities on health care resource utilization and costs in bradycardia patients: An analysis of the randomized MINERVA trial.

PubMed

Boriani, Giuseppe; Manolis, Antonis S; Tukkie, Raymond; Mont, Lluis; Pürerfellner, Helmut; Santini, Massimo; Inama, Giuseppe; Serra, Paolo; Gulizia, Michele; Samoilenko, Igor Vasilyevich; Wolff, Claudia; Holbrook, Reece; Gavazza, Federica; Padeletti, Luigi

2015-06-01

Many patients who suffer from bradycardia and need cardiac pacing also have atrial fibrillation (AF). New pacemaker algorithms, such as atrial preventive pacing and atrial antitachycardia pacing (DDDRP) and managed ventricular pacing (MVP), have been specifically designed to reduce AF occurrence and duration and to minimize the detrimental effects of right ventricular pacing. The randomized MINimizE Right Ventricular pacing to prevent Atrial fibrillation and heart failure trial established that DDDRP + MVP pacing modality reduced permanent AF in bradycardia patients as compared with standard dual-chamber pacing (DDDR). The aim of this study was to estimate the cost savings due to lower AF-related health care utilization events based on health care costs from the United States and the European Union. Dual-chamber pacemaker patients with a history of paroxysmal or persistent AF were randomly assigned to receive DDDR (n = 385) or the advanced features (DDDRP + MVP; n = 383). We used published health care costs from the United States and the European Union (Italy, Spain, and the United Kingdom) to estimate the costs associated with AF-related hospitalizations and emergency visits. The rate of AF-related hospitalizations was significantly lower in the DDDRP + MVP group than in the conventional pacemaker group (DDDR group; 42% reduction; incidence rate ratio 0.58). Similarly, a significant reduction of 68% was observed for AF-related emergency department visits (incidence rate ratio 0.32; P < .001). As a consequence, DDDRP + MVP could potentially reduce health care costs by 40%-44%. Over a ten-year period, the cost savings per 100 patients ranged from $35,702 in the United Kingdom to $121,831 in the United States. New pacing algorithms such as DDDRP + MVP used in the MINimizE Right Ventricular pacing to prevent Atrial fibrillation and heart failure trial successfully reduced AF-related health care utilization, resulting in significant cost savings to payers. Copyright © 2015 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

jsc2018m000314_Spinning_Science_Multi-use_Variable-g_Platform_Arrives_at_the_Space_Station-MP4

NASA Image and Video Library

2018-05-09

Spinning Science: Multi-use Variable-g Platform Arrives at the Space Station --- The Multi-use Variable-gravity Platform (MVP) Validation mission will install and test the MVP, a new hardware platform developed and owned by Techshot Inc., on the International Space Station (ISS). Though the MVP is designed for research with many different kinds of organisms and cell types, this validation mission will focus on Drosophila melanogaster, more commonly known as the fruit fly. This platform will be especially important for fruit fly research, as it will allow researchers to study larger sample sizes of Drosophila melanogaster than in other previous hardware utilizing centrifuges and it will be able to support fly colonies for multiple generations.

Processors for wavelet analysis and synthesis: NIFS and TI-C80 MVP

NASA Astrophysics Data System (ADS)

Brooks, Geoffrey W.

1996-03-01

Two processors are considered for image quadrature mirror filtering (QMF). The neuromorphic infrared focal-plane sensor (NIFS) is an existing prototype analog processor offering high speed spatio-temporal Gaussian filtering, which could be used for the QMF low- pass function, and difference of Gaussian filtering, which could be used for the QMF high- pass function. Although not designed specifically for wavelet analysis, the biologically- inspired system accomplishes the most computationally intensive part of QMF processing. The Texas Instruments (TI) TMS320C80 Multimedia Video Processor (MVP) is a 32-bit RISC master processor with four advanced digital signal processors (DSPs) on a single chip. Algorithm partitioning, memory management and other issues are considered for optimal performance. This paper presents these considerations with simulated results leading to processor implementation of high-speed QMF analysis and synthesis.

Prognostic significance of miR-23b in combination with P-gp, MRP and LRP/MVP expression in non-small cell lung cancer.

PubMed

Janikova, M; Zizkova, V; Skarda, J; Kharaishvili, G; Radova, L; Kolar, Z

2016-01-01

Recently, miR-23b has emerged as a promising new cancer biomarker but its role in lung cancer has not been established yet. Patients still do not respond well to available treatments, probably due to expression of multidrug resistance (MDR) proteins, such as P-gp, MRP and LRP/MVP. The aim of this study was to determine the role of miR-23b in non-small cell lung cancer (NSCLC) and its relationship to the patient outcome together with MDR transporter proteins. We immunohistochemically evaluated expression of P-gp, MRP and LRP/MVP and quantified the relative levels of miR-23b in 62 NSCLC patients´ samples. The prognostic significance of miR-23b and MDR proteins was tested by Kaplan-Meier and Cox-regression analysis. Our results showed that miR-23b is mostly downregulated in NSCLC samples (57/62) and that its upregulation in tumors is connected with longer progression-free survival (PFS; P = 0.065) and overall survival (OS; P = 0.048). The Cox proportional hazard model revealed that the risk of death or relapse in NSCLC patients with miR-23b downregulation increases together with LRP/MVP expression and both risks decrease with miR-23b upregulation (HRPFS = 4.342, PPFS = 0.022; HROS = 4.408, POS = 0.015). Our findings indicate that miR-23b, especially in combination with LRP/MVP expression, might serve as a suitable prognostic biomarker for NSCLC patients.

Assessing Motivation to Improve Learning: Practical Applications of Keller's MVP Model and ARCS-V Design Process

ERIC Educational Resources Information Center

Angelo, Thomas A.

2017-01-01

This chapter applies John Keller's MVP model and, specifically, adapts the ARCS-V components of that model--defined and described in Chapter 1 of this issue of "New Directions for Teaching and Learning"--as a frame for exploring practical, research-based assessment, and feedback strategies and tools teachers can use to help students…

MVP and College Success for First-Year Students

ERIC Educational Resources Information Center

Becker, Karen A.

2017-01-01

This chapter describes a Reading and Study Skills program and course that are offered to first-year students who are underprepared or reluctant and who may be at risk for failure in other courses as well as at risk for long-term retention and graduation. The course is discussed with respect to its parallels to the MVP model, and initial evidence…

Analytical model of tilted driver–pickup coils for eddy current nondestructive evaluation

NASA Astrophysics Data System (ADS)

Cao, Bing-Hua; Li, Chao; Fan, Meng-Bao; Ye, Bo; Tian, Gui-Yun

2018-03-01

A driver-pickup probe possesses better sensitivity and flexibility due to individual optimization of a coil. It is frequently observed in an eddy current (EC) array probe. In this work, a tilted non-coaxial driver-pickup probe above a multilayered conducting plate is analytically modeled with spatial transformation for eddy current nondestructive evaluation. Basically, the core of the formulation is to obtain the projection of magnetic vector potential (MVP) from the driver coil onto the vector along the tilted pickup coil, which is divided into two key steps. The first step is to make a projection of MVP along the pickup coil onto a horizontal plane, and the second one is to build the relationship between the projected MVP and the MVP along the driver coil. Afterwards, an analytical model for the case of a layered plate is established with the reflection and transmission theory of electromagnetic fields. The calculated values from the resulting model indicate good agreement with those from the finite element model (FEM) and experiments, which validates the developed analytical model. Project supported by the National Natural Science Foundation of China (Grant Nos. 61701500, 51677187, and 51465024).

Pulmonary Arteriovenous Malformations Embolized Using a Micro Vascular Plug System: Technical Note on a Preliminary Experience

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boatta, Emanuele, E-mail: emanuele.boatta@yahoo.it; Jahn, Christine, E-mail: christine.jahn@chru-strasbourg.fr; Canuet, Matthieu, E-mail: matthieu.canuet@chru-strasbourg.fr

AIMTo report our preliminary experience using a Micro Vascular Plug (MVP) deployed through a 2.8Fr micro-catheter for the treatment of pulmonary arteriovenous malformations (PAVMs) in a cohort of patients affected by Hereditary Haemorrhagic Telangiectasia (HHT).Materials and MethodsFour consecutive female patients (mean age 38.0 years; range 25–55 years) with PAVMs diagnosed on echocardiogram/bubble test and contrast-enhanced CT (CECT) underwent MVP embolization. One patient was symptomatic with recent transient ischaemic attack. Follow-up was undertaken at 1-month post-procedure with CECT to assess PAVMs permeability and MVP positioning and at 1-, 6-, and 12-month post-procedure, with echocardiography/bubble test and standard neurological history, to confirm absence ofmore » right-to-left shunts and recurrent symptoms.ResultsEight PAVMs were treated in 4 patients over 5 interventional sessions (mean 1.6 PAVMs per session). All PAVMs were simple, with mean feeding artery diameter of 4.25 mm. Eight 6.5 mm MVPs were deployed in total (one per lesion). Technical success was 100%. Mean procedural time and patient dose per session were 70 min (range 40–70 min) and 53418 mGy.cm{sup 2} (range 6113–101628 mGy.cm{sup 2}), respectively. No signs of reperfusion neither of MPV migration were noted at 1-month CECT follow-up. At early follow-up (mean 3.75 months; range 1–12 months), clinical success was 100% with no evidence of recurrent right-to-left shunt, and no neurological symptoms. No immediate or late complications were observed.ConclusionsMVP embolization of PAVMs appears technically feasible, safe, and effective at early follow-up. Further prospective studies are required to confirm long-term safety and efficacy of this promising technique.« less

Feasibility and performance of novel software to quantify metabolically active volumes and 3D partial volume corrected SUV and metabolic volumetric products of spinal bone marrow metastases on 18F-FDG-PET/CT.

PubMed

Torigian, Drew A; Lopez, Rosa Fernandez; Alapati, Sridevi; Bodapati, Geetha; Hofheinz, Frank; van den Hoff, Joerg; Saboury, Babak; Alavi, Abass

2011-01-01

Our aim was to assess feasibility and performance of novel semi-automated image analysis software called ROVER to quantify metabolically active volume (MAV), maximum standardized uptake value-maximum (SUV(max)), 3D partial volume corrected mean SUV (cSUV(mean)), and 3D partial volume corrected mean MVP (cMVP(mean)) of spinal bone marrow metastases on fluorine-18 fluorodeoxyglucose-positron emission tomography/computerized tomography ((18)F-FDG-PET/CT). We retrospectively studied 16 subjects with 31 spinal metastases on FDG-PET/CT and MRI. Manual and ROVER determinations of lesional MAV and SUV(max), and repeated ROVER measurements of MAV, SUV(max), cSUV(mean) and cMVP(mean) were made. Bland-Altman and correlation analyses were performed to assess reproducibility and agreement. Our results showed that analyses of repeated ROVER measurements revealed MAV mean difference (D)=-0.03±0.53cc (95% CI(-0.22, 0.16)), lower limit of agreement (LLOA)=-1.07cc, and upper limit of agreement (ULOA)=1.01cc; SUV(max) D=0.00±0.00 with LOAs=0.00; cSUV(mean) D=-0.01±0.39 (95% CI(-0.15, 0.13)), LLOA=-0.76, and ULOA=0.75; cMVP(mean) D=-0.52±4.78cc (95% CI(-2.23, 1.23)), LLOA=-9.89cc, and ULOA=8.86cc. Comparisons between ROVER and manual measurements revealed volume D= -0.39±1.37cc (95% CI (-0.89, 0.11)), LLOA=-3.08cc, and ULOA=2.30cc; SUV(max) D=0.00±0.00 with LOAs=0.00. Mean percent increase in lesional SUV(mean) and MVP(mean) following partial volume correction using ROVER was 84.25±36.00% and 84.45±35.94% , respectively. In conclusion, it is feasible to estimate MAV, SUV(max), cSUV(mean), and cMVP(mean) of spinal bone marrow metastases from (18)F-FDG-PET/CT quickly and easily with good reproducibility via ROVER software. Partial volume correction is imperative, as uncorrected SUV(mean) and MVP(mean) are significantly underestimated, even for large lesions. This novel approach has great potential for practical, accurate, and precise combined structural-functional PET quantification of disease before and after therapeutic intervention.

Infective Endocarditis in Patients With Bicuspid Aortic Valve or Mitral Valve Prolapse.

PubMed

Zegri-Reiriz, Isabel; de Alarcón, Arístides; Muñoz, Patricia; Martínez Sellés, Manuel; González-Ramallo, Victor; Miro, Jose M; Falces, Carles; Gonzalez Rico, Claudia; Kortajarena Urkola, Xabier; Lepe, José Antonio; Rodriguez Alvarez, Regino; Reguera Iglesias, Jose Maria; Navas, Enrique; Dominguez, Fernando; Garcia-Pavia, Pablo

2018-06-19

There is little information concerning infective endocarditis (IE) in patients with bicuspid aortic valve (BAV) or mitral valve prolapse (MVP). Currently, IE antibiotic prophylaxis (IEAP) is not recommended for these conditions. This study sought to describe the clinical and microbiological features of IE in patients with BAV and MVP and compare them with those of IE patients with and without IEAP indication, to determine the potential benefit of IEAP in these conditions. This analysis involved 3,208 consecutive IE patients prospectively included in the GAMES (Grupo de Apoyo al Manejo de la Endocarditis infecciosa en España) registry at 31 Spanish hospitals. Patients were classified as high-risk IE with IEAP indication (high-risk group; n = 1,226), low- and moderate-risk IE without IEAP indication (low/moderate-risk group; n = 1,839), and IE with BAV (n = 54) or MVP (n = 89). BAV and MVP patients had a higher incidence of viridans group streptococci IE than did high-risk group and low/moderate-risk group patients (35.2% and 39.3% vs. 12.1% and 15.0%, respectively; all p < 0.01). A similar pattern was seen for IE from suspected odontologic origin (14.8% and 18.0% vs. 5.8% and 6.0%; all p < 0.01). BAV and MVP patients had more intracardiac complications than did low/moderate-risk group (50% and 47.2% vs. 30.6%, both p < 0.01) patients and were similar to high-risk group patients. IE in patients with BAV and MVP have higher rates of viridans group streptococci IE and IE from suspected odontologic origin than in other IE patients, with a clinical profile similar to that of high-risk IE patients. Our findings suggest that BAV and MVP should be classified as high-risk IE conditions and the case for IEAP should be reconsidered. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Bubble accumulation and its role in the evolution of magma reservoirs in the upper crust.

PubMed

Parmigiani, A; Faroughi, S; Huber, C; Bachmann, O; Su, Y

2016-04-28

Volcanic eruptions transfer huge amounts of gas to the atmosphere. In particular, the sulfur released during large silicic explosive eruptions can induce global cooling. A fundamental goal in volcanology, therefore, is to assess the potential for eruption of the large volumes of crystal-poor, silicic magma that are stored at shallow depths in the crust, and to obtain theoretical bounds for the amount of volatiles that can be released during these eruptions. It is puzzling that highly evolved, crystal-poor silicic magmas are more likely to generate volcanic rocks than plutonic rocks. This observation suggests that such magmas are more prone to erupting than are their crystal-rich counterparts. Moreover, well studied examples of largely crystal-poor eruptions (for example, Katmai, Taupo and Minoan) often exhibit a release of sulfur that is 10 to 20 times higher than the amount of sulfur estimated to be stored in the melt. Here we argue that these two observations rest on how the magmatic volatile phase (MVP) behaves as it rises buoyantly in zoned magma reservoirs. By investigating the fluid dynamics that controls the transport of the MVP in crystal-rich and crystal-poor magmas, we show how the interplay between capillary stresses and the viscosity contrast between the MVP and the host melt results in a counterintuitive dynamics, whereby the MVP tends to migrate efficiently in crystal-rich parts of a magma reservoir and accumulate in crystal-poor regions. The accumulation of low-density bubbles of MVP in crystal-poor magmas has implications for the eruptive potential of such magmas, and is the likely source of the excess sulfur released during explosive eruptions.

Sites of Successful Ventricular Fibrillation Ablation in Bileaflet Mitral Valve Prolapse Syndrome.

PubMed

Syed, Faisal F; Ackerman, Michael J; McLeod, Christopher J; Kapa, Suraj; Mulpuru, Siva K; Sriram, Chenni S; Cannon, Bryan C; Asirvatham, Samuel J; Noseworthy, Peter A

2016-05-01

Although the vast majority of mitral valve prolapse (MVP) is benign, a small subset of patients, predominantly women, with bileaflet prolapse, complex ventricular ectopy (VE), and abnormal T waves comprise the recently described bileaflet MVP syndrome. We compared findings on electrophysiological study in bileaflet MVP syndrome patients with and without cardiac arrest to identify factors that may predispose to malignant ventricular arrhythmia. Fourteen consecutive bileaflet MVP syndrome patients (n=13 women; median [limits], age at index ablation, 33.8 [21.0-58.7] years; ejection fraction, 60% [45%-67%]; all ≤ moderate mitral regurgitation; n=6 with previous cardiac arrest and implantable cardioverter defibrillator shocks for ventricular fibrillation; and n=8 without implantable cardioverter defibrillator although with symptomatic complex VE) were included. The 2 groups had similar baseline echocardiographic and electrocardiographic characteristics. All patients had at least 1 left ventricular papillary or fascicular VE focus. Purkinje origin VE was identified as the ventricular fibrillation trigger in 6 of 6 cardiac arrest patients (4 from papillary muscle) and Purkinje origin of dominant VE was seen in 5 of 8 (3 from papillary muscle) nonarrest patients. Acute success was seen in 17 of 19 procedures, and a ventricular fibrillation storm occurred within 24 hours of ablation in a single patient. Repeat ablation for recurrent symptomatic arrhythmia was performed in 6 patients. At 478 (39-2099) days of follow-up, 2 cardiac arrest patients received appropriate shocks. Symptoms from VE were reduced in 12 of 14. Bileaflet MVP syndrome is characterized by fascicular and papillary muscle VE that triggers ventricular fibrillation. Ablation of clinically dominant VE foci improves symptoms and reduces appropriate implantable cardioverter defibrillator shocks. © 2016 American Heart Association, Inc.

Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes.

PubMed

Statello, Luisa; Maugeri, Marco; Garre, Elena; Nawaz, Muhammad; Wahlgren, Jessica; Papadimitriou, Alexandros; Lundqvist, Christina; Lindfors, Lennart; Collén, Anna; Sunnerhagen, Per; Ragusa, Marco; Purrello, Michele; Di Pietro, Cinzia; Tigue, Natalie; Valadi, Hadi

2018-01-01

The RNA that is packaged into exosomes is termed as exosomal-shuttle RNA (esRNA); however, the players, which take this subset of RNA (esRNA) into exosomes, remain largely unknown. We hypothesized that RNA binding proteins (RBPs) could serve as key players in this mechanism, by making complexes with RNAs and transporting them into exosomes during the biosynthesis of exosomes. Here, we demonstrate the presence of 30 RBPs in exosomes that were shown to form RNA-RBP complexes with both cellular RNA and exosomal-RNA species. To assess the involvement of these RBPs in RNA-transfer into exosomes, the gene transcripts encoding six of the proteins identified in exosomes (HSP90AB1, XPO5, hnRNPH1, hnRNPM, hnRNPA2B1, and MVP) were silenced by siRNA and subsequent effect on esRNA was assessed. A significant reduction of total esRNA was observed by post-transcriptional silencing of MVP, compared to other RBPs. Furthermore, to confirm the binding of MVP with esRNA, a biotinylated-MVP was transiently expressed in HEK293F cells. Higher levels of esRNA were recovered from MVP that was eluted from exosomes of transfected cells, as compared to those of non-transfected cells. Our data indicate that these RBPs could end up in exosomes together with RNA molecules in the form of RNA-ribonucleoprotein complexes, which could be important for the transport of RNAs into exosomes and the maintenance of RNAs inside exosomes. This type of maintenance may favor the shuttling of RNAs from exosomes to recipient cells in the form of stable complexes.

Usefulness of Mitral Valve Prosthetic or Bioprosthetic Time Velocity Index Ratio to Detect Prosthetic or Bioprosthetic Mitral Valve Dysfunction.

PubMed

Luis, Sushil Allen; Blauwet, Lori A; Samardhi, Himabindu; West, Cathy; Mehta, Ramila A; Luis, Chris R; Scalia, Gregory M; Miller, Fletcher A; Burstow, Darryl J

2017-10-15

This study aimed to investigate the utility of transthoracic echocardiographic (TTE) Doppler-derived parameters in detection of mitral prosthetic dysfunction and to define optimal cut-off values for identification of such dysfunction by valve type. In total, 971 TTE studies (647 mechanical prostheses; 324 bioprostheses) were compared with transesophageal echocardiography for evaluation of mitral prosthesis function. Among all prostheses, mitral valve prosthesis (MVP) ratio (ratio of time velocity integral of MVP to that of left ventricular outflow tract; odds ratio [OR] 10.34, 95% confidence interval [95% CI] 6.43 to 16.61, p<0.001), E velocity (OR 3.23, 95% CI 1.61 to 6.47, p<0.001), and mean gradient (OR 1.13, 95% CI 1.02 to 1.25, p=0.02) provided good discrimination of clinically normal and clinically abnormal prostheses. Optimal cut-off values by receiver operating characteristic analysis for differentiating clinically normal and abnormal prostheses varied by prosthesis type. Combining MVP ratio and E velocity improved specificity (92%) and positive predictive value (65%) compared with either parameter alone, with minimal decline in negative predictive value (92%). Pressure halftime (OR 0.99, 95% CI 0.98 to 1.00, p=0.04) did not differentiate between clinically normal and clinically abnormal prostheses but was useful in discriminating obstructed from normal and regurgitant prostheses. In conclusion, cut-off values for TTE-derived Doppler parameters of MVP function were specific to prosthesis type and carried high sensitivity and specificity for identifying prosthetic valve dysfunction. MVP ratio was the best predictor of prosthetic dysfunction and, combined with E velocity, provided a useful parameter for determining likelihood of dysfunction and need for further assessment. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

Directional plasticity rapidly improves 3D vestibulo-ocular reflex alignment in monkeys using a multichannel vestibular prosthesis.

PubMed

Dai, Chenkai; Fridman, Gene Y; Chiang, Bryce; Rahman, Mehdi A; Ahn, Joong Ho; Davidovics, Natan S; Della Santina, Charles C

2013-12-01

Bilateral loss of vestibular sensation can be disabling. We have shown that a multichannel vestibular prosthesis (MVP) can partly restore vestibular sensation as evidenced by improvements in the 3-dimensional angular vestibulo-ocular reflex (3D VOR). However, a key challenge is to minimize misalignment between the axes of eye and head rotation, which is apparently caused by current spread beyond each electrode's targeted nerve branch. We recently reported that rodents wearing a MVP markedly improve 3D VOR alignment during the first week after MVP activation, probably through the same central nervous system adaptive mechanisms that mediate cross-axis adaptation over time in normal individuals wearing prisms that cause visual scene movement about an axis different than the axis of head rotation. We hypothesized that rhesus monkeys would exhibit similar improvements with continuous prosthetic stimulation over time. We created bilateral vestibular deficiency in four rhesus monkeys via intratympanic injection of gentamicin. A MVP was mounted to the cranium, and eye movements in response to whole-body passive rotation in darkness were measured repeatedly over 1 week of continuous head motion-modulated prosthetic electrical stimulation. 3D VOR responses to whole-body rotations about each semicircular canal axis were measured on days 1, 3, and 7 of chronic stimulation. Horizontal VOR gain during 1 Hz, 50 °/s peak whole-body rotations before the prosthesis was turned on was <0.1, which is profoundly below normal (0.94 ± 0.12). On stimulation day 1, VOR gain was 0.4-0.8, but the axis of observed eye movements aligned poorly with head rotation (misalignment range ∼30-40 °). Substantial improvement of axis misalignment was observed after 7 days of continuous motion-modulated prosthetic stimulation under normal diurnal lighting. Similar improvements were noted for all animals, all three axes of rotation tested, for all sinusoidal frequencies tested (0.05-5 Hz), and for high-acceleration transient rotations. VOR asymmetry changes did not reach statistical significance, although they did trend toward slight improvement over time. Prior studies had already shown that directional plasticity reduces misalignment when a subject with normal labyrinths views abnormal visual scene movement. Our results show that the converse is also true: individuals receiving misoriented vestibular sensation under normal viewing conditions rapidly adapt to restore a well-aligned 3D VOR. Considering the similarity of VOR physiology across primate species, similar effects are likely to occur in humans using a MVP to treat bilateral vestibular deficiency.

Automated discrimination of lower and higher grade gliomas based on histopathological image analysis.

PubMed

Mousavi, Hojjat Seyed; Monga, Vishal; Rao, Ganesh; Rao, Arvind U K

2015-01-01

Histopathological images have rich structural information, are multi-channel in nature and contain meaningful pathological information at various scales. Sophisticated image analysis tools that can automatically extract discriminative information from the histopathology image slides for diagnosis remain an area of significant research activity. In this work, we focus on automated brain cancer grading, specifically glioma grading. Grading of a glioma is a highly important problem in pathology and is largely done manually by medical experts based on an examination of pathology slides (images). To complement the efforts of clinicians engaged in brain cancer diagnosis, we develop novel image processing algorithms and systems to automatically grade glioma tumor into two categories: Low-grade glioma (LGG) and high-grade glioma (HGG) which represent a more advanced stage of the disease. We propose novel image processing algorithms based on spatial domain analysis for glioma tumor grading that will complement the clinical interpretation of the tissue. The image processing techniques are developed in close collaboration with medical experts to mimic the visual cues that a clinician looks for in judging of the grade of the disease. Specifically, two algorithmic techniques are developed: (1) A cell segmentation and cell-count profile creation for identification of Pseudopalisading Necrosis, and (2) a customized operation of spatial and morphological filters to accurately identify microvascular proliferation (MVP). In both techniques, a hierarchical decision is made via a decision tree mechanism. If either Pseudopalisading Necrosis or MVP is found present in any part of the histopathology slide, the whole slide is identified as HGG, which is consistent with World Health Organization guidelines. Experimental results on the Cancer Genome Atlas database are presented in the form of: (1) Successful detection rates of pseudopalisading necrosis and MVP regions, (2) overall classification accuracy into LGG and HGG categories, and (3) receiver operating characteristic curves which can facilitate a desirable trade-off between HGG detection and false-alarm rates. The proposed method demonstrates fairly high accuracy and compares favorably against best-known alternatives such as the state-of-the-art WND-CHARM feature set provided by NIH combined with powerful support vector machine classifier. Our results reveal that the proposed method can be beneficial to a clinician in effectively separating histopathology slides into LGG and HGG categories, particularly where the analysis of a large number of slides is needed. Our work also reveals that MVP regions are much harder to detect than Pseudopalisading Necrosis and increasing accuracy of automated image processing for MVP detection emerges as a significant future research direction.

The Millennium Villages Project: a retrospective, observational, endline evaluation.

PubMed

Mitchell, Shira; Gelman, Andrew; Ross, Rebecca; Chen, Joyce; Bari, Sehrish; Huynh, Uyen Kim; Harris, Matthew W; Sachs, Sonia Ehrlich; Stuart, Elizabeth A; Feller, Avi; Makela, Susanna; Zaslavsky, Alan M; McClellan, Lucy; Ohemeng-Dapaah, Seth; Namakula, Patricia; Palm, Cheryl A; Sachs, Jeffrey D

2018-05-01

The Millennium Villages Project (MVP) was a 10 year, multisector, rural development project, initiated in 2005, operating across ten sites in ten sub-Saharan African countries to achieve the Millennium Development Goals (MDGs). In this study, we aimed to estimate the project's impact, target attainment, and on-site spending. In this endline evaluation of the MVP, we retrospectively selected comparison villages that best matched the project villages on possible confounding variables. Cross-sectional survey data on 40 outcomes of interest were collected from both the project and the comparison villages in 2015. Using these data, as well as on-site spending data collected during the project, we estimated project impacts as differences in outcomes between the project and comparison villages; target attainment as differences between project outcomes and prespecified targets; and on-site spending as expenditures reported by communities, donors, governments, and the project. Spending data were not collected in the comparison villages. Averaged across the ten project sites, we found that impact estimates for 30 of 40 outcomes were significant (95% uncertainty intervals [UIs] for these outcomes excluded zero) and favoured the project villages. In particular, substantial effects were seen in agriculture and health, in which some outcomes were roughly one SD better in the project villages than in the comparison villages. The project was estimated to have no significant impact on the consumption-based measures of poverty, but a significant favourable impact on an index of asset ownership. Impacts on nutrition and education outcomes were often inconclusive (95% UIs included zero). Averaging across outcomes within categories, the project had significant favourable impacts on agriculture, nutrition, education, child health, maternal health, HIV and malaria, and water and sanitation. A third of the targets were met in the project sites. Total on-site spending decreased from US$132 per person in the first half of the project (of which $66 was from the MVP) to $109 per person in the second half of the project (of which $25 was from the MVP). The MVP had favourable impacts on outcomes in all MDG areas, consistent with an integrated rural development approach. The greatest effects were in agriculture and health, suggesting support for the project's emphasis on agriculture and health systems strengthening. The project conclusively met one third of its targets. The Open Society Foundations, the Islamic Development Bank, and the governments of Japan, South Korea, Mali, Senegal, and Uganda. Copyright © 2018 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND 4.0 license. Published by Elsevier Ltd.. All rights reserved.

A GaAs vector processor based on parallel RISC microprocessors

NASA Astrophysics Data System (ADS)

Misko, Tim A.; Rasset, Terry L.

A vector processor architecture based on the development of a 32-bit microprocessor using gallium arsenide (GaAs) technology has been developed. The McDonnell Douglas vector processor (MVP) will be fabricated completely from GaAs digital integrated circuits. The MVP architecture includes a vector memory of 1 megabyte, a parallel bus architecture with eight processing elements connected in parallel, and a control processor. The processing elements consist of a reduced instruction set CPU (RISC) with four floating-point coprocessor units and necessary memory interface functions. This architecture has been simulated for several benchmark programs including complex fast Fourier transform (FFT), complex inner product, trigonometric functions, and sort-merge routine. The results of this study indicate that the MVP can process a 1024-point complex FFT at a speed of 112 microsec (389 megaflops) while consuming approximately 618 W of power in a volume of approximately 0.1 ft-cubed.

Atrial function as a guide to timing of intervention in mitral valve prolapse with mitral regurgitation.

PubMed

Ring, Liam; Rana, Bushra S; Wells, Francis C; Kydd, Anna C; Dutka, David P

2014-03-01

The purpose of this study was to determine the clinical utility of left atrial (LA) functional indexes in patients with mitral valve prolapse (MVP) and mitral regurgitation (MR). Timing of surgery for MVP remains challenging. We hypothesized that assessment of LA function may provide diagnostic utility in these patients. We studied 192 consecutive patients in sinus rhythm with MVP, classified into 3 groups: moderate or less MR (MOD group, n = 54); severe MR without surgical indication (SEV group, n = 52); and severe MR with ≥1 surgical indication (SURG group, n = 86). Comparison was made with 50 control patients. Using 2D speckle imaging, average peak contractile, conduit, and reservoir atrial strain was recorded. Using Simpson's method we recorded maximal left atrial volume (LAVmax) and minimal left atrial volume (LAVmin), from which the total left atrial emptying fraction (TLAEF) was derived: (LAVmax-LAVmin)/LAVmax × 100%. TLAEF was similar in the MOD and control groups (61% vs. 57%; p = NS), was reduced in the SEV group (55%; p < 0.001 vs. control group), and markedly lower in the SURG group (40%; p < 0.001 vs. other groups). Reservoir strain demonstrated a similar pattern. Contractile strain was similarly reduced in the MOD and SEV groups (MOD 15%; SEV 14%; p = NS; both p < 0.05 vs. control group 20%) and further reduced in the SURG group (8%; p < 0.001 vs. other groups). By multivariate analysis, TLAEF (odds ratio [OR]: 0.78; p < 0.001), reservoir strain (OR: 0.91; p = 0.028), and contractile strain (OR: 0.86; p = 0.021) were independent predictors of severe MR requiring surgery. Using receiver-operating characteristic analysis, TLAEF <50% demonstrated 91% sensitivity and 92% specificity for predicting MVP with surgical indication (area under the curve: 0.96; p < 0.001). We report the changes in left atrial function in humans with MVP and the relationship of LA dysfunction to clinical indications for mitral valve surgery. We propose that the findings support the utility of quantitative assessment of atrial function by echocardiography as an additional tool to guide the optimum timing of surgery for MVP. Copyright © 2014 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Combined magnetic vector-scalar potential finite element computation of 3D magnetic field and performance of modified Lundell alternators in Space Station applications. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Wang, Ren H.

1991-01-01

A method of combined use of magnetic vector potential (MVP) based finite element (FE) formulations and magnetic scalar potential (MSP) based FE formulations for computation of three-dimensional (3D) magnetostatic fields is developed. This combined MVP-MSP 3D-FE method leads to considerable reduction by nearly a factor of 3 in the number of unknowns in comparison to the number of unknowns which must be computed in global MVP based FE solutions. This method allows one to incorporate portions of iron cores sandwiched in between coils (conductors) in current-carrying regions. Thus, it greatly simplifies the geometries of current carrying regions (in comparison with the exclusive MSP based methods) in electric machinery applications. A unique feature of this approach is that the global MSP solution is single valued in nature, that is, no branch cut is needed. This is again a superiority over the exclusive MSP based methods. A Newton-Raphson procedure with a concept of an adaptive relaxation factor was developed and successfully used in solving the 3D-FE problem with magnetic material anisotropy and nonlinearity. Accordingly, this combined MVP-MSP 3D-FE method is most suited for solution of large scale global type magnetic field computations in rotating electric machinery with very complex magnetic circuit geometries, as well as nonlinear and anisotropic material properties.

Effects of Wound Bacteria on Postburn Energy Metabolism

DTIC Science & Technology

1990-01-01

The inflammatory response of the MVP-seeded wound was reduced by topical and systemic hydrocortisone treatments . This increased the incidence of...these organizations. In conducting the research described in this report, the investigators adhered to the "Guide for the Care and Use of Laboratory...Hydrocortisone Treatments .......................... 9 Active Immunization Against NVP .................. 9 Serum Antibody Measurements

Mitral valve prolapse and Marfan syndrome.

PubMed

Thacoor, Amitabh

2017-07-01

Marfan syndrome is a multisystemic genetic condition affecting connective tissue. It carries a reduced life expectancy, largely dependent on cardiovascular complications. More common cardiac manifestations such as aortic dissection and aortic valve incompetence have been widely documented in the literature. Mitral valve prolapse (MVP), however, has remained poorly documented. This article aims at exploring the existing literature on the pathophysiology and diagnosis of MVP in patients with Marfan syndrome, defining its current management and outlining the future developments surrounding it. © 2017 Wiley Periodicals, Inc.

Attempt of Serendipitous Science During the Mojave Volatile Prospector Field Expedition

NASA Technical Reports Server (NTRS)

Roush, T. L.; Colaprete, A.; Heldmann, J.; Lim, D. S. S.; Cook, A.; Elphic, R.; Deans, M.; Fluckiger, L.; Fritzler, E.; Hunt, David

2015-01-01

On 23 October a partial solar eclipse occurred across parts of the southwest United States between approximately 21:09 and 23:40 (UT), with maximum obscuration, 36%, occurring at 22:29 (UT). During 21-26 October 2014 the Mojave Volatile Prospector (MVP) field expedition deployed and operated the NASA Ames Krex2 rover in the Mojave desert west of Baker, California (Fig. 1, bottom). The MVP field expedition primary goal was to characterize the surface and sub-surface soil moisture properties within desert alluvial fans, and as a secondary goal to provide mission operations simulations of the Resource Prospector (RP) mission to a Lunar pole. The partial solar eclipse provided an opportunity during MVP operations to address serendipitous science. Science instruments on Krex2 included a neutron spectrometer, a near-infrared spectrometer with associated imaging camera, and an independent camera coupled with software to characterize the surface textures of the areas encountered. All of these devices are focused upon the surface and as a result are downward looking. In addition to these science instruments, two hazard cameras are mounted on Krex2. The chief device used to monitor the partial solar eclipse was the engineering development unit of the Near-Infrared Volatile Spectrometer System (NIRVSS) near-infrared spectrometer. This device uses two separate fiber optic fed Hadamard transform spectrometers. The short-wave and long-wave spectrometers measure the 1600-2400 and 2300-3400 nm wavelength regions with resolutions of 10 and 13 nm, respectively. Data are obtained approximately every 8 seconds. The NIRVSS stares in the opposite direction as the front Krex2.

An association between migraines and heart anomalies-true or false? A heart ultrasound study using cTTE in migraine patients and control participants.

PubMed

Domitrz, Izabela; Styczynski, Grzegorz; Wilczko, Justyna; Marczewska, Malgorzata M; Domitrz, Wojciech; Kaminska, Anna

2014-12-01

A migraine is a common neurological disorder that often coexists with other illnesses including heart abnormalities, such as patent foramen ovale (PFO), atrial septal aneurysm (ASA), and mitral valve prolapse (MVP). The aim of our study was to evaluate the occurrence of some heart abnormalities in migraine patients by routine and contrast transthoracic echocardiography. We assessed the occurrence of PFO, ASA, and MVP in 96 patients with migraine without aura (87 females), in 62 patients with migraine with aura (41 females) and in 53 healthy persons (40 females). In comparison with our control group, only the prevalence of PFO was statistically higher in patients with migraine (P = 0.03) and especially with aura (P = 0.01). We did not find any statistically significant differences between the occurrence of ASA or MVP in migraine and control groups. The results of our study raise the question of the heart's role in the mechanism of migraine attacks. If the occurrence of migraine with aura had been related to some heart abnormalities, the pathophysiology of migraine attacks may have some connection to some heart dysfunction. Resolving the association between migraine and comorbid cardiac conditions might shed light on the underlying mechanisms of migraines and even result in a different treatment strategy. However, we do not find any clear connection between PFP, ASA, and MVP, and migraine occurrence. Wiley Periodicals, Inc.

Understanding the Delay in Onset of Pagets Disease of Bone

DTIC Science & Technology

2015-09-01

gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C K E E K A G S S G L MVP gene D N P G Q D R A T C K E...E K A G S S G L MVV gene agcaaaccatgcctctcagcaattggatcaactgaaggcggtgcacctcgcatccgcggt S K P C L S A I G S T E G G A P R...I R G MVP gene S K P C L S A I G S T E G G A P R I R G MVV gene

Advanced Infusion Techniques with 3-D Printed Tooling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nuttall, David; Elliott, Amy; Post, Brian K.

The manufacturing of tooling for large, contoured surfaces for fiber-layup applications requires significant effort to understand the geometry and then to subtractively manufacture the tool. Traditional methods for the auto industry use clay that is hand sculpted. In the marine pleasure craft industry, the exterior of the model is formed from a foam lay-up that is either hand cut or machined to create smooth lines. Engineers and researchers at Oak Ridge National Laboratory s Manufacturing Demonstration Facility (ORNL MDF) collaborated with Magnum Venus Products (MVP) in the development of a process for reproducing legacy whitewater adventure craft via digital scanningmore » and large scale 3-D printed layup molds. The process entailed 3D scanning a legacy canoe form, converting that form to a CAD model, additively manufacturing (3-D Print) the mold tool, and subtractively finishing the mold s transfer surfaces. Future work will include applying a gelcoat to the mold transfer surface and infusing using vacuum assisted resin transfer molding, or VARTM principles, to create a watertight vessel. The outlined steps were performed on a specific canoe geometry found by MVP s principal participant. The intent of utilizing this geometry is to develop an energy efficient and marketable process for replicating complex shapes, specifically focusing on this particular watercraft, and provide a finished product for demonstration to the composites industry. The culminating part produced through this agreement has been slated for public presentation and potential demonstration at the 2016 CAMX (Composites and Advanced Materials eXpo) exposition in Anaheim, CA. Phase I of this collaborative research and development agreement (MDF-15-68) was conducted under CRADA NFE-15-05575 and was initiated on May 7, 2015, with an introduction to the MVP product line, and concluded in March of 2016 with the printing of and processing of a canoe mold. The project partner Magnum Venous Products (MVP) is a small business. Phase II as discussed herein is under consideration by MVP as of this writing. Overall, it is anticipated that developing this process for manufacturing tooling for complex contoured surfaces has applicability to naval and other watercraft as well as bathrooms and large trucks.« less

Knowledge Management for Command and Control

DTIC Science & Technology

2004-06-01

interfaces relies on rich visual and conceptual understanding of what is sketched, rather than the pattern-recognition technologies that most systems use...recognizers) required by other approaches. • The underlying conceptual representations that nuSketch uses enable it to serve as a front end to knowledge...constructing enemy-intent hypotheses via mixed visual and conceptual analogies. II.C. Multi-ViewPoint Clustering Analysis (MVP-CA) technology To

Dim target trajectory-associated detection in bright earth limb background

NASA Astrophysics Data System (ADS)

Chen, Penghui; Xu, Xiaojian; He, Xiaoyu; Jiang, Yuesong

2015-09-01

The intensive emission of earth limb in the field of view of sensors contributes much to the observation images. Due to the low signal-to-noise ratio (SNR), it is a challenge to detect small targets in earth limb background, especially for the detection of point-like targets from a single frame. To improve the target detection, track before detection (TBD) based on the frame sequence is performed. In this paper, a new technique is proposed to determine the target associated trajectories, which jointly carries out background removing, maximum value projection (MVP) and Hough transform. The background of the bright earth limb in the observation images is removed according to the profile characteristics. For a moving target, the corresponding pixels in the MVP image are shifting approximately regularly in time sequence. And the target trajectory is determined by Hough transform according to the pixel characteristics of the target and the clutter and noise. Comparing with traditional frame-by-frame methods, determining associated trajectories from MVP reduces the computation load. Numerical simulations are presented to demonstrate the effectiveness of the approach proposed.

Cross-axis adaptation improves 3D vestibulo-ocular reflex alignment during chronic stimulation via a head-mounted multichannel vestibular prosthesis

PubMed Central

Dai, Chenkai; Fridman, Gene Y.; Chiang, Bryce; Davidovics, Natan; Melvin, Thuy-Anh; Cullen, Kathleen E.; Della Santina, Charles C.

2012-01-01

By sensing three-dimensional (3D) head rotation and electrically stimulating the three ampullary branches of a vestibular nerve to encode head angular velocity, a multichannel vestibular prosthesis (MVP) can restore vestibular sensation to individuals disabled by loss of vestibular hair cell function. However, current spread to afferent fibers innervating non-targeted canals and otolith endorgans can distort the vestibular nerve activation pattern, causing misalignment between the perceived and actual axis of head rotation. We hypothesized that over time, central neural mechanisms can adapt to correct this misalignment. To test this, we rendered five chinchillas vestibular-deficient via bilateral gentamicin treatment and unilaterally implanted them with a head mounted MVP. Comparison of 3D angular vestibulo-ocular reflex (aVOR) responses during 2 Hz, 50°/s peak horizontal sinusoidal head rotations in darkness on the first, third and seventh days of continual MVP use revealed that eye responses about the intended axis remained stable (at about 70% of the normal gain) while misalignment improved significantly by the end of one week of prosthetic stimulation. A comparable time course of improvement was also observed for head rotations about the other two semicircular canal axes and at every stimulus frequency examined (0.2–5 Hz). In addition, the extent of disconjugacy between the two eyes progressively improved during the same time window. These results indicate that the central nervous system rapidly adapts to multichannel prosthetic vestibular stimulation to markedly improve 3D aVOR alignment within the first week after activation. Similar adaptive improvements are likely to occur in other species, including humans. PMID:21374081

Multi-viewpoint clustering analysis

NASA Technical Reports Server (NTRS)

Mehrotra, Mala; Wild, Chris

1993-01-01

In this paper, we address the feasibility of partitioning rule-based systems into a number of meaningful units to enhance the comprehensibility, maintainability and reliability of expert systems software. Preliminary results have shown that no single structuring principle or abstraction hierarchy is sufficient to understand complex knowledge bases. We therefore propose the Multi View Point - Clustering Analysis (MVP-CA) methodology to provide multiple views of the same expert system. We present the results of using this approach to partition a deployed knowledge-based system that navigates the Space Shuttle's entry. We also discuss the impact of this approach on verification and validation of knowledge-based systems.

Reclaiming Gender and Power in Sexual Violence Prevention in Adolescence.

PubMed

Miller, Elizabeth

2018-03-01

The Mentors in Violence Prevention (MVP) model seeks to address the root causes of gender violence using a bystander approach and leadership training to challenge structures of patriarchy. Emerging research on adolescent relationship abuse and sexual violence points to key modifiable targets-transforming gender norms, addressing homophobia, integrating with comprehensive sexuality education, and acknowledging the needs of youth already exposed to violence. A social justice-based bystander approach such as the MVP model should be part of a multi-level approach to sexual violence prevention that addresses gender and power, encourages healthy sexuality conversations, and provides safety and support for survivors.

Enabling Technologies for Advanced Soft Tissue Modeling

DTIC Science & Technology

2005-09-01

improvements 51 vivo. They also note that the in vivo condition had more to the system for future measurements. The ex vivo 107 recovery between indentations...engineering design via SolidWorks and computer-controlled milling machines (using CamWorks), managed undergraduate teaching fellows ES149 " Muscles ...2002-present (over 100 members, raised $18k) and team MVP (2004), Collegiate National Championship Div 1 competitor (2002-4), organized 100 person

A Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM) for In-Situ Mars Surface Sample Analysis

NASA Technical Reports Server (NTRS)

Edmunson, J.; Gaskin, J. A.; Jerman, G. A.; Harvey, R. P.; Doloboff, I. J.; Neidholdt, E. L.

2016-01-01

The Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM) project, funded by the NASA Planetary Instrument Concepts for the Advancement of Solar System Observations (PICASSO) Research Opportunities in Space and Earth Sciences (ROSES), will build upon previous miniaturized SEM designs and recent advancements in variable pressure SEM's to design and build a SEM to complete analyses of samples on the surface of Mars using the atmosphere as an imaging medium. This project is a collaboration between NASA Marshall Space Flight Center (MSFC), the Jet Propulsion Laboratory (JPL), electron gun and optics manufacturer Applied Physics Technologies, and small vacuum system manufacturer Creare. Dr. Ralph Harvery and environmental SEM (ESEM) inventor Dr. Gerry Danilatos serve as advisors to the team. Variable pressure SEMs allow for fine (nm-scale) resolution imaging and micron-scale chemical study of materials without sample preparation (e.g., carbon or gold coating). Charging of a sample is reduced or eliminated by the gas surrounding the sample. It is this property of ESEMs that make them ideal for locations where sample preparation is not yet feasible, such as the surface of Mars. In addition, the lack of sample preparation needed here will simplify the sample acquisition process and allow caching of the samples for future complementary payload use.

Mean-velocity profile of smooth channel flow explained by a cospectral budget model with wall-blockage

DOE PAGES

McColl, Kaighin A.; Katul, Gabriel G.; Gentine, Pierre; ...

2016-03-16

A series of recent studies has shown that a model of the turbulent vertical velocity variance spectrum (F vv) combined with a simplified cospectral budget can reproduce many macroscopic flow properties of turbulent wall-bounded flows, including various features of the mean-velocity profile (MVP), i.e., the "law of the wall". While the approach reasonably models the MVP's logarithmic layer, the buffer layer displays insufficient curvature compared to measurements. The assumptions are re-examined here using a direct numerical simulation (DNS) dataset at moderate Reynolds number that includes all the requisite spectral and co-spectral information. Starting with several hypotheses for the cause ofmore » the "missing" curvature in the buffer layer, it is shown that the curvature deficit is mainly due to mismatches between (i) the modelled and DNS-observed pressure-strain terms in the cospectral budget and (ii) the DNS-observed F vv and the idealized form used in previous models. By replacing the current parameterization for the pressure-strain term with an expansive version that directly accounts for wall-blocking effects, the modelled and DNS reported pressure-strain profiles match each other in the buffer and logarithmic layers. Forcing the new model with DNS-reported F vv rather than the idealized form previously used reproduces the missing buffer layer curvature to high fidelity thereby confirming the "spectral link" between F vv and the MVP across the full profile. A broad implication of this work is that much of the macroscopic properties of the flow (such as the MVP) may be derived from the energy distribution in turbulent eddies (i.e., F vv) representing the microstate of the flow, provided the link between them accounts for wall-blocking.« less

Diagnostic value of color flow mapping and Doppler echocardiography in the quantification of mitral regurgitation in patients with mitral valve prolapse or rheumatic heart disease.

PubMed

Pinheiro, Aurélio Carvalho; Mancuso, Frederico José Neves; Hemerly, Daniela Fernanda Alli; Kiyose, Alberto Takeshi; Campos, Orlando; de Andrade, José Lázaro; de Paola, Angelo Amato Vicenzo; de Camargo Carvalho, Antonio Carlos; Moises, Valdir Ambrosio

2007-10-01

The objective was to analyze the diagnostic value of the echocardiographic methods used for quantification of mitral regurgitation (MR) in patients with mitral valve prolapse (MVP) or rheumatic heart disease (RHD). The study included 50 patients with MR (mean age of 46.1 years; 35 women), 27 (54%) with RHD and 23 (46%) with MVP. Quantification of the mitral valve regurgitation was obtained by regurgitant orifice area (ROA) and regurgitant volume (RV) by the flow convergence region (FCR) and two-dimensional Doppler echocardiographic methods, regurgitant fraction, jet area (JA), jet area/left atrial area ratio (JA/LAA), and vena contracta (VC). Patients were clinically followed to identify cardiovascular events. Data were analyzed by Pearson, kappa, and receiver operator characteristic curve tests; significance was defined as a P value less than .05. The correlation between the two methods for ROA and RV were r = 0.79 and r = 0.80, respectively, and between these parameters and regurgitant fraction, VC, JA, and JA/LAA varied from r = 0.54 to r = 0.94 (P lt; .05); the agreement varied from kappa = 0.19 to kappa = 0.83. The highest accuracy to identify patients with clinically significant MR (events at follow-up) was 96% for ROA by FCR, 94% for VC, 86% for RV by FCR, and 86% for JA. No method showed a significant difference between MVP and RHD. The methods analyzed had significant correlation and good agreement. ROA by FCR and VC had the best performance to identify severe MR; no significant difference between MVP and RHD was observed.

The Evolution of the Meningitis Vaccine Project

PubMed Central

Tiffay, Kathleen; Jodar, Luis; Kieny, Marie-Paule; Socquet, Muriel; LaForce, F. Marc

2015-01-01

Background. In 2001, the Meningitis Vaccine Project (MVP) was tasked to develop, test, license, and introduce a group A meningococcal (MenA) conjugate vaccine for sub-Saharan Africa. African public health officials emphasized that a vaccine price of less than US$0.50 per dose was necessary to ensure introduction and sustained use of this new vaccine. Methods. Initially, MVP envisioned partnering with a multinational vaccine manufacturer, but the target price and opportunity costs were problematic and formal negotiations ended in 2002. MVP chose to become a “virtual vaccine company,” and over the next decade managed a network of public–private and public–public partnerships for pharmaceutical development, clinical development, and regulatory submission. MVP supported the transfer of key know-how for the production of group A polysaccharide and a new conjugation method to the Serum Institute of India, Ltd, based in Pune, India. A robust staff structure supported by technical consultants and overseen by advisory groups in Europe and Africa ensured that the MenA conjugate vaccine would meet all international standards. Results. A robust project structure including a team of technical consultants and 3 advisory groups in Europe and Africa ensured that the MenA conjugate vaccine (PsA-TT, MenAfriVac) was licensed by the Drug Controller General of India and prequalified by the World Health Organization in June 2010. The vaccine was introduced in Burkina Faso, Mali, and Niger in December 2010. Conclusions. The development, through a public–private partnership, of a safe, effective, and affordable vaccine for sub-Saharan Africa, PsA-TT, offers a new paradigm for the development of vaccines specifically targeting populations in resource-poor countries. PMID:26553666

The Evolution of the Meningitis Vaccine Project.

PubMed

Tiffay, Kathleen; Jodar, Luis; Kieny, Marie-Paule; Socquet, Muriel; LaForce, F Marc

2015-11-15

In 2001, the Meningitis Vaccine Project (MVP) was tasked to develop, test, license, and introduce a group A meningococcal (MenA) conjugate vaccine for sub-Saharan Africa. African public health officials emphasized that a vaccine price of less than US$0.50 per dose was necessary to ensure introduction and sustained use of this new vaccine. Initially, MVP envisioned partnering with a multinational vaccine manufacturer, but the target price and opportunity costs were problematic and formal negotiations ended in 2002. MVP chose to become a "virtual vaccine company," and over the next decade managed a network of public-private and public-public partnerships for pharmaceutical development, clinical development, and regulatory submission. MVP supported the transfer of key know-how for the production of group A polysaccharide and a new conjugation method to the Serum Institute of India, Ltd, based in Pune, India. A robust staff structure supported by technical consultants and overseen by advisory groups in Europe and Africa ensured that the MenA conjugate vaccine would meet all international standards. A robust project structure including a team of technical consultants and 3 advisory groups in Europe and Africa ensured that the MenA conjugate vaccine (PsA-TT, MenAfriVac) was licensed by the Drug Controller General of India and prequalified by the World Health Organization in June 2010. The vaccine was introduced in Burkina Faso, Mali, and Niger in December 2010. The development, through a public-private partnership, of a safe, effective, and affordable vaccine for sub-Saharan Africa, PsA-TT, offers a new paradigm for the development of vaccines specifically targeting populations in resource-poor countries. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Reexamining the minimum viable population concept for long-lived species.

PubMed

Shoemaker, Kevin T; Breisch, Alvin R; Jaycox, Jesse W; Gibbs, James P

2013-06-01

For decades conservation biologists have proposed general rules of thumb for minimum viable population size (MVP); typically, they range from hundreds to thousands of individuals. These rules have shifted conservation resources away from small and fragmented populations. We examined whether iteroparous, long-lived species might constitute an exception to general MVP guidelines. On the basis of results from a 10-year capture-recapture study in eastern New York (U.S.A.), we developed a comprehensive demographic model for the globally threatened bog turtle (Glyptemys muhlenbergii), which is designated as endangered by the IUCN in 2011. We assessed population viability across a wide range of initial abundances and carrying capacities. Not accounting for inbreeding, our results suggest that bog turtle colonies with as few as 15 breeding females have >90% probability of persisting for >100 years, provided vital rates and environmental variance remain at currently estimated levels. On the basis of our results, we suggest that MVP thresholds may be 1-2 orders of magnitude too high for many long-lived organisms. Consequently, protection of small and fragmented populations may constitute a viable conservation option for such species, especially in a regional or metapopulation context. © 2013 Society for Conservation Biology.

Multi-satellites normalization of the FengYun-2s visible detectors by the MVP method

NASA Astrophysics Data System (ADS)

Li, Yuan; Rong, Zhi-guo; Zhang, Li-jun; Sun, Ling; Xu, Na

2013-08-01

After January 13, 2012, FY-2F had successfully launched, the total number of the in orbit operating FengYun-2 geostationary meteorological satellites reached three. For accurate and efficient application of multi-satellite observation data, the study of the multi-satellites normalization of the visible detector was urgent. The method required to be non-rely on the in orbit calibration. So as to validate the calibration results before and after the launch; calculate day updating surface bidirectional reflectance distribution function (BRDF); at the same time track the long-term decay phenomenon of the detector's linearity and responsivity. By research of the typical BRDF model, the normalization method was designed. Which could effectively solute the interference of surface directional reflectance characteristics, non-rely on visible detector in orbit calibration. That was the Median Vertical Plane (MVP) method. The MVP method was based on the symmetry of principal plane, which were the directional reflective properties of the general surface targets. Two geostationary satellites were taken as the endpoint of a segment, targets on the intersecting line of the segment's MVP and the earth surface could be used as a normalization reference target (NRT). Observation on the NRT by two satellites at the moment the sun passing through the MVP brought the same observation zenith, solar zenith, and opposite relative direction angle. At that time, the linear regression coefficients of the satellite output data were the required normalization coefficients. The normalization coefficients between FY-2D, FY-2E and FY-2F were calculated, and the self-test method of the normalized results was designed and realized. The results showed the differences of the responsivity between satellites could up to 10.1%(FY-2E to FY-2F); the differences of the output reflectance calculated by the broadcast calibration look-up table could up to 21.1%(FY-2D to FY-2F); the differences of the output reflectance from FY-2D and FY-2E calculated by the site experiment results reduced to 2.9%(13.6% when using the broadcast table). The normalized relative error was also calculated by the self-test method, which was less than 0.2%.

Influence of dentinal regions on bond strengths of different adhesive systems.

PubMed

Ozer, F; Unlü, N; Sengun, A

2003-06-01

This in vitro study assessed comparatively the shear bond strengths of three composite resins, 3M Valux Plus (3MVP), Herculite (H), Clearfil AP-X (CAP-X), a polyacid modified composite resin Dyract (D), and a resin modified glass-ionomer materials Vitremer (V), to cervical and buccal dentine regions of extracted human molar teeth. Four different bonding systems, 3M ScotchBond Multipurpose (SB), Clearfil Liner Bond 2 (LB2), Opti Bond (OB), and Prime & Bond 2.1 (PB 2.1) were used with the manufacturer's respective composite and compomer materials. One hundred freshly extracted mandibular molar teeth were selected for this study. Flat buccal dentine surfaces were created on 50 teeth and cylindrical rods of the five materials were bonded to the dentine surfaces. For assessment of cervical bond strengths, the materials were bonded to mesial and distal enamel bordered occlusal dentinal surfaces of the remaining 50 teeth. The five groups of restorative procedures were applied as follows; Group 1: SB + 3MVP, Group 2: LB2 + CAP-X, Group 3: OB + H, Group 4: PB2.1 + D, Group 5: Vitremer primer (VP) VP + V. Each restorative procedure thus had 20 specimens (10 buccal + 10 cervical). After 24 h of water storage (37 degrees C), the specimens were tested on a Universal Testing machine in shear with a cross head speed of 0.5 mm min-1. The bond strength values were calculated in MPa and the results were evaluated statistically using Kruskal-Wallis one-way/anova and Mann-Whitney U-tests. It was found that the bond strengths of SB + 3MVP, LB2 + CAP-X and VP + V to buccal dentine surfaces were significantly stronger (P < 0.05) than those to the occluso-cervical dentine floors. When the bond strengths to the occluso-cervical dentine and buccal dentine surface were compared, there was no significant difference between the materials (P > 0.05). Vitremer was found the least successful adhesive material in terms of shear bond strength on both buccal and occluso-cervical dentine surfaces.

PC-SEAPAK - ANALYSIS OF COASTAL ZONE COLOR SCANNER AND ADVANCED VERY HIGH RESOLUTION RADIOMETER DATA

NASA Technical Reports Server (NTRS)

Mcclain, C. R.

1994-01-01

PC-SEAPAK is a user-interactive satellite data analysis software package specifically developed for oceanographic research. The program is used to process and interpret data obtained from the Nimbus-7/Coastal Zone Color Scanner (CZCS), and the NOAA Advanced Very High Resolution Radiometer (AVHRR). PC-SEAPAK is a set of independent microcomputer-based image analysis programs that provide the user with a flexible, user-friendly, standardized interface, and facilitates relatively low-cost analysis of oceanographic satellite data. Version 4.0 includes 114 programs. PC-SEAPAK programs are organized into categories which include CZCS and AVHRR level-1 ingest, level-2 analyses, statistical analyses, data extraction, remapping to standard projections, graphics manipulation, image board memory manipulation, hardcopy output support and general utilities. Most programs allow user interaction through menu and command modes and also by the use of a mouse. Most programs also provide for ASCII file generation for further analysis in spreadsheets, graphics packages, etc. The CZCS scanning radiometer aboard the NIMBUS-7 satellite was designed to measure the concentration of photosynthetic pigments and their degradation products in the ocean. AVHRR data is used to compute sea surface temperatures and is supported for the NOAA 6, 7, 8, 9, 10, 11, and 12 satellites. The CZCS operated from November 1978 to June 1986. CZCS data may be obtained free of charge from the CZCS archive at NASA/Goddard Space Flight Center. AVHRR data may be purchased through NOAA's Satellite Data Service Division. Ordering information is included in the PC-SEAPAK documentation. Although PC-SEAPAK was developed on a COMPAQ Deskpro 386/20, it can be run on most 386-compatible computers with an AT bus, EGA controller, Intel 80387 coprocessor, and MS-DOS 3.3 or higher. A Matrox MVP-AT image board with appropriate monitor and cables is also required. Note that the authors have received some reports of incompatibilities between the MVP-AT image board and ZENITH computers. Also, the MVP-AT image board is not necessarily compatible with 486-based systems; users of 486-based systems should consult with Matrox about compatibility concerns. Other PC-SEAPAK requirements include a Microsoft mouse (serial version), 2Mb RAM, and 100Mb hard disk space. For data ingest and backup, 9-track tape, 8mm tape and optical disks are supported and recommended. PC-SEAPAK has been under development since 1988. Version 4.0 was updated in 1992, and is distributed without source code. It is available only as a set of 36 1.2Mb 5.25 inch IBM MS-DOS format diskettes. PC-SEAPAK is a copyrighted product with all copyright vested in the National Aeronautics and Space Administration. Phar Lap's DOS_Extender run-time version is integrated into several of the programs; therefore, the PC-SEAPAK programs may not be duplicated. Three of the distribution diskettes contain DOS_Extender files. One of the distribution diskettes contains Media Cybernetics' HALO88 font files, also licensed by NASA for dissemination but not duplication. IBM is a registered trademark of International Business Machines. MS-DOS is a registered trademark of Microsoft Corporation. HALO88 is a registered trademark of Media Cybernetics, but the product was discontinued in 1991.

Immobilization of recombinant vault nanoparticles on solid substrates.

PubMed

Xia, Yun; Ramgopal, Yamini; Li, Hai; Shang, Lei; Srinivas, Parisa; Kickhoefer, Valerie A; Rome, Leonard H; Preiser, Peter R; Boey, Freddy; Zhang, Hua; Venkatraman, Subbu S

2010-03-23

Native vaults are nanoscale particles found abundantly in the cytoplasm of most eukaryotic cells. They have a capsule-like structure with a thin shell surrounding a "hollow" interior compartment. Recombinant vault particles were found to self-assemble following expression of the major vault protein (MVP) in a baculovirus expression system, and these particles are virtually identical to native vaults. Such particles have been recently studied as potential delivery vehicles. In this study, we focus on immobilization of vault particles on a solid substrate, such as glass, as a first step to study their interactions with cells. To this end, we first engineered the recombinant vaults by fusing two different tags to the C-terminus of MVP, a 3 amino acid RGD peptide and a 12 amino acid RGD-strep-tag peptide. We have demonstrated two strategies for immobilizing vaults on solid substrates. The barrel-and-cap structure of vault particles was observed for the first time, by atomic force microscopy (AFM), in a dry condition. This work proved the feasibility of immobilizing vault nanoparticles on a material surface, and the possibility of using vault nanoparticles as localized and sustainable drug carriers as well as a biocompatible surface moiety.

Simulations of Liners and Test Objects for a New Atlas Advanced Radiography Source

DOE Office of Scientific and Technical Information (OSTI.GOV)

D. V. Morgan; S. Iversen; R. A. Hilko

2002-06-01

The Advanced Radiographic Source (ARS) will improve the data significantly due to its smaller source width. Because of the enhanced ARS output, larger source-to-object distances are a reality. The harder ARS source will allow radiography of thick high-Z targets. The five different spectral simulations resulted in similar imaging detector weighted transmission. This work used a limited set of test objects and imaging detectors. Other test objects and imaging detectors could possibly change the MVp-sensitivity result. The effect of material motion blur must be considered for the ARS due to the expected smaller X-ray source size. This study supports the originalmore » 1.5-MVp value.« less

Provoked vestibulodynia-women's experience of participating in a multidisciplinary vulvodynia program.

PubMed

Sadownik, Leslie A; Seal, Brooke N; Brotto, Lori A

2012-04-01

Provoked Vestibulodynia (PVD) is the most common cause of pain with intercourse that affects reproductively aged women. The treatment outcome literature suggests that existing treatments, when administered individually, may have only limited benefits for improving pain, and that multidisciplinary approaches may be more effective for reducing pain and pain-associated distress. A program that offers education, group cognitive behavioral therapy, pelvic floor physiotherapy, and medical appointments was developed and implemented at our hospital site. To explore the experiences of women who participated in the Multidisciplinary Vulvodynia Program (MVP) in order to identify the perceived benefits of this program. Qualitative retrospective study. A semi-structured interview format was used to interview graduates of the MVP. Nineteen women, mean age 30.8 (20-54 years), participated in a one-on-one in-depth interview with a trained interviewer. The key question asked was "What has been the impact of the mvp on your life?" interviews were audio-recorded, transcribed, and qualitatively analyzed for major themes. Content analysis of interview transcripts. Five main themes emerged and included: increased knowledge, gained tools/skills, perceived improved mood/psychological well-being, a sense of validation and support, and an enhanced sense of empowerment. Overall, a multidisciplinary vulvodynia program was perceived as being beneficial for women with PVD. © 2012 International Society for Sexual Medicine.

Impact of a multidisciplinary vulvodynia program on sexual functioning and dyspareunia.

PubMed

Brotto, Lori A; Yong, Paul; Smith, Kelly B; Sadownik, Leslie A

2015-01-01

For many years, multidisciplinary approaches, which integrate psychological, physical, and medical treatments, have been shown to be effective for the treatment of chronic pain. To date, there has been anecdotal support, but little empirical data, to justify the application of this multidisciplinary approach toward the treatment of chronic sexual pain secondary to provoked vestibulodynia (PVD). This study aimed to evaluate a 10-week hospital-based treatment (multidisciplinary vulvodynia program [MVP]) integrating psychological skills training, pelvic floor physiotherapy, and medical management on the primary outcomes of dyspareunia and sexual functioning, including distress. A total of 132 women with a diagnosis of PVD provided baseline data and agreed to participate in the MVP. Of this group, n = 116 (mean age 28.4 years, standard deviation 7.1) provided complete data at the post-MVP assessment, and 84 women had complete data through to the 3- to 4-month follow-up period. There were high levels of avoidance of intimacy (38.1%) and activities that elicited sexual arousal (40.7%), with many women (50.4%) choosing to focus on their partner's sexual arousal and satisfaction at baseline. With treatment, over half the sample (53.8%) reported significant improvements in dyspareunia. Following the MVP, there were strong significant effects for the reduction in dyspareunia (P = 0.001) and sex-related distress (P < 0.001), and improvements in sexual arousal (P < 0.001) and overall sexual functioning (P = 0.001). More modest but still statistically significant were improvements in sexual desire, lubrication, orgasmic function, and sexual satisfaction. All improvements were retained at 2- to 3-month follow-up. This study provides strong support for the efficacy of a multidisciplinary approach (psychological, pelvic floor physiotherapy, and medical management) for improving dyspareunia and all domains of sexual functioning among women with PVD. The study also highlights the benefits of incorporating sexual health education into general pain management strategies for this population. © 2014 International Society for Sexual Medicine.

Production and Characterization of Bacillus thuringiensis Cry1Ac-Resistant Cotton Bollworm Helicoverpa zea (Boddie)▿

PubMed Central

Anilkumar, Konasale J.; Rodrigo-Simón, Ana; Ferré, Juan; Pusztai-Carey, Marianne; Sivasupramaniam, Sakuntala; Moar, William J.

2008-01-01

Laboratory-selected Bacillus thuringiensis-resistant colonies are important tools for elucidating B. thuringiensis resistance mechanisms. However, cotton bollworm, Helicoverpa zea, a target pest of transgenic corn and cotton expressing B. thuringiensis Cry1Ac (Bt corn and cotton), has proven difficult to select for stable resistance. Two populations of H. zea (AR and MR), resistant to the B. thuringiensis protein found in all commercial Bt cotton varieties (Cry1Ac), were established by selection with Cry1Ac activated toxin (AR) or MVP II (MR). Cry1Ac toxin reflects the form ingested by H. zea when feeding on Bt cotton, whereas MVP II is a Cry1Ac formulation used for resistance selection and monitoring. The resistance ratio (RR) for AR exceeded 100-fold after 11 generations and has been maintained at this level for nine generations. This is the first report of stable Cry1Ac resistance in H. zea. MR crashed after 11 generations, reaching only an RR of 12. AR was only partially cross-resistant to MVP II, suggesting that MVP II does not have the same Cry1Ac selection pressure as Cry1Ac toxin against H. zea and that proteases may be involved with resistance. AR was highly cross-resistant to Cry1Ab toxin but only slightly cross-resistant to Cry1Ab expressing corn leaf powder. AR was not cross-resistant to Cry2Aa2, Cry2Ab2-expressing corn leaf powder, Vip3A, and cypermethrin. Toxin-binding assays showed no significant differences, indicating that resistance was not linked to a reduction in binding. These results aid in understanding why this pest has not evolved B. thuringiensis resistance, and highlight the need to choose carefully the form of B. thuringiensis protein used in experiments. PMID:18024681

The 193-Kd Vault Protein, Vparp, Is a Novel Poly(Adp-Ribose) Polymerase

PubMed Central

Kickhoefer, Valerie A.; Siva, Amara C.; Kedersha, Nancy L.; Inman, Elisabeth M.; Ruland, Cristina; Streuli, Michel; Rome, Leonard H.

1999-01-01

Mammalian vaults are ribonucleoprotein (RNP) complexes, composed of a small ribonucleic acid and three proteins of 100, 193, and 240 kD in size. The 100-kD major vault protein (MVP) accounts for >70% of the particle mass. We have identified the 193-kD vault protein by its interaction with the MVP in a yeast two-hybrid screen and confirmed its identity by peptide sequence analysis. Analysis of the protein sequence revealed a region of ∼350 amino acids that shares 28% identity with the catalytic domain of poly(ADP-ribose) polymerase (PARP). PARP is a nuclear protein that catalyzes the formation of ADP-ribose polymers in response to DNA damage. The catalytic domain of p193 was expressed and purified from bacterial extracts. Like PARP, this domain is capable of catalyzing a poly(ADP-ribosyl)ation reaction; thus, the 193-kD protein is a new PARP. Purified vaults also contain the poly(ADP-ribosyl)ation activity, indicating that the assembled particle retains enzymatic activity. Furthermore, we show that one substrate for this vault-associated PARP activity is the MVP. Immunofluorescence and biochemical data reveal that p193 protein is not entirely associated with the vault particle, suggesting that it may interact with other protein(s). A portion of p193 is nuclear and localizes to the mitotic spindle. PMID:10477748

Miniature Variable Pressure Scanning Electron Microscope for In-Situ Imaging and Chemical Analysis

NASA Technical Reports Server (NTRS)

Gaskin, Jessica A.; Jerman, Gregory; Gregory, Don; Sampson, Allen R.

2012-01-01

NASA Marshall Space Flight Center (MSFC) is leading an effort to develop a Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM) for in-situ imaging and chemical analysis of uncoated samples. This instrument development will be geared towards operation on Mars and builds on a previous MSFC design of a mini-SEM for the moon (funded through the NASA Planetary Instrument Definition and Development Program). Because Mars has a dramatically different environment than the moon, modifications to the MSFC lunar mini-SEM are necessary. Mainly, the higher atmospheric pressure calls for the use of an electron gun that can operate at High Vacuum, rather than Ultra-High Vacuum. The presence of a CO2-rich atmosphere also allows for the incorporation of a variable pressure system that enables the in-situ analysis of nonconductive geological specimens. Preliminary testing of Mars meteorites in a commercial Environmental SEM(Tradmark) (FEI) confirms the usefulness of lowcurrent/low-accelerating voltage imaging and highlights the advantages of using the Mars atmosphere for environmental imaging. The unique capabilities of the MVP-SEM make it an ideal tool for pursuing key scientific goals of NASA's Flagship Mission Max-C; to perform in-situ science and collect and cache samples in preparation for sample return from Mars.

Mitral Valve Prolapse

MedlinePlus

... valve syndrome . What happens during MVP? Watch an animation of mitral valve prolapse When the heart pumps ( ... our brochures Popular Articles 1 Understanding Blood Pressure Readings 2 Sodium and Salt 3 Heart Attack Symptoms ...

Mitral Valve Prolapse

MedlinePlus

... valve. MVP puts you at risk for infective endocarditis, a kind of heart infection. To prevent it, ... surgeries. Now, only people at high risk of endocarditis need the antibiotics. NIH: National Heart, Lung, and ...

Vision function testing for a suprachoroidal retinal prosthesis: effects of image filtering

NASA Astrophysics Data System (ADS)

Barnes, Nick; Scott, Adele F.; Lieby, Paulette; Petoe, Matthew A.; McCarthy, Chris; Stacey, Ashley; Ayton, Lauren N.; Sinclair, Nicholas C.; Shivdasani, Mohit N.; Lovell, Nigel H.; McDermott, Hugh J.; Walker, Janine G.; BVA Consortium,the

2016-06-01

Objective. One strategy to improve the effectiveness of prosthetic vision devices is to process incoming images to ensure that key information can be perceived by the user. This paper presents the first comprehensive results of vision function testing for a suprachoroidal retinal prosthetic device utilizing of 20 stimulating electrodes. Further, we investigate whether using image filtering can improve results on a light localization task for implanted participants compared to minimal vision processing. No controlled implanted participant studies have yet investigated whether vision processing methods that are not task-specific can lead to improved results. Approach. Three participants with profound vision loss from retinitis pigmentosa were implanted with a suprachoroidal retinal prosthesis. All three completed multiple trials of a light localization test, and one participant completed multiple trials of acuity tests. The visual representations used were: Lanczos2 (a high quality Nyquist bandlimited downsampling filter); minimal vision processing (MVP); wide view regional averaging filtering (WV); scrambled; and, system off. Main results. Using Lanczos2, all three participants successfully completed a light localization task and obtained a significantly higher percentage of correct responses than using MVP (p≤slant 0.025) or with system off (p\\lt 0.0001). Further, in a preliminary result using Lanczos2, one participant successfully completed grating acuity and Landolt C tasks, and showed significantly better performance (p=0.004) compared to WV, scrambled and system off on the grating acuity task. Significance. Participants successfully completed vision tasks using a 20 electrode suprachoroidal retinal prosthesis. Vision processing with a Nyquist bandlimited image filter has shown an advantage for a light localization task. This result suggests that this and targeted, more advanced vision processing schemes may become important components of retinal prostheses to enhance performance. ClinicalTrials.gov Identifier: NCT01603576.

The Impact of a Woman's Dyspareunia and Its Treatment on Her Intimate Partner: A Qualitative Analysis.

PubMed

Sadownik, Leslie A; Smith, Kelly B; Hui, Amber; Brotto, Lori A

2017-08-18

This study explored the experiences of male partners of women with dyspareunia, secondary to provoked vestibulodynia (PVD), who participated in the Multidisciplinary Vulvodynia Program (MVP). Participants were 16 men between 22 and 45 years of age. Data were collected with semi-structured interviews and analyzed for themes. Men were interviewed about (a) the impact of the woman's PVD on themselves; and (b) the impact of the MVP on themselves. Participants experienced negative psychological effects (e.g., guilt) in addition to activating emotions (e.g., frustration). They reported diminished quantity and quality of sex. In the relationship, PVD caused strain, communication challenges, and possibilities for growth. The benefits, perceived by the partner, of the women participating in the treatment program included improvements in knowledge, communication, and psychological and sexual health.

Space-to-Ground: Color of the Sun: 04/27/2018

NASA Image and Video Library

2018-04-26

NASA has a new administrator, a facility stands out as a "MVP", and just what color is the Sun? NASA's Space to Ground is your weekly update on what's happening aboard the International Space Station.

BTS randomised feasibility study of active symptom control with or without chemotherapy in malignant pleural mesothelioma: ISRCTN 54469112.

PubMed

Muers, M F; Rudd, R M; O'Brien, M E R; Qian, W; Hodson, A; Parmar, M K B; Girling, D J

2004-02-01

The incidence of mesothelioma is rising rapidly in the UK. There is no generally accepted standard treatment. The BTS recommends active symptom control (ASC). It is not known whether chemotherapy in addition prolongs survival or provides worthwhile palliation with acceptable toxicity. Palliation as recorded by patients has been fully reported for only two regimens: mitomycin, vinblastine, and cisplatin (MVP), and vinorelbine (N). The BTS and collaborators planned to conduct a phase III randomised trial comparing ASC only, ASC+MVP, and ASC+N in 840 patients with survival as the primary outcome measure. The aim of the present study was to assess the acceptability of the trial design to patients and the suitability of two standard quality of life (QL) questionnaires for mesothelioma. Collaborating centres registered all new patients with mesothelioma. Those eligible and giving informed consent completed EORTC QLQ-C30+LC13 and FACT-L QL questionnaires and were randomised between all three or any two of (1) ASC only, (2) ASC+4 cycles of MVP, and (3) ASC+12 weekly doses of N. During 1 year, 242 patients were registered of whom 109 (45%) were randomised (55% of the 197 eligible patients). Fifty two patients from 20 centres were randomised to an option including ASC only. This translates into a rate of 312 per year from 60 centres interested in collaborating in the phase III trial. The EORTC QL questionnaire was superior to FACT-L in terms of completeness of data and patient preference. Clinically relevant palliation was achieved with ASC. The planned phase III trial is feasible.

The mathematical statement for the solving of the problem of N-version software system design

NASA Astrophysics Data System (ADS)

Kovalev, I. V.; Kovalev, D. I.; Zelenkov, P. V.; Voroshilova, A. A.

2015-10-01

The N-version programming, as a methodology of the fault-tolerant software systems design, allows successful solving of the mentioned tasks. The use of N-version programming approach turns out to be effective, since the system is constructed out of several parallel executed versions of some software module. Those versions are written to meet the same specification but by different programmers. The problem of developing an optimal structure of N-version software system presents a kind of very complex optimization problem. This causes the use of deterministic optimization methods inappropriate for solving the stated problem. In this view, exploiting heuristic strategies looks more rational. In the field of pseudo-Boolean optimization theory, the so called method of varied probabilities (MVP) has been developed to solve problems with a large dimensionality.

Ada Compiler Validation Summary Report: Certificate Number 910705S1. 11192 InterAct Corporation InterAct Ada Mips Cross-Compiler System, Release 2.0 MicroVAX 3100 Cluster = Lockheed Sanders STAR MVP R3000/R3010 board (Bare Machine).

DTIC Science & Technology

1991-07-31

have floating-point type declarations requiring more digits than SYSTEM.MAXDIGITS: C24113L..Y (14 tests) C35705L..Y (14 tests) C357C6L..Y (14 tests...2_147_483_648..2_147_483_647; type FLOAT is digits 6 range -2#l.0#E128.. 2#0.IIIIIIIIIIIIIIIIIIIII#El28; type LONGFLOAT is digits 15 range -2#l.0#EI024.. 2...are instan- tated into libary packages or subprograms.) F-14 Appendix F of the Ada Reference Manual F.8.1. Address Clauses for Variables Address

Insulin use, adipokine profiles and breast cancer prognosis.

PubMed

Wintrob, Zachary A P; Hammel, Jeffrey P; Khoury, Thaer; Nimako, George K; Fu, Hsin-Wei; Fayazi, Zahra S; Gaile, Dan P; Forrest, Alan; Ceacareanu, Alice C

2017-01-01

Type-2 diabetes mellitus (T2DM) and breast cancer (BC) share common cytokine signaling changes resultant from adipose tissue dysfunction. This modified adipokine signaling was shown to be directly associated with changes in the body mass index (BMI) and diet and it is expected to also be influenced by T2DM pharmacotherapy. We evaluated the relationship between pre-existing diabetes treatment, circulating adipokine levels at cancer diagnosis, and long-term outcomes. All incident BC cases were reviewed (01/01/2003-12/31/2009, N=2194). Each of the subjects with baseline T2DM (cases) was matched with two other subjects without T2DM (controls) based on the following criteria: age, BMI, ethnicity, menopausal status and tumor stage. All cases and controls with available baseline plasma and tumor biopsies, and being surgery and BC treatment naïve, were included (N 1 =97, N 2 =194). Clinical history and vital status were documented. Adipokine levels (adiponectin, leptin, TNF-α, CRP, IL-1β, IL-1Ra, IL-6, and C-peptide) were assessed by either ELISA or Luminex® assays. Cancer outcomes were assessed by Kaplan-Meier analysis; associations between categorical variables were assessed by Fisher's exact test, categorical and continuous variables by Kruskal-Wallis or Wilcoxon Rank-Sum test, where appropriate. Multivariate adjustments (MVP, multivariate p-value) were performed accounting for age, tumor stage, BMI, estrogen receptor (ER) status and cumulative comorbidity. All biomarker correlations were assessed by the Pearson method. Utilization of insulin and insulin secretagogues was associated with ER (-) phenotype (p=0.008, p=0.043) and poorer BC outcomes (p=0.012, p=0.033). Insulin users were found to have lower C-peptide and higher IL-6, TNF-α and CRP levels, of which elevated CRP and TNF-α were associated with poorer BC outcomes (p=0.003, MVP=0.210). Insulin remarked by higher leptin levels as compared to controls (p=0.052), but did not differ significantly from non-users. Although lower adiponectin levels were observed among non-insulin users as compared to controls (p<0.001, MVP=0.006), insulin use seemed to have restored adiponectin production. C-peptide levels were lower among insulin users as compared to non-users (p<0.001, MVP<0.001) and approached levels comparable with those of the controls. In the overall dataset, C-peptide lower than 0.75ng/ml were strongly associated with poorer survival (p=0.007, MVP=0.002). Among insulin users, C-peptide levels were inversely correlated with IL-1β and IL-1Ra levels only after full adjustment (p=0.012, p=0.030); the correlation was unremarkable in other groups. Insulin use is associated with elevated leptin, CRP, TNFα, and lower C-peptide and also linked to poor BC outcomes. More research is needed to verify these findings; however, we are among the first to correlate pharmacotherapy use, measures of adipose tissue dysfunction and cancer outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

MVP and Faculty Evaluation

ERIC Educational Resources Information Center

Theall, Michael

2017-01-01

This chapter considers faculty evaluation and motivational and volitional issues. The focus is on the ways in which faculty evaluation influences not only faculty attitudes and beliefs but also willingness to engage in professional development and instructional improvement programs. Recommendations for effective practice that enhances motivation…

Computerized whole slide quantification shows increased microvascular density in pT2 prostate cancer as compared to normal prostate tissue.

PubMed

van Niekerk, Cornelis G; van der Laak, Jeroen A W M; Börger, M Elisa; Huisman, Henk-Jan; Witjes, J Alfred; Barentsz, Jelle O; Hulsbergen-van de Kaa, Christina A

2009-01-01

Contrast enhanced imaging enables powerful, non-invasive diagnostics, important for detection and staging of early prostate cancer. The uptake of contrast agent is increased in prostate cancer as compared to normal prostate tissue. To reveal the underlying physiological mechanisms, quantification of tissue components in pathology specimens may yield important information. Aim of this study was to investigate whether microvascularity is increased in prostate confined cancer (pT2). Radical prostatectomy specimens of 26 patients were selected for organ confined peripheral zone tumors which were restricted to one side of the prostate. Microvessels were visualized by immunohistochemistry against CD31. Specimens were scanned using a computer controlled microscope and scanning stage and vessels were recognized automatically. Pseudocolor mappings were produced showing number of vascular profiles (MVD), vascular area (MVA) and perimeter (MVP) in an overview of the entire prostate transection. MVD is a common measure for vascularity, whereas MVA represents the 3D vascular volume and MVP the perfused surface area. Mean, coefficient of variation and 75th percentile of these parameters were calculated automatically in manually indicated areas, consisting of the entire tumor area and the corresponding normal area in the contra lateral side of the prostate. The mappings clearly indicate areas of increased vascularity in prostate transections. In tumor tissue an increase was found compared to normal tissue of 81%, 49%, and 62% for mean MVD, mean MVA and mean MVP, respectively (P < 0.001 for all comparisons). In contrast, the heterogeneity in tumor vasculature was significantly decreased as compared to normal prostate (P < 0.001). Characteristics of microvasculature deviated significantly in pT2 prostate tumor as compared to normal tissue. Copyright 2008 Wiley-Liss, Inc.

Dogs with heart diseases causing turbulent high-velocity blood flow have changes in platelet function and von Willebrand factor multimer distribution.

PubMed

Tarnow, Inge; Kristensen, Annemarie T; Olsen, Lisbeth H; Falk, Torkel; Haubro, Lotte; Pedersen, Lotte G; Pedersen, Henrik D

2005-01-01

The purpose of this prospective study was to investigate platelet function using in vitro tests based on both high and low shear rates and von Willebrand factor (vWf) multimeric composition in dogs with cardiac disease and turbulent high-velocity blood flow. Client-owned asymptomatic, untreated dogs were divided into 4 groups: 14 Cavalier King Charles Spaniels (Cavaliers) with mitral valve prolapse (MVP) and no or minimal mitral regurgitation (MR), 17 Cavaliers with MVP and moderate to severe MR, 14 control dogs, and 10 dogs with subaortic stenosis (SAS). Clinical examinations and echocardiography were performed in all dogs. PFA100 closure times (the ability of platelets to occlude a hole in a membrane at high shear rates), platelet activation markers (plasma thromboxane B2 concentration, platelet surface P-selectin expression), platelet aggregation (in whole blood and platelet-rich plasma with 3 different agonists), and vWf multimers were analyzed. Cavaliers with moderate to severe MR and dogs with SAS had longer closure times and a lower percentage of the largest vWf multimers than did controls. Maximal aggregation responses were unchanged in dogs with SAS but enhanced in Cavaliers with MVP (regardless of MR status) compared with control dogs. No significant difference in platelet activation markers was found among groups. The data suggest that a form of platelet dysfunction detected at high shear rates was present in dogs with MR and SAS, possibly associated with a qualitative vWf defect. Aggregation results suggest increased platelet reactivity in Cavaliers, but the platelets did not appear to circulate in a preactivated state in either disease.

The Meningitis Vaccine Project.

PubMed

LaForce, F Marc; Konde, Kader; Viviani, Simonetta; Préziosi, Marie-Pierre

2007-09-03

Epidemic meningococcal meningitis is an important public health problem in sub-Saharan Africa. Current control measures rely on reactive immunizations with polysaccharide (PS) vaccines that do not induce herd immunity and are of limited effectiveness in those under 2 years of age. Conversely, polysaccharide conjugate vaccines are effective in infants and have consistently shown an important effect on decreasing carriage, two characteristics that facilitate disease control. In 2001 the Meningitis Vaccine Project (MVP) was created as a partnership between PATH and the World Health Organization (WHO) with the goal of eliminating meningococcal epidemics in Africa through the development, licensure, introduction, and widespread use of conjugate meningococcal vaccines. Since group A Neisseria meningitidis (N. meningitidis) is the dominant pathogen causing epidemic meningitis in Africa MVP is developing an affordable (US$ 0.40 per dose) meningococcal A (Men A) conjugate vaccine through an innovative international partnership that saw transfer of a conjugation and fermentation technology to a developing country vaccine manufacturer. A Phase 1 study of the vaccine in India has shown that the product is safe and immunogenic. Phase 2 studies have begun in Africa, and a large demonstration study of the conjugate vaccine is envisioned for 2008-2009. After extensive consultations with African public health officials a vaccine introduction plan has been developed that includes introduction of the Men A conjugate vaccine into standard Expanded Programme on Immunization (EPI) schedules but also emphasizes mass vaccination of 1-29 years old to induce herd immunity, a strategy that has been shown to be highly effective when the meningococcal C (Men C) conjugate vaccine was introduced in several European countries. The MVP model is a clear example of the usefulness of a "push mechanism" to finance the development of a needed vaccine for the developing world.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richter, Christian; Pawelke, Joerg; Karsch, Leonhard

Purpose: The aim of this article is to investigate the energy dependence of the radiochromic film type, Gafchromic EBT-1, when scanned with a flatbed scanner for film readout. Methods: Dose response curves were determined for 12 different beam qualities ranging from a 10 kVp x-ray beam to a 15 MVp x-ray beam and include also two high energy electron beam qualities (6 and 18 MeV). The dose responses measured as net optical density (netOD) for the different beam qualities were normalized to the response of a reference beam quality (6 MVp). Results: A strong systematic energy dependence of the filmmore » response was found. The lower the effective beam energy, the less sensitive the EBT-1 films get. The maximum decrease in dose for the same film response between the 25 kVp and 6 MVp beam qualities was 44%. Additionally, a difference in energy dependence for different doses was discovered, meaning that higher doses show a smaller dependency on energy than lower doses. The maximum decrease in the normalized netOD was found to be 25% for a dose of 0.5 Gy relative to the normalized netOD for 10 Gy. Moreover, a scaling procedure is introduced, allowing the correction of the energy dependence for the investigated beam qualities and also for comparable x-ray beam qualities within the energy range studied. Conclusions: A strong energy dependence for EBT-1 radiochromic films was found. The films were readout with a flatbed scanner. If the effective beam energy is known, the energy dependence can be corrected with the introduced scaling procedure. Further investigation of the influence of the spectral band of the readout device on energy dependence is needed to understand the reason for the different energy dependences found in this and previous works.« less

Empirical Study: Mentorship as a Value Proposition (MVP)

ERIC Educational Resources Information Center

Sams, Doreen; Richards, Rosalie; Lewis, Robin; McMullen, Rebecca; Hammack, Jennifer; Bacnik, Larry; Powell, Caitlin

2016-01-01

Greater access to college education, owed in part to technology and globalization, increases opportunities for students to prepare and thrive professionally. Undergraduate education must offer pedagogies of engagement to meet needs of the competitive global workforce and post-baccalaureate programs requiring advanced research and analytical…

Artificial intelligence applications of fast optical memory access

NASA Astrophysics Data System (ADS)

Henshaw, P. D.; Todtenkopf, A. B.

The operating principles and performance of rapid laser beam-steering (LBS) techniques are reviewed and illustrated with diagrams; their applicability to fast optical-memory (disk) access is evaluated; and the implications of fast access for the design of expert systems are discussed. LBS methods examined include analog deflection (source motion, wavefront tilt, and phased arrays), digital deflection (polarization modulation, reflectivity modulation, interferometric switching, and waveguide deflection), and photorefractive LBS. The disk-access problem is considered, and typical LBS requirements are listed as 38,000 beam positions, rotational latency 25 ms, one-sector rotation time 1.5 ms, and intersector space 87 microsec. The value of rapid access for increasing the power of expert systems (by permitting better organization of blocks of information) is illustrated by summarizing the learning process of the MVP-FORTH system (Park, 1983).

Genetic plasticity of the Shigella virulence plasmid is mediated by intra- and inter-molecular events between insertion sequences.

PubMed

Pilla, Giulia; McVicker, Gareth; Tang, Christoph M

2017-09-01

Acquisition of a single copy, large virulence plasmid, pINV, led to the emergence of Shigella spp. from Escherichia coli. The plasmid encodes a Type III secretion system (T3SS) on a 30 kb pathogenicity island (PAI), and is maintained in a bacterial population through a series of toxin:antitoxin (TA) systems which mediate post-segregational killing (PSK). The T3SS imposes a significant cost on the bacterium, and strains which have lost the plasmid and/or genes encoding the T3SS grow faster than wild-type strains in the laboratory, and fail to bind the indicator dye Congo Red (CR). Our aim was to define the molecular events in Shigella flexneri that cause loss of Type III secretion (T3S), and to examine whether TA systems exert positional effects on pINV. During growth at 37°C, we found that deletions of regions of the plasmid including the PAI lead to the emergence of CR-negative colonies; deletions occur through intra-molecular recombination events between insertion sequences (ISs) flanking the PAI. Furthermore, by repositioning MvpAT (which belongs to the VapBC family of TA systems) near the PAI, we demonstrate that the location of this TA system alters the rearrangements that lead to loss of T3S, indicating that MvpAT acts both globally (by reducing loss of pINV through PSK) as well as locally (by preventing loss of adjacent sequences). During growth at environmental temperatures, we show for the first time that pINV spontaneously integrates into different sites in the chromosome, and this is mediated by inter-molecular events involving IS1294. Integration leads to reduced PAI gene expression and impaired secretion through the T3SS, while excision of pINV from the chromosome restores T3SS function. Therefore, pINV integration provides a reversible mechanism for Shigella to circumvent the metabolic burden imposed by pINV. Intra- and inter-molecular events between ISs, which are abundant in Shigella spp., mediate plasticity of S. flexneri pINV.

Digital Game-Based Learning Supports Student Motivation, Cognitive Success, and Performance Outcomes

ERIC Educational Resources Information Center

Woo, Jeng-Chung

2014-01-01

Traditional multimedia learning is primarily based on the cognitive load concept of information processing theory. Recent digital game-based learning (DGBL) studies have focused on exploring content support for learning motivation and related game characteristics. Motivation, volition, and performance (MVP) theory indicates that cognitive load and…

76 FR 35474 - UAW-Chrysler Technical Training Center, Technology Training Joint Programs Staff, Including On...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-17

...-Chrysler Technical Training Center, Technology Training Joint Programs Staff, Including On-Site Leased Workers From Cranks, O/E Learning, DBSI, IDEA, and Tonic/MVP, Detroit, MI; UAW-Chrysler Technical Training... workers and former workers of UAW-Chrysler Technical Training Center, Technology Training Joint Programs...

77 FR 17498 - Recovery Plan for the Endangered Spigelia gentianoides (Gentian Pinkroot)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-26

... status when: Extant populations and newly discovered sites are identified and mapped; Inventories have... management protocols on selected populations are established for 15 years to track threats to the species and its habitat; Extant populations located on public land are stable; The minimum viable population (MVP...

Synergistic effects of loxoprofen and glycine on the micturition reflex in conscious rats.

PubMed

Fukiya, Yumiko; Yoshizumi, Masaru; Saito, Mikako; Matsumoto-Miyai, Kazumasa; Nimura, Toshie; Kawatani, Masahito

2014-01-01

We examined the inhibitory effects of loxoprofen, a cyclooxygenase inhibitor, and glycine, a major inhibitory neurotransmitter, on the micturition reflex in conscious rats and hypothesized that these drugs would interact synergistically to inhibit micturition. Voiding behaviors were assessed using a metabolic cage. Oral loxoprofen decreased the urinary frequency, and only a high dose(10 mg/kg) significantly reduced the voided volume. With cystometry, intravenous loxoprofen(0.1-3 mg/kg) and glycine (30 and 100 mg/kg) prolonged the intercontraction intervals (ICI) in adose-dependent manner, but did not change the maximum voiding pressure (MVP) in conscious rats. The combination of loxoprofen (3 mg/kg) and glycine (100 mg/kg) strongly prolonged the ICI more than with either drug alone. The lowest dose of loxoprofen (0.1 mg/kg) and glycine(30 mg/kg) did not affect either the ICI or the MVP, but their combination resulted in a significant increase in the ICI. These results suggest that the combined administration of loxoprofen and glycine produced a synergistic inhibitory effect on the micturition reflex.

[Coronary revascularization in patients with preoperative electrical storm].

PubMed

Kawashima, Toshiya; Naraoka, S

2007-03-01

We report 5 cases who underwent surgical coronary revascularization for subacute myocardial ischemia with preoperative electrical storm. All patients showed severe left ventricular dysfunction. Mean ejection fraction was 24.4 +/- 7.6%. Three patients had already had implantable cardioverter-defibrillator (ICD) therapy. Procedures were on-pump coronary artery bypass grafting (CABG) and mitral valvuloplasty (MVP) [case 1], on-pump CABG, MVP, left ventricular restoration (LVR) and cryoablation (case 2), and off-pump CABG (case 3-5). Case 5 necessitated conversion to on-pump for electrical storm during left circumflex artery (LCx) anastomosis. Case 3 suddenly died on the 2nd postoperative day due to electrical storm. Case 1 had recurrent attack of electrical storm postoperatively, treated by ICD, overdrive pacing, repeated intraaortic balloon pumping (IABP), deep sedation with endotracheal intubation, and finally catheter ablation. Four patients have survived 2 years (mean) postoperatively without any arrhythmia, and are all in good condition [New York Heart Association (NYHA) I] now. It was concluded that off-pump procedure was not suitable for subacute myocardial ischemia with electrical storm and that LVR with surgical cryoablation would be effective if indicated.

Spatial variation of vessel grouping in the xylem of Betula platyphylla Roth.

PubMed

Zhao, Xiping

2016-01-01

Vessel grouping in angiosperms may improve hydraulic integration and increase the spread of cavitations through redundancy pathways. Although disputed, it is increasingly attracting research interest as a potentially significant hydraulic trait. However, the variation of vessel grouping in a tree is poorly understood. I measured the number of solitary and grouped vessels in the xylem of Betula platyphylla Roth. from the pith to the bark along the water flow path. The vessel grouping parameters included the mean number of vessels per vessel group (VG), percentage of solitary vessels (SVP), percentage of radial multiple vessels (MVP), and percentage of cluster vessels (CVP). The effects of cambial age (CA) and flow path-length (PL) on the vessel grouping were analyzed using a linear mixed model.VG and CVP increased nonlinearly, SVP decreased nonlinearly with PL. In trunks and branches, VG and CVP decreased nonlinearly, and SVP increased nonlinearly with CA. In roots, the parameters had no change with CA. MVP was almost constant with PL or CA. The results suggest that vessel grouping has a nonrandom variation pattern, which is affected deeply by cambial age and water flow path.

The Conserved Foot Domain of RNA Pol II Associates with Proteins Involved in Transcriptional Initiation and/or Early Elongation

PubMed Central

García-López, M. Carmen; Pelechano, Vicent; Mirón-García, M. Carmen; Garrido-Godino, Ana I.; García, Alicia; Calvo, Olga; Werner, Michel; Pérez-Ortín, José E.; Navarro, Francisco

2011-01-01

RNA polymerase (pol) II establishes many protein–protein interactions with transcriptional regulators to coordinate different steps of transcription. Although some of these interactions have been well described, little is known about the existence of RNA pol II regions involved in contact with transcriptional regulators. We hypothesize that conserved regions on the surface of RNA pol II contact transcriptional regulators. We identified such an RNA pol II conserved region that includes the majority of the “foot” domain and identified interactions of this region with Mvp1, a protein required for sorting proteins to the vacuole, and Spo14, a phospholipase D. Deletion of MVP1 and SPO14 affects the transcription of their target genes and increases phosphorylation of Ser5 in the carboxy-terminal domain (CTD). Genetic, phenotypic, and functional analyses point to a role for these proteins in transcriptional initiation and/or early elongation, consistent with their genetic interactions with CEG1, a guanylyltransferase subunit of the Saccharomyces cerevisiae capping enzyme. PMID:21954159

Cloud-based interactive analytics for terabytes of genomic variants data.

PubMed

Pan, Cuiping; McInnes, Gregory; Deflaux, Nicole; Snyder, Michael; Bingham, Jonathan; Datta, Somalee; Tsao, Philip S

2017-12-01

Large scale genomic sequencing is now widely used to decipher questions in diverse realms such as biological function, human diseases, evolution, ecosystems, and agriculture. With the quantity and diversity these data harbor, a robust and scalable data handling and analysis solution is desired. We present interactive analytics using a cloud-based columnar database built on Dremel to perform information compression, comprehensive quality controls, and biological information retrieval in large volumes of genomic data. We demonstrate such Big Data computing paradigms can provide orders of magnitude faster turnaround for common genomic analyses, transforming long-running batch jobs submitted via a Linux shell into questions that can be asked from a web browser in seconds. Using this method, we assessed a study population of 475 deeply sequenced human genomes for genomic call rate, genotype and allele frequency distribution, variant density across the genome, and pharmacogenomic information. Our analysis framework is implemented in Google Cloud Platform and BigQuery. Codes are available at https://github.com/StanfordBioinformatics/mvp_aaa_codelabs. cuiping@stanford.edu or ptsao@stanford.edu. Supplementary data are available at Bioinformatics online. Published by Oxford University Press 2017. This work is written by US Government employees and are in the public domain in the US.

Estimation of average burnup of damaged fuels loaded in Fukushima Dai-ichi reactors by using the {sup 134}Cs/{sup 137}Cs ratio method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Endo, T.; Sato, S.; Yamamoto, A.

2012-07-01

Average burnup of damaged fuels loaded in Fukushima Dai-ichi reactors is estimated, using the {sup 134}Cs/{sup 137}Cs ratio method for measured radioactivities of {sup 134}Cs and {sup 137}Cs in contaminated soils within the range of 100 km from the Fukushima Dai-ichi nuclear power plants. As a result, the measured {sup 134}Cs/{sup 137}Cs ratio from the contaminated soil is 0.996{+-}0.07 as of March 11, 2011. Based on the {sup 134}Cs/{sup 137}Cs ratio method, the estimated burnup of damaged fuels is approximately 17.2{+-}1.5 [GWd/tHM]. It is noted that the numerical results of various calculation codes (SRAC2006/PIJ, SCALE6.0/TRITON, and MVP-BURN) are almost themore » same evaluation values of {sup 134}Cs/ {sup 137}Cs ratio with same evaluated nuclear data library (ENDF-B/VII.0). The void fraction effect in depletion calculation has a major impact on {sup 134}Cs/{sup 137}Cs ratio compared with the differences between JENDL-4.0 and ENDF-B/VII.0. (authors)« less

Cloud-based interactive analytics for terabytes of genomic variants data

PubMed Central

Pan, Cuiping; McInnes, Gregory; Deflaux, Nicole; Snyder, Michael; Bingham, Jonathan; Datta, Somalee; Tsao, Philip S

2017-01-01

Abstract Motivation Large scale genomic sequencing is now widely used to decipher questions in diverse realms such as biological function, human diseases, evolution, ecosystems, and agriculture. With the quantity and diversity these data harbor, a robust and scalable data handling and analysis solution is desired. Results We present interactive analytics using a cloud-based columnar database built on Dremel to perform information compression, comprehensive quality controls, and biological information retrieval in large volumes of genomic data. We demonstrate such Big Data computing paradigms can provide orders of magnitude faster turnaround for common genomic analyses, transforming long-running batch jobs submitted via a Linux shell into questions that can be asked from a web browser in seconds. Using this method, we assessed a study population of 475 deeply sequenced human genomes for genomic call rate, genotype and allele frequency distribution, variant density across the genome, and pharmacogenomic information. Availability and implementation Our analysis framework is implemented in Google Cloud Platform and BigQuery. Codes are available at https://github.com/StanfordBioinformatics/mvp_aaa_codelabs. Contact cuiping@stanford.edu or ptsao@stanford.edu Supplementary information Supplementary data are available at Bioinformatics online. PMID:28961771

Major Vault Protein May Affect Nonhomologous End-Joining Repair and Apoptosis Through Ku70/80 and BAX Downregulation in Cervical Carcinoma Tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lloret, Marta; Instituto Canario de Investigacion del Cancer, Canary Islands; Lara, Pedro Carlos

Purpose: We investigated the relationship between major vault protein (MVP) expression, the nonhomologous end-joining (NHEJ) repair gene Ku70/80, and related genes involved in the regulation of apoptosis and proliferation to shed light on the possible causes of genetic instability, tumor progression, and resistance to oncologic treatment in patients with clinical cervical cancer. Methods and Materials: One hundred sixteen consecutive patients with localized cervix carcinoma were prospectively included in this study from July 1997 to Dec 2003. Patients were staged according to the tumor, node, metastasis (TNM) classification. Forty patients had Stage I disease, 45 had Stage II, and 31 hadmore » Stage III/IVA. Most patients had squamous tumors (98 cases) and Grades II (52 cases) and III (45 cases) carcinomas. Expression of MVP, Ku70/80, Insulin-Like Growth Factor-1 receptor (IGF-1R), BCL2-associated X protein (BAX), B-cell CLL/lymphoma 2 (BCL-2), p53, and Ki67 was studied by using immunohistochemistry in paraffin-embedded tumor tissue. Results: Tumors overexpressing MVP (65 of 116 cases) showed low levels of Ku70/80 (p = 0.013) and BAX expression (p < 0.0001). Furthermore, low Ku70/80 expression was strongly related to suppressed BAX (p < 0.001) and, to a lesser extent, upregulated BCL-2 (p = 0.042), altered p53 (p = 0.038), and increased proliferation (p = 0.002). Conclusion: We hypothesize that an early regulatory mechanism favors homologous or NHEJ repair at first, mediated by vaults along with other factors yet to be elucidated. If vaults are overexpressed, NHEJ repair may be suppressed by means of several mechanisms, with resultant genomic instability. These mechanisms may be associated with the decision of damaged cells to survive and proliferate, favoring tumor progression and reducing tumor response to oncologic treatment through the development of resistant cell phenotypes. Additional clinical studies are necessary to test this hypothesis.« less

Compendium 0f Dental Residents’ Research Projects and Literature Reviews

DTIC Science & Technology

1989-05-01

slow digestion to isolate chondrocytes by incubation at 370C in Ham’s F-12 with 0.1% collagenase for 24 h. Trypan-blue dye exclusion assay was used to...characteristics of matrix vesicle proteolipids (MVP). The MV were prepared from the growth cartilages of broiler chick epiphyses (All et al, 1970). Specific

A general target for MVPs: Unsupported and unnecessary

Treesearch

Curtis H. Flather; Gregory D. Hayward; Steven R. Beissinger; Philip A. Stephens

2011-01-01

In a recent article in TREE [1], we reviewed evidence for a consistent standardised estimate of minimum viable populations (MVPs) across taxa [2-4] and found that the universal MVP of 5000 adults advocated by Traill et al. [5] was unsupported by reanalyses of their data. We identified shortcomings in the original analyses, and found substantial uncertainty in...

Energy harvesting influences electrochemical performance of microbial fuel cells

NASA Astrophysics Data System (ADS)

Lobo, Fernanda Leite; Wang, Xin; Ren, Zhiyong Jason

2017-07-01

Microbial fuel cells (MFCs) can be effective power sources for remote sensing, wastewater treatment and environmental remediation, but their performance needs significant improvement. This study systematically analyzes how active harvesting using electrical circuits increased MFC system outputs as compared to passive resistors not only in the traditional maximal power point (MPP) but also in other desired operating points such as the maximum current point (MCP) and the maximum voltage point (MVP). Results show that active harvesting in MPP increased power output by 81-375% and active harvesting in MCP increased Coulombic efficiency by 207-805% compared with resisters operated at the same points. The cyclic voltammograms revealed redox potential shifts and supported the performance data. The findings demonstrate that active harvesting is a very effective approach to improve MFC performance across different operating points.

Defense Task Force on Domestic Violence

DTIC Science & Technology

2001-02-28

problem in the following areas: • Ongoing victim safety programs Domestic Violence is an offense against the institutional values of the Military Services...All the courses have a family advocacy briefing. The Marine Corps has instituted a Mentors in Violence Prevention (MVP) program in a train-the- trainer...medicine, primary care, and obstetrics /gynecology. • Require NPSP nurses to have domestic violence awareness education within 90 days of their hiring

The measles virus phosphoprotein interacts with the linker domain of STAT1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devaux, Patricia, E-mail: devaux.patricia@mayo.edu; Priniski, Lauren; Cattaneo, Roberto

2013-09-15

The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainlymore » to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.« less

Research on the Factors Influencing the Measurement Errors of the Discrete Rogowski Coil †

PubMed Central

Xu, Mengyuan; Yan, Jing; Geng, Yingsan; Zhang, Kun; Sun, Chao

2018-01-01

An innovative array of magnetic coils (the discrete Rogowski coil—RC) with the advantages of flexible structure, miniaturization and mass producibility is investigated. First, the mutual inductance between the discrete RC and circular and rectangular conductors are calculated using the magnetic vector potential (MVP) method. The results are found to be consistent with those calculated using the finite element method, but the MVP method is simpler and more practical. Then, the influence of conductor section parameters, inclination, and eccentricity on the accuracy of the discrete RC is calculated to provide a reference. Studying the influence of an external current on the discrete RC’s interference error reveals optimal values for length, winding density, and position arrangement of the solenoids. It has also found that eccentricity and interference errors decreasing with increasing number of solenoids. Finally, a discrete RC prototype is devised and manufactured. The experimental results show consistent output characteristics, with the calculated sensitivity and mutual inductance of the discrete RC being very close to the experimental results. The influence of an external conductor on the measurement of the discrete RC is analyzed experimentally, and the results show that interference from an external current decreases with increasing distance between the external and measured conductors. PMID:29534006

Research on the Factors Influencing the Measurement Errors of the Discrete Rogowski Coil.

PubMed

Xu, Mengyuan; Yan, Jing; Geng, Yingsan; Zhang, Kun; Sun, Chao

2018-03-13

An innovative array of magnetic coils (the discrete Rogowski coil-RC) with the advantages of flexible structure, miniaturization and mass producibility is investigated. First, the mutual inductance between the discrete RC and circular and rectangular conductors are calculated using the magnetic vector potential (MVP) method. The results are found to be consistent with those calculated using the finite element method, but the MVP method is simpler and more practical. Then, the influence of conductor section parameters, inclination, and eccentricity on the accuracy of the discrete RC is calculated to provide a reference. Studying the influence of an external current on the discrete RC's interference error reveals optimal values for length, winding density, and position arrangement of the solenoids. It has also found that eccentricity and interference errors decreasing with increasing number of solenoids. Finally, a discrete RC prototype is devised and manufactured. The experimental results show consistent output characteristics, with the calculated sensitivity and mutual inductance of the discrete RC being very close to the experimental results. The influence of an external conductor on the measurement of the discrete RC is analyzed experimentally, and the results show that interference from an external current decreases with increasing distance between the external and measured conductors.

Optimizing Maintenance Manpower for USMC F/A-18 Squadrons

DTIC Science & Technology

2016-06-01

experience level, with the requirement of keeping a standard number of aircraft operationally ready. MVP results show areas of deficit, either manpower ...MAINTENANCE MANPOWER FOR USMC F/A-18 SQUADRONS by Kevin J. Goodwin June 2016 Thesis Co-Advisors: W. Matthew Carlyle Robert F. Dell Second...REPORT TYPE AND DATES COVERED Master’s thesis 4. TITLE AND SUBTITLE OPTIMIZING MAINTENANCE MANPOWER FOR USMC F/A-18 SQUADRONS 5. FUNDING NUMBERS 6

Active symptom control with or without chemotherapy in the treatment of patients with malignant pleural mesothelioma (MS01): a multicentre randomised trial.

PubMed

Muers, Martin F; Stephens, Richard J; Fisher, Patricia; Darlison, Liz; Higgs, Christopher M B; Lowry, Erica; Nicholson, Andrew G; O'Brien, Mary; Peake, Michael; Rudd, Robin; Snee, Michael; Steele, Jeremy; Girling, David J; Nankivell, Matthew; Pugh, Cheryl; Parmar, Mahesh K B

2008-05-17

Malignant pleural mesothelioma is almost always fatal, and few treatment options are available. Although active symptom control (ASC) has been recommended for the management of this disease, no consensus exists for the role of chemotherapy. We investigated whether the addition of chemotherapy to ASC improved survival and quality of life. 409 patients with malignant pleural mesothelioma, from 76 centres in the UK and two in Australia, were randomly assigned to ASC alone (treatment could include steroids, analgesic drugs, bronchodilators, palliative radiotherapy [n=136]); to ASC plus MVP (four cycles of mitomycin 6 mg/m2, vinblastine 6 mg/m2, and cisplatin 50 mg/m2 every 3 weeks [n=137]); or to ASC plus vinorelbine (one injection of vinorelbine 30 mg/m2 every week for 12 weeks [n=136]). Randomisation was done by minimisation, with stratification for WHO performance status, histology, and centre. Follow-up was every 3 weeks to 21 weeks after randomisation, and every 8 weeks thereafter. Because of slow accrual, the two chemotherapy groups were combined and compared with ASC alone for the primary outcome of overall survival. Analysis was by intention to treat. This study is registered, number ISRCTN54469112. At the time of analysis, 393 (96%) patients had died (ASC 132 [97%], ASC plus MVP 132 [96%], ASC plus vinorelbine 129 [95%]). Compared with ASC alone, we noted a small, non-significant survival benefit for ASC plus chemotherapy (hazard ratio [HR] 0.89 [95% CI 0.72-1.10]; p=0.29). Median survival was 7.6 months in the ASC alone group and 8.5 months in the ASC plus chemotherapy group. Exploratory analyses suggested a survival advantage for ASC plus vinorelbine compared with ASC alone (HR 0.80 [0.63-1.02]; p=0.08), with a median survival of 9.5 months. There was no evidence of a survival benefit with ASC plus MVP (HR 0.99 [0.78-1.27]; p=0.95). We observed no between-group differences in four predefined quality-of-life subscales (physical functioning, pain, dyspnoea, and global health status) at any of the assessments in the first 6 months. The addition of chemotherapy to ASC offers no significant benefits in terms of overall survival or quality of life. However, exploratory analyses suggested that vinorelbine merits further investigation.

Working set selection using functional gain for LS-SVM.

PubMed

Bo, Liefeng; Jiao, Licheng; Wang, Ling

2007-09-01

The efficiency of sequential minimal optimization (SMO) depends strongly on the working set selection. This letter shows how the improvement of SMO in each iteration, named the functional gain (FG), is used to select the working set for least squares support vector machine (LS-SVM). We prove the convergence of the proposed method and give some theoretical support for its performance. Empirical comparisons demonstrate that our method is superior to the maximum violating pair (MVP) working set selection.

Differences in passenger car and large truck involved crash frequencies at urban signalized intersections: an exploratory analysis.

PubMed

Dong, Chunjiao; Clarke, David B; Richards, Stephen H; Huang, Baoshan

2014-01-01

The influence of intersection features on safety has been examined extensively because intersections experience a relatively large proportion of motor vehicle conflicts and crashes. Although there are distinct differences between passenger cars and large trucks-size, operating characteristics, dimensions, and weight-modeling crash counts across vehicle types is rarely addressed. This paper develops and presents a multivariate regression model of crash frequencies by collision vehicle type using crash data for urban signalized intersections in Tennessee. In addition, the performance of univariate Poisson-lognormal (UVPLN), multivariate Poisson (MVP), and multivariate Poisson-lognormal (MVPLN) regression models in establishing the relationship between crashes, traffic factors, and geometric design of roadway intersections is investigated. Bayesian methods are used to estimate the unknown parameters of these models. The evaluation results suggest that the MVPLN model possesses most of the desirable statistical properties in developing the relationships. Compared to the UVPLN and MVP models, the MVPLN model better identifies significant factors and predicts crash frequencies. The findings suggest that traffic volume, truck percentage, lighting condition, and intersection angle significantly affect intersection safety. Important differences in car, car-truck, and truck crash frequencies with respect to various risk factors were found to exist between models. The paper provides some new or more comprehensive observations that have not been covered in previous studies. Copyright © 2013 Elsevier Ltd. All rights reserved.

Evaluation of the impact of a mobile health system on adherence to antenatal and postnatal care and prevention of mother-to-child transmission of HIV programs in Kenya.

PubMed

Mushamiri, Ivy; Luo, Chibulu; Iiams-Hauser, Casey; Ben Amor, Yanis

2015-02-07

The Millennium Villages Project (MVP) implemented in Western Kenya a mobile Health tool that uses text messages to coordinate Community Health Worker (CHW) activities around antenatal care (ANC) and Prevention of Mother-to-Child Transmission of HIV (PMTCT), named the ANC/PMTCT Adherence System (APAS). End-user changes in health-seeking behavior in ANC and postnatal care (PNC) were investigated following registration of 800 women into APAS. These investigations employed interviews of pregnant women or new mothers (n = 67) and CHWs (n = 20). Ordinal logistic regressions and exact binomial tests were used in the routine data analyses (n = 650, health registers). All CHWs interviewed agreed that APAS helped them track pregnant woman efficiently, compared to paper-based tracking forms. Women registered in APAS reported that CHWs reminded them of appointments more regularly than before its inception. The routine data analysis showed that among women who had their 1(st) ANC visit in the 2(nd) trimester, women who resided in the MVP cluster and were in APAS had: 3 times the odds of going for more ANC visits compared to women who were not registered (but resided in the cluster), after adjusting for the mother's HIV status in the multivariate model (Adjusted OR = 2.58, 95% CI [1.10-6.01]); twice the odds of going for more ANC visits compared to women who were not registered and resided outside the cluster (Adjusted OR = 2.37, 95% CI [0.99-5.67]) Among women not registered, residence inside or outside the cluster did not affect the number of ANC visits made (Adjusted OR = 0.86, 95% CI [0.45-1.69]). The APAS also greatly increased the likelihood of women making the 6 recommended post-delivery baby follow-ups. For women registered in APAS, the MTCT rate at 18 months was significantly different from that of women not registered, and from the global rate of 30%. Women not registered had a 9% MTCT rate at 18 months regardless of residence, while women registered had a 0% transmission rate at both 9 and 18 months. The incorporation of mHealth tools in CHW programs can improve adherence to ANC and PNC and enhance PMTCT efforts.

Methylation variable position profiles of hMLH1 promoter CpG islands in human sporadic colorectal carcinoma.

PubMed

Huang, Qing; Huang, Jun-Fu; Zhang, Bo; Baum, Larry; Fu, Wei-Ling

2012-03-01

Aberrant hypermethylation of CpG islands (CGIs) in hMLH1 promoter regions has been well known to play an important role in the tumorigenesis of human sporadic colorectal carcinoma (SCRC). In this study, bisulfite sequencing was performed to analyze the methylation variable positions (MVPs) profiles of hMLH1 promoter CGIs in 30 clinical SCRC patients, and further analysis was carried out to evaluate the associations between the CGI methylation and the clinicopathological features in SCRC. Among the 2 CGIs in the hMLH1 promoter, that is, CGI-I and CGI-II, 20% (6/30) and 13% (4/30) of the patients had methylated CGI-I and CGI-II, respectively. Suppressed expression of hMLH1was significantly correlated with methylation of CGI-I but not CGI-II. Further analysis of the MVP profiles of CGI-I showed that most of the MVPs were hypermethylated and others were poorly methylated or unmethylated. The profiles could be classified into at least 4 groups based on the methylation status of 3 MVPs at positions 21 to 23 in CGI-I. All 6 patients with methylated CGI-I belonged to group I. This result suggests that the above 3 MVPs in CGI-I should be a targeted region to further analyze the epigenetic features of hMLH1 in human SCRC. Our results further suggest that MVP profiling is useful for identifying the aberrantly methylated CGIs associated with suppressed gene expression.

Post-genomic behavioral genetics: From revolution to routine.

PubMed

Ashbrook, D G; Mulligan, M K; Williams, R W

2018-03-01

What was once expensive and revolutionary-full-genome sequence-is now affordable and routine. Costs will continue to drop, opening up new frontiers in behavioral genetics. This shift in costs from the genome to the phenome is most notable in large clinical studies of behavior and associated diseases in cohorts that exceed hundreds of thousands of subjects. Examples include the Women's Health Initiative (www.whi.org), the Million Veterans Program (www. va.gov/MVP), the 100 000 Genomes Project (genomicsengland.co.uk) and commercial efforts such as those by deCode (www.decode.com) and 23andme (www.23andme.com). The same transition is happening in experimental neuro- and behavioral genetics, and sample sizes of many hundreds of cases are becoming routine (www.genenetwork.org, www.mousephenotyping.org). There are two major consequences of this new affordability of massive omics datasets: (1) it is now far more practical to explore genetic modulation of behavioral differences and the key role of gene-by-environment interactions. Researchers are already doing the hard part-the quantitative analysis of behavior. Adding the omics component can provide powerful links to molecules, cells, circuits and even better treatment. (2) There is an acute need to highlight and train behavioral scientists in how best to exploit new omics approaches. This review addresses this second issue and highlights several new trends and opportunities that will be of interest to experts in animal and human behaviors. © 2017 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Colorful Packages: Encapsulation of Fluorescent Proteins in Complex Coacervate Core Micelles

PubMed Central

Westphal, Adrie H.; Kleijn, J. Mieke; Borst, Jan Willem

2017-01-01

Encapsulation of proteins can be beneficial for food and biomedical applications. To study their biophysical properties in complex coacervate core micelles (C3Ms), we previously encapsulated enhanced green fluorescent protein (EGFP) and its monomeric variant, mEGFP, with the cationic-neutral diblock copolymer poly(2-methyl-vinyl-pyridinium)n-b-poly(ethylene-oxide)m (P2MVPn-b-PEOm) as enveloping material. C3Ms with high packaging densities of fluorescent proteins (FPs) were obtained, resulting in a restricted orientational freedom of the protein molecules, influencing their structural and spectral properties. To address the generality of this behavior, we encapsulated seven FPs with P2MVP41-b-PEO205 and P2MVP128-b-PEO477. Dynamic light scattering and fluorescence correlation spectroscopy showed lower encapsulation efficiencies for members of the Anthozoa class (anFPs) than for Hydrozoa FPs derived from Aequorea victoria (avFPs). Far-UV CD spectra of the free FPs showed remarkable differences between avFPs and anFPs, caused by rounder barrel structures for avFPs and more elliptic ones for anFPs. These structural differences, along with the differences in charge distribution, might explain the variations in encapsulation efficiency between avFPs and anFPs. Furthermore, the avFPs remain monomeric in C3Ms with minor spectral and structural changes. In contrast, the encapsulation of anFPs gives rise to decreased quantum yields (monomeric Kusabira Orange 2 (mKO2) and Tag red fluorescent protein (TagRFP)) or to a pKa shift of the chromophore (FP variant mCherry). PMID:28753915

Novel Rechargeable M3V2(PO4)3//Zinc (M = Li, Na) Hybrid Aqueous Batteries with Excellent Cycling Performance

NASA Astrophysics Data System (ADS)

Zhao, H. B.; Hu, C. J.; Cheng, H. W.; Fang, J. H.; Xie, Y. P.; Fang, W. Y.; Doan, T. N. L.; Hoang, T. K. A.; Xu, J. Q.; Chen, P.

2016-05-01

A rechargeable hybrid aqueous battery (ReHAB) containing NASICON-type M3V2(PO4)3 (M = Li, Na) as the cathodes and Zinc metal as the anode, working in Li2SO4-ZnSO4 aqueous electrolyte, has been studied. Both of Li3V2(PO4)3 and Na3V2(PO4)3 cathodes can be reversibly charge/discharge with the initial discharge capacity of 128 mAh g-1 and 96 mAh g-1 at 0.2C, respectively, with high up to 84% of capacity retention ratio after 200 cycles. The electrochemical assisted ex-XRD confirm that Li3V2(PO4)3 and Na3V2(PO4)3 are relative stable in aqueous electrolyte, and Na3V2(PO4)3 showed more complicated electrochemical mechanism due to the co-insertion of Li+ and Na+. The effect of pH of aqueous electrolyte and the dendrite of Zn on the cycling performance of as designed MVP/Zn ReHABs were investigated, and weak acidic aqueous electrolyte with pH around 4.0-4.5 was optimized. The float current test confirmed that the designed batteries are stable in aqueous electrolytes. The MVP//Zn ReHABs could be a potential candidate for future rechargeable aqueous battery due to their high safety, fast dynamic speed and adaptable electrochemical window. Moreover, this hybrid battery broadens the scope of battery material research from single-ion-involving to double-ions -involving rechargeable batteries.

The midgut transcriptome of Lutzomyia longipalpis: comparative analysis of cDNA libraries from sugar-fed, blood-fed, post-digested and Leishmania infantum chagasi-infected sand flies.

PubMed

Jochim, Ryan C; Teixeira, Clarissa R; Laughinghouse, Andre; Mu, Jianbing; Oliveira, Fabiano; Gomes, Regis B; Elnaiem, Dia-Eldin; Valenzuela, Jesus G

2008-01-14

In the life cycle of Leishmania within the alimentary canal of sand flies the parasites have to survive the hostile environment of blood meal digestion, escape the blood bolus and attach to the midgut epithelium before differentiating into the infective metacyclic stages. The molecular interactions between the Leishmania parasites and the gut of the sand fly are poorly understood. In the present work we sequenced five cDNA libraries constructed from midgut tissue from the sand fly Lutzomyia longipalpis and analyzed the transcripts present following sugar feeding, blood feeding and after the blood meal has been processed and excreted, both in the presence and absence of Leishmania infantum chagasi. Comparative analysis of the transcripts from sugar-fed and blood-fed cDNA libraries resulted in the identification of transcripts differentially expressed during blood feeding. This included upregulated transcripts such as four distinct microvillar-like proteins (LuloMVP1, 2, 4 and 5), two peritrophin like proteins, a trypsin like protein (Lltryp1), two chymotrypsin like proteins (LuloChym1A and 2) and an unknown protein. Downregulated transcripts by blood feeding were a microvillar-like protein (LuloMVP3), a trypsin like protein (Lltryp2) and an astacin-like metalloprotease (LuloAstacin). Furthermore, a comparative analysis between blood-fed and Leishmania infected midgut cDNA libraries resulted in the identification of the transcripts that were differentially expressed due to the presence of Leishmania in the gut of the sand fly. This included down regulated transcripts such as four microvillar-like proteins (LuloMVP1,2, 4 and 5), a Chymotrypsin (LuloChym1A) and a carboxypeptidase (LuloCpepA1), among others. Upregulated midgut transcripts in the presence of Leishmania were a peritrophin like protein (LuloPer1), a trypsin-like protein (Lltryp2) and an unknown protein. This transcriptome analysis represents the largest set of sequence data reported from a specific sand fly tissue and provides further information of the transcripts present in the sand fly Lutzomyia longipalpis. This analysis provides the detailed information of molecules present in the midgut of this sand fly and the transcripts potentially modulated by blood feeding and by the presence of the Leishmania parasite. More importantly, this analysis suggests that Leishmania infantum chagasi alters the expression profile of certain midgut transcripts in the sand fly during blood meal digestion and that this modulation may be relevant for the survival and establishment of the parasite in the gut of the fly. Moreover, this analysis suggests that these changes may be occurring during the digestion of the blood meal and not afterwards.

Impact of bileaflet mitral valve prolapse on quantification of mitral regurgitation with cardiac magnetic resonance: a single-center study.

PubMed

Vincenti, Gabriella; Masci, Pier Giorgio; Rutz, Tobias; De Blois, Jonathan; Prša, Milan; Jeanrenaud, Xavier; Schwitter, Juerg; Monney, Pierre

2017-07-27

To quantify mitral regurgitation (MR) with CMR, the regurgitant volume can be calculated as the difference between the left ventricular (LV) stroke volume (SV) measured with the Simpson's method and the reference SV, i.e. the right ventricular SV (RVSV) in patients without tricuspid regurgitation. However, for patients with prominent mitral valve prolapse (MVP), the Simpson's method may underestimate the LV end-systolic volume (LVESV) as it only considers the volume located between the apex and the mitral annulus, and neglects the ventricular volume that is displaced into the left atrium but contained within the prolapsed mitral leaflets at end systole. This may lead to an underestimation of LVESV, and resulting an over-estimation of LVSV, and an over-estimation of mitral regurgitation. The aim of the present study was to assess the impact of prominent MVP on MR quantification by CMR. In patients with MVP (and no more than trace tricuspid regurgitation) MR was quantified by calculating the regurgitant volume as the difference between LVSV and RVSV. LVSV uncorr was calculated conventionally as LV end-diastolic (LVEDV) minus LVESV. A corrected LVESV corr was calculated as the LVESV plus the prolapsed volume, i.e. the volume between the mitral annulus and the prolapsing mitral leaflets. The 2 methods were compared with respect to the MR grading. MR grades were defined as absent or trace, mild (5-29% regurgitant fraction (RF)), moderate (30-49% RF), or severe (≥50% RF). In 35 patients (44.0 ± 23.0y, 14 males, 20 patients with MR) the prolapsed volume was 16.5 ± 8.7 ml. The 2 methods were concordant in only 12 (34%) patients, as the uncorrected method indicated a 1-grade higher MR severity in 23 (66%) patients. For the uncorrected/corrected method, the distribution of the MR grades as absent-trace (0 vs 11, respectively), mild (20 vs 18, respectively), moderate (11 vs 5, respectively), and severe (4 vs 1, respectively) was significantly different (p < 0.001). In the subgroup without MR, LVSV corr was not significantly different from RVSV (difference: 2.5 ± 4.7 ml, p = 0.11 vs 0) while a systematic overestimation was observed with LVSV uncorr (difference: 16.9 ± 9.1 ml, p = 0.0007 vs 0). Also, RVSV was highly correlated with aortic forward flow (n = 24, R 2  = 0.97, p < 0.001). For patients with severe bileaflet prolapse, the correction of the LVSV for the prolapse volume is suggested as it modified the assessment of MR severity by one grade in a large portion of patients.

Progress Toward Development of a Multichannel Vestibular Prosthesis for Treatment of Bilateral Vestibular Deficiency

PubMed Central

FRIDMAN, GENE Y.; DELLA SANTINA, CHARLES C.

2014-01-01

This article reviews vestibular pathology and the requirements and progress made in the design and construction of a vestibular prosthesis. Bilateral loss of vestibular sensation is disabling. When vestibular hair cells are injured by ototoxic medications or other insults to the labyrinth, the resulting loss of sensory input disrupts vestibulo-ocular reflexes (VORs) and vestibulo-spinal reflexes that normally stabilize the eyes and body. Affected individuals suffer poor vision during head movement, postural instability, chronic disequilibrium, and cognitive distraction. Although most individuals with residual sensation compensate for their loss over time, others fail to do so and have no adequate treatment options. A vestibular prosthesis analogous to cochlear implants but designed to modulate vestibular nerve activity during head movement should improve quality of life for these chronically dizzy individuals. We describe the impact of bilateral loss of vestibular sensation, animal studies supporting feasibility of prosthetic vestibular stimulation, the current status of multichannel vestibular sensory replacement prosthesis development, and challenges to successfully realizing this approach in clinical practice. In bilaterally vestibular-deficient rodents and rhesus monkeys, the Johns Hopkins multichannel vestibular prosthesis (MVP) partially restores the three-dimensional (3D) VOR for head rotations about any axis. Attempts at prosthetic vestibular stimulation of humans have not yet included the 3D eye movement assays necessary to accurately evaluate VOR alignment, but these initial forays have revealed responses that are otherwise comparable to observations in animals. Current efforts now focus on refining electrode design and surgical technique to enhance stimulus selectivity and preserve cochlear function, optimizing stimulus protocols to improve dynamic range and reduce excitation–inhibition asymmetry, and adapting laboratory MVP prototypes into devices appropriate for use in clinical trials. PMID:23044664

Novel Rechargeable M3V2(PO4)3//Zinc (M = Li, Na) Hybrid Aqueous Batteries with Excellent Cycling Performance

PubMed Central

Zhao, H. B.; Hu, C. J.; Cheng, H. W.; Fang, J. H.; Xie, Y. P.; Fang, W. Y.; Doan, T. N. L.; Hoang, T. K. A.; Xu, J. Q.; Chen, P.

2016-01-01

A rechargeable hybrid aqueous battery (ReHAB) containing NASICON-type M3V2(PO4)3 (M = Li, Na) as the cathodes and Zinc metal as the anode, working in Li2SO4-ZnSO4 aqueous electrolyte, has been studied. Both of Li3V2(PO4)3 and Na3V2(PO4)3 cathodes can be reversibly charge/discharge with the initial discharge capacity of 128 mAh g−1 and 96 mAh g−1 at 0.2C, respectively, with high up to 84% of capacity retention ratio after 200 cycles. The electrochemical assisted ex-XRD confirm that Li3V2(PO4)3 and Na3V2(PO4)3 are relative stable in aqueous electrolyte, and Na3V2(PO4)3 showed more complicated electrochemical mechanism due to the co-insertion of Li+ and Na+. The effect of pH of aqueous electrolyte and the dendrite of Zn on the cycling performance of as designed MVP/Zn ReHABs were investigated, and weak acidic aqueous electrolyte with pH around 4.0–4.5 was optimized. The float current test confirmed that the designed batteries are stable in aqueous electrolytes. The MVP//Zn ReHABs could be a potential candidate for future rechargeable aqueous battery due to their high safety, fast dynamic speed and adaptable electrochemical window. Moreover, this hybrid battery broadens the scope of battery material research from single-ion-involving to double-ions -involving rechargeable batteries. PMID:27174224

Effects of zoledronic acid and geranylgeraniol on the cellular behaviour and gene expression of primary human alveolar osteoblasts.

PubMed

Zafar, S; Coates, D E; Cullinan, M P; Drummond, B K; Milne, T; Seymour, G J

2016-11-01

Bisphosphonate-related osteonecrosis of the jaw (BRONJ) is a serious complication of bisphosphonate therapy. The mechanism underlying BRONJ pathogenesis is poorly understood. To determine the effects of zoledronic acid (ZA) and geranylgeraniol (GGOH) on the mevalonate pathway (MVP) in osteoblasts generated from the human mandibular alveolar bone in terms of cell viability/proliferation, migration, apoptosis and gene expression. Primary human osteoblasts (HOBs) isolated from the mandibular alveolar bone were phenotyped. HOBs were cultured with or without ZA and GGOH for up to 72 h. Cellular behaviour was examined using a CellTiter-Blue® viability assay, an Ibidi culture-insert migration assay, an Apo-ONE® Homogeneous Caspase-3/7 apoptosis assay and transmission electron microscopy (TEM). Quantitative real-time reverse transcriptase polymerase chain reaction (qRT 2 -PCR) was used to determine the simultaneous expression of 168 osteogenic and angiogenic genes modulated in the presence of ZA and GGOH. ZA decreased cell viability and migration and induced apoptosis in HOBs. TEM revealed signs of apoptosis in ZA-treated HOBs. However, the co-addition of GGOH ameliorated the effect of ZA and partially restored the cells to the control state. Twenty-eight genes in the osteogenic array and 27 genes in the angiogenic array were significantly regulated in the presence of ZA compared with those in the controls at one or more time points. The cytotoxic effect of ZA on HOBs and its reversal by the addition of GGOH suggests that the effect of ZA on HOBs is mediated via the MVP. The results suggest that GGOH could be used as a possible therapeutic/preventive strategy for BRONJ.

Unveiling the Mysteries of Mars with a Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM)

NASA Technical Reports Server (NTRS)

Edmunson, J.; Gaskin, J. A.; Doloboff, I. J.

2017-01-01

Development of a miniaturized scanning electron microscope that will utilize the martian atmosphere to dissipate charge during analysis continues. This instrument is expected to be used on a future rover or lander to answer fundamental Mars science questions. To identify the most important questions, a survey was taken at the 47th Lunar and Planetary Science Conference (LPSC). From the gathered information initial topics were identified for a SEM on the martian surface. These priorities are identified and discussed below. Additionally, a concept of operations is provided with the goal of maximizing the science obtained with the minimum amount of communication with the instrument.

SpaceX CRS-14 What's On Board Science Briefing

NASA Image and Video Library

2018-04-01

During the SpaceX CRS-14 "What's On Board?" Science Briefing inside the Kennedy Space Center Press Site Auditorium, members of the media learned about the research headed to the International Space Station aboard the Dragon spacecraft. The briefing focused on several science projects including the Metabolic Tracking experiment; Atmosphere-Space Interactions Monitor (ASIM); Multi-purpose Variable-g Platform (MVP), and Veggie PONDS Validation. The Dragon spacecraft is scheduled to be launched from Space Launch Complex 40 at Cape Canaveral Air Force Station in Florida atop a SpaceX Falcon 9 rocket on the company's 14th Commercial Resupply Services mission to the space station.

Modified loop technique in three dogs with mitral regurgitation.

PubMed

Aoki, Takuma; Fujii, Yoko; Sunahara, Hiroshi; Takano, Hiroshi; Wakao, Yoshito

2013-01-31

Mitral valvuloplasty (MVP) is used in dogs with refractory mitral regurgitation (MR); however, it is difficult to tie the artificial chord, i.e., the expanded polytetrafluoroethylene suture, at the planned height of the mitral valve, because of the slippery nature of the knot. The loop technique has resolved these difficulties in humans. Premanufactured loops (length, 8.0-15.0 mm with 1.0-mm increments) were used in the new modified loop technique. In the current study, cardiac murmurs disappeared, and the MR markedly improved or completely disappeared approximately 3 months after surgery in 3 dogs. Therefore, this new technique might be effective in dogs.

Multiplanar visualization in 3D transthoracic echocardiography for precise delineation of mitral valve pathology.

PubMed

Kuppahally, Suman S; Paloma, Allan; Craig Miller, D; Schnittger, Ingela; Liang, David

2008-01-01

A novel multiplanar reformatting (MPR) technique in three-dimensional transthoracic echocardiography (3D TTE) was used to precisely localize the prolapsed lateral segment of posterior mitral valve leaflet in a patient symptomatic with mitral valve prolapse (MVP) and moderate mitral regurgitation (MR) before undergoing mitral valve repair surgery. Transesophageal echocardiography was avoided based on the findings of this new technique by 3D TTE. It was noninvasive, quick, reproducible and reliable. Also, it did not need the time-consuming reconstruction of multiple cardiac images. Mitral valve repair surgery was subsequently performed based on the MPR findings and corroborated the findings from the MPR examination.

Energy scavenging system by acoustic wave and integrated wireless communication

NASA Astrophysics Data System (ADS)

Kim, Albert

The purpose of the project was developing an energy-scavenging device for other bio implantable devices. Researchers and scientist have studied energy scavenging method because of the limitation of traditional power source, especially for bio-implantable devices. In this research, piezoelectric power generator that activates by acoustic wave, or music was developed. Follow by power generator, a wireless communication also integrated with the device for monitoring the power generation. The Lead Zirconate Titanate (PZT) bimorph cantilever with a proof mass at the free end tip was studied to convert acoustic wave to power. The music or acoustic wave played through a speaker to vibrate piezoelectric power generator. The LC circuit integrated with the piezoelectric material for purpose of wireless monitoring power generation. However, wireless monitoring can be used as wireless power transmission, which means the signal received via wireless communication also can be used for power for other devices. Size of 74 by 7 by 7cm device could generate and transmit 100mVp from 70 mm distance away with electrical resonant frequency at 420.2 kHz..

Developing a National-Level Concept Dictionary for EHR Implementations in Kenya.

PubMed

Keny, Aggrey; Wanyee, Steven; Kwaro, Daniel; Mulwa, Edwin; Were, Martin C

2015-01-01

The increasing adoption of Electronic Health Records (EHR) by developing countries comes with the need to develop common terminology standards to assure semantic interoperability. In Kenya, where the Ministry of Health has rolled out an EHR at 646 sites, several challenges have emerged including variable dictionaries across implementations, inability to easily share data across systems, lack of expertise in dictionary management, lack of central coordination and custody of a terminology service, inadequately defined policies and processes, insufficient infrastructure, among others. A Concept Working Group was constituted to address these challenges. The country settled on a common Kenya data dictionary, initially derived as a subset of the Columbia International eHealth Laboratory (CIEL)/Millennium Villages Project (MVP) dictionary. The initial dictionary scope largely focuses on clinical needs. Processes and policies around dictionary management are being guided by the framework developed by Bakhshi-Raiez et al. Technical and infrastructure-based approaches are also underway to streamline workflow for dictionary management and distribution across implementations. Kenya's approach on comprehensive common dictionary can serve as a model for other countries in similar settings.

Coordinated design of coding and modulation systems

NASA Technical Reports Server (NTRS)

Massey, J. L.; Ancheta, T.; Johannesson, R.; Lauer, G.; Lee, L.

1976-01-01

The joint optimization of the coding and modulation systems employed in telemetry systems was investigated. Emphasis was placed on formulating inner and outer coding standards used by the Goddard Spaceflight Center. Convolutional codes were found that are nearly optimum for use with Viterbi decoding in the inner coding of concatenated coding systems. A convolutional code, the unit-memory code, was discovered and is ideal for inner system usage because of its byte-oriented structure. Simulations of sequential decoding on the deep-space channel were carried out to compare directly various convolutional codes that are proposed for use in deep-space systems.

Evaluation and implementation of QR Code Identity Tag system for Healthcare in Turkey.

PubMed

Uzun, Vassilya; Bilgin, Sami

2016-01-01

For this study, we designed a QR Code Identity Tag system to integrate into the Turkish healthcare system. This system provides QR code-based medical identification alerts and an in-hospital patient identification system. Every member of the medical system is assigned a unique QR Code Tag; to facilitate medical identification alerts, the QR Code Identity Tag can be worn as a bracelet or necklace or carried as an ID card. Patients must always possess the QR Code Identity bracelets within hospital grounds. These QR code bracelets link to the QR Code Identity website, where detailed information is stored; a smartphone or standalone QR code scanner can be used to scan the code. The design of this system allows authorized personnel (e.g., paramedics, firefighters, or police) to access more detailed patient information than the average smartphone user: emergency service professionals are authorized to access patient medical histories to improve the accuracy of medical treatment. In Istanbul, we tested the self-designed system with 174 participants. To analyze the QR Code Identity Tag system's usability, the participants completed the System Usability Scale questionnaire after using the system.

System Design Description for the TMAD Code

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finfrock, S.H.

This document serves as the System Design Description (SDD) for the TMAD Code System, which includes the TMAD code and the LIBMAKR code. The SDD provides a detailed description of the theory behind the code, and the implementation of that theory. It is essential for anyone who is attempting to review or modify the code or who otherwise needs to understand the internal workings of the code. In addition, this document includes, in Appendix A, the System Requirements Specification for the TMAD System.

Error-correction coding for digital communications

NASA Astrophysics Data System (ADS)

Clark, G. C., Jr.; Cain, J. B.

This book is written for the design engineer who must build the coding and decoding equipment and for the communication system engineer who must incorporate this equipment into a system. It is also suitable as a senior-level or first-year graduate text for an introductory one-semester course in coding theory. Fundamental concepts of coding are discussed along with group codes, taking into account basic principles, practical constraints, performance computations, coding bounds, generalized parity check codes, polynomial codes, and important classes of group codes. Other topics explored are related to simple nonalgebraic decoding techniques for group codes, soft decision decoding of block codes, algebraic techniques for multiple error correction, the convolutional code structure and Viterbi decoding, syndrome decoding techniques, and sequential decoding techniques. System applications are also considered, giving attention to concatenated codes, coding for the white Gaussian noise channel, interleaver structures for coded systems, and coding for burst noise channels.

Concatenated coding systems employing a unit-memory convolutional code and a byte-oriented decoding algorithm

NASA Technical Reports Server (NTRS)

Lee, L.-N.

1977-01-01

Concatenated coding systems utilizing a convolutional code as the inner code and a Reed-Solomon code as the outer code are considered. In order to obtain very reliable communications over a very noisy channel with relatively modest coding complexity, it is proposed to concatenate a byte-oriented unit-memory convolutional code with an RS outer code whose symbol size is one byte. It is further proposed to utilize a real-time minimal-byte-error probability decoding algorithm, together with feedback from the outer decoder, in the decoder for the inner convolutional code. The performance of the proposed concatenated coding system is studied, and the improvement over conventional concatenated systems due to each additional feature is isolated.

Concatenated coding systems employing a unit-memory convolutional code and a byte-oriented decoding algorithm

NASA Technical Reports Server (NTRS)

Lee, L. N.

1976-01-01

Concatenated coding systems utilizing a convolutional code as the inner code and a Reed-Solomon code as the outer code are considered. In order to obtain very reliable communications over a very noisy channel with relatively small coding complexity, it is proposed to concatenate a byte oriented unit memory convolutional code with an RS outer code whose symbol size is one byte. It is further proposed to utilize a real time minimal byte error probability decoding algorithm, together with feedback from the outer decoder, in the decoder for the inner convolutional code. The performance of the proposed concatenated coding system is studied, and the improvement over conventional concatenated systems due to each additional feature is isolated.

Brain glucose metabolism in diffuse large B-cell lymphoma patients as assessed with FDG-PET: impact on outcome and chemotherapy effects.

PubMed

Adams, Hugo Ja; de Klerk, John Mh; Fijnheer, Rob; Heggelman, Ben Gf; Dubois, Stefan V; Nievelstein, Rutger Aj; Kwee, Thomas C

2016-06-01

There is a lack of data on the effect of rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) therapy on brain glucose metabolism of diffuse large B-cell lymphoma (DLBCL) patients, as measured by 18F-fluoro-2-deoxy-D-glucose positron emission tomography (FDG-PET). Moreover, the prognostic value of brain glucose metabolism measurements is currently unknown. To investigate the use of FDG-PET for measurement of brain glucose metabolism in R-CHOP-treated DLBCL patients, and to assess its prognostic value. This retrospective study included DLBCL patients who underwent FDG-PET including the brain. FDG-PET metabolic volume products (MVPs) of the entire brain, cerebral cortex, basal ganglia, and cerebellum were measured, before and after R-CHOP therapy. Whole-body total lesion glycolysis (TLG) was also measured. Thirty-eight patients were included, of whom 18 had an appropriate end-of-treatment FDG-PET scan. There were no significant differences (P > 0.199) between pre- and post-treatment brain glucose metabolism metrics. Low basal ganglia MVP was associated with a significantly worse progression-free survival (PFS) and overall survival (OS) (P = 0.020 and P = 0.032), and low cerebellar MVP was associated with a significantly worse OS (P = 0.034). There were non-significant very weak correlations between pretreatment brain glucose metabolism metrics and TLG. In the multivariate Cox regression, only the National Comprehensive Cancer Network International Prognostic Index (NCCN-IPI) remained an independent predictor of PFS (hazard ratio 3.787, P = 0.007) and OS (hazard ratio 2.903, P = 0.0345). Brain glucose metabolism was not affected by R-CHOP therapy. Low pretreatment brain glucose metabolism was associated with a worse outcome, but did not surpass the predictive value of the NCCN-IPI. © The Foundation Acta Radiologica 2015.

A pilot study and novel angiographic classification for superior sagittal sinus stenting in patients with non-thrombotic intracranial venous occlusive disease.

PubMed

Raper, Daniel M S; Buell, Thomas J; Ding, Dale; Pomeraniec, I Jonathan; Crowley, R Webster; Liu, Kenneth C

2018-01-01

Safety and efficacy of superior sagittal sinus (SSS) stenting for non-thrombotic intracranial venous occlusive disease (VOD) is unknown. The aim of this retrospective cohort study is to evaluate outcomes after SSS stenting. We evaluated an institutional database to identify patients who underwent SSS stenting. Radiographic and clinical outcomes were analyzed and a novel angiographic classification of the SSS was proposed. We identified 19 patients; 42% developed SSS stenosis after transverse sinus stenting. Pre-stent maximum mean venous pressure (MVP) in the SSS of 16.2 mm Hg decreased to 13.1 mm Hg after stenting (p=0.037). Preoperative trans-stenosis pressure gradient of 4.2 mm Hg decreased to 1.5 mm Hg after stenting (p<0.001). No intraprocedural complication or junctional SSS stenosis distal to the stent construct was noted. Improvement in headache, tinnitus, and visual obscurations was reported by 66.7%, 63.6%, and 50% of affected patients, respectively, at mean follow-up of 5.2 months. We divided the SSS into four anatomically equal segments, numbered S1-S4, from the torcula to frontal pole. SSS stenosis typically occurs in the S1 segment, and the anterior extent of SSS stents was deployed at the S1-S2 junction in all but one case. SSS stenting is reasonably safe, may improve clinical symptoms, and significantly reduces maximum MVP and trans-stenosis pressure gradients in patients with VOD with SSS stenosis. The S1 segment is most commonly stenotic, and minimum pressure gradients for symptomatic SSS stenosis may be lower than for transverse or sigmoid stenosis. Additional studies and follow-up are necessary to better elucidate appropriate clinical indications and long-term efficacy of SSS stenting. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Current and Future Management of Bilateral Loss of Vestibular Sensation – An update on the Johns Hopkins Multichannel Vestibular Prosthesis Project

PubMed Central

Della Santina, Charles C.; Migliaccio, Americo A.; Hayden, Russell; Melvin, Thuy-Anh; Fridman, Gene Y.; Chiang, Bryce; Davidovics, Natan S.; Dai, Chenkai; Carey, John P.; Minor, Lloyd B.; Anderson, Iee-Ching; Park, HongJu; Lyford-Pike, Sofia; Tang, Shan

2012-01-01

Bilateral loss of vestibular sensation can disable individuals whose vestibular hair cells are injured by ototoxic medications, infection, Ménière’s disease or other insults to the labyrinth including surgical trauma during cochlear implantation. Without input to vestibulo-ocular and vestibulo-spinal reflexes that normally stabilize the eyes and body, affected patients suffer blurred vision during head movement, postural instability, and chronic disequilibrium. While individuals with some residual sensation often compensate for their loss through rehabilitation exercises, those who fail to do so are left with no adequate treatment options. An implantable neuroelectronic vestibular prosthesis that emulates the normal labyrinth by sensing head movement and modulating activity on appropriate branches of the vestibular nerve could significantly improve quality of life for these otherwise chronically dizzy patients. This brief review describes the impact and current management of bilateral loss of vestibular sensation, animal studies supporting the feasibility of prosthetic vestibular stimulation, and a vestibular prosthesis designed to restore sensation of head rotation in all directions. Similar to a cochlear implant in concept and size, the Johns Hopkins Multichannel Vestibular Prosthesis (MVP) includes miniature gyroscopes to sense head rotation, a microcontroller to process inputs and control stimulus timing, and current sources switched between pairs of electrodes implanted within the vestibular labyrinth. In rodents and rhesus monkeys rendered bilaterally vestibular-deficient via treatment with gentamicin and/or plugging of semicircular canals, the MVP partially restores the vestibulo-ocular reflex for head rotations about any axis of rotation in 3-dimensional space. Our efforts now focus on addressing issues prerequisite to human implantation, including refinement of electrode designs and surgical technique to enhance stimulus selectivity and preserve cochlear function, optimization of stimulus protocols, and reduction of device size and power consumption. PMID:21756683

Ethical Challenges and Lessons Learned During the Clinical Development of a Group A Meningococcal Conjugate Vaccine.

PubMed

Martellet, Lionel; Sow, Samba O; Diallo, Aldiouma; Hodgson, Abraham; Kampmann, Beate; Hirve, Siddhivinayak; Tapia, Milagritos; Haidara, Fadima Cheick; Ndiaye, Assane; Diarra, Bou; Ansah, Patrick Odum; Akinsola, Adebayo; Idoko, Olubukola T; Adegbola, Richard A; Bavdekar, Ashish; Juvekar, Sanjay; Viviani, Simonetta; Enwere, Godwin C; Marchetti, Elisa; Chaumont, Julie; Makadi, Marie-Francoise; Pallardy, Flore; Kulkarni, Prasad S; Preziosi, Marie-Pierre; LaForce, F Marc

2015-11-15

The group A meningococcal vaccine (PsA-TT) clinical development plan included clinical trials in India and in the West African region between 2005 and 2013. During this period, the Meningitis Vaccine Project (MVP) accumulated substantial experience in the ethical conduct of research to the highest standards. Because of the public-private nature of the sponsorship of these trials and the extensive international collaboration with partners from a diverse setting of countries, the ethical review process was complex and required strategic, timely, and attentive communication to ensure the smooth review and approval for the clinical studies. Investigators and their site teams fostered strong community relationships prior to, during, and after the studies to ensure the involvement and the ownership of the research by the participating populations. As the clinical work proceeded, investigators and sponsors responded to specific questions of informed consent, pregnancy testing, healthcare, disease prevention, and posttrial access. Key factors that led to success included (1) constant dialogue between partners to explore and answer all ethical questions; (2) alertness and preparedness for emerging ethical questions during the research and in the context of evolving international ethics standards; and (3) care to assure that approaches were acceptable in the diverse community contexts. Many of the ethical issues encountered during the PsA-TT clinical development are familiar to groups conducting field trials in different cultural settings. The successful approaches used by the MVP clinical team offer useful examples of how these problems were resolved. ISRCTN17662153 (PsA-TT-001); ISRTCN78147026 (PsA-TT-002); ISRCTN87739946 (PsA-TT-003); ISRCTN46335400 (PsA-TT-003a); ISRCTN82484612 (PsA-TT-004); CTRI/2009/091/000368 (PsA-TT-005); PACTR ATMR2010030001913177 (PsA-TT-006); PACTR201110000328305 (PsA-TT-007). © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Channel coding in the space station data system network

NASA Technical Reports Server (NTRS)

Healy, T.

1982-01-01

A detailed discussion of the use of channel coding for error correction, privacy/secrecy, channel separation, and synchronization is presented. Channel coding, in one form or another, is an established and common element in data systems. No analysis and design of a major new system would fail to consider ways in which channel coding could make the system more effective. The presence of channel coding on TDRS, Shuttle, the Advanced Communication Technology Satellite Program system, the JSC-proposed Space Operations Center, and the proposed 30/20 GHz Satellite Communication System strongly support the requirement for the utilization of coding for the communications channel. The designers of the space station data system have to consider the use of channel coding.

Mean Line Pump Flow Model in Rocket Engine System Simulation

NASA Technical Reports Server (NTRS)

Veres, Joseph P.; Lavelle, Thomas M.

2000-01-01

A mean line pump flow modeling method has been developed to provide a fast capability for modeling turbopumps of rocket engines. Based on this method, a mean line pump flow code PUMPA has been written that can predict the performance of pumps at off-design operating conditions, given the loss of the diffusion system at the design point. The pump code can model axial flow inducers, mixed-flow and centrifugal pumps. The code can model multistage pumps in series. The code features rapid input setup and computer run time, and is an effective analysis and conceptual design tool. The map generation capability of the code provides the map information needed for interfacing with a rocket engine system modeling code. The off-design and multistage modeling capabilities of the code permit parametric design space exploration of candidate pump configurations and provide pump performance data for engine system evaluation. The PUMPA code has been integrated with the Numerical Propulsion System Simulation (NPSS) code and an expander rocket engine system has been simulated. The mean line pump flow code runs as an integral part of the NPSS rocket engine system simulation and provides key pump performance information directly to the system model at all operating conditions.

Automated Concurrent Blackboard System Generation in C++

NASA Technical Reports Server (NTRS)

Kaplan, J. A.; McManus, J. W.; Bynum, W. L.

1999-01-01

In his 1992 Ph.D. thesis, "Design and Analysis Techniques for Concurrent Blackboard Systems", John McManus defined several performance metrics for concurrent blackboard systems and developed a suite of tools for creating and analyzing such systems. These tools allow a user to analyze a concurrent blackboard system design and predict the performance of the system before any code is written. The design can be modified until simulated performance is satisfactory. Then, the code generator can be invoked to generate automatically all of the code required for the concurrent blackboard system except for the code implementing the functionality of each knowledge source. We have completed the port of the source code generator and a simulator for a concurrent blackboard system. The source code generator generates the necessary C++ source code to implement the concurrent blackboard system using Parallel Virtual Machine (PVM) running on a heterogeneous network of UNIX(trademark) workstations. The concurrent blackboard simulator uses the blackboard specification file to predict the performance of the concurrent blackboard design. The only part of the source code for the concurrent blackboard system that the user must supply is the code implementing the functionality of the knowledge sources.

The Exchange Data Communication System based on Centralized Database for the Meat Industry

NASA Astrophysics Data System (ADS)

Kobayashi, Yuichi; Taniguchi, Yoji; Terada, Shuji; Komoda, Norihisa

We propose applying the EDI system that is based on centralized database and supports conversion of code data to the meat industry. This system makes it possible to share exchange data on beef between enterprises from producers to retailers by using Web EDI technology. In order to efficiently convert code direct conversion of a sender's code to a receiver's code using a code map is used. This system that mounted this function has been implemented in September 2004. Twelve enterprises including retailers, and processing traders, and wholesalers were using the system as of June 2005. In this system, the number of code maps relevant to the introductory cost of the code conversion function was lower than the theoretical value and were close to the case that a standard code is mediated.

Design of ACM system based on non-greedy punctured LDPC codes

NASA Astrophysics Data System (ADS)

Lu, Zijun; Jiang, Zihong; Zhou, Lin; He, Yucheng

2017-08-01

In this paper, an adaptive coded modulation (ACM) scheme based on rate-compatible LDPC (RC-LDPC) codes was designed. The RC-LDPC codes were constructed by a non-greedy puncturing method which showed good performance in high code rate region. Moreover, the incremental redundancy scheme of LDPC-based ACM system over AWGN channel was proposed. By this scheme, code rates vary from 2/3 to 5/6 and the complication of the ACM system is lowered. Simulations show that more and more obvious coding gain can be obtained by the proposed ACM system with higher throughput.

Encrypted holographic data storage based on orthogonal-phase-code multiplexing.

PubMed

Heanue, J F; Bashaw, M C; Hesselink, L

1995-09-10

We describe an encrypted holographic data-storage system that combines orthogonal-phase-code multiplexing with a random-phase key. The system offers the security advantages of random-phase coding but retains the low cross-talk performance and the minimum code storage requirements typical in an orthogonal-phase-code-multiplexing system.

Interframe vector wavelet coding technique

NASA Astrophysics Data System (ADS)

Wus, John P.; Li, Weiping

1997-01-01

Wavelet coding is often used to divide an image into multi- resolution wavelet coefficients which are quantized and coded. By 'vectorizing' scalar wavelet coding and combining this with vector quantization (VQ), vector wavelet coding (VWC) can be implemented. Using a finite number of states, finite-state vector quantization (FSVQ) takes advantage of the similarity between frames by incorporating memory into the video coding system. Lattice VQ eliminates the potential mismatch that could occur using pre-trained VQ codebooks. It also eliminates the need for codebook storage in the VQ process, thereby creating a more robust coding system. Therefore, by using the VWC coding method in conjunction with the FSVQ system and lattice VQ, the formulation of a high quality very low bit rate coding systems is proposed. A coding system using a simple FSVQ system where the current state is determined by the previous channel symbol only is developed. To achieve a higher degree of compression, a tree-like FSVQ system is implemented. The groupings are done in this tree-like structure from the lower subbands to the higher subbands in order to exploit the nature of subband analysis in terms of the parent-child relationship. Class A and Class B video sequences from the MPEG-IV testing evaluations are used in the evaluation of this coding method.

High rate concatenated coding systems using bandwidth efficient trellis inner codes

NASA Technical Reports Server (NTRS)

Deng, Robert H.; Costello, Daniel J., Jr.

1989-01-01

High-rate concatenated coding systems with bandwidth-efficient trellis inner codes and Reed-Solomon (RS) outer codes are investigated for application in high-speed satellite communication systems. Two concatenated coding schemes are proposed. In one the inner code is decoded with soft-decision Viterbi decoding, and the outer RS code performs error-correction-only decoding (decoding without side information). In the other, the inner code is decoded with a modified Viterbi algorithm, which produces reliability information along with the decoded output. In this algorithm, path metrics are used to estimate the entire information sequence, whereas branch metrics are used to provide reliability information on the decoded sequence. This information is used to erase unreliable bits in the decoded output. An errors-and-erasures RS decoder is then used for the outer code. The two schemes have been proposed for high-speed data communication on NASA satellite channels. The rates considered are at least double those used in current NASA systems, and the results indicate that high system reliability can still be achieved.

42 CFR 405.512 - Carriers' procedural terminology and coding systems.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 2 2013-10-01 2013-10-01 false Carriers' procedural terminology and coding systems... Determining Reasonable Charges § 405.512 Carriers' procedural terminology and coding systems. (a) General. Procedural terminology and coding systems are designed to provide physicians and third party payers with a...

42 CFR 405.512 - Carriers' procedural terminology and coding systems.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 2 2011-10-01 2011-10-01 false Carriers' procedural terminology and coding systems... Determining Reasonable Charges § 405.512 Carriers' procedural terminology and coding systems. (a) General. Procedural terminology and coding systems are designed to provide physicians and third party payers with a...

42 CFR 405.512 - Carriers' procedural terminology and coding systems.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 2 2014-10-01 2014-10-01 false Carriers' procedural terminology and coding systems... Determining Reasonable Charges § 405.512 Carriers' procedural terminology and coding systems. (a) General. Procedural terminology and coding systems are designed to provide physicians and third party payers with a...

42 CFR 405.512 - Carriers' procedural terminology and coding systems.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 2 2012-10-01 2012-10-01 false Carriers' procedural terminology and coding systems... Determining Reasonable Charges § 405.512 Carriers' procedural terminology and coding systems. (a) General. Procedural terminology and coding systems are designed to provide physicians and third party payers with a...

42 CFR 405.512 - Carriers' procedural terminology and coding systems.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 2 2010-10-01 2010-10-01 false Carriers' procedural terminology and coding systems... Determining Reasonable Charges § 405.512 Carriers' procedural terminology and coding systems. (a) General. Procedural terminology and coding systems are designed to provide physicians and third party payers with a...

A novel concatenated code based on the improved SCG-LDPC code for optical transmission systems

NASA Astrophysics Data System (ADS)

Yuan, Jian-guo; Xie, Ya; Wang, Lin; Huang, Sheng; Wang, Yong

2013-01-01

Based on the optimization and improvement for the construction method of systematically constructed Gallager (SCG) (4, k) code, a novel SCG low density parity check (SCG-LDPC)(3969, 3720) code to be suitable for optical transmission systems is constructed. The novel SCG-LDPC (6561,6240) code with code rate of 95.1% is constructed by increasing the length of SCG-LDPC (3969,3720) code, and in a way, the code rate of LDPC codes can better meet the high requirements of optical transmission systems. And then the novel concatenated code is constructed by concatenating SCG-LDPC(6561,6240) code and BCH(127,120) code with code rate of 94.5%. The simulation results and analyses show that the net coding gain (NCG) of BCH(127,120)+SCG-LDPC(6561,6240) concatenated code is respectively 2.28 dB and 0.48 dB more than those of the classic RS(255,239) code and SCG-LDPC(6561,6240) code at the bit error rate (BER) of 10-7.

Trace-shortened Reed-Solomon codes

NASA Technical Reports Server (NTRS)

Mceliece, R. J.; Solomon, G.

1994-01-01

Reed-Solomon (RS) codes have been part of standard NASA telecommunications systems for many years. RS codes are character-oriented error-correcting codes, and their principal use in space applications has been as outer codes in concatenated coding systems. However, for a given character size, say m bits, RS codes are limited to a length of, at most, 2(exp m). It is known in theory that longer character-oriented codes would be superior to RS codes in concatenation applications, but until recently no practical class of 'long' character-oriented codes had been discovered. In 1992, however, Solomon discovered an extensive class of such codes, which are now called trace-shortened Reed-Solomon (TSRS) codes. In this article, we will continue the study of TSRS codes. Our main result is a formula for the dimension of any TSRS code, as a function of its error-correcting power. Using this formula, we will give several examples of TSRS codes, some of which look very promising as candidate outer codes in high-performance coded telecommunications systems.

An Interactive Concatenated Turbo Coding System

NASA Technical Reports Server (NTRS)

Liu, Ye; Tang, Heng; Lin, Shu; Fossorier, Marc

1999-01-01

This paper presents a concatenated turbo coding system in which a Reed-Solomon outer code is concatenated with a binary turbo inner code. In the proposed system, the outer code decoder and the inner turbo code decoder interact to achieve both good bit error and frame error performances. The outer code decoder helps the inner turbo code decoder to terminate its decoding iteration while the inner turbo code decoder provides soft-output information to the outer code decoder to carry out a reliability-based soft- decision decoding. In the case that the outer code decoding fails, the outer code decoder instructs the inner code decoder to continue its decoding iterations until the outer code decoding is successful or a preset maximum number of decoding iterations is reached. This interaction between outer and inner code decoders reduces decoding delay. Also presented in the paper are an effective criterion for stopping the iteration process of the inner code decoder and a new reliability-based decoding algorithm for nonbinary codes.

Error-correction coding

NASA Technical Reports Server (NTRS)

Hinds, Erold W. (Principal Investigator)

1996-01-01

This report describes the progress made towards the completion of a specific task on error-correcting coding. The proposed research consisted of investigating the use of modulation block codes as the inner code of a concatenated coding system in order to improve the overall space link communications performance. The study proposed to identify and analyze candidate codes that will complement the performance of the overall coding system which uses the interleaved RS (255,223) code as the outer code.

User Instructions for the Systems Assessment Capability, Rev. 1, Computer Codes Volume 3: Utility Codes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eslinger, Paul W.; Aaberg, Rosanne L.; Lopresti, Charles A.

2004-09-14

This document contains detailed user instructions for a suite of utility codes developed for Rev. 1 of the Systems Assessment Capability. The suite of computer codes for Rev. 1 of Systems Assessment Capability performs many functions.

Transient dynamics capability at Sandia National Laboratories

NASA Technical Reports Server (NTRS)

Attaway, Steven W.; Biffle, Johnny H.; Sjaardema, G. D.; Heinstein, M. W.; Schoof, L. A.

1993-01-01

A brief overview of the transient dynamics capabilities at Sandia National Laboratories, with an emphasis on recent new developments and current research is presented. In addition, the Sandia National Laboratories (SNL) Engineering Analysis Code Access System (SEACAS), which is a collection of structural and thermal codes and utilities used by analysts at SNL, is described. The SEACAS system includes pre- and post-processing codes, analysis codes, database translation codes, support libraries, Unix shell scripts for execution, and an installation system. SEACAS is used at SNL on a daily basis as a production, research, and development system for the engineering analysts and code developers. Over the past year, approximately 190 days of CPU time were used by SEACAS codes on jobs running from a few seconds up to two and one-half days of CPU time. SEACAS is running on several different systems at SNL including Cray Unicos, Hewlett Packard PH-UX, Digital Equipment Ultrix, and Sun SunOS. An overview of SEACAS, including a short description of the codes in the system, are presented. Abstracts and references for the codes are listed at the end of the report.

The application of coded excitation technology in medical ultrasonic Doppler imaging

NASA Astrophysics Data System (ADS)

Li, Weifeng; Chen, Xiaodong; Bao, Jing; Yu, Daoyin

2008-03-01

Medical ultrasonic Doppler imaging is one of the most important domains of modern medical imaging technology. The application of coded excitation technology in medical ultrasonic Doppler imaging system has the potential of higher SNR and deeper penetration depth than conventional pulse-echo imaging system, it also improves the image quality, and enhances the sensitivity of feeble signal, furthermore, proper coded excitation is beneficial to received spectrum of Doppler signal. Firstly, this paper analyzes the application of coded excitation technology in medical ultrasonic Doppler imaging system abstractly, showing the advantage and bright future of coded excitation technology, then introduces the principle and the theory of coded excitation. Secondly, we compare some coded serials (including Chirp and fake Chirp signal, Barker codes, Golay's complementary serial, M-sequence, etc). Considering Mainlobe Width, Range Sidelobe Level, Signal-to-Noise Ratio and sensitivity of Doppler signal, we choose Barker codes as coded serial. At last, we design the coded excitation circuit. The result in B-mode imaging and Doppler flow measurement coincided with our expectation, which incarnated the advantage of application of coded excitation technology in Digital Medical Ultrasonic Doppler Endoscope Imaging System.

Accuracy and time requirements of a bar-code inventory system for medical supplies.

PubMed

Hanson, L B; Weinswig, M H; De Muth, J E

1988-02-01

The effects of implementing a bar-code system for issuing medical supplies to nursing units at a university teaching hospital were evaluated. Data on the time required to issue medical supplies to three nursing units at a 480-bed, tertiary-care teaching hospital were collected (1) before the bar-code system was implemented (i.e., when the manual system was in use), (2) one month after implementation, and (3) four months after implementation. At the same times, the accuracy of the central supply perpetual inventory was monitored using 15 selected items. One-way analysis of variance tests were done to determine any significant differences between the bar-code and manual systems. Using the bar-code system took longer than using the manual system because of a significant difference in the time required for order entry into the computer. Multiple-use requirements of the central supply computer system made entering bar-code data a much slower process. There was, however, a significant improvement in the accuracy of the perpetual inventory. Using the bar-code system for issuing medical supplies to the nursing units takes longer than using the manual system. However, the accuracy of the perpetual inventory was significantly improved with the implementation of the bar-code system.

42 CFR 414.502 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-10-01

... laboratory test for which a new or substantially revised Healthcare Common Procedure Coding System Code is assigned on or after January 1, 2005. Substantially Revised Healthcare Common Procedure Coding System Code...

42 CFR 414.502 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-10-01

... laboratory test for which a new or substantially revised Healthcare Common Procedure Coding System Code is assigned on or after January 1, 2005. Substantially Revised Healthcare Common Procedure Coding System Code...

Channel coding for underwater acoustic single-carrier CDMA communication system

NASA Astrophysics Data System (ADS)

Liu, Lanjun; Zhang, Yonglei; Zhang, Pengcheng; Zhou, Lin; Niu, Jiong

2017-01-01

CDMA is an effective multiple access protocol for underwater acoustic networks, and channel coding can effectively reduce the bit error rate (BER) of the underwater acoustic communication system. For the requirements of underwater acoustic mobile networks based on CDMA, an underwater acoustic single-carrier CDMA communication system (UWA/SCCDMA) based on the direct-sequence spread spectrum is proposed, and its channel coding scheme is studied based on convolution, RA, Turbo and LDPC coding respectively. The implementation steps of the Viterbi algorithm of convolutional coding, BP and minimum sum algorithms of RA coding, Log-MAP and SOVA algorithms of Turbo coding, and sum-product algorithm of LDPC coding are given. An UWA/SCCDMA simulation system based on Matlab is designed. Simulation results show that the UWA/SCCDMA based on RA, Turbo and LDPC coding have good performance such that the communication BER is all less than 10-6 in the underwater acoustic channel with low signal to noise ratio (SNR) from -12 dB to -10dB, which is about 2 orders of magnitude lower than that of the convolutional coding. The system based on Turbo coding with Log-MAP algorithm has the best performance.

[Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

PubMed

Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

2012-01-01

Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

Enabling Handicapped Nonreaders to Independently Obtain Information: Initial Development of an Inexpensive Bar Code Reader System.

ERIC Educational Resources Information Center

VanBiervliet, Alan

A project to develop and evaluate a bar code reader system as a self-directed information and instructional aid for handicapped nonreaders is described. The bar code technology involves passing a light sensitive pen or laser over a printed code with bars which correspond to coded numbers. A system would consist of a portable device which could…

Technology Infusion of CodeSonar into the Space Network Ground Segment

NASA Technical Reports Server (NTRS)

Benson, Markland J.

2009-01-01

This slide presentation reviews the applicability of CodeSonar to the Space Network software. CodeSonar is a commercial off the shelf system that analyzes programs written in C, C++ or Ada for defects in the code. Software engineers use CodeSonar results as an input to the existing source code inspection process. The study is focused on large scale software developed using formal processes. The systems studied are mission critical in nature but some use commodity computer systems.

Trellis coded multilevel DPSK system with doppler correction for mobile satellite channels

NASA Technical Reports Server (NTRS)

Divsalar, Dariush (Inventor); Simon, Marvin K. (Inventor)

1991-01-01

A trellis coded multilevel differential phase shift keyed mobile communication system. The system of the present invention includes a trellis encoder for translating input signals into trellis codes; a differential encoder for differentially encoding the trellis coded signals; a transmitter for transmitting the differentially encoded trellis coded signals; a receiver for receiving the transmitted signals; a differential demodulator for demodulating the received differentially encoded trellis coded signals; and a trellis decoder for decoding the differentially demodulated signals.

SU-D-BRD-03: A Gateway for GPU Computing in Cancer Radiotherapy Research

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jia, X; Folkerts, M; Shi, F

Purpose: Graphics Processing Unit (GPU) has become increasingly important in radiotherapy. However, it is still difficult for general clinical researchers to access GPU codes developed by other researchers, and for developers to objectively benchmark their codes. Moreover, it is quite often to see repeated efforts spent on developing low-quality GPU codes. The goal of this project is to establish an infrastructure for testing GPU codes, cross comparing them, and facilitating code distributions in radiotherapy community. Methods: We developed a system called Gateway for GPU Computing in Cancer Radiotherapy Research (GCR2). A number of GPU codes developed by our group andmore » other developers can be accessed via a web interface. To use the services, researchers first upload their test data or use the standard data provided by our system. Then they can select the GPU device on which the code will be executed. Our system offers all mainstream GPU hardware for code benchmarking purpose. After the code running is complete, the system automatically summarizes and displays the computing results. We also released a SDK to allow the developers to build their own algorithm implementation and submit their binary codes to the system. The submitted code is then systematically benchmarked using a variety of GPU hardware and representative data provided by our system. The developers can also compare their codes with others and generate benchmarking reports. Results: It is found that the developed system is fully functioning. Through a user-friendly web interface, researchers are able to test various GPU codes. Developers also benefit from this platform by comprehensively benchmarking their codes on various GPU platforms and representative clinical data sets. Conclusion: We have developed an open platform allowing the clinical researchers and developers to access the GPUs and GPU codes. This development will facilitate the utilization of GPU in radiation therapy field.« less

Evaluation of low-cost, objective instruments for assessing physical activity in 10-11-year-old children.

PubMed

Hart, Teresa L; Brusseau, Timothy; Kulinna, Pamela Hodges; McClain, James J; Tudor-Locke, Catrine

2011-12-01

This study compared step counts detected by four, low-cost, objective, physical-activity-assessment instruments and evaluated their ability to detect moderate-to-vigorous physical activity (MVPA) compared to the ActiGraph accelerometer (AG). Thirty-six 10-11-year-old children wore the NL-1000, Yamax Digiwalker SW 200, Omron HJ-151, and Walk4Life MVP concurrently with the AG during school hours on a single day. AG MVPA was derived from activity count data using previously validated cut points. Two of the evaluated instruments provided similar group mean MVPA and step counts compared to AG (dependent on cut point). Low-cost instruments may be useful for measurement of both MVPA and steps in children's physical activity interventions and program evaluation.

The Tyrrhena-Malea Volcanic Province, Mars: Overview

NASA Astrophysics Data System (ADS)

Williams, D.; Greeley, R.; Ferguson, R.; Kuzmin, R.; McCord, T.; Combe, J.-P.; Head, J.; Xiao, L.; Manfredi, L.; Poulet, F.; Pinet, P.; Baratoux, D.; Plaut, J. J.; Raitala, J.; Neukum, G.

2008-09-01

Building on previous studies of volcanoes around the Hellas basin with new studies of imaging (HRSC, THEMIS, MOC, HiRISE, CTX), multispectral (HRSC, OMEGA), topographic (MOLA) and gravity data, we define a new Martian volcanic province as the Tyrrhena-Malea Volcanic Province (T-MVP). With an area of >2.1 million sq. km, it contains the six oldest central vent volcanoes on Mars, which formed after the Hellas impact basin, between 4.0 to 3.6 Ga. These volcanoes mark a transition from the flood volcanism that formed Malea Planum ~3.8 Ga, to localized point source eruptions. The T-MVP volcanoes have two general morphologies: 1) shieldlike edifices (Tyrrhena, Hadriaca, and Amphitrites Paterae), and 2) caldera-like depressions surrounded by ridged plains (Peneus, Malea, and Pityusa Paterae). Positive gravity anomalies are found at Tyrrhena, Hadriaca, and Amphitrites, perhaps indicative of dense magma bodies below the surface. The lack of shield-like edifices and weak gravity anomalies at Peneus, Malea, and Pityusa suggest a fundamental difference in their formation, styles of eruption, and/or compositions. The northernmost volcanoes, the ~3.7- 3.9 Ga Tyrrhena and Hadriaca Paterae, have low slopes, well-channeled flanks, and smooth caldera floors (at tens of meters/pixel scale), indicative of ash shields formed from poorly-consolidated pyroclastic deposits that have been modified by fluvial and aeolian erosion and deposition. The ~3.6 Ga Amphitrites Patera also has a well-channeled flank, but it and the ~3.8 Ga Peneus Patera are dominated by scalloped and pitted terrain, pedestal and ejecta flow craters, and a general `softened' appearance. This morphology is indicative not only of surface materials subjected to periglacial processes involving water ice, but also of a surface composed of easily eroded materials such as ash and dust. The southernmost volcanoes, the ~3.8 Ga Malea and Pityusa Paterae, have no channeled flanks, no scalloped and pitted terrain, and lack the `softened' appearance of their surfaces, but they do contain pedestal and ejecta flow craters and large, smooth, bright plateaus in their central depressions. This morphology is indicative of a surface with not only a high water ice content, but also a more consolidated material that is less susceptible to degradation (relative to the other four volcanoes). We suggest that Malea and Pityusa (and possibly Peneus) Paterae are Martian equivalents to Earth's giant calderas (e.g., Yellowstone, Long Valley) that erupted large volumes of volcanic materials, and that Malea and Pityusa are probably composed of either lava flows or ignimbrites. HRSC and OMEGA spectral data indicate that dark gray to slightly red materials (often represented as blue or black pixels in HRSC color images), found in the patera floors and topographic lows throughout the T-MVP, have a basaltic composition. A key issue is whether this dark material represents concentrations of underlying basaltic material exposed by aeolian winnowing, or if the material was transported from elsewhere on Mars by regional winds. Understanding the provenance of these dark materials may be the key to understanding the volcanic diversity of the Tyrrhena-Malea Volcanic Province. References [1] Crown, D. and Greeley, R. (2007) U.S. Geol. Surv. Sci. Inves. Ser. Map 2936. [2] Gregg, T., et al. (1998) U.S. Geol. Surv. Map I- 2556. [3] Leonard, G. and Tanaka, K. (2001) U. S. Geol. Survey Misc. Invest. Series Map I-2694. [4] Kolb, E. and Tanaka, K. (2008) Geologic Map of the Planum Australe Region of Mars. U. S. Geol. Survey. Misc. Investigation Series, in review. [5] Peterson, J. (1978) Proc. 9th LPSC, 3411-3432.

Development of new two-dimensional spectral/spatial code based on dynamic cyclic shift code for OCDMA system

NASA Astrophysics Data System (ADS)

Jellali, Nabiha; Najjar, Monia; Ferchichi, Moez; Rezig, Houria

2017-07-01

In this paper, a new two-dimensional spectral/spatial codes family, named two dimensional dynamic cyclic shift codes (2D-DCS) is introduced. The 2D-DCS codes are derived from the dynamic cyclic shift code for the spectral and spatial coding. The proposed system can fully eliminate the multiple access interference (MAI) by using the MAI cancellation property. The effect of shot noise, phase-induced intensity noise and thermal noise are used to analyze the code performance. In comparison with existing two dimensional (2D) codes, such as 2D perfect difference (2D-PD), 2D Extended Enhanced Double Weight (2D-Extended-EDW) and 2D hybrid (2D-FCC/MDW) codes, the numerical results show that our proposed codes have the best performance. By keeping the same code length and increasing the spatial code, the performance of our 2D-DCS system is enhanced: it provides higher data rates while using lower transmitted power and a smaller spectral width.

Performance of data-compression codes in channels with errors. Final report, October 1986-January 1987

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1987-10-01

Huffman codes, comma-free codes, and block codes with shift indicators are important candidate-message compression codes for improving the efficiency of communications systems. This study was undertaken to determine if these codes could be used to increase the thruput of the fixed very-low-frequency (FVLF) communication system. This applications involves the use of compression codes in a channel with errors.

The adaption and use of research codes for performance assessment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebetrau, A.M.

1987-05-01

Models of real-world phenomena are developed for many reasons. The models are usually, if not always, implemented in the form of a computer code. The characteristics of a code are determined largely by its intended use. Realizations or implementations of detailed mathematical models of complex physical and/or chemical processes are often referred to as research or scientific (RS) codes. Research codes typically require large amounts of computing time. One example of an RS code is a finite-element code for solving complex systems of differential equations that describe mass transfer through some geologic medium. Considerable computing time is required because computationsmore » are done at many points in time and/or space. Codes used to evaluate the overall performance of real-world physical systems are called performance assessment (PA) codes. Performance assessment codes are used to conduct simulated experiments involving systems that cannot be directly observed. Thus, PA codes usually involve repeated simulations of system performance in situations that preclude the use of conventional experimental and statistical methods. 3 figs.« less

The application of LDPC code in MIMO-OFDM system

NASA Astrophysics Data System (ADS)

Liu, Ruian; Zeng, Beibei; Chen, Tingting; Liu, Nan; Yin, Ninghao

2018-03-01

The combination of MIMO and OFDM technology has become one of the key technologies of the fourth generation mobile communication., which can overcome the frequency selective fading of wireless channel, increase the system capacity and improve the frequency utilization. Error correcting coding introduced into the system can further improve its performance. LDPC (low density parity check) code is a kind of error correcting code which can improve system reliability and anti-interference ability, and the decoding is simple and easy to operate. This paper mainly discusses the application of LDPC code in MIMO-OFDM system.

VENTURE/PC manual: A multidimensional multigroup neutron diffusion code system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shapiro, A.; Huria, H.C.; Cho, K.W.

1991-12-01

VENTURE/PC is a recompilation of part of the Oak Ridge BOLD VENTURE code system, which will operate on an IBM PC or compatible computer. Neutron diffusion theory solutions are obtained for multidimensional, multigroup problems. This manual contains information associated with operating the code system. The purpose of the various modules used in the code system, and the input for these modules are discussed. The PC code structure is also given. Version 2 included several enhancements not given in the original version of the code. In particular, flux iterations can be done in core rather than by reading and writing tomore » disk, for problems which allow sufficient memory for such in-core iterations. This speeds up the iteration process. Version 3 does not include any of the special processors used in the previous versions. These special processors utilized formatted input for various elements of the code system. All such input data is now entered through the Input Processor, which produces standard interface files for the various modules in the code system. In addition, a Standard Interface File Handbook is included in the documentation which is distributed with the code, to assist in developing the input for the Input Processor.« less

Thermal hydraulic-severe accident code interfaces for SCDAP/RELAP5/MOD3.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coryell, E.W.; Siefken, L.J.; Harvego, E.A.

1997-07-01

The SCDAP/RELAP5 computer code is designed to describe the overall reactor coolant system thermal-hydraulic response, core damage progression, and fission product release during severe accidents. The code is being developed at the Idaho National Engineering Laboratory under the primary sponsorship of the Office of Nuclear Regulatory Research of the U.S. Nuclear Regulatory Commission. The code is the result of merging the RELAP5, SCDAP, and COUPLE codes. The RELAP5 portion of the code calculates the overall reactor coolant system, thermal-hydraulics, and associated reactor system responses. The SCDAP portion of the code describes the response of the core and associated vessel structures.more » The COUPLE portion of the code describes response of lower plenum structures and debris and the failure of the lower head. The code uses a modular approach with the overall structure, input/output processing, and data structures following the pattern established for RELAP5. The code uses a building block approach to allow the code user to easily represent a wide variety of systems and conditions through a powerful input processor. The user can represent a wide variety of experiments or reactor designs by selecting fuel rods and other assembly structures from a range of representative core component models, and arrange them in a variety of patterns within the thermalhydraulic network. The COUPLE portion of the code uses two-dimensional representations of the lower plenum structures and debris beds. The flow of information between the different portions of the code occurs at each system level time step advancement. The RELAP5 portion of the code describes the fluid transport around the system. These fluid conditions are used as thermal and mass transport boundary conditions for the SCDAP and COUPLE structures and debris beds.« less

Two dimension MDW OCDMA code cross-correlation for reduction of phase induced intensity noise

NASA Astrophysics Data System (ADS)

Ahmed, Israa Sh.; Aljunid, Syed A.; Nordin, Junita M.; Dulaimi, Layth A. Khalil Al; Matem, Rima

2017-11-01

In this paper, we first review 2-D MDW code cross correlation equations and table to be improved significantly by using code correlation properties. These codes can be used in the synchronous optical CDMA systems for multi access interference cancellation and maximum suppress the phase induced intensity noise. Low Psr is due to the reduction of interference noise that is induced by the 2-D MDW code PIIN suppression. High data rate causes increases in BER, requires high effective power and severely deteriorates the system performance. The 2-D W/T MDW code has an excellent system performance where the value of PIIN is suppressed as low as possible at the optimum Psr with high data bit rate. The 2-D MDW code shows better tolerance to PIIN in comparison to others with enhanced system performance. We prove by numerical analysis that the PIIN maximally suppressed by MDW code through the minimizing property of cross correlation in comparison to 2-D PDC and 2-D MQC OCDMA code.scheme systems.

Performance enhancement of optical code-division multiple-access systems using transposed modified Walsh code

NASA Astrophysics Data System (ADS)

Sikder, Somali; Ghosh, Shila

2018-02-01

This paper presents the construction of unipolar transposed modified Walsh code (TMWC) and analysis of its performance in optical code-division multiple-access (OCDMA) systems. Specifically, the signal-to-noise ratio, bit error rate (BER), cardinality, and spectral efficiency were investigated. The theoretical analysis demonstrated that the wavelength-hopping time-spreading system using TMWC was robust against multiple-access interference and more spectrally efficient than systems using other existing OCDMA codes. In particular, the spectral efficiency was calculated to be 1.0370 when TMWC of weight 3 was employed. The BER and eye pattern for the designed TMWC were also successfully obtained using OptiSystem simulation software. The results indicate that the proposed code design is promising for enhancing network capacity.

10 CFR 434.99 - Explanation of numbering system for codes.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 3 2011-01-01 2011-01-01 false Explanation of numbering system for codes. 434.99 Section 434.99 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY CODE FOR NEW FEDERAL COMMERCIAL AND MULTI-FAMILY HIGH RISE RESIDENTIAL BUILDINGS § 434.99 Explanation of numbering system for codes. (a) For...

10 CFR 434.99 - Explanation of numbering system for codes.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Explanation of numbering system for codes. 434.99 Section 434.99 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY CODE FOR NEW FEDERAL COMMERCIAL AND MULTI-FAMILY HIGH RISE RESIDENTIAL BUILDINGS § 434.99 Explanation of numbering system for codes. (a) For...

48 CFR 452.219-70 - Size Standard and NAICS Code Information.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Size Standard and NAICS Code Information. 452.219-70 Section 452.219-70 Federal Acquisition Regulations System DEPARTMENT OF... System Code(s) and business size standard(s) describing the products and/or services to be acquired under...

Performance optimization of spectral amplitude coding OCDMA system using new enhanced multi diagonal code

NASA Astrophysics Data System (ADS)

Imtiaz, Waqas A.; Ilyas, M.; Khan, Yousaf

2016-11-01

This paper propose a new code to optimize the performance of spectral amplitude coding-optical code division multiple access (SAC-OCDMA) system. The unique two-matrix structure of the proposed enhanced multi diagonal (EMD) code and effective correlation properties, between intended and interfering subscribers, significantly elevates the performance of SAC-OCDMA system by negating multiple access interference (MAI) and associated phase induce intensity noise (PIIN). Performance of SAC-OCDMA system based on the proposed code is thoroughly analyzed for two detection techniques through analytic and simulation analysis by referring to bit error rate (BER), signal to noise ratio (SNR) and eye patterns at the receiving end. It is shown that EMD code while using SDD technique provides high transmission capacity, reduces the receiver complexity, and provides better performance as compared to complementary subtraction detection (CSD) technique. Furthermore, analysis shows that, for a minimum acceptable BER of 10-9 , the proposed system supports 64 subscribers at data rates of up to 2 Gbps for both up-down link transmission.

Production code control system for hydrodynamics simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slone, D.M.

1997-08-18

We describe how the Production Code Control System (pCCS), written in Perl, has been used to control and monitor the execution of a large hydrodynamics simulation code in a production environment. We have been able to integrate new, disparate, and often independent, applications into the PCCS framework without the need to modify any of our existing application codes. Both users and code developers see a consistent interface to the simulation code and associated applications regardless of the physical platform, whether an MPP, SMP, server, or desktop workstation. We will also describe our use of Perl to develop a configuration managementmore » system for the simulation code, as well as a code usage database and report generator. We used Perl to write a backplane that allows us plug in preprocessors, the hydrocode, postprocessors, visualization tools, persistent storage requests, and other codes. We need only teach PCCS a minimal amount about any new tool or code to essentially plug it in and make it usable to the hydrocode. PCCS has made it easier to link together disparate codes, since using Perl has removed the need to learn the idiosyncrasies of system or RPC programming. The text handling in Perl makes it easy to teach PCCS about new codes, or changes to existing codes.« less

BCH codes for large IC random-access memory systems

NASA Technical Reports Server (NTRS)

Lin, S.; Costello, D. J., Jr.

1983-01-01

In this report some shortened BCH codes for possible applications to large IC random-access memory systems are presented. These codes are given by their parity-check matrices. Encoding and decoding of these codes are discussed.

High performance and cost effective CO-OFDM system aided by polar code.

PubMed

Liu, Ling; Xiao, Shilin; Fang, Jiafei; Zhang, Lu; Zhang, Yunhao; Bi, Meihua; Hu, Weisheng

2017-02-06

A novel polar coded coherent optical orthogonal frequency division multiplexing (CO-OFDM) system is proposed and demonstrated through experiment for the first time. The principle of a polar coded CO-OFDM signal is illustrated theoretically and the suitable polar decoding method is discussed. Results show that the polar coded CO-OFDM signal achieves a net coding gain (NCG) of more than 10 dB at bit error rate (BER) of 10^-3 over 25-Gb/s 480-km transmission in comparison with conventional CO-OFDM. Also, compared to the 25-Gb/s low-density parity-check (LDPC) coded CO-OFDM 160-km system, the polar code provides a NCG of 0.88 dB @BER = 10^-3. Moreover, the polar code can relieve the laser linewidth requirement massively to get a more cost-effective CO-OFDM system.

A Review on Spectral Amplitude Coding Optical Code Division Multiple Access

NASA Astrophysics Data System (ADS)

Kaur, Navpreet; Goyal, Rakesh; Rani, Monika

2017-06-01

This manuscript deals with analysis of Spectral Amplitude Coding Optical Code Division Multiple Access (SACOCDMA) system. The major noise source in optical CDMA is co-channel interference from other users known as multiple access interference (MAI). The system performance in terms of bit error rate (BER) degrades as a result of increased MAI. It is perceived that number of users and type of codes used for optical system directly decide the performance of system. MAI can be restricted by efficient designing of optical codes and implementing them with unique architecture to accommodate more number of users. Hence, it is a necessity to design a technique like spectral direct detection (SDD) technique with modified double weight code, which can provide better cardinality and good correlation property.

Adaptive variable-length coding for efficient compression of spacecraft television data.

NASA Technical Reports Server (NTRS)

Rice, R. F.; Plaunt, J. R.

1971-01-01

An adaptive variable length coding system is presented. Although developed primarily for the proposed Grand Tour missions, many features of this system clearly indicate a much wider applicability. Using sample to sample prediction, the coding system produces output rates within 0.25 bit/picture element (pixel) of the one-dimensional difference entropy for entropy values ranging from 0 to 8 bit/pixel. This is accomplished without the necessity of storing any code words. Performance improvements of 0.5 bit/pixel can be simply achieved by utilizing previous line correlation. A Basic Compressor, using concatenated codes, adapts to rapid changes in source statistics by automatically selecting one of three codes to use for each block of 21 pixels. The system adapts to less frequent, but more dramatic, changes in source statistics by adjusting the mode in which the Basic Compressor operates on a line-to-line basis. Furthermore, the compression system is independent of the quantization requirements of the pulse-code modulation system.

Coordinated design of coding and modulation systems

NASA Technical Reports Server (NTRS)

Massey, J. L.

1976-01-01

Work on partial unit memory codes continued; it was shown that for a given virtual state complexity, the maximum free distance over the class of all convolutional codes is achieved within the class of unit memory codes. The effect of phase-lock loop (PLL) tracking error on coding system performance was studied by using the channel cut-off rate as the measure of quality of a modulation system. Optimum modulation signal sets for a non-white Gaussian channel considered an heuristic selection rule based on a water-filling argument. The use of error correcting codes to perform data compression by the technique of syndrome source coding was researched and a weight-and-error-locations scheme was developed that is closely related to LDSC coding.

[Data coding in the Israeli healthcare system - do choices provide the answers to our system's needs?].

PubMed

Zelingher, Julian; Ash, Nachman

2013-05-01

The IsraeLi healthcare system has undergone major processes for the adoption of health information technologies (HIT), and enjoys high Levels of utilization in hospital and ambulatory care. Coding is an essential infrastructure component of HIT, and ts purpose is to represent data in a simplified and common format, enhancing its manipulation by digital systems. Proper coding of data enables efficient identification, storage, retrieval and communication of data. UtiLization of uniform coding systems by different organizations enables data interoperability between them, facilitating communication and integrating data elements originating in different information systems from various organizations. Current needs in Israel for heaLth data coding include recording and reporting of diagnoses for hospitalized patients, outpatients and visitors of the Emergency Department, coding of procedures and operations, coding of pathology findings, reporting of discharge diagnoses and causes of death, billing codes, organizational data warehouses and national registries. New national projects for cLinicaL data integration, obligatory reporting of quality indicators and new Ministry of Health (MOH) requirements for HIT necessitate a high Level of interoperability that can be achieved only through the adoption of uniform coding. Additional pressures were introduced by the USA decision to stop the maintenance of the ICD-9-CM codes that are also used by Israeli healthcare, and the adoption of ICD-10-C and ICD-10-PCS as the main coding system for billing purpose. The USA has also mandated utilization of SNOMED-CT as the coding terminology for the ELectronic Health Record problem list, and for reporting quality indicators to the CMS. Hence, the Israeli MOH has recently decided that discharge diagnoses will be reported using ICD-10-CM codes, and SNOMED-CT will be used to code the cLinical information in the EHR. We reviewed the characteristics, strengths and weaknesses of these two coding systems. In summary, the adoption of ICD-10-CM is in line with the USA decision to abandon ICD-9-CM, and the Israeli heaLthcare system could benefit from USA heaLthcare efforts in this direction. The Large content of SNOMED-CT and its sophisticated hierarchical data structure will enable advanced cLinicaL decision support and quality improvement applications.

Low-density parity-check codes for volume holographic memory systems.

PubMed

Pishro-Nik, Hossein; Rahnavard, Nazanin; Ha, Jeongseok; Fekri, Faramarz; Adibi, Ali

2003-02-10

We investigate the application of low-density parity-check (LDPC) codes in volume holographic memory (VHM) systems. We show that a carefully designed irregular LDPC code has a very good performance in VHM systems. We optimize high-rate LDPC codes for the nonuniform error pattern in holographic memories to reduce the bit error rate extensively. The prior knowledge of noise distribution is used for designing as well as decoding the LDPC codes. We show that these codes have a superior performance to that of Reed-Solomon (RS) codes and regular LDPC counterparts. Our simulation shows that we can increase the maximum storage capacity of holographic memories by more than 50 percent if we use irregular LDPC codes with soft-decision decoding instead of conventionally employed RS codes with hard-decision decoding. The performance of these LDPC codes is close to the information theoretic capacity.

Identification and Classification of Orthogonal Frequency Division Multiple Access (OFDMA) Signals Used in Next Generation Wireless Systems

DTIC Science & Technology

2012-03-01

advanced antenna systems AMC adaptive modulation and coding AWGN additive white Gaussian noise BPSK binary phase shift keying BS base station BTC ...QAM-16, and QAM-64, and coding types include convolutional coding (CC), convolutional turbo coding (CTC), block turbo coding ( BTC ), zero-terminating

Deductive Glue Code Synthesis for Embedded Software Systems Based on Code Patterns

NASA Technical Reports Server (NTRS)

Liu, Jian; Fu, Jicheng; Zhang, Yansheng; Bastani, Farokh; Yen, I-Ling; Tai, Ann; Chau, Savio N.

2006-01-01

Automated code synthesis is a constructive process that can be used to generate programs from specifications. It can, thus, greatly reduce the software development cost and time. The use of formal code synthesis approach for software generation further increases the dependability of the system. Though code synthesis has many potential benefits, the synthesis techniques are still limited. Meanwhile, components are widely used in embedded system development. Applying code synthesis to component based software development (CBSD) process can greatly enhance the capability of code synthesis while reducing the component composition efforts. In this paper, we discuss the issues and techniques for applying deductive code synthesis techniques to CBSD. For deductive synthesis in CBSD, a rule base is the key for inferring appropriate component composition. We use the code patterns to guide the development of rules. Code patterns have been proposed to capture the typical usages of the components. Several general composition operations have been identified to facilitate systematic composition. We present the technique for rule development and automated generation of new patterns from existing code patterns. A case study of using this method in building a real-time control system is also presented.

3D neutronic codes coupled with thermal-hydraulic system codes for PWR, and BWR and VVER reactors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langenbuch, S.; Velkov, K.; Lizorkin, M.

1997-07-01

This paper describes the objectives of code development for coupling 3D neutronics codes with thermal-hydraulic system codes. The present status of coupling ATHLET with three 3D neutronics codes for VVER- and LWR-reactors is presented. After describing the basic features of the 3D neutronic codes BIPR-8 from Kurchatov-Institute, DYN3D from Research Center Rossendorf and QUABOX/CUBBOX from GRS, first applications of coupled codes for different transient and accident scenarios are presented. The need of further investigations is discussed.

VENTURE/PC manual: A multidimensional multigroup neutron diffusion code system. Version 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shapiro, A.; Huria, H.C.; Cho, K.W.

1991-12-01

VENTURE/PC is a recompilation of part of the Oak Ridge BOLD VENTURE code system, which will operate on an IBM PC or compatible computer. Neutron diffusion theory solutions are obtained for multidimensional, multigroup problems. This manual contains information associated with operating the code system. The purpose of the various modules used in the code system, and the input for these modules are discussed. The PC code structure is also given. Version 2 included several enhancements not given in the original version of the code. In particular, flux iterations can be done in core rather than by reading and writing tomore » disk, for problems which allow sufficient memory for such in-core iterations. This speeds up the iteration process. Version 3 does not include any of the special processors used in the previous versions. These special processors utilized formatted input for various elements of the code system. All such input data is now entered through the Input Processor, which produces standard interface files for the various modules in the code system. In addition, a Standard Interface File Handbook is included in the documentation which is distributed with the code, to assist in developing the input for the Input Processor.« less

Error control techniques for satellite and space communications

NASA Technical Reports Server (NTRS)

Costello, D. J., Jr.

1986-01-01

High rate concatenated coding systems with trellis inner codes and Reed-Solomon (RS) outer codes for application in satellite communication systems are considered. Two types of inner codes are studied: high rate punctured binary convolutional codes which result in overall effective information rates between 1/2 and 1 bit per channel use; and bandwidth efficient signal space trellis codes which can achieve overall effective information rates greater than 1 bit per channel use. Channel capacity calculations with and without side information performed for the concatenated coding system. Concatenated coding schemes are investigated. In Scheme 1, the inner code is decoded with the Viterbi algorithm and the outer RS code performs error-correction only (decoding without side information). In scheme 2, the inner code is decoded with a modified Viterbi algorithm which produces reliability information along with the decoded output. In this algorithm, path metrics are used to estimate the entire information sequence, while branch metrics are used to provide the reliability information on the decoded sequence. This information is used to erase unreliable bits in the decoded output. An errors-and-erasures RS decoder is then used for the outer code. These two schemes are proposed for use on NASA satellite channels. Results indicate that high system reliability can be achieved with little or no bandwidth expansion.

High dynamic range coding imaging system

NASA Astrophysics Data System (ADS)

Wu, Renfan; Huang, Yifan; Hou, Guangqi

2014-10-01

We present a high dynamic range (HDR) imaging system design scheme based on coded aperture technique. This scheme can help us obtain HDR images which have extended depth of field. We adopt Sparse coding algorithm to design coded patterns. Then we utilize the sensor unit to acquire coded images under different exposure settings. With the guide of the multiple exposure parameters, a series of low dynamic range (LDR) coded images are reconstructed. We use some existing algorithms to fuse and display a HDR image by those LDR images. We build an optical simulation model and get some simulation images to verify the novel system.

Mechanical code comparator

DOEpatents

Peter, Frank J.; Dalton, Larry J.; Plummer, David W.

2002-01-01

A new class of mechanical code comparators is described which have broad potential for application in safety, surety, and security applications. These devices can be implemented as micro-scale electromechanical systems that isolate a secure or otherwise controlled device until an access code is entered. This access code is converted into a series of mechanical inputs to the mechanical code comparator, which compares the access code to a pre-input combination, entered previously into the mechanical code comparator by an operator at the system security control point. These devices provide extremely high levels of robust security. Being totally mechanical in operation, an access control system properly based on such devices cannot be circumvented by software attack alone.

HERCULES: A Pattern Driven Code Transformation System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kartsaklis, Christos; Hernandez, Oscar R; Hsu, Chung-Hsing

2012-01-01

New parallel computers are emerging, but developing efficient scientific code for them remains difficult. A scientist must manage not only the science-domain complexity but also the performance-optimization complexity. HERCULES is a code transformation system designed to help the scientist to separate the two concerns, which improves code maintenance, and facilitates performance optimization. The system combines three technologies, code patterns, transformation scripts and compiler plugins, to provide the scientist with an environment to quickly implement code transformations that suit his needs. Unlike existing code optimization tools, HERCULES is unique in its focus on user-level accessibility. In this paper we discuss themore » design, implementation and an initial evaluation of HERCULES.« less

Performance analysis of optical wireless communication system based on two-fold turbo code

NASA Astrophysics Data System (ADS)

Chen, Jun; Huang, Dexiu; Yuan, Xiuhua

2005-11-01

Optical wireless communication (OWC) is beginning to emerge in the telecommunications market as a strategy to meet last-mile demand owing to its unique combination of features. Turbo codes have an impressive near Shannon-limit error correcting performance. Twofold turbo codes have been recently introduced as the least complex member of the multifold turbo code family. In this paper, at first, we present the mathematical model of signal and optical wireless channel with fading and bit error rate model with scintillation, then we provide a new turbo code method to use in OWC system, we can obtain a better BER curse of OWC system with twofold turbo code than with common turbo code.

Integration of QR codes into an anesthesia information management system for resident case log management.

PubMed

Avidan, Alexander; Weissman, Charles; Levin, Phillip D

2015-04-01

Quick response (QR) codes containing anesthesia syllabus data were introduced into an anesthesia information management system. The code was generated automatically at the conclusion of each case and available for resident case logging using a smartphone or tablet. The goal of this study was to evaluate the use and usability/user-friendliness of such system. Resident case logging practices were assessed prior to introducing the QR codes. QR code use and satisfactions amongst residents was reassessed at three and six months. Before QR code introduction only 12/23 (52.2%) residents maintained a case log. Most of the remaining residents (9/23, 39.1%) expected to receive a case list from the anesthesia information management system database at the end of their residency. At three months and six months 17/26 (65.4%) and 15/25 (60.0%) residents, respectively, were using the QR codes. Satisfaction was rated as very good or good. QR codes for residents' case logging with smartphones or tablets were successfully introduced in an anesthesia information management system and used by most residents. QR codes can be successfully implemented into medical practice to support data transfer. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Fixed-point Design of the Lattice-reduction-aided Iterative Detection and Decoding Receiver for Coded MIMO Systems

DTIC Science & Technology

2011-01-01

reliability, e.g., Turbo Codes [2] and Low Density Parity Check ( LDPC ) codes [3]. The challenge to apply both MIMO and ECC into wireless systems is on...REPORT Fixed-point Design of theLattice-reduction-aided Iterative Detection andDecoding Receiver for Coded MIMO Systems 14. ABSTRACT 16. SECURITY...illustrates the performance of coded LR aided detectors. 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND SUBTITLE 13. SUPPLEMENTARY NOTES The views, opinions

Expert system for maintenance management of a boiling water reactor power plant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong Shen; Liou, L.W.; Levine, S.

1992-01-01

An expert system code has been developed for the maintenance of two boiling water reactor units in Berwick, Pennsylvania, that are operated by the Pennsylvania Power and Light Company (PP and L). The objective of this expert system code, where the knowledge of experienced operators and engineers is captured and implemented, is to support the decisions regarding which components can be safely and reliably removed from service for maintenance. It can also serve as a query-answering facility for checking the plant system status and for training purposes. The operating and maintenance information of a large number of support systems, whichmore » must be available for emergencies and/or in the event of an accident, is stored in the data base of the code. It identifies the relevant technical specifications and management rules for shutting down any one of the systems or removing a component from service to support maintenance. Because of the complexity and time needed to incorporate a large number of systems and their components, the first phase of the expert system develops a prototype code, which includes only the reactor core isolation coolant system, the high-pressure core injection system, the instrument air system, the service water system, and the plant electrical system. The next phase is scheduled to expand the code to include all other systems. This paper summarizes the prototype code and the design concept of the complete expert system code for maintenance management of all plant systems and components.« less

FORTRAN Automated Code Evaluation System (faces) system documentation, version 2, mod 0. [error detection codes/user manuals (computer programs)

NASA Technical Reports Server (NTRS)

1975-01-01

A system is presented which processes FORTRAN based software systems to surface potential problems before they become execution malfunctions. The system complements the diagnostic capabilities of compilers, loaders, and execution monitors rather than duplicating these functions. Also, it emphasizes frequent sources of FORTRAN problems which require inordinate manual effort to identify. The principle value of the system is extracting small sections of unusual code from the bulk of normal sequences. Code structures likely to cause immediate or future problems are brought to the user's attention. These messages stimulate timely corrective action of solid errors and promote identification of 'tricky' code. Corrective action may require recoding or simply extending software documentation to explain the unusual technique.

Architecture and implementation considerations of a high-speed Viterbi decoder for a Reed-Muller subcode

NASA Technical Reports Server (NTRS)

Lin, Shu (Principal Investigator); Uehara, Gregory T.; Nakamura, Eric; Chu, Cecilia W. P.

1996-01-01

The (64, 40, 8) subcode of the third-order Reed-Muller (RM) code for high-speed satellite communications is proposed. The RM subcode can be used either alone or as an inner code of a concatenated coding system with the NASA standard (255, 233, 33) Reed-Solomon (RS) code as the outer code to achieve high performance (or low bit-error rate) with reduced decoding complexity. It can also be used as a component code in a multilevel bandwidth efficient coded modulation system to achieve reliable bandwidth efficient data transmission. The progress made toward achieving the goal of implementing a decoder system based upon this code is summarized. The development of the integrated circuit prototype sub-trellis IC, particularly focusing on the design methodology, is addressed.

Nurses' attitudes toward the use of the bar-coding medication administration system.

PubMed

Marini, Sana Daya; Hasman, Arie; Huijer, Huda Abu-Saad; Dimassi, Hani

2010-01-01

This study determines nurses' attitudes toward bar-coding medication administration system use. Some of the factors underlying the successful use of bar-coding medication administration systems that are viewed as a connotative indicator of users' attitudes were used to gather data that describe the attitudinal basis for system adoption and use decisions in terms of subjective satisfaction. Only 67 nurses in the United States had the chance to respond to the e-questionnaire posted on the CARING list server for the months of June and July 2007. Participants rated their satisfaction with bar-coding medication administration system use based on system functionality, usability, and its positive/negative impact on the nursing practice. Results showed, to some extent, positive attitude, but the image profile draws attention to nurses' concerns for improving certain system characteristics. The high bar-coding medication administration system skills revealed a more negative perception of the system by the nursing staff. The reasons underlying dissatisfaction with bar-coding medication administration use by skillful users are an important source of knowledge that can be helpful for system development as well as system deployment. As a result, strengthening bar-coding medication administration system usability by magnifying its ability to eliminate medication errors and the contributing factors, maximizing system functionality by ascertaining its power as an extra eye in the medication administration process, and impacting the clinical nursing practice positively by being helpful to nurses, speeding up the medication administration process, and being user-friendly can offer a congenial settings for establishing positive attitude toward system use, which in turn leads to successful bar-coding medication administration system use.

Variation in clinical coding lists in UK general practice: a barrier to consistent data entry?

PubMed

Tai, Tracy Waize; Anandarajah, Sobanna; Dhoul, Neil; de Lusignan, Simon

2007-01-01

Routinely collected general practice computer data are used for quality improvement; poor data quality including inconsistent coding can reduce their usefulness. To document the diversity of data entry systems currently in use in UK general practice and highlight possible implications for data quality. General practice volunteers provided screen shots of the clinical coding screen they would use to code a diagnosis or problem title in the clinical consultation. The six clinical conditions examined were: depression, cystitis, type 2 diabetes mellitus, sore throat, tired all the time, and myocardial infarction. We looked at the picking lists generated for these problem titles in EMIS, IPS, GPASS and iSOFT general practice clinical computer systems, using the Triset browser as a gold standard for comparison. A mean of 19.3 codes is offered in the picking list after entering a diagnosis or problem title. EMIS produced the longest picking lists and GPASS the shortest, with a mean number of choices of 35.2 and 12.7, respectively. Approximately three-quarters (73.5%) of codes are diagnoses, one-eighth (12.5%) symptom codes, and the remainder come from a range of Read chapters. There was no readily detectable consistent order in which codes were displayed. Velocity coding, whereby commonly-used codes are placed higher in the picking list, results in variation between practices even where they have the same brand of computer system. Current systems for clinical coding promote diversity rather than consistency of clinical coding. As the UK moves towards an integrated health IT system consistency of coding will become more important. A standardised, limited list of codes for primary care might help address this need.

48 CFR 219.303 - Determining North American Industry Classification System (NAICS) codes and size standards.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false Determining North American Industry Classification System (NAICS) codes and size standards. 219.303 Section 219.303 Federal... Programs 219.303 Determining North American Industry Classification System (NAICS) codes and size standards...

48 CFR 219.303 - Determining North American Industry Classification System (NAICS) codes and size standards.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false Determining North American Industry Classification System (NAICS) codes and size standards. 219.303 Section 219.303 Federal... Programs 219.303 Determining North American Industry Classification System (NAICS) codes and size standards...

48 CFR 219.303 - Determining North American Industry Classification System (NAICS) codes and size standards.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false Determining North American Industry Classification System (NAICS) codes and size standards. 219.303 Section 219.303 Federal... Determining North American Industry Classification System (NAICS) codes and size standards. Contracting...

48 CFR 219.303 - Determining North American Industry Classification System (NAICS) codes and size standards.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false Determining North American Industry Classification System (NAICS) codes and size standards. 219.303 Section 219.303 Federal... Determining North American Industry Classification System (NAICS) codes and size standards. Contracting...

75 FR 78707 - Medicare Program; First Semi-Annual Meeting of the Advisory Panel on Ambulatory Payment...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-16

... hospital payment systems; hospital medical care delivery systems; provider billing and accounting systems; APC groups; Current Procedural Terminology codes; Health Care Common Procedure Coding System (HCPCS) codes; the use of, and payment for, drugs, medical devices, and other services in the outpatient setting...

Survey of adaptive image coding techniques

NASA Technical Reports Server (NTRS)

Habibi, A.

1977-01-01

The general problem of image data compression is discussed briefly with attention given to the use of Karhunen-Loeve transforms, suboptimal systems, and block quantization. A survey is then conducted encompassing the four categories of adaptive systems: (1) adaptive transform coding (adaptive sampling, adaptive quantization, etc.), (2) adaptive predictive coding (adaptive delta modulation, adaptive DPCM encoding, etc.), (3) adaptive cluster coding (blob algorithms and the multispectral cluster coding technique), and (4) adaptive entropy coding.

The analysis of convolutional codes via the extended Smith algorithm

NASA Technical Reports Server (NTRS)

Mceliece, R. J.; Onyszchuk, I.

1993-01-01

Convolutional codes have been the central part of most error-control systems in deep-space communication for many years. Almost all such applications, however, have used the restricted class of (n,1), also known as 'rate 1/n,' convolutional codes. The more general class of (n,k) convolutional codes contains many potentially useful codes, but their algebraic theory is difficult and has proved to be a stumbling block in the evolution of convolutional coding systems. In this article, the situation is improved by describing a set of practical algorithms for computing certain basic things about a convolutional code (among them the degree, the Forney indices, a minimal generator matrix, and a parity-check matrix), which are usually needed before a system using the code can be built. The approach is based on the classic Forney theory for convolutional codes, together with the extended Smith algorithm for polynomial matrices, which is introduced in this article.

System for loading executable code into volatile memory in a downhole tool

DOEpatents

Hall, David R.; Bartholomew, David B.; Johnson, Monte L.

2007-09-25

A system for loading an executable code into volatile memory in a downhole tool string component comprises a surface control unit comprising executable code. An integrated downhole network comprises data transmission elements in communication with the surface control unit and the volatile memory. The executable code, stored in the surface control unit, is not permanently stored in the downhole tool string component. In a preferred embodiment of the present invention, the downhole tool string component comprises boot memory. In another embodiment, the executable code is an operating system executable code. Preferably, the volatile memory comprises random access memory (RAM). A method for loading executable code to volatile memory in a downhole tool string component comprises sending the code from the surface control unit to a processor in the downhole tool string component over the network. A central processing unit writes the executable code in the volatile memory.

Ultra Safe And Secure Blasting System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hart, M M

2009-07-27

The Ultra is a blasting system that is designed for special applications where the risk and consequences of unauthorized demolition or blasting are so great that the use of an extraordinarily safe and secure blasting system is justified. Such a blasting system would be connected and logically welded together through digital code-linking as part of the blasting system set-up and initialization process. The Ultra's security is so robust that it will defeat the people who designed and built the components in any attempt at unauthorized detonation. Anyone attempting to gain unauthorized control of the system by substituting components or tappingmore » into communications lines will be thwarted in their inability to provide encrypted authentication. Authentication occurs through the use of codes that are generated by the system during initialization code-linking and the codes remain unknown to anyone, including the authorized operator. Once code-linked, a closed system has been created. The system requires all components connected as they were during initialization as well as a unique code entered by the operator for function and blasting.« less

The design of the CMOS wireless bar code scanner applying optical system based on ZigBee

NASA Astrophysics Data System (ADS)

Chen, Yuelin; Peng, Jian

2008-03-01

The traditional bar code scanner is influenced by the length of data line, but the farthest distance of the wireless bar code scanner of wireless communication is generally between 30m and 100m on the market. By rebuilding the traditional CCD optical bar code scanner, a CMOS code scanner is designed based on the ZigBee to meet the demands of market. The scan system consists of the CMOS image sensor and embedded chip S3C2401X, when the two dimensional bar code is read, the results show the inaccurate and wrong code bar, resulted from image defile, disturber, reads image condition badness, signal interference, unstable system voltage. So we put forward the method which uses the matrix evaluation and Read-Solomon arithmetic to solve them. In order to construct the whole wireless optics of bar code system and to ensure its ability of transmitting bar code image signals digitally with long distances, ZigBee is used to transmit data to the base station, and this module is designed based on image acquisition system, and at last the wireless transmitting/receiving CC2430 module circuit linking chart is established. And by transplanting the embedded RTOS system LINUX to the MCU, an applying wireless CMOS optics bar code scanner and multi-task system is constructed. Finally, performance of communication is tested by evaluation software Smart RF. In broad space, every ZIGBEE node can realize 50m transmission with high reliability. When adding more ZigBee nodes, the transmission distance can be several thousands of meters long.

A survey to identify the clinical coding and classification systems currently in use across Europe.

PubMed

de Lusignan, S; Minmagh, C; Kennedy, J; Zeimet, M; Bommezijn, H; Bryant, J

2001-01-01

This is a survey to identify what clinical coding systems are currently in use across the European Union, and the states seeking membership to it. We sought to identify what systems are currently used and to what extent they were subject to local adaptation. Clinical coding should facilitate identifying key medical events in a computerised medical record, and aggregating information across groups of records. The emerging new driver is as the enabler of the life-long computerised medical record. A prerequisite for this level of functionality is the transfer of information between different computer systems. This transfer can be facilitated either by working on the interoperability problems between disparate systems or by harmonising the underlying data. This paper examines the extent to which the latter has occurred across Europe. Literature and Internet search. Requests for information via electronic mail to pan-European mailing lists of health informatics professionals. Coding systems are now a de facto part of health information systems across Europe. There are relatively few coding systems in existence across Europe. ICD9 and ICD 10, ICPC and Read were the most established. However the local adaptation of these classification systems either on a by country or by computer software manufacturer basis; significantly reduces the ability for the meaning coded with patients computer records to be easily transferred from one medical record system to another. There is no longer any debate as to whether a coding or classification system should be used. Convergence of different classifications systems should be encouraged. Countries and computer manufacturers within the EU should be encouraged to stop making local modifications to coding and classification systems, as this practice risks significantly slowing progress towards easy transfer of records between computer systems.

Practical guide to bar coding for patient medication safety.

PubMed

Neuenschwander, Mark; Cohen, Michael R; Vaida, Allen J; Patchett, Jeffrey A; Kelly, Jamie; Trohimovich, Barbara

2003-04-15

Bar coding for the medication administration step of the drug-use process is discussed. FDA will propose a rule in 2003 that would require bar-code labels on all human drugs and biologicals. Even with an FDA mandate, manufacturer procrastination and possible shifts in product availability are likely to slow progress. Such delays should not preclude health systems from adopting bar-code-enabled point-of-care (BPOC) systems to achieve gains in patient safety. Bar-code technology is a replacement for traditional keyboard data entry. The elements of bar coding are content, which determines the meaning; data format, which refers to the embedded data and symbology, which describes the "font" in which the machine-readable code is written. For a BPOC system to deliver an acceptable level of patient protection, the hospital must first establish reliable processes for a patient identification band, caregiver badge, and medication bar coding. Medications can have either drug-specific or patient-specific bar codes. Both varieties result in the desired code that supports patient's five rights of drug administration. When medications are not available from the manufacturer in immediate-container bar-coded packaging, other means of applying the bar code must be devised, including the use of repackaging equipment, overwrapping, manual bar coding, and outsourcing. Virtually all medications should be bar coded, the bar code on the label should be easily readable, and appropriate policies, procedures, and checks should be in place. Bar coding has the potential to be not only cost-effective but to produce a return on investment. By bar coding patient identification tags, caregiver badges, and immediate-container medications, health systems can substantially increase patient safety during medication administration.

System Design for FEC in Aeronautical Telemetry

DTIC Science & Technology

2012-03-12

rate punctured convolutional codes for soft decision Viterbi...below follows that given in [8]. The final coding rate of exactly 2/3 is achieved by puncturing the rate -1/2 code as follows. We begin with the buffer c1...concatenated convolutional code (SCCC). The contributions of this paper are on the system-design level. One major contribution is to design a SCCC code

Biomass Economy

DTIC Science & Technology

1985-11-01

Boiler and Pressure Vessel Code HEI Heat Exchanger Institute Heat and Material Balance c. System Description (1) Condenser... Boiler and Pressure Vessel Code "AN(SI B31.1 Power Piping d. System Description (1) Deaerator The deaerator will be d direct contact feedwater heater, and...vent, and drain piping. "b . Applicable Codes ASME Boiler and Pressure Vessel Code "ANSI B31.1 - Power Piping Code

Augmented burst-error correction for UNICON laser memory. [digital memory

NASA Technical Reports Server (NTRS)

Lim, R. S.

1974-01-01

A single-burst-error correction system is described for data stored in the UNICON laser memory. In the proposed system, a long fire code with code length n greater than 16,768 bits was used as an outer code to augment an existing inner shorter fire code for burst error corrections. The inner fire code is a (80,64) code shortened from the (630,614) code, and it is used to correct a single-burst-error on a per-word basis with burst length b less than or equal to 6. The outer code, with b less than or equal to 12, would be used to correct a single-burst-error on a per-page basis, where a page consists of 512 32-bit words. In the proposed system, the encoding and error detection processes are implemented by hardware. A minicomputer, currently used as a UNICON memory management processor, is used on a time-demanding basis for error correction. Based upon existing error statistics, this combination of an inner code and an outer code would enable the UNICON system to obtain a very low error rate in spite of flaws affecting the recorded data.

Simulation of spacecraft attitude dynamics using TREETOPS and model-specific computer Codes

NASA Technical Reports Server (NTRS)

Cochran, John E.; No, T. S.; Fitz-Coy, Norman G.

1989-01-01

The simulation of spacecraft attitude dynamics and control using the generic, multi-body code called TREETOPS and other codes written especially to simulate particular systems is discussed. Differences in the methods used to derive equations of motion--Kane's method for TREETOPS and the Lagrangian and Newton-Euler methods, respectively, for the other two codes--are considered. Simulation results from the TREETOPS code are compared with those from the other two codes for two example systems. One system is a chain of rigid bodies; the other consists of two rigid bodies attached to a flexible base body. Since the computer codes were developed independently, consistent results serve as a verification of the correctness of all the programs. Differences in the results are discussed. Results for the two-rigid-body, one-flexible-body system are useful also as information on multi-body, flexible, pointing payload dynamics.

A family of chaotic pure analog coding schemes based on baker's map function

NASA Astrophysics Data System (ADS)

Liu, Yang; Li, Jing; Lu, Xuanxuan; Yuen, Chau; Wu, Jun

2015-12-01

This paper considers a family of pure analog coding schemes constructed from dynamic systems which are governed by chaotic functions—baker's map function and its variants. Various decoding methods, including maximum likelihood (ML), minimum mean square error (MMSE), and mixed ML-MMSE decoding algorithms, have been developed for these novel encoding schemes. The proposed mirrored baker's and single-input baker's analog codes perform a balanced protection against the fold error (large distortion) and weak distortion and outperform the classical chaotic analog coding and analog joint source-channel coding schemes in literature. Compared to the conventional digital communication system, where quantization and digital error correction codes are used, the proposed analog coding system has graceful performance evolution, low decoding latency, and no quantization noise. Numerical results show that under the same bandwidth expansion, the proposed analog system outperforms the digital ones over a wide signal-to-noise (SNR) range.

Error Control Coding Techniques for Space and Satellite Communications

NASA Technical Reports Server (NTRS)

Lin, Shu

2000-01-01

This paper presents a concatenated turbo coding system in which a Reed-Solomom outer code is concatenated with a binary turbo inner code. In the proposed system, the outer code decoder and the inner turbo code decoder interact to achieve both good bit error and frame error performances. The outer code decoder helps the inner turbo code decoder to terminate its decoding iteration while the inner turbo code decoder provides soft-output information to the outer code decoder to carry out a reliability-based soft-decision decoding. In the case that the outer code decoding fails, the outer code decoder instructs the inner code decoder to continue its decoding iterations until the outer code decoding is successful or a preset maximum number of decoding iterations is reached. This interaction between outer and inner code decoders reduces decoding delay. Also presented in the paper are an effective criterion for stopping the iteration process of the inner code decoder and a new reliability-based decoding algorithm for nonbinary codes.

A development and integration of database code-system with a compilation of comparator, k0 and absolute methods for INAA using microsoft access

NASA Astrophysics Data System (ADS)

Hoh, Siew Sin; Rapie, Nurul Nadiah; Lim, Edwin Suh Wen; Tan, Chun Yuan; Yavar, Alireza; Sarmani, Sukiman; Majid, Amran Ab.; Khoo, Kok Siong

2013-05-01

Instrumental Neutron Activation Analysis (INAA) is often used to determine and calculate the elemental concentrations of a sample at The National University of Malaysia (UKM) typically in Nuclear Science Programme, Faculty of Science and Technology. The objective of this study was to develop a database code-system based on Microsoft Access 2010 which could help the INAA users to choose either comparator method, k0-method or absolute method for calculating the elemental concentrations of a sample. This study also integrated k0data, Com-INAA, k0Concent, k0-Westcott and Abs-INAA to execute and complete the ECC-UKM database code-system. After the integration, a study was conducted to test the effectiveness of the ECC-UKM database code-system by comparing the concentrations between the experiments and the code-systems. 'Triple Bare Monitor' Zr-Au and Cr-Mo-Au were used in k0Concent, k0-Westcott and Abs-INAA code-systems as monitors to determine the thermal to epithermal neutron flux ratio (f). Calculations involved in determining the concentration were net peak area (Np), measurement time (tm), irradiation time (tirr), k-factor (k), thermal to epithermal neutron flux ratio (f), parameters of the neutron flux distribution epithermal (α) and detection efficiency (ɛp). For Com-INAA code-system, certified reference material IAEA-375 Soil was used to calculate the concentrations of elements in a sample. Other CRM and SRM were also used in this database codesystem. Later, a verification process to examine the effectiveness of the Abs-INAA code-system was carried out by comparing the sample concentrations between the code-system and the experiment. The results of the experimental concentration values of ECC-UKM database code-system were performed with good accuracy.

A novel construction scheme of QC-LDPC codes based on the RU algorithm for optical transmission systems

NASA Astrophysics Data System (ADS)

Yuan, Jian-guo; Liang, Meng-qi; Wang, Yong; Lin, Jin-zhao; Pang, Yu

2016-03-01

A novel lower-complexity construction scheme of quasi-cyclic low-density parity-check (QC-LDPC) codes for optical transmission systems is proposed based on the structure of the parity-check matrix for the Richardson-Urbanke (RU) algorithm. Furthermore, a novel irregular QC-LDPC(4 288, 4 020) code with high code-rate of 0.937 is constructed by this novel construction scheme. The simulation analyses show that the net coding gain ( NCG) of the novel irregular QC-LDPC(4 288,4 020) code is respectively 2.08 dB, 1.25 dB and 0.29 dB more than those of the classic RS(255, 239) code, the LDPC(32 640, 30 592) code and the irregular QC-LDPC(3 843, 3 603) code at the bit error rate ( BER) of 10-6. The irregular QC-LDPC(4 288, 4 020) code has the lower encoding/decoding complexity compared with the LDPC(32 640, 30 592) code and the irregular QC-LDPC(3 843, 3 603) code. The proposed novel QC-LDPC(4 288, 4 020) code can be more suitable for the increasing development requirements of high-speed optical transmission systems.

An accurate evaluation of the performance of asynchronous DS-CDMA systems with zero-correlation-zone coding in Rayleigh fading

NASA Astrophysics Data System (ADS)

Walker, Ernest; Chen, Xinjia; Cooper, Reginald L.

2010-04-01

An arbitrarily accurate approach is used to determine the bit-error rate (BER) performance for generalized asynchronous DS-CDMA systems, in Gaussian noise with Raleigh fading. In this paper, and the sequel, new theoretical work has been contributed which substantially enhances existing performance analysis formulations. Major contributions include: substantial computational complexity reduction, including a priori BER accuracy bounding; an analytical approach that facilitates performance evaluation for systems with arbitrary spectral spreading distributions, with non-uniform transmission delay distributions. Using prior results, augmented by these enhancements, a generalized DS-CDMA system model is constructed and used to evaluated the BER performance, in a variety of scenarios. In this paper, the generalized system modeling was used to evaluate the performance of both Walsh- Hadamard (WH) and Walsh-Hadamard-seeded zero-correlation-zone (WH-ZCZ) coding. The selection of these codes was informed by the observation that WH codes contain N spectral spreading values (0 to N - 1), one for each code sequence; while WH-ZCZ codes contain only two spectral spreading values (N/2 - 1,N/2); where N is the sequence length in chips. Since these codes span the spectral spreading range for DS-CDMA coding, by invoking an induction argument, the generalization of the system model is sufficiently supported. The results in this paper, and the sequel, support the claim that an arbitrary accurate performance analysis for DS-CDMA systems can be evaluated over the full range of binary coding, with minimal computational complexity.

Surface acoustic wave coding for orthogonal frequency coded devices

NASA Technical Reports Server (NTRS)

Malocha, Donald (Inventor); Kozlovski, Nikolai (Inventor)

2011-01-01

Methods and systems for coding SAW OFC devices to mitigate code collisions in a wireless multi-tag system. Each device producing plural stepped frequencies as an OFC signal with a chip offset delay to increase code diversity. A method for assigning a different OCF to each device includes using a matrix based on the number of OFCs needed and the number chips per code, populating each matrix cell with OFC chip, and assigning the codes from the matrix to the devices. The asynchronous passive multi-tag system includes plural surface acoustic wave devices each producing a different OFC signal having the same number of chips and including a chip offset time delay, an algorithm for assigning OFCs to each device, and a transceiver to transmit an interrogation signal and receive OFC signals in response with minimal code collisions during transmission.

48 CFR 19.303 - Determining North American Industry Classification System (NAICS) codes and size standards.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Determining North American Industry Classification System (NAICS) codes and size standards. 19.303 Section 19.303 Federal Acquisition... Classification System (NAICS) codes and size standards. (a) The contracting officer shall determine the...

75 FR 51465 - Medicare Program; Announcement of Five New Members to the Advisory Panel on Ambulatory Payment...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-20

... Panel. This expertise encompasses hospital payment systems; hospital medical-care delivery systems; provider billing systems; APC groups, Current Procedural Terminology codes, and alpha-numeric Healthcare Common Procedure Coding System codes; and the use of, and payment for, drugs and medical devices in the...

Variable Coded Modulation software simulation

NASA Astrophysics Data System (ADS)

Sielicki, Thomas A.; Hamkins, Jon; Thorsen, Denise

This paper reports on the design and performance of a new Variable Coded Modulation (VCM) system. This VCM system comprises eight of NASA's recommended codes from the Consultative Committee for Space Data Systems (CCSDS) standards, including four turbo and four AR4JA/C2 low-density parity-check codes, together with six modulations types (BPSK, QPSK, 8-PSK, 16-APSK, 32-APSK, 64-APSK). The signaling protocol for the transmission mode is based on a CCSDS recommendation. The coded modulation may be dynamically chosen, block to block, to optimize throughput.

Rocketdyne/Westinghouse nuclear thermal rocket engine modeling

NASA Technical Reports Server (NTRS)

Glass, James F.

1993-01-01

The topics are presented in viewgraph form and include the following: systems approach needed for nuclear thermal rocket (NTR) design optimization; generic NTR engine power balance codes; rocketdyne nuclear thermal system code; software capabilities; steady state model; NTR engine optimizer code-logic; reactor power calculation logic; sample multi-component configuration; NTR design code output; generic NTR code at Rocketdyne; Rocketdyne NTR model; and nuclear thermal rocket modeling directions.

Properties of a certain stochastic dynamical system, channel polarization, and polar codes

NASA Astrophysics Data System (ADS)

Tanaka, Toshiyuki

2010-06-01

A new family of codes, called polar codes, has recently been proposed by Arikan. Polar codes are of theoretical importance because they are provably capacity achieving with low-complexity encoding and decoding. We first discuss basic properties of a certain stochastic dynamical system, on the basis of which properties of channel polarization and polar codes are reviewed, with emphasis on our recent results.

Ultra-narrow bandwidth voice coding

DOEpatents

Holzrichter, John F [Berkeley, CA; Ng, Lawrence C [Danville, CA

2007-01-09

A system of removing excess information from a human speech signal and coding the remaining signal information, transmitting the coded signal, and reconstructing the coded signal. The system uses one or more EM wave sensors and one or more acoustic microphones to determine at least one characteristic of the human speech signal.

Spatial transform coding of color images.

NASA Technical Reports Server (NTRS)

Pratt, W. K.

1971-01-01

The application of the transform-coding concept to the coding of color images represented by three primary color planes of data is discussed. The principles of spatial transform coding are reviewed and the merits of various methods of color-image representation are examined. A performance analysis is presented for the color-image transform-coding system. Results of a computer simulation of the coding system are also given. It is shown that, by transform coding, the chrominance content of a color image can be coded with an average of 1.0 bits per element or less without serious degradation. If luminance coding is also employed, the average rate reduces to about 2.0 bits per element or less.

Bar-Code System for a Microbiological Laboratory

NASA Technical Reports Server (NTRS)

Law, Jennifer; Kirschner, Larry

2007-01-01

A bar-code system has been assembled for a microbiological laboratory that must examine a large number of samples. The system includes a commercial bar-code reader, computer hardware and software components, plus custom-designed database software. The software generates a user-friendly, menu-driven interface.

Geographic Information Systems using CODES linked data (Crash outcome data evaluation system)

DOT National Transportation Integrated Search

2001-04-01

This report presents information about geographic information systems (GIS) and CODES linked data. Section one provides an overview of a GIS and the benefits of linking to CODES. Section two outlines the basic issues relative to the types of map data...

Validity of the Child Facial Coding System for the Assessment of Acute Pain in Children With Cerebral Palsy.

PubMed

Hadden, Kellie L; LeFort, Sandra; O'Brien, Michelle; Coyte, Peter C; Guerriere, Denise N

2016-04-01

The purpose of the current study was to examine the concurrent and discriminant validity of the Child Facial Coding System for children with cerebral palsy. Eighty-five children (mean = 8.35 years, SD = 4.72 years) were videotaped during a passive joint stretch with their physiotherapist and during 3 time segments: baseline, passive joint stretch, and recovery. Children's pain responses were rated from videotape using the Numerical Rating Scale and Child Facial Coding System. Results indicated that Child Facial Coding System scores during the passive joint stretch significantly correlated with Numerical Rating Scale scores (r = .72, P < .01). Child Facial Coding System scores were also significantly higher during the passive joint stretch than the baseline and recovery segments (P < .001). Facial activity was not significantly correlated with the developmental measures. These findings suggest that the Child Facial Coding System is a valid method of identifying pain in children with cerebral palsy. © The Author(s) 2015.

LDPC coded OFDM over the atmospheric turbulence channel.

PubMed

Djordjevic, Ivan B; Vasic, Bane; Neifeld, Mark A

2007-05-14

Low-density parity-check (LDPC) coded optical orthogonal frequency division multiplexing (OFDM) is shown to significantly outperform LDPC coded on-off keying (OOK) over the atmospheric turbulence channel in terms of both coding gain and spectral efficiency. In the regime of strong turbulence at a bit-error rate of 10(-5), the coding gain improvement of the LDPC coded single-side band unclipped-OFDM system with 64 sub-carriers is larger than the coding gain of the LDPC coded OOK system by 20.2 dB for quadrature-phase-shift keying (QPSK) and by 23.4 dB for binary-phase-shift keying (BPSK).

Convolutional coding techniques for data protection

NASA Technical Reports Server (NTRS)

Massey, J. L.

1975-01-01

Results of research on the use of convolutional codes in data communications are presented. Convolutional coding fundamentals are discussed along with modulation and coding interaction. Concatenated coding systems and data compression with convolutional codes are described.

An all-digital receiver for satellite audio broadcasting signals using trellis coded quasi-orthogonal code-division multiplexing

NASA Astrophysics Data System (ADS)

Braun, Walter; Eglin, Peter; Abello, Ricard

1993-02-01

Spread Spectrum Code Division Multiplex is an attractive scheme for the transmission of multiple signals over a satellite transponder. By using orthogonal or quasi-orthogonal spreading codes the interference between the users can be virtually eliminated. However, the acquisition and tracking of the spreading code phase can not take advantage of the code orthogonality since sequential acquisition and Delay-Locked loop tracking depend on correlation with code phases other than the optimal despreading phase. Hence, synchronization is a critical issue in such a system. A demonstration hardware for the verification of the orthogonal CDM synchronization and data transmission concept is being designed and implemented. The system concept, the synchronization scheme, and the implementation are described. The performance of the system is discussed based on computer simulations.

Los Alamos radiation transport code system on desktop computing platforms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Briesmeister, J.F.; Brinkley, F.W.; Clark, B.A.

The Los Alamos Radiation Transport Code System (LARTCS) consists of state-of-the-art Monte Carlo and discrete ordinates transport codes and data libraries. These codes were originally developed many years ago and have undergone continual improvement. With a large initial effort and continued vigilance, the codes are easily portable from one type of hardware to another. The performance of scientific work-stations (SWS) has evolved to the point that such platforms can be used routinely to perform sophisticated radiation transport calculations. As the personal computer (PC) performance approaches that of the SWS, the hardware options for desk-top radiation transport calculations expands considerably. Themore » current status of the radiation transport codes within the LARTCS is described: MCNP, SABRINA, LAHET, ONEDANT, TWODANT, TWOHEX, and ONELD. Specifically, the authors discuss hardware systems on which the codes run and present code performance comparisons for various machines.« less

48 CFR 1.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Publication and code arrangement. 1.105-1 Section 1.105-1 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 1.105-1 Publication and code...

48 CFR 901.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Publication and code arrangement. 901.105-1 Section 901.105-1 Federal Acquisition Regulations System DEPARTMENT OF ENERGY GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 901.105-1 Publication and code...

48 CFR 1.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Publication and code arrangement. 1.105-1 Section 1.105-1 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 1.105-1 Publication and code...

48 CFR 901.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Publication and code arrangement. 901.105-1 Section 901.105-1 Federal Acquisition Regulations System DEPARTMENT OF ENERGY GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 901.105-1 Publication and code...

48 CFR 1.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Publication and code arrangement. 1.105-1 Section 1.105-1 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 1.105-1 Publication and code...

W-026, Waste Receiving and Processing Facility data management system validation and verification report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palmer, M.E.

1997-12-05

This V and V Report includes analysis of two revisions of the DMS [data management system] System Requirements Specification (SRS) and the Preliminary System Design Document (PSDD); the source code for the DMS Communication Module (DMSCOM) messages; the source code for selected DMS Screens, and the code for the BWAS Simulator. BDM Federal analysts used a series of matrices to: compare the requirements in the System Requirements Specification (SRS) to the specifications found in the System Design Document (SDD), to ensure the design supports the business functions, compare the discreet parts of the SDD with each other, to ensure thatmore » the design is consistent and cohesive, compare the source code of the DMS Communication Module with the specifications, to ensure that the resultant messages will support the design, compare the source code of selected screens to the specifications to ensure that resultant system screens will support the design, compare the source code of the BWAS simulator with the requirements to interface with DMS messages and data transfers relating to the BWAS operations.« less

Coding of procedures documented by general practitioners in Swedish primary care-an explorative study using two procedure coding systems

PubMed Central

2012-01-01

Background Procedures documented by general practitioners in primary care have not been studied in relation to procedure coding systems. We aimed to describe procedures documented by Swedish general practitioners in electronic patient records and to compare them to the Swedish Classification of Health Interventions (KVÅ) and SNOMED CT. Methods Procedures in 200 record entries were identified, coded, assessed in relation to two procedure coding systems and analysed. Results 417 procedures found in the 200 electronic patient record entries were coded with 36 different Classification of Health Interventions categories and 148 different SNOMED CT concepts. 22.8% of the procedures could not be coded with any Classification of Health Interventions category and 4.3% could not be coded with any SNOMED CT concept. 206 procedure-concept/category pairs were assessed as a complete match in SNOMED CT compared to 10 in the Classification of Health Interventions. Conclusions Procedures documented by general practitioners were present in nearly all electronic patient record entries. Almost all procedures could be coded using SNOMED CT. Classification of Health Interventions covered the procedures to a lesser extent and with a much lower degree of concordance. SNOMED CT is a more flexible terminology system that can be used for different purposes for procedure coding in primary care. PMID:22230095

Child Injury Deaths: Comparing Prevention Information from Two Coding Systems

PubMed Central

Schnitzer, Patricia G.; Ewigman, Bernard G.

2006-01-01

Objectives The International Classification of Disease (ICD) external cause of injury E-codes do not sufficiently identify injury circumstances amenable to prevention. The researchers developed an alternative classification system (B-codes) that incorporates behavioral and environmental factors, for use in childhood injury research, and compare the two coding systems in this paper. Methods All fatal injuries among children less than age five that occurred between January 1, 1992, and December 31, 1994, were classified using both B-codes and E-codes. Results E-codes identified the most common causes of injury death: homicide (24%), fires (21%), motor vehicle incidents (21%), drowning (10%), and suffocation (9%). The B-codes further revealed that homicides (51%) resulted from the child being shaken or struck by another person; many fires deaths (42%) resulted from children playing with matches or lighters; drownings (46%) usually occurred in natural bodies of water; and most suffocation deaths (68%) occurred in unsafe sleeping arrangements. Conclusions B-codes identify additional information with specific relevance for prevention of childhood injuries. PMID:15944169

The Social Interactive Coding System (SICS): An On-Line, Clinically Relevant Descriptive Tool.

ERIC Educational Resources Information Center

Rice, Mabel L.; And Others

1990-01-01

The Social Interactive Coding System (SICS) assesses the continuous verbal interactions of preschool children as a function of play areas, addressees, script codes, and play levels. This paper describes the 26 subjects and the setting involved in SICS development, coding definitions and procedures, training procedures, reliability, sample…

The design of wavefront coded imaging system

NASA Astrophysics Data System (ADS)

Lan, Shun; Cen, Zhaofeng; Li, Xiaotong

2016-10-01

Wavefront Coding is a new method to extend the depth of field, which combines optical design and signal processing together. By using optical design software ZEMAX ,we designed a practical wavefront coded imaging system based on a conventional Cooke triplet system .Unlike conventional optical system, the wavefront of this new system is modulated by a specially designed phase mask, which makes the point spread function (PSF)of optical system not sensitive to defocus. Therefore, a series of same blurred images obtained at the image plane. In addition, the optical transfer function (OTF) of the wavefront coded imaging system is independent of focus, which is nearly constant with misfocus and has no regions of zeros. All object information can be completely recovered through digital filtering at different defocus positions. The focus invariance of MTF is selected as merit function in this design. And the coefficients of phase mask are set as optimization goals. Compared to conventional optical system, wavefront coded imaging system obtains better quality images under different object distances. Some deficiencies appear in the restored images due to the influence of digital filtering algorithm, which are also analyzed in this paper. The depth of field of the designed wavefront coded imaging system is about 28 times larger than initial optical system, while keeping higher optical power and resolution at the image plane.

Enhanced 2/3 four-ary modulation code using soft-decision Viterbi decoding for four-level holographic data storage systems

NASA Astrophysics Data System (ADS)

Kong, Gyuyeol; Choi, Sooyong

2017-09-01

An enhanced 2/3 four-ary modulation code using soft-decision Viterbi decoding is proposed for four-level holographic data storage systems. While the previous four-ary modulation codes focus on preventing maximum two-dimensional intersymbol interference patterns, the proposed four-ary modulation code aims at maximizing the coding gains for better bit error rate performances. For achieving significant coding gains from the four-ary modulation codes, we design a new 2/3 four-ary modulation code in order to enlarge the free distance on the trellis through extensive simulation. The free distance of the proposed four-ary modulation code is extended from 1.21 to 2.04 compared with that of the conventional four-ary modulation code. The simulation result shows that the proposed four-ary modulation code has more than 1 dB gains compared with the conventional four-ary modulation code.

Automated encoding of clinical documents based on natural language processing.

PubMed

Friedman, Carol; Shagina, Lyudmila; Lussier, Yves; Hripcsak, George

2004-01-01

The aim of this study was to develop a method based on natural language processing (NLP) that automatically maps an entire clinical document to codes with modifiers and to quantitatively evaluate the method. An existing NLP system, MedLEE, was adapted to automatically generate codes. The method involves matching of structured output generated by MedLEE consisting of findings and modifiers to obtain the most specific code. Recall and precision applied to Unified Medical Language System (UMLS) coding were evaluated in two separate studies. Recall was measured using a test set of 150 randomly selected sentences, which were processed using MedLEE. Results were compared with a reference standard determined manually by seven experts. Precision was measured using a second test set of 150 randomly selected sentences from which UMLS codes were automatically generated by the method and then validated by experts. Recall of the system for UMLS coding of all terms was .77 (95% CI.72-.81), and for coding terms that had corresponding UMLS codes recall was .83 (.79-.87). Recall of the system for extracting all terms was .84 (.81-.88). Recall of the experts ranged from .69 to .91 for extracting terms. The precision of the system was .89 (.87-.91), and precision of the experts ranged from .61 to .91. Extraction of relevant clinical information and UMLS coding were accomplished using a method based on NLP. The method appeared to be comparable to or better than six experts. The advantage of the method is that it maps text to codes along with other related information, rendering the coded output suitable for effective retrieval.

A novel construction method of QC-LDPC codes based on the subgroup of the finite field multiplicative group for optical transmission systems

NASA Astrophysics Data System (ADS)

Yuan, Jian-guo; Zhou, Guang-xiang; Gao, Wen-chun; Wang, Yong; Lin, Jin-zhao; Pang, Yu

2016-01-01

According to the requirements of the increasing development for optical transmission systems, a novel construction method of quasi-cyclic low-density parity-check (QC-LDPC) codes based on the subgroup of the finite field multiplicative group is proposed. Furthermore, this construction method can effectively avoid the girth-4 phenomena and has the advantages such as simpler construction, easier implementation, lower encoding/decoding complexity, better girth properties and more flexible adjustment for the code length and code rate. The simulation results show that the error correction performance of the QC-LDPC(3 780,3 540) code with the code rate of 93.7% constructed by this proposed method is excellent, its net coding gain is respectively 0.3 dB, 0.55 dB, 1.4 dB and 1.98 dB higher than those of the QC-LDPC(5 334,4 962) code constructed by the method based on the inverse element characteristics in the finite field multiplicative group, the SCG-LDPC(3 969,3 720) code constructed by the systematically constructed Gallager (SCG) random construction method, the LDPC(32 640,30 592) code in ITU-T G.975.1 and the classic RS(255,239) code which is widely used in optical transmission systems in ITU-T G.975 at the bit error rate ( BER) of 10-7. Therefore, the constructed QC-LDPC(3 780,3 540) code is more suitable for optical transmission systems.

The EPQ Code System for Simulating the Thermal Response of Plasma-Facing Components to High-Energy Electron Impact

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ward, Robert Cameron; Steiner, Don

2004-06-15

The generation of runaway electrons during a thermal plasma disruption is a concern for the safe and economical operation of a tokamak power system. Runaway electrons have high energy, 10 to 300 MeV, and may potentially cause extensive damage to plasma-facing components (PFCs) through large temperature increases, melting of metallic components, surface erosion, and possible burnout of coolant tubes. The EPQ code system was developed to simulate the thermal response of PFCs to a runaway electron impact. The EPQ code system consists of several parts: UNIX scripts that control the operation of an electron-photon Monte Carlo code to calculate themore » interaction of the runaway electrons with the plasma-facing materials; a finite difference code to calculate the thermal response, melting, and surface erosion of the materials; a code to process, scale, transform, and convert the electron Monte Carlo data to volumetric heating rates for use in the thermal code; and several minor and auxiliary codes for the manipulation and postprocessing of the data. The electron-photon Monte Carlo code used was Electron-Gamma-Shower (EGS), developed and maintained by the National Research Center of Canada. The Quick-Therm-Two-Dimensional-Nonlinear (QTTN) thermal code solves the two-dimensional cylindrical modified heat conduction equation using the Quickest third-order accurate and stable explicit finite difference method and is capable of tracking melting or surface erosion. The EPQ code system is validated using a series of analytical solutions and simulations of experiments. The verification of the QTTN thermal code with analytical solutions shows that the code with the Quickest method is better than 99.9% accurate. The benchmarking of the EPQ code system and QTTN versus experiments showed that QTTN's erosion tracking method is accurate within 30% and that EPQ is able to predict the occurrence of melting within the proper time constraints. QTTN and EPQ are verified and validated as able to calculate the temperature distribution, phase change, and surface erosion successfully.« less

48 CFR 19.303 - Determining North American Industry Classification System codes and size standards.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Industry Classification System codes and size standards. 19.303 Section 19.303 Federal Acquisition... of Small Business Status for Small Business Programs 19.303 Determining North American Industry... North American Industry Classification System (NAICS) code and related small business size standard and...

48 CFR 1601.104-1 - Publication and code arrangement.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Publication and code arrangement. 1601.104-1 Section 1601.104-1 Federal Acquisition Regulations System OFFICE OF PERSONNEL... SYSTEM Purpose, Authority, Issuance 1601.104-1 Publication and code arrangement. (a) The FEHBAR and its...

48 CFR 2101.104-1 - Publication and code arrangement.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Publication and code arrangement. 2101.104-1 Section 2101.104-1 Federal Acquisition Regulations System OFFICE OF PERSONNEL... REGULATIONS SYSTEM Purpose, Authority, Issuance 2101.104-1 Publication and code arrangement. (a) The LIFAR and...

Decomposition of the optical transfer function: wavefront coding imaging systems

NASA Astrophysics Data System (ADS)

Muyo, Gonzalo; Harvey, Andy R.

2005-10-01

We describe the mapping of the optical transfer function (OTF) of an incoherent imaging system into a geometrical representation. We show that for defocused traditional and wavefront-coded systems the OTF can be represented as a generalized Cornu spiral. This representation provides a physical insight into the way in which wavefront coding can increase the depth of field of an imaging system and permits analytical quantification of salient OTF parameters, such as the depth of focus, the location of nulls, and amplitude and phase modulation of the wavefront-coding OTF.

Joint design of QC-LDPC codes for coded cooperation system with joint iterative decoding

NASA Astrophysics Data System (ADS)

Zhang, Shunwai; Yang, Fengfan; Tang, Lei; Ejaz, Saqib; Luo, Lin; Maharaj, B. T.

2016-03-01

In this paper, we investigate joint design of quasi-cyclic low-density-parity-check (QC-LDPC) codes for coded cooperation system with joint iterative decoding in the destination. First, QC-LDPC codes based on the base matrix and exponent matrix are introduced, and then we describe two types of girth-4 cycles in QC-LDPC codes employed by the source and relay. In the equivalent parity-check matrix corresponding to the jointly designed QC-LDPC codes employed by the source and relay, all girth-4 cycles including both type I and type II are cancelled. Theoretical analysis and numerical simulations show that the jointly designed QC-LDPC coded cooperation well combines cooperation gain and channel coding gain, and outperforms the coded non-cooperation under the same conditions. Furthermore, the bit error rate performance of the coded cooperation employing jointly designed QC-LDPC codes is better than those of random LDPC codes and separately designed QC-LDPC codes over AWGN channels.

VeryVote: A Voter Verifiable Code Voting System

NASA Astrophysics Data System (ADS)

Joaquim, Rui; Ribeiro, Carlos; Ferreira, Paulo

Code voting is a technique used to address the secure platform problem of remote voting. A code voting system consists in secretly sending, e.g. by mail, code sheets to voters that map their choices to entry codes in their ballot. While voting, the voter uses the code sheet to know what code to enter in order to vote for a particular candidate. In effect, the voter does the vote encryption and, since no malicious software on the PC has access to the code sheet it is not able to change the voter’s intention. However, without compromising the voter’s privacy, the vote codes are not enough to prove that the vote is recorded and counted as cast by the election server.

Audit of Clinical Coding of Major Head and Neck Operations

PubMed Central

Mitra, Indu; Malik, Tass; Homer, Jarrod J; Loughran, Sean

2009-01-01

INTRODUCTION Within the NHS, operations are coded using the Office of Population Censuses and Surveys (OPCS) classification system. These codes, together with diagnostic codes, are used to generate Healthcare Resource Group (HRG) codes, which correlate to a payment bracket. The aim of this study was to determine whether allocated procedure codes for major head and neck operations were correct and reflective of the work undertaken. HRG codes generated were assessed to determine accuracy of remuneration. PATIENTS AND METHODS The coding of consecutive major head and neck operations undertaken in a tertiary referral centre over a retrospective 3-month period were assessed. Procedure codes were initially ascribed by professional hospital coders. Operations were then recoded by the surgical trainee in liaison with the head of clinical coding. The initial and revised procedure codes were compared and used to generate HRG codes, to determine whether the payment banding had altered. RESULTS A total of 34 cases were reviewed. The number of procedure codes generated initially by the clinical coders was 99, whereas the revised codes generated 146. Of the original codes, 47 of 99 (47.4%) were incorrect. In 19 of the 34 cases reviewed (55.9%), the HRG code remained unchanged, thus resulting in the correct payment. Six cases were never coded, equating to £15,300 loss of payment. CONCLUSIONS These results highlight the inadequacy of this system to reward hospitals for the work carried out within the NHS in a fair and consistent manner. The current coding system was found to be complicated, ambiguous and inaccurate, resulting in loss of remuneration. PMID:19220944

Recent improvements of reactor physics codes in MHI

NASA Astrophysics Data System (ADS)

Kosaka, Shinya; Yamaji, Kazuya; Kirimura, Kazuki; Kamiyama, Yohei; Matsumoto, Hideki

2015-12-01

This paper introduces recent improvements for reactor physics codes in Mitsubishi Heavy Industries, Ltd(MHI). MHI has developed a new neutronics design code system Galaxy/Cosmo-S(GCS) for PWR core analysis. After TEPCO's Fukushima Daiichi accident, it is required to consider design extended condition which has not been covered explicitly by the former safety licensing analyses. Under these circumstances, MHI made some improvements for GCS code system. A new resonance calculation model of lattice physics code and homogeneous cross section representative model for core simulator have been developed to apply more wide range core conditions corresponding to severe accident status such like anticipated transient without scram (ATWS) analysis and criticality evaluation of dried-up spent fuel pit. As a result of these improvements, GCS code system has very wide calculation applicability with good accuracy for any core conditions as far as fuel is not damaged. In this paper, the outline of GCS code system is described briefly and recent relevant development activities are presented.

Recent improvements of reactor physics codes in MHI

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kosaka, Shinya, E-mail: shinya-kosaka@mhi.co.jp; Yamaji, Kazuya; Kirimura, Kazuki

2015-12-31

This paper introduces recent improvements for reactor physics codes in Mitsubishi Heavy Industries, Ltd(MHI). MHI has developed a new neutronics design code system Galaxy/Cosmo-S(GCS) for PWR core analysis. After TEPCO’s Fukushima Daiichi accident, it is required to consider design extended condition which has not been covered explicitly by the former safety licensing analyses. Under these circumstances, MHI made some improvements for GCS code system. A new resonance calculation model of lattice physics code and homogeneous cross section representative model for core simulator have been developed to apply more wide range core conditions corresponding to severe accident status such like anticipatedmore » transient without scram (ATWS) analysis and criticality evaluation of dried-up spent fuel pit. As a result of these improvements, GCS code system has very wide calculation applicability with good accuracy for any core conditions as far as fuel is not damaged. In this paper, the outline of GCS code system is described briefly and recent relevant development activities are presented.« less

Numerical predictions of EML (electromagnetic launcher) system performance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schnurr, N.M.; Kerrisk, J.F.; Davidson, R.F.

1987-01-01

The performance of an electromagnetic launcher (EML) depends on a large number of parameters, including the characteristics of the power supply, rail geometry, rail and insulator material properties, injection velocity, and projectile mass. EML system performance is frequently limited by structural or thermal effects in the launcher (railgun). A series of computer codes has been developed at the Los Alamos National Laboratory to predict EML system performance and to determine the structural and thermal constraints on barrel design. These codes include FLD, a two-dimensional electrostatic code used to calculate the high-frequency inductance gradient and surface current density distribution for themore » rails; TOPAZRG, a two-dimensional finite-element code that simultaneously analyzes thermal and electromagnetic diffusion in the rails; and LARGE, a code that predicts the performance of the entire EML system. Trhe NIKE2D code, developed at the Lawrence Livermore National Laboratory, is used to perform structural analyses of the rails. These codes have been instrumental in the design of the Lethality Test System (LTS) at Los Alamos, which has an ultimate goal of accelerating a 30-g projectile to a velocity of 15 km/s. The capabilities of the individual codes and the coupling of these codes to perform a comprehensive analysis is discussed in relation to the LTS design. Numerical predictions are compared with experimental data and presented for the LTS prototype tests.« less

Identification codes for organizations listed in computerized data systems of the U.S. Geological Survey

USGS Publications Warehouse

Blackwell, C.D.

1988-01-01

Codes for the unique identification of public and private organizations listed in computerized data systems are presented. These codes are used by the U.S. Geological Survey 's National Water Data Exchange (NAWDEX), National Water Data Storage and Retrieval System (WATSTORE), National Cartographic Information Center (NCIC), and Office of Water Data Coordination (OWDC). The format structure of the codes is discussed and instructions are given for requesting new books. (Author 's abstract)

CORESAFE: A Formal Approach against Code Replacement Attacks on Cyber Physical Systems

DTIC Science & Technology

2018-04-19

AFRL-AFOSR-JP-TR-2018-0035 CORESAFE:A Formal Approach against Code Replacement Attacks on Cyber Physical Systems Sandeep Shukla INDIAN INSTITUTE OF...Formal Approach against Code Replacement Attacks on Cyber Physical Systems 5a.  CONTRACT NUMBER 5b.  GRANT NUMBER FA2386-16-1-4099 5c.  PROGRAM ELEMENT...Institute of Technology Kanpur India Final Report for AOARD Grant “CORESAFE: A Formal Approach against Code Replacement Attacks on Cyber Physical

Combined trellis coding with asymmetric MPSK modulation: An MSAT-X report

NASA Technical Reports Server (NTRS)

Simon, M. K.; Divsalar, D.

1985-01-01

Traditionally symmetric, multiple phase-shift-keyed (MPSK) signal constellations, i.e., those with uniformly spaced signal points around the circle, have been used for both uncoded and coded systems. Although symmetric MPSK signal constellations are optimum for systems with no coding, the same is not necessarily true for coded systems. This appears to show that by designing the signal constellations to be asymmetric, one can, in many instances, obtain a significant performance improvement over the traditional symmetric MPSK constellations combined with trellis coding. The joint design of n/(n + 1) trellis codes and asymmetric 2 sup n + 1 - point MPSK is considered, which has a unity bandwidth expansion relative to uncoded 2 sup n-point symmetric MPSK. The asymptotic performance gains due to coding and asymmetry are evaluated in terms of the minimum free Euclidean distance free of the trellis. A comparison of the maximum value of this performance measure with the minimum distance d sub min of the uncoded system is an indication of the maximum reduction in required E sub b/N sub O that can be achieved for arbitrarily small system bit-error rates. It is to be emphasized that the introduction of asymmetry into the signal set does not effect the bandwidth of power requirements of the system; hence, the above-mentioned improvements in performance come at little or no cost. MPSK signal sets in coded systems appear in the work of Divsalar.

Advanced Imaging Optics Utilizing Wavefront Coding.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Scrymgeour, David; Boye, Robert; Adelsberger, Kathleen

2015-06-01

Image processing offers a potential to simplify an optical system by shifting some of the imaging burden from lenses to the more cost effective electronics. Wavefront coding using a cubic phase plate combined with image processing can extend the system's depth of focus, reducing many of the focus-related aberrations as well as material related chromatic aberrations. However, the optimal design process and physical limitations of wavefront coding systems with respect to first-order optical parameters and noise are not well documented. We examined image quality of simulated and experimental wavefront coded images before and after reconstruction in the presence of noise.more » Challenges in the implementation of cubic phase in an optical system are discussed. In particular, we found that limitations must be placed on system noise, aperture, field of view and bandwidth to develop a robust wavefront coded system.« less

Exploring Type and Amount of Parent Talk during Individualized Family Service Plan Meetings

ERIC Educational Resources Information Center

Ridgley, Robyn; Snyder, Patricia; McWilliam, R. A.

2014-01-01

We discuss the utility of a coding system designed to evaluate the amount and type of parent talk during individualized family service plan (IFSP) meetings. The iterative processes used to develop the "Parent Communication Coding System" (PCCS) and its associated codes are described. In addition, we explored whether PCCS codes could be…

GCKP84-general chemical kinetics code for gas-phase flow and batch processes including heat transfer effects

NASA Technical Reports Server (NTRS)

Bittker, D. A.; Scullin, V. J.

1984-01-01

A general chemical kinetics code is described for complex, homogeneous ideal gas reactions in any chemical system. The main features of the GCKP84 code are flexibility, convenience, and speed of computation for many different reaction conditions. The code, which replaces the GCKP code published previously, solves numerically the differential equations for complex reaction in a batch system or one dimensional inviscid flow. It also solves numerically the nonlinear algebraic equations describing the well stirred reactor. A new state of the art numerical integration method is used for greatly increased speed in handling systems of stiff differential equations. The theory and the computer program, including details of input preparation and a guide to using the code are given.

Investigation of Near Shannon Limit Coding Schemes

NASA Technical Reports Server (NTRS)

Kwatra, S. C.; Kim, J.; Mo, Fan

1999-01-01

Turbo codes can deliver performance that is very close to the Shannon limit. This report investigates algorithms for convolutional turbo codes and block turbo codes. Both coding schemes can achieve performance near Shannon limit. The performance of the schemes is obtained using computer simulations. There are three sections in this report. First section is the introduction. The fundamental knowledge about coding, block coding and convolutional coding is discussed. In the second section, the basic concepts of convolutional turbo codes are introduced and the performance of turbo codes, especially high rate turbo codes, is provided from the simulation results. After introducing all the parameters that help turbo codes achieve such a good performance, it is concluded that output weight distribution should be the main consideration in designing turbo codes. Based on the output weight distribution, the performance bounds for turbo codes are given. Then, the relationships between the output weight distribution and the factors like generator polynomial, interleaver and puncturing pattern are examined. The criterion for the best selection of system components is provided. The puncturing pattern algorithm is discussed in detail. Different puncturing patterns are compared for each high rate. For most of the high rate codes, the puncturing pattern does not show any significant effect on the code performance if pseudo - random interleaver is used in the system. For some special rate codes with poor performance, an alternative puncturing algorithm is designed which restores their performance close to the Shannon limit. Finally, in section three, for iterative decoding of block codes, the method of building trellis for block codes, the structure of the iterative decoding system and the calculation of extrinsic values are discussed.

The accuracy of real-time procedure coding by theatre nurses: a comparison with the central national system.

PubMed

Maclean, Donald; Younes, Hakim Ben; Forrest, Margaret; Towers, Hazel K

2012-03-01

Accurate and timely clinical data are required for clinical and organisational purposes and is especially important for patient management, audit of surgical performance and the electronic health record. The recent introduction of computerised theatre management systems has enabled real-time (point-of-care) operative procedure coding by clinical staff. However the accuracy of these data is unknown. The aim of this Scottish study was to compare the accuracy of theatre nurses' real-time coding on the local theatre management system with the central Scottish Morbidity Record (SMR01). Paired procedural codes were recorded, qualitatively graded for precision and compared (n = 1038). In this study, real-time, point-of-care coding by theatre nurses resulted in significant coding errors compared with the central SMR01 database. Improved collaboration between full-time coders and clinical staff using computerised decision support systems is suggested.

Does cardiac catheterization laboratory activation by electrocardiography machine auto-interpretation reduce door-to-balloon time?

PubMed

Min, Mun Ki; Ryu, Ji Ho; Kim, Yong In; Park, Maeng Real; Park, Yong Myeon; Park, Sung Wook; Yeom, Seok Ran; Han, Sang Kyoon; Kim, Yang Weon

2014-11-01

In an attempt to begin ST-segment elevation myocardial infarction (STEMI) treatment more quickly (referred to as door-to-balloon [DTB] time) by minimizing preventable delays in electrocardiogram (ECG) interpretation, cardiac catheterization laboratory (CCL) activation was changed from activation by the emergency physician (code heart I) to activation by a single page if the ECG is interpreted as STEMI by the ECG machine (ECG machine auto-interpretation) (code heart II). We sought to determine the impact of ECG machine auto-interpretation on CCL activation. The study period was from June 2010 to May 2012 (from June to November 2011, code heart I; from December 2011 to May 2012, code heart II). All patients aged 18 years or older who were diagnosed with STEMI were evaluated for enrollment. Patients who experienced the code heart system were also included. Door-to-balloon time before and after code heart system were compared with a retrospective chart review. In addition, to determine the appropriateness of the activation, we compared coronary angiography performance rate and percentage of STEMI between code heart I and II. After the code heart system, the mean DTB time was significantly decreased (before, 96.51 ± 65.60 minutes; after, 65.40 ± 26.40 minutes; P = .043). The STEMI diagnosis and the coronary angiography performance rates were significantly lower in the code heart II group than in the code heart I group without difference in DTB time. Cardiac catheterization laboratory activation by ECG machine auto-interpretation does not reduce DTB time and often unnecessarily activates the code heart system compared with emergency physician-initiated activation. This system therefore decreases the appropriateness of CCL activation. Copyright © 2014 Elsevier Inc. All rights reserved.

A Novel Design of Reconfigurable Wavelength-Time Optical Codes to Enhance Security in Optical CDMA Networks

NASA Astrophysics Data System (ADS)

Nasaruddin; Tsujioka, Tetsuo

An optical CDMA (OCDMA) system is a flexible technology for future broadband multiple access networks. A secure OCDMA network in broadband optical access technologies is also becoming an issue of great importance. In this paper, we propose novel reconfigurable wavelength-time (W-T) optical codes that lead to secure transmission in OCDMA networks. The proposed W-T optical codes are constructed by using quasigroups (QGs) for wavelength hopping and one-dimensional optical orthogonal codes (OOCs) for time spreading; we call them QGs/OOCs. Both QGs and OOCs are randomly generated by a computer search to ensure that an eavesdropper could not improve its interception performance by making use of the coding structure. Then, the proposed reconfigurable QGs/OOCs can provide more codewords, and many different code set patterns, which differ in both wavelength and time positions for given code parameters. Moreover, the bit error probability of the proposed codes is analyzed numerically. To realize the proposed codes, a secure system is proposed by employing reconfigurable encoders/decoders based on array waveguide gratings (AWGs), which allow the users to change their codeword patterns to protect against eavesdropping. Finally, the probability of breaking a certain codeword in the proposed system is evaluated analytically. The results show that the proposed codes and system can provide a large codeword pattern, and decrease the probability of breaking a certain codeword, to enhance OCDMA network security.

Cardinality enhancement utilizing Sequential Algorithm (SeQ) code in OCDMA system

NASA Astrophysics Data System (ADS)

Fazlina, C. A. S.; Rashidi, C. B. M.; Rahman, A. K.; Aljunid, S. A.

2017-11-01

Optical Code Division Multiple Access (OCDMA) has been important with increasing demand for high capacity and speed for communication in optical networks because of OCDMA technique high efficiency that can be achieved, hence fibre bandwidth is fully used. In this paper we will focus on Sequential Algorithm (SeQ) code with AND detection technique using Optisystem design tool. The result revealed SeQ code capable to eliminate Multiple Access Interference (MAI) and improve Bit Error Rate (BER), Phase Induced Intensity Noise (PIIN) and orthogonally between users in the system. From the results, SeQ shows good performance of BER and capable to accommodate 190 numbers of simultaneous users contrast with existing code. Thus, SeQ code have enhanced the system about 36% and 111% of FCC and DCS code. In addition, SeQ have good BER performance 10-25 at 155 Mbps in comparison with 622 Mbps, 1 Gbps and 2 Gbps bit rate. From the plot graph, 155 Mbps bit rate is suitable enough speed for FTTH and LAN networks. Resolution can be made based on the superior performance of SeQ code. Thus, these codes will give an opportunity in OCDMA system for better quality of service in an optical access network for future generation's usage

New GOES satellite synchronized time code generation

NASA Technical Reports Server (NTRS)

Fossler, D. E.; Olson, R. K.

1984-01-01

The TRAK Systems' GOES Satellite Synchronized Time Code Generator is described. TRAK Systems has developed this timing instrument to supply improved accuracy over most existing GOES receiver clocks. A classical time code generator is integrated with a GOES receiver.

Problems, solutions and recommendations for implementing CODES (Crash Outcome Data Evaluation System)

DOT National Transportation Integrated Search

2001-02-01

Problems, solutions and recommendations for implementation have been contributed by 16 of the 27 CODES states and organized as appropriate under the administrative, linkage and application requirements for a Crash Outcome Data Evaluation System (CODE...

Validation of the new diagnosis grouping system for pediatric emergency department visits using the International Classification of Diseases, 10th Revision.

PubMed

Lee, Jin Hee; Hong, Ki Jeong; Kim, Do Kyun; Kwak, Young Ho; Jang, Hye Young; Kim, Hahn Bom; Noh, Hyun; Park, Jungho; Song, Bongkyu; Jung, Jae Yun

2013-12-01

A clinically sensible diagnosis grouping system (DGS) is needed for describing pediatric emergency diagnoses for research, medical resource preparedness, and making national policy for pediatric emergency medical care. The Pediatric Emergency Care Applied Research Network (PECARN) developed the DGS successfully. We developed the modified PECARN DGS based on the different pediatric population of South Korea and validated the system to obtain the accurate and comparable epidemiologic data of pediatric emergent conditions of the selected population. The data source used to develop and validate the modified PECARN DGS was the National Emergency Department Information System of South Korea, which was coded by the International Classification of Diseases, 10th Revision (ICD-10) code system. To develop the modified DGS based on ICD-10 code, we matched the selected ICD-10 codes with those of the PECARN DGS by the General Equivalence Mappings (GEMs). After converting ICD-10 codes to ICD-9 codes by GEMs, we matched ICD-9 codes into PECARN DGS categories using the matrix developed by PECARN group. Lastly, we conducted the expert panel survey using Delphi method for the remaining diagnosis codes that were not matched. A total of 1879 ICD-10 codes were used in development of the modified DGS. After 1078 (57.4%) of 1879 ICD-10 codes were assigned to the modified DGS by GEM and PECARN conversion tools, investigators assigned each of the remaining 801 codes (42.6%) to DGS subgroups by 2 rounds of electronic Delphi surveys. And we assigned the remaining 29 codes (4%) into the modified DGS at the second expert consensus meeting. The modified DGS accounts for 98.7% and 95.2% of diagnoses of the 2008 and 2009 National Emergency Department Information System data set. This modified DGS also exhibited strong construct validity using the concepts of age, sex, site of care, and seasons. This also reflected the 2009 outbreak of H1N1 influenza in Korea. We developed and validated clinically feasible and sensible DGS system for describing pediatric emergent conditions in Korea. The modified PECARN DGS showed good comprehensiveness and demonstrated reliable construct validity. This modified DGS based on PECARN DGS framework may be effectively implemented for research, reporting, and resource planning in pediatric emergency system of South Korea.

A Golay complementary TS-based symbol synchronization scheme in variable rate LDPC-coded MB-OFDM UWBoF system

NASA Astrophysics Data System (ADS)

He, Jing; Wen, Xuejie; Chen, Ming; Chen, Lin

2015-09-01

In this paper, a Golay complementary training sequence (TS)-based symbol synchronization scheme is proposed and experimentally demonstrated in multiband orthogonal frequency division multiplexing (MB-OFDM) ultra-wideband over fiber (UWBoF) system with a variable rate low-density parity-check (LDPC) code. Meanwhile, the coding gain and spectral efficiency in the variable rate LDPC-coded MB-OFDM UWBoF system are investigated. By utilizing the non-periodic auto-correlation property of the Golay complementary pair, the start point of LDPC-coded MB-OFDM UWB signal can be estimated accurately. After 100 km standard single-mode fiber (SSMF) transmission, at the bit error rate of 1×10-3, the experimental results show that the short block length 64QAM-LDPC coding provides a coding gain of 4.5 dB, 3.8 dB and 2.9 dB for a code rate of 62.5%, 75% and 87.5%, respectively.

Health information management: an introduction to disease classification and coding.

PubMed

Mony, Prem Kumar; Nagaraj, C

2007-01-01

Morbidity and mortality data constitute an important component of a health information system and their coding enables uniform data collation and analysis as well as meaningful comparisons between regions or countries. Strengthening the recording and reporting systems for health monitoring is a basic requirement for an efficient health information management system. Increased advocacy for and awareness of a uniform coding system together with adequate capacity building of physicians, coders and other allied health and information technology personnel would pave the way for a valid and reliable health information management system in India. The core requirements for the implementation of disease coding are: (i) support from national/institutional health administrators, (ii) widespread availability of the ICD-10 material for morbidity and mortality coding; (iii) enhanced human and financial resources; and (iv) optimal use of informatics. We describe the methodology of a disease classification and codification system as also its applications for developing and maintaining an effective health information management system for India.

From Verified Models to Verifiable Code

NASA Technical Reports Server (NTRS)

Lensink, Leonard; Munoz, Cesar A.; Goodloe, Alwyn E.

2009-01-01

Declarative specifications of digital systems often contain parts that can be automatically translated into executable code. Automated code generation may reduce or eliminate the kinds of errors typically introduced through manual code writing. For this approach to be effective, the generated code should be reasonably efficient and, more importantly, verifiable. This paper presents a prototype code generator for the Prototype Verification System (PVS) that translates a subset of PVS functional specifications into an intermediate language and subsequently to multiple target programming languages. Several case studies are presented to illustrate the tool's functionality. The generated code can be analyzed by software verification tools such as verification condition generators, static analyzers, and software model-checkers to increase the confidence that the generated code is correct.

Study on the properties of infrared wavefront coding athermal system under several typical temperature gradient distributions

NASA Astrophysics Data System (ADS)

Cai, Huai-yu; Dong, Xiao-tong; Zhu, Meng; Huang, Zhan-hua

2018-01-01

Wavefront coding for athermal technique can effectively ensure the stability of the optical system imaging in large temperature range, as well as the advantages of compact structure and low cost. Using simulation method to analyze the properties such as PSF and MTF of wavefront coding athermal system under several typical temperature gradient distributions has directive function to characterize the working state of non-ideal temperature environment, and can effectively realize the system design indicators as well. In this paper, we utilize the interoperability of data between Solidworks and ZEMAX to simplify the traditional process of structure/thermal/optical integrated analysis. Besides, we design and build the optical model and corresponding mechanical model of the infrared imaging wavefront coding athermal system. The axial and radial temperature gradients of different degrees are applied to the whole system by using SolidWorks software, thus the changes of curvature, refractive index and the distance between the lenses are obtained. Then, we import the deformation model to ZEMAX for ray tracing, and obtain the changes of PSF and MTF in optical system. Finally, we discuss and evaluate the consistency of the PSF (MTF) of the wavefront coding athermal system and the image restorability, which provides the basis and reference for the optimal design of the wavefront coding athermal system. The results show that the adaptability of single material infrared wavefront coding athermal system to axial temperature gradient can reach the upper limit of temperature fluctuation of 60°C, which is much higher than that of radial temperature gradient.

Viewing hybrid systems as products of control systems and automata

NASA Technical Reports Server (NTRS)

Grossman, R. L.; Larson, R. G.

1992-01-01

The purpose of this note is to show how hybrid systems may be modeled as products of nonlinear control systems and finite state automata. By a hybrid system, we mean a network of consisting of continuous, nonlinear control system connected to discrete, finite state automata. Our point of view is that the automata switches between the control systems, and that this switching is a function of the discrete input symbols or letters that it receives. We show how a nonlinear control system may be viewed as a pair consisting of a bialgebra of operators coding the dynamics, and an algebra of observations coding the state space. We also show that a finite automata has a similar representation. A hybrid system is then modeled by taking suitable products of the bialgebras coding the dynamics and the observation algebras coding the state spaces.

The study on dynamic cadastral coding rules based on kinship relationship

NASA Astrophysics Data System (ADS)

Xu, Huan; Liu, Nan; Liu, Renyi; Lu, Jingfeng

2007-06-01

Cadastral coding rules are an important supplement to the existing national and local standard specifications for building cadastral database. After analyzing the course of cadastral change, especially the parcel change with the method of object-oriented analysis, a set of dynamic cadastral coding rules based on kinship relationship corresponding to the cadastral change is put forward and a coding format composed of street code, block code, father parcel code, child parcel code and grandchild parcel code is worked out within the county administrative area. The coding rule has been applied to the development of an urban cadastral information system called "ReGIS", which is not only able to figure out the cadastral code automatically according to both the type of parcel change and the coding rules, but also capable of checking out whether the code is spatiotemporally unique before the parcel is stored in the database. The system has been used in several cities of Zhejiang Province and got a favorable response. This verifies the feasibility and effectiveness of the coding rules to some extent.

Prior-to-Secondary School Course Classification System: School Codes for the Exchange of Data (SCED). NFES 2011-801

ERIC Educational Resources Information Center

National Forum on Education Statistics, 2011

2011-01-01

In this handbook, "Prior-to-Secondary School Course Classification System: School Codes for the Exchange of Data" (SCED), the National Center for Education Statistics (NCES) and the National Forum on Education Statistics have extended the existing secondary course classification system with codes and descriptions for courses offered at…

Proposing a Web-Based Tutorial System to Teach Malay Language Braille Code to the Sighted

ERIC Educational Resources Information Center

Wah, Lee Lay; Keong, Foo Kok

2010-01-01

The "e-KodBrailleBM Tutorial System" is a web-based tutorial system which is specially designed to teach, facilitate and support the learning of Malay Language Braille Code to individuals who are sighted. The targeted group includes special education teachers, pre-service teachers, and parents. Learning Braille code involves memorisation…

Design and implementation of a scene-dependent dynamically selfadaptable wavefront coding imaging system

NASA Astrophysics Data System (ADS)

Carles, Guillem; Ferran, Carme; Carnicer, Artur; Bosch, Salvador

2012-01-01

A computational imaging system based on wavefront coding is presented. Wavefront coding provides an extension of the depth-of-field at the expense of a slight reduction of image quality. This trade-off results from the amount of coding used. By using spatial light modulators, a flexible coding is achieved which permits it to be increased or decreased as needed. In this paper a computational method is proposed for evaluating the output of a wavefront coding imaging system equipped with a spatial light modulator, with the aim of thus making it possible to implement the most suitable coding strength for a given scene. This is achieved in an unsupervised manner, thus the whole system acts as a dynamically selfadaptable imaging system. The program presented here controls the spatial light modulator and the camera, and also processes the images in a synchronised way in order to implement the dynamic system in real time. A prototype of the system was implemented in the laboratory and illustrative examples of the performance are reported in this paper. Program summaryProgram title: DynWFC (Dynamic WaveFront Coding) Catalogue identifier: AEKC_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEKC_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 10 483 No. of bytes in distributed program, including test data, etc.: 2 437 713 Distribution format: tar.gz Programming language: Labview 8.5 and NI Vision and MinGW C Compiler Computer: Tested on PC Intel ® Pentium ® Operating system: Tested on Windows XP Classification: 18 Nature of problem: The program implements an enhanced wavefront coding imaging system able to adapt the degree of coding to the requirements of a specific scene. The program controls the acquisition by a camera, the display of a spatial light modulator and the image processing operations synchronously. The spatial light modulator is used to implement the phase mask with flexibility given the trade-off between depth-of-field extension and image quality achieved. The action of the program is to evaluate the depth-of-field requirements of the specific scene and subsequently control the coding established by the spatial light modulator, in real time.

Reinventing radiology reimbursement.

PubMed

Marshall, John; Adema, Denise

2005-01-01

Lee Memorial Health System (LMHS), located in southwest Florida, consists of 5 hospitals, a home health agency, a skilled nursing facility, multiple outpatient centers, walk-in medical centers, and primary care physician offices. LMHS annually performs more than 300,000 imaging procedures with gross imaging revenues exceeding dollar 350 million. In fall 2002, LMHS received the results of an independent audit of its IR coding. The overall IR coding error rate was determined to be 84.5%. The projected net financial impact of these errors was an annual reimbursement loss of dollar 182,000. To address the issues of coding errors and reimbursement loss, LMHS implemented its clinical reimbursementspecialist (CRS) system in October 2003, as an extension of financial services' reimbursement division. LMHS began with CRSs in 3 service lines: emergency department, cardiac catheterization, and radiology. These 3 CRSs coordinate all facets of their respective areas' chargemaster, patient charges, coding, and reimbursement functions while serving as a resident coding expert within their clinical areas. The radiology reimbursement specialist (RRS) combines an experienced radiologic technologist, interventional technologist, medical records coder, financial auditor, reimbursement specialist, and biller into a single position. The RRS's radiology experience and technologist knowledge are key assets to resolving coding conflicts and handling complex interventional coding. In addition, performing a daily charge audit and an active code review are essential if an organization is to eliminate coding errors. One of the inherent effects of eliminating coding errors is the capturing of additional RVUs and units of service. During its first year, based on account level detail, the RRS system increased radiology productivity through the additional capture of just more than 3,000 RVUs and 1,000 additional units of service. In addition, the physicians appreciate having someone who "keeps up with all the coding changes" and looks out for the charges. By assisting a few physicians' staff with coding questions, providing coding updates, and allowing them to sit in on educational sessions, at least 2 physicians have transferred some their volume to LMHS from a competitor. The provision of a "clean account," without coding errors, allows the biller to avoid the rework and billing delays caused by coding issues. During the first quarter of the RRS system, the billers referred an average of 9 accounts per day for coding resolution. During the fourth quarter of the system, these referrals were reduced to less than one per day. Prior to the RRS system, resolving these issues took an average of 4 business days. Now the conflicts are resolved within 24 hours.

Quinoxaline-based inhibitors of Ebola and Marburg VP40 egress.

PubMed

Loughran, H Marie; Han, Ziying; Wrobel, Jay E; Decker, Sarah E; Ruthel, Gordon; Freedman, Bruce D; Harty, Ronald N; Reitz, Allen B

2016-08-01

We prepared a series of quinoxalin-2-mercapto-acetyl-urea analogs and evaluated them for their ability to inhibit viral egress in our Marburg and Ebola VP40 VLP budding assays in HEK293T cells. We also evaluated selected compounds in our bimolecular complementation assay (BiMC) to detect and visualize a Marburg mVP40-Nedd4 interaction in live mammalian cells. Antiviral activity was assessed for selected compounds using a live recombinant vesicular stomatitis virus (VSV) (M40 virus) that expresses the EBOV VP40 PPxY L-domain. Finally selected compounds were evaluated in several ADME assays to have an early assessment of their drug properties. Our compounds had low nM potency in these assays (e.g., compounds 21, 24, 26, 39), and had good human liver microsome stability, as well as little or no inhibition of P450 3A4. Copyright © 2016 Elsevier Ltd. All rights reserved.

Stochastic acceleration of electrons from multiple uncorrelated plasma waves

NASA Astrophysics Data System (ADS)

Gee, David; Michel, Pierre; Wurtele, Jonathan

2017-10-01

One-dimensional theory puts a strict limit on the maximum energy attainable by an electron trapped and accelerated by an electron plasma wave (EPW). However, experimental measurements of hot electron distributions accelerated by stimulated Raman scattering (SRS) in ICF experiments typically show a thermal distribution with temperatures of the order of the kinetic energy of the resonant EPW's (Thot mvp2 , where vp is the phase velocity of the EPW's driven by SRS) and no clear cutoff at high energies. In this project, we are investigating conditions under which electrons can be stochastically accelerated by multiple uncorrelated EPW's, such as those generated by incoherent laser speckles in large laser spots like the ones used on NIF ( mm-size), and reproduce distributions similar to those observed in experiments. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract No. DE-AC52-07NA27344.

Optimal portfolio strategy with cross-correlation matrix composed by DCCA coefficients: Evidence from the Chinese stock market

NASA Astrophysics Data System (ADS)

Sun, Xuelian; Liu, Zixian

2016-02-01

In this paper, a new estimator of correlation matrix is proposed, which is composed of the detrended cross-correlation coefficients (DCCA coefficients), to improve portfolio optimization. In contrast to Pearson's correlation coefficients (PCC), DCCA coefficients acquired by the detrended cross-correlation analysis (DCCA) method can describe the nonlinear correlation between assets, and can be decomposed in different time scales. These properties of DCCA make it possible to improve the investment effect and more valuable to investigate the scale behaviors of portfolios. The minimum variance portfolio (MVP) model and the Mean-Variance (MV) model are used to evaluate the effectiveness of this improvement. Stability analysis shows the effect of two kinds of correlation matrices on the estimation error of portfolio weights. The observed scale behaviors are significant to risk management and could be used to optimize the portfolio selection.

Improving performance of DS-CDMA systems using chaotic complex Bernoulli spreading codes

NASA Astrophysics Data System (ADS)

Farzan Sabahi, Mohammad; Dehghanfard, Ali

2014-12-01

The most important goal of spreading spectrum communication system is to protect communication signals against interference and exploitation of information by unintended listeners. In fact, low probability of detection and low probability of intercept are two important parameters to increase the performance of the system. In Direct Sequence Code Division Multiple Access (DS-CDMA) systems, these properties are achieved by multiplying the data information in spreading sequences. Chaotic sequences, with their particular properties, have numerous applications in constructing spreading codes. Using one-dimensional Bernoulli chaotic sequence as spreading code is proposed in literature previously. The main feature of this sequence is its negative auto-correlation at lag of 1, which with proper design, leads to increase in efficiency of the communication system based on these codes. On the other hand, employing the complex chaotic sequences as spreading sequence also has been discussed in several papers. In this paper, use of two-dimensional Bernoulli chaotic sequences is proposed as spreading codes. The performance of a multi-user synchronous and asynchronous DS-CDMA system will be evaluated by applying these sequences under Additive White Gaussian Noise (AWGN) and fading channel. Simulation results indicate improvement of the performance in comparison with conventional spreading codes like Gold codes as well as similar complex chaotic spreading sequences. Similar to one-dimensional Bernoulli chaotic sequences, the proposed sequences also have negative auto-correlation. Besides, construction of complex sequences with lower average cross-correlation is possible with the proposed method.

A code-aided carrier synchronization algorithm based on improved nonbinary low-density parity-check codes

NASA Astrophysics Data System (ADS)

Bai, Cheng-lin; Cheng, Zhi-hui

2016-09-01

In order to further improve the carrier synchronization estimation range and accuracy at low signal-to-noise ratio ( SNR), this paper proposes a code-aided carrier synchronization algorithm based on improved nonbinary low-density parity-check (NB-LDPC) codes to study the polarization-division-multiplexing coherent optical orthogonal frequency division multiplexing (PDM-CO-OFDM) system performance in the cases of quadrature phase shift keying (QPSK) and 16 quadrature amplitude modulation (16-QAM) modes. The simulation results indicate that this algorithm can enlarge frequency and phase offset estimation ranges and enhance accuracy of the system greatly, and the bit error rate ( BER) performance of the system is improved effectively compared with that of the system employing traditional NB-LDPC code-aided carrier synchronization algorithm.

Association between implementation of a code stroke system and poststroke epilepsy.

PubMed

Chen, Ziyi; Churilov, Leonid; Chen, Ziyuan; Naylor, Jillian; Koome, Miriam; Yan, Bernard; Kwan, Patrick

2018-03-27

We aimed to investigate the effect of a code stroke system on the development of poststroke epilepsy. We retrospectively analyzed consecutive patients treated with IV thrombolysis under or outside the code stroke system between 2003 and 2012. Patients were followed up for at least 2 years or until death. Factors with p < 0.1 in univariate comparisons were selected for multivariable logistic and Cox regression. A total of 409 patients met the eligibility criteria. Their median age at stroke onset was 75 years (interquartile range 64-83 years); 220 (53.8%) were male. The median follow-up duration was 1,074 days (interquartile range 119-1,671 days). Thirty-two patients (7.8%) had poststroke seizures during follow-up, comprising 7 (1.7%) with acute symptomatic seizures and 25 (6.1%) with late-onset seizures. Twenty-six patients (6.4%) fulfilled the definition of poststroke epilepsy. Three hundred eighteen patients (77.8%) were treated with the code stroke system while 91 (22.2%) were not. After adjustment for age and stroke etiology, use of the code stroke system was associated with decreased odds of poststroke epilepsy (odds ratio = 0.36, 95% confidence interval 0.14-0.87, p = 0.024). Cox regression showed lower adjusted hazard rates for poststroke epilepsy within 5 years for patients managed under the code stroke system (hazard ratio = 0.60, 95% confidence interval 0.47-0.79, p < 0.001). The code stroke system was associated with reduced odds and instantaneous risk of poststroke epilepsy. Further studies are required to identify the contribution of the individual components and mechanisms against epileptogenesis after stroke. This study provides Class III evidence that for people with acute ischemic stroke, implementation of a code stroke system reduces the risk of poststroke epilepsy. © 2018 American Academy of Neurology.

An ultrasound transient elastography system with coded excitation.

PubMed

Diao, Xianfen; Zhu, Jing; He, Xiaonian; Chen, Xin; Zhang, Xinyu; Chen, Siping; Liu, Weixiang

2017-06-28

Ultrasound transient elastography technology has found its place in elastography because it is safe and easy to operate. However, it's application in deep tissue is limited. The aim of this study is to design an ultrasound transient elastography system with coded excitation to obtain greater detection depth. The ultrasound transient elastography system requires tissue vibration to be strictly synchronous with ultrasound detection. Therefore, an ultrasound transient elastography system with coded excitation was designed. A central component of this transient elastography system was an arbitrary waveform generator with multi-channel signals output function. This arbitrary waveform generator was used to produce the tissue vibration signal, the ultrasound detection signal and the synchronous triggering signal of the radio frequency data acquisition system. The arbitrary waveform generator can produce different forms of vibration waveform to induce different shear wave propagation in the tissue. Moreover, it can achieve either traditional pulse-echo detection or a phase-modulated or a frequency-modulated coded excitation. A 7-chip Barker code and traditional pulse-echo detection were programmed on the designed ultrasound transient elastography system to detect the shear wave in the phantom excited by the mechanical vibrator. Then an elasticity QA phantom and sixteen in vitro rat livers were used for performance evaluation of the two detection pulses. The elasticity QA phantom's results show that our system is effective, and the rat liver results show the detection depth can be increased more than 1 cm. In addition, the SNR (signal-to-noise ratio) is increased by 15 dB using the 7-chip Barker coded excitation. Applying 7-chip Barker coded excitation technique to the ultrasound transient elastography can increase the detection depth and SNR. Using coded excitation technology to assess the human liver, especially in obese patients, may be a good choice.

Analysis of airborne antenna systems using geometrical theory of diffraction and moment method computer codes

NASA Technical Reports Server (NTRS)

Hartenstein, Richard G., Jr.

1985-01-01

Computer codes have been developed to analyze antennas on aircraft and in the presence of scatterers. The purpose of this study is to use these codes to develop accurate computer models of various aircraft and antenna systems. The antenna systems analyzed are a P-3B L-Band antenna, an A-7E UHF relay pod antenna, and traffic advisory antenna system installed on a Bell Long Ranger helicopter. Computer results are compared to measured ones with good agreement. These codes can be used in the design stage of an antenna system to determine the optimum antenna location and save valuable time and costly flight hours.

ETF system code: composition and applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reid, R.L.; Wu, K.F.

1980-01-01

A computer code has been developed for application to ETF tokamak system and conceptual design studies. The code determines cost, performance, configuration, and technology requirements as a function of tokamak parameters. The ETF code is structured in a modular fashion in order to allow independent modeling of each major tokamak component. The primary benefit of modularization is that it allows updating of a component module, such as the TF coil module, without disturbing the remainder of the system code as long as the input/output to the modules remains unchanged. The modules may be run independently to perform specific design studies,more » such as determining the effect of allowable strain on TF coil structural requirements, or the modules may be executed together as a system to determine global effects, such as defining the impact of aspect ratio on the entire tokamak system.« less

A systematic literature review of automated clinical coding and classification systems

PubMed Central

Williams, Margaret; Fenton, Susan H; Jenders, Robert A; Hersh, William R

2010-01-01

Clinical coding and classification processes transform natural language descriptions in clinical text into data that can subsequently be used for clinical care, research, and other purposes. This systematic literature review examined studies that evaluated all types of automated coding and classification systems to determine the performance of such systems. Studies indexed in Medline or other relevant databases prior to March 2009 were considered. The 113 studies included in this review show that automated tools exist for a variety of coding and classification purposes, focus on various healthcare specialties, and handle a wide variety of clinical document types. Automated coding and classification systems themselves are not generalizable, nor are the results of the studies evaluating them. Published research shows these systems hold promise, but these data must be considered in context, with performance relative to the complexity of the task and the desired outcome. PMID:20962126

[ENT and head and neck surgery in the German DRG system 2007].

PubMed

Franz, D; Roeder, N; Hörmann, K; Alberty, J

2007-07-01

The German DRG system has been further developed into version 2007. For ENT and head and neck surgery, significant changes in the coding of diagnoses and medical operations as well as in the the DRG structure have been made. New ICD codes for sleep apnoea and acquired tracheal stenosis have been implemented. Surgery on the acoustic meatus, removal of auricle hyaline cartilage for transplantation (e. g. rhinosurgery) and tonsillotomy have been coded in the 2007 version. In addition, the DRG structure has been improved. Case allocation of more than one significant operation has been established. The G-DRG system has gained in complexity. High demands are made on the coding of complex cases, whereas standard cases require mostly only one specific diagnosis and one specific OPS code. The quality of case allocation for ENT patients within the G-DRG system has been improved. Nevertheless, further adjustments of the G-DRG system are necessary.

Computer code for analyzing the performance of aquifer thermal energy storage systems

NASA Astrophysics Data System (ADS)

Vail, L. W.; Kincaid, C. T.; Kannberg, L. D.

1985-05-01

A code called Aquifer Thermal Energy Storage System Simulator (ATESSS) has been developed to analyze the operational performance of ATES systems. The ATESSS code provides an ability to examine the interrelationships among design specifications, general operational strategies, and unpredictable variations in the demand for energy. The uses of the code can vary the well field layout, heat exchanger size, and pumping/injection schedule. Unpredictable aspects of supply and demand may also be examined through the use of a stochastic model of selected system parameters. While employing a relatively simple model of the aquifer, the ATESSS code plays an important role in the design and operation of ATES facilities by augmenting experience provided by the relatively few field experiments and demonstration projects. ATESSS has been used to characterize the effect of different pumping/injection schedules on a hypothetical ATES system and to estimate the recovery at the St. Paul, Minnesota, field experiment.

A systematic literature review of automated clinical coding and classification systems.

PubMed

Stanfill, Mary H; Williams, Margaret; Fenton, Susan H; Jenders, Robert A; Hersh, William R

2010-01-01

Clinical coding and classification processes transform natural language descriptions in clinical text into data that can subsequently be used for clinical care, research, and other purposes. This systematic literature review examined studies that evaluated all types of automated coding and classification systems to determine the performance of such systems. Studies indexed in Medline or other relevant databases prior to March 2009 were considered. The 113 studies included in this review show that automated tools exist for a variety of coding and classification purposes, focus on various healthcare specialties, and handle a wide variety of clinical document types. Automated coding and classification systems themselves are not generalizable, nor are the results of the studies evaluating them. Published research shows these systems hold promise, but these data must be considered in context, with performance relative to the complexity of the task and the desired outcome.

Industrial Code Development

NASA Technical Reports Server (NTRS)

Shapiro, Wilbur

1991-01-01

The industrial codes will consist of modules of 2-D and simplified 2-D or 1-D codes, intended for expeditious parametric studies, analysis, and design of a wide variety of seals. Integration into a unified system is accomplished by the industrial Knowledge Based System (KBS), which will also provide user friendly interaction, contact sensitive and hypertext help, design guidance, and an expandable database. The types of analysis to be included with the industrial codes are interfacial performance (leakage, load, stiffness, friction losses, etc.), thermoelastic distortions, and dynamic response to rotor excursions. The first three codes to be completed and which are presently being incorporated into the KBS are the incompressible cylindrical code, ICYL, and the compressible cylindrical code, GCYL.

Interface requirements for coupling a containment code to a reactor system thermal hydraulic codes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baratta, A.J.

1997-07-01

To perform a complete analysis of a reactor transient, not only the primary system response but the containment response must also be accounted for. Such transients and accidents as a loss of coolant accident in both pressurized water and boiling water reactors and inadvertent operation of safety relief valves all challenge the containment and may influence flows because of containment feedback. More recently, the advanced reactor designs put forth by General Electric and Westinghouse in the US and by Framatome and Seimens in Europe rely on the containment to act as the ultimate heat sink. Techniques used by analysts andmore » engineers to analyze the interaction of the containment and the primary system were usually iterative in nature. Codes such as RELAP or RETRAN were used to analyze the primary system response and CONTAIN or CONTEMPT the containment response. The analysis was performed by first running the system code and representing the containment as a fixed pressure boundary condition. The flows were usually from the primary system to the containment initially and generally under choked conditions. Once the mass flows and timing are determined from the system codes, these conditions were input into the containment code. The resulting pressures and temperatures were then calculated and the containment performance analyzed. The disadvantage of this approach becomes evident when one performs an analysis of a rapid depressurization or a long term accident sequence in which feedback from the containment can occur. For example, in a BWR main steam line break transient, the containment heats up and becomes a source of energy for the primary system. Recent advances in programming and computer technology are available to provide an alternative approach. The author and other researchers have developed linkage codes capable of transferring data between codes at each time step allowing discrete codes to be coupled together.« less

A new coding system for metabolic disorders demonstrates gaps in the international disease classifications ICD-10 and SNOMED-CT, which can be barriers to genotype-phenotype data sharing.

PubMed

Sollie, Annet; Sijmons, Rolf H; Lindhout, Dick; van der Ploeg, Ans T; Rubio Gozalbo, M Estela; Smit, G Peter A; Verheijen, Frans; Waterham, Hans R; van Weely, Sonja; Wijburg, Frits A; Wijburg, Rudolph; Visser, Gepke

2013-07-01

Data sharing is essential for a better understanding of genetic disorders. Good phenotype coding plays a key role in this process. Unfortunately, the two most widely used coding systems in medicine, ICD-10 and SNOMED-CT, lack information necessary for the detailed classification and annotation of rare and genetic disorders. This prevents the optimal registration of such patients in databases and thus data-sharing efforts. To improve care and to facilitate research for patients with metabolic disorders, we developed a new coding system for metabolic diseases with a dedicated group of clinical specialists. Next, we compared the resulting codes with those in ICD and SNOMED-CT. No matches were found in 76% of cases in ICD-10 and in 54% in SNOMED-CT. We conclude that there are sizable gaps in the SNOMED-CT and ICD coding systems for metabolic disorders. There may be similar gaps for other classes of rare and genetic disorders. We have demonstrated that expert groups can help in addressing such coding issues. Our coding system has been made available to the ICD and SNOMED-CT organizations as well as to the Orphanet and HPO organizations for further public application and updates will be published online (www.ddrmd.nl and www.cineas.org). © 2013 WILEY PERIODICALS, INC.

Angiotensin receptors modulate the renal hemodynamic effects of nitric oxide in conscious newborn lambs

PubMed Central

Vinturache, Angela E.; Smith, Francine G.

2014-01-01

Abstract This study aimed to elucidate the roles of both angiotensin II (ANG II) receptors – type 1 (AT1Rs) and type 2 (AT2Rs) – separately and together in influencing hemodynamic effects of endogenously produced nitric oxide (NO) during postnatal development. In conscious, chronically instrumented lambs aged ~1 week (8 ± 1 days, N = 8) and ~6 weeks (41 ± 2 days, N = 8), systolic, diastolic, and mean arterial pressure (SAP, DAP, MAP) and venous pressure (MVP), renal blood flow (RBF), and renal vascular resistance (RVR) were measured in response to the l‐arginine analog, l‐NAME after pretreatment with either the AT1R antagonist, ZD 7155, the AT2R antagonist, PD 123319, or both antagonists. The increase in SAP, DAP, and MAP by l‐NAME was not altered by either ATR antagonist in either age group. The increase in RBF after l‐NAME was, however, altered by both ATR antagonists in an age‐dependent manner, which was mediated predominantly through AT2Rs in newborn lambs. These findings reveal that there is an age‐dependent interaction between the renin–angiotensin (RAS) and the NO pathway in regulating renal but not systemic hemodynamics through both ATRs, whereas AT2Rs appear to be important in the renal hemodynamic effects of NO early in life. PMID:24872358

Potential loss of revenue due to errors in clinical coding during the implementation of the Malaysia diagnosis related group (MY-DRG®) Casemix system in a teaching hospital in Malaysia.

PubMed

Zafirah, S A; Nur, Amrizal Muhammad; Puteh, Sharifa Ezat Wan; Aljunid, Syed Mohamed

2018-01-25

The accuracy of clinical coding is crucial in the assignment of Diagnosis Related Groups (DRGs) codes, especially if the hospital is using Casemix System as a tool for resource allocations and efficiency monitoring. The aim of this study was to estimate the potential loss of income due to an error in clinical coding during the implementation of the Malaysia Diagnosis Related Group (MY-DRG ® ) Casemix System in a teaching hospital in Malaysia. Four hundred and sixty-four (464) coded medical records were selected, re-examined and re-coded by an independent senior coder (ISC). This ISC re-examined and re-coded the error code that was originally entered by the hospital coders. The pre- and post-coding results were compared, and if there was any disagreement, the codes by the ISC were considered the accurate codes. The cases were then re-grouped using a MY-DRG ® grouper to assess and compare the changes in the DRG assignment and the hospital tariff assignment. The outcomes were then verified by a casemix expert. Coding errors were found in 89.4% (415/424) of the selected patient medical records. Coding errors in secondary diagnoses were the highest, at 81.3% (377/464), followed by secondary procedures at 58.2% (270/464), principal procedures of 50.9% (236/464) and primary diagnoses at 49.8% (231/464), respectively. The coding errors resulted in the assignment of different MY-DRG ® codes in 74.0% (307/415) of the cases. From this result, 52.1% (160/307) of the cases had a lower assigned hospital tariff. In total, the potential loss of income due to changes in the assignment of the MY-DRG ® code was RM654,303.91. The quality of coding is a crucial aspect in implementing casemix systems. Intensive re-training and the close monitoring of coder performance in the hospital should be performed to prevent the potential loss of hospital income.

Model Children's Code.

ERIC Educational Resources Information Center

New Mexico Univ., Albuquerque. American Indian Law Center.

The Model Children's Code was developed to provide a legally correct model code that American Indian tribes can use to enact children's codes that fulfill their legal, cultural and economic needs. Code sections cover the court system, jurisdiction, juvenile offender procedures, minor-in-need-of-care, and termination. Almost every Code section is…

Facilitating Internet-Scale Code Retrieval

ERIC Educational Resources Information Center

Bajracharya, Sushil Krishna

2010-01-01

Internet-Scale code retrieval deals with the representation, storage, and access of relevant source code from a large amount of source code available on the Internet. Internet-Scale code retrieval systems support common emerging practices among software developers related to finding and reusing source code. In this dissertation we focus on some…

The MARS15-based FermiCORD code system for calculation of the accelerator-induced residual dose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grebe, A.; Leveling, A.; Lu, T.

The FermiCORD code system, a set of codes based on MARS15 that calculates the accelerator-induced residual doses at experimental facilities of arbitrary configurations, has been developed. FermiCORD is written in C++ as an add-on to Fortran-based MARS15. The FermiCORD algorithm consists of two stages: 1) simulation of residual doses on contact with the surfaces surrounding the studied location and of radionuclide inventories in the structures surrounding those locations using MARS15, and 2) simulation of the emission of the nuclear decay gamma-quanta by the residuals in the activated structures and scoring the prompt doses of these gamma-quanta at arbitrary distances frommore » those structures. The FermiCORD code system has been benchmarked against similar algorithms based on other code systems and showed a good agreement. The code system has been applied for calculation of the residual dose of the target station for the Mu2e experiment and the results have been compared to approximate dosimetric approaches.« less

The MARS15-based FermiCORD code system for calculation of the accelerator-induced residual dose

NASA Astrophysics Data System (ADS)

Grebe, A.; Leveling, A.; Lu, T.; Mokhov, N.; Pronskikh, V.

2018-01-01

The FermiCORD code system, a set of codes based on MARS15 that calculates the accelerator-induced residual doses at experimental facilities of arbitrary configurations, has been developed. FermiCORD is written in C++ as an add-on to Fortran-based MARS15. The FermiCORD algorithm consists of two stages: 1) simulation of residual doses on contact with the surfaces surrounding the studied location and of radionuclide inventories in the structures surrounding those locations using MARS15, and 2) simulation of the emission of the nuclear decay γ-quanta by the residuals in the activated structures and scoring the prompt doses of these γ-quanta at arbitrary distances from those structures. The FermiCORD code system has been benchmarked against similar algorithms based on other code systems and against experimental data from the CERF facility at CERN, and FermiCORD showed reasonable agreement with these. The code system has been applied for calculation of the residual dose of the target station for the Mu2e experiment and the results have been compared to approximate dosimetric approaches.

An edge preserving differential image coding scheme

NASA Technical Reports Server (NTRS)

Rost, Martin C.; Sayood, Khalid

1992-01-01

Differential encoding techniques are fast and easy to implement. However, a major problem with the use of differential encoding for images is the rapid edge degradation encountered when using such systems. This makes differential encoding techniques of limited utility, especially when coding medical or scientific images, where edge preservation is of utmost importance. A simple, easy to implement differential image coding system with excellent edge preservation properties is presented. The coding system can be used over variable rate channels, which makes it especially attractive for use in the packet network environment.

Color Coded Cards for Student Behavior Management in Higher Education Environments

ERIC Educational Resources Information Center

Alhalabi, Wadee; Alhalabi, Mobeen

2017-01-01

The Color Coded Cards system as a possibly effective class management tool is the focus of this research. The Color Coded Cards system involves each student being given a card with a specific color based on his or her behavior. The main objective of the research is to find out whether this system effectively improves students' behavior, thus…

Organizational Effectiveness Information System (OEIS) User’s Manual

DTIC Science & Technology

1986-09-01

SUBJECT CODES B-l C. LISTING OF VALID RESOURCE SYSTEM CODES C-l »TflerÄ*w»fi*%f*fc**v.nft; ^’.A/.V. A y.A/.AAA«•.*-A/. AAV ...the valid codes used la the Implementation and Design System. MACOM 01 COE 02 DARCOM 03 EUSA 04 FORSCOM 05 HSC 06 HQDA 07 INSCOM 08 MDW 09

Throughput of Coded Optical CDMA Systems with AND Detectors

NASA Astrophysics Data System (ADS)

Memon, Kehkashan A.; Umrani, Fahim A.; Umrani, A. W.; Umrani, Naveed A.

2012-09-01

Conventional detection techniques used in optical code-division multiple access (OCDMA) systems are not optimal and result in poor bit error rate performance. This paper analyzes the coded performance of optical CDMA systems with AND detectors for enhanced throughput efficiencies and improved error rate performance. The results show that the use of AND detectors significantly improve the performance of an optical channel.

A Coding System for Qualitative Studies of the Information-Seeking Process in Computer Science Research

ERIC Educational Resources Information Center

Moral, Cristian; de Antonio, Angelica; Ferre, Xavier; Lara, Graciela

2015-01-01

Introduction: In this article we propose a qualitative analysis tool--a coding system--that can support the formalisation of the information-seeking process in a specific field: research in computer science. Method: In order to elaborate the coding system, we have conducted a set of qualitative studies, more specifically a focus group and some…

Teacher-Child Dyadic Interaction: A Manual for Coding Classroom Behavior. Report Series No. 27.

ERIC Educational Resources Information Center

Brophy, Jere E.; Good, Thomas L.

This manual presents the rationale and coding system for the study of dyadic interaction between teachers and children in classrooms. The introduction notes major differences between this system and others in common use: 1) it is not a universal system that attempts to code all classroom behavior, and 2) the teacher's interactions in his class are…

A coded tracking telemetry system

USGS Publications Warehouse

Howey, P.W.; Seegar, W.S.; Fuller, M.R.; Titus, K.; Amlaner, Charles J.

1989-01-01

We describe the general characteristics of an automated radio telemetry system designed to operate for prolonged periods on a single frequency. Each transmitter sends a unique coded signal to a receiving system that encodes and records only the appropriater, pre-programmed codes. A record of the time of each reception is stored on diskettes in a micro-computer. This system enables continuous monitoring of infrequent signals (e.g. one per minute or one per hour), thus extending operation life or allowing size reduction of the transmitter, compared to conventional wildlife telemetry. Furthermore, when using unique codes transmitted on a single frequency, biologists can monitor many individuals without exceeding the radio frequency allocations for wildlife.

Learning of spatio-temporal codes in a coupled oscillator system.

PubMed

Orosz, Gábor; Ashwin, Peter; Townley, Stuart

2009-07-01

In this paper, we consider a learning strategy that allows one to transmit information between two coupled phase oscillator systems (called teaching and learning systems) via frequency adaptation. The dynamics of these systems can be modeled with reference to a number of partially synchronized cluster states and transitions between them. Forcing the teaching system by steady but spatially nonhomogeneous inputs produces cyclic sequences of transitions between the cluster states, that is, information about inputs is encoded via a "winnerless competition" process into spatio-temporal codes. The large variety of codes can be learned by the learning system that adapts its frequencies to those of the teaching system. We visualize the dynamics using "weighted order parameters (WOPs)" that are analogous to "local field potentials" in neural systems. Since spatio-temporal coding is a mechanism that appears in olfactory systems, the developed learning rules may help to extract information from these neural ensembles.

HEC Applications on Columbia Project

NASA Technical Reports Server (NTRS)

Taft, Jim

2004-01-01

NASA's Columbia system consists of a cluster of twenty 512 processor SGI Altix systems. Each of these systems is 3 TFLOP/s in peak performance - approximately the same as the entire compute capability at NAS just one year ago. Each 512p system is a single system image machine with one Linunx O5, one high performance file system, and one globally shared memory. The NAS Terascale Applications Group (TAG) is chartered to assist in scaling NASA's mission critical codes to at least 512p in order to significantly improve emergency response during flight operations, as well as provide significant improvements in the codes. and rate of scientific discovery across the scientifc disciplines within NASA's Missions. Recent accomplishments are 4x improvements to codes in the ocean modeling community, 10x performance improvements in a number of computational fluid dynamics codes used in aero-vehicle design, and 5x improvements in a number of space science codes dealing in extreme physics. The TAG group will continue its scaling work to 2048p and beyond (10240 cpus) as the Columbia system becomes fully operational and the upgrades to the SGI NUMAlink memory fabric are in place. The NUMlink uprades dramatically improve system scalability for a single application. These upgrades will allow a number of codes to execute faster at higher fidelity than ever before on any other system, thus increasing the rate of scientific discovery even further

End-to-End Modeling with the Heimdall Code to Scope High-Power Microwave Systems

DTIC Science & Technology

2007-06-01

END-TO-END MODELING WITH THE HEIMDALL CODE TO SCOPE HIGH - POWER MICROWAVE SYSTEMS ∗ John A. Swegleξ Savannah River National Laboratory, 743A...describe the expert-system code HEIMDALL, which is used to model full high - power microwave systems using over 60 systems-engineering models, developed in...of our calculations of the mass of a Supersystem producing 500-MW, 15-ns output pulses in the X band for bursts of 1 s , interspersed with 10- s

ISSYS: An integrated synergistic Synthesis System

NASA Technical Reports Server (NTRS)

Dovi, A. R.

1980-01-01

Integrated Synergistic Synthesis System (ISSYS), an integrated system of computer codes in which the sequence of program execution and data flow is controlled by the user, is discussed. The commands available to exert such control, the ISSYS major function and rules, and the computer codes currently available in the system are described. Computational sequences frequently used in the aircraft structural analysis and synthesis are defined. External computer codes utilized by the ISSYS system are documented. A bibliography on the programs is included.

A COTS-Based Replacement Strategy for Aging Avionics Computers

DTIC Science & Technology

2001-12-01

Communication Control Unit. A COTS-Based Replacement Strategy for Aging Avionics Computers COTS Microprocessor Real Time Operating System New Native Code...Native Code Objec ts Native Code Thread Real - Time Operating System Legacy Function x Virtual Component Environment Context Switch Thunk Add-in Replace

48 CFR 1501.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Publication and code arrangement. 1501.105-1 Section 1501.105-1 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL GENERAL Purpose, Authority, Issuance 1501.105-1 Publication and code arrangement. The...

Time trend of injection drug errors before and after implementation of bar-code verification system.

PubMed

Sakushima, Ken; Umeki, Reona; Endoh, Akira; Ito, Yoichi M; Nasuhara, Yasuyuki

2015-01-01

Bar-code technology, used for verification of patients and their medication, could prevent medication errors in clinical practice. Retrospective analysis of electronically stored medical error reports was conducted in a university hospital. The number of reported medication errors of injected drugs, including wrong drug administration and administration to the wrong patient, was compared before and after implementation of the bar-code verification system for inpatient care. A total of 2867 error reports associated with injection drugs were extracted. Wrong patient errors decreased significantly after implementation of the bar-code verification system (17.4/year vs. 4.5/year, p< 0.05), although wrong drug errors did not decrease sufficiently (24.2/year vs. 20.3/year). The source of medication errors due to wrong drugs was drug preparation in hospital wards. Bar-code medication administration is effective for prevention of wrong patient errors. However, ordinary bar-code verification systems are limited in their ability to prevent incorrect drug preparation in hospital wards.

System Synchronizes Recordings from Separated Video Cameras

NASA Technical Reports Server (NTRS)

Nail, William; Nail, William L.; Nail, Jasper M.; Le, Doung T.

2009-01-01

A system of electronic hardware and software for synchronizing recordings from multiple, physically separated video cameras is being developed, primarily for use in multiple-look-angle video production. The system, the time code used in the system, and the underlying method of synchronization upon which the design of the system is based are denoted generally by the term "Geo-TimeCode(TradeMark)." The system is embodied mostly in compact, lightweight, portable units (see figure) denoted video time-code units (VTUs) - one VTU for each video camera. The system is scalable in that any number of camera recordings can be synchronized. The estimated retail price per unit would be about $350 (in 2006 dollars). The need for this or another synchronization system external to video cameras arises because most video cameras do not include internal means for maintaining synchronization with other video cameras. Unlike prior video-camera-synchronization systems, this system does not depend on continuous cable or radio links between cameras (however, it does depend on occasional cable links lasting a few seconds). Also, whereas the time codes used in prior video-camera-synchronization systems typically repeat after 24 hours, the time code used in this system does not repeat for slightly more than 136 years; hence, this system is much better suited for long-term deployment of multiple cameras.

Automatic Testcase Generation for Flight Software

NASA Technical Reports Server (NTRS)

Bushnell, David Henry; Pasareanu, Corina; Mackey, Ryan M.

2008-01-01

The TacSat3 project is applying Integrated Systems Health Management (ISHM) technologies to an Air Force spacecraft for operational evaluation in space. The experiment will demonstrate the effectiveness and cost of ISHM and vehicle systems management (VSM) technologies through onboard operation for extended periods. We present two approaches to automatic testcase generation for ISHM: 1) A blackbox approach that views the system as a blackbox, and uses a grammar-based specification of the system's inputs to automatically generate *all* inputs that satisfy the specifications (up to prespecified limits); these inputs are then used to exercise the system. 2) A whitebox approach that performs analysis and testcase generation directly on a representation of the internal behaviour of the system under test. The enabling technologies for both these approaches are model checking and symbolic execution, as implemented in the Ames' Java PathFinder (JPF) tool suite. Model checking is an automated technique for software verification. Unlike simulation and testing which check only some of the system executions and therefore may miss errors, model checking exhaustively explores all possible executions. Symbolic execution evaluates programs with symbolic rather than concrete values and represents variable values as symbolic expressions. We are applying the blackbox approach to generating input scripts for the Spacecraft Command Language (SCL) from Interface and Control Systems. SCL is an embedded interpreter for controlling spacecraft systems. TacSat3 will be using SCL as the controller for its ISHM systems. We translated the SCL grammar into a program that outputs scripts conforming to the grammars. Running JPF on this program generates all legal input scripts up to a prespecified size. Script generation can also be targeted to specific parts of the grammar of interest to the developers. These scripts are then fed to the SCL Executive. ICS's in-house coverage tools will be run to measure code coverage. Because the scripts exercise all parts of the grammar, we expect them to provide high code coverage. This blackbox approach is suitable for systems for which we do not have access to the source code. We are applying whitebox test generation to the Spacecraft Health INference Engine (SHINE) that is part of the ISHM system. In TacSat3, SHINE will execute an on-board knowledge base for fault detection and diagnosis. SHINE converts its knowledge base into optimized C code which runs onboard TacSat3. SHINE can translate its rules into an intermediate representation (Java) suitable for analysis with JPF. JPF will analyze SHINE's Java output using symbolic execution, producing testcases that can provide either complete or directed coverage of the code. Automatically generated test suites can provide full code coverage and be quickly regenerated when code changes. Because our tools analyze executable code, they fully cover the delivered code, not just models of the code. This approach also provides a way to generate tests that exercise specific sections of code under specific preconditions. This capability gives us more focused testing of specific sections of code.

Serial turbo trellis coded modulation using a serially concatenated coder

NASA Technical Reports Server (NTRS)

Divsalar, Dariush (Inventor); Dolinar, Samuel J. (Inventor); Pollara, Fabrizio (Inventor)

2010-01-01

Serial concatenated trellis coded modulation (SCTCM) includes an outer coder, an interleaver, a recursive inner coder and a mapping element. The outer coder receives data to be coded and produces outer coded data. The interleaver permutes the outer coded data to produce interleaved data. The recursive inner coder codes the interleaved data to produce inner coded data. The mapping element maps the inner coded data to a symbol. The recursive inner coder has a structure which facilitates iterative decoding of the symbols at a decoder system. The recursive inner coder and the mapping element are selected to maximize the effective free Euclidean distance of a trellis coded modulator formed from the recursive inner coder and the mapping element. The decoder system includes a demodulation unit, an inner SISO (soft-input soft-output) decoder, a deinterleaver, an outer SISO decoder, and an interleaver.

Bar Coding and Tracking in Pathology.

PubMed

Hanna, Matthew G; Pantanowitz, Liron

2016-03-01

Bar coding and specimen tracking are intricately linked to pathology workflow and efficiency. In the pathology laboratory, bar coding facilitates many laboratory practices, including specimen tracking, automation, and quality management. Data obtained from bar coding can be used to identify, locate, standardize, and audit specimens to achieve maximal laboratory efficiency and patient safety. Variables that need to be considered when implementing and maintaining a bar coding and tracking system include assets to be labeled, bar code symbologies, hardware, software, workflow, and laboratory and information technology infrastructure as well as interoperability with the laboratory information system. This article addresses these issues, primarily focusing on surgical pathology. Copyright © 2016 Elsevier Inc. All rights reserved.

Bar Coding and Tracking in Pathology.

PubMed

Hanna, Matthew G; Pantanowitz, Liron

2015-06-01

Bar coding and specimen tracking are intricately linked to pathology workflow and efficiency. In the pathology laboratory, bar coding facilitates many laboratory practices, including specimen tracking, automation, and quality management. Data obtained from bar coding can be used to identify, locate, standardize, and audit specimens to achieve maximal laboratory efficiency and patient safety. Variables that need to be considered when implementing and maintaining a bar coding and tracking system include assets to be labeled, bar code symbologies, hardware, software, workflow, and laboratory and information technology infrastructure as well as interoperability with the laboratory information system. This article addresses these issues, primarily focusing on surgical pathology. Copyright © 2015 Elsevier Inc. All rights reserved.

Uniform emergency codes: will they improve safety?

PubMed

2005-01-01

There are pros and cons to uniform code systems, according to emergency medicine experts. Uniformity can be a benefit when ED nurses and other staff work at several facilities. It's critical that your staff understand not only what the codes stand for, but what they must do when codes are called. If your state institutes a new system, be sure to hold regular drills to familiarize your ED staff.

[Quality management and strategic consequences of assessing documentation and coding under the German Diagnostic Related Groups system].

PubMed

Schnabel, M; Mann, D; Efe, T; Schrappe, M; V Garrel, T; Gotzen, L; Schaeg, M

2004-10-01

The introduction of the German Diagnostic Related Groups (D-DRG) system requires redesigning administrative patient management strategies. Wrong coding leads to inaccurate grouping and endangers the reimbursement of treatment costs. This situation emphasizes the roles of documentation and coding as factors of economical success. The aims of this study were to assess the quantity and quality of initial documentation and coding (ICD-10 and OPS-301) and find operative strategies to improve efficiency and strategic means to ensure optimal documentation and coding quality. In a prospective study, documentation and coding quality were evaluated in a standardized way by weekly assessment. Clinical data from 1385 inpatients were processed for initial correctness and quality of documentation and coding. Principal diagnoses were found to be accurate in 82.7% of cases, inexact in 7.1%, and wrong in 10.1%. Effects on financial returns occurred in 16%. Based on these findings, an optimized, interdisciplinary, and multiprofessional workflow on medical documentation, coding, and data control was developed. Workflow incorporating regular assessment of documentation and coding quality is required by the DRG system to ensure efficient accounting of hospital services. Interdisciplinary and multiprofessional cooperation is recognized to be an important factor in establishing an efficient workflow in medical documentation and coding.

RAMONA-4B a computer code with three-dimensional neutron kinetics for BWR and SBWR system transient - user`s manual

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rohatgi, U.S.; Cheng, H.S.; Khan, H.J.

This document is the User`s Manual for the Boiling Water Reactor (BWR), and Simplified Boiling Water Reactor (SBWR) systems transient code RAMONA-4B. The code uses a three-dimensional neutron-kinetics model coupled with a multichannel, nonequilibrium, drift-flux, phase-flow model of the thermal hydraulics of the reactor vessel. The code is designed to analyze a wide spectrum of BWR core and system transients. Chapter 1 gives an overview of the code`s capabilities and limitations; Chapter 2 describes the code`s structure, lists major subroutines, and discusses the computer requirements. Chapter 3 is on code, auxillary codes, and instructions for running RAMONA-4B on Sun SPARCmore » and IBM Workstations. Chapter 4 contains component descriptions and detailed card-by-card input instructions. Chapter 5 provides samples of the tabulated output for the steady-state and transient calculations and discusses the plotting procedures for the steady-state and transient calculations. Three appendices contain important user and programmer information: lists of plot variables (Appendix A) listings of input deck for sample problem (Appendix B), and a description of the plotting program PAD (Appendix C). 24 refs., 18 figs., 11 tabs.« less

Bandwidth efficient CCSDS coding standard proposals

NASA Technical Reports Server (NTRS)

Costello, Daniel J., Jr.; Perez, Lance C.; Wang, Fu-Quan

1992-01-01

The basic concatenated coding system for the space telemetry channel consists of a Reed-Solomon (RS) outer code, a symbol interleaver/deinterleaver, and a bandwidth efficient trellis inner code. A block diagram of this configuration is shown. The system may operate with or without the outer code and interleaver. In this recommendation, the outer code remains the (255,223) RS code over GF(2 exp 8) with an error correcting capability of t = 16 eight bit symbols. This code's excellent performance and the existence of fast, cost effective, decoders justify its continued use. The purpose of the interleaver/deinterleaver is to distribute burst errors out of the inner decoder over multiple codewords of the outer code. This utilizes the error correcting capability of the outer code more efficiently and reduces the probability of an RS decoder failure. Since the space telemetry channel is not considered bursty, the required interleaving depth is primarily a function of the inner decoding method. A diagram of an interleaver with depth 4 that is compatible with the (255,223) RS code is shown. Specific interleaver requirements are discussed after the inner code recommendations.

48 CFR 2001.104-1 - Publication and code arrangement.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Publication and code arrangement. 2001.104-1 Section 2001.104-1 Federal Acquisition Regulations System NUCLEAR REGULATORY... 2001.104-1 Publication and code arrangement. (a) The NRCAR and its subsequent changes are: (1...

Coding of sounds in the auditory system and its relevance to signal processing and coding in cochlear implants.

PubMed

Moore, Brian C J

2003-03-01

To review how the properties of sounds are "coded" in the normal auditory system and to discuss the extent to which cochlear implants can and do represent these codes. Data are taken from published studies of the response of the cochlea and auditory nerve to simple and complex stimuli, in both the normal and the electrically stimulated ear. REVIEW CONTENT: The review describes: 1) the coding in the normal auditory system of overall level (which partly determines perceived loudness), spectral shape (which partly determines perceived timbre and the identity of speech sounds), periodicity (which partly determines pitch), and sound location; 2) the role of the active mechanism in the cochlea, and particularly the fast-acting compression associated with that mechanism; 3) the neural response patterns evoked by cochlear implants; and 4) how the response patterns evoked by implants differ from those observed in the normal auditory system in response to sound. A series of specific issues is then discussed, including: 1) how to compensate for the loss of cochlear compression; 2) the effective number of independent channels in a normal ear and in cochlear implantees; 3) the importance of independence of responses across neurons; 4) the stochastic nature of normal neural responses; 5) the possible role of across-channel coincidence detection; and 6) potential benefits of binaural implantation. Current cochlear implants do not adequately reproduce several aspects of the neural coding of sound in the normal auditory system. Improved electrode arrays and coding systems may lead to improved coding and, it is hoped, to better performance.

Reconciliation of international administrative coding systems for comparison of colorectal surgery outcome.

PubMed

Munasinghe, A; Chang, D; Mamidanna, R; Middleton, S; Joy, M; Penninckx, F; Darzi, A; Livingston, E; Faiz, O

2014-07-01

Significant variation in colorectal surgery outcomes exists between different countries. Better understanding of the sources of variable outcomes using administrative data requires alignment of differing clinical coding systems. We aimed to map similar diagnoses and procedures across administrative coding systems used in different countries. Administrative data were collected in a central database as part of the Global Comparators (GC) Project. In order to unify these data, a systematic translation of diagnostic and procedural codes was undertaken. Codes for colorectal diagnoses, resections, operative complications and reoperative interventions were mapped across the respective national healthcare administrative coding systems. Discharge data from January 2006 to June 2011 for patients who had undergone colorectal surgical resections were analysed to generate risk-adjusted models for mortality, length of stay, readmissions and reoperations. In all, 52 544 case records were collated from 31 institutions in five countries. Mapping of all the coding systems was achieved so that diagnosis and procedures from the participant countries could be compared. Using the aligned coding systems to develop risk-adjusted models, the 30-day mortality rate for colorectal surgery was 3.95% (95% CI 0.86-7.54), the 30-day readmission rate was 11.05% (5.67-17.61), the 28-day reoperation rate was 6.13% (3.68-9.66) and the mean length of stay was 14 (7.65-46.76) days. The linkage of international hospital administrative data that we developed enabled comparison of documented surgical outcomes between countries. This methodology may facilitate international benchmarking. Colorectal Disease © 2014 The Association of Coloproctology of Great Britain and Ireland.

Diagnosis - Using automatic test equipment and artificial intelligence expert systems

NASA Astrophysics Data System (ADS)

Ramsey, J. E., Jr.

Three expert systems (ATEOPS, ATEFEXPERS, and ATEFATLAS), which were created to direct automatic test equipment (ATE), are reviewed. The purpose of the project was to develop an expert system to troubleshoot the converter-programmer power supply card for the F-15 aircraft and have that expert system direct the automatic test equipment. Each expert system uses a different knowledge base or inference engine, basing the testing on the circuit schematic, test requirements document, or ATLAS code. Implementing generalized modules allows the expert systems to be used for any different unit under test. Using converted ATLAS to LISP code allows the expert system to direct any ATE using ATLAS. The constraint propagated frame system allows for the expansion of control by creating the ATLAS code, checking the code for good software engineering techniques, directing the ATE, and changing the test sequence as needed (planning).

Translating expert system rules into Ada code with validation and verification

NASA Technical Reports Server (NTRS)

Becker, Lee; Duckworth, R. James; Green, Peter; Michalson, Bill; Gosselin, Dave; Nainani, Krishan; Pease, Adam

1991-01-01

The purpose of this ongoing research and development program is to develop software tools which enable the rapid development, upgrading, and maintenance of embedded real-time artificial intelligence systems. The goals of this phase of the research were to investigate the feasibility of developing software tools which automatically translate expert system rules into Ada code and develop methods for performing validation and verification testing of the resultant expert system. A prototype system was demonstrated which automatically translated rules from an Air Force expert system was demonstrated which detected errors in the execution of the resultant system. The method and prototype tools for converting AI representations into Ada code by converting the rules into Ada code modules and then linking them with an Activation Framework based run-time environment to form an executable load module are discussed. This method is based upon the use of Evidence Flow Graphs which are a data flow representation for intelligent systems. The development of prototype test generation and evaluation software which was used to test the resultant code is discussed. This testing was performed automatically using Monte-Carlo techniques based upon a constraint based description of the required performance for the system.

Nuclear thermal propulsion engine system design analysis code development

NASA Astrophysics Data System (ADS)

Pelaccio, Dennis G.; Scheil, Christine M.; Petrosky, Lyman J.; Ivanenok, Joseph F.

1992-01-01

A Nuclear Thermal Propulsion (NTP) Engine System Design Analyis Code has recently been developed to characterize key NTP engine system design features. Such a versatile, standalone NTP system performance and engine design code is required to support ongoing and future engine system and vehicle design efforts associated with proposed Space Exploration Initiative (SEI) missions of interest. Key areas of interest in the engine system modeling effort were the reactor, shielding, and inclusion of an engine multi-redundant propellant pump feed system design option. A solid-core nuclear thermal reactor and internal shielding code model was developed to estimate the reactor's thermal-hydraulic and physical parameters based on a prescribed thermal output which was integrated into a state-of-the-art engine system design model. The reactor code module has the capability to model graphite, composite, or carbide fuels. Key output from the model consists of reactor parameters such as thermal power, pressure drop, thermal profile, and heat generation in cooled structures (reflector, shield, and core supports), as well as the engine system parameters such as weight, dimensions, pressures, temperatures, mass flows, and performance. The model's overall analysis methodology and its key assumptions and capabilities are summarized in this paper.

The additional impact of liaison psychiatry on the future funding of general hospital services.

PubMed

Udoh, G; Afif, M; MacHale, S

2012-01-01

Accurate coding system is fundamental in determining Casemix, which is likely to become a major determinant of future funding of health care services. Our aim was to determine whether the Hospital Inpatient Enquiry (HIPE) system assigned codes for psychiatric disorders were accurate and reflective of Liaison psychiatric input into patients' care. The HIPE system's coding for psychiatric disorders were compared with psychiatrists' coding for the same patients over a prospective 6 months period, using ICD-10 diagnostic criteria. A total of 262 cases were reviewed of which 135 (51%) were male and 127 (49%) were female. The mean age was 49 years, ranging from 16 years to 87 years (SD 17.3). Our findings show a significant disparity between HIPE and psychiatrists' coding. Only 94 (36%) of the HIPE coded cases were compatible with the psychiatrists' coding. The commonest cause of incompatibility was the coding personnel's failure to code for a psychiatric disorder in the present of one 117 (69.9%), others were coding for a different diagnosis 36 (21%), coding for a psychiatric disorder in the absent of one 11 (6.6%), different sub-type and others 2 (1.2%) respectively. HIPE data coded depression 30 (11.5%) as the commonest diagnosis and general examination 1 (0.4%) as least but failed to code for dementia, illicit drug use and somatoform disorder despite their being coded for by the psychiatrists. In contrast, the psychiatrists coded delirium 46 (18%) and dementia 1 (0.4%) as the commonest and the least diagnosed disorders respectively. Given the marked increase in case complexity associated with psychiatric co-morbidities, future funding streams are at risk of inadequate payment for services rendered.

The midgut transcriptome of Phlebotomus (Larroussius) perniciosus, a vector of Leishmania infantum: comparison of sugar fed and blood fed sand flies.

PubMed

Dostálová, Anna; Votýpka, Jan; Favreau, Amanda J; Barbian, Kent D; Volf, Petr; Valenzuela, Jesus G; Jochim, Ryan C

2011-05-10

Parasite-vector interactions are fundamental in the transmission of vector-borne diseases such as leishmaniasis. Leishmania development in the vector sand fly is confined to the digestive tract, where sand fly midgut molecules interact with the parasites. In this work we sequenced and analyzed two midgut-specific cDNA libraries from sugar fed and blood fed female Phlebotomus perniciosus and compared the transcript expression profiles. A total of 4111 high quality sequences were obtained from the two libraries and assembled into 370 contigs and 1085 singletons. Molecules with putative roles in blood meal digestion, peritrophic matrix formation, immunity and response to oxidative stress were identified, including proteins that were not previously reported in sand flies. These molecules were evaluated relative to other published sand fly transcripts. Comparative analysis of the two libraries revealed transcripts differentially expressed in response to blood feeding. Molecules up regulated by blood feeding include a putative peritrophin (PperPer1), two chymotrypsin-like proteins (PperChym1 and PperChym2), a putative trypsin (PperTryp3) and four putative microvillar proteins (PperMVP1, 2, 4 and 5). Additionally, several transcripts were more abundant in the sugar fed midgut, such as two putative trypsins (PperTryp1 and PperTryp2), a chymotrypsin (PperChym3) and a microvillar protein (PperMVP3). We performed a detailed temporal expression profile analysis of the putative trypsin transcripts using qPCR and confirmed the expression of blood-induced and blood-repressed trypsins. Trypsin expression was measured in Leishmania infantum-infected and uninfected sand flies, which identified the L. infantum-induced down regulation of PperTryp3 at 24 hours post-blood meal. This midgut tissue-specific transcriptome provides insight into the molecules expressed in the midgut of P. perniciosus, an important vector of visceral leishmaniasis in the Old World. Through the comparative analysis of the libraries we identified molecules differentially expressed during blood meal digestion. Additionally, this study provides a detailed comparison to transcripts of other sand flies. Moreover, our analysis of putative trypsins demonstrated that L. infantum infection can reduce the transcript abundance of trypsin PperTryp3 in the midgut of P. perniciosus.

A Method for Constructing a New Extensible Nomenclature for Clinical Coding Practices in Sub-Saharan Africa.

PubMed

Van Laere, Sven; Nyssen, Marc; Verbeke, Frank

2017-01-01

Clinical coding is a requirement to provide valuable data for billing, epidemiology and health care resource allocation. In sub-Saharan Africa, we observe a growing awareness of the need for coding of clinical data, not only in health insurances, but also in governments and the hospitals. Presently, coding systems in sub-Saharan Africa are often used for billing purposes. In this paper we consider the use of a nomenclature to also have a clinical impact. Often coding systems are assumed to be complex and too extensive to be used in daily practice. Here, we present a method for constructing a new nomenclature based on existing coding systems by considering a minimal subset in the sub-Saharan region. Evaluation of completeness will be done nationally using the requirements of national registries. The nomenclature requires an extension character for dealing with codes that have to be used for multiple registries. Hospitals will benefit most by using this extension character.

Use the Bar Code System to Improve Accuracy of the Patient and Sample Identification.

PubMed

Chuang, Shu-Hsia; Yeh, Huy-Pzu; Chi, Kun-Hung; Ku, Hsueh-Chen

2018-01-01

In time and correct sample collection were highly related to patient's safety. The sample error rate was 11.1%, because misbranded patient information and wrong sample containers during January to April, 2016. We developed a barcode system of "Specimens Identify System" through process of reengineering of TRM, used bar code scanners, add sample container instructions, and mobile APP. Conclusion, the bar code systems improved the patient safety and created green environment.

TFaNS Tone Fan Noise Design/Prediction System. Volume 1; System Description, CUP3D Technical Documentation and Manual for Code Developers

NASA Technical Reports Server (NTRS)

Topol, David A.

1999-01-01

TFaNS is the Tone Fan Noise Design/Prediction System developed by Pratt & Whitney under contract to NASA Lewis (presently NASA Glenn). The purpose of this system is to predict tone noise emanating from a fan stage including the effects of reflection and transmission by the rotor and stator and by the duct inlet and nozzle. These effects have been added to an existing annular duct/isolated stator noise prediction capability. TFaNS consists of: The codes that compute the acoustic properties (reflection and transmission coefficients) of the various elements and write them to files. Cup3D: Fan Noise Coupling Code that reads these files, solves the coupling problem, and outputs the desired noise predictions. AWAKEN: CFD/Measured Wake Postprocessor which reformats CFD wake predictions and/or measured wake data so it can be used by the system. This volume of the report provides technical background for TFaNS including the organization of the system and CUP3D technical documentation. This document also provides information for code developers who must write Acoustic Property Files in the CUP3D format. This report is divided into three volumes: Volume I: System Description, CUP3D Technical Documentation, and Manual for Code Developers; Volume II: User's Manual, TFaNS Vers. 1.4; Volume III: Evaluation of System Codes.

Serial-data correlator/code translator

NASA Technical Reports Server (NTRS)

Morgan, L. E.

1977-01-01

System, consisting of sampling flip flop, memory (either RAM or ROM), and memory buffer, correlates sampled data with predetermined acceptance code patterns, translates acceptable code patterns to nonreturn-to-zero code, and identifies data dropouts.

Construction of a new regular LDPC code for optical transmission systems

NASA Astrophysics Data System (ADS)

Yuan, Jian-guo; Tong, Qing-zhen; Xu, Liang; Huang, Sheng

2013-05-01

A novel construction method of the check matrix for the regular low density parity check (LDPC) code is proposed. The novel regular systematically constructed Gallager (SCG)-LDPC(3969,3720) code with the code rate of 93.7% and the redundancy of 6.69% is constructed. The simulation results show that the net coding gain (NCG) and the distance from the Shannon limit of the novel SCG-LDPC(3969,3720) code can respectively be improved by about 1.93 dB and 0.98 dB at the bit error rate (BER) of 10-8, compared with those of the classic RS(255,239) code in ITU-T G.975 recommendation and the LDPC(32640,30592) code in ITU-T G.975.1 recommendation with the same code rate of 93.7% and the same redundancy of 6.69%. Therefore, the proposed novel regular SCG-LDPC(3969,3720) code has excellent performance, and is more suitable for high-speed long-haul optical transmission systems.

Performance of MIMO-OFDM using convolution codes with QAM modulation

NASA Astrophysics Data System (ADS)

Astawa, I. Gede Puja; Moegiharto, Yoedy; Zainudin, Ahmad; Salim, Imam Dui Agus; Anggraeni, Nur Annisa

2014-04-01

Performance of Orthogonal Frequency Division Multiplexing (OFDM) system can be improved by adding channel coding (error correction code) to detect and correct errors that occur during data transmission. One can use the convolution code. This paper present performance of OFDM using Space Time Block Codes (STBC) diversity technique use QAM modulation with code rate ½. The evaluation is done by analyzing the value of Bit Error Rate (BER) vs Energy per Bit to Noise Power Spectral Density Ratio (Eb/No). This scheme is conducted 256 subcarrier which transmits Rayleigh multipath fading channel in OFDM system. To achieve a BER of 10-3 is required 10dB SNR in SISO-OFDM scheme. For 2×2 MIMO-OFDM scheme requires 10 dB to achieve a BER of 10-3. For 4×4 MIMO-OFDM scheme requires 5 dB while adding convolution in a 4x4 MIMO-OFDM can improve performance up to 0 dB to achieve the same BER. This proves the existence of saving power by 3 dB of 4×4 MIMO-OFDM system without coding, power saving 7 dB of 2×2 MIMO-OFDM and significant power savings from SISO-OFDM system.

The CCONE Code System and its Application to Nuclear Data Evaluation for Fission and Other Reactions

NASA Astrophysics Data System (ADS)

Iwamoto, O.; Iwamoto, N.; Kunieda, S.; Minato, F.; Shibata, K.

2016-01-01

A computer code system, CCONE, was developed for nuclear data evaluation within the JENDL project. The CCONE code system integrates various nuclear reaction models needed to describe nucleon, light charged nuclei up to alpha-particle and photon induced reactions. The code is written in the C++ programming language using an object-oriented technology. At first, it was applied to neutron-induced reaction data on actinides, which were compiled into JENDL Actinide File 2008 and JENDL-4.0. It has been extensively used in various nuclear data evaluations for both actinide and non-actinide nuclei. The CCONE code has been upgraded to nuclear data evaluation at higher incident energies for neutron-, proton-, and photon-induced reactions. It was also used for estimating β-delayed neutron emission. This paper describes the CCONE code system indicating the concept and design of coding and inputs. Details of the formulation for modelings of the direct, pre-equilibrium and compound reactions are presented. Applications to the nuclear data evaluations such as neutron-induced reactions on actinides and medium-heavy nuclei, high-energy nucleon-induced reactions, photonuclear reaction and β-delayed neutron emission are mentioned.

48 CFR 2501.104-1 - Publication and code arrangement.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 6 2013-10-01 2013-10-01 false Publication and code arrangement. 2501.104-1 Section 2501.104-1 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION... code arrangement. (a) The NSFAR is published in the daily issues of the Federal Register and, in...

48 CFR 2501.104-1 - Publication and code arrangement.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Publication and code arrangement. 2501.104-1 Section 2501.104-1 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION... code arrangement. (a) The NSFAR is published in the daily issues of the Federal Register and, in...

48 CFR 2501.104-1 - Publication and code arrangement.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Publication and code arrangement. 2501.104-1 Section 2501.104-1 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION... code arrangement. (a) The NSFAR is published in the daily issues of the Federal Register and, in...

48 CFR 3001.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Publication and code arrangement. 3001.105-1 Section 3001.105-1 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND... Purpose, Authority, Issuance 3001.105-1 Publication and code arrangement. (a) The HSAR is published in: (1...

48 CFR 1001.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Publication and code arrangement. 1001.105-1 Section 1001.105-1 Federal Acquisition Regulations System DEPARTMENT OF THE TREASURY....105-1 Publication and code arrangement. The DTAR and its subsequent changes will be published in the...

48 CFR 1301.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Publication and code arrangement. 1301.105-1 Section 1301.105-1 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE... Publication and code arrangement. (a) The CAR is published in the Federal Register, in cumulative form in the...

48 CFR 1001.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Publication and code arrangement. 1001.105-1 Section 1001.105-1 Federal Acquisition Regulations System DEPARTMENT OF THE TREASURY....105-1 Publication and code arrangement. The DTAR and its subsequent changes will be published in the...

48 CFR 3001.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 7 2014-10-01 2014-10-01 false Publication and code arrangement. 3001.105-1 Section 3001.105-1 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND... Purpose, Authority, Issuance 3001.105-1 Publication and code arrangement. (a) The HSAR is published in: (1...

48 CFR 3001.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 7 2011-10-01 2011-10-01 false Publication and code arrangement. 3001.105-1 Section 3001.105-1 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND... Purpose, Authority, Issuance 3001.105-1 Publication and code arrangement. (a) The HSAR is published in: (1...

48 CFR 1901.104-1 - Publication and code arrangement.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Publication and code arrangement. 1901.104-1 Section 1901.104-1 Federal Acquisition Regulations System BROADCASTING BOARD OF..., Issuance 1901.104-1 Publication and code arrangement. (a) The IAAR is published in the Federal Register and...

48 CFR 3001.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 7 2012-10-01 2012-10-01 false Publication and code arrangement. 3001.105-1 Section 3001.105-1 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND... Purpose, Authority, Issuance 3001.105-1 Publication and code arrangement. (a) The HSAR is published in: (1...

48 CFR 501.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 4 2013-10-01 2013-10-01 false Publication and code arrangement. 501.105-1 Section 501.105-1 Federal Acquisition Regulations System GENERAL SERVICES... 501.105-1 Publication and code arrangement. The GSAR is published in the following sources: (a) Daily...

48 CFR 1301.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Publication and code arrangement. 1301.105-1 Section 1301.105-1 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE... Publication and code arrangement. (a) The CAR is published in the Federal Register, in cumulative form in the...

48 CFR 501.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 4 2012-10-01 2012-10-01 false Publication and code arrangement. 501.105-1 Section 501.105-1 Federal Acquisition Regulations System GENERAL SERVICES... 501.105-1 Publication and code arrangement. The GSAR is published in the following sources: (a) Daily...

48 CFR 501.105-1 - Publication and code arrangement.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 4 2014-10-01 2014-10-01 false Publication and code arrangement. 501.105-1 Section 501.105-1 Federal Acquisition Regulations System GENERAL SERVICES... 501.105-1 Publication and code arrangement. The GSAR is published in the following sources: (a) Daily...

The Modified Cognitive Constructions Coding System: Reliability and Validity Assessments

ERIC Educational Resources Information Center

Moran, Galia S.; Diamond, Gary M.

2006-01-01

The cognitive constructions coding system (CCCS) was designed for coding client's expressed problem constructions on four dimensions: intrapersonal-interpersonal, internal-external, responsible-not responsible, and linear-circular. This study introduces, and examines the reliability and validity of, a modified version of the CCCS--a version that…

Performance of the OVERFLOW-MLP and LAURA-MLP CFD Codes on the NASA Ames 512 CPU Origin System

NASA Technical Reports Server (NTRS)

Taft, James R.

2000-01-01

The shared memory Multi-Level Parallelism (MLP) technique, developed last year at NASA Ames has been very successful in dramatically improving the performance of important NASA CFD codes. This new and very simple parallel programming technique was first inserted into the OVERFLOW production CFD code in FY 1998. The OVERFLOW-MLP code's parallel performance scaled linearly to 256 CPUs on the NASA Ames 256 CPU Origin 2000 system (steger). Overall performance exceeded 20.1 GFLOP/s, or about 4.5x the performance of a dedicated 16 CPU C90 system. All of this was achieved without any major modification to the original vector based code. The OVERFLOW-MLP code is now in production on the inhouse Origin systems as well as being used offsite at commercial aerospace companies. Partially as a result of this work, NASA Ames has purchased a new 512 CPU Origin 2000 system to further test the limits of parallel performance for NASA codes of interest. This paper presents the performance obtained from the latest optimization efforts on this machine for the LAURA-MLP and OVERFLOW-MLP codes. The Langley Aerothermodynamics Upwind Relaxation Algorithm (LAURA) code is a key simulation tool in the development of the next generation shuttle, interplanetary reentry vehicles, and nearly all "X" plane development. This code sustains about 4-5 GFLOP/s on a dedicated 16 CPU C90. At this rate, expected workloads would require over 100 C90 CPU years of computing over the next few calendar years. It is not feasible to expect that this would be affordable or available to the user community. Dramatic performance gains on cheaper systems are needed. This code is expected to be perhaps the largest consumer of NASA Ames compute cycles per run in the coming year.The OVERFLOW CFD code is extensively used in the government and commercial aerospace communities to evaluate new aircraft designs. It is one of the largest consumers of NASA supercomputing cycles and large simulations of highly resolved full aircraft are routinely undertaken. Typical large problems might require 100s of Cray C90 CPU hours to complete. The dramatic performance gains with the 256 CPU steger system are exciting. Obtaining results in hours instead of months is revolutionizing the way in which aircraft manufacturers are looking at future aircraft simulation work. Figure 2 below is a current state of the art plot of OVERFLOW-MLP performance on the 512 CPU Lomax system. As can be seen, the chart indicates that OVERFLOW-MLP continues to scale linearly with CPU count up to 512 CPUs on a large 35 million point full aircraft RANS simulation. At this point performance is such that a fully converged simulation of 2500 time steps is completed in less than 2 hours of elapsed time. Further work over the next few weeks will improve the performance of this code even further.The LAURA code has been converted to the MLP format as well. This code is currently being optimized for the 512 CPU system. Performance statistics indicate that the goal of 100 GFLOP/s will be achieved by year's end. This amounts to 20x the 16 CPU C90 result and strongly demonstrates the viability of the new parallel systems rapidly solving very large simulations in a production environment.

Fundamentals, current state of the development of, and prospects for further improvement of the new-generation thermal-hydraulic computational HYDRA-IBRAE/LM code for simulation of fast reactor systems

NASA Astrophysics Data System (ADS)

Alipchenkov, V. M.; Anfimov, A. M.; Afremov, D. A.; Gorbunov, V. S.; Zeigarnik, Yu. A.; Kudryavtsev, A. V.; Osipov, S. L.; Mosunova, N. A.; Strizhov, V. F.; Usov, E. V.

2016-02-01

The conceptual fundamentals of the development of the new-generation system thermal-hydraulic computational HYDRA-IBRAE/LM code are presented. The code is intended to simulate the thermalhydraulic processes that take place in the loops and the heat-exchange equipment of liquid-metal cooled fast reactor systems under normal operation and anticipated operational occurrences and during accidents. The paper provides a brief overview of Russian and foreign system thermal-hydraulic codes for modeling liquid-metal coolants and gives grounds for the necessity of development of a new-generation HYDRA-IBRAE/LM code. Considering the specific engineering features of the nuclear power plants (NPPs) equipped with the BN-1200 and the BREST-OD-300 reactors, the processes and the phenomena are singled out that require a detailed analysis and development of the models to be correctly described by the system thermal-hydraulic code in question. Information on the functionality of the computational code is provided, viz., the thermalhydraulic two-phase model, the properties of the sodium and the lead coolants, the closing equations for simulation of the heat-mass exchange processes, the models to describe the processes that take place during the steam-generator tube rupture, etc. The article gives a brief overview of the usability of the computational code, including a description of the support documentation and the supply package, as well as possibilities of taking advantages of the modern computer technologies, such as parallel computations. The paper shows the current state of verification and validation of the computational code; it also presents information on the principles of constructing of and populating the verification matrices for the BREST-OD-300 and the BN-1200 reactor systems. The prospects are outlined for further development of the HYDRA-IBRAE/LM code, introduction of new models into it, and enhancement of its usability. It is shown that the program of development and practical application of the code will allow carrying out in the nearest future the computations to analyze the safety of potential NPP projects at a qualitatively higher level.

Computer optimization of reactor-thermoelectric space power systems

NASA Technical Reports Server (NTRS)

Maag, W. L.; Finnegan, P. M.; Fishbach, L. H.

1973-01-01

A computer simulation and optimization code that has been developed for nuclear space power systems is described. The results of using this code to analyze two reactor-thermoelectric systems are presented.

Potential Effects of Leak-Before-Break on Light Water Reactor Design.

DTIC Science & Technology

1985-08-26

Boiler and Pressure Vessel Code . In fact, section 3 of that code was created for nuclear applications. This... Boiler and Pressure Vessel Code . The only major change which leak-before-break would require in these analyses would be that all piping to be considered...XI of the ASME Boiler and Pressure Vessel Code , and is already required for all Class I piping systems in the plant. Class I systems are those

Simulation realization of 2-D wavelength/time system utilizing MDW code for OCDMA system

NASA Astrophysics Data System (ADS)

Azura, M. S. A.; Rashidi, C. B. M.; Aljunid, S. A.; Endut, R.; Ali, N.

2017-11-01

This paper presents a realization of Wavelength/Time (W/T) Two-Dimensional Modified Double Weight (2-D MDW) code for Optical Code Division Multiple Access (OCDMA) system based on Spectral Amplitude Coding (SAC) approach. The MDW code has the capability to suppress Phase-Induce Intensity Noise (PIIN) and minimizing the Multiple Access Interference (MAI) noises. At the permissible BER 10-9, the 2-D MDW (APD) had shown minimum effective received power (Psr) = -71 dBm that can be obtained at the receiver side as compared to 2-D MDW (PIN) only received -61 dBm. The results show that 2-D MDW (APD) has better performance in achieving same BER with longer optical fiber length and with less received power (Psr). Also, the BER from the result shows that MDW code has the capability to suppress PIIN ad MAI.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Uchibori, Akihiro; Kurihara, Akikazu; Ohshima, Hiroyuki

A multiphysics analysis system for sodium-water reaction phenomena in a steam generator of sodium-cooled fast reactors was newly developed. The analysis system consists of the mechanistic numerical analysis codes, SERAPHIM, TACT, and RELAP5. The SERAPHIM code calculates the multicomponent multiphase flow and sodium-water chemical reaction caused by discharging of pressurized water vapor. Applicability of the SERAPHIM code was confirmed through the analyses of the experiment on water vapor discharging in liquid sodium. The TACT code was developed to calculate heat transfer from the reacting jet to the adjacent tube and to predict the tube failure occurrence. The numerical models integratedmore » into the TACT code were verified through some related experiments. The RELAP5 code evaluates thermal hydraulic behavior of water inside the tube. The original heat transfer correlations were corrected for the tube rapidly heated by the reacting jet. The developed system enables evaluation of the wastage environment and the possibility of the failure propagation.« less

Power optimization of wireless media systems with space-time block codes.

PubMed

Yousefi'zadeh, Homayoun; Jafarkhani, Hamid; Moshfeghi, Mehran

2004-07-01

We present analytical and numerical solutions to the problem of power control in wireless media systems with multiple antennas. We formulate a set of optimization problems aimed at minimizing total power consumption of wireless media systems subject to a given level of QoS and an available bit rate. Our formulation takes into consideration the power consumption related to source coding, channel coding, and transmission of multiple-transmit antennas. In our study, we consider Gauss-Markov and video source models, Rayleigh fading channels along with the Bernoulli/Gilbert-Elliott loss models, and space-time block codes.

The Library Systems Act and Rules for Administering the Library Systems Act.

ERIC Educational Resources Information Center

Texas State Library, Austin. Library Development Div.

This document contains the Texas Library Systems Act and rules for administering the Library Systems Act. Specifically, it includes the following documents: Texas Library Systems Act; Summary of Codes;Texas Administrative Code: Service Complaints and Protest Procedure; Criteria For Texas Library System Membership; and Certification Requirements…

TFaNS Tone Fan Noise Design/Prediction System. Volume 3; Evaluation of System Codes

NASA Technical Reports Server (NTRS)

Topol, David A.

1999-01-01

TFANS is the Tone Fan Noise Design/Prediction System developed by Pratt & Whitney under contract to NASA Lewis (presently NASA Glenn). The purpose of this system is to predict tone noise emanating from a fan stage including the effects of reflection and transmission by the rotor and stator and by the duct inlet and nozzle. These effects have been added to an existing annular duct/isolated stator noise prediction capability. TFANS consists of: The codes that compute the acoustic properties (reflection and transmission coefficients) of the various elements and write them to files. Cup3D: Fan Noise Coupling Code that reads these files, solves the coupling problem, and outputs the desired noise predictions. AWAKEN: CFD/Measured Wake Postprocessor which reformats CFD wake predictions and/or measured wake data so it can be used by the system. This volume of the report evaluates TFANS versus full-scale and ADP 22" fig data using the semi-empirical wake modelling in the system. This report is divided into three volumes: Volume 1: System Description, CUP3D Technical Documentation, and Manual for Code Developers; Volume II: User's Manual, TFANS Version 1.4; Volume III: Evaluation of System Codes.

The effect of total noise on two-dimension OCDMA codes

NASA Astrophysics Data System (ADS)

Dulaimi, Layth A. Khalil Al; Badlishah Ahmed, R.; Yaakob, Naimah; Aljunid, Syed A.; Matem, Rima

2017-11-01

In this research, we evaluate the performance of total noise effect on two dimension (2-D) optical code-division multiple access (OCDMA) performance systems using 2-D Modified Double Weight MDW under various link parameters. The impact of the multi-access interference (MAI) and other noise effect on the system performance. The 2-D MDW is compared mathematically with other codes which use similar techniques. We analyzed and optimized the data rate and effective receive power. The performance and optimization of MDW code in OCDMA system are reported, the bit error rate (BER) can be significantly improved when the 2-D MDW code desired parameters are selected especially the cross correlation properties. It reduces the MAI in the system compensate BER and phase-induced intensity noise (PIIN) in incoherent OCDMA The analysis permits a thorough understanding of PIIN, shot and thermal noises impact on 2-D MDW OCDMA system performance. PIIN is the main noise factor in the OCDMA network.

Pediatric complex chronic conditions classification system version 2: updated for ICD-10 and complex medical technology dependence and transplantation

PubMed Central

2014-01-01

Background The pediatric complex chronic conditions (CCC) classification system, developed in 2000, requires revision to accommodate the International Classification of Disease 10th Revision (ICD-10). To update the CCC classification system, we incorporated ICD-9 diagnostic codes that had been either omitted or incorrectly specified in the original system, and then translated between ICD-9 and ICD-10 using General Equivalence Mappings (GEMs). We further reviewed all codes in the ICD-9 and ICD-10 systems to include both diagnostic and procedural codes indicative of technology dependence or organ transplantation. We applied the provisional CCC version 2 (v2) system to death certificate information and 2 databases of health utilization, reviewed the resulting CCC classifications, and corrected any misclassifications. Finally, we evaluated performance of the CCC v2 system by assessing: 1) the stability of the system between ICD-9 and ICD-10 codes using data which included both ICD-9 codes and ICD-10 codes; 2) the year-to-year stability before and after ICD-10 implementation; and 3) the proportions of patients classified as having a CCC in both the v1 and v2 systems. Results The CCC v2 classification system consists of diagnostic and procedural codes that incorporate a new neonatal CCC category as well as domains of complexity arising from technology dependence or organ transplantation. CCC v2 demonstrated close comparability between ICD-9 and ICD-10 and did not detect significant discontinuity in temporal trends of death in the United States. Compared to the original system, CCC v2 resulted in a 1.0% absolute (10% relative) increase in the number of patients identified as having a CCC in national hospitalization dataset, and a 0.4% absolute (24% relative) increase in a national emergency department dataset. Conclusions The updated CCC v2 system is comprehensive and multidimensional, and provides a necessary update to accommodate widespread implementation of ICD-10. PMID:25102958

Matrix-Product-State Algorithm for Finite Fractional Quantum Hall Systems

NASA Astrophysics Data System (ADS)

Liu, Zhao; Bhatt, R. N.

2015-09-01

Exact diagonalization is a powerful tool to study fractional quantum Hall (FQH) systems. However, its capability is limited by the exponentially increasing computational cost. In order to overcome this difficulty, density-matrix-renormalization-group (DMRG) algorithms were developed for much larger system sizes. Very recently, it was realized that some model FQH states have exact matrix-product-state (MPS) representation. Motivated by this, here we report a MPS code, which is closely related to, but different from traditional DMRG language, for finite FQH systems on the cylinder geometry. By representing the many-body Hamiltonian as a matrix-product-operator (MPO) and using single-site update and density matrix correction, we show that our code can efficiently search the ground state of various FQH systems. We also compare the performance of our code with traditional DMRG. The possible generalization of our code to infinite FQH systems and other physical systems is also discussed.

Coded DS-CDMA Systems with Iterative Channel Estimation and no Pilot Symbols

DTIC Science & Technology

2010-08-01

ar X iv :1 00 8. 31 96 v1 [ cs .I T ] 1 9 A ug 2 01 0 1 Coded DS - CDMA Systems with Iterative Channel Estimation and no Pilot Symbols Don...sequence code-division multiple-access ( DS - CDMA ) systems with quadriphase-shift keying in which channel estimation, coherent demodulation, and decoding...amplitude, phase, and the interference power spectral density (PSD) due to the combined interference and thermal noise is proposed for DS - CDMA systems

CELCAP: A Computer Model for Cogeneration System Analysis

NASA Technical Reports Server (NTRS)

1985-01-01

A description of the CELCAP cogeneration analysis program is presented. A detailed description of the methodology used by the Naval Civil Engineering Laboratory in developing the CELCAP code and the procedures for analyzing cogeneration systems for a given user are given. The four engines modeled in CELCAP are: gas turbine with exhaust heat boiler, diesel engine with waste heat boiler, single automatic-extraction steam turbine, and back-pressure steam turbine. Both the design point and part-load performances are taken into account in the engine models. The load model describes how the hourly electric and steam demand of the user is represented by 24 hourly profiles. The economic model describes how the annual and life-cycle operating costs that include the costs of fuel, purchased electricity, and operation and maintenance of engines and boilers are calculated. The CELCAP code structure and principal functions of the code are described to how the various components of the code are related to each other. Three examples of the application of the CELCAP code are given to illustrate the versatility of the code. The examples shown represent cases of system selection, system modification, and system optimization.

Validation of a Monte Carlo code system for grid evaluation with interference effect on Rayleigh scattering

NASA Astrophysics Data System (ADS)

Zhou, Abel; White, Graeme L.; Davidson, Rob

2018-02-01

Anti-scatter grids are commonly used in x-ray imaging systems to reduce scatter radiation reaching the image receptor. Anti-scatter grid performance and validation can be simulated through use of Monte Carlo (MC) methods. Our recently reported work has modified existing MC codes resulting in improved performance when simulating x-ray imaging. The aim of this work is to validate the transmission of x-ray photons in grids from the recently reported new MC codes against experimental results and results previously reported in other literature. The results of this work show that the scatter-to-primary ratio (SPR), the transmissions of primary (T p), scatter (T s), and total (T t) radiation determined using this new MC code system have strong agreement with the experimental results and the results reported in the literature. T p, T s, T t, and SPR determined in this new MC simulation code system are valid. These results also show that the interference effect on Rayleigh scattering should not be neglected in both mammographic and general grids’ evaluation. Our new MC simulation code system has been shown to be valid and can be used for analysing and evaluating the designs of grids.

An Overview of the Greyscales Lethality Assessment Methodology

DTIC Science & Technology

2011-01-01

code has already been integrated into the Weapon Systems Division MECA and DUEL missile engagement simulations. It can also be integrated into...incorporated into a variety of simulations. The code has already been integrated into the Weapon Systems Division MECA and DUEL missile engagement...capable of being incorporated into a variety of simulations. The code has already been integrated into the Weapon Systems Division MECA and DUEL missile

Information Retrieval System for Japanese Standard Disease-Code Master Using XML Web Service

PubMed Central

Hatano, Kenji; Ohe, Kazuhiko

2003-01-01

Information retrieval system of Japanese Standard Disease-Code Master Using XML Web Service is developed. XML Web Service is a new distributed processing system by standard internet technologies. With seamless remote method invocation of XML Web Service, users are able to get the latest disease code master information from their rich desktop applications or internet web sites, which refer to this service. PMID:14728364

Model-Driven Engineering: Automatic Code Generation and Beyond

DTIC Science & Technology

2015-03-01

and Weblogic as well as cloud environments such as Mi- crosoft Azure and Amazon Web Services®. Finally, while the generated code has dependencies on...code generation in the context of the full system lifecycle from development to sustainment. Acquisition programs in govern- ment or large commercial...Acquirers are concerned with the full system lifecycle, and they need confidence that the development methods will enable the system to meet the functional

Edge-diffraction effects in RCS predictions and their importance in systems analysis

NASA Astrophysics Data System (ADS)

Friess, W. F.; Klement, D.; Ruppel, M.; Stein, Volker

1996-06-01

In developing RCS prediction codes a variety of physical effects such as the edge diffraction effect have to be considered with the consequence that the computer effort increases considerably. This fact limits the field of application of such codes, especially if the RCS data serve as input parameters for system simulators which very often need these data for a high number of observation angles and/or frequencies. Vice versa the issues of a system analysis can be used to estimate the relevance of physical effects under system viewpoints and to rank them according to their magnitude. This paper tries to evaluate the importance of RCS predictions containing an edge diffracted field for systems analysis. A double dihedral with a strong depolarizing behavior and a generic airplane design containing many arbitrarily oriented edges are used as test structures. Data of the scattered field are generated by the RCS computer code SIGMA with and without including edge diffraction effects. These data are submitted to the code DORA to determine radar range and radar detectibility and to a SAR simulator code to generate SAR imagery. In both cases special scenarios are assumed. The essential features of the computer codes in their current state are described, the results are presented and discussed under systems viewpoints.

Single-channel voice-response-system program documentation volume I : system description

DOT National Transportation Integrated Search

1977-01-01

This report documents the design and implementation of a Voice Response System (VRS) using Adaptive Differential Pulse Code Modulation (ADPCM) voice coding. Implemented on a Digital Equipment Corporation PDP-11/20,R this VRS system supports a single ...

Performance Comparison of Orthogonal and Quasi-orthogonal Codes in Quasi-Synchronous Cellular CDMA Communication

NASA Astrophysics Data System (ADS)

Jos, Sujit; Kumar, Preetam; Chakrabarti, Saswat

Orthogonal and quasi-orthogonal codes are integral part of any DS-CDMA based cellular systems. Orthogonal codes are ideal for use in perfectly synchronous scenario like downlink cellular communication. Quasi-orthogonal codes are preferred over orthogonal codes in the uplink communication where perfect synchronization cannot be achieved. In this paper, we attempt to compare orthogonal and quasi-orthogonal codes in presence of timing synchronization error. This will give insight into the synchronization demands in DS-CDMA systems employing the two classes of sequences. The synchronization error considered is smaller than chip duration. Monte-Carlo simulations have been carried out to verify the analytical and numerical results.

Advanced technology development for image gathering, coding, and processing

NASA Technical Reports Server (NTRS)

Huck, Friedrich O.

1990-01-01

Three overlapping areas of research activities are presented: (1) Information theory and optimal filtering are extended to visual information acquisition and processing. The goal is to provide a comprehensive methodology for quantitatively assessing the end-to-end performance of image gathering, coding, and processing. (2) Focal-plane processing techniques and technology are developed to combine effectively image gathering with coding. The emphasis is on low-level vision processing akin to the retinal processing in human vision. (3) A breadboard adaptive image-coding system is being assembled. This system will be used to develop and evaluate a number of advanced image-coding technologies and techniques as well as research the concept of adaptive image coding.

Optimized iterative decoding method for TPC coded CPM

NASA Astrophysics Data System (ADS)

Ma, Yanmin; Lai, Penghui; Wang, Shilian; Xie, Shunqin; Zhang, Wei

2018-05-01

Turbo Product Code (TPC) coded Continuous Phase Modulation (CPM) system (TPC-CPM) has been widely used in aeronautical telemetry and satellite communication. This paper mainly investigates the improvement and optimization on the TPC-CPM system. We first add the interleaver and deinterleaver to the TPC-CPM system, and then establish an iterative system to iteratively decode. However, the improved system has a poor convergence ability. To overcome this issue, we use the Extrinsic Information Transfer (EXIT) analysis to find the optimal factors for the system. The experiments show our method is efficient to improve the convergence performance.

Increased registration of hypertension and cancer diagnoses after the introduction of a new reimbursement system.

PubMed

Hjerpe, Per; Boström, Kristina Bengtsson; Lindblad, Ulf; Merlo, Juan

2012-12-01

To investigate the impact on ICD coding behaviour of a new case-mix reimbursement system based on coded patient diagnoses. The main hypothesis was that after the introduction of the new system the coding of chronic diseases like hypertension and cancer would increase and the variance in propensity for coding would decrease on both physician and health care centre (HCC) levels. Cross-sectional multilevel logistic regression analyses were performed in periods covering the time before and after the introduction of the new reimbursement system. Skaraborg primary care, Sweden. All patients (n = 76 546 to 79 826) 50 years of age and older visiting 468 to 627 physicians at the 22 public HCCs in five consecutive time periods of one year each. Registered codes for hypertension and cancer diseases in Skaraborg primary care database (SPCD). After the introduction of the new reimbursement system the adjusted prevalence of hypertension and cancer in SPCD increased from 17.4% to 32.2% and from 0.79% to 2.32%, respectively, probably partly due to an increased diagnosis coding of indirect patient contacts. The total variance in the propensity for coding declined simultaneously at the physician level for both diagnosis groups. Changes in the healthcare reimbursement system may directly influence the contents of a research database that retrieves data from clinical practice. This should be taken into account when using such a database for research purposes, and the data should be validated for each diagnosis.

Parallel Grand Canonical Monte Carlo (ParaGrandMC) Simulation Code

NASA Technical Reports Server (NTRS)

Yamakov, Vesselin I.

2016-01-01

This report provides an overview of the Parallel Grand Canonical Monte Carlo (ParaGrandMC) simulation code. This is a highly scalable parallel FORTRAN code for simulating the thermodynamic evolution of metal alloy systems at the atomic level, and predicting the thermodynamic state, phase diagram, chemical composition and mechanical properties. The code is designed to simulate multi-component alloy systems, predict solid-state phase transformations such as austenite-martensite transformations, precipitate formation, recrystallization, capillary effects at interfaces, surface absorption, etc., which can aid the design of novel metallic alloys. While the software is mainly tailored for modeling metal alloys, it can also be used for other types of solid-state systems, and to some degree for liquid or gaseous systems, including multiphase systems forming solid-liquid-gas interfaces.

Hybrid and concatenated coding applications.

NASA Technical Reports Server (NTRS)

Hofman, L. B.; Odenwalder, J. P.

1972-01-01

Results of a study to evaluate the performance and implementation complexity of a concatenated and a hybrid coding system for moderate-speed deep-space applications. It is shown that with a total complexity of less than three times that of the basic Viterbi decoder, concatenated coding improves a constraint length 8 rate 1/3 Viterbi decoding system by 1.1 and 2.6 dB at bit error probabilities of 0.0001 and one hundred millionth, respectively. With a somewhat greater total complexity, the hybrid coding system is shown to obtain a 0.9-dB computational performance improvement over the basic rate 1/3 sequential decoding system. Although substantial, these complexities are much less than those required to achieve the same performances with more complex Viterbi or sequential decoder systems.

A volcanic activity alert-level system for aviation: Review of its development and application in Alaska

USGS Publications Warehouse

Guffanti, Marianne C.; Miller, Thomas

2013-01-01

An alert-level system for communicating volcano hazard information to the aviation industry was devised by the Alaska Volcano Observatory (AVO) during the 1989–1990 eruption of Redoubt Volcano. The system uses a simple, color-coded ranking that focuses on volcanic ash emissions: Green—normal background; Yellow—signs of unrest; Orange—precursory unrest or minor ash eruption; Red—major ash eruption imminent or underway. The color code has been successfully applied on a regional scale in Alaska for a sustained period. During 2002–2011, elevated color codes were assigned by AVO to 13 volcanoes, eight of which erupted; for that decade, one or more Alaskan volcanoes were at Yellow on 67 % of days and at Orange or Red on 12 % of days. As evidence of its utility, the color code system is integrated into procedures of agencies responsible for air-traffic management and aviation meteorology in Alaska. Furthermore, it is endorsed as a key part of globally coordinated protocols established by the International Civil Aviation Organization to provide warnings of ash hazards to aviation worldwide. The color code and accompanying structured message (called a Volcano Observatory Notice for Aviation) comprise an effective early-warning message system according to the United Nations International Strategy for Disaster Reduction. The aviation color code system currently is used in the United States, Russia, New Zealand, Iceland, and partially in the Philippines, Papua New Guinea, and Indonesia. Although there are some barriers to implementation, with continued education and outreach to Volcano Observatories worldwide, greater use of the aviation color code system is achievable.

A volcanic activity alert-level system for aviation: review of its development and application in Alaska

USGS Publications Warehouse

Guffanti, Marianne; Miller, Thomas P.

2013-01-01

An alert-level system for communicating volcano hazard information to the aviation industry was devised by the Alaska Volcano Observatory (AVO) during the 1989–1990 eruption of Redoubt Volcano. The system uses a simple, color-coded ranking that focuses on volcanic ash emissions: Green—normal background; Yellow—signs of unrest; Orange—precursory unrest or minor ash eruption; Red—major ash eruption imminent or underway. The color code has been successfully applied on a regional scale in Alaska for a sustained period. During 2002–2011, elevated color codes were assigned by AVO to 13 volcanoes, eight of which erupted; for that decade, one or more Alaskan volcanoes were at Yellow on 67 % of days and at Orange or Red on 12 % of days. As evidence of its utility, the color code system is integrated into procedures of agencies responsible for air-traffic management and aviation meteorology in Alaska. Furthermore, it is endorsed as a key part of globally coordinated protocols established by the International Civil Aviation Organization to provide warnings of ash hazards to aviation worldwide. The color code and accompanying structured message (called a Volcano Observatory Notice for Aviation) comprise an effective early-warning message system according to the United Nations International Strategy for Disaster Reduction. The aviation color code system currently is used in the United States, Russia, New Zealand, Iceland, and partially in the Philippines, Papua New Guinea, and Indonesia. Although there are some barriers to implementation, with continued education and outreach to Volcano Observatories worldwide, greater use of the aviation color code system is achievable.

Revision, uptake and coding issues related to the open access Orchard Sports Injury Classification System (OSICS) versions 8, 9 and 10.1

PubMed Central

Orchard, John; Rae, Katherine; Brooks, John; Hägglund, Martin; Til, Lluis; Wales, David; Wood, Tim

2010-01-01

The Orchard Sports Injury Classification System (OSICS) is one of the world’s most commonly used systems for coding injury diagnoses in sports injury surveillance systems. Its major strengths are that it has wide usage, has codes specific to sports medicine and that it is free to use. Literature searches and stakeholder consultations were made to assess the uptake of OSICS and to develop new versions. OSICS was commonly used in the sports of football (soccer), Australian football, rugby union, cricket and tennis. It is referenced in international papers in three sports and used in four commercially available computerised injury management systems. Suggested injury categories for the major sports are presented. New versions OSICS 9 (three digit codes) and OSICS 10.1 (four digit codes) are presented. OSICS is a potentially helpful component of a comprehensive sports injury surveillance system, but many other components are required. Choices made in developing these components should ideally be agreed upon by groups of researchers in consensus statements. PMID:24198559

Enhanced fault-tolerant quantum computing in d-level systems.

PubMed

Campbell, Earl T

2014-12-05

Error-correcting codes protect quantum information and form the basis of fault-tolerant quantum computing. Leading proposals for fault-tolerant quantum computation require codes with an exceedingly rare property, a transversal non-Clifford gate. Codes with the desired property are presented for d-level qudit systems with prime d. The codes use n=d-1 qudits and can detect up to ∼d/3 errors. We quantify the performance of these codes for one approach to quantum computation known as magic-state distillation. Unlike prior work, we find performance is always enhanced by increasing d.

Development of an object-oriented ORIGEN for advanced nuclear fuel modeling applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skutnik, S.; Havloej, F.; Lago, D.

2013-07-01

The ORIGEN package serves as the core depletion and decay calculation module within the SCALE code system. A recent major re-factor to the ORIGEN code architecture as part of an overall modernization of the SCALE code system has both greatly enhanced its maintainability as well as afforded several new capabilities useful for incorporating depletion analysis into other code frameworks. This paper will present an overview of the improved ORIGEN code architecture (including the methods and data structures introduced) as well as current and potential future applications utilizing the new ORIGEN framework. (authors)

National Underground Mines Inventory

DTIC Science & Technology

1983-10-01

system is well designed to minimize water accumulation on the drift levels. In many areas, sufficient water has accumulated to make the use of boots a...four characters designate Field office. 17-18 State Code Pic 99 FIPS code for state in which minets located. 19-21 County Code Plc 999 FIPS code for... Designate a general product class based onSIC code. 28-29 Nine Type Plc 99 Natal/Nonmetal mine type code. Based on subunit operations code and canvass code

Efficient Signal, Code, and Receiver Designs for MIMO Communication Systems

DTIC Science & Technology

2003-06-01

167 5-31 Concatenation of a tilted-QAM inner code with an LDPC outer code with a two component iterative soft-decision decoder. . . . . . . . . 168 5...for AWGN channels has long been studied. There are well-known soft-decision codes like the turbo codes and LDPC codes that can approach capacity to...bits) low density parity check ( LDPC ) code 1. 2. The coded bits are randomly interleaved so that bits nearby go through different sub-channels, and are

Computer Code Aids Design Of Wings

NASA Technical Reports Server (NTRS)

Carlson, Harry W.; Darden, Christine M.

1993-01-01

AERO2S computer code developed to aid design engineers in selection and evaluation of aerodynamically efficient wing/canard and wing/horizontal-tail configurations that includes simple hinged-flap systems. Code rapidly estimates longitudinal aerodynamic characteristics of conceptual airplane lifting-surface arrangements. Developed in FORTRAN V on CDC 6000 computer system, and ported to MS-DOS environment.

Flexible Generation of Kalman Filter Code

NASA Technical Reports Server (NTRS)

Richardson, Julian; Wilson, Edward

2006-01-01

Domain-specific program synthesis can automatically generate high quality code in complex domains from succinct specifications, but the range of programs which can be generated by a given synthesis system is typically narrow. Obtaining code which falls outside this narrow scope necessitates either 1) extension of the code generator, which is usually very expensive, or 2) manual modification of the generated code, which is often difficult and which must be redone whenever changes are made to the program specification. In this paper, we describe adaptations and extensions of the AUTOFILTER Kalman filter synthesis system which greatly extend the range of programs which can be generated. Users augment the input specification with a specification of code fragments and how those fragments should interleave with or replace parts of the synthesized filter. This allows users to generate a much wider range of programs without their needing to modify the synthesis system or edit generated code. We demonstrate the usefulness of the approach by applying it to the synthesis of a complex state estimator which combines code from several Kalman filters with user-specified code. The work described in this paper allows the complex design decisions necessary for real-world applications to be reflected in the synthesized code. When executed on simulated input data, the generated state estimator was found to produce comparable estimates to those produced by a handcoded estimator

Galen-In-Use: using artificial intelligence terminology tools to improve the linguistic coherence of a national coding system for surgical procedures.

PubMed

Rodrigues, J M; Trombert-Paviot, B; Baud, R; Wagner, J; Meusnier-Carriot, F

1998-01-01

GALEN has developed a language independent common reference model based on a medically oriented ontology and practical tools and techniques for managing healthcare terminology including natural language processing. GALEN-IN-USE is the current phase which applied the modelling and the tools to the development or the updating of coding systems for surgical procedures in different national coding centers co-operating within the European Federation of Coding Centre (EFCC) to create a language independent knowledge repository for multicultural Europe. We used an integrated set of artificial intelligence terminology tools named CLAssification Manager workbench to process French professional medical language rubrics into intermediate dissections and to the Grail reference ontology model representation. From this language independent concept model representation we generate controlled French natural language. The French national coding centre is then able to retrieve the initial professional rubrics with different categories of concepts, to compare the professional language proposed by expert clinicians to the French generated controlled vocabulary and to finalize the linguistic labels of the coding system in relation with the meanings of the conceptual system structure.

Code-modulated interferometric imaging system using phased arrays

NASA Astrophysics Data System (ADS)

Chauhan, Vikas; Greene, Kevin; Floyd, Brian

2016-05-01

Millimeter-wave (mm-wave) imaging provides compelling capabilities for security screening, navigation, and bio- medical applications. Traditional scanned or focal-plane mm-wave imagers are bulky and costly. In contrast, phased-array hardware developed for mass-market wireless communications and automotive radar promise to be extremely low cost. In this work, we present techniques which can allow low-cost phased-array receivers to be reconfigured or re-purposed as interferometric imagers, removing the need for custom hardware and thereby reducing cost. Since traditional phased arrays power combine incoming signals prior to digitization, orthogonal code-modulation is applied to each incoming signal using phase shifters within each front-end and two-bit codes. These code-modulated signals can then be combined and processed coherently through a shared hardware path. Once digitized, visibility functions can be recovered through squaring and code-demultiplexing operations. Pro- vided that codes are selected such that the product of two orthogonal codes is a third unique and orthogonal code, it is possible to demultiplex complex visibility functions directly. As such, the proposed system modulates incoming signals but demodulates desired correlations. In this work, we present the operation of the system, a validation of its operation using behavioral models of a traditional phased array, and a benchmarking of the code-modulated interferometer against traditional interferometer and focal-plane arrays.

DNA Barcoding through Quaternary LDPC Codes

PubMed Central

Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

2015-01-01

For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10−2 per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10−9 at the expense of a rate of read losses just in the order of 10−6. PMID:26492348

DNA Barcoding through Quaternary LDPC Codes.

PubMed

Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

2015-01-01

For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2) per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9) at the expense of a rate of read losses just in the order of 10(-6).

Automated Coding Software: Development and Use to Enhance Anti-Fraud Activities*

PubMed Central

Garvin, Jennifer H.; Watzlaf, Valerie; Moeini, Sohrab

2006-01-01

This descriptive research project identified characteristics of automated coding systems that have the potential to detect improper coding and to minimize improper or fraudulent coding practices in the setting of automated coding used with the electronic health record (EHR). Recommendations were also developed for software developers and users of coding products to maximize anti-fraud practices. PMID:17238546

An approach to the origin of self-replicating system. I - Intermolecular interactions

NASA Technical Reports Server (NTRS)

Macelroy, R. D.; Coeckelenbergh, Y.; Rein, R.

1978-01-01

The present paper deals with the characteristics and potentialities of a recently developed computer-based molecular modeling system. Some characteristics of current coding systems are examined and are extrapolated to the apparent requirements of primitive prebiological coding systems.

EBT reactor systems analysis and cost code: description and users guide (Version 1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santoro, R.T.; Uckan, N.A.; Barnes, J.M.

1984-06-01

An ELMO Bumpy Torus (EBT) reactor systems analysis and cost code that incorporates the most recent advances in EBT physics has been written. The code determines a set of reactors that fall within an allowed operating window determined from the coupling of ring and core plasma properties and the self-consistent treatment of the coupled ring-core stability and power balance requirements. The essential elements of the systems analysis and cost code are described, along with the calculational sequences leading to the specification of the reactor options and their associated costs. The input parameters, the constraints imposed upon them, and the operatingmore » range over which the code provides valid results are discussed. A sample problem and the interpretation of the results are also presented.« less

Children's Behavior in the Postanesthesia Care Unit: The Development of the Child Behavior Coding System-PACU (CBCS-P)

PubMed Central

Tan, Edwin T.; Martin, Sarah R.; Fortier, Michelle A.; Kain, Zeev N.

2012-01-01

Objective To develop and validate a behavioral coding measure, the Children's Behavior Coding System-PACU (CBCS-P), for children's distress and nondistress behaviors while in the postanesthesia recovery unit. Methods A multidisciplinary team examined videotapes of children in the PACU and developed a coding scheme that subsequently underwent a refinement process (CBCS-P). To examine the reliability and validity of the coding system, 121 children and their parents were videotaped during their stay in the PACU. Participants were healthy children undergoing elective, outpatient surgery and general anesthesia. The CBCS-P was utilized and objective data from medical charts (analgesic consumption and pain scores) were extracted to establish validity. Results Kappa values indicated good-to-excellent (κ's > .65) interrater reliability of the individual codes. The CBCS-P had good criterion validity when compared to children's analgesic consumption and pain scores. Conclusions The CBCS-P is a reliable, observational coding method that captures children's distress and nondistress postoperative behaviors. These findings highlight the importance of considering context in both the development and application of observational coding schemes. PMID:22167123

Introduction to the Natural Anticipator and the Artificial Anticipator

NASA Astrophysics Data System (ADS)

Dubois, Daniel M.

2010-11-01

This short communication deals with the introduction of the concept of anticipator, which is one who anticipates, in the framework of computing anticipatory systems. The definition of anticipation deals with the concept of program. Indeed, the word program, comes from "pro-gram" meaning "to write before" by anticipation, and means a plan for the programming of a mechanism, or a sequence of coded instructions that can be inserted into a mechanism, or a sequence of coded instructions, as genes or behavioural responses, that is part of an organism. Any natural or artificial programs are thus related to anticipatory rewriting systems, as shown in this paper. All the cells in the body, and the neurons in the brain, are programmed by the anticipatory genetic code, DNA, in a low-level language with four signs. The programs in computers are also computing anticipatory systems. It will be shown, at one hand, that the genetic code DNA is a natural anticipator. As demonstrated by Nobel laureate McClintock [8], genomes are programmed. The fundamental program deals with the DNA genetic code. The properties of the DNA consist in self-replication and self-modification. The self-replicating process leads to reproduction of the species, while the self-modifying process leads to new species or evolution and adaptation in existing ones. The genetic code DNA keeps its instructions in memory in the DNA coding molecule. The genetic code DNA is a rewriting system, from DNA coding to DNA template molecule. The DNA template molecule is a rewriting system to the Messenger RNA molecule. The information is not destroyed during the execution of the rewriting program. On the other hand, it will be demonstrated that Turing machine is an artificial anticipator. The Turing machine is a rewriting system. The head reads and writes, modifying the content of the tape. The information is destroyed during the execution of the program. This is an irreversible process. The input data are lost.

77 FR 74456 - Notice of Proposed Changes to the National Handbook of Conservation Practices for the Natural...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-14

...), Row Arrangement (Code 557), Sprinkler System (Code 442), Tree/Shrub Site Preparation (Code 490), Waste.... Tree/Shrub Site Preparation (Code 490)--Only minor changes were made to the standard including...

Qualitative assessment of cause-of-injury coding in U.S. military hospitals: NATO standardization agreement (STANAG) 2050.

PubMed

Amoroso, P J; Smith, G S; Bell, N S

2000-04-01

Accurate injury cause data are essential for injury prevention research. U.S. military hospitals, unlike civilian hospitals, use the NATO STANAG system for cause-of-injury coding. Reported deficiencies in civilian injury cause data suggested a need to specifically evaluate the STANAG. The Total Army Injury and Health Outcomes Database (TAIHOD) was used to evaluate worldwide Army injury hospitalizations, especially STANAG Trauma, Injury, and Place of Occurrence coding. We conducted a review of hospital procedures at Tripler Army Medical Center (TAMC) including injury cause and intent coding, potential crossover between acute injuries and musculoskeletal conditions, and data for certain hospital patients who are not true admissions. We also evaluated the use of free-text injury comment fields in three hospitals. Army-wide review of injury records coding revealed full compliance with cause coding, although nonspecific codes appeared to be overused. A small but intensive single hospital records review revealed relatively poor intent coding but good activity and cause coding. Data on specific injury history were present on most acute injury records and 75% of musculoskeletal conditions. Place of Occurrence coding, although inherently nonspecific, was over 80% accurate. Review of text fields produced additional details of the injuries in over 80% of cases. STANAG intent coding specificity was poor, while coding of cause of injury was at least comparable to civilian systems. The strengths of military hospital data systems are an exceptionally high compliance with injury cause coding, the availability of free text, and capture of all population hospital records without regard to work-relatedness. Simple changes in procedures could greatly improve data quality.

Design and Simulation of Material-Integrated Distributed Sensor Processing with a Code-Based Agent Platform and Mobile Multi-Agent Systems

PubMed Central

Bosse, Stefan

2015-01-01

Multi-agent systems (MAS) can be used for decentralized and self-organizing data processing in a distributed system, like a resource-constrained sensor network, enabling distributed information extraction, for example, based on pattern recognition and self-organization, by decomposing complex tasks in simpler cooperative agents. Reliable MAS-based data processing approaches can aid the material-integration of structural-monitoring applications, with agent processing platforms scaled to the microchip level. The agent behavior, based on a dynamic activity-transition graph (ATG) model, is implemented with program code storing the control and the data state of an agent, which is novel. The program code can be modified by the agent itself using code morphing techniques and is capable of migrating in the network between nodes. The program code is a self-contained unit (a container) and embeds the agent data, the initialization instructions and the ATG behavior implementation. The microchip agent processing platform used for the execution of the agent code is a standalone multi-core stack machine with a zero-operand instruction format, leading to a small-sized agent program code, low system complexity and high system performance. The agent processing is token-queue-based, similar to Petri-nets. The agent platform can be implemented in software, too, offering compatibility at the operational and code level, supporting agent processing in strong heterogeneous networks. In this work, the agent platform embedded in a large-scale distributed sensor network is simulated at the architectural level by using agent-based simulation techniques. PMID:25690550

Efficient coding and detection of ultra-long IDs for visible light positioning systems.

PubMed

Zhang, Hualong; Yang, Chuanchuan

2018-05-14

Visible light positioning (VLP) is a promising technique to complement Global Navigation Satellite System (GNSS) such as Global positioning system (GPS) and BeiDou Navigation Satellite System (BDS) which features the advantage of low-cost and high accuracy. The situation becomes even more crucial for indoor environments, where satellite signals are weak or even unavailable. For large-scale application of VLP, there would be a considerable number of Light emitting diode (LED) IDs, which bring forward the demand of long LED ID detection. In particular, to provision indoor localization globally, a convenient way is to program a unique ID into each LED during manufacture. This poses a big challenge for image sensors, such as the CMOS camera in everybody's hands since the long ID covers the span of multiple frames. In this paper, we investigate the detection of ultra-long ID using rolling shutter cameras. By analyzing the pattern of data loss in each frame, we proposed a novel coding technique to improve the efficiency of LED ID detection. We studied the performance of Reed-Solomon (RS) code in this system and designed a new coding method which considered the trade-off between performance and decoding complexity. Coding technique decreases the number of frames needed in data processing, significantly reduces the detection time, and improves the accuracy of detection. Numerical and experimental results show that the detected LED ID can be much longer with the coding technique. Besides, our proposed coding method is proved to achieve a performance close to that of RS code while the decoding complexity is much lower.

Design and simulation of material-integrated distributed sensor processing with a code-based agent platform and mobile multi-agent systems.

PubMed

Bosse, Stefan

2015-02-16

Multi-agent systems (MAS) can be used for decentralized and self-organizing data processing in a distributed system, like a resource-constrained sensor network, enabling distributed information extraction, for example, based on pattern recognition and self-organization, by decomposing complex tasks in simpler cooperative agents. Reliable MAS-based data processing approaches can aid the material-integration of structural-monitoring applications, with agent processing platforms scaled to the microchip level. The agent behavior, based on a dynamic activity-transition graph (ATG) model, is implemented with program code storing the control and the data state of an agent, which is novel. The program code can be modified by the agent itself using code morphing techniques and is capable of migrating in the network between nodes. The program code is a self-contained unit (a container) and embeds the agent data, the initialization instructions and the ATG behavior implementation. The microchip agent processing platform used for the execution of the agent code is a standalone multi-core stack machine with a zero-operand instruction format, leading to a small-sized agent program code, low system complexity and high system performance. The agent processing is token-queue-based, similar to Petri-nets. The agent platform can be implemented in software, too, offering compatibility at the operational and code level, supporting agent processing in strong heterogeneous networks. In this work, the agent platform embedded in a large-scale distributed sensor network is simulated at the architectural level by using agent-based simulation techniques.

SU-E-T-493: Accelerated Monte Carlo Methods for Photon Dosimetry Using a Dual-GPU System and CUDA.

PubMed

Liu, T; Ding, A; Xu, X

2012-06-01

To develop a Graphics Processing Unit (GPU) based Monte Carlo (MC) code that accelerates dose calculations on a dual-GPU system. We simulated a clinical case of prostate cancer treatment. A voxelized abdomen phantom derived from 120 CT slices was used containing 218×126×60 voxels, and a GE LightSpeed 16-MDCT scanner was modeled. A CPU version of the MC code was first developed in C++ and tested on Intel Xeon X5660 2.8GHz CPU, then it was translated into GPU version using CUDA C 4.1 and run on a dual Tesla m 2 090 GPU system. The code was featured with automatic assignment of simulation task to multiple GPUs, as well as accurate calculation of energy- and material- dependent cross-sections. Double-precision floating point format was used for accuracy. Doses to the rectum, prostate, bladder and femoral heads were calculated. When running on a single GPU, the MC GPU code was found to be ×19 times faster than the CPU code and ×42 times faster than MCNPX. These speedup factors were doubled on the dual-GPU system. The dose Result was benchmarked against MCNPX and a maximum difference of 1% was observed when the relative error is kept below 0.1%. A GPU-based MC code was developed for dose calculations using detailed patient and CT scanner models. Efficiency and accuracy were both guaranteed in this code. Scalability of the code was confirmed on the dual-GPU system. © 2012 American Association of Physicists in Medicine.

SCALE: A modular code system for performing Standardized Computer Analyses for Licensing Evaluation. Volume 1, Part 2: Control modules S1--H1; Revision 5

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

SCALE--a modular code system for Standardized Computer Analyses Licensing Evaluation--has been developed by Oak Ridge National Laboratory at the request of the US Nuclear Regulatory Commission. The SCALE system utilizes well-established computer codes and methods within standard analysis sequences that (1) allow an input format designed for the occasional user and/or novice, (2) automated the data processing and coupling between modules, and (3) provide accurate and reliable results. System development has been directed at problem-dependent cross-section processing and analysis of criticality safety, shielding, heat transfer, and depletion/decay problems. Since the initial release of SCALE in 1980, the code system hasmore » been heavily used for evaluation of nuclear fuel facility and package designs. This revision documents Version 4.3 of the system.« less

Study of an External Neutron Source for an Accelerator-Driven System using the PHITS Code

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugawara, Takanori; Iwasaki, Tomohiko; Chiba, Takashi

A code system for the Accelerator Driven System (ADS) has been under development for analyzing dynamic behaviors of a subcritical core coupled with an accelerator. This code system named DSE (Dynamics calculation code system for a Subcritical system with an External neutron source) consists of an accelerator part and a reactor part. The accelerator part employs a database, which is calculated by using PHITS, for investigating the effect related to the accelerator such as the changes of beam energy, beam diameter, void generation, and target level. This analysis method using the database may introduce some errors into dynamics calculations sincemore » the neutron source data derived from the database has some errors in fitting or interpolating procedures. In this study, the effects of various events are investigated to confirm that the method based on the database is appropriate.« less

Modification of LAMPF's magnet-mapping code for offsets of center coordinates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hurd, J.W.; Gomulka, S.; Merrill, F.

1991-01-01

One of the magnet measurements performed at LAMPF is the determination of the cylindrical harmonics of a quadrupole magnet using a rotating coil. The data are analyzed with the code HARMAL to derive the amplitudes of the harmonics. Initially, the origin of the polar coordinate system is the axis of the rotating coil. A new coordinate system is found by a simple translation of the old system such that the dipole moment in the new system is zero. The origin of this translated system is referred to as the magnetic center. Given this translation, the code calculates the coefficients ofmore » the cylindrical harmonics in the new system. The code has been modified to use an analytical calculation to determine these new coefficients. The method of calculation is described and some implications of this formulation are presented. 8 refs., 2 figs.« less

Interface requirements to couple thermal-hydraulic codes to 3D neutronic codes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langenbuch, S.; Austregesilo, H.; Velkov, K.

1997-07-01

The present situation of thermalhydraulics codes and 3D neutronics codes is briefly described and general considerations for coupling of these codes are discussed. Two different basic approaches of coupling are identified and their relative advantages and disadvantages are discussed. The implementation of the coupling for 3D neutronics codes in the system ATHLET is presented. Meanwhile, this interface is used for coupling three different 3D neutronics codes.

Comparison of PSF maxima and minima of multiple annuli coded aperture (MACA) and complementary multiple annuli coded aperture (CMACA) systems

NASA Astrophysics Data System (ADS)

Ratnam, Challa; Lakshmana Rao, Vadlamudi; Lachaa Goud, Sivagouni

2006-10-01

In the present paper, and a series of papers to follow, the Fourier analytical properties of multiple annuli coded aperture (MACA) and complementary multiple annuli coded aperture (CMACA) systems are investigated. First, the transmission function for MACA and CMACA is derived using Fourier methods and, based on the Fresnel-Kirchoff diffraction theory, the formulae for the point spread function are formulated. The PSF maxima and minima are calculated for both the MACA and CMACA systems. The dependence of these properties on the number of zones is studied and reported in this paper.

Low complexity Reed-Solomon-based low-density parity-check design for software defined optical transmission system based on adaptive puncturing decoding algorithm

NASA Astrophysics Data System (ADS)

Pan, Xiaolong; Liu, Bo; Zheng, Jianglong; Tian, Qinghua

2016-08-01

We propose and demonstrate a low complexity Reed-Solomon-based low-density parity-check (RS-LDPC) code with adaptive puncturing decoding algorithm for elastic optical transmission system. Partial received codes and the relevant column in parity-check matrix can be punctured to reduce the calculation complexity by adaptive parity-check matrix during decoding process. The results show that the complexity of the proposed decoding algorithm is reduced by 30% compared with the regular RS-LDPC system. The optimized code rate of the RS-LDPC code can be obtained after five times iteration.

Coding performance of the Probe-Orbiter-Earth communication link

NASA Technical Reports Server (NTRS)

Divsalar, D.; Dolinar, S.; Pollara, F.

1993-01-01

The coding performance of the Probe-Orbiter-Earth communication link is analyzed and compared for several cases. It is assumed that the coding system consists of a convolutional code at the Probe, a quantizer and another convolutional code at the Orbiter, and two cascaded Viterbi decoders or a combined decoder on the ground.

A Verification-Driven Approach to Traceability and Documentation for Auto-Generated Mathematical Software

NASA Technical Reports Server (NTRS)

Denney, Ewen W.; Fischer, Bernd

2009-01-01

Model-based development and automated code generation are increasingly used for production code in safety-critical applications, but since code generators are typically not qualified, the generated code must still be fully tested, reviewed, and certified. This is particularly arduous for mathematical and control engineering software which requires reviewers to trace subtle details of textbook formulas and algorithms to the code, and to match requirements (e.g., physical units or coordinate frames) not represented explicitly in models or code. Both tasks are complicated by the often opaque nature of auto-generated code. We address these problems by developing a verification-driven approach to traceability and documentation. We apply the AUTOCERT verification system to identify and then verify mathematical concepts in the code, based on a mathematical domain theory, and then use these verified traceability links between concepts, code, and verification conditions to construct a natural language report that provides a high-level structured argument explaining why and how the code uses the assumptions and complies with the requirements. We have applied our approach to generate review documents for several sub-systems of NASA s Project Constellation.

A good performance watermarking LDPC code used in high-speed optical fiber communication system

NASA Astrophysics Data System (ADS)

Zhang, Wenbo; Li, Chao; Zhang, Xiaoguang; Xi, Lixia; Tang, Xianfeng; He, Wenxue

2015-07-01

A watermarking LDPC code, which is a strategy designed to improve the performance of the traditional LDPC code, was introduced. By inserting some pre-defined watermarking bits into original LDPC code, we can obtain a more correct estimation about the noise level in the fiber channel. Then we use them to modify the probability distribution function (PDF) used in the initial process of belief propagation (BP) decoding algorithm. This algorithm was tested in a 128 Gb/s PDM-DQPSK optical communication system and results showed that the watermarking LDPC code had a better tolerances to polarization mode dispersion (PMD) and nonlinearity than that of traditional LDPC code. Also, by losing about 2.4% of redundancy for watermarking bits, the decoding efficiency of the watermarking LDPC code is about twice of the traditional one.

Comparison of procedure coding systems for level 1 and 2 hospitals in South Africa.

PubMed

Montewa, Lebogang; Hanmer, Lyn; Reagon, Gavin

2013-01-01

The ability of three procedure coding systems to reflect the procedure concepts extracted from patient records from six hospitals was compared, in order to inform decision making about a procedure coding standard for South Africa. A convenience sample of 126 procedure concepts was extracted from patient records at three level 1 hospitals and three level 2 hospitals. Each procedure concept was coded using ICPC-2, ICD-9-CM, and CCSA-2001. The extent to which each code assigned actually reflected the procedure concept was evaluated (between 'no match' and 'complete match'). For the study sample, CCSA-2001 was found to reflect the procedure concepts most completely, followed by ICD-9-CM and then ICPC-2. In practice, decision making about procedure coding standards would depend on multiple factors in addition to coding accuracy.

A Mechanism to Avoid Collusion Attacks Based on Code Passing in Mobile Agent Systems

NASA Astrophysics Data System (ADS)

Jaimez, Marc; Esparza, Oscar; Muñoz, Jose L.; Alins-Delgado, Juan J.; Mata-Díaz, Jorge

Mobile agents are software entities consisting of code, data, state and itinerary that can migrate autonomously from host to host executing their code. Despite its benefits, security issues strongly restrict the use of code mobility. The protection of mobile agents against the attacks of malicious hosts is considered the most difficult security problem to solve in mobile agent systems. In particular, collusion attacks have been barely studied in the literature. This paper presents a mechanism that avoids collusion attacks based on code passing. Our proposal is based on a Multi-Code agent, which contains a different variant of the code for each host. A Trusted Third Party is responsible for providing the information to extract its own variant to the hosts, and for taking trusted timestamps that will be used to verify time coherence.

Coded spread spectrum digital transmission system design study

NASA Technical Reports Server (NTRS)

Heller, J. A.; Odenwalder, J. P.; Viterbi, A. J.

1974-01-01

Results are presented of a comprehensive study of the performance of Viterbi-decoded convolutional codes in the presence of nonideal carrier tracking and bit synchronization. A constraint length 7, rate 1/3 convolutional code and parameters suitable for the space shuttle coded communications links are used. Mathematical models are developed and theoretical and simulation results are obtained to determine the tracking and acquisition performance of the system. Pseudorandom sequence spread spectrum techniques are also considered to minimize potential degradation caused by multipath.

SORTA: a system for ontology-based re-coding and technical annotation of biomedical phenotype data.

PubMed

Pang, Chao; Sollie, Annet; Sijtsma, Anna; Hendriksen, Dennis; Charbon, Bart; de Haan, Mark; de Boer, Tommy; Kelpin, Fleur; Jetten, Jonathan; van der Velde, Joeri K; Smidt, Nynke; Sijmons, Rolf; Hillege, Hans; Swertz, Morris A

2015-01-01

There is an urgent need to standardize the semantics of biomedical data values, such as phenotypes, to enable comparative and integrative analyses. However, it is unlikely that all studies will use the same data collection protocols. As a result, retrospective standardization is often required, which involves matching of original (unstructured or locally coded) data to widely used coding or ontology systems such as SNOMED CT (clinical terms), ICD-10 (International Classification of Disease) and HPO (Human Phenotype Ontology). This data curation process is usually a time-consuming process performed by a human expert. To help mechanize this process, we have developed SORTA, a computer-aided system for rapidly encoding free text or locally coded values to a formal coding system or ontology. SORTA matches original data values (uploaded in semicolon delimited format) to a target coding system (uploaded in Excel spreadsheet, OWL ontology web language or OBO open biomedical ontologies format). It then semi- automatically shortlists candidate codes for each data value using Lucene and n-gram based matching algorithms, and can also learn from matches chosen by human experts. We evaluated SORTA's applicability in two use cases. For the LifeLines biobank, we used SORTA to recode 90 000 free text values (including 5211 unique values) about physical exercise to MET (Metabolic Equivalent of Task) codes. For the CINEAS clinical symptom coding system, we used SORTA to map to HPO, enriching HPO when necessary (315 terms matched so far). Out of the shortlists at rank 1, we found a precision/recall of 0.97/0.98 in LifeLines and of 0.58/0.45 in CINEAS. More importantly, users found the tool both a major time saver and a quality improvement because SORTA reduced the chances of human mistakes. Thus, SORTA can dramatically ease data (re)coding tasks and we believe it will prove useful for many more projects. Database URL: http://molgenis.org/sorta or as an open source download from http://www.molgenis.org/wiki/SORTA. © The Author(s) 2015. Published by Oxford University Press.

SORTA: a system for ontology-based re-coding and technical annotation of biomedical phenotype data

PubMed Central

Pang, Chao; Sollie, Annet; Sijtsma, Anna; Hendriksen, Dennis; Charbon, Bart; de Haan, Mark; de Boer, Tommy; Kelpin, Fleur; Jetten, Jonathan; van der Velde, Joeri K.; Smidt, Nynke; Sijmons, Rolf; Hillege, Hans; Swertz, Morris A.

2015-01-01

There is an urgent need to standardize the semantics of biomedical data values, such as phenotypes, to enable comparative and integrative analyses. However, it is unlikely that all studies will use the same data collection protocols. As a result, retrospective standardization is often required, which involves matching of original (unstructured or locally coded) data to widely used coding or ontology systems such as SNOMED CT (clinical terms), ICD-10 (International Classification of Disease) and HPO (Human Phenotype Ontology). This data curation process is usually a time-consuming process performed by a human expert. To help mechanize this process, we have developed SORTA, a computer-aided system for rapidly encoding free text or locally coded values to a formal coding system or ontology. SORTA matches original data values (uploaded in semicolon delimited format) to a target coding system (uploaded in Excel spreadsheet, OWL ontology web language or OBO open biomedical ontologies format). It then semi- automatically shortlists candidate codes for each data value using Lucene and n-gram based matching algorithms, and can also learn from matches chosen by human experts. We evaluated SORTA’s applicability in two use cases. For the LifeLines biobank, we used SORTA to recode 90 000 free text values (including 5211 unique values) about physical exercise to MET (Metabolic Equivalent of Task) codes. For the CINEAS clinical symptom coding system, we used SORTA to map to HPO, enriching HPO when necessary (315 terms matched so far). Out of the shortlists at rank 1, we found a precision/recall of 0.97/0.98 in LifeLines and of 0.58/0.45 in CINEAS. More importantly, users found the tool both a major time saver and a quality improvement because SORTA reduced the chances of human mistakes. Thus, SORTA can dramatically ease data (re)coding tasks and we believe it will prove useful for many more projects. Database URL: http://molgenis.org/sorta or as an open source download from http://www.molgenis.org/wiki/SORTA PMID:26385205

Fault tolerant computing: A preamble for assuring viability of large computer systems

NASA Technical Reports Server (NTRS)

Lim, R. S.

1977-01-01

The need for fault-tolerant computing is addressed from the viewpoints of (1) why it is needed, (2) how to apply it in the current state of technology, and (3) what it means in the context of the Phoenix computer system and other related systems. To this end, the value of concurrent error detection and correction is described. User protection, program retry, and repair are among the factors considered. The technology of algebraic codes to protect memory systems and arithmetic codes to protect memory systems and arithmetic codes to protect arithmetic operations is discussed.

Design of wavefront coding optical system with annular aperture

NASA Astrophysics Data System (ADS)

Chen, Xinhua; Zhou, Jiankang; Shen, Weimin

2016-10-01

Wavefront coding can extend the depth of field of traditional optical system by inserting a phase mask into the pupil plane. In this paper, the point spread function (PSF) of wavefront coding system with annular aperture are analyzed. Stationary phase method and fast Fourier transform (FFT) method are used to compute the diffraction integral respectively. The OTF invariance is analyzed for the annular aperture with cubic phase mask under different obscuration ratio. With these analysis results, a wavefront coding system using Maksutov-Cassegrain configuration is designed finally. It is an F/8.21 catadioptric system with annular aperture, and its focal length is 821mm. The strength of the cubic phase mask is optimized with user-defined operand in Zemax. The Wiener filtering algorithm is used to restore the images and the numerical simulation proves the validity of the design.

Design study of a HEAO-C spread spectrum transponder telemetry system for use with the TDRSS subnet

NASA Technical Reports Server (NTRS)

Weathers, G.

1975-01-01

The results of a design study of a spread spectrum transponder for use on the HEAO-C satellite were given. The transponder performs the functions of code turn-around for ground range and range-rate determination, ground command receiver, and telemetry data transmitter. The spacecraft transponder and associated communication system components will allow the HEAO-C satellite to utilize the Tracking and Data Relay Satellite System (TDRSS) subnet of the post 1978 STDN. The following areas were discussed in the report: TDRSS Subnet Description, TDRSS-HEAO-C System Configuration, Gold Code Generator, Convolutional Encoder Design and Decoder Algorithm, High Speed Sequence Generators, Statistical Evaluation of Candidate Code Sequences using Amplitude and Phase Moments, Code and Carrier Phase Lock Loops, Total Spread Spectrum Transponder System, and Reference Literature Search.

EPA Office of Water (OW): SDWIS - HUC12 Densities for Public Surface Water and Groundwater Sources

EPA Pesticide Factsheets

Public Water System location points, based on information from the Safe Drinking Water Act Information System (SDWIS/Federal) for a 2010 third quarter (SDWIS_2010Q3) baseline period, were applied to relate system latitude and longitude coordinates (LatLongs) to Watershed Boundary Dataset subwatershed polygons (HUC12s). This HUC12 table can be mapped through setting up appropriate table relationships on the attribute HUC_12 with the HUC12 GIS layer that is part of EPA's Reach Address Database (RAD) Version 3. At the present time, the RAD Version 3 contains HUC12 polygons for the conterminous United States (CONUS), Hawaii, Puerto Rico, and the U.S. Virgin Islands (materials for Alaska or for other territories and dependencies are not available as of February, 2010). The records in this table are based on a special QUERY created by the EPA Office of Ground Water and Drinking Water (OGWDW) from the primary SDWIS/FED information to provide a robust point representation for a PWS system. PWS points are selected based on the following prioritization: 1. If the system has a treatment plant with LatLongs and MAD codes; 2. If the system has a treatment plant with LatLongs but without MAD codes; 3. If the system has a well with LatLongs and MAD codes; 4. If the system has a well with LatLongs but without MAD codes; 5. If the system has an intake with LatLongs and MAD codes; 6. If the system has an intake with LatLongs but without MAD codes; 7. If the system has any source

The use of interleaving for reducing radio loss in convolutionally coded systems

NASA Technical Reports Server (NTRS)

Divsalar, D.; Simon, M. K.; Yuen, J. H.

1989-01-01

The use of interleaving after convolutional coding and deinterleaving before Viterbi decoding is proposed. This effectively reduces radio loss at low-loop Signal to Noise Ratios (SNRs) by several decibels and at high-loop SNRs by a few tenths of a decibel. Performance of the coded system can further be enhanced if the modulation index is optimized for this system. This will correspond to a reduction of bit SNR at a certain bit error rate for the overall system. The introduction of interleaving/deinterleaving into communication systems designed for future deep space missions does not substantially complicate their hardware design or increase their system cost.

Brief surgical procedure code lists for outcomes measurement and quality improvement in resource-limited settings.

PubMed

Liu, Charles; Kayima, Peter; Riesel, Johanna; Situma, Martin; Chang, David; Firth, Paul

2017-11-01

The lack of a classification system for surgical procedures in resource-limited settings hinders outcomes measurement and reporting. Existing procedure coding systems are prohibitively large and expensive to implement. We describe the creation and prospective validation of 3 brief procedure code lists applicable in low-resource settings, based on analysis of surgical procedures performed at Mbarara Regional Referral Hospital, Uganda's second largest public hospital. We reviewed operating room logbooks to identify all surgical operations performed at Mbarara Regional Referral Hospital during 2014. Based on the documented indication for surgery and procedure(s) performed, we assigned each operation up to 4 procedure codes from the International Classification of Diseases, 9th Revision, Clinical Modification. Coding of procedures was performed by 2 investigators, and a random 20% of procedures were coded by both investigators. These codes were aggregated to generate procedure code lists. During 2014, 6,464 surgical procedures were performed at Mbarara Regional Referral Hospital, to which we assigned 435 unique procedure codes. Substantial inter-rater reliability was achieved (κ = 0.7037). The 111 most common procedure codes accounted for 90% of all codes assigned, 180 accounted for 95%, and 278 accounted for 98%. We considered these sets of codes as 3 procedure code lists. In a prospective validation, we found that these lists described 83.2%, 89.2%, and 92.6% of surgical procedures performed at Mbarara Regional Referral Hospital during August to September of 2015, respectively. Empirically generated brief procedure code lists based on International Classification of Diseases, 9th Revision, Clinical Modification can be used to classify almost all surgical procedures performed at a Ugandan referral hospital. Such a standardized procedure coding system may enable better surgical data collection for administration, research, and quality improvement in resource-limited settings. Copyright © 2017 Elsevier Inc. All rights reserved.

Why Data Linkage? The Importance of CODES (Crash Outcome Data Evaluation System)

DOT National Transportation Integrated Search

1996-06-01

This report briefly explains the computerized linked data system, Crash Outcome : Data Evaluation System (CODES) that provides greater depth accident data : analysis. The linking of data helps researchers to understand the nature of : traffic acciden...

Signal Processing Expert Code (SPEC)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ames, H.S.

1985-12-01

The purpose of this paper is to describe a prototype expert system called SPEC which was developed to demonstrate the utility of providing an intelligent interface for users of SIG, a general purpose signal processing code. The expert system is written in NIL, runs on a VAX 11/750 and consists of a backward chaining inference engine and an English-like parser. The inference engine uses knowledge encoded as rules about the formats of SIG commands and about how to perform frequency analyses using SIG. The system demonstrated that expert system can be used to control existing codes.

A Three-Phase Decision Model of Computer-Aided Coding for the Iranian Classification of Health Interventions (IRCHI).

PubMed

Azadmanjir, Zahra; Safdari, Reza; Ghazisaeedi, Marjan; Mokhtaran, Mehrshad; Kameli, Mohammad Esmail

2017-06-01

Accurate coded data in the healthcare are critical. Computer-Assisted Coding (CAC) is an effective tool to improve clinical coding in particular when a new classification will be developed and implemented. But determine the appropriate method for development need to consider the specifications of existing CAC systems, requirements for each type, our infrastructure and also, the classification scheme. The aim of the study was the development of a decision model for determining accurate code of each medical intervention in Iranian Classification of Health Interventions (IRCHI) that can be implemented as a suitable CAC system. first, a sample of existing CAC systems was reviewed. Then feasibility of each one of CAC types was examined with regard to their prerequisites for their implementation. The next step, proper model was proposed according to the structure of the classification scheme and was implemented as an interactive system. There is a significant relationship between the level of assistance of a CAC system and integration of it with electronic medical documents. Implementation of fully automated CAC systems is impossible due to immature development of electronic medical record and problems in using language for medical documenting. So, a model was proposed to develop semi-automated CAC system based on hierarchical relationships between entities in the classification scheme and also the logic of decision making to specify the characters of code step by step through a web-based interactive user interface for CAC. It was composed of three phases to select Target, Action and Means respectively for an intervention. The proposed model was suitable the current status of clinical documentation and coding in Iran and also, the structure of new classification scheme. Our results show it was practical. However, the model needs to be evaluated in the next stage of the research.

Coding response to a case-mix measurement system based on multiple diagnoses.

PubMed

Preyra, Colin

2004-08-01

To examine the hospital coding response to a payment model using a case-mix measurement system based on multiple diagnoses and the resulting impact on a hospital cost model. Financial, clinical, and supplementary data for all Ontario short stay hospitals from years 1997 to 2002. Disaggregated trends in hospital case-mix growth are examined for five years following the adoption of an inpatient classification system making extensive use of combinations of secondary diagnoses. Hospital case mix is decomposed into base and complexity components. The longitudinal effects of coding variation on a standard hospital payment model are examined in terms of payment accuracy and impact on adjustment factors. Introduction of the refined case-mix system provided incentives for hospitals to increase reporting of secondary diagnoses and resulted in growth in highest complexity cases that were not matched by increased resource use over time. Despite a pronounced coding response on the part of hospitals, the increase in measured complexity and case mix did not reduce the unexplained variation in hospital unit cost nor did it reduce the reliance on the teaching adjustment factor, a potential proxy for case mix. The main implication was changes in the size and distribution of predicted hospital operating costs. Jurisdictions introducing extensive refinements to standard diagnostic related group (DRG)-type payment systems should consider the effects of induced changes to hospital coding practices. Assessing model performance should include analysis of the robustness of classification systems to hospital-level variation in coding practices. Unanticipated coding effects imply that case-mix models hypothesized to perform well ex ante may not meet expectations ex post.

Increased registration of hypertension and cancer diagnoses after the introduction of a new reimbursement system

PubMed Central

Hjerpe, Per; Boström, Kristina Bengtsson; Lindblad, Ulf; Merlo, Juan

2012-01-01

Objective To investigate the impact on ICD coding behaviour of a new case-mix reimbursement system based on coded patient diagnoses. The main hypothesis was that after the introduction of the new system the coding of chronic diseases like hypertension and cancer would increase and the variance in propensity for coding would decrease on both physician and health care centre (HCC) levels. Design Cross-sectional multilevel logistic regression analyses were performed in periods covering the time before and after the introduction of the new reimbursement system. Setting Skaraborg primary care, Sweden. Subjects All patients (n = 76 546 to 79 826) 50 years of age and older visiting 468 to 627 physicians at the 22 public HCCs in five consecutive time periods of one year each. Main outcome measures Registered codes for hypertension and cancer diseases in Skaraborg primary care database (SPCD). Results After the introduction of the new reimbursement system the adjusted prevalence of hypertension and cancer in SPCD increased from 17.4% to 32.2% and from 0.79% to 2.32%, respectively, probably partly due to an increased diagnosis coding of indirect patient contacts. The total variance in the propensity for coding declined simultaneously at the physician level for both diagnosis groups. Conclusions Changes in the healthcare reimbursement system may directly influence the contents of a research database that retrieves data from clinical practice. This should be taken into account when using such a database for research purposes, and the data should be validated for each diagnosis. PMID:23130878

RETRACTED — PMD mitigation through interleaving LDPC codes with polarization scramblers

NASA Astrophysics Data System (ADS)

Han, Dahai; Chen, Haoran; Xi, Lixia

2012-11-01

The combination of forward error correction (FEC) and distributed fast polarization scramblers (D-FPSs) is approved as an effective method to mitigate polarization mode dispersion (PMD) in high-speed optical fiber communication system. The low-density parity-check (LDPC) codes are newly introduced into the PMD mitigation scheme with D-FPSs in this paper as one of the promising FEC codes to achieve better performance. The scrambling speed of FPS for LDPC (2040, 1903) codes system is discussed, and the reasonable speed 10 MHz is obtained from the simulation results. For easy application in practical large scale integrated (LSI) circuit, the number of iterations in decoding LDPC codes is also investigated. The PMD tolerance and cut-off optical signal-to-noise ratio (OSNR) of LDPC codes are compared with Reed-Solomon (RS) codes in different conditions. In the simulation, the interleaving LDPC codes brings incremental performance of error correction, and the PMD tolerance is 10 ps at OSNR=11.4 dB. The results show that the meaning of the work is that LDPC codes are a substitute for traditional RS codes with D-FPSs and all of the executable code files are open for researchers who have practical LSI platform for PMD mitigation.

PMD mitigation through interleaving LDPC codes with polarization scramblers

NASA Astrophysics Data System (ADS)

Han, Dahai; Chen, Haoran; Xi, Lixia

2013-09-01

The combination of forward error correction (FEC) and distributed fast polarization scramblers (D-FPSs) is approved an effective method to mitigate polarization mode dispersion (PMD) in high-speed optical fiber communication system. The low-density parity-check (LDPC) codes are newly introduced into the PMD mitigation scheme with D-FPSs in this article as one of the promising FEC codes to achieve better performance. The scrambling speed of FPS for LDPC (2040, 1903) codes system is discussed, and the reasonable speed 10MHz is obtained from the simulation results. For easy application in practical large scale integrated (LSI) circuit, the number of iterations in decoding LDPC codes is also investigated. The PMD tolerance and cut-off optical signal-to-noise ratio (OSNR) of LDPC codes are compared with Reed-Solomon (RS) codes in different conditions. In the simulation, the interleaving LDPC codes bring incremental performance of error correction, and the PMD tolerance is 10ps at OSNR=11.4dB. The results show the meaning of the work is that LDPC codes are a substitute for traditional RS codes with D-FPSs and all of the executable code files are open for researchers who have practical LSI platform for PMD mitigation.

Noise suppression system of OCDMA with spectral/spatial 2D hybrid code

NASA Astrophysics Data System (ADS)

Matem, Rima; Aljunid, S. A.; Junita, M. N.; Rashidi, C. B. M.; Shihab Aqrab, Israa

2017-11-01

In this paper, we propose a novel 2D spectral/spatial hybrid code based on 1D ZCC and 1D MD where the both present a zero cross correlation property analyzed and the influence of the noise of optical as Phase Induced Intensity Noise (PIIN), shot and thermal noise. This new code is shown effectively to mitigate the PIIN and suppresses MAI. Using 2D ZCC/MD code the performance of the system can be improved in term of as well as to support more simultaneous users compared of the 2D FCC/MDW and 2D DPDC codes.

Implementing the Code of Practice on International Recruitment in Romania - exploring the current state of implementation and what Romania is doing to retain its domestic health workforce.

PubMed

Paina, Ligia; Ungureanu, Marius; Olsavszky, Victor

2016-06-30

The Romanian health system is struggling to retain its health workers, who are currently facing strong incentives for migration to Western European health systems. Retention issues, coupled with high levels of migration, complicate Romania's efforts in providing basic health services for rural, underserved, and marginalized populations, as well as in achieving equitable health access for all. The WHO Global Code of Practice on International Recruitment of Health Personnel (the Code) aims to promote ethical international recruitment and health systems strengthening. We explore Romania's implementation of the Code's principles and recommendations. We analysed peer-reviewed and grey literature, in English and Romanian, and sought secondary data from the websites of Romania's largest medical universities. The analysis was guided by the following themes and recommendations in the Code: health personnel development and health systems sustainability, international cooperation, data gathering, information exchange, and implementation and monitoring of the Code. Romania's implementation of the Code was observed to be limited. Gaps were identified with regards to several aspects of the Romanian health system, including the lack of support to health personnel training, recruitment, and retention in order to increase the appeal for health providers to practice in Romania and in underserved areas. In terms of international cooperation, the Code recommends various policy instruments to guide recruitment, including bilateral agreements. However, we could not determine which of these instruments were used as a result of the Code and whether or not they were effective. We identified little evidence of initiatives for health workers' professional and personal support. Insufficient data and few information exchange platforms exist on health workforce issues, hindering active sharing of data on migration with European Union and WHO audiences. We could not identify any evidence of monitoring of the Code's implementation to date. In the absence of major system reforms, health workers will continue to migrate to urban areas and abroad. Romanian policymakers should address more of the Code's recommendations by developing a national policy for human resources for health, a central database to aid health workforce planning and management, stronger platforms for information exchange and civil society engagement, and updated and transparent bilateral agreements.

Temporal Code-Driven Stimulation: Definition and Application to Electric Fish Signaling

PubMed Central

Lareo, Angel; Forlim, Caroline G.; Pinto, Reynaldo D.; Varona, Pablo; Rodriguez, Francisco de Borja

2016-01-01

Closed-loop activity-dependent stimulation is a powerful methodology to assess information processing in biological systems. In this context, the development of novel protocols, their implementation in bioinformatics toolboxes and their application to different description levels open up a wide range of possibilities in the study of biological systems. We developed a methodology for studying biological signals representing them as temporal sequences of binary events. A specific sequence of these events (code) is chosen to deliver a predefined stimulation in a closed-loop manner. The response to this code-driven stimulation can be used to characterize the system. This methodology was implemented in a real time toolbox and tested in the context of electric fish signaling. We show that while there are codes that evoke a response that cannot be distinguished from a control recording without stimulation, other codes evoke a characteristic distinct response. We also compare the code-driven response to open-loop stimulation. The discussed experiments validate the proposed methodology and the software toolbox. PMID:27766078

Temporal Code-Driven Stimulation: Definition and Application to Electric Fish Signaling.

PubMed

Lareo, Angel; Forlim, Caroline G; Pinto, Reynaldo D; Varona, Pablo; Rodriguez, Francisco de Borja

2016-01-01

Closed-loop activity-dependent stimulation is a powerful methodology to assess information processing in biological systems. In this context, the development of novel protocols, their implementation in bioinformatics toolboxes and their application to different description levels open up a wide range of possibilities in the study of biological systems. We developed a methodology for studying biological signals representing them as temporal sequences of binary events. A specific sequence of these events (code) is chosen to deliver a predefined stimulation in a closed-loop manner. The response to this code-driven stimulation can be used to characterize the system. This methodology was implemented in a real time toolbox and tested in the context of electric fish signaling. We show that while there are codes that evoke a response that cannot be distinguished from a control recording without stimulation, other codes evoke a characteristic distinct response. We also compare the code-driven response to open-loop stimulation. The discussed experiments validate the proposed methodology and the software toolbox.

Theoretical and experimental studies of turbo product code with time diversity in free space optical communication.

PubMed

Han, Yaoqiang; Dang, Anhong; Ren, Yongxiong; Tang, Junxiong; Guo, Hong

2010-12-20

In free space optical communication (FSOC) systems, channel fading caused by atmospheric turbulence degrades the system performance seriously. However, channel coding combined with diversity techniques can be exploited to mitigate channel fading. In this paper, based on the experimental study of the channel fading effects, we propose to use turbo product code (TPC) as the channel coding scheme, which features good resistance to burst errors and no error floor. However, only channel coding cannot cope with burst errors caused by channel fading, interleaving is also used. We investigate the efficiency of interleaving for different interleaving depths, and then the optimum interleaving depth for TPC is also determined. Finally, an experimental study of TPC with interleaving is demonstrated, and we show that TPC with interleaving can significantly mitigate channel fading in FSOC systems.

Subband coding for image data archiving

NASA Technical Reports Server (NTRS)

Glover, Daniel; Kwatra, S. C.

1993-01-01

The use of subband coding on image data is discussed. An overview of subband coding is given. Advantages of subbanding for browsing and progressive resolution are presented. Implementations for lossless and lossy coding are discussed. Algorithm considerations and simple implementations of subband systems are given.

A reduced complexity highly power/bandwidth efficient coded FQPSK system with iterative decoding

NASA Technical Reports Server (NTRS)

Simon, M. K.; Divsalar, D.

2001-01-01

Based on a representation of FQPSK as a trellis-coded modulation, this paper investigates the potential improvement in power efficiency obtained from the application of simple outer codes to form a concatenated coding arrangement with iterative decoding.

Efficient transformation of an auditory population code in a small sensory system.

PubMed

Clemens, Jan; Kutzki, Olaf; Ronacher, Bernhard; Schreiber, Susanne; Wohlgemuth, Sandra

2011-08-16

Optimal coding principles are implemented in many large sensory systems. They include the systematic transformation of external stimuli into a sparse and decorrelated neuronal representation, enabling a flexible readout of stimulus properties. Are these principles also applicable to size-constrained systems, which have to rely on a limited number of neurons and may only have to fulfill specific and restricted tasks? We studied this question in an insect system--the early auditory pathway of grasshoppers. Grasshoppers use genetically fixed songs to recognize mates. The first steps of neural processing of songs take place in a small three-layer feed-forward network comprising only a few dozen neurons. We analyzed the transformation of the neural code within this network. Indeed, grasshoppers create a decorrelated and sparse representation, in accordance with optimal coding theory. Whereas the neuronal input layer is best read out as a summed population, a labeled-line population code for temporal features of the song is established after only two processing steps. At this stage, information about song identity is maximal for a population decoder that preserves neuronal identity. We conclude that optimal coding principles do apply to the early auditory system of the grasshopper, despite its size constraints. The inputs, however, are not encoded in a systematic, map-like fashion as in many larger sensory systems. Already at its periphery, part of the grasshopper auditory system seems to focus on behaviorally relevant features, and is in this property more reminiscent of higher sensory areas in vertebrates.

Global Coordinates and Exact Aberration Calculations Applied to Physical Optics Modeling of Complex Optical Systems

NASA Astrophysics Data System (ADS)

Lawrence, G.; Barnard, C.; Viswanathan, V.

1986-11-01

Historically, wave optics computer codes have been paraxial in nature. Folded systems could be modeled by "unfolding" the optical system. Calculation of optical aberrations is, in general, left for the analyst to do with off-line codes. While such paraxial codes were adequate for the simpler systems being studied 10 years ago, current problems such as phased arrays, ring resonators, coupled resonators, and grazing incidence optics require a major advance in analytical capability. This paper describes extension of the physical optics codes GLAD and GLAD V to include a global coordinate system and exact ray aberration calculations. The global coordinate system allows components to be positioned and rotated arbitrarily. Exact aberrations are calculated for components in aligned or misaligned configurations by using ray tracing to compute optical path differences and diffraction propagation. Optical path lengths between components and beam rotations in complex mirror systems are calculated accurately so that coherent interactions in phased arrays and coupled devices may be treated correctly.

THE CODE OF THE STREET AND INMATE VIOLENCE: INVESTIGATING THE SALIENCE OF IMPORTED BELIEF SYSTEMS*

PubMed Central

MEARS, DANIEL P.; STEWART, ERIC A.; SIENNICK, SONJA E.; SIMONS, RONALD L.

2013-01-01

Scholars have long argued that inmate behaviors stem in part from cultural belief systems that they “import” with them into incarcerative settings. Even so, few empirical assessments have tested this argument directly. Drawing on theoretical accounts of one such set of beliefs—the code of the street—and on importation theory, we hypothesize that individuals who adhere more strongly to the street code will be more likely, once incarcerated, to engage in violent behavior and that this effect will be amplified by such incarceration experiences as disciplinary sanctions and gang involvement, as well as the lack of educational programming, religious programming, and family support. We test these hypotheses using unique data that include measures of the street code belief system and incarceration experiences. The results support the argument that the code of the street belief system affects inmate violence and that the effect is more pronounced among inmates who lack family support, experience disciplinary sanctions, and are gang involved. Implications of these findings are discussed. PMID:24068837

Performance assessment of KORAT-3D on the ANL IBM-SP computer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexeyev, A.V.; Zvenigorodskaya, O.A.; Shagaliev, R.M.

1999-09-01

The TENAR code is currently being developed at the Russian Federal Nuclear Center (VNIIEF) as a coupled dynamics code for the simulation of transients in VVER and RBMK systems and other nuclear systems. The neutronic module in this code system is KORAT-3D. This module is also one of the most computationally intensive components of the code system. A parallel version of KORAT-3D has been implemented to achieve the goal of obtaining transient solutions in reasonable computational time, particularly for RBMK calculations that involve the application of >100,000 nodes. An evaluation of the KORAT-3D code performance was recently undertaken on themore » Argonne National Laboratory (ANL) IBM ScalablePower (SP) parallel computer located in the Mathematics and Computer Science Division of ANL. At the time of the study, the ANL IBM-SP computer had 80 processors. This study was conducted under the auspices of a technical staff exchange program sponsored by the International Nuclear Safety Center (INSC).« less