MUTATIONAL AND TRANSCRIPTIONAL RESPONSES OF SAMMONELLA TO MX: CORRELATION OF MUTATIONAL DOSE RESPONSE TO CHANGES IN GENE EXPRESSION

EPA Science Inventory

We measured the mutational and transcriptional response of Salmonella TA 100 to 3 concentrations of a drinking water mutagen -chloro-4-(dichloromethyl)-5-hydroxy2(5H)-furanone (MX). The mutagenicity of MX in strain TA100 was evaluated in a 30min suspension assay, and the mutageni...

MUTATIONAL AND TRANSCRIPTIONAL RESPONSE OF SALMONELLA TO MX: CORRELATION OF MUTATIONAL DOSE RESPONSE TO CHANGES IN GENE EXPRESSION

EPA Science Inventory

We measured the mutational and transcriptional response of Salmonella TA100 to 3 concentrations of the drinking water mutagen 3-chloro-4-(dichloromethyl)-5-hydroxy2(5H)-furanone (MX). The mutagenicity of MX in strain TA100 was evaluated in a 30min suspension assay, and the mutage...

MUTATIONAL AND TRANSCRIPTIONAL RESPONSES OF STATIONARY- AND LOGARITHMIC-PHASE SALMONELLA TO MX: CORRELATION OF MUTATIONAL RESPONSE TO CHANGES IN GENE EXPRESSION

EPA Science Inventory

We measured the mutational and transcriptional response of stationary-phase and logarithmic-phase S. typhimurium TA100 to 3 concentrations of the drinking water mutagen 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX). The mutagenicity of MX in strain TA100 was evaluated...

Host and viral determinants for MxB restriction of HIV-1 infection.

PubMed

Matreyek, Kenneth A; Wang, Weifeng; Serrao, Erik; Singh, Parmit Kumar; Levin, Henry L; Engelman, Alan

2014-10-25

Interferon-induced cellular proteins play important roles in the host response against viral infection. The Mx family of dynamin-like GTPases, which include MxA and MxB, target a wide variety of viruses. Despite considerable evidence demonstrating the breadth of antiviral activity of MxA, human MxB was only recently discovered to specifically inhibit lentiviruses. Here we assess both host and viral determinants that underlie MxB restriction of HIV-1 infection. Heterologous expression of MxB in human osteosarcoma cells potently inhibited HIV-1 infection (~12-fold), yet had little to no effect on divergent retroviruses. The anti-HIV effect manifested as a partial block in the formation of 2-long terminal repeat circle DNA and hence nuclear import, and we accordingly found evidence for an additional post-nuclear entry block. A large number of previously characterized capsid mutations, as well as mutations that abrogated integrase activity, counteracted MxB restriction. MxB expression suppressed integration into gene-enriched regions of chromosomes, similar to affects observed previously when cells were depleted for nuclear transport factors such as transportin 3. MxB activity did not require predicted GTPase active site residues or a series of unstructured loops within the stalk domain that confer functional oligomerization to related dynamin family proteins. In contrast, we observed an N-terminal stretch of residues in MxB to harbor key determinants. Protein localization conferred by a nuclear localization signal (NLS) within the N-terminal 25 residues, which was critical, was fully rescuable by a heterologous NLS. Consistent with this observation, a heterologous nuclear export sequence (NES) abolished full-length MxB activity. We additionally mapped sub-regions within amino acids 26-90 that contribute to MxB activity, finding sequences present within residues 27-50 particularly important. MxB inhibits HIV-1 by interfering with minimally two steps of infection, nuclear entry and post-nuclear trafficking and/or integration, without destabilizing the inherent catalytic activity of viral preintegration complexes. Putative MxB GTPase active site residues and stalk domain Loop 4 -- both previously shown to be necessary for MxA function -- were dispensable for MxB antiviral activity. Instead, we highlight subcellular localization and a yet-determined function(s) present in the unique MxB N-terminal region to be required for HIV-1 restriction.

Inhibition of interferon-inducible MxA protein expression by hepatitis B virus capsid protein.

PubMed

Rosmorduc, O; Sirma, H; Soussan, P; Gordien, E; Lebon, P; Horisberger, M; Bréchot, C; Kremsdorf, D

1999-05-01

Chronic hepatitis B treatment has been significantly improved by interferon (IFN) treatment. However, some studies have suggested that hepatitis B virus (HBV) might have a direct effect on the resistance to IFN. Defective particles, generated by spliced HBV RNA and associated with chronic hepatitis B, have been previously characterized; expression of these particles leads to cytoplasmic accumulation of the capsid protein. The aim of this study was to investigate the role of these defective genomes in IFN resistance. The global antiviral activity of IFN was studied by virus yield reduction assays, the expression of three IFN-induced antiviral proteins was analysed by Western blotting and confocal microscopy, and the regulation of MxA gene expression was studied by Northern blotting and the luciferase assay, in Huh7 cells transfected with a complete or the defective HBV genome. Results showed that the expression of the defective genome reduces the antiviral activity of IFN and that this modulation involves a selective inhibition of MxA protein induction by the HBV capsid protein. Our results also show the trans-suppressive effect of the HBV capsid on the MxA promoter, which might participate in this phenomenon. In conclusion, this study shows a direct interplay between the IFN-sensitive pathway and the capsid protein and might implicate this defective HBV genome in virus persistence.

Interferon stimulated genes as peripheral diagnostic markers of early pregnancy in sheep: a critical assessment.

PubMed

Mauffré, V; Grimard, B; Eozenou, C; Inghels, S; Silva, L; Giraud-Delville, C; Capo, D; Sandra, O; Constant, F

2016-11-01

We investigated the diagnostic reliability of pregnancy detection using changes in interferon stimulated gene (ISG) messenger RNA (mRNA) levels in circulating immune cells in ewes. Two different groups of ewes (an experimental group, experiment 1 and a farm group, experiment 2) were oestrus-synchronized and blood sampled on day 14 (D0=day of insemination in control animals, experiment 1) and day 15 (experiment 2). Real-time PCR were performed to evaluate the abundance of different ISG mRNAs. In the experimental group, peripheral blood mononuclear cells of 29 ewes born and bred in experimental facilities were isolated using a Percoll gradient method. Gene expression for Chemokine (C-X-C motif) ligand 10 (CXCL10), Myxovirus (influenza virus) resistance 1 (MX1) and Signal transducer and activator of transcription 1 (STAT1) mRNA were, respectively, 8.3-fold, 6.1-fold and 2.7-fold higher (P0.10) in CXCL10, STAT1, MX1, Myxovirus (influenza virus) resistance 2 (MX2) and ISG15 ubiquitin-like modifier (ISG15) mRNA expression were found between pregnant and non-pregnant ewes. The ROC curves and the hierarchical classification generated from the real-time PCR data failed to discriminate between pregnant and non-pregnant animals. In this group of animals, our results show a strong variability in ISG expression patterns: 17% of animals identified as non-pregnant by the five tests were in fact pregnant, only 52% of pregnant animals had at least two positive results (two genes above threshold), whereas up to five positive results (five genes above threshold) were needed to avoid misclassification. In conclusion, this study illustrates the high variability in ISG expression levels in immune circulating cells during early pregnancy and, therefore, highlights the limits of using ISG expression levels in blood samples, collected on PAXgene® tubes on farms, for early pregnancy detection in sheep.

Analysis of neutralizing antibodies to therapeutic interferon-beta in multiple sclerosis patients: a comparison of three methods in a large Australasian cohort.

PubMed

McKay, Fiona; Schibeci, Stephen; Heard, Robert; Stewart, Graeme; Booth, David

2006-03-20

Persistent high-titre neutralizing antibodies (NAB) to therapeutic interferon-beta(IFNbeta)in multiple sclerosis patients reduce therapeutic efficacy. Difficulties in standardization of cell-based bioactivity assays have hindered interlaboratory comparison of NAB titres and the determination of a clinically relevant definition of seropositivity. We determined NAB status in Australasian multiple sclerosis patients receiving IFNbetausing both the antiviral cytopathic effect (CPE) assay (n = 227) and the more specific ELISA for the type I interferon-inducible MxA protein (n = 350). While the log(10) titres determined in the two assays were highly correlated (p < 0.0001; r = 0.967) with similar distributions, the MxA assay was more sensitive, detecting lower concentrations of NAB than the CPE assay. The range of titres determined in the CPE assay was 10 to >7290; and 9 to 53,700 in the MxA assay, with ranked titre distribution highlighting the arbitrary nature of currently accepted definitions of NAB seropositivity. Bioactivity of injected IFNbetawas significantly reduced in NAB-positive patients (p = 0.006; NAB MxA titres = 184 to 5340) compared to NAB-negative patients as assessed ex vivo using real-time RT-PCR analysis of MxA gene induction. The range of MxA mRNA levels in healthy controls was remarkably consistent with previously published results, regardless of the assay standardization method [Gilli, F., Sala, A., Marnetto, F., Lindberg, R.L., Leppert, D. and Bertolotto, A. (2003) Comparison of IFNbeta bioavailability evaluations by MxA mRNA using two independent quantification methods. Abstract, ECTRIMS Meeting, Milan, Italy; Pachner, A., Narayan, K., Price, N., Hurd, M. and Dail, D. (2003a) MxA Gene Expression Analysis as an Interferon-beta Bioactivity Measurement in Patients with Multiple Sclerosis and the Identification of Antibody-Mediated Decreased Bioactivity. Mol. Diagn. 7, 17-25]. Assessment of IFNbetaresponse ex vivo accounts for both circulating factors and the cellular response to IFNbeta, and the data support the development of the MxA gene induction assay for the routine screening of patients receiving IFNbeta.

Expression of Malus xiaojinensis IRT1 (MxIRT1) protein in transgenic yeast cells leads to degradation through autophagy in the presence of excessive iron.

PubMed

Li, Shuang; Zhang, Xi; Zhang, Xiu-Yue; Xiao, Wei; Berry, James O; Li, Peng; Jin, Si; Tan, Song; Zhang, Peng; Zhao, Wei-Zhong; Yin, Li-Ping

2015-07-01

Iron is essential for plants, but highly toxic when present in excess. Consequently, iron uptake by root transporters must be finely tuned to avoid excess uptake from soil under iron excess. The iron-regulated transporter of Malus xiaojinensis (MxIRT1), induced in roots under iron deficiency, is a highly effective iron(II) transporter. Here, we investigated how the presence of excessive iron leads to MxIRT1 degradation in yeast expressing this plant iron transporter protein. To determine the relationship between iron abundance and MxIRT1 degradation, relative levels of autophagy-related gene-8 (ATG8) mRNA and the active ATG8-phosphatidylethanolamine-conjugated (PE) protein were measured in wild-type yeast and the autophagic mutant strains atg1∆, atg5∆, atg7∆, ypt7∆ and tor1∆ under normal and excessive iron conditions. The data showed that the exposure of MxIRT1-eGFP-transformed wild-type and tor1∆ strains to excessive iron led to significantly increased levels of ATG8 transcript and ATG8-PE protein, which resulted in enhanced MxIRT1 degradation. Co-localization of mCherry-ATG8 and MxIRT1-eGFP provided evidence that these proteins interact during autophagy in yeast. While inhibition of autophagic initiation, autophagosome formation and vacuole fusion all decreased MxIRT1 degradation. PMSF inhibition of autophagy prevented degradation, leading to the accumulation of MxIRT1-containing vesicles in the vacuoles. MxIRT1-vesicles were sorted into autophagosomes for iron-induced degradation in yeast, whereas the endogenous iron(II) transporter Fet4 was degraded in an autophagy-independent manner. Moreover, immunoprecipitation showed that multimono-ubiquitins provided MxIRT1 with the ubiquitination signal. Together, three factors, iron excess, autophagy and mono-ubiquitination, affect the functional activity and stability of exogenous MxIRT1 in yeast, thereby preventing iron uptake via this root transporter. Copyright © 2015 John Wiley & Sons, Ltd.

Expression kinetics of key genes in the early innate immune response to Great Lakes viral hemorrhagic septicemia virus IVb infection in yellow perch (Perca flavescens)

USGS Publications Warehouse

Olson, Wendy; Emmenegger, Eveline; Glenn, Jolene; Simchick, Crystal; Winton, Jim; Goetz, Frederick

2013-01-01

The recently discovered strain of viral hemorrhagic septicemia virus, VHSV-IVb, represents an example of the introduction of an extremely pathogenic rhabdovirus capable of infecting a wide variety of new fish species in a new host-environment. The goal of the present study was to delineate the expression kinetics of key genes in the innate immune response relative to the very early stages of VHSV-IVb infection using the yellow perch (Perca flavescens) as a model. Administration of VHSV-IVb by IP-injection into juvenile yellow perch resulted in 84% cumulative mortality, indicating their high susceptibility to this disease. In fish sampled in the very early stages of infection, a significant up-regulation of Mx gene expression in the liver, as well as IL-1β and SAA activation in the head kidney, spleen, and liver was directly correlated to viral load. The potential down-regulation of Mx in the hematopoietic tissues, head kidney and spleen, may represent a strategy utilized by the virus to increase replication.

Diversity of interferon inducible Mx gene in horses and association of variations with susceptibility vis-à-vis resistance against equine influenza infection.

PubMed

Manuja, Balvinder K; Manuja, Anju; Dahiya, Rajni; Singh, Sandeep; Sharma, R C; Gahlot, S K

2014-10-01

Equine influenza (EI) is primarily an infection of the upper respiratory tract and is one of the major infectious respiratory diseases of economic importance in equines. Re-emergence of the disease, species jumping by H3N8 virus in canines and possible threat of human pandemic due to the unpredictable nature of the virus have necessitated research on devising strategies for preventing the disease. The myxovirus resistance protein (Mx) has been reported to confer resistance to Orthomyxo virus infection by modifying cellular functions needed along the viral replication pathway. Polymorphisms and differential antiviral activities of Mx gene have been reported in pigs and chicken. Here we report the diversity of Mx gene, its expression in response to stimulation with interferon (IFN) α/β and their association with EI resistance and susceptibility in Marwari horses. Blood samples were collected from horses declared positive for equine influenza and in contact animals with a history of no clinical signs. Mx gene was amplified by reverse transcription from total RNA isolated from peripheral blood mononuclear cells (PBMCs) stimulated with IFN α/β using gene specific primers. The amplified gene products from representative samples were cloned and sequenced. Nucleotide sequences and deduced amino acid sequences were analyzed. Out of a total 24 amino acids substitutions sorting intolerant from tolerant (SIFT) analysis predicted 13 substitutions with functional consequences. Five substitutions (V67A, W123L, E346Y, N347Y, S689N) were observed only in resistant animals. Evolutionary distances based on nucleotide sequences with in equines ranged between 0.3-2.0% and 20-24% with other species. On phylogenetic analysis all equine sequences clustered together while other species formed separate clades. Copyright © 2014 Elsevier B.V. All rights reserved.

β-1,3/1,6-Glucan-supplemented diets antagonize immune inhibitory effects of hypoxia and enhance the immune response to a model vaccine.

PubMed

Rodríguez, Felipe E; Valenzuela, Beatriz; Farías, Ana; Sandino, Ana María; Imarai, Mónica

2016-12-01

The diets of farmed salmon are usually supplemented with immunostimulants to improve health status. Because β-glucan is one of the most common immunostimulants used in diets, here we examined the effect of two β-1,3/1,6-glucan-supplemented diets on the expression of immune response genes of Atlantic salmon. The relative abundances of IFN-α1, Mx, IFN-γ, IL-12, TGF-β1, IL-10, and CD4 transcripts were evaluated in head kidney by qRT-PCR. We assessed the effects of the diets under normoxia and acute hypoxia, as salmon are especially sensitive to changes in the concentration of dissolved oxygen, which can also affect immunity. These effects were also tested on vaccinated fish, as we expected that β-1,3/1,6-glucan-supplemented diets would enhance the adaptive immune response to the vaccine. We found that administration of the Bg diet (containing β-1,3/1,6-glucan) under normoxia had no effects on the expression of the analyzed genes in the kidney of the diet-fed fish, but under hypoxia/re-oxygenation (90 min of acute hypoxia), the βg diet affected the expression of the antiviral genes, IFN-α1 and Mx, preventing their decrease caused by hypoxia. The Bax diet, which in addition to β-1,3/1,6-glucan, contained astaxanthin, increased IL-12 and IFN-γ in kidneys. With fish exposed to hypoxia/reoxygenation, the diet prevented the decrease of IFN-α1 and Mx levels observed after hypoxia. When fish were vaccinated, only the levels of IL-12 and CD4 transcripts increased, but interestingly if fish were also fed the Bax diet, the vaccination induced a significant increase in all the analyzed transcripts. Finally, when vaccinated fish were exposed to hypoxia, the effect of the Bax diet was greatly reduced for all genes tested and moreover, inducible effects completely disappeared for IL-12, IFN-α, and Mx. Altogether, these results showed that the tested β-1,3/1,6-glucan diets increased the levels of transcripts of key genes involved in innate and adaptive immune response of salmon, potentiating the response to a model vaccine and also antagonizing the effects of hypoxia. Copyright © 2016 Elsevier Ltd. All rights reserved.

Expressed sequence tags from poplar wood tissues--a comparative analysis from multiple libraries.

PubMed

Déjardin, A; Leplé, J-C; Lesage-Descauses, M-C; Costa, G; Pilate, G

2004-01-01

Xylogenesis involves successive developmental processes--cambial division, cell expansion and differentiation, cell death--each occurring along a gradient from the cambium to the pith of the stem. Taking advantage of the high level of organisation of wood tissues, we isolated cambial zone (CZ), differentiating xylem (DX) and mature xylem (MX) from both tension wood (TW) and opposite wood (OW) of bent poplars. Four different cDNA libraries were then constructed and used to generate 10,062 EST, reflecting the genes expressed in the different wood tissues. For the most abundant clusters, the EST distributions were compared between libraries in order to identify genes specific or over-represented at some specific developmental stages. They clearly showed a developmental shift between CZ and DX, whereas there is a continuity of development between DX and MX. CZ was mainly characterized by clusters of genes involved in cell cycle, protein synthesis and fate. Interestingly, two clusters with no assigned function were found specific to the cambial zone. In DX and MX, clusters were mostly involved in methylation of lignin precursors and microtubule cytoskeleton. In addition, in DX, EST from TW and OW were compared: five clusters of arabinogalactan proteins, one for sucrose synthase and one for fructokinase were specific or over-represented in TW. Moreover, a putative transcription factor and a cluster of unknown function were also identified in DX-TW. The informative comparison of multiple libraries prepared from wood tissues led to the identification of genes--some with still unknown functions--putatively involved in xylogenesis and tension wood formation.

Synergistic effects in the antiviral activity of the three Mx proteins from gilthead seabream (Sparus aurata).

PubMed

Fernández-Trujillo, M A; García-Rosado, E; Alonso, M C; Álvarez, M C; Béjar, J

2015-11-15

Due to their direct antiviral activity, Mx proteins play a main role in the response mediated by type I interferon against viral infections. The study on gilthead seabream Mx proteins is especially interesting, since this species is unusually resistant to viral diseases, being asymptomatic carrier of several viruses pathogenic to other fish species. Gilthead seabream has three Mx proteins (Mx1, Mx2 and Mx3) that, separately, display antiviral activity against a wide range of viruses, showing interesting differences in their antiviral specificities. In this work, the possible synergy between the three Mx isoforms has been studied using in vitro systems consisting of CHSE-214 cells stably expressing two or the three gilthead seabream Mx proteins. The antiviral activity of these Mx combinations has been tested against the Infectious Pancreatic Necrosis Virus (IPNV), the Viral Haemorrhagic Septicaemia Virus (VHSV), the European Sheatfish Virus (ESV) and the Lymphocystis Disease Virus (LCDV). A synergistic effect of the Mx proteins was only detected against ESV, no synergy was observed against LCDV, and a negative interference was detected against the two RNA viruses tested, IPNV and VHSV, as viral replication was higher in cells expressing certain Mx combinations than in cells expressing these proteins separately. These results suggest a functional interaction between gilthead seabream Mx isoforms, which results in a higher or lower antiviral activity depending on the virus tested, thus supporting the idea of complex virus-host interactions and finely tuned mechanisms controlling the antiviral activity of Mx proteins. Copyright © 2015 Elsevier B.V. All rights reserved.

Mx1 and Mx2 key antiviral proteins are surprisingly lost in toothed whales

PubMed Central

Braun, Benjamin A.; Marcovitz, Amir; Camp, J. Gray; Jia, Robin; Bejerano, Gill

2015-01-01

Viral outbreaks in dolphins and other Delphinoidea family members warrant investigation into the integrity of the cetacean immune system. The dynamin-like GTPase genes Myxovirus 1 (Mx1) and Mx2 defend mammals against a broad range of viral infections. Loss of Mx1 function in human and mice enhances infectivity by multiple RNA and DNA viruses, including orthomyxoviruses (influenza A), paramyxoviruses (measles), and hepadnaviruses (hepatitis B), whereas loss of Mx2 function leads to decreased resistance to HIV-1 and other viruses. Here we show that both Mx1 and Mx2 have been rendered nonfunctional in Odontoceti cetaceans (toothed whales, including dolphins and orcas). We discovered multiple exon deletions, frameshift mutations, premature stop codons, and transcriptional evidence of decay in the coding sequence of both Mx1 and Mx2 in four species of Odontocetes. We trace the likely loss event for both proteins to soon after the divergence of Odontocetes and Mystocetes (baleen whales) ∼33–37 Mya. Our data raise intriguing questions as to what drove the loss of both Mx1 and Mx2 genes in the Odontoceti lineage, a double loss seen in none of 56 other mammalian genomes, and suggests a hitherto unappreciated fundamental genetic difference in the way these magnificent mammals respond to viral infections. PMID:26080416

Mx1 and Mx2 key antiviral proteins are surprisingly lost in toothed whales.

PubMed

Braun, Benjamin A; Marcovitz, Amir; Camp, J Gray; Jia, Robin; Bejerano, Gill

2015-06-30

Viral outbreaks in dolphins and other Delphinoidea family members warrant investigation into the integrity of the cetacean immune system. The dynamin-like GTPase genes Myxovirus 1 (Mx1) and Mx2 defend mammals against a broad range of viral infections. Loss of Mx1 function in human and mice enhances infectivity by multiple RNA and DNA viruses, including orthomyxoviruses (influenza A), paramyxoviruses (measles), and hepadnaviruses (hepatitis B), whereas loss of Mx2 function leads to decreased resistance to HIV-1 and other viruses. Here we show that both Mx1 and Mx2 have been rendered nonfunctional in Odontoceti cetaceans (toothed whales, including dolphins and orcas). We discovered multiple exon deletions, frameshift mutations, premature stop codons, and transcriptional evidence of decay in the coding sequence of both Mx1 and Mx2 in four species of Odontocetes. We trace the likely loss event for both proteins to soon after the divergence of Odontocetes and Mystocetes (baleen whales) ∼33-37 Mya. Our data raise intriguing questions as to what drove the loss of both Mx1 and Mx2 genes in the Odontoceti lineage, a double loss seen in none of 56 other mammalian genomes, and suggests a hitherto unappreciated fundamental genetic difference in the way these magnificent mammals respond to viral infections.

Ginsenoside C-Mx Isolated from Notoginseng Stem-leaf Ginsenosides Attenuates Ultraviolet B-mediated Photoaging in Human Dermal Fibroblasts.

PubMed

Liu, Xiao-Yi; Hwang, Eunson; Park, Bom; Ngo, Hien T T; Xiao, Yong-Kun; Yi, Tae-Hoo

2018-05-20

Notoginseng is a traditional herbal medicine widely used for medicinal therapy in Asia, as it contains numerous ginsenosides with pharmacological effects. In this study, we submitted Notoginseng stem-leaf (NGL) ginsenosides to an enzyme to create reaction the monomer products of ginsenoside C-Mx and then investigated the ability of ginsenoside C-Mx to protect the skin against ultraviolet B-induced injury in normal human dermal fibroblasts (NHDFs). Ginsenoside C-Mx alleviated UVB-induced intracellular reactive oxygen species (ROS), MMP-1, and IL-6 expression while accelerating TGF-β and procollagen type I secretion. In addition, ginsenoside C-Mx reversed UVB-induced procollagen type I reduction by regulating the TGF-β/Smad signaling pathway. Moreover, ginsenoside C-Mx inhibited activation of AP-1 transcription factor, an inducer of MMPs. Ginsenoside C-Mx displayed an outstanding antioxidant capacity, increasing expression of cytoprotective antioxidants such as HO-1 and, NQO-1 expression by enhancing the nuclear accumulation of Nrf2. Interestingly, applied of ginsenoside C-Mx treatment (1, 10, 20μM) significantly diminished UVB-induced suppressed NF-κB expression, decreasing the over-released inflammatory cytokines. Taken together, our findings indicated that ginsenoside C-Mx may act as a promising natural cosmetic ingredient for prevention and treatment of UVB-induced skin damage. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Lateral flow immunoassay with upconverting nanoparticle-based detection for indirect measurement of interferon response by the level of MxA.

PubMed

Juntunen, Etvi; Salminen, Teppo; Talha, Sheikh M; Martiskainen, Iida; Soukka, Tero; Pettersson, Kim; Waris, Matti

2017-04-01

Myxovirus resistance protein A (MxA) is a biomarker of interferon-induced gene expression state involved in many viral infections and some autoimmune disorders. It has a variety of potential utilities in clinical diagnostics, including distinguishing between bacterial and viral infections. Currently, MxA-assays are used for monitoring of IFN-β therapy in multiple sclerosis (MS) patients. As a proof-of-concept for rapid quantitative measurement of interferon response, a lateral flow immunoassay (LFIA) with upconverting nanoparticle (UCNP) reporters was developed and evaluated with clinical whole blood samples to assess the potential for a rapid and user-friendly quantitative assay for MxA, since the currently available rapid test for MxA (FebriDX) produces only qualitative result. The high detection sensitivity enabled by the UCNP reporter technology allowed the sample pre-treatment with dilution of whole blood into lysis buffer at a detectable analyte concentration. The assay can be done within 2 hr and the results correlate with the reference MxA-ELISA, which requires an overnight incubation. With 36 samples, R 2 for linear regression was 0.86. The assay detected 96% of the IFN-β responders with 89% specificity using a cut-off level of 100 μg/L for an elevated MxA-concentration. J. Med. Virol. 89:598-605, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Macular xanthophylls, lipoprotein-related genes, and age-related macular degeneration1234

PubMed Central

Koo, Euna; Neuringer, Martha; SanGiovanni, John Paul

2014-01-01

Plant-based macular xanthophylls (MXs; lutein and zeaxanthin) and the lutein metabolite meso-zeaxanthin are the major constituents of macular pigment, a compound concentrated in retinal areas that are responsible for fine-feature visual sensation. There is an unmet need to examine the genetics of factors influencing regulatory mechanisms and metabolic fates of these 3 MXs because they are linked to processes implicated in the pathogenesis of age-related macular degeneration (AMD). In this work we provide an overview of evidence supporting a molecular basis for AMD-MX associations as they may relate to DNA sequence variation in AMD- and lipoprotein-related genes. We recognize a number of emerging research opportunities, barriers, knowledge gaps, and tools offering promise for meaningful investigation and inference in the field. Overviews on AMD- and high-density lipoprotein (HDL)–related genes encoding receptors, transporters, and enzymes affecting or affected by MXs are followed with information on localization of products from these genes to retinal cell types manifesting AMD-related pathophysiology. Evidence on the relation of each gene or gene product with retinal MX response to nutrient intake is discussed. This information is followed by a review of results from mechanistic studies testing gene-disease relations. We then present findings on relations of AMD with DNA sequence variants in MX-associated genes. Our conclusion is that AMD-associated DNA variants that influence the actions and metabolic fates of HDL system constituents should be examined further for concomitant influence on MX absorption, retinal tissue responses to MX intake, and the capacity to modify MX-associated factors and processes implicated in AMD pathogenesis. PMID:24829491

Expression pattern analysis of IRF4 and its related genes revealed the functional differentiation of IRF4 paralogues in teleost.

PubMed

Ai, Kete; Luo, Kai; Li, Youshen; Hu, Wei; Gao, Weihua; Fang, Liu; Tian, Guangming; Ruan, Guoliang; Xu, Qiaoqing

2017-01-01

In mammals, interferon regulatory factor 4 (IRF4) plays an important role in the process of development and differentiation of B cells, T cells and dendritic cells. It can regulate immune pathway through IRF5, MyD88, IL21, PGC1α, and NOD2. In the present study, we investigated the expression pattern of IRF4 paralogues and these related genes for the first time in teleosts. The results showed that these genes were all expressed predominantly in known immune tissues while IRF5 was also relatively highly expressed in muscle. IRF4b, IL21, MyD88, IRF5 and NOD2 showed maternal expression in the oocyte and the higher expression of IRF4a, Mx and PGC1α before hatching might be involved in the embryonic innate defense system. Zebrafish embryonic fibroblast (ZF4) cells were infected with GCRV and SVCV. During GCRV infection, the expression of Mx was significantly up-regulated from 3 h to 24 h, reaching the highest level at 12 h (101.5-fold over the controls, P < 0.001). And the expression of IRF4a was significantly up-regulated from 3 h to 48 h, reaching the highest level at 12 h (13.75-fold over the controls, P < 0.001). While the expression of IRF4b was only slightly up-regulated at 12 h and 24 h (3.39-fold, 1.93-fold) above control levels, respectively. Whereas the expression of Mx was significantly up-regulated during SVCV infection from 1 h to 48 h, reaching the highest level at 24 h (11.49-fold over the controls, P < 0.001). IRF4a transcripts were significantly up-regulated from 6 h to 24 h, reaching the highest level at 24 h (41-fold over the controls, P < 0.01). IRF4b only showed a slightly up-regulation by SVCV at 24 h (3.2-fold over the controls, P < 0.01). IRF4a and IRF4b displayed a distinct tissue expression pattern, embryonic stages expression and inducible expression in vivo and in vitro, suggesting that IRF4 paralogues might play different roles in immune system. Copyright © 2016 Elsevier Ltd. All rights reserved.

Classical swine fever virus replicated poorly in cells from MxA transgenic pigs.

PubMed

Zhao, Yicheng; Wang, Tiedong; Yao, Li; Liu, Bo; Teng, Chunbo; Ouyang, Hongsheng

2016-08-17

In addition to their value as livestock, pigs are susceptible to classical swine fever virus (CSFV) and can serve as reservoirs for CSFV, allowing it to develop into an epizootic. CSFV, a pestivirus of the Flaviviridae family, has a single-stranded RNA genome. Recent research has indicated that the human MxA protein inhibits the life cycles of certain RNA viruses, such as members of the Bunyaviridae family, the Flaviviridae family and others. To produce pigs with antiviral protection against CSFV, transgenic pigs expressing human MxA were generated by nuclear transplantation. Cells from three MxA transgenic piglets were used to investigate in vitro antiviral activity of MxA aganist CSFV, and the results of in vitro indirect immunofluorescence assays, virus titration and real-time PCR indicated that the MxA transgenic pig has an antiviral capacity against CSFV. Transgene with human MxA on pigs is feasible. High levels of MxA expression do inhibit CSFV in vitro at early time points post-infection at 60-96dpi.

Mutagen Structure and Transcriptional Response: Induction of Distinct Transcriptional Profiles in Salmonella TA100 by the Drinking-Water Mutagen MX and Its Homologues

EPA Science Inventory

The relationship between chemical structure and biological activity has been examined for various compounds and endpoints for decades. To explore this question relative to global gene expression, we performed microarray analysis of Salmonella TA100 after treatment under condition...

Gene cloning, protein characterization, and alteration of product selectivity for the trehalulose hydrolase and trehalulose synthase from "Pseudomonas mesoacidophila" MX-45.

PubMed

Watzlawick, Hildegard; Mattes, Ralf

2009-11-01

The naturally occurring structural isomer of sucrose, trehalulose, is produced by sucrose isomerase (SI). Screening of chromosomal DNA from "Pseudomonas mesoacidophila" MX-45 with an SI-specific probe facilitated the cloning of two adjacent gene homologs, mutA and mutB. Both genes were expressed separately in Escherichia coli, and their enzyme products were characterized. MutA hydrolyzed the substrates trehalulose, isomaltulose, and sucrose into glucose and fructose. Due to its highest activity on trehalulose, MutA was referred to as trehalulase. mutB encodes the SI (trehalulose synthase) and catalyzes the isomerization of sucrose to mainly trehalulose. From Northern blot analysis it is apparent that the mutB gene is not transcribed as part of an operon and was transcriptionally upregulated when P. mesoacidophila MX-45 cells were grown in sucrose medium, whereas under investigated conditions no transcript for mutA was detected. Mutants of mutB were created by a random mutagenesis approach in order to alter the product specificity of MutB. Two types of mutants have emerged, one type that prefers the hydrolytic reaction on sucrose and another type that still acts as an SI but with a significant shift in the product from trehalulose to isomaltulose. The hydrolytic character of MutB R311C was demonstrated through its higher catalytic efficiency for glucose production over trehalulose production. MutB D442N favored the transfer reaction, with an isomer preference for isomaltulose.

Upregulation of the Suppressors of Cytokine Signaling 1 and 3 Is Associated with Arrest of Phosphorylated-STAT1 Nuclear Importation and Reduced Innate Response in Denguevirus-Infected Macrophages.

PubMed

Estrada-Jiménez, Tania; Millán-Pérez Peña, Lourdes; Flores-Mendoza, Lilian; Sedeño-Monge, Virginia; Santos-López, Gerardo; Rosas-Murrieta, Nora; Reyes-Carmona, Sandra; Terán-Cabanillas, Eli; Hernández, Jesus; Herrera-Camacho, Irma; Vallejo-Ruiz, Verónica; Reyes-Leyva, Julio

2016-03-01

To clarify whether the suppressors of cytokine signaling (SOCS) are associated with denguevirus (DENV) evasion of the antiviral response, we analyzed the expression kinetics of SOCS1 and SOCS3 and of the antiviral genes MxA and OAS during DENV infection of U937 macrophages that were or not treated with interferon (IFN)-α. DENV infection produced a viral titer three times higher in untreated than in IFN-α-treated cells (p < 0.001 at 72 h postinfection [p.i.]). Partial inhibition of DENV replication was associated with reduced expression of MxA and OAS antiviral genes as well as higher SOCS1 and SOCS3 expression in DENV-infected cells than in cells treated only with IFN-α. Complete loss of phosphorylated-signal transducer and activator of transcription (p-STAT)2 and reduced nuclear importation of p-STAT1 were observed in DENV-infected cells compared to IFN-α treatment that induced p-STAT1 and p-STAT2. Our data thus suggest that overexpression of SOCS1 and SOCS3 induced by DENV infection leads to impairment of antiviral response through the inhibition of STAT functionality.

Development of a yeast heterologous expression cassette based on the promoter and terminator elements of the Eremothecium cymbalariae translational elongation factor 1α (EcTEF1) gene.

PubMed

Linder, Tomas

2018-04-01

A new expression cassette ( EC0 ) consisting of the fused 5' and 3' intergenic regions (IGRs) of the Eremothecium cymbalariae translational elongation factor 1α ( EcTEF1 ) gene was evaluated through expression of the bacterial hygromycin B phosphotransferase ( hph ) resistance gene in the common baker's yeast Saccharomyces cerevisiae . Progressively shorter versions of the hph -containing EC cassette ( hphEC1 though hphEC6 ) with trimmed 5' and 3' EcTEF1 IGRs were tested for their ability to confer resistance to hygromycin B in S. cerevisiae . Hygromycin B resistance was retained in all six generated hphEC variants up to a concentration of 400 mg/L. The hphEC6 cassette was the shortest cassette to be assayed in this study with 366 and 155 bp of the EcTEF1 5' and 3' IGRs, respectively. When tested for deletion of the S. cerevisiae proline oxidase gene PUT1 , the hphEC6 cassette was shown to successfully act as a selection marker on hygromycin B-containing medium. The hphEC6 cassette could be placed immediately adjacent to a kanMX4 G418 disulfate resistance marker without any discernable effect on the ability of the yeast to grow in the presence of both hygromycin B and G418 disulfate. Co-cultivation experiments under non-selective conditions demonstrated that a PUT1 deletion strain carrying the hphEC6 cassette displayed equivalent fitness to an otherwise isogenic PUT1 deletion strain carrying the kanMX4 cassette.

Characterization and immune response expression of the Rig-I-like receptor mda5 in common carp Cyprinus carpio.

PubMed

Zhu, Y Y; Xing, W X; Shan, S J; Zhang, S Q; Li, Y Q; Li, T; An, L; Yang, G W

2016-06-01

In this study, the full-length complementary (c)DNA of common carp Cyprinus carpio melanoma differentiation-associated gene 5 (mda5) was cloned. The complete open reading frame of C. carpio mda5 contained 2982 bp and encodes 993 amino acids. The deduced amino acids contained six functional domains: two caspase activation and recruitment domains (CARD), a conserved restriction domain of bacterial type III restriction enzyme (ResIII), a DExD/H box-containing domain (DEXDc), a helicase super family C-terminal domain (HELICc) and a C-terminal regulatory domain (RD). The mda5 gene was expressed in all tested tissues, with high levels in the gills and spleen, while lower expressed in gonad and blood. The copy numbers of mda5 were increased in the liver, spleen, head kidney and the mucosal-associated immune tissues such as the foregut, hindgut, gills and skin after stimulation with polyinosinic polycytidylic [poly(I:C)] and Aeromonas hydrophila. The myxovirus resistance gene (mx) messenger (m)RNA levels in the spleen, head kidney, foregut and gills were significantly up-regulated after poly(I:C) injection. When injected with poly(I:C), mda5 and mx transcripts were also significantly induced in vitro. These results implied that mda5 might be involved in both antiviral and antibacterial innate immune processes in C. carpio. © 2016 The Authors. Journal of Fish Biology © 2016 The Fisheries Society of the British Isles. © 2016 The Fisheries Society of the British Isles.

Single-Construct Polycistronic Doxycycline-Inducible Vectors Improve Direct Cardiac Reprogramming and Can Be Used to Identify the Critical Timing of Transgene Expression.

PubMed

Umei, Tomohiko C; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

2017-08-19

Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming.

Single-Construct Polycistronic Doxycycline-Inducible Vectors Improve Direct Cardiac Reprogramming and Can Be Used to Identify the Critical Timing of Transgene Expression

PubMed Central

Umei, Tomohiko C.; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

2017-01-01

Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming. PMID:28825623

Maternal recognition of pregnancy and implantation are not associated with an interferon response of the endometrium to the presence of the conceptus in dromedary camel.

PubMed

Abdoon, Ahmed Sabry; Giraud-Delville, Corrine; Kandil, Omaima Mohamed; Kerboeuf-Giraud, Annelye; Eozénou, Caroline; Carvalho, Anais Vitorino; Julian, Skidmore; Sandra, Olivier

2017-03-01

Maternal recognition of pregnancy (MRP) and implantation involve appropriate interactions between the elongating conceptus and the receptive endometrium that will condition development of the feto-placental unit to term. Molecular mechanisms that take place at the conceptus-endometrium interface during early pregnancy have been extensively investigated in domestic ungulates but they are still poorly understood in camelids including the dromedary camel (Camelus dromedarius), a domestic species with important economic and social roles in arid and semi-arid areas. In order to better understand how MRP and implantation take place in the left horn of this species, we investigated expression levels of genes encoding steroid hormones (PGR, ESR1), transcription factors (STAT1, FOXL2), interferon stimulated genes (MX1, MX2, OAS1, RSAD2) including SOCS genes (SOCS1, SOCS2, SOCS3 and CISH), previously identified as conceptus regulated genes in the endometrium of other domestic animals. Using endometrial tissue collected from left and right uterine horns of dromedary camel females that were non pregnant or early pregnant, gene expression of these genes was detected and our results provided first insights on their regulation, showing that (i) conceptus implantation is not associated with an IFN response in the pregnant uterine horn (ii) when regulation of classical interferon-stimulated genes (ISG) occurs, it takes place during the formation of the feto-placental unit, and (iii) gene expression can differ between the left and right uterine horns during implantation and early placentation phase. Additional experiments will be required in dromedary camels to understand the unusual regulation of ISG during implantation as well as to determine the molecular processes that drive the systematic implantation of the elongating conceptus in the left uterine horn. Copyright © 2017 Elsevier Inc. All rights reserved.

Establishment of a New Quality Control and Vaccine Safety Test for Influenza Vaccines and Adjuvants Using Gene Expression Profiling

PubMed Central

Momose, Haruka; Mizukami, Takuo; Kuramitsu, Madoka; Takizawa, Kazuya; Masumi, Atsuko; Araki, Kumiko; Furuhata, Keiko; Yamaguchi, Kazunari; Hamaguchi, Isao

2015-01-01

We have previously identified 17 biomarker genes which were upregulated by whole virion influenza vaccines, and reported that gene expression profiles of these biomarker genes had a good correlation with conventional animal safety tests checking body weight and leukocyte counts. In this study, we have shown that conventional animal tests showed varied and no dose-dependent results in serially diluted bulk materials of influenza HA vaccines. In contrast, dose dependency was clearly shown in the expression profiles of biomarker genes, demonstrating higher sensitivity of gene expression analysis than the current animal safety tests of influenza vaccines. The introduction of branched DNA based-concurrent expression analysis could simplify the complexity of multiple gene expression approach, and could shorten the test period from 7 days to 3 days. Furthermore, upregulation of 10 genes, Zbp1, Mx2, Irf7, Lgals9, Ifi47, Tapbp, Timp1, Trafd1, Psmb9, and Tap2, was seen upon virosomal-adjuvanted vaccine treatment, indicating that these biomarkers could be useful for the safety control of virosomal-adjuvanted vaccines. In summary, profiling biomarker gene expression could be a useful, rapid, and highly sensitive method of animal safety testing compared with conventional methods, and could be used to evaluate the safety of various types of influenza vaccines, including adjuvanted vaccine. PMID:25909814

Rational site-directed mutations of the LLP-1 and LLP-2 lentivirus lytic peptide domains in the intracytoplasmic tail of human immunodeficiency virus type 1 gp41 indicate common functions in cell-cell fusion but distinct roles in virion envelope incorporation.

PubMed

Kalia, Vandana; Sarkar, Surojit; Gupta, Phalguni; Montelaro, Ronald C

2003-03-01

Two highly conserved cationic amphipathic alpha-helical motifs, designated lentivirus lytic peptides 1 and 2 (LLP-1 and LLP-2), have been characterized in the carboxyl terminus of the transmembrane (TM) envelope glycoprotein (Env) of lentiviruses. Although various properties have been attributed to these domains, their structural and functional significance is not clearly understood. To determine the specific contributions of the Env LLP domains to Env expression, processing, and incorporation and to viral replication and syncytium induction, site-directed LLP mutants of a primary dualtropic infectious human immunodeficiency virus type 1 (HIV-1) isolate (ME46) were examined. Substitutions were made for highly conserved arginine residues in either the LLP-1 or LLP-2 domain (MX1 or MX2, respectively) or in both domains (MX4). The HIV-1 mutants with altered LLP domains demonstrated distinct phenotypes. The LLP-1 mutants (MX1 and MX4) were replication defective and showed an average of 85% decrease in infectivity, which was associated with an evident decrease in gp41 incorporation into virions without a significant decrease in Env expression or processing in transfected 293T cells. In contrast, MX2 virus was replication competent and incorporated a full complement of Env into its virions, indicating a differential role for the LLP-1 domain in Env incorporation. Interestingly, the replication-competent MX2 virus was impaired in its ability to induce syncytia in T-cell lines. This defect in cell-cell fusion did not correlate with apparent defects in the levels of cell surface Env expression, oligomerization, or conformation. The lack of syncytium formation, however, correlated with a decrease of about 90% in MX2 Env fusogenicity compared to that of wild-type Env in quantitative luciferase-based cell-cell fusion assays. The LLP-1 mutant MX1 and MX4 Envs also exhibited an average of 80% decrease in fusogenicity. Altogether, these results demonstrate for the first time that the highly conserved LLP domains perform critical but distinct functions in Env incorporation and fusogenicity.

Cardiac fibroblast transcriptome analyses support a role for interferogenic, profibrotic, and inflammatory genes in anti-SSA/Ro-associated congenital heart block.

PubMed

Clancy, Robert M; Markham, Androo J; Jackson, Tanisha; Rasmussen, Sara E; Blumenberg, Miroslav; Buyon, Jill P

2017-09-01

The signature lesion of SSA/Ro autoantibody-associated congenital heart block (CHB) is fibrosis and a macrophage infiltrate, supporting an experimental focus on cues influencing the fibroblast component. The transcriptomes of human fetal cardiac fibroblasts were analyzed using two complementary approaches. Cardiac injury conditions were simulated in vitro by incubating human fetal cardiac fibroblasts with supernatants from macrophages transfected with the SSA/Ro-associated noncoding Y ssRNA. The top 10 upregulated transcripts in the stimulated fibroblasts reflected a type I interferon (IFN) response [e.g., IFN-induced protein 44-like (IFI44L), of MX dynamin-like GTPase (MX)1, MX2, and radical S -adenosyl methionine domain containing 2 (Rsad2)]. Within the fibrotic pathway, transcript levels of endothelin-1 (EDN1), phosphodiesterase (PDE)4D, chemokine (C-X-C motif) ligand (CXCL)2, and CXCL3 were upregulated, while others, including adenomedullin, RAP guanine nucleotide exchange factor 3 (RAPGEF3), tissue inhibitor of metalloproteinase (TIMP)1, TIMP3, and dual specificity phosphatase 1, were downregulated. Agnostic Database for Annotation, Visualization and Integrated Discovery analysis revealed a significant increase in inflammatory genes, including complement C3A receptor 1 (C3AR1), F2R-like thrombin/trypsin receptor 3, and neutrophil cytosolic factor 2. In addition, stimulated fibroblasts expressed high levels of phospho-MADS box transcription enhancer factor 2 [a substrate of MAPK5 (ERK5)], which was inhibited by BIX-02189, a specific inhibitor of ERK5. Translation to human disease leveraged an unprecedented opportunity to interrogate the transcriptome of fibroblasts freshly isolated and cell sorted without stimulation from a fetal heart with CHB and a matched healthy heart. Consistent with the in vitro data, five IFN response genes were among the top 10 most highly expressed transcripts in CHB fibroblasts. In addition, the expression of matrix-related genes reflected fibrosis. These data support the novel finding that cardiac injury in CHB may occur secondary to abnormal remodeling due in part to upregulation of type 1 IFN response genes. NEW & NOTEWORTHY Congenital heart block is a rare disease of the fetal heart associated with maternal anti-Ro autoantibodies which can result in death and for survivors, lifelong pacing. This study provides in vivo and in vitro transcriptome-support that injury may be mediated by an effect of Type I Interferon on fetal fibroblasts. Copyright © 2017 the American Physiological Society.

Reduced expression of selective immune-related genes in silver catfish (Rhamdia quelen) monocytes exposed to atrazine.

PubMed

Kirsten, Karina Schreiner; Canova, Raíssa; Soveral, Lucas de Figueiredo; Friedrich, Maria Tereza; Frandoloso, Rafael; Kreutz, Luiz Carlos

2017-05-01

The effect of atrazine (ATZ) and its metabolites on aquatic vertebrate species has been a matter of concern to researchers and environmentalist. In this study we exposed head kidney monocytes to sublethal concentrations of atrazine (1 and 10 μg/ml -1 ), corresponding to 1% and 10% of the LC 50-96h , to evaluate the expression of immune-related genes central to immune stimulation. The mRNA levels of TNF-α, Mieloperoxidase and Mx genes were significantly reduced following 24 h exposure to both concentrations of ATZ. The mRNA levels of iRAK4 were reduced only at the higher ATZ concentration and the mRNA levels of IL-1β were not affected. The results reported here support our previous findings on the immunosuppressive effect of ATZ indicating its potential to interfere with the expression of immune-related genes, and strengthen the need to regulate ATZ usage aiming to preserve animal and human health. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mx1, Mx2 and Mx3 proteins from the gilthead seabream (Sparus aurata) show in vitro antiviral activity against RNA and DNA viruses.

PubMed

Fernández-Trujillo, M A; García-Rosado, E; Alonso, M C; Castro, D; Álvarez, M C; Béjar, J

2013-12-01

Mx proteins are important components of the antiviral innate immune response mediated by type I interferon. Classically, these proteins have been considered to be triggered by viral RNA, thus showing activity against RNA viruses. Actually, three Mx proteins (SauMx1, SauMx2 and SauMx3) from gilthead seabream (Sparus aurata) have previously shown antiviral activity against a dsRNA virus: the infectious pancreatic necrosis virus (IPNV) in vitro. For further characterizing their antiviral spectrum, the activity of SauMx proteins were tested against three different viral pathogens of fish: the lymphocystis disease virus (LCDV, a dsDNA virus), a pathogen of gilthead seabream; the viral haemorrhagic septicaemia virus (VHSV, a ssRNA virus), to which gilthead seabream is considered a reservoir species; and the European sheatfish virus (ESV, a dsDNA virus), that has not been detected in gilthead seabream to date. Three clonal populations of CHSE-214 cells developed in a previous study, stably expressing SauMx1, SauMx2 and SauMx3, respectively, were challenged with the three viruses. Results combining cytopathic effects and virus yield reduction assays showed that SauMx1 protected the cells against VHSV and LCDV, SauMx2 protected against ESV and LCDV, and SauMx3 showed activity only against VHSV. This study, besides confirming the antiviral activity of the three gilthead seabream Mx proteins, is the first report of the protective effect of a fish Mx against DNA viruses. Additionally, it discloses a clear specificity between Mx proteins and virus targets, supporting the idea that the relationship between virus and Mx proteins is finely tuned. Copyright © 2013 Elsevier Ltd. All rights reserved.

An uncleaved signal peptide directs the Malus xiaojinensis iron transporter protein Mx IRT1 into the ER for the PM secretory pathway.

PubMed

Zhang, Peng; Tan, Song; Berry, James O; Li, Peng; Ren, Na; Li, Shuang; Yang, Guang; Wang, Wei-Bing; Qi, Xiao-Ting; Yin, Li-Ping

2014-11-07

Malus xiaojinensis iron-regulated transporter 1 (Mx IRT1) is a highly effective inducible iron transporter in the iron efficient plant Malus xiaojinensis. As a multi-pass integral plasma membrane (PM) protein, Mx IRT1 is predicted to consist of eight transmembrane domains, with a putative N-terminal signal peptide (SP) of 1-29 amino acids. To explore the role of the putative SP, constructs expressing Mx IRT1 (with an intact SP) and Mx DsIRT1 (with a deleted SP) were prepared for expression in Arabidopsis and in yeast. Mx IRT1 could rescue the iron-deficiency phenotype of an Arabidopsis irt1 mutant, and complement the iron-limited growth defect of the yeast mutant DEY 1453 (fet3fet4). Furthermore, fluorescence analysis indicated that a chimeric Mx IRT1-eGFP (enhanced Green Fluorescent Protein) construct was translocated into the ER (Endoplasmic reticulum) for the PM sorting pathway. In contrast, the SP-deleted Mx DsIRT1 could not rescue either of the mutant phenotypes, nor direct transport of the GFP signal into the ER. Interestingly, immunoblot analysis indicated that the SP was not cleaved from the mature protein following transport into the ER. Taken together, data presented here provides strong evidence that an uncleaved SP determines ER-targeting of Mx IRT1 during the initial sorting stage, thereby enabling the subsequent transport and integration of this protein into the PM for its crucial role in iron uptake.

Comparative analysis of selected innate immune-related genes following infection of immortal DF-1 cells with highly pathogenic (H5N1) and low pathogenic (H9N2) avian influenza viruses.

PubMed

Liu, Ai-Ling; Li, Yu-Feng; Qi, Wenbao; Ma, Xiu-Li; Yu, Ke-Xiang; Huang, Bing; Liao, Ming; Li, Feng; Pan, Jie; Song, Min-Xun

2015-04-01

H5N1 and H9N2 viruses are important causes of avian influenza in China. H5N1 is typically associated with severe to fatal disease in poultry, while H9N2 is usually associated with mild disease. Differences in viral virulence prompted us to investigate whether innate immune responses would be differentially regulated following infection by H5N1 and H9N2 viruses. To address this hypothesis, expression of a panel of innate immune-related genes including IFN-α, IFN-β, Mx1, OASL, ISG12, IFIT5, IRF7, USP18, SST, and KHSRP in immortal DF-1 cells following H5N1 and H9N2 infection was analyzed and compared by real-time quantitative RT-PCR. Cells infected by either virus overall exhibited a similar expression profile for four ISGs (Mx1, OASL, ISG12, and IFIT5), IFN-α, IFN-β, and SST gene. However, two immune-regulatory genes (IRF7 and KHSRP) were not responsive to highly pathogenic H5N1 infection but were strongly up-regulated in DF-1 cells infected with low pathogenic H9N2 infection. The subtype-dependent host response observed in this study offers new insights into the potential roles of IRF7 and KHSRP in control and modulation of the replication and virulence of different subtypes or strains of avian influenza A virus.

Evolution and Antiviral Specificities of Interferon-Induced Mx Proteins of Bats against Ebola, Influenza, and Other RNA Viruses

PubMed Central

Fuchs, Jonas; Hölzer, Martin; Schilling, Mirjam; Patzina, Corinna; Schoen, Andreas; Zimmer, Gert; Marz, Manja; Müller, Marcel A.

2017-01-01

ABSTRACT Bats serve as a reservoir for various, often zoonotic viruses, including significant human pathogens such as Ebola and influenza viruses. However, for unknown reasons, viral infections rarely cause clinical symptoms in bats. A tight control of viral replication by the host innate immune defense might contribute to this phenomenon. Transcriptomic studies revealed the presence of the interferon-induced antiviral myxovirus resistance (Mx) proteins in bats, but detailed functional aspects have not been assessed. To provide evidence that bat Mx proteins might act as key factors to control viral replication we cloned Mx1 cDNAs from three bat families, Pteropodidae, Phyllostomidae, and Vespertilionidae. Phylogenetically these bat Mx1 genes cluster closely with their human ortholog MxA. Using transfected cell cultures, minireplicon systems, virus-like particles, and virus infections, we determined the antiviral potential of the bat Mx1 proteins. Bat Mx1 significantly reduced the polymerase activity of viruses circulating in bats, including Ebola and influenza A-like viruses. The related Thogoto virus, however, which is not known to infect bats, was not inhibited by bat Mx1. Further, we provide evidence for positive selection in bat Mx1 genes that might explain species-specific antiviral activities of these proteins. Together, our data suggest a role for Mx1 in controlling these viruses in their bat hosts. IMPORTANCE Bats are a natural reservoir for various viruses that rarely cause clinical symptoms in bats but are dangerous zoonotic pathogens, like Ebola or rabies virus. It has been hypothesized that the interferon system might play a key role in controlling viral replication in bats. We speculate that the interferon-induced Mx proteins might be key antiviral factors of bats and have coevolved with bat-borne viruses. This study evaluated for the first time a large set of bat Mx1 proteins spanning three major bat families for their antiviral potential, including activity against Ebola virus and bat influenza A-like virus, and we describe here their phylogenetic relationship, revealing patterns of positive selection that suggest a coevolution with viral pathogens. By understanding the molecular mechanisms of the innate resistance of bats against viral diseases, we might gain important insights into how to prevent and fight human zoonotic infections caused by bat-borne viruses. PMID:28490593

Evolution and Antiviral Specificities of Interferon-Induced Mx Proteins of Bats against Ebola, Influenza, and Other RNA Viruses.

PubMed

Fuchs, Jonas; Hölzer, Martin; Schilling, Mirjam; Patzina, Corinna; Schoen, Andreas; Hoenen, Thomas; Zimmer, Gert; Marz, Manja; Weber, Friedemann; Müller, Marcel A; Kochs, Georg

2017-08-01

Bats serve as a reservoir for various, often zoonotic viruses, including significant human pathogens such as Ebola and influenza viruses. However, for unknown reasons, viral infections rarely cause clinical symptoms in bats. A tight control of viral replication by the host innate immune defense might contribute to this phenomenon. Transcriptomic studies revealed the presence of the interferon-induced antiviral myxovirus resistance (Mx) proteins in bats, but detailed functional aspects have not been assessed. To provide evidence that bat Mx proteins might act as key factors to control viral replication we cloned Mx1 cDNAs from three bat families, Pteropodidae, Phyllostomidae, and Vespertilionidae. Phylogenetically these bat Mx1 genes cluster closely with their human ortholog MxA. Using transfected cell cultures, minireplicon systems, virus-like particles, and virus infections, we determined the antiviral potential of the bat Mx1 proteins. Bat Mx1 significantly reduced the polymerase activity of viruses circulating in bats, including Ebola and influenza A-like viruses. The related Thogoto virus, however, which is not known to infect bats, was not inhibited by bat Mx1. Further, we provide evidence for positive selection in bat Mx1 genes that might explain species-specific antiviral activities of these proteins. Together, our data suggest a role for Mx1 in controlling these viruses in their bat hosts. IMPORTANCE Bats are a natural reservoir for various viruses that rarely cause clinical symptoms in bats but are dangerous zoonotic pathogens, like Ebola or rabies virus. It has been hypothesized that the interferon system might play a key role in controlling viral replication in bats. We speculate that the interferon-induced Mx proteins might be key antiviral factors of bats and have coevolved with bat-borne viruses. This study evaluated for the first time a large set of bat Mx1 proteins spanning three major bat families for their antiviral potential, including activity against Ebola virus and bat influenza A-like virus, and we describe here their phylogenetic relationship, revealing patterns of positive selection that suggest a coevolution with viral pathogens. By understanding the molecular mechanisms of the innate resistance of bats against viral diseases, we might gain important insights into how to prevent and fight human zoonotic infections caused by bat-borne viruses. Copyright © 2017 American Society for Microbiology.

Induction of Interferon-Stimulated Genes by Simian Virus 40 T Antigens

PubMed Central

Rathi, Abhilasha V.; Cantalupo, Paul G.; Sarkar, Saumendra N.; Pipas, James M.

2010-01-01

Simian virus 40 (SV40) large T antigen (TAg) is a multifunctional oncoprotein essential for productive viral infection and for cellular transformation. We have used microarray analysis to examine the global changes in cellular gene expression induced by wild-type T antigen (TAgwt) and TAg-mutants in mouse embryo fibroblasts (MEFs). The expression profile of approximately 800 cellular genes was altered by TAgwt and a truncated TAg (TAgN136), including many genes that influence cell cycle, DNA-replication, transcription, chromatin structure and DNA repair. Unexpectedly, we found a significant number of immune response genes upregulated by TAgwt including many interferon stimulated genes (ISGs) such as ISG56, OAS, Rsad2, Ifi27 and Mx1. Additionally, we also observed activation of STAT1 by TAgwt. Our genetic studies using several TAg mutants reveal an unexplored function of TAg and indicate that the LXCXE motif and p53 binding are required for the upregulation of ISGs. PMID:20692676

SurvExpress: an online biomarker validation tool and database for cancer gene expression data using survival analysis.

PubMed

Aguirre-Gamboa, Raul; Gomez-Rueda, Hugo; Martínez-Ledesma, Emmanuel; Martínez-Torteya, Antonio; Chacolla-Huaringa, Rafael; Rodriguez-Barrientos, Alberto; Tamez-Peña, José G; Treviño, Victor

2013-01-01

Validation of multi-gene biomarkers for clinical outcomes is one of the most important issues for cancer prognosis. An important source of information for virtual validation is the high number of available cancer datasets. Nevertheless, assessing the prognostic performance of a gene expression signature along datasets is a difficult task for Biologists and Physicians and also time-consuming for Statisticians and Bioinformaticians. Therefore, to facilitate performance comparisons and validations of survival biomarkers for cancer outcomes, we developed SurvExpress, a cancer-wide gene expression database with clinical outcomes and a web-based tool that provides survival analysis and risk assessment of cancer datasets. The main input of SurvExpress is only the biomarker gene list. We generated a cancer database collecting more than 20,000 samples and 130 datasets with censored clinical information covering tumors over 20 tissues. We implemented a web interface to perform biomarker validation and comparisons in this database, where a multivariate survival analysis can be accomplished in about one minute. We show the utility and simplicity of SurvExpress in two biomarker applications for breast and lung cancer. Compared to other tools, SurvExpress is the largest, most versatile, and quickest free tool available. SurvExpress web can be accessed in http://bioinformatica.mty.itesm.mx/SurvExpress (a tutorial is included). The website was implemented in JSP, JavaScript, MySQL, and R.

SurvExpress: An Online Biomarker Validation Tool and Database for Cancer Gene Expression Data Using Survival Analysis

PubMed Central

Aguirre-Gamboa, Raul; Gomez-Rueda, Hugo; Martínez-Ledesma, Emmanuel; Martínez-Torteya, Antonio; Chacolla-Huaringa, Rafael; Rodriguez-Barrientos, Alberto; Tamez-Peña, José G.; Treviño, Victor

2013-01-01

Validation of multi-gene biomarkers for clinical outcomes is one of the most important issues for cancer prognosis. An important source of information for virtual validation is the high number of available cancer datasets. Nevertheless, assessing the prognostic performance of a gene expression signature along datasets is a difficult task for Biologists and Physicians and also time-consuming for Statisticians and Bioinformaticians. Therefore, to facilitate performance comparisons and validations of survival biomarkers for cancer outcomes, we developed SurvExpress, a cancer-wide gene expression database with clinical outcomes and a web-based tool that provides survival analysis and risk assessment of cancer datasets. The main input of SurvExpress is only the biomarker gene list. We generated a cancer database collecting more than 20,000 samples and 130 datasets with censored clinical information covering tumors over 20 tissues. We implemented a web interface to perform biomarker validation and comparisons in this database, where a multivariate survival analysis can be accomplished in about one minute. We show the utility and simplicity of SurvExpress in two biomarker applications for breast and lung cancer. Compared to other tools, SurvExpress is the largest, most versatile, and quickest free tool available. SurvExpress web can be accessed in http://bioinformatica.mty.itesm.mx/SurvExpress (a tutorial is included). The website was implemented in JSP, JavaScript, MySQL, and R. PMID:24066126

PML mediates the interferon-induced antiviral state against a complex retrovirus via its association with the viral transactivator

PubMed Central

Regad, Tarik; Saib, Ali; Lallemand-Breitenbach, Valérie; Pandolfi, Pier Paolo; de Thé, Hugues; Chelbi-Alix, Mounira K.

2001-01-01

The promyelocytic leukaemia (PML) protein localizes in the nucleus both in the nucleoplasm and in matrix-associated multiprotein complexes known as nuclear bodies (NBs). The number and the intensity of PML NBs increase in response to interferon (IFN). Overexpression of PML affects the replication of vesicular stomatitis virus and influenza virus. However, PML has a less powerful antiviral activity against these viruses than the IFN mediator MxA. Here, we show that overexpression of PML, but not that of Mx1 or MxA, leads to a drastic decrease of a complex retrovirus, the human foamy virus (HFV), gene expression. PML represses HFV transcription by complexing the HFV transactivator, Tas, preventing its direct binding to viral DNA. This physical interaction requires the N-terminal region of Tas and the RING finger of PML, but does not necessitate PML localization in NBs. Finally, we show that IFN treatment inhibits HFV replication in wild-type but not in PML–/– cells. These findings point to a role for PML in transcriptional repression and suggest that PML could play a key role in mediating an IFN-induced antiviral state against a complex retrovirus. PMID:11432836

Modeling Host Genetic Regulation of Influenza Pathogenesis in the Collaborative Cross

PubMed Central

Ferris, Martin T.; Aylor, David L.; Bottomly, Daniel; Whitmore, Alan C.; Aicher, Lauri D.; Bell, Timothy A.; Bradel-Tretheway, Birgit; Bryan, Janine T.; Buus, Ryan J.; Gralinski, Lisa E.; Haagmans, Bart L.; McMillan, Leonard; Miller, Darla R.; Rosenzweig, Elizabeth; Valdar, William; Wang, Jeremy; Churchill, Gary A.; Threadgill, David W.; McWeeney, Shannon K.; Katze, Michael G.; Pardo-Manuel de Villena, Fernando; Baric, Ralph S.; Heise, Mark T.

2013-01-01

Genetic variation contributes to host responses and outcomes following infection by influenza A virus or other viral infections. Yet narrow windows of disease symptoms and confounding environmental factors have made it difficult to identify polymorphic genes that contribute to differential disease outcomes in human populations. Therefore, to control for these confounding environmental variables in a system that models the levels of genetic diversity found in outbred populations such as humans, we used incipient lines of the highly genetically diverse Collaborative Cross (CC) recombinant inbred (RI) panel (the pre-CC population) to study how genetic variation impacts influenza associated disease across a genetically diverse population. A wide range of variation in influenza disease related phenotypes including virus replication, virus-induced inflammation, and weight loss was observed. Many of the disease associated phenotypes were correlated, with viral replication and virus-induced inflammation being predictors of virus-induced weight loss. Despite these correlations, pre-CC mice with unique and novel disease phenotype combinations were observed. We also identified sets of transcripts (modules) that were correlated with aspects of disease. In order to identify how host genetic polymorphisms contribute to the observed variation in disease, we conducted quantitative trait loci (QTL) mapping. We identified several QTL contributing to specific aspects of the host response including virus-induced weight loss, titer, pulmonary edema, neutrophil recruitment to the airways, and transcriptional expression. Existing whole-genome sequence data was applied to identify high priority candidate genes within QTL regions. A key host response QTL was located at the site of the known anti-influenza Mx1 gene. We sequenced the coding regions of Mx1 in the eight CC founder strains, and identified a novel Mx1 allele that showed reduced ability to inhibit viral replication, while maintaining protection from weight loss. PMID:23468633

Immunogenetic Factors Affecting Susceptibility of Humans and Rodents to Hantaviruses and the Clinical Course of Hantaviral Disease in Humans

PubMed Central

Charbonnel, Nathalie; Pagès, Marie; Sironen, Tarja; Henttonen, Heikki; Vapalahti, Olli; Mustonen, Jukka; Vaheri, Antti

2014-01-01

We reviewed the associations of immunity-related genes with susceptibility of humans and rodents to hantaviruses, and with severity of hantaviral diseases in humans. Several class I and class II HLA haplotypes were linked with severe or benign hantavirus infections, and these haplotypes varied among localities and hantaviruses. The polymorphism of other immunity-related genes including the C4A gene and a high-producing genotype of TNF gene associated with severe PUUV infection. Additional genes that may contribute to disease or to PUUV infection severity include non-carriage of the interleukin-1 receptor antagonist (IL-1RA) allele 2 and IL-1β (-511) allele 2, polymorphisms of plasminogen activator inhibitor (PAI-1) and platelet GP1a. In addition, immunogenetic studies have been conducted to identify mechanisms that could be linked with the persistence/clearance of hantaviruses in reservoirs. Persistence was associated during experimental infections with an upregulation of anti-inflammatory responses. Using natural rodent population samples, polymorphisms and/or expression levels of several genes have been analyzed. These genes were selected based on the literature of rodent or human/hantavirus interactions (some Mhc class II genes, Tnf promoter, and genes encoding the proteins TLR4, TLR7, Mx2 and β3 integrin). The comparison of genetic differentiation estimated between bank vole populations sampled over Europe, at neutral and candidate genes, has allowed to evidence signatures of selection for Tnf, Mx2 and the Drb Mhc class II genes. Altogether, these results corroborated the hypothesis of an evolution of tolerance strategies in rodents. We finally discuss the importance of these results from the medical and epidemiological perspectives. PMID:24859344

Molecular cloning, polyclonal antibody preparation, and characterization of a functional iron-related transcription factor IRO2 from Malus xiaojinensis.

PubMed

Yin, Lili; Wang, Yi; Yan, Mudan; Zhang, Xinzhong; Pan, Haifa; Xu, Xuefeng; Han, Zhenhai

2013-06-01

Transcription factors play important roles in plant growth and responses to environmental stresses. In this study, a novel basic helix-loop-helix iron-related transcription factor, IRO2, containing a 762-bp open reading frame and encoding 253 amino acids, was cloned from the iron-efficient genotype of Malus xiaojinensis. Localization analyses in onion showed that the MxIRO2 protein was targeted to the nucleus and activation studies in yeast indicated MxIRO2-BD had weak transcriptional activation activity. Prokaryotic expression of MxIRO2 in Escherichia coli BL21 (DE3) pLysS cells resulted in high expression levels of the protein when induced with isopropyl-β-d-thiogalactoside. The fusion protein was purified using Ni-NTA His-bind resin, and the purified MxIRO2-His fusion protein was used as the antigen to immunize a New Zealand rabbit. The resulting antiserum was purified by precipitation with 50% saturated ammonium sulfate and DEAE Sephadex A-50 chromatography to obtain the immunoglobulin G fraction. The expression of MxIRO2 in roots and leaves of M. xiaojinensis seedlings under iron deficiency was determined. The results indicated that MxIRO2 was induced in both roots and leaves under iron deficiency. In these experimental conditions, the transcription and translation levels first increased and then decreased under iron deficiency. This work offers an important basis for further investigating the mechanisms of fruit tree adaptation to iron deficiency. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Retinoic acid induces signal transducer and activator of transcription (STAT) 1, STAT2, and p48 expression in myeloid leukemia cells and enhances their responsiveness to interferons.

PubMed

Matikainen, S; Ronni, T; Lehtonen, A; Sareneva, T; Melén, K; Nordling, S; Levy, D E; Julkunen, I

1997-06-01

IFNs are antiproliferative cytokines that have growth-inhibitory effects on various normal and malignant cells. Therefore, they have been used in the treatment of certain forms of cancer, such as chronic myelogenous leukemia and hairy cell leukemia. However, there is little evidence that IFNs would be effective in the treatment of acute myelogenous leukemia, and molecular mechanisms underlying IFN unresponsiveness have not been clarified. Here we have studied the activation and induction of IFN-specific transcription factors signal transducer and activator of transcription (STAT) 1, STAT2, and p48 in all-trans-retinoic acid (ATRA)-differentiated myeloid leukemia cells using promyelocytic NB4, myeloblastic HL-60, and monoblastic U937 cells as model systems. These cells respond to ATRA by growth inhibition and differentiation. We show that in undifferentiated NB4 cells, 2',5'-oligoadenylate synthetase and MxB gene expression is not activated by IFN-alpha, possibly due to a relative lack of signaling molecules, especially p48 protein. However, during ATRA-induced differentiation, steady-state STAT1, STAT2, and especially p48 mRNA and corresponding protein levels were elevated both in NB4 and U937 cells, apparently correlating to an enhanced responsiveness of these cells to IFNs. ATRA treatment of NB4 cells sensitized them to IFN action as seen by increased IFN-gamma activation site DNA-binding activity or by efficient formation of IFN-alpha-specific ISGF3 complex and subsequent oligoadenylate synthetase and MxB gene expression. Lack of p48 expression could be one of the mechanisms of promyelocytic leukemia cell escape from growth-inhibitory effects of IFN-alpha.

Antagonist-mediated down-regulation of toll-like receptors increases the prevalence of human papillomavirus infection in systemic lupus erythematosus

PubMed Central

2012-01-01

Introduction Prevalence of an abnormal Papanicolaou smear was significantly increased in lupus patients in cross-sectional studies, associated with a higher prevalence of high-risk human papillomavirus (HPV) infection. The nucleic acid-specific Toll-like receptors (TLRs) locate at the endolysosomal compartments and trigger the induction of cytokines for the innate immune response. This study evaluated whether abnormal host innate immune response in lupus patients may enhance HPV persistence. Methods Protein levels of TLRs 3, 7, 8 and 9 in cervical epithelial cells of lupus patients and controls with or without HPV infection were assessed using flow cytometry. Characteristics associated with the differential expression of TLRs in systemic lupus erythematosus (SLE) were elucidated. The effect and interferon-stimulated genes (ISGs) (ISG15 and Mx-1) gene expressions were then measured in oncogenic HeLa (HPV18), CaSki (HPV) and C33A (HPV negative) cell lines using flow cytometry and quantitative real-time PCR. Ex vivo productions of cytokines and interferon-gamma (IFN-γ) upon TLR ligands stimulations were subsequently measured using cytometric bead array and ELISA. Results For subjects with HPV infection, levels of TLR3 and TLR7 were significantly lower in lupus patients compared with controls. Significantly decreased TLRs 7, 8 and 9 levels were observed in HPV-negative SLE compared to healthy controls. For SLE with and without HPV infection, TLR7 and 9 levels were significantly lower in infected SLE than those in HPV-negative patients. Independent explanatory variables associated with down-regulation of TLR7 level included HPV infection and a higher cumulative dose of prednisolone; while a higher cumulative dose of hydroxychloroquine and HPV infection were associated with down-regulation of TLR9 level. In cervical cell lines, TLRs 3, 7, 8, 9 protein levels and antiviral ISG15 and Mx-1 gene expressions were inhibited in two oncogenic HPV types. Functional data showed that the induction of pro-inflammatory cytokines by TLR ligands (R837, ssRNA and ODN2395) was greatly impaired in CaSki and HeLa than C33A cells. Conclusions In conclusion, prednisolone and TLR antagonist (hydroxychloroquine) may down-regulate protein levels of TLR7 and TLR9 in lupus patients, thereby decreasing the innate immune response against HPV infection. Upon infection, HPV further down-regulate TLR7 and 9 levels for viral persistence. Furthermore, reduction of nucleic acid-sensing TLRs 7, 8 and 9 in carcinogenic HPVs ensures that the expression of inducible pro-inflammatory cytokines is minimized to prevent the expression of antiviral ISGs (ISG15 and Mx-1) on a biologically relevant antiviral response. PMID:22513098

Transcriptomic Analysis of the Innate Antiviral Immune Response in Porcine Intestinal Epithelial Cells: Influence of Immunobiotic Lactobacilli

PubMed Central

Albarracin, Leonardo; Kobayashi, Hisakazu; Iida, Hikaru; Sato, Nana; Nochi, Tomonori; Aso, Hisashi; Salva, Susana; Alvarez, Susana; Kitazawa, Haruki; Villena, Julio

2017-01-01

Lactobacillus rhamnosus CRL1505 and Lactobacillus plantarum CRL1506 are immunobiotic strains able to increase protection against viral intestinal infections as demonstrated in animal models and humans. To gain insight into the host–immunobiotic interaction, the transcriptomic response of porcine intestinal epithelial (PIE) cells to the challenge with viral molecular associated pattern poly(I:C) and the changes in the transcriptomic profile induced by the immunobiotics strains CRL1505 and CRL1506 were investigated in this work. By using microarray technology and reverse transcription PCR, we obtained a global overview of the immune genes involved in the innate antiviral immune response in PIE cells. Stimulation of PIE cells with poly(I:C) significantly increased the expression of IFN-α and IFN-β, several interferon-stimulated genes, cytokines, chemokines, adhesion molecules, and genes involved in prostaglandin biosynthesis. It was also determined that lactobacilli differently modulated immune gene expression in poly(I:C)-challenged PIE cells. Most notable changes were found in antiviral factors (IFN-α, IFN-β, NPLR3, OAS1, OASL, MX2, and RNASEL) and cytokines/chemokines (IL-1β, IL-6, CCL4, CCL5, and CXCL10) that were significantly increased in lactobacilli-treated PIE cells. Immunobiotics reduced the expression of IL-15 and RAE1 genes that mediate poly(I:C) inflammatory damage. In addition, lactobacilli treatments increased the expression PLA2G4A, PTGES, and PTGS2 that are involved in prostaglandin E2 biosynthesis. L. rhamnosus CRL1505 and L. plantarum CRL1506 showed quantitative and qualitative differences in their capacities to modulate the innate antiviral immune response in PIE cells, which would explain the higher capacity of the CRL1505 strain when compared to CRL1506 to protect against viral infection and inflammatory damage in vivo. These results provided valuable information for the deeper understanding of the host–immunobiotic interaction and their effect on antiviral immunity. The comprehensive transcriptomic analyses successfully identified a group of genes (IFN-β, RIG1, RNASEL, MX2, A20, IL27, CXCL5, CCL4, PTGES, and PTGER4), which can be used as prospective biomarkers for the screening of new antiviral immunobiotics in PIE cells and for the development of novel functional food and feeds, which may help to prevent viral infections. PMID:28210256

Transcriptomic Analysis of the Innate Antiviral Immune Response in Porcine Intestinal Epithelial Cells: Influence of Immunobiotic Lactobacilli.

PubMed

Albarracin, Leonardo; Kobayashi, Hisakazu; Iida, Hikaru; Sato, Nana; Nochi, Tomonori; Aso, Hisashi; Salva, Susana; Alvarez, Susana; Kitazawa, Haruki; Villena, Julio

2017-01-01

Lactobacillus rhamnosus CRL1505 and Lactobacillus plantarum CRL1506 are immunobiotic strains able to increase protection against viral intestinal infections as demonstrated in animal models and humans. To gain insight into the host-immunobiotic interaction, the transcriptomic response of porcine intestinal epithelial (PIE) cells to the challenge with viral molecular associated pattern poly(I:C) and the changes in the transcriptomic profile induced by the immunobiotics strains CRL1505 and CRL1506 were investigated in this work. By using microarray technology and reverse transcription PCR, we obtained a global overview of the immune genes involved in the innate antiviral immune response in PIE cells. Stimulation of PIE cells with poly(I:C) significantly increased the expression of IFN- α and IFN- β, several interferon-stimulated genes, cytokines, chemokines, adhesion molecules, and genes involved in prostaglandin biosynthesis. It was also determined that lactobacilli differently modulated immune gene expression in poly(I:C)-challenged PIE cells. Most notable changes were found in antiviral factors ( IFN- α, IFN- β, NPLR3, OAS1, OASL, MX2 , and RNASEL ) and cytokines/chemokines ( IL-1 β, IL-6, CCL4, CCL5 , and CXCL10 ) that were significantly increased in lactobacilli-treated PIE cells. Immunobiotics reduced the expression of IL-15 and RAE1 genes that mediate poly(I:C) inflammatory damage. In addition, lactobacilli treatments increased the expression PLA2G4A, PTGES , and PTGS2 that are involved in prostaglandin E2 biosynthesis . L. rhamnosus CRL1505 and L. plantarum CRL1506 showed quantitative and qualitative differences in their capacities to modulate the innate antiviral immune response in PIE cells, which would explain the higher capacity of the CRL1505 strain when compared to CRL1506 to protect against viral infection and inflammatory damage in vivo . These results provided valuable information for the deeper understanding of the host-immunobiotic interaction and their effect on antiviral immunity. The comprehensive transcriptomic analyses successfully identified a group of genes ( IFN- β, RIG1, RNASEL, MX2, A20, IL27, CXCL5, CCL4, PTGES , and PTGER4 ), which can be used as prospective biomarkers for the screening of new antiviral immunobiotics in PIE cells and for the development of novel functional food and feeds, which may help to prevent viral infections.

Inhibitory mechanism of five natural flavonoids against murine norovirus.

PubMed

Seo, Dong Joo; Choi, Changsun

2017-07-01

Human noroviruses (HuNoV), which are responsible for acute gastroenteritis, are becoming a serious public health concern worldwide. Since no effective antiviral drug or vaccine for HuNoV has been developed yet, some natural extracts and their active components have been investigated for their ability to inhibit noroviruses. However, their exact antiviral mechanisms have not been investigated. This study was performed to investigate the expression of interferon (IFN)-α, IFN-λ, tumor necrosis factor-α (TNF-α), Mx, and zinc finger CCCH type antiviral protein 1 (ZAP), 2'-5' oligo (A) synthetase (OAS), and inducible nitric oxide synthase (iNOS) in RAW 264.7 cells pre-treated with fisetin, daidzein, quercetin, epigallocatechin gallate (EGCG), and epicatechin gallate (ECG) that have anti-noroviral activity. Based on the antiviral activity of the five flavonoids, recently reported by our group, the expression of antiviral factors such as IFN-α, IFN-λ, TNF-α, IL-1β, IL-6, Mx, ZAP, OAS, and iNOS was investigated in RAW 264.7 cells pre-treated with these flavonoids. Anti-noroviral effect was determined by performing a plaque assay on cells treated with the flavonoid. RAW 264.7 cells were treated with fisetin, daidzein, quercetin, EGCG, and ECG. Then, mRNA of IFN-α, IFN-λ, TNF-α, IL-1β, IL-6, Mx, ZAP, OAS, and iNOS were measured by real-time RT-PCR. IFN-α, TNF-α, IL-1β, and IL-6 proteins were measured by ELISA. Pre-treatment with fisetin (50μM), fisetin (100μM), EGCG (100μM), quercetin (100μM), daidzein (50μM), and ECG (150μM) significantly reduced MNoV by 50.00±7.14 to 60.67±9.26%. The mRNA levels of IFN-α, IFN-λ, TNF-α, Mx, and ZAP were upregulated in RAW 264.7 cells pre-treated with fisetin, quercetin, and daidzein, but not in those pre-treated with EGCG or ECG. Regarding protein levels, IFN-α was significantly induced in cells pre-treated with fisetin, quercetin, and daidzein, whereas TNF-α was significantly induced only in cells pre-treated with daidzein. Pre-treatment of RAW 264.7 cells with the five flavonoids inhibited MNoV by upregulating the expression of antiviral cytokines (IFN-α, IFN-λ, and TNF-α) and interferon-stimulating genes (Mx and ZAP). Copyright © 2017 Elsevier GmbH. All rights reserved.

Interferon-induced Sus scrofa Mx1 blocks endocytic traffic of incoming influenza A virus particles.

PubMed

Palm, Mélanie; Garigliany, Mutien-Marie; Cornet, François; Desmecht, Daniel

2010-01-01

The interferon-induced Mx proteins of vertebrates are dynamin-like GTPases, some isoforms of which can additionally inhibit the life cycle of certain RNA viruses. Here we show that the porcine Mx1 protein (poMx1) inhibits replication of influenza A virus and we attempt to identify the step at which the viral life cycle is blocked. In infected cells expressing poMx1, the level of transcripts encoding the viral nucleoprotein is significantly lower than normal, even when secondary transcription is prevented by exposure to cycloheximide. This reveals that a pretranscriptional block participates to the anti-influenza activity. Binding and internalization of incoming virus particles are normal in the presence of poMx1 but centripetal traffic to the late endosomes is interrupted. Surprisingly but decisively, poMx1 significantly alters binding of early endosome autoantigen 1 to early endosomes and/or early endosome size and spatial distribution. This is compatible with impairment of traffic of the endocytic vesicles to the late endosomes. INRA, EDP Sciences, 2010.

Interferon lambda 1-3 expression in infants hospitalized for RSV or HRV associated bronchiolitis.

PubMed

Selvaggi, Carla; Pierangeli, Alessandra; Fabiani, Marco; Spano, Lucia; Nicolai, Ambra; Papoff, Paola; Moretti, Corrado; Midulla, Fabio; Antonelli, Guido; Scagnolari, Carolina

2014-05-01

The airway expression of type III interferons (IFNs) was evaluated in infants hospitalized for respiratory syncytial virus (RSV) or rhinovirus (HRV) bronchiolitis. As an additional objective we sought to determine whether a different expression of IFN lambda 1-3 was associated with different harboring viruses, the clinical course of bronchiolitis or with the levels of well established IFN stimulated genes (ISGs), such as mixovirus resistance A (MxA) and ISG56. The analysis was undertaken in 118 infants with RSV or HRV bronchiolitis. Nasopharyngeal washes were collected for virological studies and molecular analysis of type III IFN responses. RSV elicited higher levels of IFN lambda subtypes when compared with HRV. A similar expression of type III IFN was found in RSVA or RSVB infected infants and in those infected with HRVA or HRVC viruses. Results also indicate that IFN lambda 1 and IFN lambda 2-3 levels were correlated with each other and with MxA and ISG56-mRNAs. In addition, a positive correlation exists between the IFN lambda1 levels and the clinical score index during RSV infection. In particular, higher IFN lambda 1 levels are associated to an increase of respiratory rate. These findings show that differences in the IFN lambda 1-3 levels in infants with RSV or HRV infections are present and that the expression of IFN lambda 1 correlates with the severity of RSV bronchiolitis. Copyright © 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

A effective DNA vaccine against diverse genotype J infectious hematopoietic necrosis virus strains prevalent in China

USGS Publications Warehouse

Xu, Liming; Zhao, Jingzhuang; Liu, Miao; Kurath, Gael; Ren, Guangming; LaPatra, Scott E.; Yin, Jiasheng; Liu, Hongbai; Feng, Jian; Lu, Tongyan

2017-01-01

Infectious hematopoietic necrosis virus (IHNV) is the most important pathogen threatening the aquaculture of salmonid fish in China. In this study, a DNA vaccine, designated pIHNch-G, was constructed with the glycoprotein (G) gene of a Chinese IHNV isolate SD-12 (also called Sn1203) of genotype J. The minimal dose of vaccine required, the expression of the Mx-1 gene in the muscle (vaccine delivery site) and anterior kidney, and the titers of the neutralizing antibodies produced were used to evaluate the vaccine efficacy. To assess the potential utility of the vaccine in controlling IHNV throughout China, the cross protective efficacy of the vaccine was determined by challenging fish with a broad range of IHNV strains from different geographic locations in China. A single 100 ng dose of the vaccine conferred almost full protection to rainbow trout fry (3 g) against waterborne or intraperitoneal injection challenge with IHNV strain SD-12 as early as 4 days post-vaccination (d.p.v.), and significant protection was still observed at 180 d.p.v. Intragenogroup challenges showed that the DNA vaccine provided similar protection to the fish against all the Chinese IHNV isolates tested, suggesting that the vaccine can be widely used in China. Mx-1 gene expression was significantly upregulated in the muscle tissue (vaccine delivery site) and anterior kidney in the vaccinated rainbow trout at both 4 and 7 d.p.v. Similar levels of neutralizing antibodies were determined with each of the Chinese IHNV strains at 60 and 180 d.p.v. This DNA vaccine should play an important role in the control of IHN in China.

Immune-regulatory transcriptional responses in multiple organs of Atlantic salmon after tributyltin exposure, alone or in combination with forskolin.

PubMed

Pavlikova, Nela; Arukwe, Augustine

2011-01-01

Tributyltin (TBT) is a widespread marine pollutant that influences physiological conditions of fish and other aquatic organisms. In addition to effects on reproduction, the immune system has been proposed as a possible target for TBT effects. In the present study, the effects of TBT exposure were examined on the expression of genes involved in immune system compentence in liver and head kidney of Atlantic salmon, in the presence and absence of a second-messenger activator (forskolin). Juvenile salmon were force-fed a diet containing TBT (0-solvent control, 0.1, 1, or 10 mg/kg fish) for 72 h. Consequently, fish from the control group and 10-mg/kg TBT group were exposed to the adenylate cyclase (AC) activator forskolin (200 μg/L) for 2 or 4 h. Forskolin was selected for this study because it is known to exhibit potent immune system enhancement by activating macrophages and lymphocytes. After sacrifice, liver and head kidney were sampled and transcript changes for interleukin (IL)-1β, IL-10, transforming growth factor (TGF) β, interferon (INF) α, INFγ, tumor necrosis factor (TNF) α, Mx3, and insulin-like growth factor (IGF)-1 were determined in both tissues by quantitative polymerase chain reaction (qPCR) using gene-specific primers. TBT, when given alone and also in combination with forskolin, decreased IL-1β, TNFα, IFNγ, IFNα, Mx3, and IGF-1 gene expression. In contrast, IL-10 and TGFβ transcripts were increased after TBT exposure alone and also in combination with forskolin. Generally, these effects were largely dependent on TBT dose and time of exposure when given in combination with forskolin. Overall, our findings suggest a possible immunomodulatory effect of TBT, possibly involving cAMP activation.

Genipin-induced inhibition of uncoupling protein-2 sensitizes drug-resistant cancer cells to cytotoxic agents.

PubMed

Mailloux, Ryan J; Adjeitey, Cyril Nii-Klu; Harper, Mary-Ellen

2010-10-13

Uncoupling protein-2 (UCP2) is known to suppress mitochondrial reactive oxygen species (ROS) production and is employed by drug-resistant cancer cells to mitigate oxidative stress. Using the drug-sensitive HL-60 cells and the drug-resistant MX2 subline as model systems, we show that genipin, a UCP2 inhibitor, sensitizes drug-resistant cells to cytotoxic agents. Increased MX2 cell death was observed upon co-treatment with genipin and different doses of menadione, doxorubicin, and epirubicin. DCFH-DA fluorimetry revealed that the increase in MX2 cell death was accompanied by enhanced cellular ROS levels. The drug-induced increase in ROS was linked to genipin-mediated inhibition of mitochondrial proton leak. State 4 and resting cellular respiratory rates were higher in the MX2 cells in comparison to the HL-60 cells, and the increased respiration was readily suppressed by genipin in the MX2 cells. UCP2 accounted for a remarkable 37% of the resting cellular oxygen consumption indicating that the MX2 cells are functionally reliant on this protein. Higher amounts of UCP2 protein were detected in the MX2 versus the HL-60 mitochondria. The observed effects of genipin were absent in the HL-60 cells pointing to the selectivity of this natural product for drug-resistant cells. The specificity of genipin for UCP2 was confirmed using CHO cells stably expressing UCP2 in which genipin induced an ∼22% decrease in state 4 respiration. These effects were absent in empty vector CHO cells expressing no UCP2. Thus, the chemical inhibition of UCP2 with genipin sensitizes multidrug-resistant cancer cells to cytotoxic agents.

Strain Screening from Traditional Fermented Soybean Foods and Induction of Nattokinase Production in Bacillus subtilis MX-6.

PubMed

Man, Li-Li; Xiang, Dian-Jun; Zhang, Chun-Lan

2018-02-06

The plasminogen-free fibrin plate assay method was used to isolate Bacillus subtilis MX-6, a strain with high production of nattokinase from Chinese douchi. The presence of aprN, a gene-encoding nattokinase, was verified with PCR method. The predicted amino acid sequence was aligned with homologous sequences, and a phylogenetic tree was constructed. Nattokinase was sublimated with ammonium sulfate, using a DEAE-Sepharose Fast Flow column, a CM-Sepharose Fast Flow column and a Sephadex G-75 gel filtration column. SDS-PAGE analysis indicated that the molecular weight of the purified nattokinase from Bacillus subtilis MX-6 was about 28 kDa. Fermentation of Bacillus subtilis MX-6 nattokinase showed that nattokinase production was maximized after 72 h; the diameter of clear zone reached 21.60 mm on the plasminogen-free fibrin plate. Nattokinase production by Bacillus subtilis MX-6 increased significantly after supplementation with supernatant I, supernatant II and soy peptone but decreased substantially after the addition of amino acids. This result indicated that the nattokinase production by B. subtilis MX-6 might be induced by soybean polypeptides. The addition of MgSO 4 and CaCl 2 increased B. subtilis MX-6 nattokinase production.

CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

PubMed

Jung, Myung-Hwa; Jung, Sung-Ju

2017-10-01

Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

Myxovirus resistance 1 gene polymorphisms and outcomes of viral hepatitis B and C infections in Moroccan patients.

PubMed

Rebbani, Khadija; Ababou, Mostafa; Nadifi, Sellama; Kandil, Mostafa; Marchio, Agnès; Pineau, Pascal; Ezzikouri, Sayeh; Benjelloun, Soumaya

2017-04-01

Host genetic factors may influence the establishment of chronicity or spontaneous clearance in viral hepatitis B and C infections. More light was shed on the role played by interferon-stimulated genes in the innate immunity. Myxovirus resistance 1 (MX1) is one of those key genes that have reported to inhibit several viruses. The present study aims to explore the possible association of -88G/T and -123C/A promoter variants of MX1 with susceptibility to chronic hepatitis B and C and/or with spontaneous clearance in a Moroccan population. The -88G/T and -123C/A SNPs were genotyped by PCR-RFLP in 538 individuals stratified into HBV chronically infected patients (n = 120), HCV-chronically infected patients (n = 115), HBV spontaneously resolved subjects (n = 114), HCV spontaneously resolved group (n = 52), and healthy controls (n = 137). A significant association of -123C allele with HBV spontaneous clearance has been found (P = 0.002, OR = 2.34; 95%CI [1.36-4]). In addition, a significant correlation between the MX1-GC haplotype and HBV spontaneous clearance (P < 0.001) was found. No significant association of -88G/T and -123C/A polymorphisms with regard to HCV infection was observed in this study. Here, we show that for North African patients with chronic hepatitis, MX1 gene variation at position -123 may influence the outcome of HBV infection but not HCV infection. J. Med. Virol. 89:647-652, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

The TRA-1 transcription factor binds TRA-2 to regulate sexual fates in Caenorhabditis elegans

PubMed Central

Wang, Shanping; Kimble, Judith

2001-01-01

The tra-1 and tra-2 sex-determining genes promote female fates in Caenorhabditis elegans. Classical genetic studies placed tra-1 as the terminal regulator of the pathway with tra-2 acting upstream as a regulator of regulators of tra-1. Here we report the surprising result that the TRA-1 transcription factor binds the intracellular domain of the TRA-2 membrane protein. This binding is dependent on the MX regulatory domain, a region of the TRA-2 intracellular domain shown previously to be critical for the onset of hermaphrodite spermatogenesis. The functional importance of the TRA-1–TRA-2 physical interaction is supported by genetic interactions between tra-1(0) and tra-2(mx) mutations: a reduction of tra-1 gene dose from two copies to one copy enhances the tra-2(mx) feminization phenotype, but has no apparent somatic effect. In Caenorhabditis briggsae, we also find an MX-dependent interaction between Cb-TRA-1 and Cb-TRA-2, but intriguingly, no cross-species interactions are seen. The conservation of the TRA-1– TRA-2 interaction underscores its importance in sex determination. PMID:11250902

The West Nile virus assembly process evades the conserved antiviral mechanism of the interferon-induced MxA protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoenen, Antje; Gillespie, Leah; Department of Microbiology and Immunology, University of Melbourne, Melbourne

2014-01-05

Flaviviruses have evolved means to evade host innate immune responses. Recent evidence suggests this is due to prevention of interferon production and signaling in flavivirus-infected cells. Here we show that the interferon-induced MxA protein can sequester the West Nile virus strain Kunjin virus (WNV{sub KUN}) capsid protein in cytoplasmic tubular structures in an expression-replication system. This sequestering resulted in reduced titers of secreted WNV{sub KUN} particles. We show by electron microscopy, tomography and 3D modeling that these cytoplasmic tubular structures form organized bundles. Additionally we show that recombinant ER-targeted MxA can restrict production of infectious WNV{sub KUN} under conditions ofmore » virus infection. Our results indicate a co-ordinated and compartmentalized WNV{sub KUN} assembly process may prevent recognition of viral components by MxA, particularly the capsid protein. This recognition can be exploited if MxA is targeted to intracellular sites of WNV{sub KUN} assembly. This results in further understanding of the mechanisms of flavivirus evasion from the immune system. - Highlights: • We show that the ISG MxA can recognize the West Nile virus capsid protein. • Interaction between WNV C protein and MxA induces cytoplasmic fibrils. • MxA can be retargeted to the ER to restrict WNV particle release. • WNV assembly process is a strategy to avoid MxA recognition.« less

TOXICOGENOMIC ANALYSIS INCORPORATING OPERON-TRANSCRIPTIONAL COUPLING AND TOXICANT CONCENTRATRION-EXPRESSION RESPONSE: Analysis of MX-Treated Salmonella

EPA Science Inventory

What is the study? This study is the first to use microarray analysis in the Ames strains of Salmonella. The microarray chips were custom-designed for this study and are not commercially available, and we evaluated the well-studied drinking water mutagen, MX. Because much inform...

Characterizing the heterogeneity of tumor tissues from spatially resolved molecular measures

PubMed Central

Zavodszky, Maria I.

2017-01-01

Background Tumor heterogeneity can manifest itself by sub-populations of cells having distinct phenotypic profiles expressed as diverse molecular, morphological and spatial distributions. This inherent heterogeneity poses challenges in terms of diagnosis, prognosis and efficient treatment. Consequently, tools and techniques are being developed to properly characterize and quantify tumor heterogeneity. Multiplexed immunofluorescence (MxIF) is one such technology that offers molecular insight into both inter-individual and intratumor heterogeneity. It enables the quantification of both the concentration and spatial distribution of 60+ proteins across a tissue section. Upon bioimage processing, protein expression data can be generated for each cell from a tissue field of view. Results The Multi-Omics Heterogeneity Analysis (MOHA) tool was developed to compute tissue heterogeneity metrics from MxIF spatially resolved tissue imaging data. This technique computes the molecular state of each cell in a sample based on a pathway or gene set. Spatial states are then computed based on the spatial arrangements of the cells as distinguished by their respective molecular states. MOHA computes tissue heterogeneity metrics from the distributions of these molecular and spatially defined states. A colorectal cancer cohort of approximately 700 subjects with MxIF data is presented to demonstrate the MOHA methodology. Within this dataset, statistically significant correlations were found between the intratumor AKT pathway state diversity and cancer stage and histological tumor grade. Furthermore, intratumor spatial diversity metrics were found to correlate with cancer recurrence. Conclusions MOHA provides a simple and robust approach to characterize molecular and spatial heterogeneity of tissues. Research projects that generate spatially resolved tissue imaging data can take full advantage of this useful technique. The MOHA algorithm is implemented as a freely available R script (see supplementary information). PMID:29190747

Equine Myxovirus Resistance Protein 2 Restricts Lentiviral Replication by Blocking Nuclear Uptake of Capsid Protein.

PubMed

Ji, Shuang; Na, Lei; Ren, Huiling; Wang, Yujie; Wang, Xiaojun

2018-05-09

Human Myxovirus resistance 2 (huMxB) has been shown to be a determinant type I interferon-induced host factor involved in the inhibition of HIV-1 as well as many other primate lentiviruses. This blocking occurs after the reverse transcription of viral RNA and ahead of the integration into the host DNA, which is closely connected to the ability of the protein to bind the viral capsid. To date, Mx2s derived from non-primate animals have shown no capacity for HIV-1 suppression. In this study, we examined the restrictive effect of equine Mx2 (eqMx2) on both the equine infectious anemia virus (EIAV) and HIV-1 and investigated possible mechanisms for its specific function. We demonstrated that IFNα/β upregulates the expression of eqMx2 in equine monocyte-derived macrophages (eMDMs). Overexpression of eqMx2 significantly suppresses the replication of EIAV, HIV-1, and SIVs, but not that of MLV. Knockdown of eqMx2 transcription weakens the inhibition of EIAV replication by type I interferon. Interestingly, immunofluorescence assays suggest that the subcellular localization of eqMx2 changes following virus infection, from being dispersed in the cytoplasm to being accumulated at the nuclear envelope. Furthermore, eqMx2 blocks the nuclear uptake of the proviral genome by binding to the viral capsid. The N-truncated mutant of eqMx2 lost the ability to bind the viral capsid as well as the restriction effect for lentiviruses. These results improve our understanding of the Mx2 protein in non-primate animals. IMPORTANCE Previous research has shown that the antiviral ability of Mx2s is confined to primates, particularly humans. EIAV has been shown to be insensitive to the restriction by human MxB. Here, we described the function of equine Mx2. This protein plays an important role in the suppression of EIAV, HIV-1, and SIVs. The antiviral activity of eqMx2 depends on its subcellular location as well as its capsid binding capacity. Our results showed that following viral infection, eqMx2 changes its original cytoplasmic location and accumulates at the nuclear envelope where it binds to the viral capsid and blocks the nuclear entry of reverse transcribed proviral DNAs. In contrast, huMxB does not bind to the EIAV capsid and shows no EIAV restriction effect. These studies expand our understanding of the function of the equine Mx2 protein. Copyright © 2018 Ji et al.

Profiling of hepatic gene expression of mice fed with edible japanese mushrooms by DNA microarray analysis: comparison among Pleurotus ostreatus, Grifola frondosa, and Hypsizigus marmoreus.

PubMed

Sato, Mayumi; Tokuji, Yoshihiko; Yoneyama, Shozo; Fujii-Akiyama, Kyoko; Kinoshita, Mikio; Ohnishi, Masao

2011-10-12

To compare and estimate the effects of dietary intake of three kinds of mushrooms (Pleurotus ostreatus, Grifola frondosa, and Hypsizigus marmoreus), mice were fed a diet containing 10-14% of each mushroom for 4 weeks. Triacylglycerol in the liver and plasma decreased and plasma cholesterol increased in the P. ostreatus-fed group compared with those in the control group. Cholesterol in the liver was lower in the G. frondosa-fed group than in the control group, but no changes were found in the H. marmoreus-fed group. DNA microarray analysis of the liver revealed differences of gene expression patterns among mushrooms. Ctp1a and Fabp families were upregulated in the P. ostreatus-fed group, which were considered to promote lipid transport and β-oxidation. In the G. frondosa-fed group, not only the gene involved in signal transduction of innate immunity via TLR3 and interferon but also virus resistance genes, such as Mx1, Rsad2, and Oas1, were upregulated.

Novel candidate genes for alcoholism--transcriptomic analysis of prefrontal medial cortex, hippocampus and nucleus accumbens of Warsaw alcohol-preferring and non-preferring rats.

PubMed

Stankiewicz, Adrian M; Goscik, Joanna; Dyr, Wanda; Juszczak, Grzegorz R; Ryglewicz, Danuta; Swiergiel, Artur H; Wieczorek, Marek; Stefanski, Roman

2015-12-01

Animal models provide opportunity to study neurobiological aspects of human alcoholism. Changes in gene expression have been implicated in mediating brain functions, including reward system and addiction. The current study aimed to identify genes that may underlie differential ethanol preference in Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) rats. Microarray analysis comparing gene expression in nucleus accumbens (NAc), hippocampus (HP) and medial prefrontal cortex (mPFC) was performed in male WHP and WLP rats bred for differences in ethanol preference. Differential and stable between biological repeats expression of 345, 254 and 129 transcripts in NAc, HP and mPFC was detected. Identified genes and processes included known mediators of ethanol response (Mx2, Fam111a, Itpr1, Gabra4, Agtr1a, LTP/LTD, renin-angiotensin signaling pathway), toxicity (Sult1c2a, Ces1, inflammatory response), as well as genes involved in regulation of important addiction-related brain systems such as dopamine, tachykinin or acetylcholine (Gng7, Tac4, Slc5a7). The identified candidate genes may underlie differential ethanol preference in an animal model of alcoholism. Names of genes are written in italics, while names of proteins are written in standard font. Names of human genes/proteins are written in all capital letters. Names of rodent genes/proteins are written in capital letter followed by small letters. Copyright © 2015 Elsevier Inc. All rights reserved.

Genome-wide gene expression pattern underlying differential host response to high or low pathogenic H5N1 avian influenza virus in ducks.

PubMed

Kumar, A; Vijayakumar, P; Gandhale, P N; Ranaware, P B; Kumar, H; Kulkarni, D D; Raut, A A; Mishra, A

The differences in the influenza viral pathogenesis observed between different pathogenic strains are associated with distinct properties of virus strains and the host immune responses. In order to determine the differences in the duck immune response against two different pathogenic strains, we studied genome-wide host immune gene response of ducks infected with A/duck/India/02CA10/2011 and A/duck/Tripura/103597/2008 H5N1 viruses using custom-designed microarray. A/duck/India/02CA10/2011 is highly pathogenic virus (HP) to ducks, whereas A/duck/Tripura/103597/2008 is a low pathogenic (LP) virus strain. Comparative lung tissue transcriptome analysis of differentially expressed genes revealed that 686 genes were commonly expressed, 880 and 1556 genes are expressed uniquely to infection with HP and LP virus, respectively. The up-regulation of chemokines (CCL4 and CXCR4) and IFN-stimulated genes (IFITM2, STAT3, TGFB1 and TGFB3) was observed in the lung tissues of ducks infected with HP virus. The up-regulation of other immune genes (IL17, OAS, SOCS3, MHC I and MHC II) was observed in both infection conditions. The expression of important antiviral immune genes MX, IFIT5, IFITM5, ISG12, β-defensins, RSAD2, EIF2AK2, TRIM23 and SLC16A3 was observed in LP virus infection, but not in HP virus infection. Several immune-related gene ontology terms and pathways activated by both the viruses were qualitatively similar but quantitatively different. Based on these findings, the differences in the host immune response might explain a part of the difference observed in the viral pathogenesis of high and low pathogenic influenza strains in ducks.

In vitro and in vivo modulation of ABCG2 by functionalized aurones and structurally related analogs

PubMed Central

Sim, Hong-May; Wu, Chung-Pu; Ambudkar, Suresh V.; Go, Mei-Lin

2013-01-01

Over-expression of ABCG2 is linked to multidrug resistance in cancer chemotherapy. We have previously shown that functionalized aurones effectively reduced the efflux of pheophorbide A (an ABCG2 substrate) from ABCG2 over-expressing MDA-MB-231/R (“R”) cells. In the present report, we investigated the functional relevance of this observation and the mechanisms by which it occurs. Aurones and related analogs were investigated for re-sensitization of R cells to mitoxantrone (MX, a chemotherapeutic substrate of ABCG2) in cell-based assays, accumulation of intracellular MX by cell cytometry, interaction with ABCG2 by biochemical assays and in vivo efficacy in MX resistant nude mice xenografts. We found that methoxylated aurones interacted directly with ABCG2 to inhibit efflux activity, possibly by competing for occupancy of one of the substrate binding sites on ABCG2. The present evidence suggests that they are not transported by ABCG2 although they stimulate ABCG2-ATPase activity. Alteration of ABCG2 protein expression was also discounted. One member was found to re-sensitize R cells to MX in both in vitro and in vivo settings. Our study identified methoxylated aurones as promising compounds associated with low toxicities and potent modulatory effects on the ABCG2 efflux protein. Thus, they warrant further scrutiny as lead templates for development as reversal agents of multidrug resistance. PMID:21855533

Draft Genome Sequences of Endophytic Isolates of Klebsiella variicola and Klebsiella pneumoniae Obtained from the Same Sugarcane Plant

PubMed Central

2018-01-01

ABSTRACT Endophytic Klebsiella variicola KvMx2 and Klebsiella pneumoniae KpMx1 isolates obtained from the same sugarcane stem were used for whole-genome sequencing. The genomes revealed clear differences in essential genes for plant growth, development, and detoxification, as well as nitrogen fixation, catalases, cellulases, and shared virulence factors described in the K. pneumoniae pathogen. PMID:29567733

Dynamic gene expression analysis in a H1N1 influenza virus mouse pneumonia model.

PubMed

Bao, Yanyan; Gao, Yingjie; Shi, Yujing; Cui, Xiaolan

2017-06-01

H1N1, a major pathogenic subtype of influenza A virus, causes a respiratory infection in humans and livestock that can range from a mild infection to more severe pneumonia associated with acute respiratory distress syndrome. Understanding the dynamic changes in the genome and the related functional changes induced by H1N1 influenza virus infection is essential to elucidating the pathogenesis of this virus and thereby determining strategies to prevent future outbreaks. In this study, we filtered the significantly expressed genes in mouse pneumonia using mRNA microarray analysis. Using STC analysis, seven significant gene clusters were revealed, and using STC-GO analysis, we explored the significant functions of these seven gene clusters. The results revealed GOs related to H1N1 virus-induced inflammatory and immune functions, including innate immune response, inflammatory response, specific immune response, and cellular response to interferon-beta. Furthermore, the dynamic regulation relationships of the key genes in mouse pneumonia were revealed by dynamic gene network analysis, and the most important genes were filtered, including Dhx58, Cxcl10, Cxcl11, Zbp1, Ifit1, Ifih1, Trim25, Mx2, Oas2, Cd274, Irgm1, and Irf7. These results suggested that during mouse pneumonia, changes in the expression of gene clusters and the complex interactions among genes lead to significant changes in function. Dynamic gene expression analysis revealed key genes that performed important functions. These results are a prelude to advancements in mouse H1N1 influenza virus infection biology, as well as the use of mice as a model organism for human H1N1 influenza virus infection studies.

In vivo evasion of MxA by avian influenza viruses requires human signature in the viral nucleoprotein.

PubMed

Deeg, Christoph M; Hassan, Ebrahim; Mutz, Pascal; Rheinemann, Lara; Götz, Veronika; Magar, Linda; Schilling, Mirjam; Kallfass, Carsten; Nürnberger, Cindy; Soubies, Sébastien; Kochs, Georg; Haller, Otto; Schwemmle, Martin; Staeheli, Peter

2017-05-01

Zoonotic transmission of influenza A viruses can give rise to devastating pandemics, but currently it is impossible to predict the pandemic potential of circulating avian influenza viruses. Here, we describe a new mouse model suitable for such risk assessment, based on the observation that the innate restriction factor MxA represents an effective species barrier that must be overcome by zoonotic viruses. Our mouse lacks functional endogenous Mx genes but instead carries the human MX1 locus as a transgene. Such transgenic mice were largely resistant to highly pathogenic avian H5 and H7 influenza A viruses, but were almost as susceptible to infection with influenza viruses of human origin as nontransgenic littermates. Influenza A viruses that successfully established stable lineages in humans have acquired adaptive mutations which allow partial MxA escape. Accordingly, an engineered avian H7N7 influenza virus carrying a nucleoprotein with signature mutations typically found in human virus isolates was more virulent in transgenic mice than parental virus, demonstrating that a few amino acid changes in the viral target protein can mediate escape from MxA restriction in vivo. Similar mutations probably need to be acquired by emerging influenza A viruses before they can spread in the human population. © 2017 Deeg et al.

In vivo evasion of MxA by avian influenza viruses requires human signature in the viral nucleoprotein

PubMed Central

Magar, Linda; Schilling, Mirjam; Kallfass, Carsten; Nürnberger, Cindy; Soubies, Sébastien; Kochs, Georg; Schwemmle, Martin

2017-01-01

Zoonotic transmission of influenza A viruses can give rise to devastating pandemics, but currently it is impossible to predict the pandemic potential of circulating avian influenza viruses. Here, we describe a new mouse model suitable for such risk assessment, based on the observation that the innate restriction factor MxA represents an effective species barrier that must be overcome by zoonotic viruses. Our mouse lacks functional endogenous Mx genes but instead carries the human MX1 locus as a transgene. Such transgenic mice were largely resistant to highly pathogenic avian H5 and H7 influenza A viruses, but were almost as susceptible to infection with influenza viruses of human origin as nontransgenic littermates. Influenza A viruses that successfully established stable lineages in humans have acquired adaptive mutations which allow partial MxA escape. Accordingly, an engineered avian H7N7 influenza virus carrying a nucleoprotein with signature mutations typically found in human virus isolates was more virulent in transgenic mice than parental virus, demonstrating that a few amino acid changes in the viral target protein can mediate escape from MxA restriction in vivo. Similar mutations probably need to be acquired by emerging influenza A viruses before they can spread in the human population. PMID:28396461

TRIM5α and TRIM22 Are Differentially Regulated According to HIV-1 Infection Phase and Compartment

PubMed Central

Singh, Ravesh; Patel, Vinod; Mureithi, Marianne W.; Naranbhai, Vivek; Ramsuran, Duran; Tulsi, Sahil; Hiramen, Keshni; Werner, Lise; Mlisana, Koleka; Altfeld, Marcus; Luban, Jeremy; Kasprowicz, Victoria; Dheda, Keertan; Abdool Karim, Salim S.

2014-01-01

ABSTRACT The antiviral role of TRIM E3 ligases in vivo is not fully understood. To test the hypothesis that TRIM5α and TRIM22 have differential transcriptional regulation and distinct anti-HIV roles according to infection phase and compartment, we measured TRIM5α, TRIM22, and type I interferon (IFN-I)-inducible myxovirus resistance protein A (MxA) levels in peripheral blood mononuclear cells (PBMCs) during primary and chronic HIV-1 infection, with chronic infection samples being matched PBMCs and central nervous system (CNS)-derived cells. Associations with biomarkers of disease progression were explored. The impact of IFN-I, select proinflammatory cytokines, and HIV on TRIM E3 ligase-specific expression was investigated. PBMCs from individuals with primary and chronic HIV-1 infection had significantly higher levels of MxA and TRIM22 than did PBMCs from HIV-1-negative individuals (P < 0.05 for all comparisons). PBMCs from chronic infection had lower levels of TRIM5α than did PBMCs from primary infection or HIV-1-uninfected PBMCs (P = 0.0001 for both). In matched CNS-derived samples and PBMCs, higher levels of MxA (P = 0.001) and TRIM5α (P = 0.0001) in the CNS were noted. There was a negative correlation between TRIM22 levels in PBMCs and plasma viral load (r = −0.40; P = 0.04). In vitro, IFN-I and, rarely, proinflammatory cytokines induced TRIM5α and TRIM22 in a cell type-dependent manner, and the knockdown of either protein in CD4+ lymphocytes resulted in increased HIV-1 infection. These data suggest that there are infection-phase-specific and anatomically compartmentalized differences in TRIM5α and TRIM22 regulation involving primarily IFN-I and specific cell types and indicate subtle differences in the antiviral roles and transcriptional regulation of TRIM E3 ligases in vivo. IMPORTANCE Type I interferon-inducible TRIM E3 ligases are a family of intracellular proteins with potent antiviral activities mediated through diverse mechanisms. However, little is known about the contribution of these proteins to antiviral immunity in vivo and how their expression is regulated. We show here that TRIM5α and TRIM22, two prominent members of the family, have different expression patterns in vivo and that the expression pattern depends on HIV-1 infection status and phase. Furthermore, expression differs in peripheral blood versus central nervous system anatomical sites of infection. Only TRIM22 expression correlated negatively with HIV-1 viral load, but gene silencing of both proteins enhances HIV-1 infection of target cells. We report subtle differences in TRIM5α and TRIM22 gene induction by IFN-I and proinflammatory cytokines in CD4+ lymphocytes, monocytes, and neuronal cells. This study enhances our understanding of antiviral immunity by intrinsic antiviral factors and how their expression is determined. PMID:24478420

Draft Genome Sequences of Endophytic Isolates of Klebsiella variicola and Klebsiella pneumoniae Obtained from the Same Sugarcane Plant.

PubMed

Reyna-Flores, Fernando; Barrios-Camacho, Humberto; Dantán-González, Edgar; Ramírez-Trujillo, José Augusto; Lozano Aguirre Beltrán, Luis Fernando; Rodríguez-Medina, Nadia; Garza-Ramos, Ulises; Suárez-Rodríguez, Ramón

2018-03-22

Endophytic Klebsiella variicola KvMx2 and Klebsiella pneumoniae KpMx1 isolates obtained from the same sugarcane stem were used for whole-genome sequencing. The genomes revealed clear differences in essential genes for plant growth, development, and detoxification, as well as nitrogen fixation, catalases, cellulases, and shared virulence factors described in the K. pneumoniae pathogen. Copyright © 2018 Reyna-Flores et al.

Identification of diverse defense mechanisms in rainbow trout red blood cells in response to halted replication of VHS virus.

PubMed

Nombela, Ivan; Puente-Marin, Sara; Chico, Veronica; Villena, Alberto J; Carracedo, Begoña; Ciordia, Sergio; Mena, Maria Carmen; Mercado, Luis; Perez, Luis; Coll, Julio; Estepa, Amparo; Ortega-Villaizan, Maria Del Mar

2017-01-01

Background: It has been described that fish nucleated red blood cells (RBCs) generate a wide variety of immune-related gene transcripts when viruses highly replicate inside them and are their main target cell. The immune response and mechanisms of fish RBCs against viruses targeting other cells or tissues has not yet been explored and is the objective of our study. Methods: Rainbow trout RBCs were obtained from peripheral blood, ficoll purified and exposed to Viral Haemorrhagic Septicaemia virus (VHSV). Immune response was evaluated by means of RT-qPCR, flow cytometry, immunofluorescence and isobaric tag for relative and absolute quantification (iTRAQ) protein profiling. Results: VHSV N gene transcripts incremented early postexposure and were drastically decreased after 6 hours postexposure (hpe). The expression of type I interferon ( ifn1 ) gene was significantly downregulated at early postexposure (3 hpe), together with a gradual downregulation of interferon-inducible mx and pkr genes until 72 hpe. Type I IFN protein was downregulated and interferon-inducible Mx protein was maintained at basal levels. Co-culture assays of RBCs, previously exposed to UV-inactivated VHSV, and TSS (stromal cell line from spleen) revealed IFN crosstalk between both cell types. On the other hand, anti-microbial peptide β-defensin 1 and neutrophil chemotactic factor interleukin 8 were slightly upregulated in VHSV-exposed RBCs. iTRAQ profiling revealed that VHSV exposure can induce a global protein downregulation in rainbow trout RBCs, mainly related to RNA stability and proteasome pathways. Antioxidant/antiviral response is also suggested to be involved in the response of rainbow trout RBCs to VHSV. Conclusions: A variety of mechanisms are proposed to be implicated in the antiviral response of rainbow trout RBCs against VHSV halted infection. Ongoing research is focused on understanding the mechanisms in detail.

Specificity of DNA vaccines against the U and M genogroups of infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss)

USGS Publications Warehouse

Penaranda, M.M.D.; LaPatra, S.E.; Kurath, G.

2011-01-01

Infectious hematopoietic necrosis virus (IHNV) is a fish rhabdovirus that causes significant mortality in salmonid species. In North America IHNV has three major genogroups designated U, M, and L. Host-specificity of the M and U genogroups of IHNV has been established both in the field and in experimental challenges, with M isolates being more prevalent and more virulent in rainbow trout (Oncorhynchus mykiss), and U isolates being more prevalent and highly virulent in sockeye salmon (Oncorhynchus nerka). In this study, efficacy of DNA vaccines containing either M (pM) or U (pU) virus glycoprotein genes was investigated during intra- and cross-genogroup challenges in rainbow trout. In virus challenges at 7 days post-vaccination (early antiviral response), both pM and pU were highly protective against either M or U IHNV. In challenges at 28 days post-vaccination (specific antiviral response), both pM and pU were protective against M IHNV but the homologous pM vaccine was significantly more protective than pU in one of two experiments. At this stage both pM and pU induced comparably high protection against U IHNV challenge. Correlates of protection were also investigated by assessing the expression of the interferon-stimulated gene Mx-1 and the production of neutralizing antibodies (NAbs) following pM or pU DNA vaccination. Mx-1 gene expression, measured at 4 and 7 days post-vaccination as an indicator of the host innate immune response, was found to be significantly higher after pM than pU vaccination in some cases. Neutralizing antibody was produced in response to the two vaccines, but antibody titers did not show consistent correlation with protection. The results show that the rainbow trout innate and adaptive immune responses have some ability to distinguish between the U and M genogroup IHNV, but overall the pM and pU vaccines were protective against both homologous and cross-genogroup challenges.

Early bovine embryos regulate oviduct epithelial cell gene expression during in vitro co-culture.

PubMed

Schmaltz-Panneau, Barbara; Cordova, Amanda; Dhorne-Pollet, Sophie; Hennequet-Antier, Christelle; Uzbekova, Sveltlana; Martinot, Emmanuelle; Doret, Sarah; Martin, Patrice; Mermillod, Pascal; Locatelli, Yann

2014-10-01

In mammals, the oviduct may participate to the regulation of early embryo development. In vitro co-culture of early bovine embryos with bovine oviduct epithelial cells (BOEC) has been largely used to mimic the maternal environment. However, the mechanisms of BOEC action have not been clearly elucidated yet. The aim of this study was to determine the response of BOEC cultures to the presence of developing bovine embryos. A 21,581-element bovine oligonucleotide array was used compare the gene expression profiles of confluent BOEC cultured for 8 days with or without embryos. This study revealed 34 differentially expressed genes (DEG). Of these 34 genes, IFI6, ISG15, MX1, IFI27, IFI44, RSAD2, IFITM1, EPSTI1, USP18, IFIT5, and STAT1 expression increased to the greatest extent due to the presence of embryos with a major impact on antiviral and immune response. Among the mRNAs at least 25 are already described as induced by interferons. In addition, transcript levels of new candidate genes involved in the regulation of transcription, modulation of the maternal immune system and endometrial remodeling were found to be increased. We selected 7 genes and confirmed their differential expression by quantitative RT-PCR. The immunofluorescence imaging of cellular localization of STAT1 protein in BOEC showed a nuclear translocation in the presence of embryos, suggesting the activation of interferon signaling pathway. This first systematic study of BOEC transcriptome changes in response to the presence of embryos in cattle provides some evidences that these cells are able to adapt their transcriptomic profile in response to embryo signaling. Copyright © 2014 Elsevier B.V. All rights reserved.

Autoantibodies against Muscarinic Receptors in Breast Cancer: Their Role in Tumor Angiogenesis

PubMed Central

Lombardi, María Gabriela; Negroni, María Pía; Pelegrina, Laura Tatiana; Castro, María Ester; Fiszman, Gabriel L.; Azar, María Eugenia; Morgado, Carlos Cresta; Sales, María Elena

2013-01-01

The presence of autoantibodies in cancer has become relevant in recent years. We demonstrated that autoantibodies purified from the sera of breast cancer patients activate muscarinic acetylcholine receptors in tumor cells. Immunoglobulin G (IgG) from breast cancer patients in T1N0Mx stage (tumor size≤2 cm, without lymph node metastasis) mimics the action of the muscarinic agonist carbachol stimulating MCF-7 cell proliferation, migration and invasion. Angiogenesis is a central step in tumor progression because it promotes tumor invasion and metastatic spread. Vascular endothelial growth factor-A (VEGF-A) is the main angiogenic mediator, and its levels have been correlated with poor prognosis in cancer. The aim of the present work was to investigate the effect of T1N0Mx-IgG on the expression of VEGF-A, and the in vivo neovascular response triggered by MCF-7 cells, via muscarinic receptor activation. We demonstrated that T1N0Mx-IgG (10−8 M) and carbachol (10−9 M) increased the constitutive expression of VEGF-A in tumor cells, effect that was reverted by the muscarinic antagonist atropine. We also observed that T1N0Mx-IgG and carbachol enhanced the neovascular response produced by MCF-7 cells in the skin of NUDE mice. The action of IgG or carbachol was reduced in the presence of atropine. In conclusion, T1N0Mx-IgG and carbachol may promote VEGF-A production and neovascularization induced by breast tumor cells via muscarinic receptors activation. These effects may be accelerating breast tumor progression. PMID:23460876

JC virus induces altered patterns of cellular gene expression: Interferon-inducible genes as major transcriptional targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Verma, Saguna; Ziegler, Katja; Ananthula, Praveen

2006-02-20

Human polyomavirus JC (JCV) infects 80% of the population worldwide. Primary infection, typically occurring during childhood, is asymptomatic in immunocompetent individuals and results in lifelong latency and persistent infection. However, among the severely immunocompromised, JCV may cause a fatal demyelinating disease, progressive multifocal leukoencephalopathy (PML). Virus-host interactions influencing persistence and pathogenicity are not well understood, although significant regulation of JCV activity is thought to occur at the level of transcription. Regulation of the JCV early and late promoters during the lytic cycle is a complex event that requires participation of both viral and cellular factors. We have used cDNA microarraymore » technology to analyze global alterations in gene expression in JCV-permissive primary human fetal glial cells (PHFG). Expression of more than 400 cellular genes was altered, including many that influence cell proliferation, cell communication and interferon (IFN)-mediated host defense responses. Genes in the latter category included signal transducer and activator of transcription 1 (STAT1), interferon stimulating gene 56 (ISG56), myxovirus resistance 1 (MxA), 2'5'-oligoadenylate synthetase (OAS), and cig5. The expression of these genes was further confirmed in JCV-infected PHFG cells and the human glioblastoma cell line U87MG to ensure the specificity of JCV in inducing this strong antiviral response. Results obtained by real-time RT-PCR and Western blot analyses supported the microarray data and provide temporal information related to virus-induced changes in the IFN response pathway. Our data indicate that the induction of an antiviral response may be one of the cellular factors regulating/controlling JCV replication in immunocompetent hosts and therefore constraining the development of PML.« less

Infectious pancreatic necrosis virus triggers antiviral immune response in rainbow trout red blood cells, despite not being infective

PubMed Central

Nombela, Ivan; Carrion, Aurora; Puente-Marin, Sara; Chico, Verónica; Mercado, Luis; Perez, Luis; Coll, Julio; Ortega-Villaizan, Maria del Mar

2017-01-01

Background: Some fish viruses, such as piscine orthoreovirus and infectious salmon anemia virus, target red blood cells (RBCs), replicate inside them and induce an immune response. However, the roles of RBCs in the context of infectious pancreatic necrosis virus (IPNV) infection  have not been studied yet. Methods: Ex vivo rainbow trout RBCs were obtained from peripheral blood, Ficoll purified and exposed to IPNV in order to analyze infectivity and immune response using RT-qPCR, immune fluorescence imaging, flow cytometry and western-blotting techniques. Results: IPNV could not infect RBCs; however, IPNV increased the expression of the INF1-related genes ifn-1, pkr and mx genes. Moreover, conditioned media from IPNV-exposed RBCs conferred protection against IPNV infection in CHSE-214 fish cell line. Conclusions: Despite not being infected, rainbow trout RBCs could respond to IPNV with increased expression of antiviral genes. Fish RBCs could be considered as mediators of the antiviral response and therefore targets of new strategies against fish viral infections. Further research is ongoing to completely understand the molecular mechanism that triggers this antiviral response in rainbow trout RBCs. PMID:29333244

Infectious pancreatic necrosis virus triggers antiviral immune response in rainbow trout red blood cells, despite not being infective.

PubMed

Nombela, Ivan; Carrion, Aurora; Puente-Marin, Sara; Chico, Verónica; Mercado, Luis; Perez, Luis; Coll, Julio; Ortega-Villaizan, Maria Del Mar

2017-01-01

Background : Some fish viruses, such as piscine orthoreovirus and infectious salmon anemia virus, target red blood cells (RBCs), replicate inside them and induce an immune response. However, the roles of RBCs in the context of infectious pancreatic necrosis virus (IPNV) infection  have not been studied yet. Methods : Ex vivo rainbow trout RBCs were obtained from peripheral blood, Ficoll purified and exposed to IPNV in order to analyze infectivity and immune response using RT-qPCR, immune fluorescence imaging, flow cytometry and western-blotting techniques. Results : IPNV could not infect RBCs; however, IPNV increased the expression of the INF1-related genes ifn-1 , pkr and mx genes. Moreover, conditioned media from IPNV-exposed RBCs conferred protection against IPNV infection in CHSE-214 fish cell line. Conclusions : Despite not being infected, rainbow trout RBCs could respond to IPNV with increased expression of antiviral genes. Fish RBCs could be considered as mediators of the antiviral response and therefore targets of new strategies against fish viral infections. Further research is ongoing to completely understand the molecular mechanism that triggers this antiviral response in rainbow trout RBCs.

The antiviral defense mechanisms in mandarin fish induced by DNA vaccination against a rhabdovirus.

PubMed

Chen, Zhong-Yuan; Lei, Xiao-Ying; Zhang, Qi-Ya

2012-06-15

Plasmid DNAs containing Siniperca chuatsi rhabdovirus (SCRV) glycoprotein gene (pcDNA-G) and nucleoprotein gene (pcDNA-N) were constructed, and used to determine the antiviral immune response elicited by DNA vaccination in mandarin fish. In vitro and in vivo expression of the plasmid constructs was confirmed in transfected cells and muscle tissues of vaccinated fish by Western blot, indirect immunofluorescence or RT-PCR analysis. Fish injected with pcDNA-G exhibited protective effect against SCRV challenge with a relative percent survival (RPS) of 77.5%, but no significant protection (RPS of 2.5%) was observed in fish vaccinated with pcDNA-N. Immunohistochemical analysis showed that vaccination with pcDNA-G decreased histological lesions and suppressed the virus replication in fish target organs, e.g. kidney, liver, spleen, gill and heart. Transcriptional analysis further revealed that the expression levels of type I IFN system genes including interferon regulation factor-7 (IRF-7) gene, myxovirus resistance (Mx) gene and virus inhibitory protein (Viperin) gene were strongly up-regulated after injection with pcDNA-G, whereas the level of transcription of immunoglobulin M (IgM) gene did not show a statistically significant change. These results reveal that type I IFN antiviral immune response is rapidly triggered by the plasmid DNA containing rhabdovirus glycoprotein gene in fish, which offers an explanation of molecular mechanisms for DNA vaccination inducing mandarin fish resist to SCRV disease. Copyright © 2011 Elsevier B.V. All rights reserved.

Masitinib antagonizes ATP-binding cassette subfamily G member 2-mediated multidrug resistance

PubMed Central

KATHAWALA, RISHIL J.; CHEN, JUN-JIANG; ZHANG, YUN-KAI; WANG, YI-JUN; PATEL, ATISH; WANG, DE-SHEN; TALELE, TANAJI T.; ASHBY, CHARLES R.; CHEN, ZHE-SHENG

2014-01-01

In this in vitro study, we determined whether masitinib could reverse multidrug resistance (MDR) in cells overexpressing the ATP binding cassette subfamily G member 2 (ABCG2) transporter. Masitinib (1.25 and 2.5 μM) significantly decreases the resistance to mitoxantrone (MX), SN38 and doxorubicin in HEK293 and H460 cells overexpressing the ABCG2 transporter. In addition, masitinib (2.5 μM) significantly increased the intracellular accumulation of [3H]-MX, a substrate for ABCG2, by inhibiting the function of ABCG2 and significantly decreased the efflux of [3H]-MX. However, masitinib (2.5 μM) did not significantly alter the expression of the ABCG2 protein. In addition, a docking model suggested that masitinib binds within the transmembrane region of a homology-modeled human ABCG2 transporter. Overall, our in vitro findings suggest that masitinib reverses MDR to various anti-neoplastic drugs in HEK293 and H460 cells overexpressing ABCG2 by inhibiting their transport activity as opposed to altering their levels of expression. PMID:24626598

Influences of MxA gene -88 G/T and IFN-gamma +874 A/T on the natural history of hepatitis B virus infection in an endemic area.

PubMed

Peng, X M; Lei, R X; Gu, L; Ma, H H; Xie, Q F; Gao, Z L

2007-10-01

The influence of human genetics on the natural history of hepatitis B virus (HBV) infection may be diminished in endemic areas because infection at a young age predisposes to chronic HBV infection. The present study aimed to address this issue through the determination of the influences of single nucleotide polymorphisms (SNPs) of myxovirus resistence-1 (MxA) -88 G/T and interferon (IFN)-gamma +874 A/T on the natural history of HBV infection in endemic regions. One hundred adult patients with self-limiting HBV infection (positive for both anti-HBs and anti-HBc) and 340 adult patients with persistent HBV infection were recruited from southern China, an endemic area with an HBsAg carrier rate of 17.8%. SNPs of MxA -88 G/T and interferon (IFN)-gamma +874 A/T were typed using a protocol based on competitively differentiated polymerase chain reaction. A highly significant difference in the distribution of MxA -88 G/T was observed between those with persistent and self-limiting HBV infections. The latter displayed a lower frequency of the GG genotype (41.0% vs. 52.9%, P = 0.036) and a higher frequency of the TT genotype (16.0% vs. 2.4%, P = 0.000), compared to patients with persistent infection. These differences were not gender- or age-specific. However, a significant distribution difference of IFN-gamma +874 A/T was not observed. Between two groups of patients, respectively, the distribution frequencies of the AA genotype (65.0% vs. 72.8%, P = 0.139) and the TT genotype (2.0% vs. 1.2%, P = 0.894) were found. These results suggest that MxA gene -88 G/T and IFN-gamma +874 A/T behave differently in endemic HBV infections. Further study is necessary to clarify the influences of human genetics on endemic HBV infections.

Primary EBV Infection Induces an Expression Profile Distinct from Other Viruses but Similar to Hemophagocytic Syndromes

PubMed Central

Dunmire, Samantha K.; Odumade, Oludare A.; Porter, Jean L.; Reyes-Genere, Juan; Schmeling, David O.; Bilgic, Hatice; Fan, Danhua; Baechler, Emily C.; Balfour, Henry H.; Hogquist, Kristin A.

2014-01-01

Epstein-Barr Virus (EBV) causes infectious mononucleosis and establishes lifelong infection associated with cancer and autoimmune disease. To better understand immunity to EBV, we performed a prospective study of natural infection in healthy humans. Transcriptome analysis defined a striking and reproducible expression profile during acute infection but no lasting gene changes were apparent during latent infection. Comparing the EBV response profile to multiple other acute viral infections, including influenza A (influenza), respiratory syncytial virus (RSV), human rhinovirus (HRV), attenuated yellow fever virus (YFV), and Dengue fever virus (DENV), revealed similarity only to DENV. The signature shared by EBV and DENV was also present in patients with hemophagocytic syndromes, suggesting these two viruses cause uncontrolled inflammatory responses. Interestingly, while EBV induced a strong type I interferon response, a subset of interferon induced genes, including MX1, HERC5, and OAS1, were not upregulated, suggesting a mechanism by which viral antagonism of immunity results in a profound inflammatory response. These data provide an important first description of the response to a natural herpesvirus infection in humans. PMID:24465555

Primary EBV infection induces an expression profile distinct from other viruses but similar to hemophagocytic syndromes.

PubMed

Dunmire, Samantha K; Odumade, Oludare A; Porter, Jean L; Reyes-Genere, Juan; Schmeling, David O; Bilgic, Hatice; Fan, Danhua; Baechler, Emily C; Balfour, Henry H; Hogquist, Kristin A

2014-01-01

Epstein-Barr Virus (EBV) causes infectious mononucleosis and establishes lifelong infection associated with cancer and autoimmune disease. To better understand immunity to EBV, we performed a prospective study of natural infection in healthy humans. Transcriptome analysis defined a striking and reproducible expression profile during acute infection but no lasting gene changes were apparent during latent infection. Comparing the EBV response profile to multiple other acute viral infections, including influenza A (influenza), respiratory syncytial virus (RSV), human rhinovirus (HRV), attenuated yellow fever virus (YFV), and Dengue fever virus (DENV), revealed similarity only to DENV. The signature shared by EBV and DENV was also present in patients with hemophagocytic syndromes, suggesting these two viruses cause uncontrolled inflammatory responses. Interestingly, while EBV induced a strong type I interferon response, a subset of interferon induced genes, including MX1, HERC5, and OAS1, were not upregulated, suggesting a mechanism by which viral antagonism of immunity results in a profound inflammatory response. These data provide an important first description of the response to a natural herpesvirus infection in humans.

Prevalence of interferon type I signature in CD14 monocytes of patients with Sjögren's syndrome and association with disease activity and BAFF gene expression

PubMed Central

Brkic, Zana; Maria, Naomi I; van Helden-Meeuwsen, Cornelia G; van de Merwe, Joop P; van Daele, Paul L; Dalm, Virgil A; Wildenberg, Manon E; Beumer, Wouter; Drexhage, Hemmo A; Versnel, Marjan A

2013-01-01

Objective To determine the prevalence of upregulation of interferon (IFN) type I inducible genes, the so called ‘IFN type I signature’, in CD14 monocytes in 69 patients with primary Sjögren's syndrome (pSS) and 44 healthy controls (HC) and correlate it with disease manifestations and expression of B cell activating factor (BAFF). Methods Expression of IFI44L, IFI44, IFIT3, LY6E and MX1 was measured using real time quantitative PCR in monocytes. Expression values were used to calculate IFN type I scores for each subject. pSS patients positive for the IFN type I signature (IFN score≥10) and patients negative for the signature (IFN score<10) were then compared for clinical disease manifestations and BAFF expression. A bioassay using a monocytic cell line was performed to study whether BAFF mRNA expression was inducible by IFN type I activity in serum of patients with pSS. Results An IFN type I signature was present in 55% of patients with pSS compared with 4.5% of HC. Patients with the IFN type I signature showed: (a) higher EULAR Sjögren's Syndrome Disease Activity Index scores; higher anti-Ro52, anti-Ro60 and anti-La autoantibodies; higher rheumatoid factor; higher serum IgG; lower C3, lower absolute lymphocyte and neutrophil counts; (b)higher BAFF gene expression in monocytes. In addition, serum of signature-positive patients induced BAFF gene expression in monocytes. Conclusions The monocyte IFN type I signature identifies a subgroup of patients with pSS with a higher clinical disease activity together with higher BAFF mRNA expression. Such patients might benefit from treatment blocking IFN type I production or activity. PMID:22736090

Whole-genome transcription and DNA methylation analysis of peripheral blood mononuclear cells identified aberrant gene regulation pathways in systemic lupus erythematosus.

PubMed

Zhu, Honglin; Mi, Wentao; Luo, Hui; Chen, Tao; Liu, Shengxi; Raman, Indu; Zuo, Xiaoxia; Li, Quan-Zhen

2016-07-13

Recent achievement in genetics and epigenetics has led to the exploration of the pathogenesis of systemic lupus erythematosus (SLE). Identification of differentially expressed genes and their regulatory mechanism(s) at whole-genome level will provide a comprehensive understanding of the development of SLE and its devastating complications, lupus nephritis (LN). We performed whole-genome transcription and DNA methylation analysis in PBMC of 30 SLE patients, including 15 with LN (SLE LN(+)) and 15 without LN (SLE LN(-)), and 25 normal controls (NC) using HumanHT-12 Beadchips and Illumina Human Methy450 chips. The serum proinflammatory cytokines were quantified using Bio-plex Human Cytokine 27-plex assay. Differentially expressed genes and differentially methylated CpG were analyzed with GenomeStudio, R, and SAM software. The association between DNA methylation and gene expression were tested. Gene interaction pathways of the differentially expressed genes were analyzed by IPA software. We identified 552 upregulated genes and 550 downregulated genes in PBMC of SLE. Integration of DNA methylation and gene expression profiling showed that 334 upregulated genes were hypomethylated, and 479 downregulated genes were hypermethylated. Pathway analysis on the differential genes in SLE revealed significant enrichment in interferon (IFN) signaling and toll-like receptor (TLR) signaling pathways. Nine IFN- and seven TLR-related genes were identified and displayed step-wise increase in SLE LN(-) and SLE LN(+). Hypomethylated CpG sites were detected on these genes. The gene expressions for MX1, GPR84, and E2F2 were increased in SLE LN(+) as compared to SLE LN(-) patients. The serum levels of inflammatory cytokines, including IL17A, IP-10, bFGF, TNF-α, IL-6, IL-15, GM-CSF, IL-1RA, IL-5, and IL-12p70, were significantly elevated in SLE compared with NC. The levels of IL-15 and IL1RA correlated with their mRNA expression. The upregulation of IL-15 may be regulated by hypomethylated CpG sites in the promotor region of the gene. Our study has demonstrated that significant number of differential genes in SLE were involved in IFN, TLR signaling pathways, and inflammatory cytokines. The enrichment of differential genes has been associated with aberrant DNA methylation, which may be relevant to the pathogenesis of SLE. Our observations have laid the groundwork for further diagnostic and mechanistic studies of SLE and LN.

Bioinformatics analysis of differentially expressed gene profiles associated with systemic lupus erythematosus

PubMed Central

Wu, Chengjiang; Zhao, Yangjing; Lin, Yu; Yang, Xinxin; Yan, Meina; Min, Yujiao; Pan, Zihui; Xia, Sheng; Shao, Qixiang

2018-01-01

DNA microarray and high-throughput sequencing have been widely used to identify the differentially expressed genes (DEGs) in systemic lupus erythematosus (SLE). However, the big data from gene microarrays are also challenging to work with in terms of analysis and processing. The presents study combined data from the microarray expression profile (GSE65391) and bioinformatics analysis to identify the key genes and cellular pathways in SLE. Gene ontology (GO) and cellular pathway enrichment analyses of DEGs were performed to investigate significantly enriched pathways. A protein-protein interaction network was constructed to determine the key genes in the occurrence and development of SLE. A total of 310 DEGs were identified in SLE, including 193 upregulated genes and 117 downregulated genes. GO analysis revealed that the most significant biological process of DEGs was immune system process. Kyoto Encyclopedia of Genes and Genome pathway analysis showed that these DEGs were enriched in signaling pathways associated with the immune system, including the RIG-I-like receptor signaling pathway, intestinal immune network for IgA production, antigen processing and presentation and the toll-like receptor signaling pathway. The current study screened the top 10 genes with higher degrees as hub genes, which included 2′-5′-oligoadenylate synthetase 1, MX dynamin like GTPase 2, interferon induced protein with tetratricopeptide repeats 1, interferon regulatory factor 7, interferon induced with helicase C domain 1, signal transducer and activator of transcription 1, ISG15 ubiquitin-like modifier, DExD/H-box helicase 58, interferon induced protein with tetratricopeptide repeats 3 and 2′-5′-oligoadenylate synthetase 2. Module analysis revealed that these hub genes were also involved in the RIG-I-like receptor signaling, cytosolic DNA-sensing, toll-like receptor signaling and ribosome biogenesis pathways. In addition, these hub genes, from different probe sets, exhibited significant co-expressed tendency in multi-experiment microarray datasets (P<0.01). In conclusion, these key genes and cellular pathways may improve the current understanding of the underlying mechanism of development of SLE. These key genes may be potential biomarkers of diagnosis, therapy and prognosis for SLE. PMID:29257335

The extent to which immunity, apoptosis and detoxification gene expression interact with 17 alpha-methyltestosterone.

PubMed

Abo-Al-Ela, Haitham G; El-Nahas, Abeer F; Mahmoud, Shawky; Ibrahim, Essam M

2017-01-01

Innate immunity is the first line of defence against invasion by foreign pathogens. One widely used synthetic androgen for the production of all-male fish, particularly commercially valuable Nile tilapia, Oreochromis niloticus, is 17 alpha-methyltestosterone (MT). The present study investigates the effect of MT on innate immunity, cellular apoptosis and detoxification and the mortality rate, during and after the feeding of fry with 0-, 40-and 60-mg MT/kg. Expression analysis was completed on interleukin 1 beta (il1β), interleukin 8 (il8), tumour necrosis factor alpha (tnfα), CXC2- and CC-chemokines, interferon (ifn), myxovirus resistance (mx), toll-like receptor 7 (tlr7), immunoglobulin M heavy chain (IgM heavy chain), vitellogenin (vtg), cellular apoptosis susceptibility (cas) and glutathione S-transferase α1 (gstα1). Expression analysis revealed that MT had a significant impact on these genes, and this impact varied from induction to repression during and after the treatment. Linear regression analysis showed a significant association between the majority of the tested gene transcript levels and mortality rates on the 7 th and 21 st days of hormonal treatment and 2 weeks following hormonal cessation. The results are thoroughly discussed in this article. This is the first report concerning the hazardous effect of MT on a series of genes involved in immunity, apoptosis and detoxification in the Nile tilapia fry. Copyright © 2016 Elsevier Ltd. All rights reserved.

Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

PubMed

Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

2015-08-18

p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

Anti-viral activity of galectin-1 from flounder Paralichthys olivaceus.

PubMed

Liu, Shousheng; Hu, Guobin; Sun, Chen; Zhang, Shicui

2013-06-01

Galectins are a family of Ca(2+)-independent soluble lectins characterized by their affinity to β-galactosides. Mammalian galectins have been shown to play a defense role against certain bacteria, fungi and viruses. However, the immunological functions of galectins in fish is poorly characterized. Here we demonstrated that the expression of galectin-1 gene from the flounder Paralichthys olivaceus was decreased in the initial 8 h after challenge with poly I:C, then increased markedly from 24 h onwards, and the recombinant galectin-1 was able to neutralize the lymphocystis disease virus (LCDV), inhibiting the formation of cytopathic effects. In addition, the recombinant galectin had a potential anti-inflammatory activity against infection by LCDV, and was able to restrain the overexpression of the anti-viral protein gene mx against virus infection. These results indicate that flounder galectin-1 has an anti-viral activity, capable of reducing LCDV pathogenicity. Copyright © 2013 Elsevier Ltd. All rights reserved.

Establishment and characterization of a new cell line (SSP-9) derived from Atlantic salmon Salmo salar that expresses type I ifn.

PubMed

Rodriguez Saint-Jean, S; González, C; Monrás, M; Romero, A; Ballesteros, N; Enríquez, R; Perez-Prieto, S

2014-11-01

In the present work, the establishment and biological characterization of a new cell line, SSP-9, derived from the pronephros of the Atlantic salmon Salmo salar, are reported. These cells grew well in Leibovitz's (L15) medium supplemented with 10% foetal calf serum at temperatures from 15 to 25° C, and they have been sub-cultured over 100 passages to produce a continuous cell line with an epithelial-like morphology. The SSP-9 cells attached and spread efficiently at different plating densities, retaining 80% of cell viability after storage in liquid nitrogen. When karyotyped, the cells had 40-52 chromosomes, with a modal number of 48. Viral susceptibility tests showed that SSP-9 cells were susceptible to infectious pancreatic necrosis virus and infectious haematopoietic necrosis virus, producing infectious virus and regular cytopathic effects. Moreover, these cells could be stimulated by poly I:C, showing significant up-regulation in the expression of the genes that regulate immune responses, such as ifn and mx-1. SSP-9 cells constitutively express genes characteristic of macrophages, such as major histocompatibility complex (mhc-II) and interleukin 12b (il-12b), and flow cytometry assays confirmed that SSP-9 cells can be permanently transfected with plasmids expressing a reporter gene. Accordingly, this new cell line is apparently suitable for transgenic manipulation, and to study host cell-virus interactions and immune processes. © 2014 The Fisheries Society of the British Isles.

Gene expression profiles associated with lymphocystis disease virus (LCDV) in experimentally infected Senegalese sole (Solea senegalensis).

PubMed

Carballo, Carlos; Castro, Dolores; Borrego, Juan J; Manchado, Manuel

2017-07-01

In the present study, the pathogenesis of lymphocystis disease virus (LCDV) and the immune gene expression patterns associated with this viral infection were determined in the flatfish Senegalese sole. The results indicate that LCDV spreads rapidly from the peritoneal cavity through the bloodstream to reach target organs such as kidney, gut, liver, and skin/fin. The viral load was highest in kidney and reduced progressively thorough the experiment in spite of the viral major capsid protein gene was transcribed. The LCDV injection activated a similar set of differentially expressed transcripts in kidney and intestine although with some differences in the intensity and time-course response. This set included antiviral-related transcripts (including the mx and interferon-related factors irf1, irf2, irf3, irf7, irf8, irf9, irf10), cytokines (il1b, il6, il8, il12 and tnfa) and their receptors (il1r, il8r, il10r, il15ra, il17r), chemokines (CXC-type, CC-type and IL-8), prostaglandins (cox-2), g-type lysozymes, hepcidin, complement fractions (c2, c4-1 and c4-2) and the antigen differentiation factors cd4, cd8a, and cd8b. The expression profile observed indicated that the host triggered a systemic defensive response including inflammation able to cope with the viral challenge. Copyright © 2017 Elsevier Ltd. All rights reserved.

Specificity of DNA vaccines against the U and M genogroups of infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss).

PubMed

Peñaranda, Ma Michelle D; Lapatra, Scott E; Kurath, Gael

2011-07-01

Infectious hematopoietic necrosis virus (IHNV) is a fish rhabdovirus that causes significant mortality in salmonid species. In North America IHNV has three major genogroups designated U, M, and L. Host-specificity of the M and U genogroups of IHNV has been established both in the field and in experimental challenges, with M isolates being more prevalent and more virulent in rainbow trout (Oncorhynchus mykiss), and U isolates being more prevalent and highly virulent in sockeye salmon (Oncorhynchus nerka). In this study, efficacy of DNA vaccines containing either M (pM) or U (pU) virus glycoprotein genes was investigated during intra- and cross-genogroup challenges in rainbow trout. In virus challenges at 7 days post-vaccination (early antiviral response), both pM and pU were highly protective against either M or U IHNV. In challenges at 28 days post-vaccination (specific antiviral response), both pM and pU were protective against M IHNV but the homologous pM vaccine was significantly more protective than pU in one of two experiments. At this stage both pM and pU induced comparably high protection against U IHNV challenge. Correlates of protection were also investigated by assessing the expression of the interferon-stimulated gene Mx-1 and the production of neutralizing antibodies (NAbs) following pM or pU DNA vaccination. Mx-1 gene expression, measured at 4 and 7 days post-vaccination as an indicator of the host innate immune response, was found to be significantly higher after pM than pU vaccination in some cases. Neutralizing antibody was produced in response to the two vaccines, but antibody titers did not show consistent correlation with protection. The results show that the rainbow trout innate and adaptive immune responses have some ability to distinguish between the U and M genogroup IHNV, but overall the pM and pU vaccines were protective against both homologous and cross-genogroup challenges. Copyright © 2011 Elsevier Ltd. All rights reserved.

Identification of diverse defense mechanisms in rainbow trout red blood cells in response to halted replication of VHS virus

PubMed Central

Nombela, Ivan; Puente-Marin, Sara; Chico, Veronica; Villena, Alberto J.; Carracedo, Begoña; Ciordia, Sergio; Mena, Maria Carmen; Mercado, Luis; Perez, Luis; Coll, Julio; Ortega-Villaizan, Maria del Mar

2018-01-01

Background: It has been described that fish nucleated red blood cells (RBCs) generate a wide variety of immune-related gene transcripts when viruses highly replicate inside them and are their main target cell. The immune response and mechanisms of fish RBCs against viruses targeting other cells or tissues has not yet been explored and is the objective of our study. Methods: Rainbow trout RBCs were obtained from peripheral blood, ficoll purified and exposed to Viral Haemorrhagic Septicaemia virus (VHSV). Immune response was evaluated by means of RT-qPCR, flow cytometry, immunofluorescence and isobaric tag for relative and absolute quantification (iTRAQ) protein profiling. Results: VHSV N gene transcripts incremented early postexposure and were drastically decreased after 6 hours postexposure (hpe). The expression of type I interferon ( ifn1) gene was significantly downregulated at early postexposure (3 hpe), together with a gradual downregulation of interferon-inducible mx and pkr genes until 72 hpe. Type I IFN protein was downregulated and interferon-inducible Mx protein was maintained at basal levels. Co-culture assays of RBCs, previously exposed to UV-inactivated VHSV, and TSS (stromal cell line from spleen) revealed IFN crosstalk between both cell types. On the other hand, anti-microbial peptide β-defensin 1 and neutrophil chemotactic factor interleukin 8 were slightly upregulated in VHSV-exposed RBCs. iTRAQ profiling revealed that VHSV exposure can induce a global protein downregulation in rainbow trout RBCs, mainly related to RNA stability and proteasome pathways. Antioxidant/antiviral response is also suggested to be involved in the response of rainbow trout RBCs to VHSV. Conclusions: A variety of mechanisms are proposed to be implicated in the antiviral response of rainbow trout RBCs against VHSV halted infection. Ongoing research is focused on understanding the mechanisms in detail. PMID:29527292

Innate immune responses against rock bream iridovirus (RBIV) infection in rock bream (Oplegnathus fasciatus) following poly (I:C) administration.

PubMed

Jung, Myung-Hwa; Jung, Sung-Ju

2017-12-01

Poly (I:C) showed promise as an immunoprotective agents in rock bream against rock bream iridovirus (RBIV) infection. In this study, we evaluated the time-dependent virus replication pattern and antiviral immune responses in RBIV-infected rock bream with and without poly (I:C) administration. In the poly (I:C)+virus-injected group, virus copy numbers were more than 18.9-, 24.0- and 479.2-fold lower than in the virus only injected group at 4 (4.73 × 10 4 and 8.95 × 10 5 /μl, respectively), 7 (3.67 × 10 5 and 8.81 × 10 6 /μl, respectively) and 10 days post infection (dpi) (1.26 × 10 5 and 6.02 × 10 7 /μl, respectively). Moreover, significantly high expression levels of TLR3 (8.6- and 7.7-fold, at 4 and 7 dpi, respectively) and IL1β (3.6-fold at 2 dpi) were observed in the poly (I:C)+virus-injected group, but the expression levels were not significantly in the virus-injected group. However, IL8 and TNFα expression levels showed no statistical significance in both groups. Mx, ISG15 and PKR were significantly highly expressed from 4 to 10 dpi in the virus-injected group. Nevertheless, in the poly (I:C)+virus-injected group, Mx and ISG15 expression were significantly expressed from 2 dpi. In summary, poly (I:C) administration in rock bream induces TLR3, IL1β, Mx and ISG15-mediated immune responses, which could be a critical factor for inhibition of virus replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

N-methylpurine DNA glycosylase and DNA polymerase β modulate BER inhibitor potentiation of glioma cells to temozolomide

PubMed Central

Tang, Jiang-bo; Svilar, David; Trivedi, Ram N.; Wang, Xiao-hong; Goellner, Eva M.; Moore, Briana; Hamilton, Ronald L.; Banze, Lauren A.; Brown, Ashley R.; Sobol, Robert W.

2011-01-01

Temozolomide (TMZ) is the preferred chemotherapeutic agent in the treatment of glioma following surgical resection and/or radiation. Resistance to TMZ is attributed to efficient repair and/or tolerance of TMZ-induced DNA lesions. The majority of the TMZ-induced DNA base adducts are repaired by the base excision repair (BER) pathway and therefore modulation of this pathway can enhance drug sensitivity. N-methylpurine DNA glycosylase (MPG) initiates BER by removing TMZ-induced N3-methyladenine and N7-methylguanine base lesions, leaving abasic sites (AP sites) in DNA for further processing by BER. Using the human glioma cell lines LN428 and T98G, we report here that potentiation of TMZ via BER inhibition [methoxyamine (MX), the PARP inhibitors PJ34 and ABT-888 or depletion (knockdown) of PARG] is greatly enhanced by over-expression of the BER initiating enzyme MPG. We also show that methoxyamine-induced potentiation of TMZ in MPG expressing glioma cells is abrogated by elevated-expression of the rate-limiting BER enzyme DNA polymerase β (Polβ), suggesting that cells proficient for BER readily repair AP sites in the presence of MX. Further, depletion of Polβ increases PARP inhibitor-induced potentiation in the MPG over-expressing glioma cells, suggesting that expression of Polβ modulates the cytotoxic effect of combining increased repair initiation and BER inhibition. This study demonstrates that MPG overexpression, together with inhibition of BER, sensitizes glioma cells to the alkylating agent TMZ in a Polβ-dependent manner, suggesting that the expression level of both MPG and Polβ might be used to predict the effectiveness of MX and PARP-mediated potentiation of TMZ in cancer treatment. PMID:21377995

COMPADRE: an R and web resource for pathway activity analysis by component decompositions.

PubMed

Ramos-Rodriguez, Roberto-Rafael; Cuevas-Diaz-Duran, Raquel; Falciani, Francesco; Tamez-Peña, Jose-Gerardo; Trevino, Victor

2012-10-15

The analysis of biological networks has become essential to study functional genomic data. Compadre is a tool to estimate pathway/gene sets activity indexes using sub-matrix decompositions for biological networks analyses. The Compadre pipeline also includes one of the direct uses of activity indexes to detect altered gene sets. For this, the gene expression sub-matrix of a gene set is decomposed into components, which are used to test differences between groups of samples. This procedure is performed with and without differentially expressed genes to decrease false calls. During this process, Compadre also performs an over-representation test. Compadre already implements four decomposition methods [principal component analysis (PCA), Isomaps, independent component analysis (ICA) and non-negative matrix factorization (NMF)], six statistical tests (t- and f-test, SAM, Kruskal-Wallis, Welch and Brown-Forsythe), several gene sets (KEGG, BioCarta, Reactome, GO and MsigDB) and can be easily expanded. Our simulation results shown in Supplementary Information suggest that Compadre detects more pathways than over-representation tools like David, Babelomics and Webgestalt and less false positives than PLAGE. The output is composed of results from decomposition and over-representation analyses providing a more complete biological picture. Examples provided in Supplementary Information show the utility, versatility and simplicity of Compadre for analyses of biological networks. Compadre is freely available at http://bioinformatica.mty.itesm.mx:8080/compadre. The R package is also available at https://sourceforge.net/p/compadre.

The Antiviral Mechanism of an Influenza A Virus Nucleoprotein-Specific Single-Domain Antibody Fragment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanke, Leo; Knockenhauer, Kevin E.; Brewer, R. Camille

Alpaca-derived single-domain antibody fragments (VHHs) that target the influenza A virus nucleoprotein (NP) can protect cells from infection when expressed in the cytosol. We found that one such VHH, αNP-VHH1, exhibits antiviral activity similar to that of Mx proteins by blocking nuclear import of incoming viral ribonucleoproteins (vRNPs) and viral transcription and replication in the nucleus. We determined a 3.2-Å crystal structure of αNP-VHH1 in complex with influenza A virus NP. The VHH binds to a nonconserved region on the body domain of NP, which has been associated with binding to host factors and serves as a determinant of hostmore » range. Several of the NP/VHH interface residues determine sensitivity of NP to antiviral Mx GTPases. The structure of the NP/αNP-VHH1 complex affords a plausible explanation for the inhibitory properties of the VHH and suggests a rationale for the antiviral properties of Mx proteins. Such knowledge can be leveraged for much-needed novel antiviral strategies. IMPORTANCEInfluenza virus strains can rapidly escape from protection afforded by seasonal vaccines or acquire resistance to available drugs. Additional ways to interfere with the virus life cycle are therefore urgently needed. The influenza virus nucleoprotein is one promising target for antiviral interventions. We have previously isolated alpaca-derived single-domain antibody fragments (VHHs) that protect cells from influenza virus infection if expressed intracellularly. We show here that one such VHH exhibits antiviral activities similar to those of proteins of the cellular antiviral defense (Mx proteins). We determined the three-dimensional structure of this VHH in complex with the influenza virus nucleoprotein and identified the interaction site, which overlaps regions that determine sensitivity of the virus to Mx proteins. Our data define a new vulnerability of influenza virus, help us to better understand the cellular antiviral mechanisms, and provide a well-characterized tool to further study them.« less

Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

2014-02-01

Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

Differential role of gp130-dependent STAT and Ras signalling for haematopoiesis following bone-marrow transplantation.

PubMed

Kroy, Daniela C; Hebing, Lisa; Sander, Leif E; Gassler, Nikolaus; Erschfeld, Stephanie; Sackett, Sara; Galm, Oliver; Trautwein, Christian; Streetz, Konrad L

2012-01-01

Bone marrow transplantation (BMT) is a complex process regulated by different cytokines and growth factors. The pleiotropic cytokine IL-6 (Interleukin-6) and related cytokines of the same family acting on the common signal transducer gp130 are known to play a key role in bone marrow (BM) engraftment. In contrast, the exact signalling events that control IL-6/gp130-driven haematopoietic stem cell development during BMT remain unresolved. Conditional gp130 knockout and knockin mice were used to delete gp130 expression (gp130(ΔMx)), or to selectively disrupt gp130-dependent Ras (gp130(ΔMxRas)) or STAT signalling (gp130(ΔMxSTAT)) in BM cells. BM derived from the respective strains was transplanted into irradiated wildtype hosts and repopulation of various haematopoietic lineages was monitored by flow cytometry. BM derived from gp130 deficient donor mice (gp130(ΔMx)) displayed a delayed engraftment, as evidenced by reduced total white blood cells (WBC), marked thrombocytopenia and anaemia in the early phase after BMT. Lineage analysis unravelled a restricted development of CD4(+) and CD8(+) T-cells, CD19(+) B-cells and CD11b(+) myeloid cells after transplantation of gp130-deficient BM grafts. To further delineate the two major gp130-induced signalling cascades, Ras-MAPK and STAT1/3-signalling respectively, we used gp130(ΔMxRas) and gp130(ΔMxSTAT) donor BM. BMT of gp130(ΔMxSTAT) cells significantly impaired engraftment of CD4(+), CD8(+), CD19(+) and CD11b(+) cells, whereas gp130(ΔMxRas) BM displayed a selective impairment in early thrombopoiesis. Importantly, gp130-STAT1/3 signalling deficiency in BM grafts severely impaired survival of transplanted mice, thus demonstrating a pivotal role for this pathway in BM graft survival and function. Our data unravel a vital function of IL-6/gp130-STAT1/3 signals for BM engraftment and haematopoiesis, as well as for host survival after transplantation. STAT1/3 and ras-dependent pathways thereby exert distinct functions on individual bone-marrow-lineages.

Glutathione Fine-Tunes the Innate Immune Response toward Antiviral Pathways in a Macrophage Cell Line Independently of Its Antioxidant Properties

PubMed Central

Diotallevi, Marina; Checconi, Paola; Palamara, Anna Teresa; Celestino, Ignacio; Coppo, Lucia; Holmgren, Arne; Abbas, Kahina; Peyrot, Fabienne; Mengozzi, Manuela; Ghezzi, Pietro

2017-01-01

Glutathione (GSH), a major cellular antioxidant, is considered an inhibitor of the inflammatory response involving reactive oxygen species (ROS). However, evidence is largely based on experiments with exogenously added antioxidants/reducing agents or pro-oxidants. We show that depleting macrophages of 99% of GSH does not exacerbate the inflammatory gene expression profile in the RAW264 macrophage cell line or increase expression of inflammatory cytokines in response to the toll-like receptor 4 (TLR4) agonist lipopolysaccharide (LPS); only two small patterns of LPS-induced genes were sensitive to GSH depletion. One group, mapping to innate immunity and antiviral responses (Oas2, Oas3, Mx2, Irf7, Irf9, STAT1, il1b), required GSH for optimal induction. Consequently, GSH depletion prevented the LPS-induced activation of antiviral response and its inhibition of influenza virus infection. LPS induction of a second group of genes (Prdx1, Srxn1, Hmox1, GSH synthase, cysteine transporters), mapping to nrf2 and the oxidative stress response, was increased by GSH depletion. We conclude that the main function of endogenous GSH is not to limit inflammation but to fine-tune the innate immune response to infection. PMID:29033950

Antimicrobial peptides (AMP) with antiviral activity against fish nodavirus.

PubMed

Chia, Ta-Jui; Wu, Yu-Chi; Chen, Jyh-Yih; Chi, Shau-Chi

2010-03-01

Nervous necrosis virus (NNV) is classified as betanodavirus of Nodaviridae, and has caused mass mortality of numerous marine fish species at larval stage. Antimicrobial peptides (AMPs) play an important role of innate immunity either against bacterial pathogens or viruses. Up to date, little is known if any AMP could effectively inhibit fish nodaviruses and its mechanism. In this study, the antiviral activities of three antimicrobial peptides (AMPs) against grouper NNV (GNNV) were screened in the fish cell line. Two of the three AMPs, tilapia hepcidin 1-5 (TH 1-5) and cyclic shrimp anti-lipopolysaccharide factor (cSALF), were able to agglutinate purified NNV particles into clump, and the clumps were further confirmed to be viral proteins by TEM and Western blot. The NNV solution, separately pre-mixed with AMP (TH 1-5 or cSALF) or deionized-distilled water for 1 h, was used to infect GF-1 cells, and the levels of capsid protein in the GNNV-AMP-infected cells at 1 h post infection were much lower than that in the GNNV-H(2)O-infected cells, indicating that only a small portion of viral particles in the GNNV-AMP mixture could successfully infected the cells. Treatment of cBB cells with TH 1-5 and cSALF did not induce Mx gene expression; however, grouper epinecidin-1 (CP643-1) could induce the expression of Mx in the pre-treated cBB cells. This study revealed three AMPs with anti-NNV activity through two different mechanisms, and shed light on the future application in aquaculture. Copyright 2009 Elsevier Ltd. All rights reserved.

The influence of temperature on viral replication and antiviral-related genes response in hirame rhabdovirus-infected flounder (Paralichthys olivaceus).

PubMed

Zhang, Jialin; Tang, Xiaoqian; Sheng, Xiuzhen; Xing, Jing; Zhan, Wenbin

2017-09-01

Hirame rhabdovirus (HIRRV) is a rhabdovirus that causes severe disease in fish. The mortality due to HIRRV infection occurs at temperatures below 15 °C, but no mortality is observed over 20 °C. In this study, Japanese flounder (Paralichthys olivaceus) was artificially infected with the HIRRV CNPo2015 strain at 10 °C or 20 °C. Absolute quantitative real-time PCR was employed to examine the viral replication in spleens after HIRRV infection. Expression profiles of four interferon-related genes (type I IFN, Mx, ISG15, MDA5) and two proinflammatory genes (TNF-α and IL-1β) were also investigated by quantitative real-time PCR. Results showed that viral copies in spleens increased gradually over time and peaked at 72 h post infection (hpi) in the 10 °C group, while viral copies in the 20 °C group increased within 24 hpi, but afterwards decreased to very low levels. Moreover, the expressions of IFNs in the 10 °C group reached the highest levels at 72 hpi, whereas their peak levels appeared much earlier in the 20 °C group, at 12 hpi. The expression levels of TNF-α and IL-1β in the 10 °C group peaked at 12 hpi and then quickly declined. However, the two genes were highly expressed during 6-24 hpi in the 20 °C group. Based on these findings, we concluded that HIRRV infection induced an efficient antiviral immune response at 20 °C, which might inhibit the viral transcription at early stages and finally prevent HIRRV infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Two distinct interferon-γ genes in Tetraodon nigroviridis: Functional analysis during Vibrio parahaemolyticus infection.

PubMed

Peng, Wan; Lu, Dan-Qi; Li, Gao-Fei; Zhang, Xu; Yao, Mi; Zhang, Yong; Lin, Hao-Ran

2016-02-01

Interferon gamma (IFNγ) is a Th1 cytokine that plays a very important role in almost all phases of immune and inflammatory responses. In this study, we explored the functions of IFNγ1 and IFNγ2 of Tetraodon nigroviridis. Treating T. nigroviridis spleen and head kidney cells in vitro with recombinant T. nigroviridis IFNγ1 protein (rTn IFNγ1) or recombinant T. nigroviridis IFNγ2 protein (rTn IFNγ2) enhanced their nitric oxide responses. Both rTn IFNγ1 and rTn IFNγ2 also induced the expression of interferon-stimulated gene 15 (ISG15), a common anti-viral gene, although the expression of the interferon-inducible Mx gene was markedly inhibited by rTn IFNγ1 and was induced by rTn IFNγ2. The in vivo effects of rTn IFNγ1 and rTn IFNγ2 on Vibrio parahaemolyticus (V. parahaemolyticus) infection were assessed by intraperitoneally injecting rTn IFNγ1 or rTn IFNγ2 (100 ng) and V. parahaemolyticus (8 × 10(10)CFU/mL) into T. nigroviridis. A comparison of the group treated only with V. parahaemolyticus and those also treated with rTn IFNγ1 or rTn IFNγ2 showed that neither of these IFNγs protected T. nigroviridis from V. parahaemolyticus infection. However, rTn IFNγ1 more rapidly and robustly promoted inflammatory responses compared with rTn IFNγ2, whereas rTn IFNγ2 was involved in inducing the host to develop a more effective response earlier during the later stage of a V. parahaemolyticus infection. Moreover, microRNA-29b (miR-29b) expression is inversely correlated with IFNγ2 expression in T. nigroviridis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Luciferase NanoLuc as a reporter for gene expression and protein levels in Saccharomyces cerevisiae.

PubMed

Masser, Anna E; Kandasamy, Ganapathi; Kaimal, Jayasankar Mohanakrishnan; Andréasson, Claes

2016-05-01

Reporter proteins are essential tools in the study of biological processes and are employed to monitor changes in gene expression and protein levels. Luciferases are reporter proteins that enable rapid and highly sensitive detection with an outstanding dynamic range. Here we evaluated the usefulness of the 19 kDa luciferase NanoLuc (Nluc), derived from the deep sea shrimp Oplophorus gracilirostris, as a reporter protein in yeast. Cassettes with codon-optimized genes expressing yeast Nluc (yNluc) or its destabilized derivative yNlucPEST have been assembled in the context of the dominant drug resistance marker kanMX. The reporter proteins do not impair the growth of yeast cells and exhibit half-lives of 40 and 5 min, respectively. The commercial substrate Nano-Glo® is compatible with detection of yNluc bioluminescence in < 50 cells. Using the unstable yNlucPEST to report on the rapid and transient expression of a heat-shock promoter (PCYC1-HSE ), we found a close match between the intensity of the bioluminescent signal and mRNA levels during both induction and decay. We demonstrated that the bioluminescence of yNluc fused to the C-terminus of a temperature-sensitive protein reports on its protein levels. In conclusion, yNluc and yNlucPEST are valuable new reporter proteins suitable for experiments with yeast using standard commercial substrate. © 2016 The Authors. Yeast published by John Wiley & Sons Ltd. © 2016 The Authors. Yeast published by John Wiley & Sons Ltd.

Survey of genome sequences in a wild sweet potato, Ipomoea trifida (H. B. K.) G. Don

PubMed Central

Hirakawa, Hideki; Okada, Yoshihiro; Tabuchi, Hiroaki; Shirasawa, Kenta; Watanabe, Akiko; Tsuruoka, Hisano; Minami, Chiharu; Nakayama, Shinobu; Sasamoto, Shigemi; Kohara, Mitsuyo; Kishida, Yoshie; Fujishiro, Tsunakazu; Kato, Midori; Nanri, Keiko; Komaki, Akiko; Yoshinaga, Masaru; Takahata, Yasuhiro; Tanaka, Masaru; Tabata, Satoshi; Isobe, Sachiko N.

2015-01-01

Ipomoea trifida (H. B. K.) G. Don. is the most likely diploid ancestor of the hexaploid sweet potato, I. batatas (L.) Lam. To assist in analysis of the sweet potato genome, de novo whole-genome sequencing was performed with two lines of I. trifida, namely the selfed line Mx23Hm and the highly heterozygous line 0431-1, using the Illumina HiSeq platform. We classified the sequences thus obtained as either ‘core candidates’ (common to the two lines) or ‘line specific’. The total lengths of the assembled sequences of Mx23Hm (ITR_r1.0) was 513 Mb, while that of 0431-1 (ITRk_r1.0) was 712 Mb. Of the assembled sequences, 240 Mb (Mx23Hm) and 353 Mb (0431-1) were classified into core candidate sequences. A total of 62,407 (62.4 Mb) and 109,449 (87.2 Mb) putative genes were identified, respectively, in the genomes of Mx23Hm and 0431-1, of which 11,823 were derived from core sequences of Mx23Hm, while 28,831 were from the core candidate sequence of 0431-1. There were a total of 1,464,173 single-nucleotide polymorphisms and 16,682 copy number variations (CNVs) in the two assembled genomic sequences (under the condition of log2 ratio of >1 and CNV size >1,000 bases). The results presented here are expected to contribute to the progress of genomic and genetic studies of I. trifida, as well as studies of the sweet potato and the genus Ipomoea in general. PMID:25805887

Transcriptional Innate Immune Response of the Developing Chicken Embryo to Newcastle Disease Virus Infection

PubMed Central

Schilling, Megan A.; Katani, Robab; Memari, Sahar; Cavanaugh, Meredith; Buza, Joram; Radzio-Basu, Jessica; Mpenda, Fulgence N.; Deist, Melissa S.; Lamont, Susan J.; Kapur, Vivek

2018-01-01

Traditional approaches to assess the immune response of chickens to infection are through animal trials, which are expensive, require enhanced biosecurity, compromise welfare, and are frequently influenced by confounding variables. Since the chicken embryo becomes immunocompetent prior to hatch, we here characterized the transcriptional response of selected innate immune genes to Newcastle disease virus (NDV) infection in chicken embryos at days 10, 14, and 18 of embryonic development. The results suggest that the innate immune response 72 h after challenge of 18-day chicken embryo is both consistent and robust. The expression of CCL5, Mx1, and TLR3 in lung tissues of NDV challenged chicken embryos from the outbred Kuroiler and Tanzanian local ecotype lines showed that their expression was several orders of magnitude higher in the Kuroiler than in the local ecotypes. Next, the expression patterns of three additional innate-immunity related genes, IL-8, IRF-1, and STAT1, were examined in the highly congenic Fayoumi (M5.1 and M15.2) and Leghorn (Ghs6 and Ghs13) sublines that differ only at the microchromosome bearing the major histocompatibility locus. The results show that the Ghs13 Leghorn subline had a consistently higher expression of all genes except IL-8 and expression seemed to be subline-dependent rather than breed-dependent, suggesting that the innate immune response of chicken embryos to NDV infection may be genetically controlled by the MHC-locus. Taken together, the results suggest that the chicken embryo may represent a promising model to studying the patterns and sources of variation of the avian innate immune response to infection with NDV and related pathogens. PMID:29535762

Expression of the autoantigen TRIM33/TIF1γ in skin and muscle of patients with dermatomyositis is upregulated, together with markers of cellular stress.

PubMed

Scholtissek, B; Ferring-Schmitt, S; Maier, J; Wenzel, J

2017-08-01

Dermatomyositis (DM) is an autoimmune disorder associated with a dysregulation of immune homeostasis of both the innate and adaptive immune system. Earlier data suggested that these two arms of the immune system interconnect in DM. In the current study, we analysed the association of autoantigen expression [adaptive system components: Mi2, transcriptional intermediary factor (TIF)1γ, small ubiquitin-like modifier 1 activating enzyme subunit (SAE)1, melanoma differentiation-associated protein (MDA)5] with markers of cellular stress (innate system components: MxA, p53) in skin and muscle (immunohistology and gene expression data, respectively). We found that distinctive self-antigens of DM were elevated in both skin and muscle tissue. In particular, TIF1γ expression was seen in autoimmune diseases including DM, but not in other inflammatory skin disorders. This upregulation was closely associated with p53 expression and type I interferon-regulated inflammation, suggesting that upregulation of autoantigens in the skin and muscle of patients with DM might be driven by cellular stress. Better understanding of these mechanisms could pave the way for new therapeutic concepts focusing on stress reduction. © 2017 British Association of Dermatologists.

Porcine Mx1 Protein Inhibits Classical Swine Fever Virus Replication by Targeting Nonstructural Protein NS5B.

PubMed

Zhou, Jing; Chen, Jing; Zhang, Xiao-Min; Gao, Zhi-Can; Liu, Chun-Chun; Zhang, Yun-Na; Hou, Jin-Xiu; Li, Zhao-Yao; Kan, Lin; Li, Wen-Liang; Zhou, Bin

2018-04-01

Mx proteins are interferon (IFN)-induced GTPases that have broad antiviral activity against a wide range of RNA and DNA viruses; they belong to the dynamin superfamily of large GTPases. In this study, we confirmed the anti-classical swine fever virus (CSFV) activity of porcine Mx1 in vitro and showed that porcine Mx2 (poMx2), human MxA (huMxA), and mouse Mx1 (mmMx1) also have anti-CSFV activity in vitro Small interfering RNA (siRNA) experiments revealed that depletion of endogenous poMx1 or poMx2 enhanced CSFV replication, suggesting that porcine Mx proteins are responsible for the antiviral activity of interferon alpha (IFN-α) against CSFV infection. Confocal microscopy, immunoprecipitation, glutathione S -transferase (GST) pulldown, and bimolecular fluorescence complementation (BiFC) demonstrated that poMx1 associated with NS5B, the RNA-dependent RNA polymerase (RdRp) of CSFV. We used mutations in the poMx1 protein to elucidate the mechanism of their anti-CSFV activity and found that mutants that disrupted the association with NS5B lost all anti-CSV activity. Moreover, an RdRp activity assay further revealed that poMx1 undermined the RdRp activities of NS5B. Together, these results indicate that porcine Mx proteins exert their antiviral activity against CSFV by interacting with NS5B. IMPORTANCE Our previous studies have shown that porcine Mx1 (poMx1) inhibits classical swine fever virus (CSFV) replication in vitro and in vivo , but the molecular mechanism of action remains largely unknown. In this study, we dissect the molecular mechanism of porcine Mx1 and Mx2 against CSFV in vitro Our results show that poMx1 associates with NS5B, the RNA-dependent RNA polymerase of CSFV, resulting in the reduction of CSFV replication. Moreover, the mutants of poMx1 further elucidate the mechanism of their anti-CSFV activities. Copyright © 2018 American Society for Microbiology.

Thymic stromal lymphopoietin is up-regulated in the skin of patients with systemic sclerosis and induces profibrotic genes and intracellular signaling that overlap with those induced by interleukin-13 and transforming growth factor β.

PubMed

Christmann, Romy B; Mathes, Allison; Affandi, Alsya J; Padilla, Cristina; Nazari, Banafsheh; Bujor, Andreea M; Stifano, Giuseppina; Lafyatis, Robert

2013-05-01

To explore the expression of thymic stromal lymphopoietin (TSLP) in patients with diffuse cutaneous systemic sclerosis (dcSSc) and compare its effects in vivo and in vitro with those of interleukin-13 (IL-13) and transforming growth factor β (TGFβ). Skin biopsy specimens from patients with dcSSc (n = 14) and healthy controls (n = 13) were analyzed by immunohistochemistry and immunofluorescence for TSLP, TSLP receptor, CD4, CD8, CD31, and CD163 markers. Wild-type, IL-4Rα1-, and TSLP-deficient mice were treated with TGFβ, IL-13, poly(I-C), or TSLP by osmotic pump. Human fibroblasts and peripheral blood mononuclear cells (PBMCs) were stimulated with TGFβ, IL-13, poly(I-C), or TSLP. Microarray analysis and quantitative polymerase chain reaction were performed to determine gene expression, and protein levels of phospho-Smad2 and macrophage marker CD163 were tested. TSLP was highly expressed in the skin of dcSSc patients, more strongly in perivascular areas and in immune cells, and was produced mainly by CD163+ cells. The skin of TSLP-treated mice showed up-regulated clusters of gene expression that overlapped strongly with those in IL-13- and TGFβ-treated mice. TSLP up-regulated specific genes, including CXCL9, proteasome, and interferon (IFN)-regulated genes. TSLP treatment in IL-4Rα1-deficient mice promoted similar cutaneous inflammation as in wild-type mice, though TSLP-induced arginase 1, CCL2, and matrix metalloproteinase 12 messenger RNA levels were blocked. In PBMCs, TSLP up-regulated tumor necrosis factor α, Mx-1, IFNγ, CXCL9, and mannose receptor 1 gene expression. TSLP-deficient mice treated with TGFβ showed less fibrosis and blocked expression of plasminogen activator inhibitor 1 and osteopontin 1. Poly(I-C)-treated mice showed high levels of cutaneous TSLP. TSLP is highly expressed in the skin of dcSSc patients and interacts in a complex manner with 2 other profibrotic cytokines, TGFβ and IL-13, strongly suggesting that it might promote SSc fibrosis directly or indirectly by synergistically stimulating profibrotic genes, or production of these cytokines. Copyright © 2013 by the American College of Rheumatology.

A two force-constant model for complexes B⋯M-X (B is a Lewis base and MX is any diatomic molecule): Intermolecular stretching force constants from centrifugal distortion constants D(J) or Δ(J).

PubMed

Bittner, Dror M; Walker, Nicholas R; Legon, Anthony C

2016-02-21

A two force-constant model is proposed for complexes of the type B⋯MX, in which B is a simple Lewis base of at least C2v symmetry and MX is any diatomic molecule lying along a Cn axis (n ≥ 2) of B. The model assumes a rigid subunit B and that force constants beyond quadratic are negligible. It leads to expressions that allow, in principle, the determination of three quadratic force constants F11, F12, and F22 associated with the r(B⋯M) = r2 and r(M-X) = r1 internal coordinates from the equilibrium centrifugal distortion constants DJ (e) or ΔJ (e), the equilibrium principal axis coordinates a1 and a2, and equilibrium principal moments of inertia. The model can be applied generally to complexes containing different types of intermolecular bond. For example, the intermolecular bond of B⋯MX can be a hydrogen bond if MX is a hydrogen halide, a halogen-bond if MX is a dihalogen molecule, or a stronger, coinage-metal bond if MX is a coinage metal halide. The equations were tested for BrCN, for which accurate equilibrium spectroscopic constants and a complete force field are available. In practice, equilibrium values of DJ (e) or ΔJ (e) for B⋯MX are not available and zero-point quantities must be used instead. The effect of doing so has been tested for BrCN. The zero-point centrifugal distortion constants DJ (0) or ΔJ (0) for all B⋯MX investigated so far are of insufficient accuracy to allow F11 and F22 to be determined simultaneously, even under the assumption F12 = 0 which is shown to be reasonable for BrCN. The calculation of F22 at a series of fixed values of F11 reveals, however, that in cases for which F11 is sufficiently larger than F22, a good approximation to F22 is obtained. Plots of F22 versus F11 have been provided for Kr⋯CuCl, Xe⋯CuCl, OC⋯CuCl, and C2H2⋯AgCl as examples. Even in cases where F22 ∼ F11 (e.g., OC⋯CuCl), such plots will yield either F22 or F11 if the other becomes available.

A two force-constant model for complexes B⋯M-X (B is a Lewis base and MX is any diatomic molecule): Intermolecular stretching force constants from centrifugal distortion constants DJ or ΔJ

NASA Astrophysics Data System (ADS)

Bittner, Dror M.; Walker, Nicholas R.; Legon, Anthony C.

2016-02-01

A two force-constant model is proposed for complexes of the type B⋯MX, in which B is a simple Lewis base of at least C2v symmetry and MX is any diatomic molecule lying along a Cn axis (n ≥ 2) of B. The model assumes a rigid subunit B and that force constants beyond quadratic are negligible. It leads to expressions that allow, in principle, the determination of three quadratic force constants F11, F12, and F22 associated with the r(B⋯M) = r2 and r(M-X) = r1 internal coordinates from the equilibrium centrifugal distortion constants DJ e or ΔJ e , the equilibrium principal axis coordinates a1 and a2, and equilibrium principal moments of inertia. The model can be applied generally to complexes containing different types of intermolecular bond. For example, the intermolecular bond of B⋯MX can be a hydrogen bond if MX is a hydrogen halide, a halogen-bond if MX is a dihalogen molecule, or a stronger, coinage-metal bond if MX is a coinage metal halide. The equations were tested for BrCN, for which accurate equilibrium spectroscopic constants and a complete force field are available. In practice, equilibrium values of DJ e or ΔJ e for B⋯MX are not available and zero-point quantities must be used instead. The effect of doing so has been tested for BrCN. The zero-point centrifugal distortion constants DJ 0 or ΔJ 0 for all B⋯MX investigated so far are of insufficient accuracy to allow F11 and F22 to be determined simultaneously, even under the assumption F12 = 0 which is shown to be reasonable for BrCN. The calculation of F22 at a series of fixed values of F11 reveals, however, that in cases for which F11 is sufficiently larger than F22, a good approximation to F22 is obtained. Plots of F22 versus F11 have been provided for Kr⋯CuCl, Xe⋯CuCl, OC⋯CuCl, and C2H2⋯AgCl as examples. Even in cases where F22 ˜ F11 (e.g., OC⋯CuCl), such plots will yield either F22 or F11 if the other becomes available.

Protective immunity induced by an intranasal multivalent vaccine comprising 10 Lactococcus lactis strains expressing highly prevalent M-protein antigens derived from Group A Streptococcus.

PubMed

Wozniak, Aniela; Scioscia, Natalia; García, Patricia C; Dale, James B; Paillavil, Braulio A; Legarraga, Paulette; Salazar-Echegarai, Francisco J; Bueno, Susan M; Kalergis, Alexis M

2018-04-28

Streptococcus pyogenes (group A Streptococcus) causes diseases ranging from mild pharyngitis to severe invasive infections. The N-terminal fragment of Streptococcal M protein elicits protective antibodies and is an attractive vaccine target. However, this N- terminal fragment is hypervariable and there are more than 200 different M types. We are developing an intranasal live bacterial vaccine comprised of 10 strains of Lactococcus lactis, each expressing one N-terminal fagment of M protein. Live bacterial-vectored vaccines have lower associated costs because of its less complex manufacturing processes compared to protein subunit vaccines. Moreover, intranasal administration does not require syringe or specilized personnel. The evaluation of individual vaccine types (M1, M2, M3, M4, M6, M9, M12, M22, M28 and M77) showed that most of them protected mice against challenge with virulent S. pyogenes. All of the 10 strains combined in a 10-valent vaccine (Mx10) induced serum and bronchoalveolar lavages IgG titers that ranged from 3 to 10-fold those of unimmunized mice. Survival of Mx10-immunized mice after intranasal challenge with M28 streptococci is significantly higher than unimmunized mice. In contrast, when mice were challenged with M75 streptococci, survival of Mx10-immunized mice was not significantly different from unimmunized mice. Mx-10 immunized mice were significantly less colonized with S. pyogenes in oropharyngeal washes and developed less severe disease symptoms after challenge compared to unimmunized mice. Our L. lactis-based vaccine may provide an alternative solution to the development of broadly protective group A streptococcal vaccines. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

Hepatitis C virus (HCV) induces formation of stress granules whose proteins regulate HCV RNA replication and virus assembly and egress.

PubMed

Garaigorta, Urtzi; Heim, Markus H; Boyd, Bryan; Wieland, Stefan; Chisari, Francis V

2012-10-01

Stress granules (SGs) are cytoplasmic structures that are induced in response to environmental stress, including viral infections. Here we report that hepatitis C virus (HCV) triggers the appearance of SGs in a PKR- and interferon (IFN)-dependent manner. Moreover, we show an inverse correlation between the presence of stress granules and the induction of IFN-stimulated proteins, i.e., MxA and USP18, in HCV-infected cells despite high-level expression of the corresponding MxA and USP18 mRNAs, suggesting that interferon-stimulated gene translation is inhibited in stress granule-containing HCV-infected cells. Finally, in short hairpin RNA (shRNA) knockdown experiments, we found that the stress granule proteins T-cell-restricted intracellular antigen 1 (TIA-1), TIA1-related protein (TIAR), and RasGAP-SH3 domain binding protein 1 (G3BP1) are required for efficient HCV RNA and protein accumulation at early time points in the infection and that G3BP1 and TIA-1 are required for intracellular and extracellular infectious virus production late in the infection, suggesting that they are required for virus assembly. In contrast, TIAR downregulation decreases extracellular infectious virus titers with little effect on intracellular RNA content or infectivity late in the infection, suggesting that it is required for infectious particle release. Collectively, these results illustrate that HCV exploits the stress granule machinery at least two ways: by inducing the formation of SGs by triggering PKR phosphorylation, thereby downregulating the translation of antiviral interferon-stimulated genes, and by co-opting SG proteins for its replication, assembly, and egress.

Atlantic salmon endothelial cells from the heart were more susceptible than fibroblasts from the bulbus arteriosus to four RNA viruses but protected from two viruses by dsRNA pretreatment.

PubMed

Pham, Phuc H; Tong, Winnie W L; Misk, Ehab; Jones, Ginny; Lumsden, John S; Bols, Niels C

2017-11-01

Heart diseases caused by viruses are major causes of Atlantic salmon aquaculture loss. Two Atlantic salmon cardiovascular cell lines, an endothelial cell line (ASHe) from the heart and a fibroblast cell line (BAASf) from the bulbus arteriosus, were evaluated for their response to four fish viruses, CSV, IPNV, VHSV IVa and VHSV IVb, and the innate immune agonist, double-stranded RNA mimic poly IC. All four viruses caused cytopathic effects in ASHe and BAASf. However, ASHe was more susceptible to all four viruses than BAASf. When comparing between the viruses, ASHe cells were found to be moderately susceptible to CSV and VHSV IVb, but highly susceptible to IPNV and VHSV IVa induced cell death. All four viruses were capable of propagating in the ASHe cell line, leading to increases in virus titre over time. In BAASf, CSV and IPNV produced more than one log increase in titre from initial infection, but VHSV IVb and IVa did not. When looking at the antiviral response of both cell lines, Mx proteins were induced in ASHe and BAASf by poly IC. All four viruses induced Mx proteins in BAASf, while only CSV and VHSV IVb induced Mx proteins in ASHe. IPNV and VHSV IVa suppressed Mx proteins expression in ASHe. Pretreatment of ASHe with poly IC to allow for Mx proteins accumulation protected the culture from subsequent infections with IPNV and VHSV IVa, resulting in delayed cell death, reduced virus titres and reduced viral proteins expression. These data suggest that endothelial cells potentially can serve as points of infections for viruses in the heart and that two of the four viruses, IPNV and VHSV IVa, have mechanisms to avoid or downregulate antiviral responses in ASHe cells. Furthermore, the high susceptibility of the ASHe cell line to IPNV and VHSV IVa can make it a useful tool for studying antiviral compounds against these viruses and for general detection of fish viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effectiveness of a Layer-by-Layer Microbubbles-Based Delivery System for Applying Minoxidil to Enhance Hair Growth.

PubMed

Liao, Ai-Ho; Lu, Ying-Jui; Lin, Yi-Chun; Chen, Hang-Kang; Sytwu, Huey-Kang; Wang, Chih-Hung

2016-01-01

Minoxidil (Mx) is a conventional drug for treating androgenetic alopecia, preventing hair loss, and promoting hair growth. The solubility of Mx has been improved using chemical enhancement methods to increase its skin permeability over the long term. This study created a new ultrasound (US) contrast agent-albumin-shelled microbubbles (MBs) that absorb chitosan oligosaccharide lactate (COL) and Mx-and combined it with sonication by US energy in the water phase to enhance hair growth while shortening the treatment period. COL and Mx grafted with MBs (mean diameter of 1480 nm) were synthesized into self-assembled complexes of COL-MBs and Mx-COL-MBs that had mean diameters of 4150 and 4500 nm, respectively. The US was applied at 3 W/cm(2) for 1 min, and combined with Mx-COL-MBs containing 0.3% Mx. The diffusion of Mx through the dialysis membrane from Mx-COL-MB during US (US+Mx-COL-MB) was more rapid at pH 4 than at pH 7.4, which is favorable given that the environment of the scalp is mildly acidic (pH=4.5-5.5). In Franz diffusion experiments performed in vitro, the release rates at 18 hours in the US+Mx-COL-MBs and US+MBs+Mx groups resulted in 2.3 and 1.7 times the penetration and deposition, respectively, of Mx relative to the group with Mx alone. During 21 days treatment in animal experiments, the growth rates at days 10 and 14 in the US+Mx-COL-MBs group increased by 22.6% and 64.7%, respectively, and there were clear significant differences (p<0.05) between the US+Mx-COL-MBs group and the other four groups. The use of US+Mx-COL-MB in the water phase can increased the effects of Mx so as to shorten the telogen phase, and also increase both the diameter of keratinized hair shafts and the size of hair follicles without causing skin damage.

Accumulation of MxB/Mx2-resistant HIV-1 Capsid Variants During Expansion of the HIV-1 Epidemic in Human Populations.

PubMed

Wei, Wei; Guo, Haoran; Ma, Min; Markham, Richard; Yu, Xiao-Fang

2016-06-01

Recent studies have identified human myxovirus resistance protein 2 (MxB or Mx2) as an interferon induced inhibitor of HIV-1 replication. However, whether HIV-1 can overcome MxB restriction without compromise of viral fitness has been undefined. Here, we have discovered that naturally occurring capsid (CA) variants can render HIV-1 resistant to the activity of MxB without losing viral infectivity or the ability to escape from interferon induction. Moreover, these MxB resistant HIV-1 variants do not lose MxB recognition. Surprisingly, MxB resistant CA variants are most commonly found in the Clade C HIV-1 that is the most rapidly expanding Clade throughout the world. Accumulation of MxB resistant mutations is also observed during HIV-1 spreading in human populations. These findings support a potential role for MxB as a selective force during HIV-1 transmission and evolution. Copyright © 2016. Published by Elsevier B.V.

Galactoglucomannans increase cell population density and alter the protoxylem/metaxylem tracheary element ratio in xylogenic cultures of Zinnia.

PubMed

Benová-Kákosová, Anna; Digonnet, Catherine; Goubet, Florence; Ranocha, Philippe; Jauneau, Alain; Pesquet, Edouard; Barbier, Odile; Zhang, Zhinong; Capek, Peter; Dupree, Paul; Lisková, Desana; Goffner, Deborah

2006-10-01

Xylogenic cultures of zinnia (Zinnia elegans) provide a unique opportunity to study signaling pathways of tracheary element (TE) differentiation. In vitro TEs differentiate into either protoxylem (PX)-like TEs characterized by annular/helical secondary wall thickening or metaxylem (MX)-like TEs with reticulate/scalariform/pitted thickening. The factors that determine these different cell fates are largely unknown. We show here that supplementing zinnia cultures with exogenous galactoglucomannan oligosaccharides (GGMOs) derived from spruce (Picea abies) xylem had two major effects: an increase in cell population density and a decrease in the ratio of PX to MX TEs. In an attempt to link these two effects, the consequence of the plane of cell division on PX-MX differentiation was assessed. Although GGMOs did not affect the plane of cell division per se, they significantly increased the proportion of longitudinally divided cells differentiating into MX. To test the biological significance of these findings, we have determined the presence of mannan-containing oligosaccharides in zinnia cultures in vitro. Immunoblot assays indicated that beta-1,4-mannosyl epitopes accumulate specifically in TE-inductive media. These epitopes were homogeneously distributed within the thickened secondary walls of TEs when the primary cell wall was weakly labeled. Using polysaccharide analysis carbohydrate gel electrophoresis, glucomannans were specifically detected in cell walls of differentiating zinnia cultures. Finally, zinnia macroarrays probed with cDNAs from cells cultured in the presence or absence of GGMOs indicated that significantly more genes were down-regulated rather than up-regulated by GGMOs. This study constitutes a major step in the elucidation of signaling mechanisms of PX- and MX-specific genetic programs in zinnia.

Association of N-acetyltransferase-2 polymorphism with an increased risk of coronary heart disease in a Chinese population.

PubMed

Sun, J D; Yuan, H; Hu, H Q; Yu, H M

2016-03-04

We investigated the possible correlations between N-acetyltransferase-2 (NAT2) gene polymorphisms and the risk of coronary heart disease (CHD). CHD patients (113) and healthy controls (118) were enrolled from the First People's Hospital of Yuhang between January 2013 and June 2014. The patients were divided into mild CHD (N = 72) and severe CHD (N = 41) subgroups. DNA samples were extracted and the distributions of NAT2 polymorphisms were examined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Clinical characteristic indexes of severe CHD patients were also examined for relevant statistical analysis. WT, M1, M2, and M3 alleles were observed in both case and control groups. PCR-RFLP identified a wild-type homozygote, WT/WT; a mutant heterozygote, WT/Mx; and a mutant homozygote, Mx/Mx (x = 1, 2, and 3) variant of the NAT2 genotype. Mx/Mx differed significantly between case and control groups (P < 0.05); the frequencies of all four alleles did not differ significantly between case and control groups (P > 0.05). Slow acetylator genotype frequencies were notably higher in the case group than in the control group (P < 0.05). Individuals with the slow acetylator genotype were at 1.97-times higher risk of CHD and also displayed higher triglyceride and lower high-density lipoprotein cholesterol levels than those with the rapid acetylator genotype (P < 0.05). Therefore, the NAT2 polymorphism was believed to be associated with increased risk of CHD, with the NAT2 slow acetylator genotype serving as a risk factor for severe CHD in a Chinese population.

Fingolimod induces neuroprotective factors in human astrocytes.

PubMed

Hoffmann, Franziska S; Hofereiter, Johann; Rübsamen, Heike; Melms, Johannes; Schwarz, Sigrid; Faber, Hans; Weber, Peter; Pütz, Benno; Loleit, Verena; Weber, Frank; Hohlfeld, Reinhard; Meinl, Edgar; Krumbholz, Markus

2015-09-30

Fingolimod (FTY720) is the first sphingosine-1-phosphate (S1P) receptor modulator approved for the treatment of multiple sclerosis. The phosphorylated active metabolite FTY720-phosphate (FTY-P) interferes with lymphocyte trafficking. In addition, it accumulates in the CNS and reduces brain atrophy in multiple sclerosis (MS), and neuroprotective effects are hypothesized. Human primary astrocytes as well as human astrocytoma cells were stimulated with FTY-P or S1P. We analyzed gene expression by a genome-wide microarray and validated induced candidate genes by quantitative PCR (qPCR) and ELISA. To identify the S1P-receptor subtypes involved, we applied a membrane-impermeable S1P analog (dihydro-S1P), receptor subtype specific agonists and antagonists, as well as RNAi silencing. FTY-P induced leukemia inhibitory factor (LIF), interleukin 11 (IL11), and heparin-binding EGF-like growth factor (HBEGF) mRNA, as well as secretion of LIF and IL11 protein. In order to mimic an inflammatory milieu as observed in active MS lesions, we combined FTY-P application with tumor necrosis factor (TNF). In the presence of this key inflammatory cytokine, FTY-P synergistically induced LIF, HBEGF, and IL11 mRNA, as well as secretion of LIF and IL11 protein. TNF itself induced inflammatory, B-cell promoting, and antiviral factors (CXCL10, BAFF, MX1, and OAS2). Their induction was blocked by FTY-P. After continuous exposure of cells to FTY-P or S1P for up to 7 days, the extent of induction of neurotrophic factors and the suppression of TNF-induced inflammatory genes declined but was still detectable. The induction of neurotrophic factors was mediated via surface S1P receptors 1 (S1PR1) and 3 (S1PR3). We identified effects of FTY-P on astrocytes, namely induction of neurotrophic mediators (LIF, HBEGF, and IL11) and inhibition of TNF-induced inflammatory genes (CXCL10, BAFF, MX1, and OAS2). This supports the view that a part of the effects of fingolimod may be mediated via astrocytes.

Transcriptome analysis of olive flounder (Paralichthys olivaceus) head kidney infected with moderate and high virulent strains of infectious viral hemorrhagic septicaemia virus (VHSV).

PubMed

Hwang, Jee Youn; Markkandan, Kesavan; Kwon, Mun Gyeong; Seo, Jung Soo; Yoo, Seung-Il; Hwang, Seong Don; Son, Maeng-Hyun; Park, Junhyung

2018-05-01

Olive flounder (Paralichthys olivaceus) is one of the most valuable marine aquatic species in South Korea and faces tremendous exposure to the viral hemorrhagic septicemia virus (VHSV). Given the growing importance of flounder, it is therefore essential to understand the host defense of P. olivaceus against VHSV infection, but studies on its immune mechanism are hindered by the lack of genomic resources. In this study, the P. olivaceus was infected with disease-causing VHSV isolates, ADC-VHS2012-11 and ADC-VHS2014-5 which showed moderate virulent (20% mortality) and high virulent (65% mortality), in order to investigate the effect of difference in pathogenicity in head kidney during 1, 3, 7 days of post-infection using Illumina sequencing. After removing low-quality sequences, we obtained 144,933,160 high quality reads from thirty-six libraries which were further assembled into 53,384 unigenes with an average length of 563 bp with a range of 200 to 9605 bp. Transcriptome annotation revealed that 30,475 unigenes with a cut-off e-value of 10 -5 were functionally annotated. In total, 10,046 unigenes were clustered into 26 functional categories by searching against the eggNOG database, and 22,233 unigenes to 52 GO terms. In addition, 12,985 unigenes were grouped into 387 KEGG pathways. Among the 13,270 differently expressed genes, 6578 and 6692 were differentially expressed only in moderate and high virulent, respectively. Based on our sequence analysis, many candidate genes with fundamental roles in innate immune system including, pattern recognition receptors (TLRs & RLRs), Mx, complement proteins, lectins, and cytokines (chemokines, IFN, IRF, IL, TRF) were differentially expressed. Furthermore, GO enrichment analysis for these genes revealed gene response to defense response to virus, apoptotic process and transcription factor activity. In summary, this study identifies several putative immune pathways and candidate genes deserving further investigation in the context of novel gene discovery, gene expression and regulation studies and lays the foundation for fish immunology especially in P. olivaceus against VHSV. Copyright © 2018. Published by Elsevier Ltd.

Functional Roles of Pattern Recognition Receptors That Recognize Virus Nucleic Acids in Human Adipose-Derived Mesenchymal Stem Cells

PubMed Central

Wang, Fangchao; Yang, Can; Liu, Guoyan; Song, Xiangfeng

2016-01-01

Human adipose-derived mesenchymal stem cells (hAD-MSCs) are mesenchymal stem cells with the capability to modulate immune responses. Evidence showing that hAD-MSCs could mediate innate immune responses through pattern recognition receptors (PRRs) is increasing. However, the roles of PRRs in regulating the innate sensing of virus nucleic acids (RNA and DNA) in hAD-MSCs have not yet been investigated. This study focused on the abundant expression of PRRs, including Toll-like receptor 3 (TLR3) and retinoic acid-inducible gene I (RIG-I), which recognize viral RNA, and gamma-interferon inducible protein 16 (IFI16), which recognizes viral DNA in hAD-MSCs. Poly(I:C), a synthetic dsRNA analogy, activated TLR3 and RIG-I and induced the expression of type I interferons (IFN-α/β) and antivirus proteins, including IFN-stimulating gene 15, 2′5′-oligoadenylate synthetase, and Mx GTPase 1 in hAD-MSCs, which were attenuated by the knockdown of each TLR3 or RIG-I. Synthetic herpes simplex viral DNA (HSV60) activated IFI16 and induced the expression of IFN-α/β and antivirus proteins in hAD-MSCs, which were inhibited by the knockdown of IFI16. Both poly(I:C) and HSV60 induced the expression of IFN-α/β through the phosphorylation of IFN-regulatory factor 3. All these results indicated that PRRs recognizing virus nucleic acids were expressed and can mediate antivirus responses in hAD-MSCs. PMID:28105439

Effectiveness of a Layer-by-Layer Microbubbles-Based Delivery System for Applying Minoxidil to Enhance Hair Growth

PubMed Central

Liao, Ai-Ho; Lu, Ying-Jui; Lin, Yi-Chun; Chen, Hang-Kang; Sytwu, Huey-Kang; Wang, Chih-Hung

2016-01-01

Minoxidil (Mx) is a conventional drug for treating androgenetic alopecia, preventing hair loss, and promoting hair growth. The solubility of Mx has been improved using chemical enhancement methods to increase its skin permeability over the long term. This study created a new ultrasound (US) contrast agent—albumin-shelled microbubbles (MBs) that absorb chitosan oligosaccharide lactate (COL) and Mx—and combined it with sonication by US energy in the water phase to enhance hair growth while shortening the treatment period. COL and Mx grafted with MBs (mean diameter of 1480 nm) were synthesized into self-assembled complexes of COL-MBs and Mx-COL-MBs that had mean diameters of 4150 and 4500 nm, respectively. The US was applied at 3 W/cm2 for 1 min, and combined with Mx-COL-MBs containing 0.3% Mx. The diffusion of Mx through the dialysis membrane from Mx-COL-MB during US (US+Mx-COL-MB) was more rapid at pH 4 than at pH 7.4, which is favorable given that the environment of the scalp is mildly acidic (pH=4.5-5.5). In Franz diffusion experiments performed in vitro, the release rates at 18 hours in the US+Mx-COL-MBs and US+MBs+Mx groups resulted in 2.3 and 1.7 times the penetration and deposition, respectively, of Mx relative to the group with Mx alone. During 21 days treatment in animal experiments, the growth rates at days 10 and 14 in the US+Mx-COL-MBs group increased by 22.6% and 64.7%, respectively, and there were clear significant differences (p<0.05) between the US+Mx-COL-MBs group and the other four groups. The use of US+Mx-COL-MB in the water phase can increased the effects of Mx so as to shorten the telogen phase, and also increase both the diameter of keratinized hair shafts and the size of hair follicles without causing skin damage. PMID:27162552

Human endogenous retrovirus expression is inversely related with the up-regulation of interferon-inducible genes in the skin of patients with lichen planus.

PubMed

Nogueira, Marcelle Almeida de Sousa; Gavioli, Camila Fátima Biancardi; Pereira, Nátalli Zanete; de Carvalho, Gabriel Costa; Domingues, Rosana; Aoki, Valéria; Sato, Maria Notomi

2015-04-01

Lichen planus (LP) is a common inflammatory skin disease of unknown etiology. Reports of a common transactivation of quiescent human endogenous retroviruses (HERVs) support the connection of viruses to the disease. HERVs are ancient retroviral sequences in the human genome and their transcription is often deregulated in cancer and autoimmune diseases. We explored the transcriptional activity of HERV sequences as well as the antiviral restriction factor and interferon-inducible genes in the skin from LP patients and healthy control (HC) donors. The study included 13 skin biopsies from patients with LP and 12 controls. Real-time PCR assay identified significant decrease in the HERV-K gag and env mRNA expression levels in LP subjects, when compared to control group. The expressions of HERV-K18 and HERV-W env were also inhibited in the skin of LP patients. We observed a strong correlation between HERV-K gag with other HERV sequences, regardless the down-modulation of transcripts levels in LP group. In contrast, a significant up-regulation of the cytidine deaminase APOBEC 3G (apolipoprotein B mRNA-editing), and the GTPase MxA (Myxovirus resistance A) mRNA expression level was identified in the LP skin specimens. Other transcript expressions, such as the master regulator of type I interferon-dependent immune responses, STING (stimulator of interferon genes) and IRF-7 (interferon regulatory factor 7), IFN-β and the inflammassome NALP3, had increased levels in LP, when compared to HC group. Our study suggests that interferon-inducible factors, in addition to their role in innate immunity against exogenous pathogens, contribute to the immune control of HERVs. Evaluation of the balance between HERV and interferon-inducible factor expression could possibly contribute to surveillance of inflammatory/malignant status of skin diseases.

Endothelial Cell Proteomic Response to Rickettsia conorii Infection Reveals Activation of the Janus Kinase (JAK)-Signal Transducer and Activator of Transcription (STAT)-Inferferon Stimulated Gene (ISG)15 Pathway and Reprogramming Plasma Membrane Integrin/Cadherin Signaling.

PubMed

Zhao, Yingxin; Valbuena, Gustavo; Walker, David H; Gazi, Michal; Hidalgo, Marylin; DeSousa, Rita; Oteo, Jose Antonio; Goez, Yenny; Brasier, Allan R

2016-01-01

Rickettsia conorii is the etiologic agent of Mediterranean spotted fever, a re-emerging infectious disease with significant mortality. This Gram-negative, obligately intracellular pathogen is transmitted via tick bites, resulting in disseminated vascular endothelial cell infection with vascular leakage. In the infected human, Rickettsia conorii infects endothelial cells, stimulating expression of cytokines and pro-coagulant factors. However, the integrated proteomic response of human endothelial cells to R. conorii infection is not known. In this study, we performed quantitative proteomic profiling of primary human umbilical vein endothelial cells (HUVECs) with established R conorii infection versus those stimulated with endotoxin (LPS) alone. We observed differential expression of 55 proteins in HUVEC whole cell lysates. Of these, we observed induction of signal transducer and activator of transcription (STAT)1, MX dynamin-like GTPase (MX1), and ISG15 ubiquitin-like modifier, indicating activation of the JAK-STAT signaling pathway occurs in R. conorii-infected HUVECs. The down-regulated proteins included those involved in the pyrimidine and arginine biosynthetic pathways. A highly specific biotinylated cross-linking enrichment protocol was performed to identify dysregulation of 11 integral plasma membrane proteins that included up-regulated expression of a sodium/potassium transporter and down-regulation of α-actin 1. Analysis of Golgi and soluble Golgi fractions identified up-regulated proteins involved in platelet-endothelial adhesion, phospholipase activity, and IFN activity. Thirty four rickettsial proteins were identified with high confidence in the Golgi, plasma membrane, or secreted protein fractions. The host proteins associated with rickettsial infections indicate activation of interferon-STAT signaling pathways; the disruption of cellular adhesion and alteration of antigen presentation pathways in response to rickettsial infections are distinct from those produced by nonspecific LPS stimulation. These patterns of differentially expressed proteins suggest mechanisms of pathogenesis as well as methods for diagnosis and monitoring Rickettsia infections. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Dual-energy contrast-enhanced digital mammography: initial clinical results of a multireader, multicase study

PubMed Central

2012-01-01

Introduction The purpose of this study was to compare the diagnostic accuracy of dual-energy contrast-enhanced digital mammography (CEDM) as an adjunct to mammography (MX) ± ultrasonography (US) with the diagnostic accuracy of MX ± US alone. Methods One hundred ten consenting women with 148 breast lesions (84 malignant, 64 benign) underwent two-view dual-energy CEDM in addition to MX and US using a specially modified digital mammography system (Senographe DS, GE Healthcare). Reference standard was histology for 138 lesions and follow-up for 12 lesions. Six radiologists from 4 institutions interpreted the images using high-resolution softcopy workstations. Confidence of presence (5-point scale), probability of cancer (7-point scale), and BI-RADS scores were evaluated for each finding. Sensitivity, specificity and ROC curve areas were estimated for each reader and overall. Visibility of findings on MX ± CEDM and MX ± US was evaluated with a Likert scale. Results The average per-lesion sensitivity across all readers was significantly higher for MX ± US ± CEDM than for MX ± US (0.78 vs. 0.71 using BIRADS, p = 0.006). All readers improved their clinical performance and the average area under the ROC curve was significantly superior for MX ± US ± CEDM than for MX ± US ((0.87 vs 0.83, p = 0.045). Finding visibility was similar or better on MX ± CEDM than MX ± US in 80% of cases. Conclusions Dual-energy contrast-enhanced digital mammography as an adjunct to MX ± US improves diagnostic accuracy compared to MX ± US alone. Addition of iodinated contrast agent to MX facilitates the visualization of breast lesions. PMID:22697607

Adenosine receptor distribution in Rhesus monkey ocular tissue.

PubMed

Beach, Krista M; Hung, Li-Fang; Arumugam, Baskar; Smith, Earl L; Ostrin, Lisa A

2018-05-21

Adenosine receptor (ADOR) antagonists, such as 7-methylxanthine (7-MX), have been shown to slow myopia progression in humans and animal models. Adenosine receptors are found throughout the body, and regulate the release of neurotransmitters such as dopamine and glutamate. However, the role of adenosine in eye growth is unclear. Evidence suggests that 7-MX increases scleral collagen fibril diameter, hence preventing axial elongation. This study used immunohistochemistry (IHC) and reverse-transcription quantitative polymerase chain reaction (RT-qPCR) to examine the distribution of the four ADORs in the normal monkey eye to help elucidate potential mechanisms of action. Eyes were enucleated from six Rhesus monkeys. Anterior segments and eyecups were separated into components and flash-frozen for RNA extraction or fixed in 4% paraformaldehyde and processed for immunohistochemistry against ADORA1, ADORA2a, ADORA2b, and ADORA3. RNA was reverse-transcribed, and qPCR was performed using custom primers. Relative gene expression was calculated using the ΔΔCt method normalizing to liver expression, and statistical analysis was performed using Relative Expression Software Tool. ADORA1 immunostaining was highest in the iris sphincter muscle, trabecular meshwork, ciliary epithelium, and retinal nerve fiber layer. ADORA2a immunostaining was highest in the corneal epithelium, trabecular meshwork, ciliary epithelium, retinal nerve fiber layer, and scleral fibroblasts. ADORA2b immunostaining was highest in corneal basal epithelium, limbal stem cells, iris sphincter, ciliary muscle, ciliary epithelium, choroid, isolated retinal ganglion cells and scattered scleral fibroblasts. ADORA3 immunostaining was highest in the iris sphincter, ciliary muscle, ciliary epithelium, choroid, isolated retinal ganglion cells, and scleral fibroblasts. Compared to liver mRNA, ADORA1 mRNA was significantly higher in the brain, retina and choroid, and significantly lower in the iris/ciliary body. ADORA2a expression was higher in brain and retina, ADORA2b expression was higher in retina, and ADORA3 was higher in the choroid. In conclusion, immunohistochemistry and RT-qPCR indicated differential patterns of expression of the four adenosine receptors in the ocular tissues of the normal non-human primate. The presence of ADORs in scleral fibroblasts and the choroid may support mechanisms by which ADOR antagonists prevent myopia. The potential effects of ADOR inhibition on both anterior and posterior ocular structures warrant investigation. Copyright © 2018 Elsevier Ltd. All rights reserved.

OpenMx: An Open Source Extended Structural Equation Modeling Framework

ERIC Educational Resources Information Center

Boker, Steven; Neale, Michael; Maes, Hermine; Wilde, Michael; Spiegel, Michael; Brick, Timothy; Spies, Jeffrey; Estabrook, Ryne; Kenny, Sarah; Bates, Timothy; Mehta, Paras; Fox, John

2011-01-01

OpenMx is free, full-featured, open source, structural equation modeling (SEM) software. OpenMx runs within the "R" statistical programming environment on Windows, Mac OS-X, and Linux computers. The rationale for developing OpenMx is discussed along with the philosophy behind the user interface. The OpenMx data structures are…

Induction of viral interference by IPNV-carrier cells on target cells: A cell co-culture study.

PubMed

Parreño, Ricardo; Torres, Susana; Almagro, Lucía; Belló-Pérez, Melissa; Estepa, Amparo; Perez, Luis

2016-11-01

IPNV is a salmonid birnavirus that possesses the ability to establish asymptomatic persistent infections in a number of valuable fish species. The presence of IPNV may interfere with subsequent infection by other viruses. In the present study we show that an IPNV-carrier cell line (EPC IPNV ) can induce an antiviral state in fresh EPC by co-cultivating both cell types in three different ways: a "droplet" culture system, a plastic chamber setup, and a transmembrane (Transwell ® ) system. All three cell co-culture methods were proven useful to study donor/target cell interaction. Naïve EPC cells grown in contact with EPC IPNV cells develop resistance to VHSV superinfection. The transmembrane system seems best suited to examine gene expression in donor and target cells separately. Our findings point to the conclusion that one or more soluble factors produced by the IPNV carrier culture induce the innate immune response within the target cells. This antiviral response is associated to the up-regulation of interferon (ifn) and mx gene expression in target EPC cells. To our knowledge this is the first article describing co-culture systems to study the interplay between virus-carrier cells and naive cells in fish. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Identification of orange-spotted grouper (Epinephelus coioides) interferon regulatory factor 3 involved in antiviral immune response against fish RNA virus.

PubMed

Huang, Youhua; Huang, Xiaohong; Cai, Jia; OuYang, Zhengliang; Wei, Shina; Wei, Jingguang; Qin, Qiwei

2015-02-01

Interferon regulatory factor 3 (IRF3) is an important transcription factor which regulates the expression of interferon (IFN) and IFN-stimulated genes (ISGs) following virus recognition. In this study, a novel IRF3 gene was cloned from grouper Epinephelus coioides (EcIRF3) and its effects against Singapore grouper iridovirus (SGIV) and red spotted grouper nervous necrosis virus (RGNNV) was investigated. The full-length of EcIRF3 cDNA was composed of 2513 bp and encoded a polypeptide of 458 amino acids which shared 82% identity with European seabass (Dicentrarchus labrax). EcIRF3 contained three conserved domains including a DNA-binding domain (DBD), an IRF associated domain (IAD) and a serine-rich domain. Expression profile analysis revealed that EcIRF3 was abundant in head kidney, kidney, spleen and gill. Upon different stimuli in vitro, the transcript of EcIRF3 was significantly up-regulated after RGNNV infection or treatment with polyinosin-polycytidylic acid (poly I:C). During SGIV infection, the increase of the EcIRF3 transcription was only detected at the late stage, suggesting that EcIRF3 was differently regulated by different stimuli. Immune fluorescence assay indicated that the fluorescence signal of EcIRF3 was increased significantly after infection with RGNNV or treatment with poly I:C, but moderately at the late stage of SGIV infection. Reporter gene assay showed that EcIRF3 activated zebrafish type I IFN and type III IFN promoter in vitro. The viral gene transcription and virus production of RGNNV were significantly decreased in EcIRF3 overexpressing cells. However, the ectopic expression of EcIRF3 did not affect the gene transcription and virus production of SGIV. Moreover, the mRNA expression levels of type I IFN and IFN-inducible genes (MxI, ISG15 and ISG56) were increased in RGNNV infected EcIRF3 overexpressing cells compared to empty vector transfected cells. Together, our results demonstrated that IFN immune response mediated by grouper IRF3 was exerted crucial roles for fish RNA virus, but not for DNA virus replication. Copyright © 2014 Elsevier Ltd. All rights reserved.

Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage.

PubMed

Dey, Arup; Vassallo, Christopher N; Conklin, Austin C; Pathak, Darshankumar T; Troselj, Vera; Wall, Daniel

2016-01-19

Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large "polyploid prophage," Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population "addicted" to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their siblings, and in part, this is mediated by the TraA cell surface receptor. Surprisingly, we report that TraA recognition can also involve sibling killing. We show that killing originates from a prophage-like element that has apparently hijacked the TraA system to deliver a toxin to kin. We hypothesize that this killing system has imposed selective pressures on kin recognition, which in turn has resulted in TraA polymorphisms and hence many different recognition groups. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage

PubMed Central

Dey, Arup; Vassallo, Christopher N.; Conklin, Austin C.; Pathak, Darshankumar T.; Troselj, Vera

2016-01-01

ABSTRACT Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large “polyploid prophage,” Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population “addicted” to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. IMPORTANCE The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their siblings, and in part, this is mediated by the TraA cell surface receptor. Surprisingly, we report that TraA recognition can also involve sibling killing. We show that killing originates from a prophage-like element that has apparently hijacked the TraA system to deliver a toxin to kin. We hypothesize that this killing system has imposed selective pressures on kin recognition, which in turn has resulted in TraA polymorphisms and hence many different recognition groups. PMID:26787762

Transgene and immune gene expression following intramuscular injection of Atlantic salmon (Salmo salar L.) with DNA-releasing PLGA nano- and microparticles.

PubMed

Hølvold, Linn Benjaminsen; Fredriksen, Børge N; Bøgwald, Jarl; Dalmo, Roy A

2013-09-01

The use of poly-(D,L-lactic-co-glycolic) acid (PLGA) particles as carriers for DNA delivery has received considerable attention in mammalian studies. DNA vaccination of fish has been shown to elicit durable transgene expression, but no reports exist on intramuscular administration of PLGA-encapsulated plasmid DNA (pDNA). We injected Atlantic salmon (Salmo salar L.) intramuscularly with a plasmid vector containing a luciferase (Photinus pyralis) reporter gene as a) naked pDNA, b) encapsulated into PLGA nano- (~320 nm) (NP) or microparticles (~4 μm) (MP), c) in an oil-based formulation, or with empty particles of both sizes. The ability of the different pDNA-treatments to induce transgene expression was analyzed through a 70-day experimental period. Anatomical distribution patterns and depot effects were determined by tracking isotope labeled pDNA. Muscle, head kidney and spleen from all treatment groups were analyzed for proinflammatory cytokines (TNF-α, IL-1β), antiviral genes (IFN-α, Mx) and cytotoxic T-cell markers (CD8, Eomes) at mRNA transcription levels at days 1, 2, 4 and 7. Histopathological examinations were performed on injection site samples from days 2, 7 and 30. Injection of either naked pDNA or the oil-formulation was superior to particle treatments for inducing transgene expression at early time-points. Empty particles of both sizes were able to induce proinflammatory immune responses as well as degenerative and inflammatory pathology at the injection site. Microparticles demonstrated injection site depots and an inflammatory pathology comparable to the oil-based formulation. In comparison, the distribution of NP-encapsulated pDNA resembled that of naked pDNA, although encapsulation into NPs significantly elevated the expression of antiviral genes in all tissues. Together the results indicate that while naked pDNA is most efficient for inducing transgene expression, the encapsulation of pDNA into NPs up-regulates antiviral responses that could be of benefit to DNA vaccination. Copyright © 2013 Elsevier Ltd. All rights reserved.

Cloning, Expression and Characteristics of a Novel Alkalistable and Thermostable Xylanase Encoding Gene (Mxyl) Retrieved from Compost-Soil Metagenome

PubMed Central

Verma, Digvijay; Kawarabayasi, Yutaka; Miyazaki, Kentaro; Satyanarayana, Tulasi

2013-01-01

Background The alkalistable and thermostable xylanases are in high demand for pulp bleaching in paper industry and generating xylooligosaccharides by hydrolyzing xylan component of agro-residues. The compost-soil samples, one of the hot environments, are expected to be a rich source of microbes with thermostable enzymes. Methodology/Principal Findings Metagenomic DNA from hot environmental samples could be a rich source of novel biocatalysts. While screening metagenomic library constructed from DNA extracted from the compost-soil in the p18GFP vector, a clone (TSDV-MX1) was detected that exhibited clear zone of xylan hydrolysis on RBB xylan plate. The sequencing of 6.321 kb DNA insert and its BLAST analysis detected the presence of xylanase gene that comprised 1077 bp. The deduced protein sequence (358 amino acids) displayed homology with glycosyl hydrolase (GH) family 11 xylanases. The gene was subcloned into pET28a vector and expressed in E. coli BL21 (DE3). The recombinant xylanase (rMxyl) exhibited activity over a broad range of pH and temperature with optima at pH 9.0 and 80°C. The recombinant xylanase is highly thermostable having T1/2 of 2 h at 80°C and 15 min at 90°C. Conclusion/Significance This is the first report on the retrieval of xylanase gene through metagenomic approach that encodes an enzyme with alkalistability and thermostability. The recombinant xylanase has a potential application in paper and pulp industry in pulp bleaching and generating xylooligosaccharides from the abundantly available agro-residues. PMID:23382818

3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX): toxicological properties and risk assessment in drinking water.

PubMed

Hirose, A; Nishikawa, A; Kinae, N; Hasegawa, R

1999-01-01

MX (3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone), one of the byproducts formed during the chlorine disinfection process of drinking water, shows strong mutagenic activity for Salmonella strains in the Ames test. In several countries, the contribution of MX to the total mutagenicity of drinking water is estimated to range from 7% to 67%. To assess the risk of MX for human health, we summarized the toxicological properties of MX and estimated the tolerable daily intake (TDI) or tolerable concentration in drinking water. MX is genotoxic in cultured mammalian cells and causes in vivo DNA damage in several tissues. MX is carcinogenic for rodents in addition to possessing skin and gastric promotion activities. From these toxicological profiles of MX, we estimated the virtual safety dose (VSD) for genotoxic action as 5 ng/kg/d and the TDI for non-genotoxic action of MX as 40 ng/kg/d. We assumed a tolerable MX concentration of 150 ng/L in drinking water. Because of the uncertainty about human genotoxicity, however, and the lack of information on reproductive or developmental toxicity, the estimated tolerable dose level may be provisional.

Effect of 3-substituted 1,4-benzodiazepin-2-ones on bradykinin-induced smooth muscle contraction.

PubMed

Virych, P A; Shelyuk, O V; Kabanova, T A; Khalimova, E I; Martynyuk, V S; Pavlovsky, V I; Andronati, S A

2017-01-01

Biochemical properties of 3-substituted 1,4-benzodiazepine determined by the characteristics of their chemical structure. Influence of 3-substituted 1,4-benzodiazepin-2-ones on maximal normalized rate and amplitudes of isometric smooth muscle contraction in rats was investigated. Compounds MX-1775 and MX-1828 demonstrated the similar inhibition effect on bradykinin-induced contraction of smooth muscle like competitive inhibitor des-arg9-bradykinin-acetate to bradykinin B2-receptors. MX-1626 demonstrated unidirectional changes of maximal normalized rate and force of smooth muscle that proportionally depended on bradykinin concentration in the range 10-10-10-6 M. MX-1828 has statistically significant decrease of normalized rate of smooth muscle contraction for bradykinin concentrations 10-10 and 10-9 M by 20.7 and 8.6%, respectively, but for agonist concentration 10-6 M, this parameter increased by 10.7% and amplitude was reduced by 29.5%. Compounds MX-2011, MX-1785 and MX-2004 showed no natural effect on bradykinin-induced smooth muscle contraction. Compounds MX-1775, MX-1828, MX-1626 were selected for further research of their influence on kinin-kallikrein system and pain perception.

Comparative study of torque expression among active and passive self-ligating and conventional brackets

PubMed Central

Franco, Érika Mendonça Fernandes; Valarelli, Fabrício Pinelli; Fernandes, João Batista; Cançado, Rodrigo Hermont; de Freitas, Karina Maria Salvatore

2015-01-01

Abstract Objective: The aim of this study was to compare torque expression in active and passive self-ligating and conventional brackets. Methods: A total of 300 segments of stainless steel wire 0.019 x 0.025-in and six different brands of brackets (Damon 3MX, Portia, In-Ovation R, Bioquick, Roth SLI and Roth Max) were used. Torque moments were measured at 12°, 24°, 36° and 48°, using a wire torsion device associated with a universal testing machine. The data obtained were compared by analysis of variance followed by Tukey test for multiple comparisons. Regression analysis was performed by the least-squares method to generate the mathematical equation of the optimal curve for each brand of bracket. Results: Statistically significant differences were observed in the expression of torque among all evaluated bracket brands in all evaluated torsions (p < 0.05). It was found that Bioquick presented the lowest torque expression in all tested torsions; in contrast, Damon 3MX bracket presented the highest torque expression up to 36° torsion. Conclusions: The connection system between wire/bracket (active, passive self-ligating or conventional with elastic ligature) seems not to interfere in the final torque expression, the latter being probably dependent on the interaction between the wire and the bracket chosen for orthodontic mechanics. PMID:26691972

Bovine embryo induces an anti-inflammatory response in uterine epithelial cells and immune cells in vitro: possible involvement of interferon tau as an intermediator

PubMed Central

TALUKDER, Anup K.; YOUSEF, Mohamed S.; RASHID, Mohammad B.; AWAI, Kensuke; ACOSTA, Tomas J.; SHIMIZU, Takashi; OKUDA, Kiyoshi; SHIMADA, Masayuki; IMAKAWA, Kazuhiko; MIYAMOTO, Akio

2017-01-01

Recent observations suggest that the bovine uterus starts to react to the early embryo immediately after its arrival from the oviduct. The present study aimed to investigate the effect of the early developing embryo on the immune-related gene profile in bovine uterine epithelial cells (BUECs) in vitro, and to further examine the impact of conditioned media (CM), either from embryo-BUEC co-culture or embryo culture alone, on gene expression in peripheral blood mononuclear cells (PBMCs). First, BUECs were co-cultured with morulae (n = 10) for D5-D9 (D0 = IVF), and gene expression in BUECs was analyzed. Subsequently, PBMCs were cultured in CM from embryo-BUEC co-culture or D5-D9 embryo culture, and gene expression was evaluated. In BUECs, the embryo induced interferon (IFN)-stimulated genes (ISGs: ISG15, OAS1, and MX2), a key factor for IFN-signaling (STAT1), and type-1 IFN receptors (IFNAR1 and IFNAR2), with suppression of NFkB2, NFkBIA and pro-inflammatory cytokines (TNFA and IL1B). The embryo also stimulated PTGES and PGE2 secretion in BUECs. In PBMCs, both CM from embryo-BUEC co-culture and embryo culture alone induced ISGs, STAT1 and TGFB1, while suppressing TNFA and IL17. Similarly, interferon tau (IFNT) at 100 pg/ml suppressed NFkB2, TNFA and IL1B in BUECs, and also stimulated TGFB1 and suppressed TNFA in PBMCs. Our findings suggest that the bovine embryo, in the first four days in the uterus (D5-D9), starts to induce an anti-inflammatory response in epithelial cells and in immune cells. IFNT is likely to act as one of the intermediators for induction of the anti-inflammatory response in the bovine uterus. PMID:28603222

Induction of anti-viral genes during acute infection with Viral hemorrhagic septicemia virus (VHSV) genogroup IVa in Pacific herring (Clupea pallasii)

USGS Publications Warehouse

Hansen, John D.; Woodson, James C.; Hershberger, Paul K.; Grady, Courtney; Gregg, Jacob L.; Purcell, Maureen K.

2012-01-01

Infection with the aquatic rhabdovirus Viral hemorrhagic septicemia virus (VHSV) genogroup IVa results in high mortality in Pacific herring (Clupea pallasii) and is hypothesized to be a potential limiting factor for herring recovery. To investigate anti-viral immunity in the Pacific herring, four immune response genes were identified: the myxovirus resistance (Clpa-Mx), a major histocompatibility complex IB (named Clpa-UAA.001), the inducible immunoproteosome subunit 9 (Clpa-PSMB9) and the neutrophil chemotactic factor (Clpa-LECT2). Reverse transcriptase quantitative PCR (RT-qPCR) assays were developed based on these gene sequences to investigate the host immune response to acute VHSV infection following both injection and immersion challenge. Virus levels were measured by both plaque assay and RT-qPCR and peaked at day 6 during the 10-day exposure period for both groups of fish. The interferon stimulated genes (Clpa-Mx, −UAA.001, and −PSMB9) were significantly up-regulated in response to VHSV infection at both 6 and 10 days post-infection in both spleen and fin. Results from this study indicate that Pacific herring mount a robust, early antiviral response in both fin and spleen tissues. The immunological tools developed in this study will be useful for future studies to investigate antiviral immunity in Pacific herring.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takemura, Takayo; Yoshida, Yuichi; Kiso, Shinichi, E-mail: kiso@gh.med.osaka-u.ac.jp

Highlights: •HB-EGF expression was increased during the development of liver fibrosis. •Conditional HB-EGF knockout mouse showed enhanced experimental liver fibrosis. •HB-EGF antagonized TGF-β-induced activation of hepatic stellate cells. •We report a possible protective role of HB-EGF in cholestatic liver fibrosis. -- Abstract: Our aims were to evaluate the involvement of heparin-binding EGF-like growth factor (HB-EGF) in liver fibrogenesis of humans and mice and to elucidate the effect of HB-EGF deficiency on cholestatic liver fibrosis using conditional HB-EGF knockout (KO) mice. We first demonstrated that gene expression of HB-EGF had a positive significant correlation with that of collagen in human fibroticmore » livers, and was increased in bile duct ligation (BDL)-induced fibrotic livers in mouse. We then generated conditional HB-EGF knockout (KO) mice using the interferon inducible Mx-1 promoter driven Cre recombinase transgene and wild type (WT) and KO mice were subjected to BDL. After BDL, KO mice exhibited enhanced liver fibrosis with increased expression of collagen, compared with WT mice. Finally, we used mouse hepatic stellate cells (HSCs) to examine the role of HB-EGF in the activation of these cells and showed that HB-EGF antagonized TGF-β-induced gene expression of collagen in mouse primary HSCs. Interestingly, HB-EGF did not prevent the TGF-β-induced nuclear accumulation of Smad3, but did lead to stabilization of the Smad transcriptional co-repressor TG-interacting factor. In conclusion, our data suggest a possible protective role of HB-EGF in cholestatic liver fibrosis.« less

Icotinib antagonizes ABCG2-mediated multidrug resistance, but not the pemetrexed resistance mediated by thymidylate synthase and ABCG2

PubMed Central

Shukla, Suneet; Zhang, Yun-Kai; Wang, Yi-Jun; Kathawala, Rishil J.; Robey, Robert W.; Zhang, Li; Yang, Dong-Hua; Talele, Tanaji T.; Bates, Susan E.; Ambudkar, Suresh V.; Chen, Zhe-Sheng

2014-01-01

ABCG2 is a potential biomarker causing multidrug resistance (MDR) in Non-Small Cell Lung Cancer (NSCLC). We conducted this study to investigate whether Icotinib, a small-molecule inhibitor of EGFR tyrosine kinase, could interact with ABCG2 transporter in NSCLC. Our results showed that Icotinib reversed ABCG2-mediated MDR by antagonizing the drug efflux function of ABCG2. Icotinib stimulated the ATPase activity in a concentration-dependent manner and inhibited the photolabeling of ABCG2 with [125I]-Iodoarylazidoprazosin, demonstrating that it interacts at the drug-binding pocket. Homology modeling predicted the binding conformation of Icotinib at Asn629 centroid-based grid of ABCG2. However, Icotinib at reversal concentration did not affect the expression levels of AKT and ABCG2. Furthermore, a combination of Icotinib and topotecan exhibited significant synergistic anticancer activity against NCI-H460/MX20 tumor xenografts. However, the inhibition of transport activity of ABCG2 was insufficient to overcome pemetrexed resistance in NCI-H460/MX20 cells, which was due to the co-upregulated thymidylate synthase (TS) and ABCG2 expression. This is the first report to show that the up-regulation of TS in ABCG2-overexpressing cell line NCI-H460/MX20 may play a role of resistance to pemetrexate. Our findings suggested different possible strategies of overcoming the resistance of topotecan and pemetrexed in the NSCLC patients. PMID:24980828

Icotinib antagonizes ABCG2-mediated multidrug resistance, but not the pemetrexed resistance mediated by thymidylate synthase and ABCG2.

PubMed

Wang, De-Shen; Patel, Atish; Shukla, Suneet; Zhang, Yun-Kai; Wang, Yi-Jun; Kathawala, Rishil J; Robey, Robert W; Zhang, Li; Yang, Dong-Hua; Talele, Tanaji T; Bates, Susan E; Ambudkar, Suresh V; Xu, Rui-Hua; Chen, Zhe-Sheng

2014-06-30

ABCG2 is a potential biomarker causing multidrug resistance (MDR) in Non-Small Cell Lung Cancer (NSCLC). We conducted this study to investigate whether Icotinib, a small-molecule inhibitor of EGFR tyrosine kinase, could interact with ABCG2 transporter in NSCLC. Our results showed that Icotinib reversed ABCG2-mediated MDR by antagonizing the drug efflux function of ABCG2. Icotinib stimulated the ATPase activity in a concentration-dependent manner and inhibited the photolabeling of ABCG2 with [125I]-Iodoarylazidoprazosin, demonstrating that it interacts at the drug-binding pocket. Homology modeling predicted the binding conformation of Icotinib at Asn629 centroid-based grid of ABCG2. However, Icotinib at reversal concentration did not affect the expression levels of AKT and ABCG2. Furthermore, a combination of Icotinib and topotecan exhibited significant synergistic anticancer activity against NCI-H460/MX20 tumor xenografts. However, the inhibition of transport activity of ABCG2 was insufficient to overcome pemetrexed resistance in NCI-H460/MX20 cells, which was due to the co-upregulated thymidylate synthase (TS) and ABCG2 expression. This is the first report to show that the up-regulation of TS in ABCG2-overexpressing cell line NCI-H460/MX20 may play a role of resistance to pemetrexate. Our findings suggested different possible strategies of overcoming the resistance of topotecan and pemetrexed in the NSCLC patients.

High Expression of Antiviral and Vitamin D Pathway Genes Are a Natural Characteristic of a Small Cohort of HIV-1-Exposed Seronegative Individuals.

PubMed

Aguilar-Jimenez, Wbeimar; Saulle, Irma; Trabattoni, Daria; Vichi, Francesca; Lo Caputo, Sergio; Mazzotta, Francesco; Rugeles, Maria T; Clerici, Mario; Biasin, Mara

2017-01-01

Natural resistance to HIV-1 infection is influenced by genetics, viral-exposure, and endogenous immunomodulators such as vitamin D (VitD), being a multifactorial phenomenon that characterizes HIV-1-exposed seronegative individuals (HESNs). We compared mRNA expression of 10 antivirals, 5 immunoregulators, and 3 VitD pathway genes by qRT-PCR in cells of a small cohort of 11 HESNs, 16 healthy-controls (HCs), and 11 seropositives (SPs) at baseline, in response to calcidiol (VitD precursor) and/or aldithriol-2-(AT2)-inactivated HIV-1. In addition, the expression of TIM-3 on T and NK cells of six HCs after calcidiol and calcitriol (active VitD) treatments was evaluated by flow cytometry. Calcidiol increased the mRNA expression of HAVCR2 (TIM-3; Th1-cells inhibitor) in HCs and HESNs. AT2-HIV-1 increased the mRNA expression of the activating VitD enzyme CYP27B1 , of the endogenous antiviral proteins MX2, TRIM22, APOBEC3G , and of immunoregulators ERAP2 and HAVCR2 , but reduced the mRNA expression of VitD receptor ( VDR ) and antiviral peptides PI3 and CAMP in all groups. Remarkably, higher mRNA levels of VDR, CYP27B1, PI3, CAMP, SLPI , and of ERAP2 were found in HESNs compared to HCs either at baseline or after stimuli. Furthermore, calcitriol increases the percentage of CD4+ T cells expressing TIM-3 protein compared to EtOH controls. These results suggest that high mRNA expression of antiviral and VitD pathway genes could be genetically determined in HESNs more than viral-induced at least in peripheral blood mononuclear cells. Moreover, the virus could potentiate bio-activation and use of VitD, maintaining the homeostasis of the immune system. Interestingly, VitD-induced TIM-3 on T cells, a T cell inhibitory and anti-HIV-1 molecule, requires further studies to analyze the functional outcomes during HIV-1 infection.

Pathological and immunological responses associated with differential survival of Chinook salmon following Renibacterium salmoninarum challenge

USGS Publications Warehouse

Metzger, David C.; Elliott, Diane G.; Wargo, Andrew; Park, Linda K.; Purcell, Maureen K.

2010-01-01

Chinook salmon Oncorhynchus tshawytscha are highly susceptible to Renibacterium salmoninarum, the causative agent of bacterial kidney disease (BKD). Previously we demonstrated that introduced Chinook salmon from Lake Michigan, Wisconsin (WI), USA, have higher survival following R. salmoninarum challenge relative to the progenitor stock from Green River, Washington, USA. In the present study, we investigated the pathological and immunological responses that are associated with differential survival in the 2 Chinook salmon stocks following intra-peritoneal R. salmoninarum challenge of 2 different cohort years (2003 and 2005). Histological evaluation revealed delayed appearance of severe granulomatous lesions in the kidney and lower overall prevalence of membranous glomerulopathy in the higher surviving WI stock. The higher survival WI stock had a lower bacterial load at 28 d post-infection, as measured by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR). However, at all other time points, bacterial load levels were similar despite higher mortality in the more susceptible Green River stock, suggesting the possibility that the stocks may differ in their tolerance to infection by the bacterium. Interferon-γ, inducible nitric oxide synthase (iNOS), Mx-1, and transferrin gene expression were up-regulated in both stocks following challenge. A trend of higher iNOS gene expression at later time points (≥28 d post-infection) was observed in the lower surviving Green River stock, suggesting the possibility that higher iNOS expression may contribute to greater pathology in that stock.

Immune-Related Gene Expression Patterns in GPV- or H9N2-Infected Goose Spleens.

PubMed

Chen, Shun; Wang, Anqi; Sun, Lipei; Liu, Fei; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Yang, Qiao; Wu, Ying; Sun, Kunfeng; Chen, Xiaoyue; Cheng, Anchun

2016-12-01

Goose parvovirus (GPV) and avian influenza virus subtype H9N2 are single-stranded DNA (ssDNA) and single-stranded RNA (ssRNA) viruses, respectively, both of which can spread in goslings and cause a significant economic loss. To explore the comprehensive transcriptome of GPV- or H9N2-infected goose spleens and to understand the immune responses induced by a DNA virus (GPV) or a RNA virus (H9N2), RNA-seq was performed on the spleens of goslings at the fifth day post infection. In the present study, 2604 and 2409 differentially expressed unigenes were identified in the GPV- and H9N2-infected groups, respectively. Through KEGG pathway enrichment analyses, the up-regulated transcripts in the two virus-infected groups were mainly involved in immune-related pathways. In addition, the two virus-infected groups displayed similar expression patterns in the immune response pathways, including pattern-recognition receptor signaling pathways, the antigen processing and presentation pathway, the NF-κB signaling pathway and the JAK-STAT signaling pathway, as well as cytokines. Furthermore, most of the immune-related genes, particularly TLR7, TRAF3, Mx, TRIM25, CD4, and CD8α, increased in response to GPV and H9N2 infection. However, the depression of NF-κB signaling may be a mechanism by which the viruses evade the host immune system or a strategy to achieve immune homeostasis.

Effects of dietary n-3 fatty acids on Toll-like receptor activation in primary leucocytes from Atlantic salmon (Salmo salar).

PubMed

Arnemo, Marianne; Kavaliauskis, Arturas; Andresen, Adriana Magalhaes Santos; Bou, Marta; Berge, Gerd Marit; Ruyter, Bente; Gjøen, Tor

2017-08-01

The shortage of the n-3 fatty acids eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) on the international markets has led to increasing substitution of fish oil by plant oils in Atlantic salmon (Salmo salar) feed and thereby reducing the EPA and DHA content in salmon. However, the minimum required levels of these fatty acids in fish diets for securing fish health are unknown. Fish were fed with 0, 1 or 2% EPA or DHA alone or in combination of both over a period, growing from 50 to 400 g. Primary head kidney leucocytes were isolated and stimulated with Toll-like receptor (TLR) ligands to determine if EPA and DHA deficiency can affect expression of important immune genes and eicosanoid production. Several genes related to viral immune response did not vary between groups. However, there was a tendency that the high-level EPA and DHA groups expressed lower levels of IL-1β in non-stimulated leucocytes. These leucocytes were also more responsive to the TLR ligands, inducing higher expression levels of IL-1β and Mx1 after stimulation. The levels of prostaglandin E2 and leukotriene B4 in serum and media from stimulated leucocytes were lower in both low and high EPA and DHA groups. In conclusion, leucocytes from low EPA and DHA groups seemed to be less responsive towards immunostimulants, like TLR ligands, indicating that low levels or absence of dietary EPA and DHA may have immunosuppressive effects.

Deep mutational scanning identifies sites in influenza nucleoprotein that affect viral inhibition by MxA

PubMed Central

Ashenberg, Orr; Padmakumar, Jai

2017-01-01

The innate-immune restriction factor MxA inhibits influenza replication by targeting the viral nucleoprotein (NP). Human influenza virus is more resistant than avian influenza virus to inhibition by human MxA, and prior work has compared human and avian viral strains to identify amino-acid differences in NP that affect sensitivity to MxA. However, this strategy is limited to identifying sites in NP where mutations that affect MxA sensitivity have fixed during the small number of documented zoonotic transmissions of influenza to humans. Here we use an unbiased deep mutational scanning approach to quantify how all single amino-acid mutations to NP affect MxA sensitivity in the context of replication-competent virus. We both identify new sites in NP where mutations affect MxA resistance and re-identify mutations known to have increased MxA resistance during historical adaptations of influenza to humans. Most of the sites where mutations have the greatest effect are almost completely conserved across all influenza A viruses, and the amino acids at these sites confer relatively high resistance to MxA. These sites cluster in regions of NP that appear to be important for its recognition by MxA. Overall, our work systematically identifies the sites in influenza nucleoprotein where mutations affect sensitivity to MxA. We also demonstrate a powerful new strategy for identifying regions of viral proteins that affect inhibition by host factors. PMID:28346537

Antiviral Activity of Lambda Interferon in Chickens

PubMed Central

Reuter, Antje; Soubies, Sebastien; Härtle, Sonja; Schusser, Benjamin; Kaspers, Bernd

2014-01-01

Interferons (IFNs) are essential components of the antiviral defense system of vertebrates. In mammals, functional receptors for type III IFN (lambda interferon [IFN-λ]) are found mainly on epithelial cells, and IFN-λ was demonstrated to play a crucial role in limiting viral infections of mucosal surfaces. To determine whether IFN-λ plays a similar role in birds, we produced recombinant chicken IFN-λ (chIFN-λ) and we used the replication-competent retroviral RCAS vector system to generate mosaic-transgenic chicken embryos that constitutively express chIFN-λ. We could demonstrate that chIFN-λ markedly inhibited replication of various virus strains, including highly pathogenic influenza A viruses, in ovo and in vivo, as well as in epithelium-rich tissue and cell culture systems. In contrast, chicken fibroblasts responded poorly to chIFN-λ. When applied in vivo to 3-week-old chickens, recombinant chIFN-λ strongly induced the IFN-responsive Mx gene in epithelium-rich organs, such as lungs, tracheas, and intestinal tracts. Correspondingly, these organs were found to express high transcript levels of the putative chIFN-λ receptor alpha chain (chIL28RA) gene. Transfection of chicken fibroblasts with a chIL28RA expression construct rendered these cells responsive to chIFN-λ treatment, indicating that receptor expression determines cell type specificity of IFN-λ action in chickens. Surprisingly, mosaic-transgenic chickens perished soon after hatching, demonstrating a detrimental effect of constitutive chIFN-λ expression. Our data highlight fundamental similarities between the IFN-λ systems of mammals and birds and suggest that type III IFN might play a role in defending mucosal surfaces against viral intruders in most if not all vertebrates. PMID:24371053

Transcriptomic analysis of spleen infected with infectious salmon anemia virus reveals distinct pattern of viral replication on resistant and susceptible Atlantic salmon (Salmo salar).

PubMed

Dettleff, Phillip; Moen, Thomas; Santi, Nina; Martinez, Victor

2017-02-01

The infectious salmon anemia virus (ISAv) produces a systemic infection in salmonids, causing large losses in salmon production. However, little is known regarding the mechanisms exerting disease resistance. In this paper, we perform an RNA-seq analysis in Atlantic salmon challenged with ISAv (using individuals coming from families that were highly susceptible or highly resistant to ISAv infection). We evaluated the differential expression of both host and ISAv genes in a target organ for the virus, i.e. the spleen. The results showed differential expression of host genes related to response to stress, immune response and protein folding (genes such as; atf3, mhc, mx1-3, cd276, cd2, cocs1, c7, il10, il10rb, il13ra2, ubl-1, ifng, ifngr1, hivep2, sigle14 and sigle5). An increased protein processing activity was found in susceptible fish, which generates a subsequent unfolded protein response. We observed extreme differences in the expression of viral segments between susceptible and resistant groups, demonstrating the capacity of resistant fish to overcome the virus replication, generating a very low viral load. This phenomenon and survival of this higher resistant fish seem to be related to differences in immune and translational process, as well as to the increase of HIV-EP2 (hivep2) transcript in resistant fish, although the causal mechanism is yet to be discovered. This study provides valuable information about disease resistance mechanisms in Atlantic salmon from a host-pathogen interaction point of view. Copyright © 2017 Elsevier Ltd. All rights reserved.

Class B CpG-ODN2006 is highly associated with IgM and antimicrobial peptide gene expression through TLR9 pathway in yellowtail Seriola lalandi.

PubMed

Angulo, Carlos; Alamillo, Erika; Hirono, Ikuo; Kondo, Hidehiro; Jirapongpairoj, Walissara; Perez-Urbiola, Juan Carlos; Reyes-Becerril, Martha

2018-06-01

The purpose of this study was to characterize the TLR9 gene from yellowtail (Seriola lalandi) and evaluate its functional activity using the class B Cytosine-phosphate-guanine-oligodeoxynucleotide2006 (CpG-ODN2006) in an in vivo experiment after one-week immunostimulation. The gene expressions of TLR9, Immunoglobulin M (IgM), antimicrobial peptides and cytokines were evaluated by real time PCR, and humoral immune parameters were analyzed in serum. The TLR9 nucleotide sequence from yellowtail was obtained using the whole-genome shotgun sequencing method and bioinformatics tools. The yellowtail full-length cDNA sequence of SlTLR9 was 3789 bp in length, including a 66-bp 5'-untranslated region (UTR), a 3'-UTR of 528 bp, and an open reading frame (ORF) of 3192 bp translatable to 1064 amino acid showing a high degree of similarity with the counterparts of other fish species and sharing common structural architecture of the TLR family, including LRR domains, one C-terminal LRR region, and a TIR domain. Gene expression studies revealed the constitutive expression of TLR9 mRNA in all analyzed tissues; the highest levels were observed in intestine, liver and spleen where they play an important role in the fish immune system. The expression levels of TLR9 after B class CpG-ODN2006 (the main TLR9-agonist) was significantly up-regulated in all analyzed tissues, with the high expression observed in spleen followed by intestine and skin. The CpG-B has been shown as a potent B cell mitogen, and interestingly, IgM mRNA transcript was up-regulated in spleen and intestine, which was highly correlated with TLR9 after CpG-ODN2006 stimulation. The antimicrobial peptides, piscidin and NK-lysine, were up-regulated in spleen and gill after CpG-ODN2006 injection with a high correlation (r ≥ 0.82) with TLR9 gene expression. Cytokine genes were up-regulated in spleen, intestine and skin after CpG-ODN was compared with the control group. No significant correlation was observed between TLR9 and IL-1β, TNF-α and Mx gene expressions. The results showed that CpG-ODN2006 intraperitoneal injection enhanced lysozyme, peroxidase and superoxide dismutase activities in serum and demonstrated that CpG-ODN2006 can induce a specific immune response via TLR9 in which IgM and antimicrobial peptides must have an important role in the defense mechanisms against infections in yellowtail. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular cloning, expression and characterization of Pekin duck interferon-λ.

PubMed

Yao, Qingxia; Fischer, Karl P; Arnesen, Karina; Tyrrell, D Lorne; Gutfreund, Klaus S

2014-09-10

Interferons (IFNs) are the first line of defense against viral infections in vertebrates. Type III interferon (IFN-λ) is recognized for its key role in innate immunity of tissues of epithelial origin. Here we describe the identification of the Pekin duck IFN-λ ortholog (duIFN-λ). The predicted duIFN-λ protein has an amino acid identity of 63%, 38%, 37% and 33% with chicken IFN-λ and human IFN-λ3, IFN-λ2 and IFN-λ1, respectively. The duck genome contains a single IFN-λ gene that is comprised of five exons and four introns. Recombinant duIFN-λ up-regulated OASL and Mx-1 mRNA in primary duck hepatocytes. Our observations suggest evolutionary conservation of genomic organization and structural features implicated in receptor binding and antiviral activity. The identification and expression of duIFN-λ will facilitate further study of the role of type III IFN in antiviral defense and inflammatory responses of the Pekin duck, a non-mammalian vertebrate and pathogen host with relevance for human and animal health. Copyright © 2014 Elsevier B.V. All rights reserved.

Comparison of MX-857 versus MX-641 chemistries for type 2485 film

NASA Technical Reports Server (NTRS)

Bourque, P. F.

1972-01-01

Tests were conducted to evaluate Kodak MX-857 and MX-641 chemistry systems for use with film Type 2485 to be used in the dim light experiments on Apollo 16. The test program objectives were to: (1) retain a minimum ASA speed of at least 4000; (2) maintain a base-plus-fog level of 0.21 density units or less; and (3) minimize the granularity but do not exceed the granularity level of the Apollo 15 imagery. Test results on the Versamat processor indicate that the use of MX-857 chemistry is preferred over MX-641 chemistry in satisfying the stated test objectives.

Differentiation-associated alteration in human monocyte-macrophage accessory cell function.

PubMed

Mayernik, D G; Ul-Haq, A; Rinehart, J J

1983-05-01

Human monocyte (Mo) to macrophage (Mx) differentiation is associated with marked and well studied changes in morphology, biochemical parameters, and effector cell function. Nevertheless, the comparative accessory cell (AC) function of blood Mo and differentiated Mx has not been carefully studied. We, therefore, examined the kinetics and mechanisms of change in AC function during in vitro Mo to Mx differentiation. The system utilized has two distinctive features: blood Mo and resultant cultured Mx represent a cohort of cells derived from the bone marrow within a 12-hr period. Moreover, the in vitro derived Mx utilized herein have been characterized extensively and are functionally and biochemically similar to pulmonary macrophages (PMx). In the experiments reported, AC functions of blood Mo, Mx derived from Mo after 1 to 6 days of culture, and PMx was compared. AC were cultured with nylon wool column-purified autologous T cells and were stimulated with concanavalin A (Con A) or streptokinase-streptodornase (SKSD). Blood T cell proliferation to Con A or SKSD was inhibited greater than 90% by the removal of Mo and was reconstituted by 20% Mo. Mx derived from Mo by culture for 1 to 3 days exhibited the same (or better) AC function as Mo when T cells were stimulated with either SKSD or Con A. In marked contrast, Mx derived from 6-day cultures exhibited less than or equal to 15% of Mo (i.e., control) capacity to support T cell proliferative response to SKSD. Six-day Mx support T cell proliferation to Con A was somewhat variable. Similar to 6-day cultured Mx, PMx failed to function as AC. The mechanism of loss of AC function was examined: a) cultured Mx maintained Ia antigen positivity for greater than 8 days; b) mixing experiments with Mo + 6-day cultured Mx or Mo + PMx demonstrated no T cell suppression; c) the normal capacity of most 6-day cultured Mx to support Con A but not SKSD induced T cell proliferation, apparently ruled out the loss of the ability to deliver a nonspecific "second signal" as the involved mechanism; d) inhibition of Mo to Mx differentiation by dexamethasone preserved AC activity. Thus, human culture-derived Mx and PMx exhibit deficit AC function through loss of an undefined mechanism. However, loss of AC antigen processing or presentation may occur.

A Host Transcriptional Signature for Presymptomatic Detection of Infection in Humans Exposed to Influenza H1N1 or H3N2

DTIC Science & Technology

2013-01-09

specificity. The majority of the top 50 predictive genes contained in each factor are known to characterize host response to viral infection, and include...RSAD2, the OAS family, multiple interferon response elements, the myxovirus- resistance gene MX1, cytokine response pathways and others [16,17,18]. Many...antiviral pathways (Fig. s4). Furthermore, the high degree of similarity and cross- applicability of the two signatures permit the mathematical

The nucleoprotein of newly emerged H7N9 influenza A virus harbors a unique motif conferring resistance to antiviral human MxA.

PubMed

Riegger, David; Hai, Rong; Dornfeld, Dominik; Mänz, Benjamin; Leyva-Grado, Victor; Sánchez-Aparicio, Maria T; Albrecht, Randy A; Palese, Peter; Haller, Otto; Schwemmle, Martin; García-Sastre, Adolfo; Kochs, Georg; Schmolke, Mirco

2015-02-01

Interferon-induced Mx proteins show strong antiviral activity against influenza A viruses (IAVs). We recently demonstrated that the viral nucleoprotein (NP) determines resistance of seasonal and pandemic human influenza viruses to Mx, while avian isolates retain Mx sensitivity. We identified a surface-exposed cluster of amino acids in NP of pandemic A/BM/1/1918 (H1N1), comprising isoleucine-100, proline-283, and tyrosine-313, that is essential for reduced Mx sensitivity in cell culture and in vivo. This cluster has been maintained in all descendant seasonal strains, including A/PR/8/34 (PR/8). Accordingly, two substitutions in the NP of PR/8 [PR/8(mut)] to the Mx-sensitive amino acids (P283L and Y313F) led to attenuation in Mx1-positive mice. Serial lung passages of PR/8(mut) in Mx1 mice resulted in a single exchange of tyrosine to asparagine at position 52 in NP (in close proximity to the amino acid cluster at positions 100, 283, and 313), which partially compensates loss of Mx resistance in PR/8(mut). Intriguingly, the NP of the newly emerged avian-origin H7N9 virus also contains an asparagine at position 52 and shows reduced Mx sensitivity. N52Y substitution in NP results in increased sensitivity of the H7N9 virus to human Mx, indicating that this residue is a determinant of Mx resistance in mammals. Our data strengthen the hypothesis that the human Mx protein represents a potent barrier against zoonotic transmission of avian influenza viruses. However, the H7N9 viruses overcome this restriction by harboring an NP that is less sensitive to Mx-mediated host defense. This might contribute to zoonotic transmission of H7N9 and to the severe to fatal outcome of H7N9 infections in humans. The natural host of influenza A viruses (IAVs) are aquatic birds. Occasionally, these viruses cross the species barrier, as in early 2013 when an avian H7N9 virus infected humans in China. Since then, multiple transmissions of H7N9 viruses to humans have occurred, leaving experts puzzled about molecular causes for such efficient crossing of the species barrier compared to other avian influenza viruses. Mx proteins are known restriction factors preventing influenza virus replication. Unfortunately, some viruses (e.g., human IAV) have developed some resistance, which is associated with specific amino acids in their nucleoproteins, the target of Mx function. Here, we demonstrate that the novel H7N9 bird IAV already carries a nucleoprotein that overcomes the inhibition of viral replication by human MxA. This is the first example of an avian IAV that is naturally less sensitive to Mx-mediated inhibition and might explain why H7N9 viruses transmitted efficiently to humans. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Differential Expression Profile of Chicken Embryo Fibroblast DF-1 Cells Infected with Cell-Adapted Infectious Bursal Disease Virus.

PubMed

Hui, Raymond K; Leung, Frederick C

2015-01-01

RNA-Seq was used to unveil the transcriptional profile of DF-1 cells at the early stage of caIBDV infection. Total RNAs were extracted from virus-infected cells at 0, 6 and 12 hpi. RNA-Seq datasets of respective samples mapped to 56.5-57.6% of isoforms in the reference genome Galgal4.73. At 6 hpi, 23 isoforms underwent an elevated expression, while 128 isoforms were up-regulated and 5 were down-regulated at 12 hpi in the virus-infected group. Besides, 10 isoforms were exclusively expressed in the virus-infected cells. Though no significant change was detected in cytokine and interferon expression levels at the first 12 hours of infection, modulations of the upstream regulators were observed. In addition to the reported regulatory factors including EIF2AK2, MX, OAS*A, GBP7 and IFIT, IBDV infection also triggered a IFIT5-IRF1/3-RSAD5 pathway in the DF-1 cells which potentially restricted the viral replication cycle in the early infection stage. Over-expression of LIPA and CH25H, together with the suppression of STARD4, LSS and AACS genes implied a modulation of membrane fluidity and lipid raft arrangement in the infected cells. Alternative splicing of the EFR3 homolog A gene was also through to be involved in the lipid membrane regulation, and these cumulative responses projected an inhibition of viral endocytosis. Recognition of viral RNA genomes and intermediates was presumably enhanced by the elevated levels of IFIH1, DHX58 and TRIM25 genes which possess properties on detecting viral dsRNA. On the other hand, the caIBDV arrested the host's apoptotic process by inducing the expression of apoptosis inhibitors including NFKBIA/Z, TNFAIP2/3 and ITA at the first 12 hours of infection. In conclusion, the differential expression landscape demonstrated with RNA-Seq provides a comprehensive picture on the molecular interactions between host cells and virus at the early stage of infection.

MX: A beamline control system toolkit

NASA Astrophysics Data System (ADS)

Lavender, William M.

2000-06-01

The development of experimental and beamline control systems for two Collaborative Access Teams at the Advanced Photon Source has resulted in the creation of a portable data acquisition and control toolkit called MX. MX consists of a set of servers, application programs and libraries that enable the creation of command line and graphical user interface applications that may be easily retargeted to new and different kinds of motor and device controllers. The source code for MX is written in ANSI C and Tcl/Tk with interprocess communication via TCP/IP. MX is available for several versions of Unix, Windows 95/98/NT and DOS. It may be downloaded from the web site http://www.imca.aps.anl.gov/mx/.

Determination of the band parameters of bulk 2H-MX2 (M = Mo, W; X = S, Se) by angle-resolved photoemission spectroscopy

PubMed Central

Kim, Beom Seo; Rhim, Jun-Won; Kim, Beomyoung; Kim, Changyoung; Park, Seung Ryong

2016-01-01

Monolayer MX2 (M = Mo, W; X = S, Se) has recently been drawn much attention due to their application possibility as well as the novel valley physics. On the other hand, it is also important to understand the electronic structures of bulk MX2 for material applications since it is very challenging to grow large size uniform and sustainable monolayer MX2. We performed angle-resolved photoemission spectroscopy and tight binding calculations to investigate the electronic structures of bulk 2H-MX2. We could extract all the important electronic band parameters for bulk 2H-MX2, including the band gap, direct band gap size at K (-K) point and spin splitting size. Upon comparing the parameters for bulk 2H-MX2 (our work) with mono- and multi-layer MX2 (published), we found that stacked layers, substrates for thin films, and carrier concentration significantly affect the parameters, especially the band gap size. The origin of such effect is discussed in terms of the screening effect. PMID:27805019

Potential biomarkers for paclitaxel sensitivity in hypopharynx cancer cell.

PubMed

Xu, Cheng-Zhi; Shi, Run-Jie; Chen, Dong; Sun, Yi-Yuan; Wu, Qing-Wei; Wang, Tao; Wang, Pei-Hua

2013-01-01

Paclitaxel has been proved to be active in treatment and larynx preservation of HNSCC, however, the fact that about 20-40% patients do not respond to paclitaxel makes it urgent to figure out the biomarkers for paclitaxel-based treatment in Hypopharynx cancer (HPC) patients to improve the therapy effect. In this work, Fadu cells, treated or untreated with low dose of paclitaxel for 24 h, were applied to DNA microarray chips. The differential expression in mRNAs and miRs was analyzed and the network between expression-altered mRNAs and miRs was constructed. Differentially expressed genes were mainly enriched in superpathway of cholesterol biosynthesis (ACAT2, MSMO1, LSS, FDFT1 and FDPS etc.), complement system (C3, C1R, C1S, CFR and CFB etc.), interferon signaling (IFIT1, IFIT3, IFITM1 and MX1 etc.), mTOR signaling (MRAS, PRKAA2, PLD1, RND3 and EIF4A1 etc.) and IGF1 signaling (MRAS, IGFBP7, JUN and FOS etc.), most of these pathways are implicated in tumorigenesis or chemotherapy resistance. The first three pathways were predicted to be suppressed, while the last two pathways were predicted to be induced by paclitaxel, suggesting the combination therapy with mTOR inhibition and paclitaxel might be better than single one. The dramatically expression-altered miRs were miR-112, miR-7, miR-1304, miR-222*, miR-29b-1* (these five miRs were upregulated) and miR-210 (downregulated). The 26 putative target genes mediated by the 6 miRs were figured out and the miR-gene network was constructed. Furthermore, immunoblotting assay showed that ERK signaling in Fadu cells was active by low dose of paclitaxel but repressed by high dose of paclitaxel. Collectively, our data would provide potential biomarkers and therapeutic targets for paclitaxel-based therapy in HPC patients.

Potential biomarkers for paclitaxel sensitivity in hypopharynx cancer cell

PubMed Central

Xu, Cheng-Zhi; Shi, Run-Jie; Chen, Dong; Sun, Yi-Yuan; Wu, Qing-Wei; Wang, Tao; Wang, Pei-Hua

2013-01-01

Paclitaxel has been proved to be active in treatment and larynx preservation of HNSCC, however, the fact that about 20-40% patients do not respond to paclitaxel makes it urgent to figure out the biomarkers for paclitaxel-based treatment in Hypopharynx cancer (HPC) patients to improve the therapy effect. In this work, Fadu cells, treated or untreated with low dose of paclitaxel for 24 h, were applied to DNA microarray chips. The differential expression in mRNAs and miRs was analyzed and the network between expression-altered mRNAs and miRs was constructed. Differentially expressed genes were mainly enriched in superpathway of cholesterol biosynthesis (ACAT2, MSMO1, LSS, FDFT1 and FDPS etc.), complement system (C3, C1R, C1S, CFR and CFB etc.), interferon signaling (IFIT1, IFIT3, IFITM1 and MX1 etc.), mTOR signaling (MRAS, PRKAA2, PLD1, RND3 and EIF4A1 etc.) and IGF1 signaling (MRAS, IGFBP7, JUN and FOS etc.), most of these pathways are implicated in tumorigenesis or chemotherapy resistance. The first three pathways were predicted to be suppressed, while the last two pathways were predicted to be induced by paclitaxel, suggesting the combination therapy with mTOR inhibition and paclitaxel might be better than single one. The dramatically expression-altered miRs were miR-112, miR-7, miR-1304, miR-222*, miR-29b-1* (these five miRs were upregulated) and miR-210 (downregulated). The 26 putative target genes mediated by the 6 miRs were figured out and the miR-gene network was constructed. Furthermore, immunoblotting assay showed that ERK signaling in Fadu cells was active by low dose of paclitaxel but repressed by high dose of paclitaxel. Collectively, our data would provide potential biomarkers and therapeutic targets for paclitaxel-based therapy in HPC patients. PMID:24294361

Fluorescence-Activated Cell Sorting-Based Analysis Reveals an Asymmetric Induction of Interferon-Stimulated Genes in Response to Seasonal Influenza A Virus

PubMed Central

von Recum-Knepper, Jessica; Sadewasser, Anne; Weinheimer, Viola K.

2015-01-01

ABSTRACT Influenza A virus (IAV) infection provokes an antiviral response involving the expression of type I and III interferons (IFN) and IFN-stimulated genes (ISGs) in infected cell cultures. However, the spatiotemporal dynamics of the IFN reaction are incompletely understood, as previous studies investigated mainly the population responses of virus-infected cultures, although substantial cell-to-cell variability has been documented. We devised a fluorescence-activated cell sorting-based assay to simultaneously quantify expression of viral antigens and ISGs, such as ISG15, MxA, and IFIT1, in IAV-infected cell cultures at the single-cell level. This approach revealed that seasonal IAV triggers an unexpected asymmetric response, as the major cell populations expressed either viral antigen or ISG, but rarely both. Further investigations identified a role of the viral NS1 protein in blocking ISG expression in infected cells, which surprisingly did not reduce paracrine IFN signaling to noninfected cells. Interestingly, viral ISG control was impaired in cultures infected with avian-origin IAV, including the H7N9 virus from eastern China. This phenotype was traced back to polymorphic NS1 amino acids known to be important for stable binding of the polyadenylation factor CPSF30 and concomitant suppression of host cell gene expression. Most significantly, mutation of two amino acids within the CPSF30 attachment site of NS1 from seasonal IAV diminished the strict control of ISG expression in infected cells and substantially attenuated virus replication. In conclusion, our approach revealed an asymmetric, NS1-dependent ISG induction in cultures infected with seasonal IAV, which appears to be essential for efficient virus propagation. IMPORTANCE Interferons are expressed by infected cells in response to IAV infection and play important roles in the antiviral immune response by inducing hundreds of interferon-stimulated genes (ISGs). Unlike many previous studies, we investigated the ISG response at the single-cell level, enabling novel insights into this virus-host interaction. Hence, cell cultures infected with seasonal IAV displayed an asymmetric ISG induction that was confined almost exclusively to noninfected cells. In comparison, ISG expression was observed in larger cell populations infected with avian-origin IAV, suggesting a more resolute antiviral response to these strains. Strict control of ISG expression by seasonal IAV was explained by the binding of the viral NS1 protein to the polyadenylation factor CPSF30, which reduces host cell gene expression. Mutational disruption of CPSF30 binding within NS1 concomitantly attenuated ISG control and replication of seasonal IAV, illustrating the importance of maintaining an asymmetric ISG response for efficient virus propagation. PMID:25903337

Observations of galactic X-ray sources by OSO-7

NASA Technical Reports Server (NTRS)

Markert, T. H.; Canizares, C. R.; Clark, G. W.; Hearn, D. R.; Li, F. K.; Sprott, G. F.; Winkler, P. F.

1977-01-01

We present the MIT data from the OSO-7 satellite for observations of the galactic plane between 1971 and 1974. A number of sources discovered in the MIT all-sky survey are described in detail: MX 0049 + 59, MX 0836 - 42, MX 1353 - 64, MX 1406 - 61, MX 1418 - 61, MX 1709 - 40, and MX 1608 - 52 (the persistent source suggested to be associated with the X-ray burst source XB 1608 - 52). Upper limits to the X-ray emission from a number of interesting objects are also derived. General results describing all of our observations of galactic sources are presented. Specifically, we display the number-intensity diagrams, luminosity functions, and color-color diagrams for all of the sources we detected. The data are divided between disk and bulge populations, and the characteristics of the two groups are contrasted. Finally, the concept of X-ray source populations and the relationship of globular cluster sources and burst sources to the disk and bulge populations are discussed.

Inhibition on hepatitis B virus in vitro of lectin from Musca domestica pupa via the activation of NF-κB.

PubMed

Cao, Xiaohong; Zhou, Minghui; Wang, Songxue; Wang, Chunling; Hou, Lihua; Luo, Yiqing; Chen, Linye

2012-12-01

The present study reported that the secretions of HBsAg and HBeAg in HepG2.2.15 cells were significantly decreased under the treatment of lectin from Musca domestica pupa (MPL). Both the replication of hepatitis B virus (HBV) DNA and HBV cccDNA in cells, and the copies of extracellular HBV DNA were inhibited by MPL. The mRNA expressions of interleukin-2 (IL-2), gamma interferon (INF-γ) and MxA were up-regulated by MPL treatments, but down-regulated when nuclear factor-κB (NF-κB) signal pathway was blocked by pyrrolidine dithiocarbamate (PDTC). Subsequent investigation revealed that nuclear factor-κB inhibitory κB (IκB) in endochylema was inhibited and NF-κB was translocated into the nucleus. These findings indicate that MPL could inhibit HBV replication via the induction of the expression of IL-2, INF-γ and MxA through the activation of NF-κB. Copyright © 2012 Elsevier B.V. All rights reserved.

Pathogenesis, Transmissibility, and Ocular Tropism of a Highly Pathogenic Avian Influenza A (H7N3) Virus Associated with Human Conjunctivitis

PubMed Central

Belser, Jessica A.; Davis, C. Todd; Balish, Amanda; Edwards, Lindsay E.; Zeng, Hui; Maines, Taronna R.; Gustin, Kortney M.; Martínez, Irma López; Fasce, Rodrigo; Cox, Nancy J.; Katz, Jacqueline M.

2013-01-01

H7 subtype influenza A viruses, responsible for numerous outbreaks in land-based poultry in Europe and the Americas, have caused over 100 cases of confirmed or presumed human infection over the last decade. The emergence of a highly pathogenic avian influenza H7N3 virus in poultry throughout the state of Jalisco, Mexico, resulting in two cases of human infection, prompted us to examine the virulence of this virus (A/Mexico/InDRE7218/2012 [MX/7218]) and related avian H7 subtype viruses in mouse and ferret models. Several high- and low-pathogenicity H7N3 and H7N9 viruses replicated efficiently in the respiratory tract of mice without prior adaptation following intranasal inoculation, but only MX/7218 virus caused lethal disease in this species. H7N3 and H7N9 viruses were also detected in the mouse eye following ocular inoculation. Virus from both H7N3 and H7N9 subtypes replicated efficiently in the upper and lower respiratory tracts of ferrets; however, only MX/7218 virus infection caused clinical signs and symptoms and was capable of transmission to naive ferrets in a direct-contact model. Similar to other highly pathogenic H7 viruses, MX/7218 replicated to high titers in human bronchial epithelial cells, yet it downregulated numerous genes related to NF-κB-mediated signaling transduction. These findings indicate that the recently isolated North American lineage H7 subtype virus associated with human conjunctivitis is capable of causing severe disease in mice and spreading to naive-contact ferrets, while concurrently retaining the ability to replicate within ocular tissue and allowing the eye to serve as a portal of entry. PMID:23487452

Developmentally induced Mll1 loss reveals defects in postnatal haematopoiesis.

PubMed

Gan, T; Jude, C D; Zaffuto, K; Ernst, P

2010-10-01

The mixed lineage leukemia (MLL) gene is disrupted by chromosomal translocations in acute leukemia, producing a fusion oncogene with altered properties relative to the wild-type gene. Murine loss-of-function studies have shown an essential role for Mll in developing the haematopoietic system, yet studies using different conditional knockout models have yielded conflicting results regarding the requirement for Mll during adult steady-state haematopoiesis. In this study, we used a loxP-flanked Mll allele (Mll(F)) and a developmentally regulated, haematopoietic-specific VavCre transgene to reassess the consequences of Mll loss in the haematopoietic lineage, without the need for inducers of Cre recombinase. We show that VavCre;Mll mutants exhibit phenotypically normal fetal haematopoiesis, but rarely survive past 3 weeks of age. Surviving animals are anemic, thrombocytopenic and exhibit a significant reduction in bone marrow haematopoietic stem/progenitor populations, consistent with our previous findings using the inducible Mx1Cre transgene. Furthermore, the analysis of VavCre mutants revealed additional defects in B-lymphopoiesis that could not be assessed using Mx1Cre-mediated Mll deletion. Collectively, these data support the conclusion that Mll has an essential role in sustaining postnatal haematopoiesis.

Mission X: Train Like an Astronaut Challenge

NASA Technical Reports Server (NTRS)

Lloyd, Charles W.

2016-01-01

The Mission X: Train Like an Astronaut Challenge was developed in 2011 to encourage proper exercise and nutrition at an early age by teaching young people to live and eat like space explorers. The strong correlation between an unhealthy childhood diet and adolescent fitness, and the onset of chronic diseases as an adult is the catalyst for Mission X. Mission X is dedicated to assisting people on a global scale to live healthier lifestyles and learn about human space exploration. The Mission X: Train Like an Astronaut 2015 (MX15) International Challenge hosted almost 40,000 children on 800 teams, 28 countries affiliated with 12 space agencies. The MX15 website included 17 languages. MX15, the fifth annual international fitness challenges sponsored by the NASA Human Research Program worked with the European Space Agency and other space agencies from around the world. In comparison to MX14, MX15 expanded to include four additional new countries, increased the number of students by approximately 68% and the number of teams by 29%. Chile' and South Korea participated in the new fall Astro Charlie Walk Around the Earth Challenge. Pre-challenge training materials were made more readily available from the website. South Korea completed a prospective assessment of the usability of the MX content for improving health and fitness in 212 preschool children and their families. Mission X is fortunate to have the support of the NASA, ESA and JAXA astronaut corps. In MX15, they participated in the opening and closing events as well as while on-board the International Space Station. Italian Astronaut Samantha Cristoretti participated as the MX15 Astronaut Ambassador for health and fitness providing the opening video and other videos from ISS. United Kingdom Astronaut Tim Peake and US Astronaut Kate Rubins have agreed to be the MX Ambassadors for 2016 and 2017 respectively. The MX15 International Working Group Face-to-Face meeting and Closing Event were held at the Agenzia Spaziale Italiana (ASI) in Rome, Italy. A record number of twenty-eight countries participated. Austria and Norway have offered to host the 2016 and 2017 working group meetings. MX16 planning began with the working group meetings and areas of improvement will include another second early challenge to accommodate countries in the Southern Hemisphere, recommended changes to the MX website, development of a more defined approach to metrics, a change to the format of future MX International Working Group meetings, and proposed new activities to be developed by the MX International Educator Working Group. We look forward to welcoming many new participants in 2016!

A Study of MX Environmental Management Information System (MXEMIS) Needs.

DTIC Science & Technology

1983-12-01

ENVIRONMENTAL MANAGEMENT INFORMATION SYSTEM (MXEMIS) NEEDS by Ronald Webster Ralph Mitchell Valorie Young -J : 2 34 LA--. Approved for public release...System (SAIFS) The MX Management Information System (MX MIS) The Mobilization Early Warning System (MEWS) The Computer-Aided Environmental Baseline...26 REFERENCES DISTRIBUTION I5 S’ t A STUDY OF MX ENVIRONMENTAL 2 EXISTING SYSTEMS CLASSIFICATION MANAGEMENT INFORMATION SYSTEM (MXEMIS

PREFACE: 4th National Meeting in Chaos, Complex System and Time Series

NASA Astrophysics Data System (ADS)

Raúl Hernández Montoya, Alejandro; Hernández Lemus, Enrique; Rubén Luévano Enríquez, José; Rodríguez Achach, Manuel Enrique; Vargas Madrazo, Carlos Ernesto

2013-12-01

The fourth edition of the National Meeting on Chaos, Complex Systems and Time Series (NMCCSTS4), or in Spanish 4a. Reunión Nacional de Caos, Sistemas Complejos y Series de Tiempo, was held from 29 November to 2 December 2011 in the University of Veracruz (Universidad Veracruzana), Campus Xalapa, at Xalapa Veracruz, México, in the beautiful House of the Lake (Casa del Lago), a late XIX century former textile factory situated in the edge of an also ancient former dam, currently a park containing three small lakes, very emblematic of Xalapa, City, the capital of the state of Veracruz, México. The previous editions of this meeting, were held in Mérida (2006), Pachuca (2008) and Puebla (2009). A clear uptrend is observed in the number of participants in this academic event from all Universities of México and abroad, going from about 15 participants in the first meeting to more than 90 in the last one. On this occasion, about 90 participants from three countries attended our event, where 29 papers (10 master lectures from top recognized national and international leaders in the fields of complexity, and 19 invited papers), one course for students and 42 posters were presented. A look at the scientific program of the NMCCSTS4, allows us to appreciate the wide range of topics and recent advances that were covered during our event; topics and recent results in the areas of biology, econophysics, sociophysics, genomics and bioinformatics, complex networks, thermodynamics, etc, were presented and discussed rigorously in a friendly, dynamical and informal atmosphere. Also, on this occasion, we celebrated Professor Miguel Angel Jiménez Montaño, for his very distinguished academic career throughout more that 50 years and as a founding member of the Faculty of Physics and AI of University of Veracruz. Prizes were awarded for the best poster presentations. The winner was Porfirio Toledo, from Faculty of Mathematics, University of Veracruz (Game theory to characterize solutions of a discrete-time Hamilton--Jacobi equation). The present volume contains a rigorous selection of the lectures presented at the NMCCSTS4. All papers were peer reviewed and we consider the high quality and the wide range of topics covered here displays the high level that the community of complexity sciences is reaching in our country. We would like to thank all of the speakers, participants and the members of the Organizing Committee, also we would like to express our gratitude to all students and support personal involved with the logistic and technical aspects of the organization of our event. This IV edition of the National Meeting on Caos, Complex System and Time Series was sponsored by the following organizations and institutions, we warmly thank all of them: Universidad Veracruzana, IF-BUAP, UAM Azcapotzalco, INMEGEN, Conacyt (155492), all them from México and the Ministero degli Affari Esteri (MAE) from Italy. A R Hernández Montoya University of Veracruz M E Rodríguez Achach University of Veracruz E Hernández Lemus National Institute of Genomic Medicine J R Luévano Enríquez Universidad Autónoma Metropolitana-Azcapotzalco C E Vargas Madrazo University of Veracruz Organizing Committee José Luis Carrillo Estrada Instituto de Física, Benemerita Universidad Autónoma de Puebla, carrillo@sirio.ifuap.buap.mx José Rubén Luévano Enríquez Universidad Autónoma Metropolitana-Azcapotzalco, jrle@correo.azc.uam.mx Enrique Hernández Lemus National Institute of Genomic Medicine, ehernandez@inmegen.gob.mx Alejandro Raúl Hernández Montoya University of Veracruz, alhernandez@uv.mx Norma Bagatella Flores University of Veracruz, nbagatella@uv.mx Adrian Arturo Huerta Hernández University of Veracruz, adhuerta@uv.mx Manuel Enrique Rodríguez Achach University of Veracruz, manurodriguez@uv.mx Carlos Ernesto Vargas Madrazo University of Veracruz, cavargas@uv.mx Sol Haret Baez Barrios University of Veracruz, arbaez@uv.mx Héctor Francisco Coronel Brizio University of Veracruz, hcoronel@uv.mx Sergio Adrian Lerma Hernández University of Veracruz, slerma@uv.mx Rodrígo Huerta Quintanilla CINVESTAV U. Mérida, rhuerta@mda.cinvestav.mx

Studies on the precursors of strong mutagen [3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone]MX by chlorination of fractions from different waters.

PubMed

Xu, X; Liang, L; Zou, H; Liu, Y; Wang, L; Zhang, J

1997-10-01

The strong mutagen, [3-chloro-4-(dichloromethyl)-5-hydroxy- 2(5H)-furanone] MX, was found to be one of the most potent mutagens in drinking water. In this study, dissolved organic matters from river water and lake water were separated into several compound classes by sorbtion on a series of resin absorbents. After chlorine treatment of the fractions, MX was determined with GC/MS in the selected ion monitoring mode. Humic substances produced more MX on a TOC-basis than other fractions and contributed more to MX formation in the chlorinated natural waters. Some phenols were detected in the oxidation products of humic substances and therefore formation of MX may occur when some phenolic precursor structures in humic substances are treated with chlorine.

Chemical-controlled Activation of Antiviral Myxovirus Resistance Protein 1.

PubMed

Verhelst, Judith; Van Hoecke, Lien; Spitaels, Jan; De Vlieger, Dorien; Kolpe, Annasaheb; Saelens, Xavier

2017-02-10

The antiviral myxovirus resistance protein 1 (MX1) is an interferon-induced GTPase that plays an important role in the defense of mammalian cells against influenza A viruses. Mouse MX1 interacts with the influenza ribonucleoprotein complexes (vRNPs) and can prevent the interaction between polymerase basic 2 (PB2) and the nucleoprotein (NP) of influenza A viruses. However, it is unclear whether mouse MX1 disrupts the PB2-NP interaction in the context of pre-existing vRNPs or prevents the assembly of new vRNP components. Here, we describe a conditionally active mouse MX1 variant that only exerts antiviral activity in the presence of a small molecule drug. Once activated, this MX1 construct phenocopies the antiviral and NP binding activity of wild type MX1. The interaction between PB2 and NP is disrupted within minutes after the addition of the small molecule activator. These findings support a model in which mouse MX1 interacts with the incoming influenza A vRNPs and inhibits their activity by disrupting the PB2-NP interaction. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Chemical-controlled Activation of Antiviral Myxovirus Resistance Protein 1*

PubMed Central

Verhelst, Judith; Van Hoecke, Lien; Spitaels, Jan; De Vlieger, Dorien; Kolpe, Annasaheb

2017-01-01

The antiviral myxovirus resistance protein 1 (MX1) is an interferon-induced GTPase that plays an important role in the defense of mammalian cells against influenza A viruses. Mouse MX1 interacts with the influenza ribonucleoprotein complexes (vRNPs) and can prevent the interaction between polymerase basic 2 (PB2) and the nucleoprotein (NP) of influenza A viruses. However, it is unclear whether mouse MX1 disrupts the PB2-NP interaction in the context of pre-existing vRNPs or prevents the assembly of new vRNP components. Here, we describe a conditionally active mouse MX1 variant that only exerts antiviral activity in the presence of a small molecule drug. Once activated, this MX1 construct phenocopies the antiviral and NP binding activity of wild type MX1. The interaction between PB2 and NP is disrupted within minutes after the addition of the small molecule activator. These findings support a model in which mouse MX1 interacts with the incoming influenza A vRNPs and inhibits their activity by disrupting the PB2-NP interaction. PMID:28011636

Gene expression profile after activation of RIG-I in 5'ppp-dsRNA challenged DF1.

PubMed

Chen, Yang; Xu, Qi; Li, Yang; Liu, Ran; Huang, Zhengyang; Wang, Bin; Chen, Guohong

2016-12-01

Retinoic acid inducible gene I (RIG-I) can recognize influenza viruses and evoke the innate immune response. RIG-I is absent in the chicken genome, but is conserved in the genome of ducks. Lack of RIG-I renders chickens more susceptible to avian influenza infection, and the clinical symptoms are more prominent than in other poultry. It is unknown whether introduction of duck RIG-I into chicken cells can establish the immunity as is seen in ducks and the role of RIG-I in established immunity is unknown. In this study, a chicken cell strain with stable expression of duRIG-I was established by lentiviral infection, giving DF1/LV5-RIG-I, and a control strain DF1/LV5 was established in parallel. To verify stable, high level expression of duRIG-I in DF1 cells, the levels of duRIG-I mRNA and protein were determined by real-time RT-PCR and Western blot, respectively. Further, 5'triphosphate double stranded RNA (5'ppp-dsRNA) was used to mimic an RNA virus infection and the infected DF1/LV5-RIG-I and DF1/LV5 cells were subjected to high-throughput RNA-sequencing, which yielded 193.46 M reads and 39.07 G bases. A total of 278 differentially expressed genes (DEGs), i.e., duRIG-I-mediated responsive genes, were identified by RNA-seq. Among the 278 genes, 120 DEGs are annotated in the KEGG database, and the most reliable KEGG pathways are likely to be the signaling pathways of RIG-I like receptors. Functional analysis by Gene ontology (GO) indicates that the functions of these DEGs are primarily related to Type I interferon (IFN) signaling, IFN-β-mediated cellular responses and up-regulation of the RIG-I signaling pathway. Based on the shared genes among different pathways, a network representing crosstalk between RIG-I and other signaling pathways was constructed using Cytoscape software. The network suggests that RIG-mediated pathway may crosstalk with the Jak-STAT signaling pathway, Toll-like receptor signaling pathway, Wnt signaling pathway, ubiquitin-mediated proteolysis and MAPK signaling pathway during the transduction of antiviral signals. After screening, a group of key responsive genes in RIG-I-mediated signaling pathways, such as ISG12-2, Mx1, IFIT5, TRIM25, USP18, STAT1, STAT2, IRF1, IRF7 and IRF8, were tested for differential expression by real-time RT-PCR. In summary, by combining our results and the current literature, we propose a RIG-I-mediated signaling network in chickens. Copyright © 2016 Elsevier Ltd. All rights reserved.

Minoxidil (Mx) as a prophylaxis of doxorubicin--induced alopecia.

PubMed

Rodriguez, R; Machiavelli, M; Leone, B; Romero, A; Cuevas, M A; Langhi, M; Romero Acuña, L; Romero Acuña, J; Amato, S; Barbieri, M

1994-10-01

Minoxidil (Mx) is known to induce hair growth in men with male-pattern baldness. Based on this potential, the effectiveness of Mx 2% topical solution was evaluated in cancer patients (pts) to prevent doxorubicin-induced alopecia. 48 female pts with different types of solid tumors treated with doxorubicin-based chemotherapy in a dose range of 50-60 mg/m2/cycle were randomly assigned to receive Mx 2% topical solution or placebo. 88% and 92% of pts in both arms showed severe alopecia (p = ns). No adverse effects were observed. In this study Mx 2% topical solution was non-toxic but was not effective in the prevention of chemotherapy-induced alopecia.

Validity of the SC-StepMX pedometer during treadmill walking and running.

PubMed

Colley, Rachel C; Barnes, Joel D; Leblanc, Allana G; Borghese, Michael; Boyer, Charles; Tremblay, Mark S

2013-05-01

The purpose of this study was to examine the validity of the SC-StepMX pedometer for measuring step counts. A convenience sample of 40 participants wore 4 SC-StepMX pedometers, 2 Yamax DigiWalker pedometers, and 2 Actical accelerometers around their waist on a treadmill at 4 speeds based on each participant's self-paced walking speed (50%, 100%, 180%, and 250%; range: 1.4-14.1 km·h(-1)). The SC-StepMX demonstrated lower mean absolute percent error (-0.2%) compared with the Yamax DigiWalker (-20.5%) and the Actical (-26.1%). Mean measurement bias was lower for the SC-StepMX (0.1 ± 9.1; 95% confidence interval = -17.8 to 18.0 steps·min(-1)) when compared with both the Yamax DigiWalker (-15.9 ± 23.3; 95% confidence interval = -61.6 to 29.7 steps·min(-1)) and the Actical (-22.0 ± 36.3; 95% CI = -93.1 to 49.1 steps·min(-1)). This study demonstrates that the SC-StepMX pedometer is a valid tool for the measurement of step counts. The SC-StepMX accurately measures step counts at slower walking speeds when compared with 2 other commercially available activity monitors. This makes the SC-StepMX useful in measuring step counts in populations that are active at lower intensities (e.g., sedentary individuals, the elderly).

The Adenosine Receptor Antagonist, 7-Methylxanthine, Alters Emmetropizing Responses in Infant Macaques

PubMed Central

Hung, Li-Fang; Arumugam, Baskar; Ostrin, Lisa; Patel, Nimesh; Trier, Klaus; Jong, Monica; III, Earl L. Smith

2018-01-01

Purpose Previous studies suggest that the adenosine receptor antagonist, 7-methylxanthine (7-MX), retards myopia progression. Our aim was to determine whether 7-MX alters the compensating refractive changes produced by defocus in rhesus monkeys. Methods Starting at age 3 weeks, monkeys were reared with −3 diopter (D; n = 10; 7-MX −3D/pl) or +3D (n = 6; 7-MX +3D/pl) spectacles over their treated eyes and zero-powered lenses over their fellow eyes. In addition, they were given 100 mg/kg of 7-MX orally twice daily throughout the lens-rearing period (age 147 ± 4 days). Comparison data were obtained from lens-reared controls (−3D/pl, n = 17; +3D/pl, n = 9) and normal monkeys (n = 37) maintained on a standard diet. Refractive status, corneal power, and axial dimensions were assessed biweekly. Results The −3D/pl and +3D/pl lens-reared controls developed compensating myopic (−2.10 ± 1.07 D) and hyperopic anisometropias (+1.86 ± 0.54 D), respectively. While the 7-MX +3D/pl monkeys developed hyperopic anisometropias (+1.79 ± 1.11 D) that were similar to those observed in +3D/pl controls, the 7-MX −3D/pl animals did not consistently exhibit compensating myopia in their treated eyes and were on average isometropic (+0.35 ± 1.96 D). The median refractive errors for both eyes of the 7-MX −3D/pl (+5.47 D and +4.38 D) and 7-MX +3D/pl (+5.28 and +3.84 D) monkeys were significantly more hyperopic than that for normal monkeys (+2.47 D). These 7-MX–induced hyperopic ametropias were associated with shorter vitreous chambers and thicker choroids. Conclusions In primates, 7-MX reduced the axial myopia produced by hyperopic defocus, augmented hyperopic shifts in response to myopic defocus, and induced hyperopia in control eyes. The results suggest that 7-MX has therapeutic potential in efforts to slow myopia progression. PMID:29368006

MX-INDUCED URINARY BLADDER EPITHELIAL HYPERPLASIA IN EKER RATS

EPA Science Inventory

MX-INDUCED URINARY BLADDER EPITHELIAL HYPERPLASIA IN EKER RATS

Epidemiological studies have shown a positive association between chronic exposure to chlorinated drinking water and human cancer, particularly of the urinary bladder. MX (3- chloro-4-(dichloromethyl)-5-hydrox...

Increased ethanol accumulation from glucose via reduction of ATP level in a recombinant strain of Saccharomyces cerevisiae overexpressing alkaline phosphatase.

PubMed

Semkiv, Marta V; Dmytruk, Kostyantyn V; Abbas, Charles A; Sibirny, Andriy A

2014-05-15

The production of ethyl alcohol by fermentation represents the largest scale application of Saccharomyces cerevisiae in industrial biotechnology. Increased worldwide demand for fuel bioethanol is anticipated over the next decade and will exceed 200 billion liters from further expansions. Our working hypothesis was that the drop in ATP level in S. cerevisiae cells during alcoholic fermentation should lead to an increase in ethanol production (yield and productivity) with a greater amount of the utilized glucose converted to ethanol. Our approach to achieve this goal is to decrease the intracellular ATP level via increasing the unspecific alkaline phosphatase activity. Intact and truncated versions of the S. cerevisiae PHO8 gene coding for vacuolar or cytosolic forms of alkaline phosphatase were fused with the alcohol dehydrogenase gene (ADH1) promoter. The constructed expression cassettes used for transformation vectors also contained the dominant selective marker kanMX4 and S. cerevisiae δ-sequence to facilitate multicopy integration to the genome. Laboratory and industrial ethanol producing strains BY4742 and AS400 overexpressing vacuolar form of alkaline phosphatase were characterized by a slightly lowered intracellular ATP level and biomass accumulation and by an increase in ethanol productivity (13% and 7%) when compared to the parental strains. The strains expressing truncated cytosolic form of alkaline phosphatase showed a prolonged lag-phase, reduced biomass accumulation and a strong defect in ethanol production. Overexpression of vacuolar alkaline phosphatase leads to an increased ethanol yield in S. cerevisiae.

Planning and Implementation of Remote Sensing Experiments.

DTIC Science & Technology

Contents: TEKTITE II experiment-upwelling detection (NASA Mx 138); Design of oceanographic experiments (Gulf of Mexico, Mx 159); Design of oceanographic experiments (Gulf of Mexico, Mx 165); Experiments on thermal pollution; Remote sensing newsletter; Symposium on remote sensing in marine biology and fishery resources.

Stability and Control. Volume 2. Stability and Control Flight Test Theory

DTIC Science & Technology

1974-07-01

e we have 2 mx , . mx , mx n am e + bme + ce = 0 or (am2 + bm + c)emx = 0 (1.21) mx , n Since e ? 0...1.97) (1.98) Substituting 2 mt , , mt , mt n am e + bme + ce =0 (1.99) and emt (am2 + bm + c) =0 (1.100) led us to assert that 1.98 would...derive Laplace transforms each time we use them. Extensive tables of transforms exist in most advanced mathe- matics and control system textbooks . We

MX Survivability: Passive and Active Defense.

DTIC Science & Technology

1982-03-01

coefficient of determination (K2) and model parameters (i.e., bo, b1 , b2 , and b3 ) significantly different from zero: MX Survivability = 0 + b1X1...following equation was chosen as the best fit for the data: MX Survivability - b° + blX1 , - 0.881 where F-Ratio b = .2884 49.26 b1 - .02695 112.46 X1...that all of the model parameters estimated (i.e., b and b1 ) are significantly different from zero. Substituting 60% MX survivability into this equation

Operational manual for MX-290 data-voice PN Mod, MX-291 data-voice PN DEMOD

NASA Technical Reports Server (NTRS)

1971-01-01

This operation manual is also the final report of the program to design, assemble, checkout, and deliver to the customer three MX-290 transmitters and two MX-291 companion receivers. These equipments are designed and assembled to provide for maximum flexibility with respect to making changes in electrical circuits which may be required for future applications. A number of test points for monitoring and troubleshooting are provided along with easy access to subunits.

Oncologic safety of breast conserving surgery after tumour downsizing by neoadjuvant therapy: a retrospective single centre cohort study.

PubMed

Fitzal, F; Riedl, O; Mittlböck, M; Dubsky, P; Bartsch, R; Steger, G; Jakesz, R; Gnant, M

2011-05-01

The objective of this study is to analyse local recurrence rates in patients receiving neoadjuvant chemotherapy (nCT) comparing mastecomized (MX) patients with those undergoing breast conserving therapy (BCT). Patients undergoing breast cancer surgery after nCT (3xCMF or 3-6xED) between 1995 and 2007 at our department were retrospectively analysed. The median follow up was 60 months for 308 patients. Patients who were downsized from MX to BCT with partial or complete response (n = 104) had a similar local recurrence free survival (LRFS) compared to patients who did not experience successful downsizing (n = 67) and finally undergoing MX (LRFS MX-BCT 81% vs. MX-MX 91%; P = 0.79). Uni- and multivariate analyses demonstrated that BCT itself was not an independent prognostic factor for a worse LRFS (P = 0.07 and 0.14). After no pathologic change or progressive disease the risk of local recurrence was increased in patients undergoing BCT (MX-BCT; n = 6 LRFS 66%) compared with MX (n = 44; LRFS 90%; P = 0.04). Overall survival in general was better for the BCT group (n = 197) compared with MX group (n = 111) regardless of clinical response (92% vs. 72%; P < 0.0001). Breast conservation, nodal negativity and low or medium grade histology were prognostic factors for an improved OS (P = 0.02, 0.01, 0.004). In conclusion, our study suggests that BCT is oncologically safe after tumour downsizing by nCT in patients primarily scheduled for mastectomy. These patients, however, should not be treated with breast conservation in the absence of any proven response after nCT.

A dynamic Shh expression pattern, regulated by SHH and BMP signaling, coordinates fusion of primordia in the amniote face

PubMed Central

Hu, Diane; Young, Nathan M.; Li, Xin; Xu, Yanhua; Hallgrímsson, Benedikt; Marcucio, Ralph S.

2015-01-01

The mechanisms of morphogenesis are not well understood, yet shaping structures during development is essential for establishing correct organismal form and function. Here, we examine mechanisms that help to shape the developing face during the crucial period of facial primordia fusion. This period of development is a time when the faces of amniote embryos exhibit the greatest degree of similarity, and it probably results from the necessity for fusion to occur to establish the primary palate. Our results show that hierarchical induction mechanisms, consisting of iterative signaling by Sonic hedgehog (SHH) followed by Bone morphogenetic proteins (BMPs), regulate a dynamic expression pattern of Shh in the ectoderm covering the frontonasal (FNP) and maxillary (MxP) processes. Furthermore, this Shh expression domain contributes to the morphogenetic processes that drive the directional growth of the globular process of the FNP toward the lateral nasal process and MxP, in part by regulating cell proliferation in the facial mesenchyme. The nature of the induction mechanism that we discovered suggests that the process of fusion of the facial primordia is intrinsically buffered against producing maladaptive morphologies, such as clefts of the primary palate, because there appears to be little opportunity for variation to occur during expansion of the Shh expression domain in the ectoderm of the facial primordia. Ultimately, these results might explain why this period of development constitutes a phylotypic stage of facial development among amniotes. PMID:25605783

Visualization of Client-Side Web Browsing and Email Activity

DTIC Science & Technology

2009-06-01

mantenimiento the amazing race dustin & candice oskar schindler mythbusters femjoy 080814-kathi in peace anna_ac_-_elixia miley cyrus mapa linea 12 metro... mantenimiento www.google.com.mx alcohol isopropilico www.google.com.mx descargas rapidshare corta final firefox www.google.com.mx desactivar

Neutralizing Antibodies against IFN-[Beta] in Multiple Sclerosis: Antagonization of IFN-[Beta] Mediated Suppression of MMPs

ERIC Educational Resources Information Center

Gilli, Francesca; Bertolotto, Antonio; Sala, Arianna; Hoffmann, Francine; Capobianco, Marco; Malucchi, Simona; Glass, Tracy; Kappos, Ludwig; Lindberg, Raija L. P.; Leppert, David

2004-01-01

Neutralizing antibodies (NAb) against interferon-[Beta] (IFN-Beta) develop in about a third of treated multiple sclerosis patients and are believed to reduce therapeutic efficacy of IFN-[Beta] on clinical and MRI measures. The expression of the interferon acute-response protein, myxovirus resistance protein A (MxA) is a sensitive measure of the…

Molecular cloning and characterization of interferon regulatory factor 7 (IRF-7) in Japanese flounder, Paralichthys olivaceus.

PubMed

Hu, Guobin; Yin, Xiangyan; Xia, Jun; Dong, Xianzhi; Zhang, Jianyie; Liu, Qiuming

2010-12-01

Interferon regulatory factor (IRF) 7 in mammals is known to be a key player in regulating the type I interferon (IFN) response to viral infection as a transcription activator of IFNs and IFN-stimulated genes (ISGs). In this study, a full-length cDNA of Japanese flounder, Paralichthys olivaceus, (Po)IRF-7 was cloned and characterized. PoIRF-7 is 2032 bp in length, with an open reading frame (ORF) of 1293 bp that encodes 430 amino acid residues. The putative amino acid sequence shows the highest homology to fish IRF-7 with 51.5-76.3% identity and possesses a DNA-binding domain (DBD), an IRF association domain (IAD) and a serine-rich domain of vertebrate IRF-7. In addition, the tryptophan cluster of PoIRF-7 DBD consists of only four tryptophans, which is a characteristic unique to all fish IRF-7 members. The PoIRF-7 was expressed constitutively in all tested tissues of healthy flounders, with high levels in head kidney, spleen, gill, intestine and skin, and moderately expressed in FG9307 cells, a flounder gill epithelial cell line. Using a luciferase assay, PoIRF-7 was proved to be capable of activating fish type I IFN promoter in FG9307 cells. A quantitative real time PCR assay was employed to monitor the gene expression of PoIRF-7 and Mx in FG9307 cells and flounder head kidney and gill. Both genes were up-regulated by polyinosinic:polycytidylic acid (poly I:C) and lymphocystis disease virus (LCDV) though to a much lesser extent in FG9307 cells. Further, their transcription kinetics were similar in fish organs but different in FG9307 cells. These data provide insights into the functions of PoIRF-7 and imply a difference in PoIRF-7-related signaling pathways in antiviral response between cultured cells and live fish. Copyright © 2010 Elsevier Ltd. All rights reserved.

Interferon lambda inhibits dengue virus replication in epithelial cells.

PubMed

Palma-Ocampo, Helen K; Flores-Alonso, Juan C; Vallejo-Ruiz, Verónica; Reyes-Leyva, Julio; Flores-Mendoza, Lilian; Herrera-Camacho, Irma; Rosas-Murrieta, Nora H; Santos-López, Gerardo

2015-09-28

In viral disease, infection is controlled at the cellular level by type I interferon (IFN-I), but dengue virus (DENV) has the ability to inhibit this response. Type III interferon, also known as lambda IFN (IFN-III or IFN-λ), is a complementary pathway to the antiviral response by IFN-I. This work analyzed the IFN-λ (IFN-III) mediated antiviral response against DENV serotype 2 (DENV-2) infection. Dengue fever patients were sampled to determine their IFN-λ levels by ELISA. To study the IFN-λ response during DENV infection we selected the epithelial cell line C33-A, and we demonstrated that it is permissive to DENV-2 infection. The effect of IFN-λ on virus replication was determined in these cells, in parallel to the expression of IFN-stimulated genes (ISGs), and Suppressor of Cytokine Signaling (SOCS), genes measured by RT-qPCR. We found increased (~1.8 times) serological IFN-λ in dengue fever patients compared to healthy blood donors. IFN-λ inhibited DENV-2 replication in a dose-dependent manner in vitro. The reduction of viral titer corresponded with increased ISG mRNA levels (MX1 and OAS1), with the highest inhibition occurring at ISG's peak expression. Presence of IFN-negative regulators, SOCS1 and SOCS3, during DENV-2 infection was associated with reduced IFN-λ1 expression. Evidence described here suggests that IFN-λ is a good candidate inhibitor of viral replication in dengue infection. Mechanisms for the cellular and organismal interplay between DENV and IFN- λ need to be further studied as they could provide insights into strategies to treat this disease. Furthermore, we report a novel epithelial model to study dengue infection in vitro.

Control of Meloidogyne incognita Using Mixtures of Organic Acids

PubMed Central

Seo, Yunhee; Kim, Young Ho

2014-01-01

This study sought to control the root-knot nematode (RKN) Meloidogyne incognita using benign organo-chemicals. Second-stage juveniles (J2) of RKN were exposed to dilutions (1.0%, 0.5%, 0.2%, and 0.1%) of acetic acid (AA), lactic acid (LA), and their mixtures (MX). The nematode bodies were disrupted severely and moderately by vacuolations in 0.5% of MX and single organic acids, respectively, suggesting toxicity of MX may be higher than AA and LA. The mortality of J2 was 100% at all concentrations of AA and MX and only at 1.0% and 0.5% of LA, which lowered slightly at 0.2% and greatly at 0.1% of LA. This suggests the nematicidal activity of MX may be mostly derived from AA together with supplementary LA toxicity. MX was applied to chili pepper plants inoculated with about 1,000 J2, for which root-knot gall formations and plant growths were examined 4 weeks after inoculation. The root gall formation was completely inhibited by 0.5% MX and standard and double concentrations of fosthiazate; and inhibited 92.9% and 57.1% by 0.2% and 0.1% MX, respectively. Shoot height, shoot weight, and root weight were not significantly (P ≤ 0.05) different among all treatments and the untreated and non-inoculated controls. All of these results suggest that the mixture of the organic acids may have a potential to be developed as an eco-friendly nematode control agent that needs to be supported by the more nematode control experiments in fields. PMID:25506312

Studies on the potent bacterial mutagen, 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone: aqueous stability, XAD recovery and analytical determination in drinking water and in chlorinated humic acid solutions.

PubMed

Meier, J R; Knohl, R B; Coleman, W E; Ringhand, H P; Munch, J W; Kaylor, W H; Streicher, R P; Kopfler, F C

1987-12-01

3-Chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX) was detected by gas chromatography/mass spectrometry in drinking water samples from 3 locations in the U.S.A., and also in a chlorinated humic acid solution. MX appears to account for a significant proportion of the mutagenicity of these samples, as measured in the Ames test using strain TA100 without metabolic activation. Studies on recovery of MX from spiked water samples by XAD-2/8 resin adsorption/acetone elution indicated that sample acidification prior to resin adsorption was essential to the effective recovery of MX. The stability of MX in aqueous solution was pH and temperature dependent. At 23 degrees C the order of stability, based on persistence of mutagenic activity was found to be: pH 2 greater than pH 4 greater than pH 8 greater than pH 6. The half-life at pH 8 and 23 degrees C was 4.6 days. One of the degradation products has been tentatively identified as 2-chloro-3-(dichloromethyl)-4-oxo-2-butenoic acid, an open form of MX which appears to be in the "E" configuration. Overall, these results suggest that MX is formed during water chlorination as a result of reaction of chlorine with humic substances, and that a substantial fraction of the MX formed is likely to persist throughout the distribution system.

Fast releasing oral electrospun PVP/CD nanofiber mats of taste-masked meloxicam.

PubMed

Samprasit, Wipada; Akkaramongkolporn, Prasert; Ngawhirunpat, Tanasait; Rojanarata, Theerasak; Kaomongkolgit, Ruchadaporn; Opanasopit, Praneet

2015-06-20

Fast release and taste masking of meloxicam (MX)-loaded polyvinylpyrrolidone (PVP)/cyclodextrin (CD) nanofiber mats were developed using an electrospinning process. CDs were blended to improve the stability of the mats. The morphology and diameter of the mats were determined using scanning electron microscopy (SEM); physical and mechanical properties were also studied. The MX content, disintegration time, MX release and cytotoxicity of the mats were investigated. In vivo studies were also performed in healthy human volunteers. The results indicated that the mats were successfully prepared with fiber in the nanometer range. MX was well incorporated into the mats, with an amorphous form. The mats showed suitable tensile strength. CDs improved the physical stability by their cage-like supramolecular structure to protect from humidity and moisture, and create bead free nanofiber mats. The nanofiber mats with CDs were physically stable without any hygroscopicity and fusion. A fast disintegration and release of MX was achieved. Moreover, this mat released MX faster than the MX powder and commercial tablets. The cytotoxicity test revealed that mats were safe for a 5-min incubation. The disintegration studies indicated that in vivo disintegration agreed with the in vitro studies; the mat rapidly disintegrated in the mouth. The less bitter of MX was occurred in the mats that incorporated CD, menthol and aspartame. In addition, this mat was physical stable for 6 months. The results suggest that these mats may be a good candidate for fast dissolving drug delivery systems of bitter drugs to increase the palatability of dosage forms. Copyright © 2015 Elsevier B.V. All rights reserved.

Human but Not Mouse Hepatocytes Respond to Interferon-Lambda In Vivo

PubMed Central

Hermant, Pascale; Demarez, Céline; Mahlakõiv, Tanel; Staeheli, Peter; Meuleman, Philip; Michiels, Thomas

2014-01-01

The type III interferon (IFN) receptor is preferentially expressed by epithelial cells. It is made of two subunits: IFNLR1, which is specific to IFN-lambda (IFN-λ) and IL10RB, which is shared by other cytokine receptors. Human hepatocytes express IFNLR1 and respond to IFN-λ. In contrast, the IFN-λ response of the mouse liver is very weak and IFNLR1 expression is hardly detectable in this organ. Here we investigated the IFN-λ response at the cellular level in the mouse liver and we tested whether human and mouse hepatocytes truly differ in responsiveness to IFN-λ. When monitoring expression of the IFN-responsive Mx genes by immunohistofluorescence, we observed that the IFN-λ response in mouse livers was restricted to cholangiocytes, which form the bile ducts, and that mouse hepatocytes were indeed not responsive to IFN-λ. The lack of mouse hepatocyte response to IFN-λ was observed in different experimental settings, including the infection with a hepatotropic strain of influenza A virus which triggered a strong local production of IFN-λ. With the help of chimeric mice containing transplanted human hepatocytes, we show that hepatocytes of human origin readily responded to IFN-λ in a murine environment. Thus, our data suggest that human but not mouse hepatocytes are responsive to IFN-λ in vivo. The non-responsiveness is an intrinsic property of mouse hepatocytes and is not due to the mouse liver micro-environment. PMID:24498220

p-Nitrophenol and glutathione response in medaka (Oryzias latipes)exposed to MX, a drinking water carcinogen

EPA Science Inventory

When chlorine is introduced into public drinking water for disinfection, it can react with organic compounds in surface waters to form toxic by-products such as 3-chloro-4-(dichloromethyl)-5-hydroxy-2[5H]-furanone (MX). We investigated the effect of exposure to MX on cytochrome ...

P-NITROPHENOL AND GLUTATHIONE RESPONSE IN MEDAKA (ORYZIAS LATIPES) EXPOSED TO MX, A DRINKING WATER CARCINOGEN.

EPA Science Inventory

When chlorine is introduced into public drinking water for disinfection, it can react with organic compounds in surface waters to form toxic by-products such as 3-chloro-4- (dichloromethyl)-5-hydroxy-2[5H]-furanone (MX). We investigated the effect of exposure to MX on cytochr...

Pre-hatching embryo-dependent and -independent programming of endometrial function in cattle

PubMed Central

Sponchiado, Mariana; Gomes, Nathália Souza; Fontes, Patrícia Kubo; Martins, Thiago; del Collado, Maite; Pastore, Athos de Assumpção; Pugliesi, Guilherme; Nogueira, Marcelo Fábio Gouveia

2017-01-01

The bovine pre-implantation embryo secretes bioactive molecules from early development stages, but effects on endometrial function are reported to start only after elongation. Here, we interrogated spatially defined regions of the endometrium transcriptome for responses to a day 7 embryo in vivo. We hypothesize that exposure to an embryo changes the abundance of specific transcripts in the cranial region of the pregnant uterine horn. Endometrium was collected from the uterotubal junction (UTJ), anterior (IA), medial (IM) and posterior (IP) regions of the uterine horn ipsilateral to the CL 7 days after estrus from sham-inseminated (Con) or artificially inseminated, confirmed pregnant (Preg) cows. Abundance of 86 transcripts was evaluated by qPCR using a microfluidic platform. Abundance of 12 transcripts was modulated in the Preg endometrium, including classical interferon-stimulated genes (ISG15, MX1, MX2 and OAS1Y), prostaglandin biosynthesis genes (PTGES, HPGD and AKR1C4), water channel (AQP4) and a solute transporter (SLC1A4) and this was in the UTJ and IA mainly. Additionally, for 71 transcripts, abundance varied according to region of the reproductive tract. Regulation included downregulation of genes associated with proliferation (IGF1, IGF2, IGF1R and IGF2R) and extracellular matrix remodeling (MMP14, MMP19 and MMP2) and upregulation of anti-adhesive genes (MUC1) in the cranial regions of uterine horn. Physical proximity to the embryo provides paracrine regulation of endometrial function. Embryo-independent regulation of the endometrial transcriptome may support subsequent stages of embryo development, such as elongation and implantation. We speculate that successful early embryo-dependent and -independent programming fine-tune endometrial functions that are important for maintenance of pregnancy in cattle. PMID:28423001

Expression of a dominant allele of human ARF1 inhibits membrane traffic in vivo

PubMed Central

1994-01-01

ADP-ribosylation factor (ARF) proteins and inhibitory peptides derived from ARFs have demonstrated activities in a number of in vitro assays that measure ER-to-Golgi and intra-Golgi transport and endosome fusion. To better understand the roles of ARF proteins in vivo, stable cell lines were obtained from normal rat kidney (NRK) cells transfected with either wild-type or a dominant activating allele ([Q71L]) of the human ARF1 gene under the control of the interferon-inducible mouse Mx1 promoter. Upon addition of interferon, expression of ARF1 proteins increased with a half-time of 7-8 h, as determined by immunoblot analysis. Induction of mutant ARF1, but not wild-type ARF1, led to an inhibition of protein secretion with kinetics similar to that observed for induction of protein expression. Examination of the Golgi apparatus and the ER by indirect immunofluorescence or transmission electron microscopy revealed that expression of low levels of mutant ARF1 protein correlated with a dramatic increase in vesiculation of the Golgi apparatus and expansion of the ER lumen, while expression of substantially higher levels of wild-type ARF1 had no discernible effect. Endocytosis was also inhibited by expression of mutant ARF1, but not by the wild-type protein. Finally, the expression of [Q71L]ARF1, but not wild-type ARF1, antagonized the actions of brefeldin A, as determined by the delayed loss of ARF and beta-COP from Golgi membranes and disruption of the Golgi apparatus. General models for the actions of ARF1 in membrane traffic events are discussed. PMID:8294513

Transcriptome analysis of rainbow trout infected with high and low virulence strains of Infectious hematopoietic necrosis virus

USGS Publications Warehouse

Purcell, Maureen K.; Marjara, Inderjit Singh; Batts, William; Kurath, Gael; Hansen, John D.

2010-01-01

There are three main genetic lineages or genogroups of Infectious hematopoietic necrosis virus (IHNV) in N. America. Strains representing the M genogroup are more virulent in rainbow trout relative to the U genogroup. In this study, we used microarray analysis to evaluate potential mechanisms responsible for host-specific virulence in rainbow trout that were given intraperitoneal injections of buffer or a representative M or U type virus strain. Reverse transcriptase quantitative PCR (RT-qPCR) was used to assess viral load and gene expression of select immune genes. Viral load was significantly higher in trout infected with the M virus starting at 24 h post-infection (p.i.) and continuing until 72 h p.i. Microarray analysis of the 48 h time point revealed 153 up-regulated and 248 down-regulated features in response to M virus infection but only 62 up-regulated and 49 down-regulated features following U virus infection. Translation and transcription features were among the most frequent down-regulated features in response to M virus infection and may be associated with the host cell shutoff phenomenon. A greater host cell shutoff response by the M virus may facilitate subversion of the host cell transcriptional machinery and enhance viral replication, suggesting the M virus may be better optimized to manipulate the rainbow trout transcriptional and translational machinery. Anti-viral associated features were the most commonly up-regulated features. A common set of features were up-regulated in both the M and U infection groups, but were induced to a higher magnitude in the M infection group. Gene expression of the anti-viral genes Mx-1 and Vig-1 was correlated but not entirely dependent on viral load in the anterior kidney. Slower replication of the U virus may allow the host more time to induce protective anti-viral immune mechanisms.

Influenza A viruses escape from MxA restriction at the expense of efficient nuclear vRNP import.

PubMed

Götz, Veronika; Magar, Linda; Dornfeld, Dominik; Giese, Sebastian; Pohlmann, Anne; Höper, Dirk; Kong, Byung-Whi; Jans, David A; Beer, Martin; Haller, Otto; Schwemmle, Martin

2016-03-18

To establish a new lineage in the human population, avian influenza A viruses (AIV) must overcome the intracellular restriction factor MxA. Partial escape from MxA restriction can be achieved when the viral nucleoprotein (NP) acquires the critical human-adaptive amino acid residues 100I/V, 283P, and 313Y. Here, we show that introduction of these three residues into the NP of an avian H5N1 virus renders it genetically unstable, resulting in viruses harboring additional single mutations, including G16D. These substitutions restored genetic stability yet again yielded viruses with varying degrees of attenuation in mammalian and avian cells. Additionally, most of the mutant viruses lost the capacity to escape MxA restriction, with the exception of the G16D virus. We show that MxA escape is linked to attenuation by demonstrating that the three substitutions promoting MxA escape disturbed intracellular trafficking of incoming viral ribonucleoprotein complexes (vRNPs), thereby resulting in impaired nuclear import, and that the additional acquired mutations only partially compensate for this import block. We conclude that for adaptation to the human host, AIV must not only overcome MxA restriction but also an associated block in nuclear vRNP import. This inherent difficulty may partially explain the frequent failure of AIV to become pandemic.

Pigeon RIG-I Function in Innate Immunity against H9N2 IAV and IBDV.

PubMed

Xu, Wenping; Shao, Qiang; Zang, Yunlong; Guo, Qiang; Zhang, Yongchao; Li, Zandong

2015-07-22

Retinoic acid-inducible gene I (RIG-I), a cytosolic pattern recognition receptor (PRR), can sense various RNA viruses, including the avian influenza virus (AIV) and infectious bursal disease virus (IBDV), and trigger the innate immune response. Previous studies have shown that mammalian RIG-I (human and mice) and waterfowl RIG-I (ducks and geese) are essential for type I interferon (IFN) synthesis during AIV infection. Like ducks, pigeons are also susceptible to infection but are ineffective propagators and disseminators of AIVs, i.e., "dead end" hosts for AIVs and even highly pathogenic avian influenza (HPAI). Consequently, we sought to identify pigeon RIG-I and investigate its roles in the detection of A/Chicken/Shandong/ZB/2007 (H9N2) (ZB07), Gansu/Tianshui (IBDV TS) and Beijing/CJ/1980 (IBDV CJ-801) strains in chicken DF-1 fibroblasts or human 293T cells. Pigeon mRNA encoding the putative pigeon RIG-I analogs was identified. The exogenous expression of enhanced green fluorescence protein (EGFP)-tagged pigeon RIG-I and caspase activation and recruitment domains (CARDs), strongly induced antiviral gene (IFN-β, Mx, and PKR) mRNA synthesis, decreased viral gene (M gene and VP2) mRNA expression, and reduced the viral titers of ZB07 and IBDV TS/CJ-801 virus strains in chicken DF-1 cells, but not in 293T cells. We also compared the antiviral abilities of RIG-I proteins from waterfowl (duck and goose) and pigeon. Our data indicated that waterfowl RIG-I are more effective in the induction of antiviral genes and the repression of ZB07 and IBDV TS/CJ-801 strain replication than pigeon RIG-I. Furthermore, chicken melanoma differentiation associated gene 5(MDA5)/ mitochondrial antiviral signaling (MAVS) silencing combined with RIG-I transfection suggested that pigeon RIG-I can restore the antiviral response in MDA5-silenced DF-1 cells but not in MAVS-silenced DF-1 cells. In conclusion, these results demonstrated that pigeon RIG-I and CARDs have a strong antiviral ability against AIV H9N2 and IBDV in chicken DF-1 cells but not in human 293T cells.

Type I Interferon Responses by HIV-1 Infection: Association with Disease Progression and Control.

PubMed

Soper, Andrew; Kimura, Izumi; Nagaoka, Shumpei; Konno, Yoriyuki; Yamamoto, Keisuke; Koyanagi, Yoshio; Sato, Kei

2017-01-01

Human immunodeficiency virus type 1 (HIV-1) is the causative agent of acquired immunodeficiency syndrome and its infection leads to the onset of several disorders such as the depletion of peripheral CD4 + T cells and immune activation. HIV-1 is recognized by innate immune sensors that then trigger the production of type I interferons (IFN-Is). IFN-Is are well-known cytokines eliciting broad anti-viral effects by inducing the expression of anti-viral genes called interferon-stimulated genes (ISGs). Extensive in vitro studies using cell culture systems have elucidated that certain ISGs such as APOBEC3G, tetherin, SAM domain and HD domain-containing protein 1, MX dynamin-like GTPase 2, guanylate-binding protein 5, and schlafen 11 exert robust anti-HIV-1 activity, suggesting that IFN-I responses triggered by HIV-1 infection are detrimental for viral replication and spread. However, recent studies using animal models have demonstrated that at both the acute and chronic phase of infection, the role of IFN-Is produced by HIV or SIV infection in viral replication, spread, and pathogenesis, may not be that straightforward. In this review, we describe the pluses and minuses of HIV-1 infection stimulated IFN-I responses on viral replication and pathogenesis, and further discuss the possibility for therapeutic approaches.

An Indo-Pacific damselfish (Neopomacentrus cyanomos) in the Gulf of Mexico: origin and mode of introduction.

PubMed

Robertson, D Ross; Dominguez-Dominguez, Omar; Victor, Benjamin; Simoes, Nuno

2018-01-01

The Indo-West Pacific (IWP) coral-reef damselfish Neopomacentrus cyanomos is well established across the south-west Gulf of Mexico (SwGoMx). Comparisons of mtDNA sequences of the SwGoMx population with those from conspecifics from 16 sites scattered across its native geographic range show that the SwGoMx population is derived from two of four native lineages: one from the north-west Pacific Ocean, the other from the northern Indian Ocean. Three hypotheses address how this species was introduced to the SwGoMX: (1) aquarium release; (2) borne by cargo-ship; and (3) carried by offshore petroleum platform (petro-platform). The first is unlikely because this species rarely features in the aquarium trade, and " N. cyanomos " traded to the USA from the sole IWP source we are aware of are a misidentified congener, N. taeniurus . The second hypothesis is unlikely because shipping has not been associated with the introduction of alien damselfishes, there is little international shipping between the IWP and the SwGoMx, and voyages between those areas would be lengthy and along environmentally unfavorable routes. Various lines of evidence support the third hypothesis: (i) bio-fouled petro-platforms represent artificial reefs that can sustain large and diverse populations of tropical reef-fishes, including N. cyanomos in the SwGoMx; (ii) relocation of such platforms has been implicated in trans-oceanic introductions leading to establishment of non-native populations of such fishes; and (iii) genetic characteristics of the SwGoMx population indicate that it was established by a large and diverse group of founders drawn from the IWP regions where many petro-platforms currently in the SwGoMx and other Atlantic offshore oilfields originated.

An Indo-Pacific damselfish (Neopomacentrus cyanomos) in the Gulf of Mexico: origin and mode of introduction

PubMed Central

Dominguez-Dominguez, Omar; Victor, Benjamin; Simoes, Nuno

2018-01-01

The Indo-West Pacific (IWP) coral-reef damselfish Neopomacentrus cyanomos is well established across the south-west Gulf of Mexico (SwGoMx). Comparisons of mtDNA sequences of the SwGoMx population with those from conspecifics from 16 sites scattered across its native geographic range show that the SwGoMx population is derived from two of four native lineages: one from the north-west Pacific Ocean, the other from the northern Indian Ocean. Three hypotheses address how this species was introduced to the SwGoMX: (1) aquarium release; (2) borne by cargo-ship; and (3) carried by offshore petroleum platform (petro-platform). The first is unlikely because this species rarely features in the aquarium trade, and “N. cyanomos” traded to the USA from the sole IWP source we are aware of are a misidentified congener, N. taeniurus. The second hypothesis is unlikely because shipping has not been associated with the introduction of alien damselfishes, there is little international shipping between the IWP and the SwGoMx, and voyages between those areas would be lengthy and along environmentally unfavorable routes. Various lines of evidence support the third hypothesis: (i) bio-fouled petro-platforms represent artificial reefs that can sustain large and diverse populations of tropical reef-fishes, including N. cyanomos in the SwGoMx; (ii) relocation of such platforms has been implicated in trans-oceanic introductions leading to establishment of non-native populations of such fishes; and (iii) genetic characteristics of the SwGoMx population indicate that it was established by a large and diverse group of founders drawn from the IWP regions where many petro-platforms currently in the SwGoMx and other Atlantic offshore oilfields originated. PMID:29441235

Analysis of 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX) and its brominated analogues in chlorine-treated water by gas chromatography coupled to triple quadrupole tandem mass spectrometry (GC-QqQ-MS/MS).

PubMed

Planas, Carles; Ventura, Francesc; Caixach, Josep; Martín, Jordi; Boleda, M Rosa; Paraira, Miquel

2015-11-01

A simple, selective and sensitive method for the analysis of the strong mutagen 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX) and its brominated analogues (BMXs) in chlorine-treated water has been developed. The method is based on gas chromatography coupled to triple quadrupole tandem mass spectrometry (GC-QqQ-MS/MS), previous liquid-liquid extraction (LLE) of a smaller sample volume compared to other methods and on-line derivatization with a silylation reactive. GC-QqQ-MS/MS has been raised as an alternative easier to perform than gas chromatography coupled to high resolution mass spectrometry (GC-HRMS) for the analysis of MX and BMXs, and it allows to achieve low LODs (0.3 ng/L for MX and 0.4-0.9 ng/L for BMXs). This technique had not been previously described for the analysis of MX and BMXs. Quality parameters were calculated and real samples related to 3 drinking water treatment plants (DWTPs), tap water and both untreated and chlorinated groundwater were analyzed. Concentrations of 0.3-6.6 ng/L for MX and 1.0-7.3 ng/L for BMXs were detected. Results were discussed according to five of the main factors affecting MX and BMXs formation in chlorine-treated water (organic precursors, influence of bromide ions, evolution of MX and BMXs in the drinking water distribution system, groundwater chlorination and infiltration of water coming from chlorination processes in groundwater). Copyright © 2015 Elsevier B.V. All rights reserved.

Compressive strain induced dynamical stability of monolayer 1T-MX2 (M  =  Mo, W; X  =  S, Se)

NASA Astrophysics Data System (ADS)

Li, Xiaoyong; Wu, Musheng; Xu, Bo; Liu, Ruifan; Ouyang, Chuying

2017-11-01

The lattice dynamical properties of 1T-MX2 (M  =  Mo, W; X  =  S, Se) under different strains were studied by using density functional perturbation theory method. Our results show that all MX2 with 1T phase in our calculations are dynamical instable under zero strain or tensile strain as obvious imaginary frequencies (soft modes) exist. When 3% biaxial compressive strains are applied, the imaginary frequencies remain except that the absolute values of maximum imaginary frequency decrease. With the increase of compressive strain to be 6%, 1T-MoS2, 1T-MoSe2, 1T-WS2 become stable, whereas 1T-WSe2 has small imaginary frequencies. When biaxial compressive strain reaches 9%, all 1T-MX2 are dynamical stable without imaginary frequencies in the phonon dispersion curves. Energy band structures show that all 1T-MX2 are metallic, regardless of zero strain or compressive strain. Therefore, compressive strain could be a practical approach to enhance the stability of 1T-MX2 while maintaining the metallic property.

Duck MDA5 functions in innate immunity against H5N1 highly pathogenic avian influenza virus infections

PubMed Central

2014-01-01

Melanoma differentiation-associated gene 5 (MDA5) is an important intracellular receptor that recognizes long molecules of viral double-stranded RNA in innate immunity. To understand the mechanism of duck MDA5-mediated innate immunity, we cloned the MDA5 cDNA from the Muscovy duck (Cairina moschata). Quantitative real-time PCR analysis indicates that duck MDA5 mRNA was constitutively expressed in all sampled tissues. A significant increase of MDA5 mRNA was detected in the brain, spleen and lungs of ducks after infection with an H5N1 highly pathogenic avian influenza virus (HPAIV). We investigated the role of the predicted functional domains of MDA5. The results indicate the caspase activation and recruitment domain (CARD) of duck MDA5 had a signal transmission function through IRF-7-dependent signaling pathway. Overexpression of the CARD strongly activated the chicken IFN-β promoter and upregulated the mRNA expression of antiviral molecules (such as OAS, PKR and Mx), proinflammatory cytokines (such as IL-2, IL-6, IFN-α and IFN-γ, but not IL-1β and IL-8) and retinoic acid-inducible gene I (RIG-I)-like receptors (RLR) (RIG-I and LGP2) without exogenous stimulation. We also demonstrate the NS1 of the H5N1 HPAIV inhibited the duck MDA5-mediated signaling pathway in vitro. These results suggest that duck MDA5 is an important receptor for inducing antiviral activity in the host immune response of ducks. PMID:24939427

Function of duck RIG-I in induction of antiviral response against IBDV and avian influenza virus on chicken cells.

PubMed

Shao, Qiang; Xu, Wenpin; Yan, Li; Liu, Jinhua; Rui, Lei; Xiao, Xiao; Yu, Xiaoxue; Lu, Yanan; Li, Zandong

2014-10-13

The avian influenza (AI) H9N2 virus and IBDV are two major problems in the poultry industry. They have been prevalent among domestic poultry in Asia for many years and have caused considerable economic losses. Retinoic-acid-induced gene I (RIG-I) is a cytoplasmic sensor of dsRNA and ssRNA. It can detect Encephalomyocarditis virus (EMCV) and vesicular stomatitis virus (VSV) in human cells, influenza virus in duck leads to production of IFN-β and IFN-stimulated antiviral genes and reductions in the replication of RNA virus. Chickens, which lack RIG-I, are more sensitive to influenza virus than ducks. However, little is known about the roles of duck RIG-I (dRIG-I) in the detection of IBDV and AI H9N2 in chicken cells DF-1. The purpose of this study was to examine the function of dRIG-I in the recognition of IBDV Ts strain and H9N2 A/Chicken/Shandong/ZB/2007(ZB07) and in the induction of antiviral gene expression to gain an understanding of antiviral ability of dRIG-I in chicken cells against dsRNA virus IBDV and ssRNA virus ZB07. After challenge with the IBDV Ts strain and ZB07 the expression levels of Type I IFN (IFN-β and IFN-α) and IFN-induced antiviral genes (Mx and PKR) were significantly up-regulated in dRIG-I-transfected DF-1cells compared with the empty-vector-transfected control. dRIG-I knockdown experiments further proved that dRIG-I is essential to sensing IBDV and ZB07 in duck embryo fibroblasts (DEF). Growth curves showed that dRIG-I repressed the replication of IBDV and almost blunted the growth of ZB07 in DF-1. Apoptosis analysis revealed that dRIG-I increase the number of the survival cells after IBDV Ts strain or ZB07 infection relative to the empty-vector-transfected control. These results indicate that dRIG-I can up-regulates type I IFN and reduce viral gene expression and viral replication and protect chicken cells from virus-induced apoptosis during ZB07 and IBDV infection. Copyright © 2014 Elsevier B.V. All rights reserved.

CHARACTERISTICS AND TOXICITY OF THE DRINKING WATER DISINFECTION BY-PRODUCT 3-CHLORO-4(DICHLOROMETHYL)-5-HYDROXY-2[5H]-FURANONE (MX) TO MEDAKA (ORYZIAS LATIPES)

EPA Science Inventory

The compound 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone, also known as MX, is a by-product of wood pulp manufacture and a contaminant of chlorinated drinking and sewage water. MX has recently been shown to be carcinogenic to rodents. However, no data exist for its effec...

A Recombinant Adenovirus Expressing Ovine Interferon Tau Prevents Influenza Virus-Induced Lethality in Mice.

PubMed

Martín, V; Pascual, E; Avia, M; Rangel, G; de Molina, A; Alejo, A; Sevilla, N

2016-01-06

Ovine interferon tau (IFN-τ) is a unique type I interferon with low toxicity and a broad host range in vivo. We report the generation of a nonreplicative recombinant adenovirus expressing biologically active IFN-τ. Using the B6.A2G-Mx1 mouse model, we showed that single-dose intranasal administration of recombinant Ad5-IFN-τ can effectively prevent lethality and disease induced by highly virulent hv-PR8 influenza virus by activating the interferon response and preventing viral replication. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Calculational Schemes in GUTs

NASA Astrophysics Data System (ADS)

Kounnas, Costas

The following sections are included: * Introduction * Mass Spectrum in a Spontaneously Broken-Theory SU(5) - Minimal Model * Renormalization and Renormalization Group Equation (R.G.E.) * Step Approximation and Decoupling Theorem * Notion of the Effective Coupling Constant * First Estimation of MX, α(MX) and sin2θ(MW) * Renormalization Properties and Photon-Z Mixing * β-Function Definitions * Threshold Functions and Decoupling Theorem * MX-Determination * Proton Lifetime * sin2θ(μ)-Determination * Quark-Lepton Mass Relations (mb/mτ) * Overview of the Conventional GUTs - Hierarchy Problem * Stability of Hierarchy - Supersymmetric GUTS * Cosmologically Acceptable SUSY GUT Models * Radiative Breaking of SU(2) × U(1) — MW/MX Hierarchy Generation * No Scale Supergravity Models^{56,57} Dynamical Determination of M_{B}-M_{F} * Conclusion * References

MxCuBE: a synchrotron beamline control environment customized for macromolecular crystallography experiments

PubMed Central

Gabadinho, José; Beteva, Antonia; Guijarro, Matias; Rey-Bakaikoa, Vicente; Spruce, Darren; Bowler, Matthew W.; Brockhauser, Sandor; Flot, David; Gordon, Elspeth J.; Hall, David R.; Lavault, Bernard; McCarthy, Andrew A.; McCarthy, Joanne; Mitchell, Edward; Monaco, Stéphanie; Mueller-Dieckmann, Christoph; Nurizzo, Didier; Ravelli, Raimond B. G.; Thibault, Xavier; Walsh, Martin A.; Leonard, Gordon A.; McSweeney, Sean M.

2010-01-01

The design and features of a beamline control software system for macromolecular crystallography (MX) experiments developed at the European Synchrotron Radiation Facility (ESRF) are described. This system, MxCuBE, allows users to easily and simply interact with beamline hardware components and provides automated routines for common tasks in the operation of a synchrotron beamline dedicated to experiments in MX. Additional functionality is provided through intuitive interfaces that enable the assessment of the diffraction characteristics of samples, experiment planning, automatic data collection and the on-line collection and analysis of X-ray emission spectra. The software can be run in a tandem client-server mode that allows for remote control and relevant experimental parameters and results are automatically logged in a relational database, ISPyB. MxCuBE is modular, flexible and extensible and is currently deployed on eight macromolecular crystallography beamlines at the ESRF. Additionally, the software is installed at MAX-lab beamline I911-3 and at BESSY beamline BL14.1. PMID:20724792

MX Hierarchical Networking System.

DTIC Science & Technology

1982-02-01

criteria considered in this report are defined as follows: 1. Single Network Limitation. Will the scheme allow the maximum size network anticipated to be...AD-AI16 758 CONSTRUCTION ENGINEERING RESEARCH LAB (ARMY) CHAMPAIGN IL F/G 5/2 MX HIERARCHICAL NETWORKING SYSTEM.(U) FEB 82 M O-CONNOR, L M SOLISH, L...laboratory__ _ _ _ _ _ _ _ _ _ _ _ MX HIERARCHICAL NETWORKING SYSTEM by Michael O’Connor L. Michael Golish Lee Boyer IsI Approved for public

CHARACTERISTICS AND TOXICITY OF THE CHLORINATED DRINKING WATER DISINFECTION BY-PRODUCT 3-CHLORO-4-(DICHLOROMETHYL)-5-HYDROXY-2[5H]-FURANONE (MX) TO MEDAKA (ORYZIAS LATIPES)

EPA Science Inventory

The compound 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone, also know as MX, is a by-product of wood pulp manufacture and a contaminant of chlorinated drinking and sewage water. MX has recently been shown to be a multi-site carcinogen in rodents. We investigated the acute...

Virulence and genotypes of white spot syndrome virus infecting Pacific white shrimp Litopenaeus vannamei in north-western Mexico.

PubMed

Ramos-Paredes, J; Grijalva-Chon, J M; Ibarra-Gámez, J C

2017-03-01

White spot syndrome virus (WSSV) has caused substantial global economic impact on aquaculture, and it has been determined that strains can vary in virulence. In this study, the effect of viral load was evaluated by infecting Litopenaeus vannamei with 10-fold serial dilution of tissue infected with strain WSSV Mx-H, and the virulence of four WSSV strains from north-western Mexico was assessed along with their variable number of tandem repeat (VNTR) genotypes in ORF75, ORF94 and ORF125. The LD 50 of the Mx-H strain was a dilution dose of 10 -7.5 ; the mortality titre was 10 9.2 LD 50 per gram. In shrimp injected with 10 2.5 to 10 6.5 LD 50 , no significant virulence differences were evident. Using mortality data, the four WSSV strains grouped into three virulence levels. The Mx-F strain (intermediate virulence) and the Mx-C strain (high virulence) showed more genetic differences than those observed between the Mx-G (low-virulence) and Mx-H (high-virulence) strains, in ORF94 and ORF125. The application of high-viral-load inocula proved useful in determining the different virulence phenotypes of the WSSV strains from the Eastern Pacific. © 2017 John Wiley & Sons Ltd.

Surface enhanced Raman scattering of monolayer MX2 with metallic nano particles

PubMed Central

Zhang, Duan; Wu, Ye-Cun; Yang, Mei; Liu, Xiao; Coileáin, Cormac Ó; Abid, Mourad; Abid, Mohamed; Wang, Jing-Jing; Shvets, Igor; Xu, Hongjun; Chun, Byong Sun; Liu, Huajun; Wu, Han-Chun

2016-01-01

Monolayer transition metal dichalcogenides MX2 (M = Mo, W; X = S) exhibit remarkable electronic and optical properties, making them candidates for application within flexible nano-optoelectronics. The ability to achieve a high optical signal, while quantitatively monitoring strain in real-time is the key requirement for applications in flexible sensing and photonics devices. Surface-enhanced Raman scattering (SERS) allows us to achieve both simultaneously. However, the SERS depends crucially on the size and shape of the metallic nanoparticles (NPs), which have a large impact on its detection sensitivity. Here, we investigated the SERS of monolayer MX2, with particular attention paid to the effect of the distribution of the metallic NPs. We show that the SERS depends crucially on the distribution of the metallic NPs and also the phonon mode of the MX2. Moreover, strong coupling between MX2 and metallic NPs, through surface plasmon excitation, results in splitting of the and modes and an additional peak becomes apparent. For a WS2-Ag system the intensity of the additional peak increases exponentially with local strain, which opens another interesting window to quantitatively measure the local strain using SERS. Our experimental study may be useful for the application of monolayer MX2 in flexible nano-optoelectronics. PMID:27457808

Glutathionylation of UCP2 sensitizes drug resistant leukemia cells to chemotherapeutics.

PubMed

Pfefferle, Aline; Mailloux, Ryan J; Adjeitey, Cyril Nii-Klu; Harper, Mary-Ellen

2013-01-01

Uncoupling protein-2 (UCP2) is used by cells to control reactive oxygen species (ROS) production by mitochondria. This ability depends on the glutathionylation state of UCP2. UCP2 is often overexpressed in drug resistant cancer cells and therein controls cell ROS levels and limits drug toxicity. With our recent observation that glutathionylation deactivates proton leak through UCP2, we decided to test if diamide, a glutathionylation catalyst, can sensitize drug resistant cells to chemotherapeutic agents. Using drug sensitive HL-60 cells and the drug resistant HL-60 subline, Mx2, we show that chemical induction of glutathionylation selectively deactivates proton leak through UCP2 in Mx2 cells. Chemical glutathionylation of UCP2 disables chemoresistance in the Mx2 cells. Exposure to 200μM diamide led to a significant increase in Mx2 cell death that was augmented when cells were exposed to either menadione or the anthracycline doxorubicin. Diamide also sensitized Mx2 cells to a number of other chemotherapeutics. Proton leak through UCP2 contributed significantly to the energetics of the Mx2 cells. Knockdown of UCP2 led to a significant decrease in both resting and state 4 (i.e., proton leak-dependent) respiration (~43% and 62%, respectively) in Mx2 cells. Similarly diamide inhibited proton leak-dependent respiration by ~64%. In contrast, diamide had very little effect on proton leak in HL-60 cells. Collectively, our observations indicate that manipulation of UCP2 glutathionylation status can serve as a therapeutic strategy for cancer treatment. Copyright © 2012 Elsevier B.V. All rights reserved.

Bayesian Diallel Analysis Reveals Mx1-Dependent and Mx1-Independent Effects on Response to Influenza A Virus in Mice.

PubMed

Maurizio, Paul L; Ferris, Martin T; Keele, Gregory R; Miller, Darla R; Shaw, Ginger D; Whitmore, Alan C; West, Ande; Morrison, Clayton R; Noll, Kelsey E; Plante, Kenneth S; Cockrell, Adam S; Threadgill, David W; Pardo-Manuel de Villena, Fernando; Baric, Ralph S; Heise, Mark T; Valdar, William

2018-02-02

Influenza A virus (IAV) is a respiratory pathogen that causes substantial morbidity and mortality during both seasonal and pandemic outbreaks. Infection outcomes in unexposed populations are affected by host genetics, but the host genetic architecture is not well understood. Here, we obtain a broad view of how heritable factors affect a mouse model of response to IAV infection using an 8 × 8 diallel of the eight inbred founder strains of the Collaborative Cross (CC). Expanding on a prior statistical framework for modeling treatment response in diallels, we explore how a range of heritable effects modify acute host response to IAV through 4 d postinfection. Heritable effects in aggregate explained ∼57% of the variance in IAV-induced weight loss. Much of this was attributable to a pattern of additive effects that became more prominent through day 4 postinfection and was consistent with previous reports of antiinfluenza myxovirus resistance 1 ( Mx1 ) polymorphisms segregating between these strains; these additive effects largely recapitulated haplotype effects observed at the Mx1 locus in a previous study of the incipient CC, and are also replicated here in a CC recombinant intercross population. Genetic dominance of protective Mx1 haplotypes was observed to differ by subspecies of origin: relative to the domesticus null Mx1 allele, musculus acts dominantly whereas castaneus acts additively. After controlling for Mx1 , heritable effects, though less distinct, accounted for ∼34% of the phenotypic variance. Implications for future mapping studies are discussed. Copyright © 2018 Maurizio et al.

Purification and characterization of rat liver minoxidil sulphotransferase.

PubMed Central

Hirshey, S J; Falany, C N

1990-01-01

Minoxidil (Mx), a pyrimidine N-oxide, is used therapeutically as an antihypertensive agent and to induce hair growth in patients with male pattern baldness. Mx NO-sulphate has been implicated as the agent active in producing these effects. This paper describes the purification of a unique sulphotransferase (ST) from rat liver cytosol that is capable of catalysing the sulphation of Mx. By using DEAE-Sepharose CL-6B chromatography, hydroxyapatite chromatography and ATP-agarose affinity chromatography, Mx-ST activity was purified 240-fold compared with the activity in cytosol. The purified enzyme was also capable of sulphating p-nitrophenol (PNP) at low concentrations (less than 10 microM). Mx-ST was purified to homogeneity, as evaluated by SDS/PAGE and reverse-phase h.p.l.c. The active form of the enzyme had a molecular mass of 66,000-68,000 Da as estimated by gel exclusion chromatography and a subunit molecular mass of 35,000 Da. The apparent Km values for Mx, 3'-phosphoadenosine 5'-phosphosulphate and PNP were 625 microM, 5.0 microM and 0.5 microM respectively. However, PNP displayed potent substrate inhibition at concentrations above 1.2 microM. Antibodies raised in rabbits to the pure enzyme detected a single band in rat liver cytosol with a subunit molecular mass of 35,000 Da, as determined by immunoblotting. The anti-(rat Mx-ST) antibodies also reacted with the phenol-sulphating form of human liver phenol sulphotransferase, suggesting some structural similarity between these proteins. Images Fig. 5. Fig. 6. Fig. 7. PMID:2241904

An in vitro analysis of a carotid artery stent with a protective porous membrane.

PubMed

Müller-Hülsbeck, Stefan; Hüsler, Erhard J; Schaffner, Silvio R; Jahnke, Thomas; Glass, Christoph; Wenke, Rüdiger; Heller, Martin

2004-11-01

To prove the effectiveness of a new stent concept with integrated protection (MembraX [MX]) by comparing it with five cerebral protection devices designed for carotid angioplasty in an in vitro model. Two simulation series of embolization from carotid angioplasty have been performed. In the first series, polyvinyl-alcohol particles (150-250 microm [small], 355-500 microm [medium], 710-1000 microm [large]; 5 mg each) were injected into a silicone flow model simulating the aortic arch with a carotid bifurcation. The particles were injected proximally to the partially deployed MX stent or one of the following protection devices: Angioguard (AG), FilterWire EX (EX), Trap, Neuroshield (NS), or GuardWire Plus (GW). Particles evading the protection device were caught in a filter at the end of the flow model and weighed. In the second series, human plaque material (8-12 particles; total weight 6.09 +/- 0.01 mg; 500-1500 microm) was injected into the model with the respective devices. MX was compared with the AG, EX, Trap, and NS devices. MX had the most effective overall filtration performance for polyvinyl alcohol particles in the effluent of the internal carotid artery (ICA; 0.43 mg, 2.9%), compared with NS (0.53 mg, 3.5%), GW (1.10 mg, 7.0%), EX and AG (1.18 and 1.21 mg, respectively; 7.8% and 8.0%), and Trap (1.24 mg, 8.2%). MX performed best for the small particles (2.0% passed particles into ICA; P < .05 compared with all). Human plaque material was retained best in the in vitro model by MX (0.0%), followed by NS (0.8%), EX (1.3%), Trap (2.6%), and AG (4.4%). In vitro, none of the tested devices had the ability to prevent embolization completely. Comparing current designs, the MX device captured the highest percentage of the three different particle groups. Tested with human plaque emboli, MX performed effectively in filtering the particles in the ICA.

Protective oral vaccination against infectious salmon anaemia virus in Salmo salar.

PubMed

Caruffo, Mario; Maturana, Carlos; Kambalapally, Swetha; Larenas, Julio; Tobar, Jaime A

2016-07-01

Infectious salmon anemia (ISA) is a systemic disease caused by an orthomyxovirus, which has a significant economic impact on the production of Atlantic salmon (Salmo salar). Currently, there are several commercial ISA vaccines available, however, those products are applied through injection, causing stress in the fish and leaving them susceptible to infectious diseases due to the injection process and associated handling. In this study, we evaluated an oral vaccine against ISA containing a recombinant viral hemagglutinin-esterase and a fusion protein as antigens. Our findings indicated that oral vaccination is able to protect Atlantic salmon against challenge with a high-virulence Chilean isolate. The oral vaccination was also correlated with the induction of IgM-specific antibodies. On the other hand, the vaccine was unable to modulate expression of the antiviral related gene Mx, showing the importance of the humoral response to the disease survival. This study provides new insights into fish protection and immune response induced by an oral vaccine against ISA, but also promises future development of preventive solutions or validation of the current existing therapies. Copyright © 2016 Elsevier Ltd. All rights reserved.

PISMA: A Visual Representation of Motif Distribution in DNA Sequences.

PubMed

Alcántara-Silva, Rogelio; Alvarado-Hermida, Moisés; Díaz-Contreras, Gibrán; Sánchez-Barrios, Martha; Carrera, Samantha; Galván, Silvia Carolina

2017-01-01

Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code-like, as a gene-map-like, and as a transcript scheme. We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf.

PISMA: A Visual Representation of Motif Distribution in DNA Sequences

PubMed Central

Alcántara-Silva, Rogelio; Alvarado-Hermida, Moisés; Díaz-Contreras, Gibrán; Sánchez-Barrios, Martha; Carrera, Samantha; Galván, Silvia Carolina

2017-01-01

Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf. PMID:28469418

Systematic exploration of essential yeast gene function with temperature-sensitive mutants

PubMed Central

Li, Zhijian; Vizeacoumar, Franco J; Bahr, Sondra; Li, Jingjing; Warringer, Jonas; Vizeacoumar, Frederick S; Min, Renqiang; VanderSluis, Benjamin; Bellay, Jeremy; DeVit, Michael; Fleming, James A; Stephens, Andrew; Haase, Julian; Lin, Zhen-Yuan; Baryshnikova, Anastasia; Lu, Hong; Yan, Zhun; Jin, Ke; Barker, Sarah; Datti, Alessandro; Giaever, Guri; Nislow, Corey; Bulawa, Chris; Myers, Chad L; Costanzo, Michael; Gingras, Anne-Claude; Zhang, Zhaolei; Blomberg, Anders; Bloom, Kerry; Andrews, Brenda; Boone, Charles

2012-01-01

Conditional temperature-sensitive (ts) mutations are valuable reagents for studying essential genes in the yeast Saccharomyces cerevisiae. We constructed 787 ts strains, covering 497 (~45%) of the 1,101 essential yeast genes, with ~30% of the genes represented by multiple alleles. All of the alleles are integrated into their native genomic locus in the S288C common reference strain and are linked to a kanMX selectable marker, allowing further genetic manipulation by synthetic genetic array (SGA)–based, high-throughput methods. We show two such manipulations: barcoding of 440 strains, which enables chemical-genetic suppression analysis, and the construction of arrays of strains carrying different fluorescent markers of subcellular structure, which enables quantitative analysis of phenotypes using high-content screening. Quantitative analysis of a GFP-tubulin marker identified roles for cohesin and condensin genes in spindle disassembly. This mutant collection should facilitate a wide range of systematic studies aimed at understanding the functions of essential genes. PMID:21441928

Author Correction: New activities for old antibiotics.

PubMed

Cohen, Jeffrey I

2018-06-19

In the version of this News and Views originally published, the author made an incorrect reference to 'mice deficient in Mx1'. This has now been corrected so that the text instead refers to 'mice congenic for Mx1'. The full corrected sentence reads as "Pretreatment of mice congenic for Mx1, an ISG that is critical for protection of animals from influenza, with intranasal neomycin significantly improved survival; however, about 50% of the mice died."

Molecular basis of viral and microbial pathogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rott, R.; Goebel, W.

1988-01-01

The contents of this book are: Correlation Between Viroid Structure and Pathogenicty; Antigenicity of the Influenza Haemagglutinia Membrane Glycoprotein; Viral Glycoproteins as Determinants of Pathogenicity; Virus Genes Involved in Host Range and Pathogenicity; Molecular Heterogenetiy of Pathogenic Herpus Viruses; Recombination of Foreign (Viral) DNA with Host Genome: Studies in Vivo and in a Cell-Free system; Disorders of Cellular Neuro-Functions by Persistent Viral Infection; Pathogenic Aspects of Measles Virus-Persistent Infections in Man; Analysis of the Dual Lineage Specificity of E26 Avian Leukemia Virus; Mx Gene Control of Influenza Virus Susceptibility; Shiga and Shika-Like Toxins: A Family of Related Cytokinons; and Molecularmore » Mechanisms of Pathogenicity in Shigella Flexneri.« less

Comparison of the dental anomalies found in maxillary canine-first premolar transposition cases with those in palatally displaced canine cases.

PubMed

Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon

2016-02-01

To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Structure and properties of the anions MF4-, MCl4- and MBr4- (M = C, Si, Ge)

NASA Astrophysics Data System (ADS)

Grein, Friedrich

2015-04-01

Density functional theory (DFT), Møller-Plesset (MP2) and coupled cluster with single and double substitutions including non-iterative triple excitations (CCSD(T)) calculations on the anions MX4-, with M = C, Si, Ge and X = F, Cl, Br, show that GeF4-, SiCl4-, GeCl4- and SiBr4- prefer a C2v conformation, but CCl4- is an elongated C3v structure. CBr4- has Td symmetry in MP2, but is slightly more stable in elongated C3v form with DFT and CCSD(T). GeBr4- has Td symmetry. CF4- and SiF4- are unstable with respect to loss of an electron. Vertical electron affinities (EAs) are negative also for CCl4 and SiCl4, and close to zero for GeF4 and SiBr4. Adiabatic EAs range from 0.47 eV for SiCl4 to 1.78 eV for GeBr4. The lowest excited states at Td symmetry are 2T2 resonances with energies of 2.1-3.5 eV, resulting from excitation of the a1 singly occupied molecular orbital to vacant t2 orbitals. Vertical excitation energies (VEEs) and vibrational frequencies are given for the most stable anionic geometries. Comparison with experimental VEEs for CCl4- is made. From dissociation energies of MX4, MX4-, MX3 and MX3-, appearance energies of X-, MX3-, X2- and MX2- were calculated. Most were found to be in reasonable agreement with experimental values. Theoretical spin densities and g-factors have been compared with experimental results available for CCl4-, SiCl4- and GeCl4-.

Early diagnosis of a Mexican variant of Papaya meleira virus (PMeV-Mx) by RT-PCR.

PubMed

Zamudio-Moreno, E; Ramirez-Prado, J H; Moreno-Valenzuela, O A; Lopez-Ochoa, L A

2015-02-06

Papaya meleira disease was identified in Brazil in the 1980s. The disease is caused by a double-stranded RNA virus known as Papaya meleira virus (PMeV), which has also been recently reported in Mexico. However, previously reported PMeV primers failed to diagnose the Mexican form of the disease. A genomic approach was used to identify sequences of the Mexican virus isolate, referred here to as PMeV-Mx, to develop a diagnostic method. A mini cDNA library was generated using total RNA from the latex of fruits; this RNA was also sequenced using the Illumina platform. Sequences corresponding to the previously reported 669-base pair sequence for PMeV from Brazil (PMeV-Br) were identified within the PMeV-Mx genome, exhibiting 79-92% identity with PMeV-Br. In addition, a new sequence of 1154-base pairs encoding a putative RNA-dependent RNA polymerase was identified in PMeV-Mx. Primers designed against this sequence detected both virus isolates, 2 amplicons of 173 and 491 base pairs from PMeV-Br and PMeV-Mx, and shared 100 and 98% identity, respectively. PMeV-Mx was found in the latex of fruits, in seedlings, and in the leaves, flowers, petioles, and seeds of mature plants. PMeV-Mx was more abundant in the latex of fruits than in the leaves. The limit of detection of the CB38/CB39 primer pair was 1 fg and 1 pg using total RNA extracted from the latex of fruits and from seedlings, respectively. A sensitive and early diagnosis protocol was developed; this method will enable the certification of seeds and seedlings prior to transplantation to the field.

Study of photon dissociation in diffractive photoproduction at HERA.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Breitweg, J.; Derrick, M.; Krakauer, D.

1997-01-01

Diffractive dissociation of quasi-real photons at a photon-proton centre of mass energy of W >> 200 GeV is studied with the ZEUS detector at HERA. The process under consideration is {gamma}{rho}{yields} XN, where X is the diffractively dissociated photon system of mass MX and N is either a proton or a nucleonic system with mass MN < 2 GeV. The cross section for this process in the interval 3 < MX < 24 GeV relative to the total photoproduction cross section was measured to be s{sup partial}D/s{sub tot} = 6.2 {+-}0.2 (stat) {+-}1.4 (syst)%. After extrapolating this result to themore » mass interval of mf2 < MX2 < 0.05W2 and correcting it for proton dissociation, the fraction of the total cross section attributed to single diffractive photon dissociation, {gamma}{rho}{yields}, is found to be s{sub SD}/s{sub tot} = 13.3 {+-}0.5 (stat){+-}3.6(syst)%. The mass spectrum of the dissociated photon system in the interval 8 < MX < 24 GeV can be described by the triple pomeron (PPP) diagram with an effective pomeron intercept of {alpha}{sub P}(0)=1.12{+-}0.04(stat) {+-}0.08(syst). The cross section for photon dissociation in the range 3 < MX < 8 GeV is significantly higher than that expected from the triple pomeron amplitude describing the region 8 < MX < 24 GeV. Assuming that this discrepancy is due to a pomeron-pomeron-reggeon (PPR) term, its contribution to the diffractive cross section in the interval 3 < MX < 24 GeVis estimated to be f{sub PPR}=26{+-} 3(stat) {+-} 12(syst).« less

Comparison of the responses of different recombinant fish type I interferons against betanodavirus infection in grouper.

PubMed

Kuo, Hsiang-Ping; Chung, Chia-Ling; Hung, Yu-Fang; Lai, Yu-Shen; Chiou, Pinwen P; Lu, Ming-Wei; Kong, Zwe-Ling

2016-02-01

The nervous necrosis virus (NNV) is an aquatic virus that can infect more than 30 species including the grouper, which is a valuable fish species in Taiwan. NNV causes up to 90-100% mortality in the aquaculture industry. Interferons (IFNs) are a family of cytokines that stimulate the expression of numerous proteins to protect the host against viruses and possess very unique specific characteristics in fish. The cross-reactivity of heterologous IFNs on grouper cells and larvae has not been well-studied to date. To evaluate and compare the anti-NNV effect of different fish IFNs in grouper, we successfully synthesized, subcloned, expressed and purified several fish type I IFNs in the present study: grouper (gIFN), salmon (sIFN), seabass (sbIFN) and tilapia (tpIFN). The gIFN and sIFN proteins up-regulated myxovirus resistance protein (Mx) gene expression in grouper kidney (GK) cells, but similar effects were not observed for sbIFN and tpIFN. Following co- and pre-treatment with the 4 types of IFNs with NNV infection in GK cells, sIFN exhibited the strongest antiviral ability to suppress NNV gene replication (especially at 24 h) and significantly reduced the cytopathic effect (CPE) at 72 h, followed by gIFN. Unsurprisingly, sbIFN and tpIFN had no significant effect on CPE but slightly suppressed NNV gene replication. The cytotoxicity of these four fish IFNs on GK cells was also examined for the first time. In the in vivo test, we confirmed that gIFN and sIFN had a significant protective effect against NNV when administered by intraperitoneal (IP) injection and the oral route in Malabar grouper (Epinephelus malabaricus) larvae. This study compared the protective effects of IFNs from various fish species against NNV and demonstrated crosstalk between sIFN and grouper cells for the first time. These results provide information concerning the efficacy of fish IFNs for possible therapeutic applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Research in high frequency ultrasonic for degradation of azo dye wastewater containing MX-5B].

PubMed

Xie, Wei-Ping; Qin, Yan; Zou, Yuan; He, De-Wen; Song, Dan

2010-09-01

The degradation of azo dye wastewater, containing MX-5B, was investigated by using high frequency ultrasonic irradiation. The effect of different factors like the initial pH of solution, sonolysis parameters, air-blowing, Fe2+ concentration were studied, the synergistic action of complex frequency and the mechanism of degradation was explored primarily. The results show that MX-5B in aqueous solution can be degraded efficiently by ultrasonic irradiation, when the pH 3.5, ultrasonic frequency 418.3 kHz, ultrasonic power 69 W, color removal rate up to 100% in 180 min. Adding of Fe2+ and blowing air had some effects. The results also indicated that radical-oxidation controlled the ultrasonic decompose of MX-5B and MX-5B ultrasonic removal was observed to behave as pseudo-first-order kinetics under different experimental conditions tested in the present work. Comparison of UV-Vis absorption spectrums before and after treatment showed that all of the conjugate structure and part of aromatic structure were destroyed after being ultrasonic irradiation.

Rovibronically Selected and Resolved Laser Photoionization and Photoelectron Studies of Transition Metal Carbides, Nitrides, and Oxides.

NASA Astrophysics Data System (ADS)

Luo, Zhihong; Chang, Yih-Chung; Huang, Huang; Ng, Cheuk-Yiu

2014-06-01

Transition metal (M) carbides, nitrides, and oxides (MX, X = C, N, and O) are important molecules in astrophysics, catalysis, and organometallic chemistry. The measurements of the ionization energies (IEs), bond energies, and spectroscopic constants for MX/MX+ in the gas phase by high-resolution photoelectron methods represent challenging but profitable approaches to gain fundamental understandings of the electronic structures and bonding properties of these compounds and their cations. We have developed a two-color laser excitation scheme for high-resolution pulse field ionization photoelectron (PFI-PE) measurements of MX species. By exciting the neutral MX species to a single rovibronic state using a visible laser prior to photoionization by a UV laser, we have obtained fully rotational resolved PFI-PE spectra for TiC+, TiO+, VCH+, VN+, CoC+, ZrO+, and NbC+. The unambiguous rotational assignments of these spectra have provided highly accurate IE values for TiC, TiO, VCH, VN, CoC, ZrO, and NbC, and spectroscopic constants for their cations.

Geometric validation of a mobile laser scanning system for urban applications

NASA Astrophysics Data System (ADS)

Guan, Haiyan; Li, Jonathan; Yu, Yongtao; Liu, Yan

2016-03-01

Mobile laser scanning (MLS) technologies have been actively studied and implemented over the past decade, as their application fields are rapidly expanding and extending beyond conventional topographic mapping. Trimble's MX-8, as one of the MLS systems in the current market, generates rich survey-grade laser and image data for urban surveying. The objective of this study is to evaluate whether Trimble MX-8 MLS data satisfies the accuracy requirements of urban surveying. According to the formula of geo-referencing, accuracies of navigation solution and laser scanner determines the accuracy of the collected LiDAR point clouds. Two test sites were selected to test the performance of Trimble MX-8. Those extensive tests confirm that Trimble MX-8 offers a very promising tool to survey complex urban areas.

MX Siting Investigation. MX System Siting Summary Report. General Introduction. Volume I. Part I.

DTIC Science & Technology

1982-01-18

Mountain Spring Peak 1972 Observation Knoll 1971 Pinto Spring 1971 Steamboat Mountain 1971 Steamboat Mountain SW 1971 The Tetons 1971 Zane 1972 MX SITING...Silver Peak 1978 Stoddard Mountain 1978 Water Creek Canyon 1972 Yale Crossing 1971 49 Beaver Dam Mountains NE 1955 Central East 1972 Central West 1972...SHELTER SITE -ORIGINAL ROAD --- RESITED ROAD *• = FOUND 3 1/2" BRASS CAP SET ON 2 1/2" IRON PIPE . U.S DEPARTMENT OF THE INTERIOR. BUREAU OF LAND

The strategic balance, the MX-system and deficiencies in the SALT Treaty

NASA Astrophysics Data System (ADS)

Karlsson, H.

1982-04-01

The Strategic Arms Limitation Treaty project SALT 2 is shown to have fundamental deficiencies. An asymetric development of the USA's and the USSR's strategic forces and their military doctrines led to increasing vulnerability of these forces. According to the American intimidation theory, nonvulnerable retaliation forces are a precondition for strategic stability, therefore the USA developed the MX-system, a more reliable land-based system for intercontinental missiles. The characteristics of the MX are not definitely defined yet.

In vitro inhibition of monkeypox virus production and spread by Interferon-β

PubMed Central

2012-01-01

Background The Orthopoxvirus genus contains numerous virus species that are capable of causing disease in humans, including variola virus (the etiological agent of smallpox), monkeypox virus, cowpox virus, and vaccinia virus (the prototypical member of the genus). Monkeypox is a zoonotic disease that is endemic in the Democratic Republic of the Congo and is characterized by systemic lesion development and prominent lymphadenopathy. Like variola virus, monkeypox virus is a high priority pathogen for therapeutic development due to its potential to cause serious disease with significant health impacts after zoonotic, accidental, or deliberate introduction into a naïve population. Results The purpose of this study was to investigate the prophylactic and therapeutic potential of interferon-β (IFN-β) for use against monkeypox virus. We found that treatment with human IFN-β results in a significant decrease in monkeypox virus production and spread in vitro. IFN-β substantially inhibited monkeypox virus when introduced 6-8 h post infection, revealing its potential for use as a therapeutic. IFN-β induced the expression of the antiviral protein MxA in infected cells, and constitutive expression of MxA was shown to inhibit monkeypox virus infection. Conclusions Our results demonstrate the successful inhibition of monkeypox virus using human IFN-β and suggest that IFN-β could potentially serve as a novel safe therapeutic for human monkeypox disease. PMID:22225589

VP2 (PTA motif) encoding DNA vaccine confers protection against lethal challenge with infectious pancreatic necrosis virus (IPNV) in trout.

PubMed

Ahmadivand, Sohrab; Soltani, Mehdi; Behdani, Mahdi; Evensen, Øystein; Alirahimi, Ehsan; Soltani, Elahe; Hassanzadeh, Reza; Ashrafi-Helan, Javad

2018-02-01

IPNV in Atlantic salmon is represented by various strains with different virulence and immunogenicity linked to various motifs of the VP2 capsid. IPNV variant with P 217 , T 221 , A 247 (PTA) motif is found to be avirulent in Atlantic salmon, but virulent in rainbow trout, and other salmonid species. This study describes a DNA vaccine delivered intramuscularly encoding the VP2 protein of infectious pancreatic necrosis virus (IPNV) with PTA motif that confers high protection in rainbow trout (Oncorhynchus mykiss). Intramuscular injection of 2, 5 and 10 μg of DNA (pcDNA3.1-VP2) in rainbow trout fry (4-5 g), confers relative protection of 75-83% in the different vaccine groups at 30 days post vaccination (450° days). The VP2 gene is expressed in spleen, kidney, muscle and liver at day 30 post-vaccination (RT-PCR), and IFN-1 and Mx-1 mRNA are upregulated at early time post vaccination, and so also for IgM, IgT, CD4 and CD8 in the head kidney of vaccinated fish compared to controls, 15 and 30 days post vaccination. Significant increase of serum anti-IPNV antibodies was found 30-90 days post-vaccination that was correlated with protection levels. Mortality corresponded with viral VP4 gene expression were significantly decreased in vaccinated and challenged fish. This shows for the first time that a VP2-encoding DNA vaccine delivered intramuscularly elicits a high level of protection alongside with high levels of circulating antibodies in rainbow trout and a lowered viral replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

VII International Congress of Engineering Physics

NASA Astrophysics Data System (ADS)

2015-01-01

In the frame of the fortieth anniversary celebration of the Universidad Autónoma Metropolitana and the Physics Engineering career, the Division of Basic Science and Engineering and its Departments organized the "VII International Congress of Physics Engineering". The Congress was held from 24 to 28 November 2014 in Mexico City, Mexico. This congress is the first of its type in Latin America, and because of its international character, it gathers experts on physics engineering from Mexico and all over the globe. Since 1999, this event has shown research, articles, projects, technological developments and vanguard scientists. These activities aim to spread, promote, and share the knowledge of Physics Engineering. The topics of the Congress were: • Renewable energies engineering • Materials technology • Nanotechnology • Medical physics • Educational physics engineering • Nuclear engineering • High precision instrumentation • Atmospheric physics • Optical engineering • Physics history • Acoustics This event integrates lectures on top trending topics with pre-congress workshops, which are given by recognized scientists with an outstanding academic record. The lectures and workshops allow the exchange of experiences, and create and strengthen research networks. The Congress also encourages professional mobility among all universities and research centres from all countries. CIIF2014 Organizing and Editorial Committee Dr. Ernesto Rodrigo Vázquez Cerón Universidad Autónoma Metropolitana - Azcapotzalco ervc@correo.azc.uam.mx Dr. Luis Enrique Noreña Franco Universidad Autónoma Metropolitana - Azcapotzalco lnf@correo.azc.uam.mx Dr. Alberto Rubio Ponce Universidad Autónoma Metropolitana - Azcapotzalco arp@correo.azc.uam.mx Dr. Óscar Olvera Neria Universidad Autónoma Metropolitana - Azcapotzalco oon@correo.azc.uam.mx Professor Jaime Granados Samaniego Universidad Autónoma Metropolitana - Azcapotzalco jgs@correo.azc.uam.mx Dr. Roberto Tito Hernández López Universidad Autónoma Metropolitana - Azcapotzalco hlrt@correo.azc.uam.mx Dr. Anatolio Martínez Jiménez Universidad Autónoma Metropolitana - Azcapotzalco amartinez@correo.azc.uam.mx Dr. Eusebio Guzmán Serrano Universidad Autónoma Metropolitana - Azcapotzalco gse@correo.azc.uam.mx

Attenuation of Pathogenic Immune Responses during Infection with Human and Simian Immunodeficiency Virus (HIV/SIV) by the Tetracycline Derivative Minocycline

PubMed Central

Drewes, Julia L.; Szeto, Gregory L.; Engle, Elizabeth L.; Liao, Zhaohao; Shearer, Gene M.; Zink, M. Christine; Graham, David R.

2014-01-01

HIV immune pathogenesis is postulated to involve two major mechanisms: 1) chronic innate immune responses that drive T cell activation and apoptosis and 2) induction of immune regulators that suppress T cell function and proliferation. Both arms are elevated chronically in lymphoid tissues of non-natural hosts, which ultimately develop AIDS. However, these mechanisms are not elevated chronically in natural hosts of SIV infection that avert immune pathogenesis despite similarly high viral loads. In this study we investigated whether minocycline could modulate these pathogenic antiviral responses in non-natural hosts of HIV and SIV. We found that minocycline attenuated in vitro induction of type I interferon (IFN) and the IFN-stimulated genes indoleamine 2,3-dioxygenase (IDO1) and TNF-related apoptosis inducing ligand (TRAIL) in human plasmacytoid dendritic cells and PBMCs exposed to aldrithiol-2 inactivated HIV or infectious influenza virus. Activation-induced TRAIL and expression of cytotoxic T-lymphocyte antigen 4 (CTLA-4) in isolated CD4+ T cells were also reduced by minocycline. Translation of these in vitro findings to in vivo effects, however, were mixed as minocycline significantly reduced markers of activation and activation-induced cell death (CD25, Fas, caspase-3) but did not affect expression of IFNβ or the IFN-stimulated genes IDO1, FasL, or Mx in the spleens of chronically SIV-infected pigtailed macaques. TRAIL expression, reflecting the mixed effects of minocycline on activation and type I IFN stimuli, was reduced by half, but this change was not significant. These results show that minocycline administered after infection may protect against aspects of activation-induced cell death during HIV/SIV immune disease, but that in vitro effects of minocycline on type I IFN responses are not recapitulated in a rapid progressor model in vivo. PMID:24732038

Factors Associated with Overweight and Obesity among Children of Mexican Descent: Results of a Binational Study

PubMed Central

Rosas, Lisa G.; Guendelman, Sylvia; Harley, Kim; Fernald, Lia C. H.; Neufeld, Lynnette; Mejia, Fabiola

2010-01-01

The prevalence of childhood obesity is high among young children of Mexican origin in the United States, however, the determinants are poorly understood. We conducted a binational study with a sample from California (CA) and Mexico (MX), to identify and compare the most important factors associated with overweight and obesity among children of Mexican descent. Significantly more children were classified as overweight or obese in CA compared to MX (53.3 vs. 14.9%, P < 0.01). In CA and MX, having an obese mother was significantly associated with being overweight or obese. In MX, male gender, high socioeconomic status and very low food insecurity were associated with being overweight or obese. These data offer hypotheses for how migration may influence the high prevalence of overweight among the Mexican children in California. PMID:20217234

Protein-tyrosine phosphatase Shp2 positively regulates macrophage oxidative burst.

PubMed

Li, Xing Jun; Goodwin, Charles B; Nabinger, Sarah C; Richine, Briana M; Yang, Zhenyun; Hanenberg, Helmut; Ohnishi, Hiroshi; Matozaki, Takashi; Feng, Gen-Sheng; Chan, Rebecca J

2015-02-13

Macrophages are vital to innate immunity and express pattern recognition receptors and integrins for the rapid detection of invading pathogens. Stimulation of Dectin-1 and complement receptor 3 (CR3) activates Erk- and Akt-dependent production of reactive oxygen species (ROS). Shp2, a protein-tyrosine phosphatase encoded by Ptpn11, promotes activation of Ras-Erk and PI3K-Akt and is crucial for hematopoietic cell function; however, no studies have examined Shp2 function in particulate-stimulated ROS production. Maximal Dectin-1-stimulated ROS production corresponded kinetically to maximal Shp2 and Erk phosphorylation. Bone marrow-derived macrophages (BMMs) from mice with a conditionally deleted allele of Ptpn11 (Shp2(flox/flox);Mx1Cre+) produced significantly lower ROS levels compared with control BMMs. Although YFP-tagged phosphatase dead Shp2-C463A was strongly recruited to the early phagosome, its expression inhibited Dectin-1- and CR3-stimulated phospho-Erk and ROS levels, placing Shp2 phosphatase function and Erk activation upstream of ROS production. Further, BMMs expressing gain of function Shp2-D61Y or Shp2-E76K and peritoneal exudate macrophages from Shp2D61Y/+;Mx1Cre+ mice produced significantly elevated levels of Dectin-1- and CR3-stimulated ROS, which was reduced by pharmacologic inhibition of Erk. SIRPα (signal regulatory protein α) is a myeloid inhibitory immunoreceptor that requires tyrosine phosphorylation to exert its inhibitory effect. YFP-Shp2C463A-expressing cells have elevated phospho-SIRPα levels and an increased Shp2-SIRPα interaction compared with YFP-WT Shp2-expressing cells. Collectively, these findings indicate that Shp2 phosphatase function positively regulates Dectin-1- and CR3-stimulated ROS production in macrophages by dephosphorylating and thus mitigating the inhibitory function of SIRPα and by promoting Erk activation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Approximating the 0-1 Multiple Knapsack Problem with Agent Decomposition and Market Negotiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smolinski, B.

The 0-1 multiple knapsack problem appears in many domains from financial portfolio management to cargo ship stowing. Methods for solving it range from approximate algorithms, such as greedy algorithms, to exact algorithms, such as branch and bound. Approximate algorithms have no bounds on how poorly they perform and exact algorithms can suffer from exponential time and space complexities with large data sets. This paper introduces a market model based on agent decomposition and market auctions for approximating the 0-1 multiple knapsack problem, and an algorithm that implements the model (M(x)). M(x) traverses the solution space rather than getting caught inmore » a local maximum, overcoming an inherent problem of many greedy algorithms. The use of agents ensures that infeasible solutions are not considered while traversing the solution space and that traversal of the solution space is not just random, but is also directed. M(x) is compared to a bound and bound algorithm (BB) and a simple greedy algorithm with a random shuffle (G(x)). The results suggest that M(x) is a good algorithm for approximating the 0-1 Multiple Knapsack problem. M(x) almost always found solutions that were close to optimal in a fraction of the time it took BB to run and with much less memory on large test data sets. M(x) usually performed better than G(x) on hard problems with correlated data.« less

A class of monolayer metal halogenides MX{sub 2}: Electronic structures and band alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Feng; Wang, Weichao; Luo, Xiaoguang

2016-03-28

With systematic first principles calculations, a class of monolayer metal halogenides MX{sub 2} (M = Mg, Ca, Zn, Cd, Ge, Pb; M = Cl, Br, I) has been proposed. Our study indicates that these monolayer materials are semiconductors with the band gaps ranging from 2.03 eV of ZnI{sub 2} to 6.08 eV of MgCl{sub 2}. Overall, the band gap increases with the increase of the electronegativity of the X atom or the atomic number of the metal M. Meanwhile, the band gaps of monolayer MgX{sub 2} (X = Cl, Br) are direct while those of other monolayers are indirect. Based on the band edge curvatures, the derived electronmore » (m{sub e}) and hole (m{sub h}) effective masses of MX{sub 2} monolayers are close to their corresponding bulk values except that the m{sub e} of CdI{sub 2} is three times larger and the m{sub h} for PbI{sub 2} is twice larger. Finally, the band alignments of all the studied MX{sub 2} monolayers are provided using the vacuum level as energy reference. These theoretical results may not only introduce the monolayer metal halogenides family MX{sub 2} into the emerging two-dimensional materials, but also provide insights into the applications of MX{sub 2} in future electronic, visible and ultraviolet optoelectronic devices.« less

Soybean-derived Bowman-Birk Inhibitor (BBI) Inhibits HIV Replication in Macrophages.

PubMed

Ma, Tong-Cui; Zhou, Run-Hong; Wang, Xu; Li, Jie-Liang; Sang, Ming; Zhou, Li; Zhuang, Ke; Hou, Wei; Guo, De-Yin; Ho, Wen-Zhe

2016-10-13

The Bowman-Birk inhibitor (BBI), a soybean-derived protease inhibitor, is known to have anti-inflammatory effect in both in vitro and in vivo systems. Macrophages play a key role in inflammation and immune activation, which is implicated in HIV disease progression. Here, we investigated the effect of BBI on HIV infection of peripheral blood monocyte-derived macrophages. We demonstrated that BBI could potently inhibit HIV replication in macrophages without cytotoxicity. Investigation of the mechanism(s) of BBI action on HIV showed that BBI induced the expression of IFN-β and multiple IFN stimulated genes (ISGs), including Myxovirus resistance protein 2 (Mx2), 2',5'-oligoadenylate synthetase (OAS-1), Virus inhibitory protein (viperin), ISG15 and ISG56. BBI treatment of macrophages also increased the expression of several known HIV restriction factors, including APOBEC3F, APOBEC3G and tetherin. Furthermore, BBI enhanced the phosphorylation of IRF3, a key regulator of IFN-β. The inhibition of IFN-β pathway by the neutralization antibody to type I IFN receptor (Anti-IFNAR) abolished BBI-mediated induction of the anti-HIV factors and inhibition of HIV in macrophages. These findings that BBI could activate IFN-β-mediated signaling pathway, initialize the intracellular innate immunity in macrophages and potently inhibit HIV at multiple steps of viral replication cycle indicate the necessity to further investigate BBI as an alternative and cost-effective anti-HIV natural product.

IFN-stimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses

PubMed Central

Lenschow, Deborah J.; Lai, Caroline; Frias-Staheli, Natalia; Giannakopoulos, Nadia V.; Lutz, Andrew; Wolff, Thorsten; Osiak, Anna; Levine, Beth; Schmidt, Robert E.; García-Sastre, Adolfo; Leib, David A.; Pekosz, Andrew; Knobeloch, Klaus-Peter; Horak, Ivan; Virgin, Herbert Whiting

2007-01-01

Type I interferons (IFNs) play an essential role in the host response to viral infection through the induction of numerous IFN-stimulated genes (ISGs), including important antiviral molecules such as PKR, RNase L, Mx, and iNOS. Yet, additional antiviral ISGs likely exist. IFN-stimulated gene 15 (ISG15) is a ubiquitin homolog that is rapidly up-regulated after viral infection, and it conjugates to a wide array of host proteins. Although it has been hypothesized that ISG15 functions as an antiviral molecule, the initial evaluation of ISG15-deficient mice revealed no defects in their responses to vesicular stomatitis virus or lymphocytic choriomeningitis virus, leaving open the important question of whether ISG15 is an antiviral molecule in vivo. Here we demonstrate that ISG15 is critical for the host response to viral infection. ISG15−/− mice are more susceptible to influenza A/WSN/33 and influenza B/Lee/40 virus infections. ISG15−/− mice also exhibited increased susceptibility to both herpes simplex virus type 1 and murine gammaherpesvirus 68 infection and to Sindbis virus infection. The increased susceptibility of ISG15−/− mice to Sindbis virus infection was rescued by expressing wild-type ISG15, but not a mutant form of ISG15 that cannot form conjugates, from the Sindbis virus genome. The demonstration of ISG15 as a novel antiviral molecule with activity against both RNA and DNA viruses provides a target for the development of therapies against important human pathogens. PMID:17227866

Xylitol production by genetically modified industrial strain of Saccharomyces cerevisiae using glycerol as co-substrate.

PubMed

Kogje, Anushree B; Ghosalkar, Anand

2017-06-01

Xylitol is commercially used in chewing gum and dental care products as a low calorie sweetener having medicinal properties. Industrial yeast strain of S. cerevisiae was genetically modified to overexpress an endogenous aldose reductase gene GRE3 and a xylose transporter gene SUT1 for the production of xylitol. The recombinant strain (XP-RTK) carried the expression cassettes of both the genes and the G418 resistance marker cassette KanMX integrated into the genome of S. cerevisiae. Short segments from the 5' and 3' delta regions of the Ty1 retrotransposons were used as homology regions for integration of the cassettes. Xylitol production by the industrial recombinant strain was evaluated using hemicellulosic hydrolysate of the corn cob with glucose as the cosubstrate. The recombinant strain XP-RTK showed significantly higher xylitol productivity (212 mg L -1  h -1 ) over the control strain XP (81 mg L -1  h -1 ). Glucose was successfully replaced by glycerol as a co-substrate for xylitol production by S. cerevisiae. Strain XP-RTK showed the highest xylitol productivity of 318.6 mg L -1  h -1 and titre of 47 g L -1 of xylitol at 12 g L -1 initial DCW using glycerol as cosubstrate. The amount of glycerol consumed per amount of xylitol produced (0.47 mol mol -1 ) was significantly lower than glucose (23.7 mol mol -1 ). Fermentation strategies such as cell recycle and use of the industrial nitrogen sources were demonstrated using hemicellulosic hydrolysate for xylitol production.

Molecular Analyses of Vibrio cholerae O1 Clinical Strains, Including New Nontoxigenic Variants Isolated in Mexico during the Cholera Epidemic Years between 1991 and 2000▿

PubMed Central

Lizárraga-Partida, Marcial Leonardo; Quilici, Marie-Laure

2009-01-01

We studied the evolution of Vibrio cholerae O1 during the 1991 to 2000 cholera epidemic in Mexico by biochemical, serological, and molecular characterization of strains collected during this period. Strains were divided into toxigenic and nontoxigenic groups according to the presence or absence of genes encoding cholera toxin. As previously reported, we characterized two populations among toxigenic strains, which were present from the first year of the epidemic. BglI rRNA analysis revealed that these strains had ribotype profiles, denoted M5 and M6 in our study, that were identical to those previously designated Koblavi B5 or Popovic 5 and Popovic 6a or Tamayo B21a, respectively. Ribotype M5 was isolated between 1991 and 1993. This ribotype had a low level of genetic variation as detected by pulsed-field gel electrophoresis (PFGE). Ribotype M6 persisted from 1991 to 2000. However, PFGE profiles suggested that two epidemiologically unrelated strains coexisted within this single ribotype from 1995 until the end of the epidemic. We identified three new BglI ribotypes, Mx1, Mx2, and Mx3, from nontoxigenic V. cholerae O1 strains isolated between 1998 and 2000; one of them grouped strains positive for the toxin-coregulated pilus island. They differed from nontoxigenic clones isolated in Latin America and on the U.S. Gulf Coast and are probably autochthonous Mexican V. cholerae O1 variants. Most of these new variants were isolated from states surrounding the Gulf of Mexico, where the highest incidence of cholera in the country was recorded. Thus, the Mexican Gulf Coast, like the U.S. Gulf Coast, may act as an environmental reservoir of V. cholerae O1. PMID:19213700

Molecular analyses of Vibrio cholerae O1 clinical strains, including new nontoxigenic variants isolated in Mexico during the Cholera epidemic years between 1991 and 2000.

PubMed

Lizárraga-Partida, Marcial Leonardo; Quilici, Marie-Laure

2009-05-01

We studied the evolution of Vibrio cholerae O1 during the 1991 to 2000 cholera epidemic in Mexico by biochemical, serological, and molecular characterization of strains collected during this period. Strains were divided into toxigenic and nontoxigenic groups according to the presence or absence of genes encoding cholera toxin. As previously reported, we characterized two populations among toxigenic strains, which were present from the first year of the epidemic. BglI rRNA analysis revealed that these strains had ribotype profiles, denoted M5 and M6 in our study, that were identical to those previously designated Koblavi B5 or Popovic 5 and Popovic 6a or Tamayo B21a, respectively. Ribotype M5 was isolated between 1991 and 1993. This ribotype had a low level of genetic variation as detected by pulsed-field gel electrophoresis (PFGE). Ribotype M6 persisted from 1991 to 2000. However, PFGE profiles suggested that two epidemiologically unrelated strains coexisted within this single ribotype from 1995 until the end of the epidemic. We identified three new BglI ribotypes, Mx1, Mx2, and Mx3, from nontoxigenic V. cholerae O1 strains isolated between 1998 and 2000; one of them grouped strains positive for the toxin-coregulated pilus island. They differed from nontoxigenic clones isolated in Latin America and on the U.S. Gulf Coast and are probably autochthonous Mexican V. cholerae O1 variants. Most of these new variants were isolated from states surrounding the Gulf of Mexico, where the highest incidence of cholera in the country was recorded. Thus, the Mexican Gulf Coast, like the U.S. Gulf Coast, may act as an environmental reservoir of V. cholerae O1.

The calibration of the WISE W1 and W2 Tully-Fisher relation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neill, J. D.; Seibert, Mark; Scowcroft, Victoria

2014-09-10

In order to explore local large-scale structures and velocity fields, accurate galaxy distance measures are needed. We now extend the well-tested recipe for calibrating the correlation between galaxy rotation rates and luminosities—capable of providing such distance measures—to the all-sky, space-based imaging data from the Wide-field Infrared Survey Explorer (WISE) W1 (3.4 μm) and W2 (4.6 μm) filters. We find a correlation of line width to absolute magnitude (known as the Tully-Fisher relation, TFR) of M{sub W1}{sup b,i,k,a}=−20.35−9.56(log W{sub mx}{sup i}−2.5) (0.54 mag rms) and M{sub W2}{sup b,i,k,a}=−19.76−9.74(log W{sub mx}{sup i}−2.5) (0.56 mag rms) from 310 galaxies in 13 clusters. We update themore » I-band TFR using a sample 9% larger than in Tully and Courtois. We derive M{sub I}{sup b,i,k}=−21.34−8.95(log W{sub mx}{sup i}−2.5) (0.46 mag rms). The WISE TFRs show evidence of curvature. Quadratic fits give M{sub W1}{sup b,i,k,a}=−20.48−8.36(log W{sub mx}{sup i}−2.5)+3.60(log W{sub mx}{sup i}−2.5){sup 2} (0.52 mag rms) and M{sub W2}{sup b,i,k,a}=−19.91−8.40(log W{sub mx}{sup i}−2.5)+4.32(log W{sub mx}{sup i}−2.5){sup 2} (0.55 mag rms). We apply an I-band –WISE color correction to lower the scatter and derive M{sub C{sub W{sub 1}}}=−20.22−9.12(log W{sub mx}{sup i}−2.5) and M{sub C{sub W{sub 2}}}=−19.63−9.11(log W{sub mx}{sup i}−2.5) (both 0.46 mag rms). Using our three independent TFRs (W1 curved, W2 curved, and I band), we calibrate the UNION2 Type Ia supernova sample distance scale and derive H {sub 0} = 74.4 ± 1.4(stat) ± 2.4(sys) km s{sup –1} Mpc{sup –1} with 4% total error.« less

Induction of interferon-λ contributes to TLR3 and RIG-I activation-mediated inhibition of herpes simplex virus type 2 replication in human cervical epithelial cells.

PubMed

Zhou, Li; Li, Jie-Liang; Zhou, Yu; Liu, Jin-Biao; Zhuang, Ke; Gao, Jian-Feng; Liu, Shi; Sang, Ming; Wu, Jian-Guo; Ho, Wen-Zhe

2015-12-01

Is it possible to immunologically activate human cervical epithelial cells to produce antiviral factors that inhibit herpes simplex virus type 2 (HSV-2) replication? Our results indicate that human cervical epithelial cells possess a functional TLR3/RIG-I signaling system, the activation of which can mount an Interferon-λ (IFN-λ)-mediated anti-HSV-2 response. There is limited information about the role of cervical epithelial cells in genital innate immunity against HSV-2 infection. We examined the expression of toll-like receptors (TLRs) and retinoic acid-inducible I (RIG-I) in End1/E6E7 cells by real-time PCR. The IFN-λ induced by TLR3 and RIG-I activation of End1/E6E7 cells was also examined by real-time PCR and ELISA. HSV-2 infection of End1/E6E7 cells was evaluated by the real-time PCR detection of HSV-2 gD expression. The antibody to IL-10Rβ was used to determine whether IFN-λ contributes to TLR3/RIG-I mediated HSV-2 inhibition. Expression of interferon regulatory factor 3 (IRF3), IRF7, IFN-stimulated gene 56 (ISG56), 2'-5'-oligoadenylate synthetase I (OAS-1) and myxovirus resistance A (MxA) were determined by the real-time PCR and western blot. End1/E6E7 cells were transfected with shRNA to knockdown the IRF3, IRF7 or RIG-I expression. Student's t-test and post Newman-Keuls test were used to analyze stabilized differences in the immunological parameters above between TLR3/RIG-I-activated cells and control cells. Human cervical epithelial cells expressed functional TLR3 and RIG-I, which could be activated by poly I:C and 5'ppp double-strand RNAs (5'ppp dsRNA), resulting in the induction of endogenous interferon lambda (IFN-λ). The induced IFN-λ contributed to TLR3/RIG-I-mediated inhibition of HSV-2 replication in human cervical epithelial cells, as an antibody to IL-10Rβ, an IFN-λ receptor subunit, could compromise TLR3/RIG-I-mediated inhibition of HSV-2. Further studies showed that TLR3/RIG-I signaling in the cervical epithelial cells by dsRNA induced the expression of the IFN-stimulated genes (ISGs), ISG56, 2'-5'-oligoadenylate synthetase I (OAS-1) and myxovirus resistance A (MxA), the key antiviral elements in the IFN signaling pathway. In addition, we observed that the topical treatment of genital mucosa with poly I:C could protect mice from genital HSV-2 infection. Future prospective studies with primary cells and suitable animal models are needed in order to confirm these outcomes. The findings provide direct and compelling evidence that there is intracellular expression and regulation of IFN-λ in human cervical epithelial cells, which may have a key role in the innate genital protection against viral infections. Not applicable. This work was supported by the National Natural Science Foundation of China (81301428 to L.Z. and 81271334 to W.-Z.H.), the Fundamental Research Funds for the Central Universities (2042015kf0188 to L.Z.), the China Postdoctoral Science Foundation (2013M531745 to L.Z.), the Development Program of China ('973', 2012CB518900 to W.-Z.H.) from the Ministry of Science and Technology of the People's Republic of China, grants (DA12815 and DA022177 to W.-Z.H.) from the National Institute on Drug Abuse (NIDA) and the open project of Hubei Key Laboratory of Wudang Local Chinese Medicine Research (WDCM005 to M.S.). The authors declare no competing financial interests. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Current advances in synchrotron radiation instrumentation for MX experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Owen, Robin L.; Juanhuix, Jordi; Fuchs, Martin

2016-07-01

Following pioneering work 40 years ago, synchrotron beamlines dedicated to macromolecular crystallography (MX) have improved in almost every aspect as instrumentation has evolved. Beam sizes and crystal dimensions are now on the single micron scale while data can be collected from proteins with molecular weights over 10 MDa and from crystals with unit cell dimensions over 1000 Å. Furthermore it is possible to collect a complete data set in seconds, and obtain the resulting structure in minutes. The impact of MX synchrotron beamlines and their evolution is reflected in their scientific output, and MX is now the method of choicemore » for a variety of aims from ligand binding to structure determination of membrane proteins, viruses and ribosomes, resulting in a much deeper understanding of the machinery of life. A main driving force of beamline evolution have been advances in almost every aspect of the instrumentation comprising a synchrotron beamline. In this review we aim to provide an overview of the current status of instrumentation at modern MX experiments. The most critical optical components are discussed, as are aspects of endstation design, sample delivery, visualisation and positioning, the sample environment, beam shaping, detectors and data acquisition and processing.« less

Current advances in synchrotron radiation instrumentation for MX experiments.

PubMed

Owen, Robin L; Juanhuix, Jordi; Fuchs, Martin

2016-07-15

Following pioneering work 40 years ago, synchrotron beamlines dedicated to macromolecular crystallography (MX) have improved in almost every aspect as instrumentation has evolved. Beam sizes and crystal dimensions are now on the single micron scale while data can be collected from proteins with molecular weights over 10 MDa and from crystals with unit cell dimensions over 1000 Å. Furthermore it is possible to collect a complete data set in seconds, and obtain the resulting structure in minutes. The impact of MX synchrotron beamlines and their evolution is reflected in their scientific output, and MX is now the method of choice for a variety of aims from ligand binding to structure determination of membrane proteins, viruses and ribosomes, resulting in a much deeper understanding of the machinery of life. A main driving force of beamline evolution have been advances in almost every aspect of the instrumentation comprising a synchrotron beamline. In this review we aim to provide an overview of the current status of instrumentation at modern MX experiments. The most critical optical components are discussed, as are aspects of endstation design, sample delivery, visualisation and positioning, the sample environment, beam shaping, detectors and data acquisition and processing. Copyright © 2016. Published by Elsevier Inc.

Current advances in synchrotron radiation instrumentation for MX experiments

PubMed Central

Owen, Robin L.; Juanhuix, Jordi; Fuchs, Martin

2017-01-01

Following pioneering work 40 years ago, synchrotron beamlines dedicated to macromolecular crystallography (MX) have improved in almost every aspect as instrumentation has evolved. Beam sizes and crystal dimensions are now on the single micron scale while data can be collected from proteins with molecular weights over 10 MDa and from crystals with unit cell dimensions over 1000 Å. Furthermore it is possible to collect a complete data set in seconds, and obtain the resulting structure in minutes. The impact of MX synchrotron beamlines and their evolution is reflected in their scientific output, and MX is now the method of choice for a variety of aims from ligand binding to structure determination of membrane proteins, viruses and ribosomes, resulting in a much deeper understanding of the machinery of life. A main driving force of beamline evolution have been advances in almost every aspect of the instrumentation comprising a synchrotron beamline. In this review we aim to provide an overview of the current status of instrumentation at modern MX experiments. The most critical optical components are discussed, as are aspects of endstation design, sample delivery, visualization and positioning, the sample environment, beam shaping, detectors and data acquisition and processing. PMID:27046341

Current advances in synchrotron radiation instrumentation for MX experiments

DOE PAGES

Owen, Robin L.; Juanhuix, Jordi; Fuchs, Martin

2016-04-01

Following pioneering work 40 years ago, synchrotron beamlines dedicated to macromolecular crystallography (MX) have improved in almost every aspect as instrumentation has evolved. Beam sizes and crystal dimensions are now on the single micron scale while data can be collected from proteins with molecular weights over 10 MDa and from crystals with unit cell dimensions over 1000 Å. Moreover, it is possible to collect a complete data set in seconds, and obtain the resulting structure in minutes. The impact of MX synchrotron beamlines and their evolution is reflected in their scientific output, and MX is now the method of choicemore » for a variety of aims from ligand binding to structure determination of membrane proteins, viruses and ribosomes, resulting in a much deeper understanding of the machinery of life. One main driving force of beamline evolution have been advances in almost every aspect of the instrumentation comprising a synchrotron beamline. In this review we aim to provide an overview of the current status of instrumentation at modern MX experiments. Furthermore, we discuss the most critical optical components, aspects of endstation design, sample delivery, visualisation and positioning, the sample environment, beam shaping, detectors and data acquisition and processing.« less

Dynamic Modulation of Expression of Lentiviral Restriction Factors in Primary CD4+ T Cells following Simian Immunodeficiency Virus Infection.

PubMed

Rahmberg, Andrew R; Rajakumar, Premeela A; Billingsley, James M; Johnson, R Paul

2017-04-01

Although multiple restriction factors have been shown to inhibit HIV/SIV replication, little is known about their expression in vivo Expression of 45 confirmed and putative HIV/SIV restriction factors was analyzed in CD4 + T cells from peripheral blood and the jejunum in rhesus macaques, revealing distinct expression patterns in naive and memory subsets. In both peripheral blood and the jejunum, memory CD4 + T cells expressed higher levels of multiple restriction factors compared to naive cells. However, relative to their expression in peripheral blood CD4 + T cells, jejunal CCR5 + CD4 + T cells exhibited significantly lower expression of multiple restriction factors, including APOBEC3G , MX2 , and TRIM25 , which may contribute to the exquisite susceptibility of these cells to SIV infection. In vitro stimulation with anti-CD3/CD28 antibodies or type I interferon resulted in upregulation of distinct subsets of multiple restriction factors. After infection of rhesus macaques with SIVmac239, the expression of most confirmed and putative restriction factors substantially increased in all CD4 + T cell memory subsets at the peak of acute infection. Jejunal CCR5 + CD4 + T cells exhibited the highest levels of SIV RNA, corresponding to the lower restriction factor expression in this subset relative to peripheral blood prior to infection. These results illustrate the dynamic modulation of confirmed and putative restriction factor expression by memory differentiation, stimulation, tissue microenvironment and SIV infection and suggest that differential expression of restriction factors may play a key role in modulating the susceptibility of different populations of CD4 + T cells to lentiviral infection. IMPORTANCE Restriction factors are genes that have evolved to provide intrinsic defense against viruses. HIV and simian immunodeficiency virus (SIV) target CD4 + T cells. The baseline level of expression in vivo and degree to which expression of restriction factors is modulated by conditions such as CD4 + T cell differentiation, stimulation, tissue location, or SIV infection are currently poorly understood. We measured the expression of 45 confirmed and putative restriction factors in primary CD4 + T cells from rhesus macaques under various conditions, finding dynamic changes in each state. Most dramatically, in acute SIV infection, the expression of almost all target genes analyzed increased. These are the first measurements of many of these confirmed and putative restriction factors in primary cells or during the early events after SIV infection and suggest that the level of expression of restriction factors may contribute to the differential susceptibility of CD4 + T cells to SIV infection. Copyright © 2017 American Society for Microbiology.

Prospective multicenter clinical trial to evaluate the safety and effectiveness of a new glistening-free one-piece acrylic toric intraocular lens.

PubMed

Packer, Mark; Williams, Jon I; Feinerman, Gregg; Hope, Richard S

2018-01-01

Glistening formation in the intraocular lens (IOL) optic has the potential to impact quality of vision. The enVista One-Piece Hydrophobic Acrylic Spherical IOL Model MX60 (MX60 IOL) is currently the only US Food and Drug Administration-approved IOL with a label of "no glistenings". The purpose of this prospective, multicenter, partially randomized, partially controlled, double-masked, pivotal study was to evaluate the safety and effectiveness of the enVista One-Piece Hydrophobic Acrylic MX60T Toric IOL (enVista MX60T Toric IOL). Subjects (n=191) were implanted with the enVista MX60T Toric IOL (cylinder powers 1.25, 2.00, or 2.75 D) or the parent MX60 IOL (control). Eyes within the lowest range of corneal astigmatism were randomized to receive either Toric 1.25 D IOL or control IOL in a 1:1 ratio. All subjects with corneal astigmatism requiring 2.00 or 2.75 D cylinder IOLs received toric IOLs. Rotational stability, cylinder reduction, and best-corrected distance visual acuity were primary effectiveness endpoints measured at Visit 4 (120-180 days postoperatively). Visit 4 mean absolute axis misalignment in the All Toric group was 4.68°±7.33°, and all subjects had ≤5° absolute rotation from Visit 3 to Visit 4. The 1.25 D group had significantly greater improvement in dioptric cylinder reduction ( P <0.001), percent cylinder reduction ( P <0.001), and mean uncorrected distance visual acuity ( P <0.001), compared to control at Visit 4. Most adverse events (AEs) were mild, with no serious AEs in the study eyes. The rates of cumulative AEs through Visit 4 were below International Organization for Standardization (ISO) standard 11979-7 AE rates. enVista MX60T Toric IOL is safe and effective for patients with preoperative corneal astigmatism undergoing IOL implantation.

TEM characterization on new 9% Cr advanced steels thermomechanical treated after tempering

NASA Astrophysics Data System (ADS)

Fernández, P.; Hoffmann, J.; Rieth, M.; Roldán, M.; Gómez-Herrero, A.

2018-03-01

Phase transformation on new six reduced activation ferritic/martensitic steels (RAFMs) was investigated to provide the basis for the design and development of advanced steels to maintain adequate strength and creep resistance above 500 °C. The new alloys are designed to increase the amount of fine MX precipitates and reduce coarse M23C6 carbides through alloy composition refinement and the application of thermomechanical treatments. The microstructural investigations by TEM have shown M23C6, M2X, and MX precipitation after tempering at 700 °C/2h with low dislocation recovery, while at 825 °C/2h the martensite developed to subgrain formation and growth. At this stage, only M23C6 and MX were detected. Preliminary results demonstrate that it is feasible to produce fine MX strengthened particles dispersed in the matrix with further optimization of tempering treatments.

Inorganic fullerene-like structures and nanotubes of MX{sub 2} (M = W, Mo; X = S, Se)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tenne, R.; Homyonfer, M.; Frey, G.L.

Extensive investigation of the newly discovered inorganic fullerene-like (IF-MX{sub 2}) and nanotubes of metal dichalcogenides, is reported. Our findings suggest that the IF-MX{sub 2} material constitute a new phase between the low temperature amorphous precursor and the bulk 2H polymorph, which is obtained upon annealing above 950{degrees}C. The energy bandgap of the NP, was found to be somewhat smaller than that of the bulk 2H phase, and possible explanations for that phenomenon are forwarded. New synthetic routes allow for the production of a few grams of IF-WS{sub 2} (macrosynthesis), on the one hand, and a single IF in a predeterminedmore » position (nanosynthesis), on the other hand. Synthesis of new IF-MX{sub 2} from different layered compounds, will be reported. Measurements of the optical properties; photocatalytic and photoelectrochemical effects of these materials, will be reported.« less

Complete Mitochondrial and Plastid Genomes of the Green Microalga Trebouxiophyceae sp. Strain MX-AZ01 Isolated from a Highly Acidic Geothermal Lake

PubMed Central

Martínez-Romero, Esperanza

2012-01-01

We report the complete organelle genome sequences of Trebouxiophyceae sp. strain MX-AZ01, an acidophilic green microalga isolated from a geothermal field in Mexico. This eukaryote has the remarkable ability to thrive in a particular shallow lake with emerging hot springs at the bottom, extremely low pH, and toxic heavy metal concentrations. Trebouxiophyceae sp. MX-AZ01 represents one of few described photosynthetic eukaryotes living in such a hostile environment. The organelle genomes of Trebouxiophyceae sp. MX-AZ01 are remarkable. The plastid genome sequence currently presents the highest G+C content for a trebouxiophyte. The mitochondrial genome sequence is the largest reported to date for the Trebouxiophyceae class of green algae. The analysis of the genome sequences presented here provides insight into the evolution of organelle genomes of trebouxiophytes and green algae. PMID:23104370

Reassortant group A rotavirus from straw-colored fruit bat (Eidolon helvum).

PubMed

Esona, Mathew D; Mijatovic-Rustempasic, Slavica; Conrardy, Christina; Tong, Suxiang; Kuzmin, Ivan V; Agwanda, Bernard; Breiman, Robert F; Banyai, Krisztian; Niezgoda, Michael; Rupprecht, Charles E; Gentsch, Jon R; Bowen, Michael D

2010-12-01

Bats are known reservoirs of viral zoonoses. We report genetic characterization of a bat rotavirus (Bat/KE4852/07) detected in the feces of a straw-colored fruit bat (Eidolon helvum). Six bat rotavirus genes (viral protein [VP] 2, VP6, VP7, nonstructural protein [NSP] 2, NSP3, and NSP5) shared ancestry with other mammalian rotaviruses but were distantly related. The VP4 gene was nearly identical to that of human P[6] rotavirus strains, and the NSP4 gene was closely related to those of previously described mammalian rotaviruses, including human strains. Analysis of partial sequence of the VP1 gene indicated that it was distinct from cognate genes of other rotaviruses. No sequences were obtained for the VP3 and NSP1 genes of the bat rotavirus. This rotavirus was designated G25-P[6]-I15-R8(provisional)-C8-Mx-Ax-N8-T11-E2-H10. Results suggest that several reassortment events have occurred between human, animal, and bat rotaviruses. Several additional rotavirus strains were detected in bats.

Reassortant Group A Rotavirus from Straw-colored Fruit Bat (Eidolon helvum)

PubMed Central

Esona, Mathew D.; Mijatovic-Rustempasic, Slavica; Conrardy, Christina; Tong, Suxiang; Kuzmin, Ivan V.; Agwanda, Bernard; Breiman, Robert F.; Banyai, Krisztian; Niezgoda, Michael; Rupprecht, Charles E.; Gentsch, Jon R.

2010-01-01

Bats are known reservoirs of viral zoonoses. We report genetic characterization of a bat rotavirus (Bat/KE4852/07) detected in the feces of a straw-colored fruit bat (Eidolon helvum). Six bat rotavirus genes (viral protein [VP] 2, VP6, VP7, nonstructural protein [NSP] 2, NSP3, and NSP5) shared ancestry with other mammalian rotaviruses but were distantly related. The VP4 gene was nearly identical to that of human P[6] rotavirus strains, and the NSP4 gene was closely related to those of previously described mammalian rotaviruses, including human strains. Analysis of partial sequence of the VP1 gene indicated that it was distinct from cognate genes of other rotaviruses. No sequences were obtained for the VP3 and NSP1 genes of the bat rotavirus. This rotavirus was designated G25-P[6]-I15-R8(provisional)-C8-Mx-Ax-N8-T11-E2-H10. Results suggest that several reassortment events have occurred between human, animal, and bat rotaviruses. Several additional rotavirus strains were detected in bats. PMID:21122212

Mammographic and Ultrasonographic Findings of Oxidized Regenerated Cellulose in Breast Cancer Surgery: A 5-Year Experience.

PubMed

Giuliani, Michela; Fubelli, Rita; Patrolecco, Federica; Rella, Rossella; Borelli, Cristina; Buccheri, Chiara; Di Giovanni, Silvia Eleonora; Belli, Paolo; Romani, Maurizio; Rinaldi, Pierluigi; Bufi, Enida; Franceschini, Gianluca; Bonomo, Lorenzo

2015-10-01

The purpose of this study was to describe the ultrasonographic (US) and mammographic (MX) findings in patients who underwent breast-conserving surgery followed by oxidized regenerated cellulose (ORC) implantation in the surgical cavity and their size variations in follow-up. We retrospectively reviewed 417 MX and 743 US images performed between January 2009 and January 2014 for 262 women who underwent breast-conserving surgery. All patients underwent US, only 203 women underwent MX examination. In 170 of 262 patients, US examinations showed abnormal findings. Three main US patterns were identified: (1) complex masses: well-encapsulated ipoisoechoic lesions with circumscribed margins with internal hyperechoic nodules (56%); (2) hypoanechoic lesions without internal hyperechoic nodules (24%); and (3) completely anechoic collections (20%). Moreover, Doppler ultrasound examination was performed on all of the patients. In 95 of 203 patients, MX examinations showed abnormalities. Four main MX patterns were identified: (1) round or oval opacity with circumscribed margins (58%); (2) round or oval opacity with indistinct or ill-defined margins (17%); (3) irregular opacity with indistinct or spiculated margins (9%); and (4) architectural distortion or focal asymmetry (15%). Most of the lesions showed a decrease in size at US and MX follow-up examination and the decrease was statistically significant (P < .01). When applied to the surgical residual cavity, ORC aids to control local hemorrhage and reduce the risk of postoperative infections, but can lead to alterations in surgical scar. Thus, knowledge of the radiological findings might allow avoidance of misdiagnosis of tumor recurrence or unnecessary diagnostic examinations. Copyright © 2015 Elsevier Inc. All rights reserved.

Skin colour, skin redness and melanin biometric measurements: comparison study between Antera(®) 3D, Mexameter(®) and Colorimeter(®).

PubMed

Matias, Ana Rita; Ferreira, Marta; Costa, Paulo; Neto, Patrícia

2015-08-01

The actual skin colorimeters analyse reflect values from a limited number of broad spectral bands and consequently present limited reproducibility and specificity when measuring skin colour. Here, Antera 3D(®) , a new device which uses reflectance mapping of seven different light wavelengths spanning the entire visible spectrum, has been compared with Mexameter(®) MX-18, an established narrow-band reflectance spectrophotometer and with Colorimeter(®) CL-400, an established tristimulus colorimetric instrument. Thirty volunteers were exposed to a controlled ultra-violet B light. Measurements with Antera 3D(®) , Mexameter(®) MX-18 and Colorimeter(®) CL-400 were done before treatment and after 2, 7 and 14 days. Antera 3D(®) showed to have a better sensitivity and specificity than Mexameter(®) MX-18 regarding the melanin parameter. A similar sensitivity between Antera 3D(®) and Mexameter(®) MX-18 was found for erythema determination and also for the Commission Internationale de l'Eclairage L*, a* and b* parameters between Antera 3D(®) and Colorimeter(®) CL-400. Good correlations were observed for all the parameters analysed. Repeatability of Mexameter(®) MX-18 and Colorimeter(®) CL-400 values were lower than that of Antera 3D(®) for all the parameters analysed. Antera 3D(®) , such as Mexameter(®) MX-18 and Colorimeter(®) CL-400, are robust, sensitive and precise equipment for the skin colour analysis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Miscanthus x giganteus xylooligosaccharides: Purification andfermentation

USDA-ARS?s Scientific Manuscript database

A procedure was developed to recover xylooligosaccharides (XOS) from Miscanthus x giganteus (MxG) hydrolyzates. MxG hydrolyzates were prepared using autohydrolysis, and XOS rich fractions were acquired using activated carbon adsorption and stepwise ethanol elution. The combined XOS fractions were pu...

Theoretical Studies in Chemical Kinetics - Annual Report, 1970.

DOE R&D Accomplishments Database

Karplus, Martin

1970-10-01

The research performed includes (a) Alkali-Halide, Alkali-Halide (MX, M?X?) Exchange Reactions; (b) Inversion Problem; (c) Quantum Mechanics of Scattering Processes, (d) Transition State Analysis of Classical Trajectories, (e) Differential Cross Sections from Classical Trajectories; and (f) Other Studies.

Helicopter Blade Analysis

DTIC Science & Technology

1947-01-01

9, 9^ + 9, ) • sin (*-©„)- 0 za ^ yf Neglecting the gravity forces and using the above assumptions, ( jt- 8o ) reduces to U-ßZ) i pcV2 C...ez ), by dropping subscript "f" and setting 0 = Q , d* = 0 , becomes (iC-84) Tg pcV2 C1 dx - mx (0 9^ + 9 ) dx + dS = 0 Subtracting {a-&4...from (ff-ɝ£ ): (x-a^-) | pcV2 (C, - C,) dx - mx Of (<t> - 8 ) dx f za y - mx (9 - 9 ) dx + dS„ - dS H- P do = 0 Integrating (z-83

Collider signals of maximal flavor violation: Same-sign leptons from same-sign top quarks at the Fermilab Tevatron

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bar-Shalom, Shaouly; Department of Physics and Astronomy, University of California, Irvine, California 92697; Rajaraman, Arvind

2008-08-01

In models of maximal flavor violation (MxFV) suggested in [S. Bar-Shalom and A. Rajaraman, Phys. Rev. D 77, 095011 (2008).] there is at least one new scalar {phi}{sub FV} which couples to the quarks via {phi}{sub FV}q{sub i}q{sub j}{proportional_to}{xi}{sub ij} where {xi}{sub i3},{xi}{sub 3i}{approx}V{sub tb} for i=1, 2 and {xi}{sub 33}{approx}V{sub td} and V is the CKM matrix. In this article, we explore the potential phenomenological implications of MxFV for collider experiments. We study MxFV signals of same-sign leptons from same-sign top-quark pair production at the Tevatron and at the LHC. We show that the current Tevatron data set hasmore » strong sensitivity to this signature, for which there are no current limits. For example, if m{sub {phi}{sub FV}}{approx}200 GeV and the MxFV coupling {xi} has a natural value of {approx}1, we expect {approx}12 MxFV events to survive a selection requiring a pair of same-sign leptons, a tagged b-jet and missing transverse energy, over a background of approximately 4-5 events.« less

Mixomics analysis of breast cancer: Long non-coding RNA linc01561 acts as ceRNA involved in the progression of breast cancer.

PubMed

Jiang, Rui; Zhao, Chunming; Gao, Binbin; Xu, Jiawen; Song, Wei; Shi, Peng

2018-06-08

This study aimed at finding the long non-coding RNA (lncRNA), miRNA and mRNA which played critical roles in breast cancer (BrCa) by using mixOmics R package. The BrCa dataset were obtained from TCGA and then analyzed using "DESeq2" R package. Multivariate analyses were performed with the "mixOmics" R package and the first component of the stacked partial least-Squares discriminant analysis results were used for searching the interested lncRNA, miRNA and mRNA. qRT-PCR was applied to identify the bioinformatics results in four BrCa cell lines (MCF7, BT-20, ZR-75-1, and MX-1) and the breast epithelial cell line MCF-10 A. Then cells (MCF-1 and MX-1) were transfected with si-linc01561, miR-145-5p mimics and si-MMP11 to further investigate the effects of linc01561, miR-145-5p and MMP11 on the BrCa cells proliferation and apoptosis. MixOmics results showed that linc01561, miR-145-5p and MMP11 might play important roles in BrCa. qRT-PCR results identified that in BrCa cell lines, linc01561 and MMP11 were higher expressed while miR-145-5p was lower expressed compared with those in epithelial cell line. The linc01561 inhibition elevated miR-145-5p expression and then suppressed MMP11 expression. Moreover, linc01561 inhibition suppressed the BrCa cells proliferation and promoted the apoptosis, which was realized by up-regulating expression of miR-145-5p and down-regulating expression of MMP11. In summary, the findings of this study, based on ceRNA theory, combining the research foundation of miR-145-5p and MMP11, and taking linc01561 as a new study point, provide new insight into molecular-level reversing proliferation and apoptosis of BrCa. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effects of hirami lemon, Citrus depressa Hayata, leaf meal in diets on the immune response and disease resistance of juvenile barramundi, Lates calcarifer (bloch), against Aeromonas hydrophila.

PubMed

Shiu, Ya-Li; Lin, Hsueh-Li; Chi, Chia-Chun; Yeh, Shinn-Pyng; Liu, Chun-Hung

2016-08-01

The present study was conducted to evaluate the dietary supplementation of leaf meal from Citrus depressa Hayata on the growth, innate immune response, and disease resistance of juvenile barramundi, Lates calcarifer. Four diets were formulated to contain 0% (control), 1% (C1), 3% (C3), and 5% (C5) leaf meal, respectively. During a 56 d feeding trial, fish survival, growth performance, and feed efficiency were not significantly different among all groups. For immune response, respiratory burst, superoxide dismutase and lysozyme activities were not significantly different among all groups. However, fish fed the C5 diet for 56 d had significantly higher phagocytic activity. Also, fish fed C3 and C5 diets had significantly higher Mx gene expressions in spleens and head kidneys with nerve necrosis virus injections after 24 h. Disease resistance against Aeromonas hydrophila was increased by the C5 diet. In this study, barramundi fed on a diet containing 5% C. depressa Hayata leaf meal had significantly better innate immune response and disease resistance against A. hydrophila. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparing oncoplastic breast conserving surgery with mastectomy and immediate breast reconstruction: Case-matched patient reported outcomes.

PubMed

Kelsall, Jennett E; McCulley, Stephen J; Brock, Lisa; Akerlund, Malin T E; Macmillan, R Douglas

2017-10-01

Oncoplastic breast conserving surgery (OBCS) allows women who may otherwise have mastectomy and immediate reconstruction (MxIR) the choice to conserve their breast yet avoid deformity. We compared the outcome of these options. Two cohorts meeting study criteria were identified from prospectively audited series of women undergoing OBCS or MxIR. After case matching for age, tumour size and date of surgery, stratification by breast size and controlling for radiotherapy; body image scale (BIS) scores of psychosocial function and patient reported outcome measures (PROMs) for breast appearance and return to function were analysed. A total of 567 women (286 treated by OBCS and 281 by MxIR) fulfilled inclusion criteria. Demographics were similar between the two unmatched cohorts, except for radiotherapy, age and tumour size (all p < 0.001). Overall, BIS score (p = 0.002), self-rated breast appearance, return to work and function (all p < 0.001) significantly favoured OBCS. Case-matched women with larger breasts treated by OBCS reported better BIS scores (mean 3.30 vs. 5.37, p = 0.011) and self-rated breast appearance score (p < 0.001) than MxIR, whereas no significant difference was observed for smaller breasts. BIS and appearance favoured OBCS, regardless of whether radiotherapy would have been avoided if treated by MxIR. OBCS offers suitable women the option to avoid MxIR while providing faster recovery. Better psychosocial and self-rated satisfaction with breast appearance is achieved for OBCS in all groups, regardless of the need for radiotherapy, apart from those women with smaller breasts for whom the results are comparable. Copyright © 2017 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Developing an in silico model of the modulation of base excision repair using methoxyamine for more targeted cancer therapeutics.

PubMed

Gurkan-Cavusoglu, Evren; Avadhani, Sriya; Liu, Lili; Kinsella, Timothy J; Loparo, Kenneth A

2013-04-01

Base excision repair (BER) is a major DNA repair pathway involved in the processing of exogenous non-bulky base damages from certain classes of cancer chemotherapy drugs as well as ionising radiation (IR). Methoxyamine (MX) is a small molecule chemical inhibitor of BER that is shown to enhance chemotherapy and/or IR cytotoxicity in human cancers. In this study, the authors have analysed the inhibitory effect of MX on the BER pathway kinetics using a computational model of the repair pathway. The inhibitory effect of MX depends on the BER efficiency. The authors have generated variable efficiency groups using different sets of protein concentrations generated by Latin hypercube sampling, and they have clustered simulation results into high, medium and low efficiency repair groups. From analysis of the inhibitory effect of MX on each of the three groups, it is found that the inhibition is most effective for high efficiency BER, and least effective for low efficiency repair.

Deviations from idealised geometries part 4: approximately tetrahedral molecules of form MX 2Y 2 studied by SCF and MP2 localised orbital calculations

NASA Astrophysics Data System (ADS)

Palmer, Michael H.

1997-03-01

Using the delocalised wavefunctions from Part 3, for a series of molecules of type MX 2Y 2 where M is tetravalent, and X, Y are either H, Me or halogen, with a triple-zeta plus polarisation basis and either SCF of MP2 methods, the wavefunctions were converted to localised orbitals by the Foster-Boys method. This enabled the LMO to be subject to population analysis for changes in hybridisation in the individual total density of the MX and MY bonds, and some quantitative discussion of the role of hybridisation in Bent's Rule.

Plasma Cholesterol–Induced Lesion Networks Activated before Regression of Early, Mature, and Advanced Atherosclerosis

PubMed Central

Björkegren, Johan L. M.; Hägg, Sara; Jain, Rajeev K.; Cedergren, Cecilia; Shang, Ming-Mei; Rossignoli, Aránzazu; Takolander, Rabbe; Melander, Olle; Hamsten, Anders; Michoel, Tom; Skogsberg, Josefin

2014-01-01

Plasma cholesterol lowering (PCL) slows and sometimes prevents progression of atherosclerosis and may even lead to regression. Little is known about how molecular processes in the atherosclerotic arterial wall respond to PCL and modify responses to atherosclerosis regression. We studied atherosclerosis regression and global gene expression responses to PCL (≥80%) and to atherosclerosis regression itself in early, mature, and advanced lesions. In atherosclerotic aortic wall from Ldlr−/−Apob 100/100 Mttp flox/floxMx1-Cre mice, atherosclerosis regressed after PCL regardless of lesion stage. However, near-complete regression was observed only in mice with early lesions; mice with mature and advanced lesions were left with regression-resistant, relatively unstable plaque remnants. Atherosclerosis genes responding to PCL before regression, unlike those responding to the regression itself, were enriched in inherited risk for coronary artery disease and myocardial infarction, indicating causality. Inference of transcription factor (TF) regulatory networks of these PCL-responsive gene sets revealed largely different networks in early, mature, and advanced lesions. In early lesions, PPARG was identified as a specific master regulator of the PCL-responsive atherosclerosis TF-regulatory network, whereas in mature and advanced lesions, the specific master regulators were MLL5 and SRSF10/XRN2, respectively. In a THP-1 foam cell model of atherosclerosis regression, siRNA targeting of these master regulators activated the time-point-specific TF-regulatory networks and altered the accumulation of cholesterol esters. We conclude that PCL leads to complete atherosclerosis regression only in mice with early lesions. Identified master regulators and related PCL-responsive TF-regulatory networks will be interesting targets to enhance PCL-mediated regression of mature and advanced atherosclerotic lesions. PMID:24586211

p-Nitrophenol and glutathione response in medaka (Oryzias latipes) exposed to MX, a drinking water carcinogen.

PubMed

Geter, David R; Fournie, John W; Brouwer, Marius H; DeAngelo, Anthony B; Hawkins, William E

2003-03-01

When chlorine is introduced into public drinking water for disinfection, it can react with organic compounds in surface waters to form toxic by-products such as 3-chloro-4-(dichloromethyl)-5-hydroxy-2[5H]-furanone (MX). We investigated the effect of exposure to MX on cytochrome P450 2E1 (CYP2E1)-like activity and total glutathione (GSH) in the liver of the small fish model, medaka (Oryzias latipes). The multi-site carcinogen methylazoxymethanol acetate (MAMAc) was the positive control compound. Both medaka liver microsome preparations and S-9 fractions catalyzed the hydroxylation of p-nitrophenol (PNP), suggesting CYP2E1-like activity in the medaka. Male medaka exposed for 96 h to the CYP2E1 inducers ethanol and acetone under fasted conditions showed significant increases in PNP-hydroxylation activity. Furthermore, total reduced hepatic GSH was reduced in fish fasted for 96 h, indicating that normal feeding is a factor in maintaining xenobiotic defenses. Exposure to MX and MAMAc induced significant increases in hepatic CYP2E1-like activity, however MX exposure did not alter hepatic GSH levels. These data strengthen the role of the medaka as a suitable species for examining cytochrome P450 and GSH detoxification processes and the role these systems play in chemical carcinogenesis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gošić, M.; Rubio, L. R. Bellot; Iniesta, J. C. del Toro

Small-scale internetwork magnetic fields are important ingredients of the quiet Sun. In this paper we analyze how they appear and disappear on the solar surface. Using high resolution Hinode magnetograms, we follow the evolution of individual magnetic elements in the interior of two supergranular cells at the disk center. From up to 38 hr of continuous measurements, we show that magnetic flux appears in internetwork regions at a rate of 120 ± 3 Mx cm{sup −2} day{sup −1} (3.7 ± 0.4 × 10{sup 24} Mx day{sup −1} over the entire solar surface). Flux disappears from the internetwork at a rate of 125 ± 6 Mx cm{sup −2} day{supmore » −1} (3.9 ± 0.5 × 10{sup 24} Mx day{sup −1}) through fading of magnetic elements, cancelation between opposite-polarity features, and interactions with network patches, which converts internetwork elements into network features. Most of the flux is lost through fading and interactions with the network, at nearly the same rate of about 50 Mx cm{sup −2} day{sup −1}. Our results demonstrate that the sources and sinks of internetwork magnetic flux are well balanced. Using the instantaneous flux appearance and disappearance rates, we successfully reproduce the time evolution of the total unsigned flux in the two supergranular cells.« less

Origin of the satellites Lα3, Lα4 and Lα5 in the elements from 40Zr to 50Sn

NASA Astrophysics Data System (ADS)

Kendurkar, Renuka; Shrivastava, B. D.

2014-09-01

The origin of the Lα satellites Lα3, Lα4 and Lα5 have been explained in the elements from 40Zr to 50Sn, on the basis of multiple ionization theory. The energies and intensities of the various transitions corresponding to the L3Mx - MxM4,5 (where x = 1-5) transition array, which may give rise to these satellites, have been calculated theoretically. The energies of the transitions have been calculated using the available Hartree-Fock-Slater data for the energies of K-LM and L-MM Auger transitions. The intensities of the various transitions have been estimated by considering cross sections for L1-L3Mx Coster-Kronig transitions as well as for M-shell shake-off process occurring simultaneous to a L3 hole creation. The total cross sections for initial two-hole states L3Mx have then been distributed statistically amongst the various allowed transitions from these initial states to the final states MxM4,5. By assuming each transition as a Gaussian line, theoretical satellite spectrum has been computed as the sum of these Gaussian curves. The energies of the satellites, as obtained from the theoretical spectrum, have been found to be comparable with the measured energies of the satellites Lα3, Lα4 and Lα5. Consequently, these satellites have been assigned the transitions.

Ab initio study of adsorption and diffusion of lithium on transition metal dichalcogenide monolayers

PubMed Central

Sun, Xiaoli

2017-01-01

Using first principles calculations, we studied the stability and electronic properties of transition metal dichalcogenide monolayers of the type MX2 (M = Ti, Zr, Hf, V, Nb, Ta, Mo, Cr, W; X= S, Se, Te). The adsorption and diffusion of lithium on the stable MX2 phase was also investigated for potential application as an anode for lithium ion batteries. Some of these compounds were found to be stable in the 2H phase and some are in the 1T or 1T' phase, but only a few of them were stable in both 2H/1T or 2H/1T' phases. The results show that lithium is energetically favourable for adsorption on MX2 monolayers, which can be semiconductors with a narrow bandgap and metallic materials. Lithium cannot be adsorbed onto 2H-WS2 and 2H-WSe2, which have large bandgaps of 1.66 and 1.96 eV, respectively. The diffusion energy barrier is in the range between 0.17 and 0.64 eV for lithium on MX2 monolayers, while for most of the materials it was found to be around 0.25 eV. Therefore, this work illustrated that most of the MX2 monolayers explored in this work can be used as promising anode materials for lithium ion batteries. PMID:29354342

Non-chemically amplified 193-nm top surface imaging photoresist development: polymer substituent and polydispersity effects

NASA Astrophysics Data System (ADS)

Kim, Myoung-Soo; Kim, Hyoung-Gi; Kim, Hyeong-Soo; Baik, Ki-Ho; Johnson, Donald W.; Cernigliaro, George J.; Minsek, David W.

1999-06-01

Thin film imaging processes such as top surface imaging (TSI) are candidates for sub-150 nm lithography using 193 nm lithography. Single component, non-chemically amplified, positive tone TSI photoresists based on phenolic polymers demonstrate good post-etch contrast, resolution, and minimal line edge roughness, in addition to being the most straightforward thin film imaging approach. In this approach, ArF laser exposure results directly in radiation- induced crosslinking of the phenolic polymer, followed by formation of a thin etch mask at the surface of the un- exposed regions by vapor-phase silylation, followed by reactive ion etching of the non-silylated regions. However, single component resists based on poly(para-hydroxystryene) (PHS), such as MicroChem's Nano MX-P7, suffer from slow photospeed as well as low silylation contrast which can cause reproducibility and line-edge-roughness problems. We report that selected aromatic substitution of the poly(para- hydroxystryene) polymer can increase the photospeed by up to a factor of four relative to un-substituted PHS. In this paper we report the synthesis and lithographic evaluations of four experimental TSI photoresists. MX-EX-1, MX-EX-2, MX- EX-3 and MX-EX-4 are non-chemically amplified resists based on aromatic substitutions of chloro- and hydroxymethyl- groups and PHS. We report optimized lithographic processing conditions, line edge roughness, silylation contrast, and compare the results to the parent PHS photoresist.

Design and Implementation of A DICOM PACS With Secure Access Via Internet

DTIC Science & Technology

2001-10-25

which we have called SINFIM ( Sistema de INFormación de Imágenes Médicas). This system permits the automatic acquisition of DICOM images [2] [3...1] MA. Martínez, AJR. Jiménez, BV. Medina, LJ. Azpiroz. “Los Sistemas PACS”. [Last access 08/12/2000]. Available URL http://itzamna.uam.mx...junio, por el que se aprueba el Reglamento de medidas de seguridad de los ficheros automatizados que contengan datos de carácter personal” (Boletín Oficial del Estado, número 151, de 25 de junio de 1999)

Plasmacytoid dendritic cells and type I interferon in the immunological response against warts.

PubMed

Saadeh, D; Kurban, M; Abbas, O

2017-12-01

Plasmacytoid dendritic cells (pDCs) are the most potent producers of type I interferons (IFNs), and are involved in the pathogenesis of several cutaneous infectious (especially viral), inflammatory/autoimmune and neoplastic entities. Their role in the pathogenesis and regression of human papilloma virus (HPV)-induced skin lesions has not been well studied. To investigate pDC occurrence and activity in HPV-induced skin lesions, including inflamed and uninflamed warts as well as epidermodysplasia verruciformis (EDV)-associated lesions. In total 20 inflamed and 20 uninflamed HPV-induced skin lesions (including 7 EDV lesions) were retrieved from our database, and the tissue was immunohistochemically tested for pDC occurrence and activity using anti-BDCA-2 and anti-MxA antibodies, respectively. pDCs were present in all 20 inflamed warts and absent from all 20 uninflamed cases. MxA expression was also diffuse and strong in 75% (15/20) inflamed warts, but not in any of the uninflamed warts. pDCs constitute a central component of the inflammatory host response in inflamed warts, possibly contributing to their regression through production of type I interferons. © 2017 British Association of Dermatologists.

Expression of the Human Epidermal Growth Factor Receptor in a Murine T- Cell Hybridoma: A Transmembrane Protein Tyrosine Kinase Can Synergize with the T-Cell Antigen Receptor

DTIC Science & Technology

1992-01-01

protein kirases suchmembrane P17K. nln T ts ebaepoenkr sssc as the EGFR or platelet-derived growth factor re,,,ptor. For instance, the EGFR and TCR...stimulated with EGF (100 ng/mi, in PBS containing phosphatase inhibitors , lysed, and immunoprecip. 5 min, B) anti Thy- I antibody (07 1:50 dilution or...washed in PBS containing phosphatase inhibitors and lysed. Total cellular MX1- lysate was subjected to SDS.PAGE. Western-transferred, and im- Mxi

Success in Mexico Requires a Military Solution

DTIC Science & Technology

2011-10-27

Nacional de los Derechos Humanos México. Background – National Commission on Human Rights, 2011, http://www.cndh.org.mx/node/17 [page translated by...Nacional de los Derechos Humanos México. Background – National Commission on Human Rights, 2011, http://www.cndh.org.mx/node/17. [page translated by

Search for narrow-width tt(bar) resonances in pp(bar) collisons at sqrt(s)=1.8TeV

NASA Astrophysics Data System (ADS)

Jain, Supriya

2004-03-01

We present a preliminary result on a search for narrow-width resonances that decay into ttbar pairs using 130 pb^{-1} of lepton plus jets data in ppbar collisions at center of mass energy = 1.8 TeV. No significant deviation from Standard Model prediction is observed. 95% C.L. upper limits on the production cross section of the narrow-width resonance times its branching fraction to ttbar are presented for different resonance masses, M_X. We also exclude the existence of a leptophobic topcolor particle, X, with M_X < 560 GeV/c^2 for a width \\Gamma_X = 0.012 M_X.

Distinct herpesvirus resistances and immune responses of three gynogenetic clones of gibel carp revealed by comprehensive transcriptomes.

PubMed

Gao, Fan-Xiang; Wang, Yang; Zhang, Qi-Ya; Mou, Cheng-Yan; Li, Zhi; Deng, Yuan-Sheng; Zhou, Li; Gui, Jian-Fang

2017-07-24

Gibel carp is an important aquaculture species in China, and a herpesvirus, called as Carassius auratus herpesvirus (CaHV), has hampered the aquaculture development. Diverse gynogenetic clones of gibel carp have been identified or created, and some of them have been used as aquaculture varieties, but their resistances to herpesvirus and the underlying mechanism remain unknown. To reveal their susceptibility differences, we firstly performed herpesvirus challenge experiments in three gynogenetic clones of gibel carp, including the leading variety clone A + , candidate variety clone F and wild clone H. Three clones showed distinct resistances to CaHV. Moreover, 8772, 8679 and 10,982 differentially expressed unigenes (DEUs) were identified from comparative transcriptomes between diseased individuals and control individuals of clone A + , F and H, respectively. Comprehensive analysis of the shared DEUs in all three clones displayed common defense pathways to the herpesvirus infection, activating IFN system and suppressing complements. KEGG pathway analysis of specifically changed DEUs in respective clones revealed distinct immune responses to the herpesvirus infection. The DEU numbers identified from clone H in KEGG immune-related pathways, such as "chemokine signaling pathway", "Toll-like receptor signaling pathway" and others, were remarkably much more than those from clone A + and F. Several IFN-related genes, including Mx1, viperin, PKR and others, showed higher increases in the resistant clone H than that in the others. IFNphi3, IFI44-like and Gig2 displayed the highest expression in clone F and IRF1 uniquely increased in susceptible clone A + . In contrast to strong immune defense in resistant clone H, susceptible clone A + showed remarkable up-regulation of genes related to apoptosis or death, indicating that clone A + failed to resist virus offensive and evidently induced apoptosis or death. Our study is the first attempt to screen distinct resistances and immune responses of three gynogenetic gibel carp clones to herpesvirus infection by comprehensive transcriptomes. These differential DEUs, immune-related pathways and IFN system genes identified from susceptible and resistant clones will be beneficial to marker-assisted selection (MAS) breeding or molecular module-based resistance breeding in gibel carp.

Interferon regulatory factor 3 (IRF-3) in Japanese flounder, Paralichthys olivaceus: sequencing, limited tissue distribution, inducible expression and induction of fish type I interferon promoter.

PubMed

Hu, Guobin; Yin, Xiangyan; Lou, Huimin; Xia, Jun; Dong, Xianzhi; Zhang, Jianyie; Liu, Qiuming

2011-02-01

Two cDNAs with different 3'-untranslated region (UTR) encoding an interferon regulatory factor 3 (IRF-3) were cloned from head kidney of Japanese flounder, Paralichthys olivaceus, by reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. Sequence analysis reveals that they were generated by alternative polyadenylation. The predicted protein consists of 467 amino acid residues which shares the highest identity of 50.7-57.6% to fish IRF-3 and possesses a DNA-binding domain (DBD), an IRF association domain (IAD) and a serine-rich domain (SRD) of vertebrate IRF-3. The presence of these domains along with phylogenetic analysis places it into the IRF-3 group of the IRF-3 subfamily. RT-PCR analysis revealed that flounder IRF-3 was expressed constitutively in limited tissue types including head kidney, spleen, kidney, heart, gill, intestine and liver. A quantitative real time PCR assay was employed to monitor expression of IRF-3, type I interferon (IFN) and Mx in flounder head kidney and gill. All three genes were up-regulated by polyinosinic:polycytidylic acid (polyI:C) and lymphocystis disease virus (LCDV) with an earlier but slight and less persistent increase in transcription levels seen for the IRF-3. Finally, flounder IRF-3 was proved to induce fish type I IFN promoter in FG9307 cells, a flounder gill cell line, by a luciferase assay. These results provide insights into the roles of fish IRF-3 in the antiviral immunity. Copyright © 2010 Elsevier Ltd. All rights reserved.

MULTISPECTRAL IDENTIFICATION OF POTENTIALLY HAZARDOUS BYPRODUCTS OF OZONATION AND CHLORINATION - PART I: STUDIES OF CHROMATOGRAPHIC AND SPECTROSCOPIC PROPERTIES OF MX

EPA Science Inventory

The gas chromatographic (GC) and Fourier transform infrared and mass spectroscopic (FT-IR and MS, respectively) properties of (Z)-2-chloro-3-(dichloromethyl)4-oxobutenoic acid (MX) (a highly mutagenic byproduct of drinking water chlorination) and several related compounds were st...

77 FR 27837 - Pilot Program on NAFTA Trucking Provisions

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-11

... Federal de Conductor and English language proficiency. L. If No, Which Element Failed: If FMCSA cannot... collection facility 1 Higienicos y 710491 MX-327700 N/A Pass 1 1 US RMC Testing Desechables del Solutions. Bajio SA de CV. 2 Servicios 1052546 MX-440938 N/A Pass 1 1 US RMC Testing Refrigerados Solutions...

Induction of Abasic Sites by the Drinking-Water Mutagen MX in Salmonella TA100

EPA Science Inventory

Mutagen X (MX) is a chlorinated furanone that accounts for more of the mutagenic activity of drinking water than any other disinfection by-product. It is one of the most potent base-substitution mutagens in the Salmonella (Ames) mutagenicity assay, producing primarily GC to TA mu...

Sequence Curriculum: High School to College. Middlesex Community College/Haddam-Killingworth High School. Final Report.

ERIC Educational Resources Information Center

Middlesex Community Coll., Middletown, CT.

Through a collaborative effort between Middlesex Community College (MxCC) and Haddam-Killingworth High School (HKHS), students taking specific high school courses in television production, broadcast journalism, electronics, and photography are granted college credit by MxCC upon admission to the college's Broadcast Communication Program. The…

FORMATION OF NITRO MUSK ADDUCTS OF RAINBOW TROUT HEMOGLOBIN FOR POTENTIAL USE AS BIOMARKERS OF EXPOSURE

EPA Science Inventory

The high use of nitro musk xylene (MX) and musk ketone (MK) as fragrances, and their persistence and bioaccumulation potential make them ubiquitous environmental contaminants. The 4-amino-MX (AMX) and 2-amino-MK (AMK) metabolites have been detected in trout fish hemoglobin (Hb) s...

3D Synergistical MXene/Reduced Graphene Oxide Aerogel for a Piezoresistive Sensor.

PubMed

Ma, Yanan; Yue, Yang; Zhang, Hang; Cheng, Feng; Zhao, Wanqiu; Rao, Jiangyu; Luo, Shijun; Wang, Jie; Jiang, Xueliang; Liu, Zhitian; Liu, Nishuang; Gao, Yihua

2018-04-24

A piezoresistive sensor based on ultralight and superelastic aerogel is reported to fabricate MXene/reduced graphene oxide (MX/rGO) hybrid 3D structures and utilize their pressure-sensitive characteristics. The MX/rGO aerogel not only combines the rGO's large specific surface area and the MXene's (Ti 3 C 2 T x ) high conductivity but also exhibits rich porous structure, which leads to performance better than that of single-component rGO or MXene in terms of the pressure sensor. The large nanosheets of rGO can prevent the poor oxidization of MXene by wrapping MXene inside the aerogel. More importantly, the piezoresistive sensor based on the MX/rGO aerogel shows extremely high sensitivity (22.56 kPa -1 ), fast response time (<200 ms), and good stability over 10 000 cycles. The piezoresistive sensor based on the MX/rGO hybrid 3D aerogel can easily capture the signal below 10 Pa, thus clearly testing the pulse of an adult at random. Based on its superior performance, it also demonstrates potential applications in measuring pressure distribution, distinguishing subtle strain, and monitoring healthy activity.

Strong room-temperature ultraviolet to red excitons from inorganic organic-layered perovskites, (MX4 (M=Pb, Sn, Hg; X=I-, Br-)

NASA Astrophysics Data System (ADS)

Ahmad, Shahab; Prakash, G. Vijaya

2014-01-01

Many varieties of layered inorganic-organic (IO) perovskite of type (MX4 (where R: organic moiety, M: divalent metal, and X: halogen) were successfully fabricated and characterized. X-ray diffraction data suggest that these inorganic and organic structures are alternatively stacked up along c-axis, where inorganic mono layers are of extended corner-shared MX6 octahedra and organic spacers are the bi-layers of organic entities. These layered perovskites show unusual room-temperature exciton absorption and photoluminescence due to the quantum and dielectric confinement-induced enhancement in the exciton binding energies. A wide spectral range of optical exciton tunability (350 to 600 nm) was observed experimentally from systematic compositional variation in (i) divalent metal ions (M=Pb, Sn, Hg), (ii) halides (X=I and Br-), and (iii) organic moieties (R). Specific photoluminescence features are due to the structure of the extended MX42- network and the eventual electronic band structure. The compositionally dependent photoluminescence of these IO hybrids could be useful in various photonic and optoelectronic devices.

Inherited genetic variants associated with occurrence of multiple primary melanoma.

PubMed

Gibbs, David C; Orlow, Irene; Kanetsky, Peter A; Luo, Li; Kricker, Anne; Armstrong, Bruce K; Anton-Culver, Hoda; Gruber, Stephen B; Marrett, Loraine D; Gallagher, Richard P; Zanetti, Roberto; Rosso, Stefano; Dwyer, Terence; Sharma, Ajay; La Pilla, Emily; From, Lynn; Busam, Klaus J; Cust, Anne E; Ollila, David W; Begg, Colin B; Berwick, Marianne; Thomas, Nancy E

2015-06-01

Recent studies, including genome-wide association studies, have identified several putative low-penetrance susceptibility loci for melanoma. We sought to determine their generalizability to genetic predisposition for multiple primary melanoma in the international population-based Genes, Environment, and Melanoma (GEM) Study. GEM is a case-control study of 1,206 incident cases of multiple primary melanoma and 2,469 incident first primary melanoma participants as the control group. We investigated the odds of developing multiple primary melanoma for 47 SNPs from 21 distinct genetic regions previously reported to be associated with melanoma. ORs and 95% confidence intervals were determined using logistic regression models adjusted for baseline features (age, sex, age by sex interaction, and study center). We investigated univariable models and built multivariable models to assess independent effects of SNPs. Eleven SNPs in 6 gene neighborhoods (TERT/CLPTM1L, TYRP1, MTAP, TYR, NCOA6, and MX2) and a PARP1 haplotype were associated with multiple primary melanoma. In a multivariable model that included only the most statistically significant findings from univariable modeling and adjusted for pigmentary phenotype, back nevi, and baseline features, we found TERT/CLPTM1L rs401681 (P = 0.004), TYRP1 rs2733832 (P = 0.006), MTAP rs1335510 (P = 0.0005), TYR rs10830253 (P = 0.003), and MX2 rs45430 (P = 0.008) to be significantly associated with multiple primary melanoma, while NCOA6 rs4911442 approached significance (P = 0.06). The GEM Study provides additional evidence for the relevance of these genetic regions to melanoma risk and estimates the magnitude of the observed genetic effect on development of subsequent primary melanoma. ©2015 American Association for Cancer Research.

Inherited genetic variants associated with occurrence of multiple primary melanoma

PubMed Central

Gibbs, David C.; Orlow, Irene; Kanetsky, Peter A.; Luo, Li; Kricker, Anne; Armstrong, Bruce K.; Anton-Culver, Hoda; Gruber, Stephen B.; Marrett, Loraine D.; Gallagher, Richard P.; Zanetti, Roberto; Rosso, Stefano; Dwyer, Terence; Sharma, Ajay; La Pilla, Emily; From, Lynn; Busam, Klaus J.; Cust, Anne E.; Ollila, David W.; Begg, Colin B.; Berwick, Marianne; Thomas, Nancy E.

2015-01-01

Recent studies including genome-wide association studies have identified several putative low-penetrance susceptibility loci for melanoma. We sought to determine their generalizability to genetic predisposition for multiple primary melanoma in the international population-based Genes, Environment, and Melanoma (GEM) Study. GEM is a case-control study of 1,206 incident cases of multiple primary melanoma and 2,469 incident first primary melanoma participants as the control group. We investigated the odds of developing multiple primary melanoma for 47 single nucleotide polymorphisms (SNP) from 21 distinct genetic regions previously reported to be associated with melanoma. ORs and 95% CIs were determined using logistic regression models adjusted for baseline features (age, sex, age by sex interaction, and study center). We investigated univariable models and built multivariable models to assess independent effects of SNPs. Eleven SNPs in 6 gene neighborhoods (TERT/CLPTM1L, TYRP1, MTAP, TYR, NCOA6, and MX2) and a PARP1 haplotype were associated with multiple primary melanoma. In a multivariable model that included only the most statistically significant findings from univariable modeling and adjusted for pigmentary phenotype, back nevi, and baseline features, we found TERT/CLPTM1L rs401681 (P = 0.004), TYRP1 rs2733832 (P = 0.006), MTAP rs1335510 (P = 0.0005), TYR rs10830253 (P = 0.003), and MX2 rs45430 (P = 0.008) to be significantly associated with multiple primary melanoma while NCOA6 rs4911442 approached significance (P = 0.06). The GEM study provides additional evidence for the relevance of these genetic regions to melanoma risk and estimates the magnitude of the observed genetic effect on development of subsequent primary melanoma. PMID:25837821

Early Immune Responses in Rainbow Trout Liver upon Viral Hemorrhagic Septicemia Virus (VHSV) Infection

PubMed Central

Castro, Rosario; Abós, Beatriz; Pignatelli, Jaime; von Gersdorff Jørgensen, Louise; González Granja, Aitor; Buchmann, Kurt; Tafalla, Carolina

2014-01-01

Among the essential metabolic functions of the liver, in mammals, a role as mediator of systemic and local innate immunity has also been reported. Although the presence of an important leukocyte population in mammalian liver is well documented, the characterization of leukocyte populations in the teleost liver has been only scarcely addressed. In the current work, we have confirmed the presence of IgM+, IgD+, IgT+, CD8α+, CD3+ cells, and cells expressing major histocompatibility complex (MHC-II) in rainbow trout (Oncorhynchus mykiss) liver by flow cytometry and/or immunohistochemistry analysis. Additionally, the effect of viral hemorrhagic septicemia virus (VHSV) on the liver immune response was assessed. First, we studied the effect of viral intraperitoneal injection on the transcription of a wide selection of immune genes at days 1, 2 and 5 post-infection. These included a group of leukocyte markers genes, pattern recognition receptors (PRRs), chemokines, chemokine receptor genes, and other genes involved in the early immune response and in acute phase reaction. Our results indicate that T lymphocytes play a key role in the initial response to VHSV in the liver, since CD3, CD8, CD4, perforin, Mx and interferon (IFN) transcription levels were up-regulated in response to VHSV. Consequently, flow cytometry analysis of CD8α+ cells in liver and spleen at day 5 post-infection revealed a decrease in the number of CD8α+ cells in the spleen and an increased population in the liver. No differences were found however in the percentages of B lymphocyte (IgM+ or IgD+) populations. In addition, a strong up-regulation in the transcription levels of several PRRs and chemokines was observed from the second day of infection, indicating an important role of these factors in the response of the liver to viral infections. PMID:25338079

Upregulation of innate antiviral restricting factor expression in the cord blood and decidual tissue of HIV-infected mothers.

PubMed

Pereira, Nátalli Zanete; Cardoso, Elaine Cristina; Oliveira, Luanda Mara da Silva; de Lima, Josenilson Feitosa; Branco, Anna Cláudia Calvielli Castelo; Ruocco, Rosa Maria de Souza Aveiro; Zugaib, Marcelo; de Oliveira Filho, João Bosco; Duarte, Alberto José da Silva; Sato, Maria Notomi

2013-01-01

Programs for the prevention of mother-to-child transmission of HIV have reduced the transmission rate of perinatal HIV infection and have thereby increased the number of HIV-exposed uninfected (HEU) infants. Natural immunity to HIV-1 infection in both mothers and newborns needs to be further explored. In this study, we compared the expression of antiviral restricting factors in HIV-infected pregnant mothers treated with antiretroviral therapy (ART) in pregnancy (n=23) and in cord blood (CB) (n=16), placental tissues (n=10-13) and colostrum (n=5-6) samples and compared them to expression in samples from uninfected (UN) pregnant mothers (n=21). Mononuclear cells (MNCs) were prepared from maternal and CB samples following deliveries by cesarean section. Maternal (decidua) and fetal (chorionic villus) placental tissues were obtained, and colostrum was collected 24 h after delivery. The mRNA and protein expression levels of antiviral factors were then evaluated. We observed a significant increase in the mRNA expression levels of antiviral factors in MNCs from HIV-infected mothers and CB, including the apolipoprotein B mRNA-editing enzyme 3G (A3G), A3F, tripartite motif family-5α (TRIM-5α), TRIM-22, myxovirus resistance protein A (MxA), stimulator of interferon (IFN) genes (STING) and IFN-β, compared with the levels detected in uninfected (UN) mother-CB pairs. Moreover, A3G transcript and protein levels and α-defensin transcript levels were decreased in the decidua of HIV-infected mothers. Decreased TRIM-5α protein levels in the villi and increased STING mRNA expression in both placental tissues were also observed in HIV-infected mothers compared with uninfected (UN) mothers. Additionally, colostrum cells from infected mothers showed increased tetherin and IFN-β mRNA levels and CXCL9 protein levels. The data presented here indicate that antiviral restricting factor expression can be induced in utero in HIV-infected mothers. Future studies are warranted to determine whether this upregulation of antiviral factors during the perinatal period has a protective effect against HIV-1 infection.

Upregulation of Innate Antiviral Restricting Factor Expression in the Cord Blood and Decidual Tissue of HIV-Infected Mothers

PubMed Central

Pereira, Nátalli Zanete; Cardoso, Elaine Cristina; Oliveira, Luanda Mara da Silva; de Lima, Josenilson Feitosa; Branco, Anna Cláudia Calvielli Castelo; Ruocco, Rosa Maria de Souza Aveiro; Zugaib, Marcelo; de Oliveira Filho, João Bosco; Duarte, Alberto José da Silva; Sato, Maria Notomi

2013-01-01

Programs for the prevention of mother-to-child transmission of HIV have reduced the transmission rate of perinatal HIV infection and have thereby increased the number of HIV-exposed uninfected (HEU) infants. Natural immunity to HIV-1 infection in both mothers and newborns needs to be further explored. In this study, we compared the expression of antiviral restricting factors in HIV-infected pregnant mothers treated with antiretroviral therapy (ART) in pregnancy (n=23) and in cord blood (CB) (n=16), placental tissues (n=10-13) and colostrum (n=5-6) samples and compared them to expression in samples from uninfected (UN) pregnant mothers (n=21). Mononuclear cells (MNCs) were prepared from maternal and CB samples following deliveries by cesarean section. Maternal (decidua) and fetal (chorionic villus) placental tissues were obtained, and colostrum was collected 24 h after delivery. The mRNA and protein expression levels of antiviral factors were then evaluated. We observed a significant increase in the mRNA expression levels of antiviral factors in MNCs from HIV-infected mothers and CB, including the apolipoprotein B mRNA-editing enzyme 3G (A3G), A3F, tripartite motif family-5α (TRIM-5α), TRIM-22, myxovirus resistance protein A (MxA), stimulator of interferon (IFN) genes (STING) and IFN-β, compared with the levels detected in uninfected (UN) mother-CB pairs. Moreover, A3G transcript and protein levels and α-defensin transcript levels were decreased in the decidua of HIV-infected mothers. Decreased TRIM-5α protein levels in the villi and increased STING mRNA expression in both placental tissues were also observed in HIV-infected mothers compared with uninfected (UN) mothers. Additionally, colostrum cells from infected mothers showed increased tetherin and IFN-β mRNA levels and CXCL9 protein levels. The data presented here indicate that antiviral restricting factor expression can be induced in utero in HIV-infected mothers. Future studies are warranted to determine whether this upregulation of antiviral factors during the perinatal period has a protective effect against HIV-1 infection. PMID:24367701

Joint FCRC Utah-Nevada MX Missile System.

DTIC Science & Technology

1980-09-22

FOUR CORN ]EIRS REGIONAL COMM4ISSIlON 2350 A.amno, .S. ,E., Suite 303 Albuquer(ue , New Mexico 871.06 NEVADA MX LOCAL OVFRSTG[IT COZMl’CVLEE Lincoln...coordinators have i had i .ny imiee, in gs anl traveled jointlIy to prosent a unified Utah fosition tLo regi•(liOna 1 anid federal agencies - A cob

Testing the Hypothesis of a Homoscedastic Error Term in Simple, Nonparametric Regression

ERIC Educational Resources Information Center

Wilcox, Rand R.

2006-01-01

Consider the nonparametric regression model Y = m(X)+ [tau](X)[epsilon], where X and [epsilon] are independent random variables, [epsilon] has a median of zero and variance [sigma][squared], [tau] is some unknown function used to model heteroscedasticity, and m(X) is an unknown function reflecting some conditional measure of location associated…

MX, A DRINKING WATER CARCINOGEN, DOES NOT INDUCE MUTATIONS IN THE LIVER OF CII TRANSGENIC MEDAKA

EPA Science Inventory

MX, a drinking water carcinogen, does not induce mutations in the liver of cII transgenic medaka
Geter, DR; Winn, RN; Fournie, JW; Norris, MB; DeAngelo, AB; and Hawkins, WE

Abstract

Geter et al., page 2
Abstract
"Salmonella" mutagenicity assays have shown t...

Assessing Patient Management Plans of Doctors and Medical Students: An Illness Script Perspective

ERIC Educational Resources Information Center

Monajemi, Alireza; Schmidt, Henk G.; Rikers, Remy M. J. P.

2012-01-01

Introduction: Illness script theory offers explanations for expert-novice differences in clinical reasoning. However, it has mainly focused on diagnostic (Dx) performance, while patient management (Mx) has been largely ignored. The aim of the present study was to show the role of Mx knowledge in illness script development and how it relates to…

DETERMINATION OF A BOUND MUSK XYLENE METABOLITE IN CARP HEMOGLOBIN AS A BIOMARKER OF EXPOSURE BY GAS CHROMATOGRAPHY MASS SPECTROMETRY USING SELECTED ION MONITORING

EPA Science Inventory

Musk xylene (MX) is widely used as a fragrance ingredient in commercial toiletries. Identification and quantification of a bound 4-amino-MX (AMX) metabolite was carried out by gas chromatography-mass spectrometry (GC/MS), with selected ion monitoring (SIM). Detection of AMX occur...

Axial Waterjet (AxWJ) Model 5662 and Mixed-Flow Waterjet (MxWJ) Model 5662-1: Comparisons of Resistance and Model-Scale Powering with Propulsion Nozzle Designs

DTIC Science & Technology

2007-12-01

The smaller transom size required of an axial waterjet propelled hull places it at a distinct advantage , in terms of low to medium speed resistance...transom. (b) The greater transom volume of the MxWJ may become an advantage in terms of reduced resistance at very high speeds. (c) Some decrease in...MxWJ C5 NellH JOMOd GAlpeUJ3 U’) LO U-) ul U) U*) LO C4 ~ ~ 0% 0 oq c6 o 6- 6 0P U’) .. .. ... . lic C) U) COU o xo _ NU w UJ I4C V- T- (000 d4) GMO OAIG

A comparison of torque expression between stainless steel, titanium molybdenum alloy, and copper nickel titanium wires in metallic self-ligating brackets.

PubMed

Archambault, Amy; Major, Thomas W; Carey, Jason P; Heo, Giseon; Badawi, Hisham; Major, Paul W

2010-09-01

The force moment providing rotation of the tooth around the x-axis (buccal-lingual) is referred to as torque expression in orthodontic literature. Many factors affect torque expression, including the wire material characteristics. This investigation aims to provide an experimental study into and comparison of the torque expression between wire types. With a worm-gear-driven torquing apparatus, wire was torqued while a bracket mounted on a six-axis load cell was engaged. Three 0.019 x 0.0195 inch wire (stainless steel, titanium molybdenum alloy [TMA], copper nickel titanium [CuNiTi]), and three 0.022 inch slot bracket combinations (Damon 3MX, In-Ovation-R, SPEED) were compared. At low twist angles (<12 degrees), the differences in torque expression between wires were not statistically significant. At twist angles over 24 degrees, stainless steel wire yielded 1.5 to 2 times the torque expression of TMA and 2.5 to 3 times that of nickel titanium (NiTi). At high angles of torsion (over 40 degrees) with a stiff wire material, loss of linear torque expression sometimes occurred. Stainless steel has the largest torque expression, followed by TMA and then NiTi.

The Koukopoulos Mixed Depression Rating Scale (KMDRS): An International Mood Network (IMN) validation study of a new mixed mood rating scale.

PubMed

Sani, Gabriele; Vöhringer, Paul A; Barroilhet, Sergio A; Koukopoulos, Alexia E; Ghaemi, S Nassir

2018-05-01

It has been proposed that the broad major depressive disorder (MDD) construct is heterogenous. Koukopoulos has provided diagnostic criteria for an important subtype within that construct, "mixed depression" (MxD), which encompasses clinical pictures characterized by marked psychomotor or inner excitation and rage/anger, along with severe depression. This study provides psychometric validation for the first rating scale specifically designed to assess MxD symptoms cross-sectionally, the Koukopoulos Mixed Depression Rating Scale (KMDRS). 350 patients from the international mood network (IMN) completed three rating scales: the KMDRS, Montgomery-Asberg Depression Rating Scale (MADRS) and Young Mania Rating Scale (YMRS). KMDRS' psychometric properties assessed included Cronbach's alpha, inter-rater reliability, factor analysis, predictive validity, and Receiver Operator Curve analysis. Internal consistency (Cronbach's alpha = 0.76; 95% CI 0.57, 0.94) and interrater reliability (kappa = 0.73) were adequate. Confirmatory factor analysis identified 2 components: anger and psychomotor excitation (80% of total variance). Good predictive validity was seen (C-statistic = 0.82 95% CI 0.68, 0.93). Severity cut-off scores identified were as follows: none (0-4), possible (5-9), mild (10-15), moderate (16-20) and severe (> 21) MxD. Non DSM-based diagnosis of MxD may pose some difficulties in the initial use and interpretation of the scoring of the scale. Moreover, the cross-sectional nature of the evaluation does not verify the long-term stability of the scale. KMDRS was a reliable and valid instrument to assess MxD symptoms. Copyright © 2018 Elsevier B.V. All rights reserved.

Highly multiplexed single-cell analysis of formalin-fixed, paraffin-embedded cancer tissue

PubMed Central

Gerdes, Michael J.; Sevinsky, Christopher J.; Sood, Anup; Adak, Sudeshna; Bello, Musodiq O.; Bordwell, Alexander; Can, Ali; Corwin, Alex; Dinn, Sean; Filkins, Robert J.; Hollman, Denise; Kamath, Vidya; Kaanumalle, Sireesha; Kenny, Kevin; Larsen, Melinda; Lazare, Michael; Lowes, Christina; McCulloch, Colin C.; McDonough, Elizabeth; Pang, Zhengyu; Rittscher, Jens; Santamaria-Pang, Alberto; Sarachan, Brion D.; Seel, Maximilian L.; Seppo, Antti; Shaikh, Kashan; Sui, Yunxia; Zhang, Jingyu; Ginty, Fiona

2013-01-01

Limitations on the number of unique protein and DNA molecules that can be characterized microscopically in a single tissue specimen impede advances in understanding the biological basis of health and disease. Here we present a multiplexed fluorescence microscopy method (MxIF) for quantitative, single-cell, and subcellular characterization of multiple analytes in formalin-fixed paraffin-embedded tissue. Chemical inactivation of fluorescent dyes after each image acquisition round allows reuse of common dyes in iterative staining and imaging cycles. The mild inactivation chemistry is compatible with total and phosphoprotein detection, as well as DNA FISH. Accurate computational registration of sequential images is achieved by aligning nuclear counterstain-derived fiducial points. Individual cells, plasma membrane, cytoplasm, nucleus, tumor, and stromal regions are segmented to achieve cellular and subcellular quantification of multiplexed targets. In a comparison of pathologist scoring of diaminobenzidine staining of serial sections and automated MxIF scoring of a single section, human epidermal growth factor receptor 2, estrogen receptor, p53, and androgen receptor staining by diaminobenzidine and MxIF methods yielded similar results. Single-cell staining patterns of 61 protein antigens by MxIF in 747 colorectal cancer subjects reveals extensive tumor heterogeneity, and cluster analysis of divergent signaling through ERK1/2, S6 kinase 1, and 4E binding protein 1 provides insights into the spatial organization of mechanistic target of rapamycin and MAPK signal transduction. Our results suggest MxIF should be broadly applicable to problems in the fields of basic biological research, drug discovery and development, and clinical diagnostics. PMID:23818604

Highly multiplexed single-cell analysis of formalin-fixed, paraffin-embedded cancer tissue.

PubMed

Gerdes, Michael J; Sevinsky, Christopher J; Sood, Anup; Adak, Sudeshna; Bello, Musodiq O; Bordwell, Alexander; Can, Ali; Corwin, Alex; Dinn, Sean; Filkins, Robert J; Hollman, Denise; Kamath, Vidya; Kaanumalle, Sireesha; Kenny, Kevin; Larsen, Melinda; Lazare, Michael; Li, Qing; Lowes, Christina; McCulloch, Colin C; McDonough, Elizabeth; Montalto, Michael C; Pang, Zhengyu; Rittscher, Jens; Santamaria-Pang, Alberto; Sarachan, Brion D; Seel, Maximilian L; Seppo, Antti; Shaikh, Kashan; Sui, Yunxia; Zhang, Jingyu; Ginty, Fiona

2013-07-16

Limitations on the number of unique protein and DNA molecules that can be characterized microscopically in a single tissue specimen impede advances in understanding the biological basis of health and disease. Here we present a multiplexed fluorescence microscopy method (MxIF) for quantitative, single-cell, and subcellular characterization of multiple analytes in formalin-fixed paraffin-embedded tissue. Chemical inactivation of fluorescent dyes after each image acquisition round allows reuse of common dyes in iterative staining and imaging cycles. The mild inactivation chemistry is compatible with total and phosphoprotein detection, as well as DNA FISH. Accurate computational registration of sequential images is achieved by aligning nuclear counterstain-derived fiducial points. Individual cells, plasma membrane, cytoplasm, nucleus, tumor, and stromal regions are segmented to achieve cellular and subcellular quantification of multiplexed targets. In a comparison of pathologist scoring of diaminobenzidine staining of serial sections and automated MxIF scoring of a single section, human epidermal growth factor receptor 2, estrogen receptor, p53, and androgen receptor staining by diaminobenzidine and MxIF methods yielded similar results. Single-cell staining patterns of 61 protein antigens by MxIF in 747 colorectal cancer subjects reveals extensive tumor heterogeneity, and cluster analysis of divergent signaling through ERK1/2, S6 kinase 1, and 4E binding protein 1 provides insights into the spatial organization of mechanistic target of rapamycin and MAPK signal transduction. Our results suggest MxIF should be broadly applicable to problems in the fields of basic biological research, drug discovery and development, and clinical diagnostics.

Generation and electric control of spin-valley-coupled circular photogalvanic current in WSe2

NASA Astrophysics Data System (ADS)

Yuan, Hongtao; Hwang, Harold Y.; Cui, Yi

2015-03-01

Compared to the weak spin-orbit-interaction (SOI) in graphene, layered transitionmetal chalcogenides MX2 have heavy 4d/5d elements with strong atomic SOI, providing a unique way to extend functionalities of novel spintronics and valleytronics devices. Such a valley polarization achieved via valley-selective circular dichroism has been predicted theoretically and demonstrated with optical experiments in MX2 systems. Despite the exciting progresses, the generation of a valley/spin current by valley polarization in MX2 remains elusive and a great challenge. A spin/valley current in MX2 compounds caused by such a valley polarization has never been observed, nor its electric-field control. In this talk, we demonstrated, within an electric-double-layer transistor based on WSe2, the manipulation of a spin-coupled valley photocurrent whose direction and magnitude depend on the degree of circular polarization of the incident radiation and can be further greatly modulated with an external electric field. Such room temperature generation and electric control of valley/spin photocurrent provides a new property of electrons in MX2 systems, thereby enabling new degrees of control for quantum-confined spintronics devices. (In collaboration with S.C. Zhang, Y.L. Chen, Z.X. Shen, B Lian, H.J. Zhang, G Xu, Y Xu, B Zhou, X.Q. Wang, B Shen X.F. Fang) Acknowledge the support from DoE, BES, Division of MSE under contract DE-AC02-76SF00515. Acknowledge the support from DoE, BES, Division of MSE under contract DE-AC02-76SF00515.

Diagnostic performance of dual-energy contrast-enhanced subtracted mammography in dense breasts compared to mammography alone: interobserver blind-reading analysis.

PubMed

Cheung, Yun-Chung; Lin, Yu-Ching; Wan, Yung-Liang; Yeow, Kee-Min; Huang, Pei-Chin; Lo, Yung-Feng; Tsai, Hsiu-Pei; Ueng, Shir-Hwa; Chang, Chee-Jen

2014-10-01

To analyse the accuracy of dual-energy contrast-enhanced spectral mammography in dense breasts in comparison with contrast-enhanced subtracted mammography (CESM) and conventional mammography (Mx). CESM cases of dense breasts with histological proof were evaluated in the present study. Four radiologists with varying experience in mammography interpretation blindly read Mx first, followed by CESM. The diagnostic profiles, consistency and learning curve were analysed statistically. One hundred lesions (28 benign and 72 breast malignancies) in 89 females were analysed. Use of CESM improved the cancer diagnosis by 21.2 % in sensitivity (71.5 % to 92.7 %), by 16.1 % in specificity (51.8 % to 67.9 %) and by 19.8 % in accuracy (65.9 % to 85.8 %) compared with Mx. The interobserver diagnostic consistency was markedly higher using CESM than using Mx alone (0.6235 vs. 0.3869 using the kappa ratio). The probability of a correct prediction was elevated from 80 % to 90 % after 75 consecutive case readings. CESM provided additional information with consistent improvement of the cancer diagnosis in dense breasts compared to Mx alone. The prediction of the diagnosis could be improved by the interpretation of a significant number of cases in the presence of 6 % benign contrast enhancement in this study. • DE-CESM improves the cancer diagnosis in dense breasts compared with mammography. • DE-CESM shows greater consistency than mammography alone by interobserver blind reading. • Diagnostic improvement of DE-CESM is independent of the mammographic reading experience.

Calorimetric Investigation of Thermal Stability of 304H Cu (Fe-17.7Cr-9.3Ni-2.95Cu-0.91Mn-0.58Nb-0.24Si-0.1C-0.12N-Wt Pct) Austenitic Stainless Steel

NASA Astrophysics Data System (ADS)

Tripathy, Haraprasanna; Subramanian, Raju; Hajra, Raj Narayan; Rai, Arun Kumar; Rengachari, Mythili; Saibaba, Saroja; Jayakumar, Tammana

2016-12-01

The sequence of phase instabilities that take place in a Fe-17.7Cr-9.3Ni-0.58Nb-2.95Cu-0.12N (wt pct) austenitic stainless steel (304H Cu grade) as a function of temperature has been investigated using dynamic calorimetry. The results obtained from this investigation are supplemented by Thermocalc-based equilibrium and Scheil-Gulliver nonequilibrium solidification simulation. The following phase transformation sequence is found upon slow cooling from liquid: L → L + γ → L + γ + MX → γ + MX + δ → γ +MX + M23C6 → γ + MX + M23C6 + Cu. Under slow cooling, the solidification follows austenite + ferrite (AF) mode, which is in accordance with Thermocalc prediction and Scheil-Gulliver simulation. However, higher cooling rates result in skeletal δ-ferrite formation, due to increased segregation tendency of Nb and Cr to segregate to interdendritic liquid. The solidification mode is found to depend on combined Nb + Cu content. Experimental estimates of enthalpy change associated with melting and secondary phase precipitation are also obtained. In addition a semi-quantitative study on the dissolution kinetics of M23C6 type carbides has also been investigated. The standard solution treatment at 1413 K (1140 °C) is found to be adequate to dissolve both Cu and M23C6 into γ-austenite; but the complete dissolution of MX type carbonitrides occurs near the melting region.

Involvement of zebrafish RIG-I in NF-κB and IFN signaling pathways: insights into functional conservation of RIG-I in antiviral innate immunity.

PubMed

Nie, Li; Zhang, Ying-sheng; Dong, Wei-ren; Xiang, Li-xin; Shao, Jian-zhong

2015-01-01

The retinoic acid-inducible gene I (RIG-I) is a critical sensor for host recognition of RNA virus infection and initiation of antiviral signaling pathways in mammals. However, data on the occurrence and functions of this molecule in lower vertebrates are limited. In this study, we characterized an RIG-I homolog (DrRIG-I) from zebrafish. Structurally, this DrRIG-I shares a number of conserved functional domains/motifs with its mammalian counterparts, namely, caspase activation and recruitment domain, DExD/H box, a helicase domain, and a C-terminal domain. Functionally, stimulation with DrRIG-I CARD in zebrafish embryos significantly activated the NF-κB and IFN signaling pathways, leading to the expression of TNF-α, IL-8 and IFN-induced Mx, ISG15, and viperin. However, knockdown of TRIM25 (a pivotal activator for RIG-I receptors) significantly suppressed the induced activation of IFN signaling. Results suggested the functional conservation of RIG-I receptors in the NF-κB and IFN signaling pathways between teleosts and mammals, providing a perspective into the evolutionary history of RIG-I-mediated antiviral innate immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Foot-and-mouth disease virus replicates only transiently in well-differentiated porcine nasal epithelial cells.

PubMed

Dash, Pradyot; Barnett, Paul V; Denyer, Michael S; Jackson, Terry; Stirling, Catrina M A; Hawes, Philippa C; Simpson, Jennifer L; Monaghan, Paul; Takamatsu, Haru-H

2010-09-01

Three-dimensional (3D) porcine nasal mucosal and tracheal mucosal epithelial cell cultures were developed to analyze foot-and-mouth disease virus (FMDV) interactions with mucosal epithelial cells. The cells in these cultures differentiated and polarized until they closely resemble the epithelial layers seen in vivo. FMDV infected these cultures predominantly from the apical side, primarily by binding to integrin alphav beta6, in an Arg-Gly-Asp (RGD)-dependent manner. However, FMDV replicated only transiently without any visible cytopathic effect (CPE), and infectious progeny virus could be recovered only from the apical side. The infection induced the production of beta interferon (IFN-beta) and the IFN-inducible gene Mx1 mRNA, which coincided with the disappearance of viral RNA and progeny virus. The induction of IFN-beta mRNA correlated with the antiviral activity of the supernatants from both the apical and basolateral compartments. IFN-alpha mRNA was constitutively expressed in nasal mucosal epithelial cells in vitro and in vivo. In addition, FMDV infection induced interleukin 8 (IL-8) protein, granulocyte-macrophage colony-stimulating factor (GM-CSF), and RANTES mRNA in the infected epithelial cells, suggesting that it plays an important role in modulating the immune response.

Bank vole immunoheterogeneity may limit Nephropatia Epidemica emergence in a French non-endemic region.

PubMed

Dubois, A; Castel, G; Murri, S; Pulido, C; Pons, J-B; Benoit, L; Loiseau, A; Lakhdar, L; Galan, M; Marianneau, P; Charbonnel, N

2018-03-01

Ecoevolutionary processes affecting hosts, vectors and pathogens are important drivers of zoonotic disease emergence. In this study, we focused on nephropathia epidemica (NE), which is caused by Puumala hantavirus (PUUV) whose natural reservoir is the bank vole, Myodes glareolus. We questioned the possibility of NE emergence in a French region that is considered to be NE-free but that is adjacent to a NE-endemic region. We first confirmed the epidemiology of these two regions and we demonstrated the absence of spatial barriers that could have limited dispersal, and consequently, the spread of PUUV into the NE-free region. We next tested whether regional immunoheterogeneity could impact PUUV chances to circulate and persist in the NE-free region. We showed that bank voles from the NE-free region were sensitive to experimental PUUV infection. We observed high levels of immunoheterogeneity between individuals and also between regions. Antiviral gene expression (Tnf and Mx2) reached higher levels in bank voles from the NE-free region. During experimental infections, anti-PUUV antibody production was higher in bank voles from the NE-endemic region. These results indicated a lower susceptibility to PUUV for bank voles from this NE-free region, which might limit PUUV persistence and therefore, the risk of NE.

Balancing Agile Combat Support Manpower to Better Meet the Future Security Environment

DTIC Science & Technology

2014-01-01

for a 3,000-person deployment package. 6 Figure 1.1 Postured Manpower Included in This Analysis NOTE: Spc = space, Avn = aviation, MX...an po w er ,  1 00 0s USAF  postured  manpower Spc,   Avn ,  Mx,  Intel Other  ACS Our  scope 7 • In Chapter Four, we discuss several

Nanocrystal synthesis

DOEpatents

Tisdale, William; Prins, Ferry; Weidman, Mark; Beck, Megan

2016-11-01

A method of preparing monodisperse MX semiconductor nanocrystals can include contacting an M-containing precursor with an X donor to form a mixture, where the molar ratio between the M containing precursor and the X donor is large. Alternatively, if additional X donor is added during the reaction, a smaller ratio between the M containing precursor and the X donor can be used to prepare monodisperse MX semiconductor nanocrystals.

Everything You Ever Wanted to Know about the MxCC Class of '85 (and More).

ERIC Educational Resources Information Center

Coggins, John H.; And Others

A study of Connecticut's Middlesex Community College (MxCC) graduates of 1985 was conducted to provide information for use in academic advising, program and curriculum planning, and identifying needs for further research. The study revealed the following information about the 281 members of the graduating class: (1) of the 284 degrees awarded, 79…

78 FR 49207 - Airworthiness Directives; Maule Aerospace Technology, Inc. Airplanes

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-13

... Technology, Inc. Airplanes AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of proposed... certain Maule Aerospace Technology, Inc. M-4, M-5, M-6, M-7, MT-7, MX-7, MXT-7, and M-8 airplanes that are... Technology Corp. (currently Maule Aerospace Technology, Inc.) M-4, M-5, M-6, M-7, MX-7, and MXT-7 series...

Self-optimizing, highly surface-active layered metal dichalcogenide catalysts for hydrogen evolution

NASA Astrophysics Data System (ADS)

Liu, Yuanyue; Wu, Jingjie; Hackenberg, Ken P.; Zhang, Jing; Wang, Y. Morris; Yang, Yingchao; Keyshar, Kunttal; Gu, Jing; Ogitsu, Tadashi; Vajtai, Robert; Lou, Jun; Ajayan, Pulickel M.; Wood, Brandon C.; Yakobson, Boris I.

2017-09-01

Low-cost, layered transition-metal dichalcogenides (MX2) based on molybdenum and tungsten have attracted substantial interest as alternative catalysts for the hydrogen evolution reaction (HER). These materials have high intrinsic per-site HER activity; however, a significant challenge is the limited density of active sites, which are concentrated at the layer edges. Here we unravel electronic factors underlying catalytic activity on MX2 surfaces, and leverage the understanding to report group-5 MX2 (H-TaS2 and H-NbS2) electrocatalysts whose performance instead mainly derives from highly active basal-plane sites, as suggested by our first-principles calculations and performance comparisons with edge-active counterparts. Beyond high catalytic activity, they are found to exhibit an unusual ability to optimize their morphology for enhanced charge transfer and accessibility of active sites as the HER proceeds, offering a practical advantage for scalable processing. The catalysts reach 10 mA cm-2 current density at an overpotential of ˜50-60 mV with a loading of 10-55 μg cm-2, surpassing other reported MX2 candidates without any performance-enhancing additives.

Evaluation of mechanical deformation and distributive magnetic loads with different mechanical constraints in two parallel conducting bars

NASA Astrophysics Data System (ADS)

Lee, Ho-Young; Lee, Se-Hee

2017-08-01

Mechanical deformation, bending deformation, and distributive magnetic loads were evaluated numerically and experimentally for conducting materials excited with high current. Until now, many research works have extensively studied the area of magnetic force and mechanical deformation by using coupled approaches such as multiphysics solvers. In coupled analysis for magnetoelastic problems, some articles and commercial software have presented the resultant mechanical deformation and stress on the body. To evaluate the mechanical deformation, the Lorentz force density method (LZ) and the Maxwell stress tensor method (MX) have been widely used for conducting materials. However, it is difficult to find any experimental verification regarding mechanical deformation or bending deformation due to magnetic force density. Therefore, we compared our numerical results to those from experiments with two parallel conducting bars to verify our numerical setup for bending deformation. Before showing this, the basic and interesting coupled simulation was conducted to test the mechanical deformations by the LZ (body force density) and the MX (surface force density) methods. This resulted in MX gave the same total force as LZ, but the local force distribution in MX introduced an incorrect mechanical deformation in the simulation of a solid conductor.

Binding Affinity, Specificity and Comparative Biodistribution of the Parental Murine Monoclonal Antibody MX35 (Anti-NaPi2b) and Its Humanized Version Rebmab200

PubMed Central

Lindegren, Sture; Andrade, Luciana N. S.; Bäck, Tom; Machado, Camila Maria L.; Horta, Bruno Brasil; Buchpiguel, Carlos; Moro, Ana Maria; Okamoto, Oswaldo Keith; Jacobsson, Lars; Cederkrantz, Elin; Washiyama, Kohshin; Aneheim, Emma; Palm, Stig; Jensen, Holger; Tuma, Maria Carolina B.; Chammas, Roger; Hultborn, Ragnar; Albertsson, Per

2015-01-01

The aim of this preclinical study was to evaluate the characteristics of the monoclonal antibody Rebmab200, which is a humanized version of the ovarian-specific murine antibody MX35. This investigation contributes to the foundation for future clinical α-radioimmunotherapy of minimal residual ovarian cancer with 211At-Rebmab200. Here, the biodistribution of 211At-Rebmab200 was evaluated, as was the utility of 99mTc-Rebmab200 for bioimaging. Rebmab200 was directly compared with its murine counterpart MX35 in terms of its in-vitro capacity for binding the immobilized NaPi2B epitope and live cells; we also assessed its biodistribution in nude mice carrying subcutaneous OVCAR-3 tumors. Tumor antigen and cell binding were similar between Rebmab200 and murine MX35, as was biodistribution, including normal tissue uptake and in-vivo tumor binding. We also demonstrated that 99mTc-Rebmab200 can be used for single-photon emission computed tomography of subcutaneous ovarian carcinomas in tumor-bearing mice. Taken together, our data support the further development of Rebmab200 for radioimmunotherapy and diagnostics. PMID:25970341

Binding Affinity, Specificity and Comparative Biodistribution of the Parental Murine Monoclonal Antibody MX35 (Anti-NaPi2b) and Its Humanized Version Rebmab200.

PubMed

Lindegren, Sture; Andrade, Luciana N S; Bäck, Tom; Machado, Camila Maria L; Horta, Bruno Brasil; Buchpiguel, Carlos; Moro, Ana Maria; Okamoto, Oswaldo Keith; Jacobsson, Lars; Cederkrantz, Elin; Washiyama, Kohshin; Aneheim, Emma; Palm, Stig; Jensen, Holger; Tuma, Maria Carolina B; Chammas, Roger; Hultborn, Ragnar; Albertsson, Per

2015-01-01

The aim of this preclinical study was to evaluate the characteristics of the monoclonal antibody Rebmab200, which is a humanized version of the ovarian-specific murine antibody MX35. This investigation contributes to the foundation for future clinical α-radioimmunotherapy of minimal residual ovarian cancer with 211At-Rebmab200. Here, the biodistribution of 211At-Rebmab200 was evaluated, as was the utility of 99mTc-Rebmab200 for bioimaging. Rebmab200 was directly compared with its murine counterpart MX35 in terms of its in-vitro capacity for binding the immobilized NaPi2B epitope and live cells; we also assessed its biodistribution in nude mice carrying subcutaneous OVCAR-3 tumors. Tumor antigen and cell binding were similar between Rebmab200 and murine MX35, as was biodistribution, including normal tissue uptake and in-vivo tumor binding. We also demonstrated that 99mTc-Rebmab200 can be used for single-photon emission computed tomography of subcutaneous ovarian carcinomas in tumor-bearing mice. Taken together, our data support the further development of Rebmab200 for radioimmunotherapy and diagnostics.

Expression of BAFF receptors in muscle tissue of myositis patients with anti-Jo-1 or anti-Ro52/anti-Ro60 autoantibodies.

PubMed

Kryštůfková, Olga; Barbasso Helmers, Sevim; Venalis, Paulius; Malmström, Vivianne; Lindroos, Eva; Vencovský, Jiří; Lundberg, Ingrid E

2014-10-10

Anti-Jo-1 and anti-Ro52 autoantibodies are common in patients with myositis, but the mechanisms behind their production are not known. Survival of autoantibody-producing cells is dependent on B-cell-activating factor of the tumour necrosis factor family (BAFF). BAFF levels are elevated in serum of anti-Jo-1-positive myositis patients and are influenced by type-I interferon (IFN). IFN-producing cells and BAFF mRNA expression are present in myositis muscle. We investigated expression of the receptors for BAFF in muscle tissue in relation to anti-Jo-1 and anti-Ro52/anti-Ro60 autoantibodies and type-I IFN markers. Muscle biopsies from 23 patients with myositis selected based on autoantibody profile and 7 healthy controls were investigated for expression of BAFF receptor (BAFF-R), B-cell maturation antigen (BCMA) and transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI). Nineteen samples were assessed for plasma (CD138) and B-cell (CD19) markers. The numbers of positive cells per area were compared with the expression of plasmacytoid dendritic cell (pDC) marker blood dendritic cell antigen-2 (BDCA-2) and IFNα/β-inducible myxovirus resistance-1 protein (MX-1). BAFF-R, BCMA and TACI were expressed in five, seven and seven patients, respectively, and more frequently in anti-Jo-1-positive and/or anti-Ro52/anti-Ro60-positive patients compared to controls and to patients without these autoantibodies (P = BAFF-R: 0.007, BCMA: 0.03 and TACI: 0.07). A local association of receptors with B and plasma cells was confirmed by confocal microscopy. The numbers of CD138-positive and BCMA-positive cells were correlated (r = 0.79; P = 0.001). Expression of BDCA-2 correlated with numbers of CD138-positive cells and marginally with BCMA-positive cells (r = 0.54 and 0.42, respectively; P = 0.04 and 0.06, respectively). There was a borderline correlation between the numbers of positively stained TACI cells and MX-1 areas (r = 0.38, P = 0.08). The expression pattern of receptors for BAFF on B and plasma cells in muscle suggests a local role for BAFF in autoantibody production in muscle tissues of patients with myositis who have anti-Jo-1 or anti-Ro52/anti-Ro60 autoantibodies. BAFF production could be influenced by type-I IFN produced by pDCs. Thus, B-cell-related molecular pathways may participate in the pathogenesis of myositis in this subset of patients.

Rapid, directed transport of DC-SIGN clusters in the plasma membrane

PubMed Central

Liu, Ping; Weinreb, Violetta; Ridilla, Marc; Betts, Laurie; Patel, Pratik; de Silva, Aravinda M.; Thompson, Nancy L.; Jacobson, Ken

2017-01-01

C-type lectins, including dendritic cell–specific intercellular adhesion molecule-3–grabbing nonintegrin (DC-SIGN), are all-purpose pathogen receptors that exist in nanoclusters in plasma membranes of dendritic cells. A small fraction of these clusters, obvious from the videos, can undergo rapid, directed transport in the plane of the plasma membrane at average speeds of more than 1 μm/s in both dendritic cells and MX DC-SIGN murine fibroblasts ectopically expressing DC-SIGN. Surprisingly, instantaneous speeds can be considerably greater. In MX DC-SIGN cells, many cluster trajectories are colinear with microtubules that reside close to the ventral membrane, and the microtubule-depolymerizing drug, nocodazole, markedly reduced the areal density of directed movement trajectories, suggesting a microtubule motor–driven transport mechanism; by contrast, latrunculin A, which affects the actin network, did not depress this movement. Rapid, retrograde movement of DC-SIGN may be an efficient mechanism for bringing bound pathogen on the leading edge and projections of dendritic cells to the perinuclear region for internalization and processing. Dengue virus bound to DC-SIGN on dendritic projections was rapidly transported toward the cell center. The existence of this movement within the plasma membrane points to an unexpected lateral transport mechanism in mammalian cells and challenges our current concepts of cortex-membrane interactions. PMID:29134199

Functional Characterization of Canine Interferon-Lambda

PubMed Central

Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun

2014-01-01

In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

DA+ data acquisition and analysis software at the Swiss Light Source macromolecular crystallography beamlines.

PubMed

Wojdyla, Justyna Aleksandra; Kaminski, Jakub W; Panepucci, Ezequiel; Ebner, Simon; Wang, Xiaoqiang; Gabadinho, Jose; Wang, Meitian

2018-01-01

Data acquisition software is an essential component of modern macromolecular crystallography (MX) beamlines, enabling efficient use of beam time at synchrotron facilities. Developed at the Paul Scherrer Institute, the DA+ data acquisition software is implemented at all three Swiss Light Source (SLS) MX beamlines. DA+ consists of distributed services and components written in Python and Java, which communicate via messaging and streaming technologies. The major components of DA+ are the user interface, acquisition engine, online processing and database. Immediate data quality feedback is achieved with distributed automatic data analysis routines. The software architecture enables exploration of the full potential of the latest instrumentation at the SLS MX beamlines, such as the SmarGon goniometer and the EIGER X 16M detector, and development of new data collection methods.

An ab initio study on MgX 3- and CaX 3- superhalogen anions (X=F, Cl, Br)

NASA Astrophysics Data System (ADS)

Anusiewicz, Iwona; Sobczyk, Monika; Dąbkowska, Iwona; Skurski, Piotr

2003-06-01

The vertical electron detachment energies (VDEs) of twenty MX 3- (M=Mg, Ca; X=F, Cl, Br) anions were calculated at the OVGF level with the 6-311++G(3df) basis sets. The largest vertical electron binding energy was found for MgF 3- system (8.793 eV). All negatively charged species possess the VDEs that are larger than 5.9 eV and thus may be termed superhalogen anions. The strong dependence of the VDE of the MX 3- species on the ligand-central atom (M-X) distance and on the partial atomic charge localized on Mg or Ca was observed and discussed, as well as the other factors that may influence the electronic stability of such anions.

Seismic Hazard and Fault Length

NASA Astrophysics Data System (ADS)

Black, N. M.; Jackson, D. D.; Mualchin, L.

2005-12-01

If mx is the largest earthquake magnitude that can occur on a fault, then what is mp, the largest magnitude that should be expected during the planned lifetime of a particular structure? Most approaches to these questions rely on an estimate of the Maximum Credible Earthquake, obtained by regression (e.g. Wells and Coppersmith, 1994) of fault length (or area) and magnitude. Our work differs in two ways. First, we modify the traditional approach to measuring fault length, to allow for hidden fault complexity and multi-fault rupture. Second, we use a magnitude-frequency relationship to calculate the largest magnitude expected to occur within a given time interval. Often fault length is poorly defined and multiple faults rupture together in a single event. Therefore, we need to expand the definition of a mapped fault length to obtain a more accurate estimate of the maximum magnitude. In previous work, we compared fault length vs. rupture length for post-1975 earthquakes in Southern California. In this study, we found that mapped fault length and rupture length are often unequal, and in several cases rupture broke beyond the previously mapped fault traces. To expand the geologic definition of fault length we outlined several guidelines: 1) if a fault truncates at young Quaternary alluvium, the fault line should be inferred underneath the younger sediments 2) faults striking within 45° of one another should be treated as a continuous fault line and 3) a step-over can link together faults at least 5 km apart. These definitions were applied to fault lines in Southern California. For example, many of the along-strike faults lines in the Mojave Desert are treated as a single fault trending from the Pinto Mountain to the Garlock fault. In addition, the Rose Canyon and Newport-Inglewood faults are treated as a single fault line. We used these more generous fault lengths, and the Wells and Coppersmith regression, to estimate the maximum magnitude (mx) for the major faults in southern California. Then we compared our mx values with those proposed by CALTRANS, and those assumed in the 2002 USGS/CGS hazard model. To calculate the planning magnitude mp we assumed a truncated Gutenberg-Richter magnitude distribution with parameters a, b, and mx. We fixed b and solved for the a-value in terms of mx, b, and the tectonic moment rate. For many faults mp is relatively insensitive to mx and typically falls off at higher magnitudes because the a-value decreases with increasing mx when the moment rate is constrained. Furthermore, we find that by increasing mx the cumulative earthquake rate actually decreases for smaller magnitude (5 and 6) events. This suggests that fewer magnitude 5 and 6 earthquakes are required to balance the moment budget if larger, but highly infrequent, earthquakes are allowed to occur.

Remote access and automation of SPring-8 MX beamlines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ueno, Go, E-mail: ueno@spring8.or.jp; Hikima, Takaaki; Yamashita, Keitaro

At SPring-8 MX beamlines, a remote access system has been developed and started user operation in 2010. The system has been developed based on an automated data collection and data management architecture utilized for the confirmed scheme of SPring-8 mail-in data collection. Currently, further improvement to the remote access and automation which covers data processing and analysis are being developed.

MX [3-Chloro-4-(Dichloromethyl)-5-Hydroxy-2[5H]-Furanone], A Drinking-Water Carcinogen, Does Not Induce Mutations in the Liver of Cii Transgenic Medaka (Oryzias latipes)

EPA Science Inventory

Mutagenicity assays with Salmonella have shown that 3-chloro-4-(dichloromethyl)-5-hydroxy-2[5H]-furanone (MX), a drinking water disinfection by-product is a potent mutagen, accounting for about one third of the mutagenic potency/potential of chlorinated drinking water. The abilit...

Anthropometric Characteristics and Performance Capabilities of Highly Trained Motocross Athletes Compared With Physically Active Men.

PubMed

Bach, Christopher W; Brown, Ann F; Kinsey, Amber W; Ormsbee, Michael J

2015-12-01

Motocross (MX) is a physically demanding sport with little research concerning the physiological characteristics of these athletes. The purpose of this study was to assess the anthropometric characteristics and performance capabilities of highly trained MX athletes (n = 20; 19 ± 1.6 years) compared with age-matched physically active (PA) men (n = 22; 22 ± 2.9 years). Testing was performed on 2 occasions. The initial visit consisted of a personality assessment in addition to the following (in order): anthropometrics, body composition, anaerobic power/fatigue, isokinetic/isometric strength and fatigue, and flexibility. The second visit consisted of peak oxygen uptake (V[Combining Dot Above]O2peak), handgrip strength, maximum push-ups in 1 minute, extended arm hang time to exhaustion (TTE), and 90° weighted wall-sit tests. All anthropometric and performance data were analyzed using independent samples t-tests to compare group means. Significance was set at p ≤ 0.05. Data are reported as mean ± SD. There were no significant differences between groups in anthropometric or body composition measurements except android fat (MX: 11.7 ± 1.9% vs. PA: 16.4 ± 8.4%, p = 0.04) and biceps circumference (MX: 30.1 ± 2.0 vs. PA: 33.1 ± 3.2 cm, p = 0.001). MX had significantly higher absolute and relative mean anaerobic power (747.3 ± 63.7 vs. 679.7 ± 93.5 W, p = 0.009 and 10.0 ± 0.6 vs. 9.2 ± 1.3 W·kg, p = 0.002, respectively), relative anaerobic peak power (12.7 ± 0.8 vs. 11.9 ± 1.4 W·kg, p = 0.029), TTE (550.1 ± 70.6 vs. 470.1 ± 93.2 seconds, p = 0.004), and extended arm hang duration (113.3 ± 44.9 vs. 73.4 ± 25.3 seconds, p = 0.001). These results suggest highly trained MX athletes possess certain physiological adaptations that likely result from sport-specific demands compared with PA.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

ALV-J strain SCAU-HN06 induces innate immune responses in chicken primary monocyte-derived macrophages.

PubMed

Feng, Min; Dai, Manman; Cao, Weisheng; Tan, Yan; Li, Zhenhui; Shi, Meiqing; Zhang, Xiquan

2017-01-01

Avian leucosis virus subgroup J (ALV-J) can cause lifelong infection and can escape from the host immune defenses in chickens. Since macrophages act as the important defense line against invading pathogens in host innate immunity, we investigated the function and innate immune responses of chicken primary monocyte-derived macrophages (MDM) after ALV-J infection in this study. Our results indicated that ALV-J was stably maintained in MDM cells but that the viral growth rate was significantly lower than that in DF-1 cells. We also found that ALV-J infection significantly increased nitric oxide (NO) production, but had no effect on MDM phagocytic capacity. Interestingly, infection with ALV-J rapidly promoted the expression levels of Myxovirus resistance 1 (Mx) (3 h, 6 h), ISG12 (6 h), and interleukin-1β (IL-1β) (3 h, 12 h) at an early infection stage, whereas it sharply decreased the expression of Mx (24 h, 36 h), ISG12 (36 h), and made little change on IL-1β (24 h, 36 h) production at a late infection stage in MDM cells. Moreover, the protein levels of interferon-β (IFN-β) and interleukin-6 (IL-6) had sharply increased in infected MDM cells from 3 to 36 h post infection (hpi) of ALV-J. And, the protein level of interleukin-10 (IL-10) was dramatically decreased at 36 hpi in MDM cells infected with ALV-J. These results demonstrate that ALV-J can induce host innate immune responses and we hypothesize that macrophages play an important role in host innate immune attack and ALV-J immune escape. © The Author 2016. Published by Oxford University Press on behalf of Poultry Science Association.

Accuracy of three-dimensional dental resin models created by fused deposition modeling, stereolithography, and Polyjet prototype technologies: A comparative study.

PubMed

Rebong, Raymund E; Stewart, Kelton T; Utreja, Achint; Ghoneima, Ahmed A

2018-05-01

The aim of this study was to assess the dimensional accuracy of fused deposition modeling (FDM)-, Polyjet-, and stereolithography (SLA)-produced models by comparing them to traditional plaster casts. A total of 12 maxillary and mandibular posttreatment orthodontic plaster casts were selected from the archives of the Orthodontic Department at the Indiana University School of Dentistry. Plaster models were scanned, saved as stereolithography files, and printed as physical models using three different three-dimensional (3D) printers: Makerbot Replicator (FDM), 3D Systems SLA 6000 (SLA), and Objet Eden500V (Polyjet). A digital caliper was used to obtain measurements on the original plaster models as well as on the printed resin models. Comparison between the 3D printed models and the plaster casts showed no statistically significant differences in most of the parameters. However, FDM was significantly higher on average than were plaster casts in maxillary left mixed plane (MxL-MP) and mandibular intermolar width (Md-IMW). Polyjet was significantly higher on average than were plaster casts in maxillary intercanine width (Mx-ICW), mandibular intercanine width (Md-ICW), and mandibular left mixed plane (MdL-MP). Polyjet was significantly lower on average than were plaster casts in maxillary right vertical plane (MxR-vertical), maxillary left vertical plane (MxL-vertical), mandibular right anteroposterior plane (MdR-AP), mandibular right vertical plane (MdR-vertical), and mandibular left vertical plane (MdL-vertical). SLA was significantly higher on average than were plaster casts in MxL-MP, Md-ICW, and overbite. SLA was significantly lower on average than were plaster casts in MdR-vertical and MdL-vertical. Dental models reconstructed by FDM technology had the fewest dimensional measurement differences compared to plaster models.

[Validation of an instrument for measuring the effects of oral health on the quality of life of older adults in Mexico].

PubMed

Castrejón-Pérez, Roberto Carlos; Borges-Yáñez, S Aída; Irigoyen-Camacho, María Esther

2010-05-01

Translate, culturally adapt, and validate a new Spanish version of the Oral Health Impact Profile (OHIP) for older persons in Mexico City, Mexico. A validation study of the new version of OHIP-Mx-49 was carried out through interviews and clinical examinations of people aged 60 or older in the southern area of Mexico City. The following variables were analyzed: sociodemographic (age, sex, marital status, level of schooling, and whether the subject lived alone), clinical (current number of teeth, coronal and root caries, dental hygiene, and the use of removable prostheses and dentures), and self-perception (of the need for dental and general health care). The OHIP-Mx-49 value was calculated as the sum of the scores in seven dimensions: functional limitation, pain, psychological discomfort, physical disability, psychological disability, social disability, and handicap. The internal consistency (Cronbach's alpha coefficient), replicability (intraclass correlation coefficient), and convergent and discriminant validity (Mann-Whitney and Kruskal-Wallis tests) were assessed. Of the 131 people interviewed (average age: 73.8 +/- 8.3 years), 77.9% were women. High internal consistency values were obtained for the OHIP-Mx-49 (0.96) and the dimensions (0.79-0.86), and replicability in the instrument (0.877) and all the dimensions except social disability (0.176). The average OHIP-Mx-49 score was 37.1 +/- 35.3; higher scores were observed in people with 1-9 teeth (P = 0.02), people who did not have coronal caries (P = 0.02), and people who perceived a need for dental care (P = 0.01). The OHIP-Mx-49 is a reliable and valid instrument that can be used with older Mexicans.

Relative validity of a tool to measure food acculturation in children of Mexican descent.

PubMed

Vera-Becerra, Luz Elvia; Lopez, Martha L; Kaiser, Lucia L

2016-02-01

The purpose of this study was to examine relative validity of a food frequency questionnaire (FFQ) to measure food acculturation in young Mexican-origin children. In 2006, Spanish-speaking staff interviewed mothers in a community-based sample of households from Ventura, California (US) (n = 95) and Guanajuato, Mexico (MX) (n = 200). Data included two 24-h dietary recalls (24-DR); a 30-item FFQ; and anthropometry of the children. To measure construct, convergent, and discriminant validity, data analyses included factor analysis, Spearman correlations, t-test, respectively. Factor analysis revealed two constructs: 1) a US food pattern including hamburgers, pizza, hot dogs, fried chicken, juice, cereal, pastries, lower fat milk, quesadillas, and American cheese and 2) a MX food pattern including tortillas, fried beans, rice/noodles, whole milk, and pan dulce (sweet bread). Out of 22 food items that could be compared across the FFQ and mean 24-DRs, 17 were significantly, though weakly, correlated (highest r = 0.62, for whole milk). The mean US food pattern score was significantly higher, and the MX food pattern score, lower in US children than in MX children (p < 0.0001). After adjusting for child's age and gender; mother's education; and household size, the US food pattern score was positively related to body mass index (BMI) z-scores (beta coefficient: +0.29, p = - 0.004), whereas the MX food pattern score was negatively related to BMI z-scores (beta coefficient: -0.28, p = 0.002). This tool may be useful to evaluate nutrition education interventions to prevent childhood obesity on both sides of the border. Copyright © 2015 Elsevier Ltd. All rights reserved.

DA+ data acquisition and analysis software at the Swiss Light Source macromolecular crystallography beamlines

PubMed Central

Wojdyla, Justyna Aleksandra; Kaminski, Jakub W.; Ebner, Simon; Wang, Xiaoqiang; Gabadinho, Jose; Wang, Meitian

2018-01-01

Data acquisition software is an essential component of modern macromolecular crystallography (MX) beamlines, enabling efficient use of beam time at synchrotron facilities. Developed at the Paul Scherrer Institute, the DA+ data acquisition software is implemented at all three Swiss Light Source (SLS) MX beamlines. DA+ consists of distributed services and components written in Python and Java, which communicate via messaging and streaming technologies. The major components of DA+ are the user interface, acquisition engine, online processing and database. Immediate data quality feedback is achieved with distributed automatic data analysis routines. The software architecture enables exploration of the full potential of the latest instrumentation at the SLS MX beamlines, such as the SmarGon goniometer and the EIGER X 16M detector, and development of new data collection methods. PMID:29271779

Improved ambient-pressure organic superconductor. [Bis(ethylenedithio)TTF-MX/sub 2/

DOEpatents

Williams, J.M.; Wang, Hsien-Hau; Beno, M.A.

1985-05-29

Disclosed is a new class of organic superconductors having the formula (ET)/sub 2/MX/sub 2/ wherein ET represents bis(ethylenedithio)-tetrathiafulvalene, M is a metal such as Au, Ag, In, Tl, Rb, Pd and the like and X is a halide. The superconductor (ET)/sub 2/AuI/sub 2/ exhibits a transition temperature of 5/sup 0/K which is high for organic superconductors.

Why 1986 Minus 1985 Does Not Equal One: A Comparison of Selected Demographics of the 1986 and 1985 Graduates of MxCC.

ERIC Educational Resources Information Center

Muzeroll, Terry; And Others

In 1986, a study was conducted at Middlesex Community College (MxCC) to examine selected demographics of that year's graduating class and to compare them with similar statistics compiled for 1985 graduates. The graduating classes were compared in terms of students' major, sex, age, full-/part-time status, average number of semesters attended,…

Iontophoresis-targeted, follicular delivery of minoxidil sulfate for the treatment of alopecia.

PubMed

Gelfuso, Guilherme Martins; Gratieri, Tais; Delgado-Charro, M Begoña; Guy, Richard H; Vianna Lopez, Renata Fonseca

2013-05-01

Although minoxidil (MX) is a drug known to stimulate hair growth, the treatment of androgenic alopecia could be improved by delivery strategies that would favor drug accumulation into the hair follicles. This work investigated in vitro the potential of iontophoresis to achieve this objective using MX sulfate (MXS), a more water-soluble derivative of MX. Passive delivery of MXS was first determined from an ethanol-water solution and from a thermosensitive gel. The latter formulation resulted in greater accumulation of MXS in the stratum corneum (skin's outermost layer) and hair follicles and an overall decrease in absorption through the skin. Anodal iontophoresis of MXS from the same gel formulation was then investigated at pH 3.5 and pH 5.5. Compared with passive delivery, iontophoresis increased the amount of drug reaching the follicular infundibula from 120 to 600 ng per follicle. In addition, drug recovery from follicular casts was threefold higher following iontophoresis at pH 5.5 compared with that at pH 3.5. Preliminary in vivo experiments in rats confirmed that iontophoretic delivery of MXS facilitated drug accumulation in hair follicles. Overall, therefore, iontophoresis successfully and significantly enhanced follicular delivery of MX suggesting a useful opportunity for the improved treatment of alopecia. Copyright © 2013 Wiley Periodicals, Inc.

Austenitizing Temperature Effects on the Martensitic Transformation, Microstructural Characteristics, and Mechanical Performance of Modified Ferritic Heat-Resistant Steel

NASA Astrophysics Data System (ADS)

Zhou, Xiaosheng; Liu, Yongchang; Liu, Chenxi; Yu, Liming; Li, Huijun

2018-06-01

The martensitic transformation, microstructural characteristics, and mechanical performance of modified ferritic heat-resistant steels under various austenitizing conditions were investigated by differential scanning calorimetry, microstructural examination, and mechanical tests. When the austenitizing temperature was as high as 1200 °C, a considerable amount of δ-ferrite formed, and the austenite grain size was seen to decrease. Higher austenitizing temperatures were found to promote martensite formation, but retard martensite growth, and the lath width increased as the austenitizing temperature increased. After tempering, rod-like and granular M23C6 carbides appeared within the tempered martensite, the average size and composition of which were dependent on the austenitizing conditions. When the austenitizing temperature was 1050 °C, granular MX with sizes less than 6 nm were identified in the δ-ferrite, while for other austenitizing temperatures, plate MX was inside the δ-ferrite. At 1200 °C, the length of the plate MX was as high as 100 nm, and the number density of plate MX decreased. The steel austenitized at 1150 °C exhibited the best tensile performance. It was found that the presence of a large amount of δ-ferrite would initiate cracking, thereby impeding the tensile strength.

Lateral topological crystalline insulator heterostructure

NASA Astrophysics Data System (ADS)

Sun, Qilong; Dai, Ying; Niu, Chengwang; Ma, Yandong; Wei, Wei; Yu, Lin; Huang, Baibiao

2017-06-01

The emergence of lateral heterostructures fabricated by two-dimensional building blocks brings many exciting realms in material science and device physics. Enriching available nanomaterials for creating such heterostructures and enabling the underlying new physics is highly coveted for the integration of next-generation devices. Here, we report a breakthrough in lateral heterostructure based on the monolayer square transition-metal dichalcogenides MX2 (M  =  W, X  =  S/Se) modules. Our results reveal that the MX2 lateral heterostructure (1S-MX2 LHS) can possess excellent thermal and dynamical stability. Remarkably, the highly desired two-dimensional topological crystalline insulator phase is confirmed by the calculated mirror Chern number {{n}\\text{M}}=-1 . A nontrivial band gap of 65 meV is obtained with SOC, indicating the potential for room-temperature observation and applications. The topologically protected edge states emerge at the edges of two different nanoribbons between the bulk band gap, which is consistent with the mirror Chern number. In addition, a strain-induced topological phase transition in 1S-MX2 LHS is also revealed, endowing the potential utilities in electronics and spintronics. Our predictions not only introduce new member and vitality into the studies of lateral heterostructures, but also highlight the promise of lateral heterostructure as appealing topological crystalline insulator platforms with excellent stability for future devices.

Preparing high performance of LiFe(1-x)MxPO4 by using Fe(1-x)MxC2O4 as raw material precipitated from ferrochrome alloy leaching solution

NASA Astrophysics Data System (ADS)

Hu, Guo-rong; Liu, Ji-jun; Du, Ke; Peng, Zhong-dong; Cao, Yan-bing; Wang, Wei-gang; Duan, Jian-guo

2014-08-01

To separate ferrum from chromium in the leaching sulfate solution of ferrochrome alloy, the oxalic acid was employed to precipitate the ferrum as the form of FeC2O4 and Cr was left in the solution. In this route, small amount of nickel, cobalt and manganese exited in ferrochrome alloy were also precipitated simultaneously together with ferrous oxalate. Analysis from ICP shows that the molar percent of Fe in oxalic precipitate is 97.9% and the main doped elements are Ni (1.1%) and Mn (0.4%).The mixed metal oxalate Fe(1-x)MxC2O4 was used as a raw material to prepare doped LiFePO4 cathode material of lithium ion batteries. The obtained LiFe(1-x)MxPO4/C was a single olivine-type phase with higher crystallinity and presents the well-distributed fine particles. It shows an outstanding electrochemical performance with a discharge capacity of 162 mAh/g at the rate of 0.1 C, 136 mAh/g at 1 C and 103 mAh/g at 5 C. When cycled at 1 C for 50 times, the capacity retention is 98.2%.

The electronic and transport properties of monolayer transition metal dichalcogenides: a complex band structure analysis

NASA Astrophysics Data System (ADS)

Szczesniak, Dominik

Recently, monolayer transition metal dichalcogenides have attracted much attention due to their potential use in both nano- and opto-electronics. In such applications, the electronic and transport properties of group-VIB transition metal dichalcogenides (MX2 , where M=Mo, W; X=S, Se, Te) are particularly important. Herein, new insight into these properties is presented by studying the complex band structures (CBS's) of MX2 monolayers while accounting for spin-orbit coupling effects. By using the symmetry-based tight-binding model a nonlinear generalized eigenvalue problem for CBS's is obtained. An efficient method for solving such class of problems is presented and gives a complete set of physically relevant solutions. Next, these solutions are characterized and classified into propagating and evanescent states, where the latter states present not only monotonic but also oscillatory decay character. It is observed that some of the oscillatory evanescent states create characteristic complex loops at the direct band gaps, which describe the tunneling currents in the MX2 materials. The importance of CBS's and tunneling currents is demonstrated by the analysis of the quantum transport across MX2 monolayers within phase field matching theory. Present work has been prepared within the Qatar Energy and Environment Research Institute (QEERI) grand challenge ATHLOC project (Project No. QEERI- GC-3008).

Partition of volatile organic compounds from air and from water into plant cuticular matrix: An LFER analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Platts, J.A.; Abraham, M.H.

The partitioning of organic compounds between air and foliage and between water and foliage is of considerable environmental interest. The purpose of this work is to show that partitioning into the cuticular matrix of one particular species can be satisfactorily modeled by general equations the authors have previously developed and, hence, that the same general equations could be used to model partitioning into other plant materials of the same or different species. The general equations are linear free energy relationships that employ descriptors for polarity/polarizability, hydrogen bond acidity and basicity, dispersive effects, and volume. They have been applied to themore » partition of 62 very varied organic compounds between cuticular matrix of the tomato fruit, Lycopersicon esculentum, and either air (MX{sub a}) or water (MX{sub w}). Values of log MX{sub a} covering a range of 12.4 log units are correlated with a standard deviation of 0.232 log unit, and values of log MX{sub w} covering a range of 7.6 log unit are correlated with an SD of 0.236 log unit. Possibilities are discussed for the prediction of new air-plant cuticular matrix and water-plant cuticular matrix partition values on the basis of the equations developed.« less

Utilization Chitosan-p-t-Butylcalix[4]Arene for Red MX 8B Adsorbent

NASA Astrophysics Data System (ADS)

Handayani, D. S.; Kusumaningsih, T.; Hak, L. A.

2017-02-01

Adsorption of Procion Red MX 8B using chitosan dan chitosan-linked p-t-butylcalix[4]arene has been done. The research aimed to understand the adsorption of Procion Red MX 8B using chitosan p-t-butylcalix[4]arene compared to ordinary chitosan. The research was conducted in a batch process varying in pH, contact time and initial concentration of the Procion Red MX 8B. The amount of dye adsorbed was determined using UV-Vis spectrophotometer and the adsorben was characterized using FTIR and SEM-EDX spectrophotometer. The result showed that the optimum condition was achieved when the pH was set at 4, contact time 135 minutes and initial concentration at 200 ppm. The kinetic analysis showed that the adsorption followed Ho kinetic model and pseudo second order with the adsorption rate constant was 3.69×10-3 g/mg.minute and 2.03×10-3 g/mg.minute. The isotherm analysis showed that the adsorption process tend to occur following the Langmuir model with maximum capacity for chitosan and chitosan-linked p-t-butylcalix[4]arene 136.09 mg/g and 147.35 mg/g respectively. The adsorption energy of chitosan and chitosan-linked p-t-butylcalix[4]arene at 30.53 kJ/mole and 33.65 kJ/mole.

Operon-mapper: A Web Server for Precise Operon Identification in Bacterial and Archaeal Genomes.

PubMed

Taboada, Blanca; Estrada, Karel; Ciria, Ricardo; Merino, Enrique

2018-06-19

Operon-mapper is a web server that accurately, easily, and directly predicts the operons of any bacterial or archaeal genome sequence. The operon predictions are based on the intergenic distance of neighboring genes as well as the functional relationships of their protein-coding products. To this end, Operon-mapper finds all the ORFs within a given nucleotide sequence, along with their genomic coordinates, orthology groups, and functional relationships. We believe that Operon-mapper, due to its accuracy, simplicity and speed, as well as the relevant information that it generates, will be a useful tool for annotating and characterizing genomic sequences. http://biocomputo.ibt.unam.mx/operon_mapper/.

Standardized UXO Technology Demonstration Site Open Field Scoring Record No. 908

DTIC Science & Technology

2008-08-01

demonstration at Aberdeen Proving Ground, a system with eight fluxgate magnetometers (Foerster CON650 gradiometers) and RTK-DGPS georeferencing will...be used. The spacing between the individual fluxgate sensors will be 25 cm (ca. 10 inches), totaling to a swath width of 2 m. c. The MAGNETO...MX system consists of: the MX-compact hardware multiplexer electronic module, up to 32 fluxgate gradiometers (for the APG demonstration: 8 fluxgate

Equivalent Circuit for Magnetoelectric Read and Write Operations

NASA Astrophysics Data System (ADS)

Camsari, Kerem Y.; Faria, Rafatul; Hassan, Orchi; Sutton, Brian M.; Datta, Supriyo

2018-04-01

We describe an equivalent circuit model applicable to a wide variety of magnetoelectric phenomena and use spice simulations to benchmark this model against experimental data. We use this model to suggest a different mode of operation where the 1 and 0 states are represented not by states with net magnetization (like mx , my, or mz) but by different easy axes, quantitatively described by (mx2-my2), which switches from 0 to 1 through the write voltage. This change is directly detected as a read signal through the inverse effect. The use of (mx2-my2) to represent a bit is a radical departure from the standard convention of using the magnetization (m ) to represent information. We then show how the equivalent circuit can be used to build a device exhibiting tunable randomness and suggest possibilities for extending it to nonvolatile memory with read and write capabilities, without the use of external magnetic fields or magnetic tunnel junctions.

Urine mutagenicity and biochemical effects of the drinking water mutagen, 3-chloro-4-(dichloromethyl)-5-hydroxy-2[5H]-furanone (MX), following repeated oral administration to mice and rats.

PubMed

Meier, J R; Monarca, S; Patterson, K S; Villarini, M; Daniel, F B; Moretti, M; Pasquini, R

1996-06-17

Mutagenicity analysis of urine from rats treated by oral gavage with MX at a dose of 64 mg/kg for 14 days revealed that only 0.3% of the administered compound was excreted in a genotoxically active form. At lower doses, mutagenicity was not detectable. No evidence of micronucleus induction in peripheral blood erythrocytes was observed in mice treated similarly. These findings indicate that MX is extensively detoxified in vivo and is unlikely to cause genetic damage in systemic tissues except at relatively high doses where detoxification pathways become saturated. In a separate experiment, significant depressions were observed in D-glucaric acid and thioether excretion and in levels of several liver enzymes involved in xenobiotic metabolism. The mechanism for these metabolic alterations and their relevance to the in vivo metabolism of the compound require further investigation.

Design and evaluation of novel interferon lambda analogs with enhanced antiviral activity and improved drug attributes

PubMed Central

Yu, Debin; Zhao, Mingzhi; Dong, Liwei; Zhao, Lu; Zou, Mingwei; Sun, Hetong; Zhang, Mengying; Liu, Hongyu; Zou, Zhihua

2016-01-01

Type III interferons (IFNs) (also called IFN-λ: IFN-λ1, IFN-λ2, IFN-λ3, and IFN-λ4) are critical players in the defense against viral infection of mucosal epithelial cells, where the activity of type I IFNs is weak, and unlike type I IFNs that are associated with severe and diverse side effects, type III IFNs cause minimal side effects due to the highly restricted expression of their receptors, and thus appear to be promising agents for the treatment and prevention of respiratory and gastrointestinal viral infection. However, the antiviral potency of natural type III IFNs is weak compared to type I and, although IFN-λ3 possesses the highest bioactivity among the type III IFNs, IFN-λ1, instead of IFN-λ3, is being developed as a therapeutic drug due to the difficulty to express IFN-λ3 in the prokaryotic expression system. Here, to develop optimal IFN-λ molecules with improved drug attributes, we designed a series of IFN-λ analogs by replacing critical amino acids of IFN-λ1 with the IFN-λ3 counterparts, and vice versa. Four of the designed analogs were successfully expressed in Escherichia coli with high yield and were easily purified from inclusion bodies. Interestingly, all four analogs showed potent activity in inducing the expression of the antiviral genes MxA and OAS and two of them, analog-6 and -7, displayed an unexpected high potency that is higher than that of type I IFN (IFN-α2a) in activating the IFN-stimulated response element (ISRE)-luciferase reporter. Importantly, both analog-6 and -7 effectively inhibited replication of hepatitis C virus in Huh-7.5.1 cells, with an IC50 that is comparable to that of IFN-α2a; and consistent with the roles of IFN-λ in mucosal epithelia, both analogs potently inhibited replication of H3N2 influenza A virus in A549 cells. Together, these studies identified two IFN-λ analogs as candidates to be developed as novel antiviral biologics. PMID:26792983

In vivo Ebola virus infection leads to a strong innate response in circulating immune cells.

PubMed

Caballero, Ignacio S; Honko, Anna N; Gire, Stephen K; Winnicki, Sarah M; Melé, Marta; Gerhardinger, Chiara; Lin, Aaron E; Rinn, John L; Sabeti, Pardis C; Hensley, Lisa E; Connor, John H

2016-09-05

Ebola virus is the causative agent of a severe syndrome in humans with a fatality rate that can approach 90 %. During infection, the host immune response is thought to become dysregulated, but the mechanisms through which this happens are not entirely understood. In this study, we analyze RNA sequencing data to determine the host response to Ebola virus infection in circulating immune cells. Approximately half of the 100 genes with the strongest early increases in expression were interferon-stimulated genes, such as ISG15, OAS1, IFIT2, HERC5, MX1 and DHX58. Other highly upregulated genes included cytokines CXCL11, CCL7, IL2RA, IL2R1, IL15RA, and CSF2RB, which have not been previously reported to change during Ebola virus infection. Comparing this response in two different models of exposure (intramuscular and aerosol) revealed a similar signature of infection. The strong innate response in the aerosol model was seen not only in circulating cells, but also in primary and secondary target tissues. Conversely, the innate immune response of vaccinated macaques was almost non-existent. This suggests that the innate response is a major aspect of the cellular response to Ebola virus infection in multiple tissues. Ebola virus causes a severe infection in humans that is associated with high mortality. The host immune response to virus infection is thought to be an important aspect leading to severe pathology, but the components of this overactive response are not well characterized. Here, we analyzed how circulating immune cells respond to the virus and found that there is a strong innate response dependent on active virus replication. This finding is in stark contrast to in vitro evidence showing a suppression of innate immune signaling, and it suggests that the strong innate response we observe in infected animals may be an important contributor to pathogenesis.

Experimental infection studies demonstrating Atlantic salmon as a host and reservoir of viral hemorrhagic septicemia virus type IVa with insights into pathology and host immunity

USGS Publications Warehouse

Lovy, Jan; Piesik, P.; Hershberger, P.K.; Garver, K.A.

2013-01-01

In British Columbia, Canada (BC), aquaculture of finfish in ocean netpens has the potential for pathogen transmission between wild and farmed species due to the sharing of an aquatic environment. Viral hemorrhagic septicemia virus (VHSV) is enzootic in BC and causes serious disease in wild Pacific herring, Clupea pallasii, which often enter and remain in Atlantic salmon, Salmo salar, netpens. Isolation of VHSV from farmed Atlantic salmon has been previously documented, but the effects on the health of farmed salmon and the wild fish sharing the environment are unknown. To determine their susceptibility, Atlantic salmon were exposed to a pool of 9 isolates of VHSV obtained from farmed Atlantic salmon in BC by IP-injection or by waterborne exposure and cohabitation with diseased Pacific herring. Disease intensity was quantified by recording mortality, clinical signs, histopathological changes, cellular sites of viral replication, expression of interferon-related genes, and viral tissue titers. Disease ensued in Atlantic salmon after both VHSV exposure methods. Fish demonstrated gross disease signs including darkening of the dorsal skin, bilateral exophthalmia, light cutaneous hemorrhage, and lethargy. The virus replicated within endothelial cells causing endothelial cell necrosis and extensive hemorrhage in anterior kidney. Infected fish demonstrated a type I interferon response as seen by up-regulation of genes for IFNα, Mx, and ISG15. In a separate trial infected salmon transmitted the virus to sympatric Pacific herring. The results demonstrate that farmed Atlantic salmon can develop clinical VHS and virus can persist in the tissues for at least 10 weeks. Avoiding VHS epizootics in Atlantic salmon farms would limit the potential of VHS in farmed Atlantic salmon, the possibility for further host adaptation in this species, and virus spillback to sympatric wild fishes.

WORLD PORT INDEX Nineteenth Edition

DTIC Science & Technology

2009-01-01

SABLE US 4424N 08319W CP06 14863 V RN E N N Y Y Y Q N Q M Y N 4460 OSCODA US 4425N 08319W CP06 14863 V RN E N N Y Y Y Q N Q M Y N 4470 ALPENA US 4504N... ALPENA US CP06 04470 ALSEA 16810 * ALTA NO 182 21130 ALTAMIRA MX 148 09355 ALTATA MX 153 15820 ALUMINA MARINE TERM 10772 * ALUSHTA UP BA24 43810

Fine Resolution Imaging of Space Objects.

DTIC Science & Technology

1982-02-01

Figur einschliesst," J. reine agnew. Math. 123, 241 (1901). 5. J. Christou, "Imaging of Star Clusters from Speckle Inter- ferometry," Opt. Commun...Also, at any point x, by definition g.+,(x) is the near- est value to gMx ) that satisfies the object-domain constraints. Therefore, at all...the point gk(x) rather than from g^(x) since presumably gMx ) is closer to the solution than gk(x). After using Eq. (40), one would employ Eq. (35

M-X Environmental Technical Report. Socioeconomic Impact Estimates for White Pine County, Nevada. Detailed Tables.

DTIC Science & Technology

1980-12-22

8217AP0A095 772 HENNINGSON DURHAM AND RICHARDSON SANTA BARBARA CA F/G 16/1 B-B ENVIRONMENTAL TECHNICAL REPORT. SOCIOECONOMIC IMPACT ESTIMA--ETC(U) DEC... Environmental Technical Reports,. 53ocioeconctnic’ Final r1eport Impact . Estimates for White Pine County, Nevada. ____________ Detailed Tables 6. PERFORMING...background information for the analysis contained in the M-X Deploment Area Selection and Land Withirawal/Acquisition Draft Environmental Impact Statement

M-X Environmental Technical Report. Alternative Potential Operating Base Locations, Coyote Spring Valley.

DTIC Science & Technology

1980-12-22

necessary and identify by block number) MX Coyote Spring, Nevada Siting Analysis Nevada Environnental Report 20. ABSTRACT (Continue on reverse side If...necessary and Identify by block number) The area of analysis (AO) for the Coyote Spring Valley operating base option includes both Clark and Lincoln...counties, and is located in the southern portion of the designated region of influence. Las Vegas and the surrounding suburbs are the major settlements and

Port and Supply-Chain Security Initiatives in the United States and Abroad

DTIC Science & Technology

2006-01-01

Secretaria de Comunicacion y Transportes (SCT), “Get to Know Us,” Online. Available: http://portal.sct.gob.mx:80/SctPortal/apPAMnager/Portal/Sct;jsessionid... Comunicacion y Transportes (SCT), “Principal Advancements in the Sector” SCT: Annual Report 2005, Online. Available: http://portal.sct.gob.mx:80...SctPortal/apPAMnager/Portal/Sct?_nfpb=true&_pageLabel=B28002. Accessed: June 20, 2006. 564 Secretaria de Comunicacion y Transportes (SCT), “Structure

MX Siting Investigation. Water Resources Program Industry Activity Inventory, Nevada-Utah.

DTIC Science & Technology

1980-09-02

sites. New and revived mining activities and the cooling needs of possible new coal -fired electric power plants represent the chief competitors with MX...34 !- ---- ON CO. Figure .-. Ma showing araipce yUaIoto f𔃻XMsieCmlx 1 3 include new mining activity and coal -fired, geothermal, and hydroelectric j energy...in northeastern Juab County. The Soil Conservation Service has been actively pushing land treatment programs to increase the productivity of irrigated

MX Siting Investigation. Faults and Lineaments in the MX Siting Region, Nevada and Utah. Volume I.

DTIC Science & Technology

1981-11-06

indicate favorable mineral potential. Verifi- cation, Operational Base, and Shelter Layout studies used fault and lineament data to assist in determining... shelter locations were situated so as to avoid faults but roads were allowed to cross some faults and lineaments because it is generally infeasible, if not... Cordillera in the Western United States, in Smith, R. B., and Eaton, G. P., eds., Cenozoic tectonics - and regional geophysics of the western Cordillera

AmeriFlux MX-Lpa La Paz

DOE Data Explorer

Oechel, Walter [San Diego State University

2016-01-01

This is the AmeriFlux version of the carbon flux data for the site MX-Lpa La Paz. Site Description - As evident by some very large Cardon (5-7 meters), according to Coyle and Roberts, 1975, extent vegetation has likely been around at least 200 years. Until about 15 years ago from 1996, site was used for livestock production and selective firewood extraction. However, when I look over the fence where there has been livestock activity, not much difference

Mutagenic and clastogenic properties of 3-chloro-4-(dichloromethyl)-5-hydroxy-2 (5H)-furanone: a potent bacterial mutagen in drinking water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meier, J.R.; Blazak, W.F.; Knohl, R.B.

1987-01-01

3-Chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX) was found to be a direct-acting mutagen in the Ames test for strains TA1535, TA1538, TA92, TA97, TA98, TA100 and TA102. The highest mutagenic response (approximately 13,000 revertants/nmol) was seen in strain TA100. The TA100 response was six- to tenfold higher than in TA98, TA97, and TA102, and 100- to 500-fold higher than in TA1535, TA92, and TA1538. The addition of a 9,000 x g supernatant fraction (S-9) from livers of polychlorinated biphenyl-treated rats, along with cofactors for NADPH generation, resulted in a 90% reduction in the TA100 mutagenicity. MX induced chromosomal aberrations in Chinese hamster ovary cellsmore » after 6-8 hr exposure without S-9 at a dose as low as 4 micrograms/ml, and after 2 hr exposure with S-9 at a dose of 75 micrograms/ml. The oral dose of MX lethal to 50% (LD50) in Swiss-Webster mice was determined to be 128 mg/kg. MX did not induce micronuclei in mouse bone marrow when administered by oral gavage at doses up to 70% of the LD50.« less

New Insight into Phase Formation of MxMg2Al4+xSi5−xO18:Eu2+ Solid Solution Phosphors and Its Luminescence Properties

PubMed Central

Zhou, Jun; Xia, Zhiguo; Chen, Mingyue; Molokeev, Maxim S.; Liu, Quanlin

2015-01-01

Here we reported the phase formation of MxMg2Al4+xSi5−xO18:Eu2+ (M = K, Rb) solid solution phosphors, where M+ ions were introduced into the void channels of Mg2Al4Si5O18 via Al3+/Si4+ substitution to keep the charge balance. XRD results revealed that the as-prepared phosphors with different M+ contents were iso-structural with Mg2Al4Si5O18 phase. The combined analysis of the Rietveld refinement and high resolution transmission electron microscopy (HRTEM) results proved that M+ ions were surely introduced into the intrinsic channels in Mg2Al4Si5O18. The emission peaks of MxMg2Al4+xSi5−xO18:Eu2+ (M = K, Rb) phosphors with various x values performed a systematic red-shift tendency, which was ascribed to the elongation of [MgO6] octahedra. The temperature stable photoluminescence and internal quantum efficiency (QE) of MxMg2Al4+xSi5−xO18:Eu2+ (M = K, Rb) phosphors were enhanced owing to the filling of M+ in the void channels suggesting a new insight to design the solid solution phosphors with improved photoluminescence properties. PMID:26190348

First principles study of structural, vibrational and electronic properties of graphene-like MX 2 (M=Mo, Nb, W, Ta; X=S, Se, Te) monolayers

NASA Astrophysics Data System (ADS)

Ding, Yi; Wang, Yanli; Ni, Jun; Shi, Lin; Shi, Siqi; Tang, Weihua

2011-05-01

Using first principles calculations, we investigate the structural, vibrational and electronic structures of the monolayer graphene-like transition-metal dichalcogenide (MX 2) sheets. We find the lattice parameters and stabilities of the MX 2 sheets are mainly determined by the chalcogen atoms, while the electronic properties depend on the metal atoms. The NbS 2 and TaS 2 sheets have comparable energetic stabilities to the synthesized MoS 2 and WS 2 ones. The molybdenum and tungsten dichalcogenide (MoX 2 and WX 2) sheets have similar lattice parameters, vibrational modes, and electronic structures. These analogies also exist between the niobium and tantalum dichalcogenide (NbX 2 and TaX 2) sheets. However, the NbX 2 and TaX 2 sheets are metals, while the MoX 2 and WX 2 ones are semiconductors with direct-band gaps. When the Nb and Ta atoms are doped into the MoS 2 and WS 2 sheets, a semiconductor-to-metal transition occurs. Comparing to the bulk compounds, these monolayer sheets have similar structural parameters and properties, but their vibrational and electronic properties are varied and have special characteristics. Our results suggest that the graphene-like MX 2 sheets have potential applications in nano-electronics and nano-devices.

Investigation of Ta-MX/Z-Phase and Laves Phase as Precipitation Hardening Particles in a 12 Pct Cr Heat-Resistant Steel

NASA Astrophysics Data System (ADS)

Sanhueza, J. P.; Rojas, D.; Prat, O.; García, J.; Meléndrez, M. F.; Suarez, S.

2018-07-01

A 12 pct Cr martensitic/ferritic steel was designed and produced to study Laves and Z-phase as precipitation hardening particles under creep conditions (650 °C). According to thermodynamic calculations, W and Cu additions were selected to ensure the precipitation of Laves after tempering. It is known that Z-phase formation does not follow the classical nucleation theory. Indeed, MX particles are transformed into Z-phase by Cr diffusion from the matrix to the precipitate. Therefore, to promote fast Z-phase formation, Ta, Co, and N additions were used to produce Ta-MX, which will be transformed into Z-phase. The main result achieved was the precipitation of Laves after tempering, with a particle size of 196 nm. As regards to Z-phase, the transformation of Ta-MX into Z-phase after tempering was confirmed by the formation of hybrid nanoparticles of 30 nm. Although W and Ta have a low diffusion in the martensitic/ferritic matrix, characterization of the precipitates after isothermal aging revealed that Laves and Z-phase have fast growth kinetics, reaching 400 and 143 nm, respectively, at 8760 hours. Consequently, creep test at 650 °C showed premature failures after few thousand hours. Therefore, it is expected that future research in the field of martensitic/ferritic steels will focus on the growth and coarsening behavior of Laves and Z-phase.

UV-visible spectroscopy of macrocyclic alkyl, nitrosyl and halide complexes of cobalt and rhodium. Experiment and calculation.

PubMed

Hull, Emily A; West, Aaron C; Pestovsky, Oleg; Kristian, Kathleen E; Ellern, Arkady; Dunne, James F; Carraher, Jack M; Bakac, Andreja; Windus, Theresa L

2015-02-28

Transition metal complexes (NH3)5CoX(2+) (X = CH3, Cl) and L(H2O)MX(2+), where M = Rh or Co, X = CH3, NO, or Cl, and L is a macrocyclic N4 ligand are examined by both experiment and computation to better understand their electronic spectra and associated photochemistry. Specifically, irradiation into weak visible bands of nitrosyl and alkyl complexes (NH3)5CoCH3(2+) and L(H2O)M(III)X(2+) (X = CH3 or NO) leads to photohomolysis that generates the divalent metal complex and ˙CH3 or ˙NO, respectively. On the other hand, when X = halide or NO2, visible light photolysis leads to dissociation of X(-) and/or cis/trans isomerization. Computations show that visible bands for alkyl and nitrosyl complexes involve transitions from M-X bonding orbitals and/or metal d orbitals to M-X antibonding orbitals. In contrast, complexes with X = Cl or NO2 exhibit only d-d bands in the visible, so that homolytic cleavage of the M-X bond requires UV photolysis. UV-Vis spectra are not significantly dependent on the structure of the equatorial ligands, as shown by similar spectral features for (NH3)5CoCH3(2+) and L(1)(H2O)CoCH3(2+).

Sensitivity Enhancement of Transition Metal Dichalcogenides/Silicon Nanostructure-based Surface Plasmon Resonance Biosensor

PubMed Central

Ouyang, Qingling; Zeng, Shuwen; Jiang, Li; Hong, Liying; Xu, Gaixia; Dinh, Xuan-Quyen; Qian, Jun; He, Sailing; Qu, Junle; Coquet, Philippe; Yong, Ken-Tye

2016-01-01

In this work, we designed a sensitivity-enhanced surface plasmon resonance biosensor structure based on silicon nanosheet and two-dimensional transition metal dichalcogenides. This configuration contains six components: SF10 triangular prism, gold thin film, silicon nanosheet, two-dimensional MoS2/MoSe2/WS2/WSe2 (defined as MX2) layers, biomolecular analyte layer and sensing medium. The minimum reflectivity, sensitivity as well as the Full Width at Half Maximum of SPR curve are systematically examined by using Fresnel equations and the transfer matrix method in the visible and near infrared wavelength range (600 nm to 1024 nm). The variation of the minimum reflectivity and the change in resonance angle as the function of the number of MX2 layers are presented respectively. The results show that silicon nanosheet and MX2 layers can be served as effective light absorption medium. Under resonance conditions, the electrons in these additional dielectric layers can be transferred to the surface of gold thin film. All silicon-MX2 enhanced sensing models show much better performance than that of the conventional sensing scheme where pure Au thin film is used, the highest sensitivity can be achieved by employing 600 nm excitation light wavelength with 35 nm gold thin film and 7 nm thickness silicon nanosheet coated with monolayer WS2. PMID:27305974

Investigation of Ta-MX/Z-Phase and Laves Phase as Precipitation Hardening Particles in a 12 Pct Cr Heat-Resistant Steel

NASA Astrophysics Data System (ADS)

Sanhueza, J. P.; Rojas, D.; Prat, O.; García, J.; Meléndrez, M. F.; Suarez, S.

2018-05-01

A 12 pct Cr martensitic/ferritic steel was designed and produced to study Laves and Z-phase as precipitation hardening particles under creep conditions (650 °C). According to thermodynamic calculations, W and Cu additions were selected to ensure the precipitation of Laves after tempering. It is known that Z-phase formation does not follow the classical nucleation theory. Indeed, MX particles are transformed into Z-phase by Cr diffusion from the matrix to the precipitate. Therefore, to promote fast Z-phase formation, Ta, Co, and N additions were used to produce Ta-MX, which will be transformed into Z-phase. The main result achieved was the precipitation of Laves after tempering, with a particle size of 196 nm. As regards to Z-phase, the transformation of Ta-MX into Z-phase after tempering was confirmed by the formation of hybrid nanoparticles of 30 nm. Although W and Ta have a low diffusion in the martensitic/ferritic matrix, characterization of the precipitates after isothermal aging revealed that Laves and Z-phase have fast growth kinetics, reaching 400 and 143 nm, respectively, at 8760 hours. Consequently, creep test at 650 °C showed premature failures after few thousand hours. Therefore, it is expected that future research in the field of martensitic/ferritic steels will focus on the growth and coarsening behavior of Laves and Z-phase.

Formation of nitro musk adducts of rainbow trout hemoglobin for potential use as biomarkers of exposure.

PubMed

Mottaleb, M A; Zhao, X; Curtis, L R; Sovocool, G W

2004-05-12

The high use of nitro musk xylene (MX) and musk ketone (MK) as fragrances, and their persistence and bioaccumulation potential make them ubiquitous environmental contaminants. The 4-amino-MX (AMX) and 2-amino-MK (AMK) metabolites have been detected in trout fish hemoglobin (Hb) samples by gas chromatography-ion trap-mass spectrometry (GC-MS). Twelve Hb samples prepared from rainbow trout that were exposed to MX and MK, over a period of 24 and 72 h, were analyzed. Amino metabolites were liberated by basic hydrolysis and extracted from the fish Hb into n-hexane. The extract was concentrated, analyzed, and spiked with a standard solution (80 pg/microl) of AMX or AMK and reanalyzed. Concentrations of AMX from 10 to 25 ng/g were detected in Hb from fish taken 24 and 72 h after MX exposure. At 24 and 72 h after MK exposure, the concentration of AMK was found to be 25-51 ng/g and 9.5-25 ng/g, respectively. Concentrations of AMK in Hb from two of the three trout were substantially lower after 72 h compared with 24 h exposure. The AMX and AMK metabolites were not detected in four control samples. Average recoveries exceeding 89 and 86% could be achieved for AMX and AMK, respectively, with a coefficient of variation (CV) around 5%.

Nutritional and metabolic responses in common dentex (Dentex dentex) fed on different types and levels of carbohydrates.

PubMed

Pérez-Jiménez, Amalia; Abellán, Emilia; Arizcun, Marta; Cardenete, Gabriel; Morales, Amalia E; Hidalgo, M Carmen

2015-06-01

The present study was aimed to evaluate the capacity of common dentex (Dentex dentex) to efficiently use dietary carbohydrates. So, the effects of different type and levels of carbohydrates on growth performance, feed utilization, fish composition, plasma metabolites and key metabolic pathways in liver and white muscle of common dentex are presented. Nine isonitrogenous (43%) and isoenergetic (22 MJ kg(-1)) diets were formulated combining three types, pregelatinized starch (PS), dextrin (Dx) and maltodextrin (Mx), and three levels (12, 18 and 24%) of carbohydrates. Growth performance was not significantly influenced by treatments. The best feed utilization was observed in 18% Mx group. Higher hepatic lipid content was found in fish fed lower dietary carbohydrate levels. PS induced higher liver and white muscle hexokinase and pyruvate kinase activities compared to the lower values observed for Mx. Malic enzyme and glucose 6-phosphate dehydrogenase in liver and white muscle were lower in Mx group. The influence of dietary carbohydrates source was more noticeable than those induced by the carbohydrate level, when glycolysis and lipogenesis pathways were considered. Common dentex is able to use properly dietary carbohydrates, although optimal dietary inclusion levels are below 24%. The greater protein-sparing effect was promoted by the less complex carbohydrate (maltodextrin) and the best feed utilization indices were obtained at intermediate levels of inclusion (18%). Copyright © 2015 Elsevier Inc. All rights reserved.

Differential virulence mechanisms of infectious hematopoietic necrosis virus in rainbow trout (Oncorhynchus mykiss) include host entry and virus replication kinetics

USGS Publications Warehouse

Penaranda, M.M.D.; Purcell, M.K.; Kurath, G.

2009-01-01

Host specificity is a phenomenon exhibited by all viruses. For the fish rhabdovirus infectious hematopoietic necrosis virus (IHNV), differential specificity of virus strains from the U and M genogroups has been established both in the field and in experimental challenges. In rainbow trout (Oncorhynchus mykiss), M IHNV strains are consistently more prevalent and more virulent than U IHNV. The basis of the differential ability of these two IHNV genogroups to cause disease in rainbow trout was investigated in live infection challenges with representative U and M IHNV strains. When IHNV was delivered by intraperitoneal injection, the mortality caused by U IHNV increased, indicating that the low virulence of U IHNV is partly due to inefficiency in entering the trout host. Analyses of in vivo replication showed that U IHNV consistently had lower prevalence and lower viral load than M IHNV during the course of infection. In analyses of the host immune response, M IHNV-infected fish consistently had higher and longer expression of innate immune-related genes such as Mx-1. This suggests that the higher virulence of M IHNV is not due to suppression of the immune response in rainbow trout. Taken together, the results support a kinetics hypothesis wherein faster replication enables M IHNV to rapidly achieve a threshold level of virus necessary to override the strong host innate immune response. ?? 2009 SGM.

Metabolic Mechanism for l-Leucine-Induced Metabolome To Eliminate Streptococcus iniae.

PubMed

Du, Chao-Chao; Yang, Man-Jun; Li, Min-Yi; Yang, Jun; Peng, Bo; Li, Hui; Peng, Xuan-Xian

2017-05-05

Crucial metabolites that modulate hosts' metabolome to eliminate bacterial pathogens have been documented, but the metabolic mechanisms are largely unknown. The present study explores the metabolic mechanism for l-leucine-induced metabolome to eliminate Streptococcus iniae in tilapia. GC-MS-based metabolomics was used to investigate the tilapia liver metabolic profile in the presence of exogenous l-leucine. Thirty-seven metabolites of differential abundance were determined, and 11 metabolic pathways were enriched. Pattern recognition analysis identified serine and proline as crucial metabolites, which are the two metabolites identified in survived tilapias during S. iniae infection, suggesting that the two metabolites play crucial roles in l-leucine-induced elimination of the pathogen by the host. Exogenous l-serine reduces the mortality of tilapias infected by S. iniae, providing a robust proof supporting the conclusion. Furthermore, exogenous l-serine elevates expression of genes IL-1β and IL-8 in tilapia spleen, but not TNFα, CXCR4 and Mx, suggesting that the metabolite promotes a phagocytosis role of macrophages, which is consistent with the finding that l-leucine promotes macrophages to kill both Gram-positive and Gram-negative bacterial pathogens. Therefore, the ability of phagocytosis enhanced by exogenous l-leucine is partly attributed to elevation of l-serine. These results demonstrate a metabolic mechanism by which exogenous l-leucine modulates tilapias' metabolome to enhance innate immunity and eliminate pathogens.

The interferon response circuit in antiviral host defense.

PubMed

Haller, O; Weber, F

2009-01-01

Viruses have learned to multiply in the face of a powerful innate and adaptive immune response of the host. They have evolved multiple strategies to evade the interferon (IFN) system which would otherwise limit virus growth at an early stage of infection. IFNs induce the synthesis of a range of antiviral proteins which serve as cell-autonomous intrinsic restriction factors. For example, the dynamin-like MxA GTPase inhibits the multiplication of influenza and bunyaviruses (such as La Crosse virus, Hantaan virus, Rift Valley Fever virus, and Crimean-Congo hemorrhagic fever virus) by binding and sequestering the nucleocapsid protein into large perinuclear complexes. To overcome such intracellular restrictions, virulent viruses either inhibit IFN synthesis, bind and inactivate secreted IFN molecules, block IFN-activated signaling, or disturb the action of IFN-induced antiviral proteins. Many viruses produce specialized proteins to disarm the danger signal or express virulence genes that target members of the IFN regulatory factor family (IRFs) or components of the JAK-STAT signaling pathway. An alternative evasion strategy is based on extreme viral replication speed which out-competes the IFN response. The identification of viral proteins with IFN antagonistic functions has great implications for disease prevention and therapy. Virus mutants lacking IFN antagonistic properties represent safe yet highly immunogenic candidate vaccines. Furthermore, novel drugs intercepting viral IFN-antagonists could be used to disarm the viral intruders.

Comparative cytotoxic and genotoxic potential of 13 drinking water disinfection by-products using a microplate-based cytotoxicity assay and a developed SOS/umu assay.

PubMed

Zhang, Shao-Hui; Miao, Dong-Yue; Tan, Li; Liu, Ai-Lin; Lu, Wen-Qing

2016-01-01

The implications of disinfection by-products (DBPs) present in drinking water are of public health concern because of their potential mutagenic, carcinogenic and other toxic effects on humans. In this study, we selected 13 main DBPs found in drinking water to quantitatively analyse their cytotoxicity and genotoxicity using a microplate-based cytotoxicity assay and a developed SOS/umu assay in Salmonella typhimurium TA1535/pSK1002. With the developed SOS/umu test, eight DBPs: 3-chloro-4-(dichloromethyl)-5-hydroxy-2[5H]-fura3-chloro-4-(dichloromethyl)-5-hydroxy-2-[5H]-furanone (MX), dibromoacetonitrile (DBN), iodoacetic acid (IA), bromochloroacetonitrile (BCN), bromoacetic acid (BA), trichloroacetonitrile (TCN), dibromoacetic acid (DBA) and dichloroacetic acid (DCA) were significantly genotoxic to S. typhimurium. Three DBPs: chloroacetic acid (CA), trichloroacetic acid (TCA) and dichloroacetonitrile (DCN) were weakly genotoxic, whereas the remaining DBPs: chloroacetonitrile (CN) and chloral hydrate (CH) were negative. The rank order in decreasing genotoxicity was as follows: MX > DBN > IA > BCN > BA > TCN > DBA > DCA > CA, TCA, DCN > CN, CH. MX was approximately 370 000 times more genotoxic than DCA. In the microplate-based cytotoxicity assay, cytotoxic potencies of the 13 DBPs were compared and ranked in decreasing order as follows: MX > IA > DBN > BCN > BA > TCN > DCN > CA > DCA > DBA > CN > TCA > CH. MX was approximately 19 200 times more cytotoxic than CH. A statistically significant correlation was found between cytotoxicity and genotoxicity of the 13 DBPs in S. typhimurium. Results suggest that microplate-based cytotoxicity assay and the developed SOS/umu assay are feasible tools for analysing the cytotoxicity and genotoxicity of DBPs, particularly for comparing their toxic intensities quantitatively. © The Author 2015. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Comparison of gait and pathology outcomes of three meniscal procedures for induction of knee osteoarthritis in sheep.

PubMed

Cake, M A; Read, R A; Corfield, G; Daniel, A; Burkhardt, D; Smith, M M; Little, C B

2013-01-01

Meniscectomy (MX) of sheep induces a well-established animal model of human osteoarthritis (OA). This study compared the clinical (lameness) and pathological outcomes of unilateral, complete medial MX vs two less traumatic and more easily performed meniscal destabilisation procedures. Four-year old wethers (n = 6/group) underwent sham operation, cranial pole release (CPR), mid-body transection (MBT) or total MX of the medial meniscus. Joints were assessed for gross pathology (cartilage erosion and osteophytes), histomorphometry, two histopathology scoring methods (modified Mankin-type and Pritzker score), and immunohistology for ADAMTS- and MMP-cleaved neoepitopes, at 12 weeks post-op. Ground reaction forces (GRFs) were determined by force plate in a subset (n = 4/group) at baseline, 2.5, 8, and 12 weeks post-op. Gross pathology scores of operated groups differed significantly from sham animals (P < 0.05) but not from each other, though qualitative differences were noted: CPR sheep developed more cranial and focal lesions, while MBT and MX joints showed more widespread lesions and osteophyte formation. Similarly, histopathology scores were significantly elevated vs sham but did not differ between operated groups at P < 0.05, except for a trend for lower tibial cartilage histopathology in MBT consistent with the immunohistologic pattern of reduced aggrecanase-cleavage neoepitope in that model. CPR sheep developed less femoral subchondral sclerosis, suggesting some residual biomechanical effect from the destabilised but intact meniscus. Few significant differences were noted between operated groups in force plate analyses, though gait abnormalities appeared to be least in CPR sheep, and most persistent (>12 weeks) in MBT animals. The well-validated ovine MX model and the simpler meniscal destabilisation procedures resulted in broadly similar joint pathology and lameness. Meniscal CPR or MBT, as easier and more clinically relevant procedures, may represent preferred models for the induction of OA and evaluation of potential disease-modifying therapies. Copyright © 2012 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Tunable magneto-optical effects in hole-doped group-IIIA metal-monochalcogenide monolayers

NASA Astrophysics Data System (ADS)

Feng, Wanxiang; Guo, Guang-Yu; Yao, Yugui

2017-03-01

Because of unusual properties and fascinating prospects for next-generation device applications, two-dimensional (2D) materials have attracted enormous attention since graphene was discovered in 2004. Among the 2D materials beyond graphene, group-IIIA metal-monochalcogenide (MX) monolayers (MLs), are receiving increasing interests because their excellent applications on electronics and optoelectronics. Recently, ferromagnetism and half-metallicity have been predicted in hole-doped GaS and GaSe MLs, which promise exciting potentials for semiconductor spintronics. Detection and measurement of spontaneous magnetization in these 2D materials will be essential for their spintronic applications. The magneto-optical (MO) effects not only are a powerful probe of magnetism in 2D materials but also have valuable applications in high-density data-storage technology. Furthermore, anomalous Hall effect is not only an ideal transport probe of itinerant magnetism but also of considerable current interest because of its topological nature. Here we perform a systematic first-principles density functional study on the MO Kerr and Faraday effects as well as such important magnetic and transport properties as magneto-crystalline anisotropy energy (MAE) and anomalous Hall conductivity (AHC) of all hole-doped MX (M = Ga, In; X = S, Se, Te) MLs. In this paper, we report the following important findings: (a) gate-tunable MO effects in MX MLs in a broad range of hole concentration; (b) large Kerr and Faraday rotation angles with Kerr angles comparable to well-known MO 3d-transition-metal multilayers and Faraday angles being among the largest ones reported; (c) tunable MAE and large AHC, making MX MLs suitable for magnetic memory devices current-driven via spin-transfer torque and also promising materials for magnetic field nanosensors with high sensitivity. Superior MO characteristics, together with the other interesting properties, would make MX MLs an excellent family of 2D materials for semiconductor MO and spintronic nanodevices.

Essential roles of FoxM1 in Ras-induced liver cancer progression and in cancer cells with stem cell features.

PubMed

Kopanja, Dragana; Pandey, Akshay; Kiefer, Megan; Wang, Zebin; Chandan, Neha; Carr, Janai R; Franks, Roberta; Yu, Dae-Yeul; Guzman, Grace; Maker, Ajay; Raychaudhuri, Pradip

2015-08-01

Overexpression of FoxM1 correlates with poor prognosis in hepatocellular carcinoma (HCC). Moreover, the Ras-signaling pathway is found to be ubiquitously activated in HCC through epigenetic silencing of the Ras-regulators. We investigated the roles of FoxM1 in Ras-driven HCC, and on HCC cells with stem-like features. We employed a transgenic mouse model that expresses the oncogenic Ras in the liver. That strain was crossed with a strain that harbor floxed alleles of FoxM1 and the MxCre gene that allows conditional deletion of FoxM1. FoxM1 alleles were deleted after development of HCC, and the effects on the tumors were analyzed. Also, FoxM1 siRNA was used in human HCC cell lines to determine its role in the survival of the HCC cells with stem cell features. Ras-driven tumors overexpress FoxM1. Deletion of FoxM1 inhibits HCC progression. There was increased accumulation of reactive oxygen species (ROS) in the FoxM1 deleted HCC cells. Moreover, FoxM1 deletion caused a disproportionate loss of the CD44+ and EpCAM+ HCC cells in the tumors. We show that FoxM1 directly activates expression of CD44 in human HCC cells. Moreover, the human HCC cells with stem cell features are addicted to FoxM1 for ROS-regulation and survival. Our results provide genetic evidence for an essential role of FoxM1 in the progression of Ras-driven HCC. In addition, FoxM1 is required for the expression of CD44 in HCC cells. Moreover, FoxM1 plays a critical role in the survival of the HCC cells with stem cell features by regulating ROS. Published by Elsevier B.V.

MX Siting Investigation. Geotechnical Evaluation. Verification Study - Lake Valley, Nevada. Volume II. Geotechnical Data.

DTIC Science & Technology

1981-07-31

dolomite , chalk). J S3 Argillaceous Rocks - Composed of clay and silt-sized particles (e.g., siltstone, shale, claystone). S4 Evaporite Rocks...of preexisting rocks by heat and pressure (e.g., gneiss, schist, hornfels, metaquartzite). I I I J • I I I I I I II II 19 E-TR-27.LV-I S 1IL 0 ESCR I...Weathering 26. Structure Bedding Characteristics Bedding Attitude Fracture , Joint 27. Secondary Alteration/Mineralization S MX SITING

MX Siting Investigation. Geotechnical Evaluation. Aggregate Resources Study, Lake Valley, Nevada.

DTIC Science & Technology

1981-02-27

KILOMETERS Mx SITING INVESTIGATION IGURE IPARTMENT OF TNt Ag1 FORCE - GMO 2 -_ONiO NATIONAL INC. FlU It FN-TR-37-f 5 2. Aerial and ground reconnaissance...fine, or crushed rock) and potential construction use ( con - crete and/or road base). TOM. FN-TR -37-f 6 2.0 STUDY APPROACH 2.1 EXISTING DATA Collection...2 the southwestern part of Lake Valley. This formation also pro - vides Class I crushed rock aggregate material in the southern White Rock Mountains

MX Siting Investigation. Municipal Water-Supply and Waste-Water Treatment Facilities in Selected Nevada and Utah Communities.

DTIC Science & Technology

1980-06-20

located between the six cells of the lagoon system. Table 23 shows the characteristics of the system. I The detention lagoon was designed to...Wastewater Facilities for Selected Rural Nevada Communities B Municipal Water Resources Analysis for Area Potential- ly Impacted by MX Missile Complex in Utah...order teaet very large grocth up tntiel grond-cater rights In Stepee 0.4e/a , for average demand plus io a designated basin these quentiti Ruth- c~ill

Draft Environmental Impact Statement. MX Deployment Area Selection and Land Withdrawal/Acquisition DEIS. Volume IV. Part I. Environmental Consequences to the Study Regions and Operating Base Vicinities.

DTIC Science & Technology

1980-12-01

consequences such that the ecosystem will not recover at all, (7) are the consequences such that the impact may be large but the recovery process...Bswe $Vicinitoe MLWI Impact Analysis Process DEPLOYMENT AREA SELECTION AND LAND WITHDRAWAL/ ACQUISITION DISI, DEPARTMENT OF THE AmR F1ORC ’oritinax...Subtitle) S. TYPE OF REPORT & PERIOD COVEREDDraft Environmental Impact Statement-MX Deployment Area Selection-Environmental Draft-December 80 Consequences

MX Siting Investigation. MX System Siting Summary Report. Land Acquisition Application Package Map Sheets. Volume III.

DTIC Science & Technology

1982-01-18

O006 UNCLASSIFIED E-TR-58-VOL-3 NL3I~hEhE EhHEEE00000000E law 4r: 32 1 8 41 PHOTOGRAPH THIS SHEET //* LEVEL INVENTORY z ~ DOCUMENT IDENTIFICATION I I...kNPOTTN 44. 4 4F OPERATIO "MAL BASE TE48T SIT *.DeISlrNATED’%RAINING AREA I I IT R8W 0000 1 , Iv t DR V’ NG f4 12 󈧱 00 W - • , .: . .i .. . i

MX Siting Investigation. Mineral Resources Survey, Seven Additional Valleys, Nevada/Utah Siting Area. Volume I.

DTIC Science & Technology

1981-06-23

Some negative impacts of MX deployment on mining in the study area are unavoidable, but careful planning in water use and actual shelter site...depend upon the extent of deployment and location of shelter sites. A major impact on the mining industry will result if draw-down of the water table...use and acquire the necessary land rights or whether the affected shelter (s) should be abandoned or replaced elsewhere in the deployment area. Egec E-TR

Enhanced Night Vision Via a Combination of Poisson Interpolation and Machine Learning

DTIC Science & Technology

2006-02-01

of 0-255, they are mostly similar. The right plot shows a family of m(x, ψ) curves of ψ=2 (the most linear) through ψ=1024 (the most curved ...complicating low-light imaging. Nayar and Branzoi [04] later suggested a second variant using a DLP micromirror array to modulate the exposure, via time...255, they are mostly similar. The right plot shows a family of m(x, ψ) curves of ψ=2 (the most linear) through ψ=1024 (the most curved

Health Care in Mexico: Is U.S. Partnership/Intervention an Advisable Course of Action?

DTIC Science & Technology

2011-10-26

July 15, 2011, http:// www.imss.gob.mx/ en /institute. html (accessed 4 September 2011). 4 Instituto de Seguridad y Servicios Sociales de los...www.usatoday.com/news/world/2009-08-31- mexico -health-care_N.htm (accessed 4 September 2011). Instituto de Seguridad y Servicios Sociales de los Trabajadores...Seguro Social , Last modified on July 15, 2011, http://www.imss.gob.mx/ en /institute. html (accessed 4 September 2011). 3 access.2 The IMSS, by its

Transceiver Multiplexers TD-1288( )/GRC and TD-1289( )(V)/GRC.

DTIC Science & Technology

1982-02-01

TRASITCAS TD-1289( )iV)1/GRC C.76 IR BANPAS FLER TERMINATION UNIT CU26()/GRC] G -42 RC MX-10080t )/GRC F’igure l-l. X1liF’ MultipleXer amily Tree. F1- CU-2266...the equations become: Y G o t Q 1Q+/Qu C o s 0 = j2 + Q QU L° l~ Qu I+j L=010 log 4 + j 2 Qt The passband loss expression may be simplified to read: 4...a character istic impedance of 50 oims. The linle len,_tli was 16i.5 inches and was tet oiinated inl a -ohio If load. The tap pointt was nojusted to g

Measurement of M2-Curve for Asymmetric Beams by Self-Referencing Interferometer Wavefront Sensor

PubMed Central

Du, Yongzhao

2016-01-01

For asymmetric laser beams, the values of beam quality factor Mx2 and My2 are inconsistent if one selects a different coordinate system or measures beam quality with different experimental conditionals, even when analyzing the same beam. To overcome this non-uniqueness, a new beam quality characterization method named as M2-curve is developed. The M2-curve not only contains the beam quality factor Mx2 and My2 in the x-direction and y-direction, respectively; but also introduces a curve of Mxα2 versus rotation angle α of coordinate axis. Moreover, we also present a real-time measurement method to demonstrate beam propagation factor M2-curve with a modified self-referencing Mach-Zehnder interferometer based-wavefront sensor (henceforth SRI-WFS). The feasibility of the proposed method is demonstrated with the theoretical analysis and experiment in multimode beams. The experimental results showed that the proposed measurement method is simple, fast, and a single-shot measurement procedure without movable parts. PMID:27916845

Quantum algorithm for linear systems of equations.

PubMed

Harrow, Aram W; Hassidim, Avinatan; Lloyd, Seth

2009-10-09

Solving linear systems of equations is a common problem that arises both on its own and as a subroutine in more complex problems: given a matrix A and a vector b(-->), find a vector x(-->) such that Ax(-->) = b(-->). We consider the case where one does not need to know the solution x(-->) itself, but rather an approximation of the expectation value of some operator associated with x(-->), e.g., x(-->)(dagger) Mx(-->) for some matrix M. In this case, when A is sparse, N x N and has condition number kappa, the fastest known classical algorithms can find x(-->) and estimate x(-->)(dagger) Mx(-->) in time scaling roughly as N square root(kappa). Here, we exhibit a quantum algorithm for estimating x(-->)(dagger) Mx(-->) whose runtime is a polynomial of log(N) and kappa. Indeed, for small values of kappa [i.e., poly log(N)], we prove (using some common complexity-theoretic assumptions) that any classical algorithm for this problem generically requires exponentially more time than our quantum algorithm.

Unified Description of the Optical Phonon Modes in N-Layer MoTe2

NASA Astrophysics Data System (ADS)

Froehlicher, Guillaume; Lorchat, Etienne; Fernique, François; Joshi, Chaitanya; Molina-Sánchez, Alejandro; Wirtz, Ludger; Berciaud, Stéphane

N -layer transition metal dichalcogenides (denoted MX2) provide a unique platform to investigate the evolution of the physical properties between the bulk (3D) and monolayer (quasi-2D) limits. Here, we present a unified analysis of the optical phonon modes in N-layer 2 H -MX2. The 2 H -phase (or hexagonal phase) is the most common polytype for semiconducting MX2 (such as MoS2). Using Raman spectroscopy, we have measured the manifold of low-frequency (rigid layer), mid-frequency (involving intralayer displacement of the chalcogen atoms only), and high-frequency (involving intralayer displacements of all atoms) Raman-active modes in N = 1 to 12 layer 2 H -molybdenenum ditelluride (MoTe2). For each monolayer mode, the N-dependent phonon frequencies give rise to fan diagrams that are quantitatively fit to a force constant model. This analysis allows us to deduce the frequencies of all the bulk (including silent) optical phonon modes.

Rashba effect and enriched spin-valley coupling in Ga X /M X2 (M = Mo, W; X = S, Se, Te) heterostructures

NASA Astrophysics Data System (ADS)

Zhang, Qingyun; Schwingenschlögl, Udo

2018-04-01

Using first-principles calculations, we investigate the electronic properties of the two-dimensional Ga X /MX 2 (M = Mo, W; X = S, Se, Te) heterostructures. Orbital hybridization between Ga X and MX 2 is found to result in Rashba splitting at the valence-band edge around the Γ point, which grows for increasing strength of the spin-orbit coupling in the p orbitals of the chalcogenide atoms. The location of the valence-band maximum in the Brillouin zone can be tuned by strain and application of an out-of-plane electric field. The coexistence of Rashba splitting (in-plane spin direction) and band splitting at the K and K' valleys (out-of-plane spin direction) makes Ga X /MX 2 heterostructures interesting for spintronics and valleytronics. They are promising candidates for two-dimensional spin-field-effect transistors and spin-valley Hall effect devices. Our findings shed light on the spin-valley coupling in van der Waals heterostructures.

Magneto-reactance based detection of MnO nanoparticle-embedded Lewis lung carcinoma cells

NASA Astrophysics Data System (ADS)

Devkota, J.; Howell, M.; Mukherjee, P.; Srikanth, H.; Mohapatra, S.; Phan, M. H.

2015-05-01

We demonstrate the capacity of detecting magnetically weak manganese oxide (MnO) nanoparticles and the Lewis lung carcinoma (LLC) cancer cells that have taken up these nanoparticles using a novel biosensor based on the magneto-reactance (MX) effect of a soft ferromagnetic amorphous ribbon with a microhole-patterned surface. While the magnetic moment of the MnO nanoparticles is relatively small, and a magneto-impedance based sensor fails to detect them in solution (0.05 mg/ml manganese oxide lipid micellar nanoparticles) and inside cells at low concentrations (8.25 × 104 cells/ml), the detection of these nanoparticles and the LLC cells containing them is achieved with the MX-based sensor, which, respectively, reaches the detection sensitivity of ˜3.6% and 2.8% as compared to the blank cells. Since the MnO nanoparticles are a promising contrast agent for magnetic resonance imaging (MRI) of lung cells, the MX-based biosensing technique can be developed as a pre-detection method for MRI of lung cancer cells.

Development of new generation reduced activation ferritic-martenstic steels for advanced fusion reactors

DOE PAGES

Tan, Lizhen; Snead, Lance Lewis; Katoh, Yutai

2016-05-26

International development of reduced activation ferritic-martensitic (RAFM) steels has focused on 9 wt percentage Cr, which primarily contain M 23C 6 (M = Cr-rich) and small amounts of MX (M = Ta/V, X = C/N) precipitates, not adequate to maintain strength and creep resistance above ~500 °C. To enable applications at higher temperatures for better thermal efficiency of fusion reactors, computational alloy thermodynamics coupled with strength modeling have been employed to explore a new generation RAFM steels. The new alloys are designed to significantly increase the amount of MX nanoprecipitates, which are manufacturable through standard and scalable industrial steelmaking methods.more » Preliminary experimental results of the developed new alloys demonstrated noticeably increased amount of MX, favoring significantly improved strength, creep resistance, and Charpy impact toughness as compared to current RAFM steels. Furthermore, the strength and creep resistance were comparable or approaching to the lower bound of, but impact toughness was noticeably superior to 9–20Cr oxide dispersion-strengthened ferritic alloys.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tan, Lizhen; Snead, Lance Lewis; Katoh, Yutai

International development of reduced activation ferritic-martensitic (RAFM) steels has focused on 9 wt percentage Cr, which primarily contain M 23C 6 (M = Cr-rich) and small amounts of MX (M = Ta/V, X = C/N) precipitates, not adequate to maintain strength and creep resistance above ~500 °C. To enable applications at higher temperatures for better thermal efficiency of fusion reactors, computational alloy thermodynamics coupled with strength modeling have been employed to explore a new generation RAFM steels. The new alloys are designed to significantly increase the amount of MX nanoprecipitates, which are manufacturable through standard and scalable industrial steelmaking methods.more » Preliminary experimental results of the developed new alloys demonstrated noticeably increased amount of MX, favoring significantly improved strength, creep resistance, and Charpy impact toughness as compared to current RAFM steels. Furthermore, the strength and creep resistance were comparable or approaching to the lower bound of, but impact toughness was noticeably superior to 9–20Cr oxide dispersion-strengthened ferritic alloys.« less

RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond

PubMed Central

Gama-Castro, Socorro; Salgado, Heladia; Santos-Zavaleta, Alberto; Ledezma-Tejeida, Daniela; Muñiz-Rascado, Luis; García-Sotelo, Jair Santiago; Alquicira-Hernández, Kevin; Martínez-Flores, Irma; Pannier, Lucia; Castro-Mondragón, Jaime Abraham; Medina-Rivera, Alejandra; Solano-Lira, Hilda; Bonavides-Martínez, César; Pérez-Rueda, Ernesto; Alquicira-Hernández, Shirley; Porrón-Sotelo, Liliana; López-Fuentes, Alejandra; Hernández-Koutoucheva, Anastasia; Moral-Chávez, Víctor Del; Rinaldi, Fabio; Collado-Vides, Julio

2016-01-01

RegulonDB (http://regulondb.ccg.unam.mx) is one of the most useful and important resources on bacterial gene regulation,as it integrates the scattered scientific knowledge of the best-characterized organism, Escherichia coli K-12, in a database that organizes large amounts of data. Its electronic format enables researchers to compare their results with the legacy of previous knowledge and supports bioinformatics tools and model building. Here, we summarize our progress with RegulonDB since our last Nucleic Acids Research publication describing RegulonDB, in 2013. In addition to maintaining curation up-to-date, we report a collection of 232 interactions with small RNAs affecting 192 genes, and the complete repertoire of 189 Elementary Genetic Sensory-Response units (GENSOR units), integrating the signal, regulatory interactions, and metabolic pathways they govern. These additions represent major progress to a higher level of understanding of regulated processes. We have updated the computationally predicted transcription factors, which total 304 (184 with experimental evidence and 120 from computational predictions); we updated our position-weight matrices and have included tools for clustering them in evolutionary families. We describe our semiautomatic strategy to accelerate curation, including datasets from high-throughput experiments, a novel coexpression distance to search for ‘neighborhood’ genes to known operons and regulons, and computational developments. PMID:26527724

Search for Higgs boson pair production in the b b τ τ final state in proton-proton collisions at √{(}s )=8 TeV

NASA Astrophysics Data System (ADS)

Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; König, A.; Krätschmer, I.; Liko, D.; Matsushita, T.; Mikulec, I.; Rabady, D.; Rad, N.; Rahbaran, B.; Rohringer, H.; Schieck, J.; Strauss, J.; Waltenberger, W.; Wulz, C.-E.; Chekhovsky, V.; Dvornikov, O.; Dydyshka, Y.; Emeliantchik, I.; Litomin, A.; Makarenko, V.; Mossolov, V.; Stefanovitch, R.; Suarez Gonzalez, J.; Zykunov, V.; Shumeiko, N.; Alderweireldt, S.; De Wolf, E. A.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; Daci, N.; De Bruyn, I.; Deroover, K.; Lowette, S.; Moortgat, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Léonard, A.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Garcia, G.; Gul, M.; Khvastunov, I.; Poyraz, D.; Salva, S.; Schöfbeck, R.; Tytgat, M.; Van Driessche, W.; Yazgan, E.; Zaganidis, N.; Bakhshiansohi, H.; Beluffi, C.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Jez, P.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Nuttens, C.; Piotrzkowski, K.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Matos Figueiredo, D.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Moon, C. S.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Cheng, T.; Jiang, C. H.; Leggat, D.; Liu, Z.; Romeo, F.; Ruan, M.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Zhang, H.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Micanovic, S.; Sudic, L.; Susa, T.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Tsiakkouri, D.; Finger, M.; Finger, M.; Carrera Jarrin, E.; Assran, Y.; Elkafrawy, T.; Mahrous, A.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Zghiche, A.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Chapon, E.; Charlot, C.; Davignon, O.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Miné, P.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sirois, Y.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Le Bihan, A.-C.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Carrillo Montoya, C. A.; Chierici, R.; Contardo, D.; Courbon, B.; Depasse, P.; El Mamouni, H.; Fan, J.; Fay, J.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sabes, D.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Albert, A.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Cherepanov, V.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bin Anuar, A. A.; Borras, K.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Dolinska, G.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Karacheban, O.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Roland, B.; Sahin, M. Ö.; Saxena, P.; Schoerner-Sadenius, T.; Seitz, C.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wissing, C.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hoffmann, M.; Junkes, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Lapsien, T.; Lenz, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Poehlsen, J.; Sander, C.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Baus, C.; Berger, J.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Fink, S.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Goldenzweig, P.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Katkov, I.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Röcker, S.; Roscher, F.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Tziaferi, E.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Loukas, N.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Filipovic, N.; Bencze, G.; Hajdu, C.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Bahinipati, S.; Choudhury, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Bhawandeep, U.; Chawla, R.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Mittal, M.; Singh, J. B.; Walia, G.; Kumar, Ashok; Bhardwaj, A.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Malhotra, S.; Naimuddin, M.; Nishu, N.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhattacharya, R.; Bhattacharya, S.; Chatterjee, K.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Kole, G.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Parida, B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhowmik, S.; Dewanjee, R. K.; Ganguly, S.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Fahim, A.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Sguazzoni, G.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Lo Vetere, M.; Monge, M. R.; Robutti, E.; Tosi, S.; Brianza, L.; Brivio, F.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; De Nardo, G.; Di Guida, S.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes De Oliveira, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Dosselli, U.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Pazzini, J.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Torassa, E.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Mantovani, G.; Menichelli, M.; Saha, A.; Santocchia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fedi, G.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Del Re, D.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Finco, L.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, S.; Lee, S. W.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Brochero Cifuentes, J. A.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, B.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Lee, H.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Goh, J.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Komaragiri, J. R.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Magaña Villalba, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Carpinteyro, S.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khan, W. A.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Calpas, B.; Di Francesco, A.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Rodrigues Antunes, J.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Vischia, P.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Savina, M.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Chtchipounov, L.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Murzin, V.; Oreshkin, V.; Sulimov, V.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Bylinkin, A.; Chadeeva, M.; Danilov, M.; Rusinov, V.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Gribushin, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Navarro De Martino, E.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Suárez Andrés, I.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Castiñeiras De Saa, J. R.; Curras, E.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Bachtis, M.; Baillon, P.; Ball, A. H.; Barney, D.; Bloch, P.; Bocci, A.; Bonato, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Di Marco, E.; Dobson, M.; Dorney, B.; du Pree, T.; Duggan, D.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fartoukh, S.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Girone, M.; Glege, F.; Gulhan, D.; Gundacker, S.; Guthoff, M.; Hammer, J.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Kousouris, K.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Morovic, S.; Mulders, M.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Sauvan, J. B.; Schäfer, C.; Schwick, C.; Seidel, M.; Sharma, A.; Silva, P.; Sphicas, P.; Steggemann, J.; Stoye, M.; Takahashi, Y.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Veres, G. I.; Verweij, M.; Wardle, N.; Wöhri, H. K.; Zagozdzinska, A.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Bachmair, F.; Bäni, L.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Lecomte, P.; Lustermann, W.; Mangano, B.; Marionneau, M.; Martinez Ruiz del Arbol, P.; Masciovecchio, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Rossini, M.; Schönenberger, M.; Starodumov, A.; Tavolaro, V. R.; Theofilatos, K.; Wallny, R.; Aarrestad, T. K.; Amsler, C.; Caminada, L.; Canelli, M. F.; De Cosa, A.; Galloni, C.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Yang, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Konyushikhin, M.; Kuo, C. M.; Lin, W.; Lu, Y. J.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chang, Y. H.; Chang, Y. W.; Chao, Y.; Chen, K. F.; Chen, P. H.; Dietz, C.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Miñano Moya, M.; Paganis, E.; Psallidas, A.; Tsai, J. f.; Tzeng, Y. M.; Asavapibhop, B.; Singh, G.; Srimanobhas, N.; Suwonjandee, N.; Adiguzel, A.; Bakirci, M. N.; Cerci, S.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Dumanoglu, I.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Kayis Topaksu, A.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Tali, B.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Bilmis, S.; Isildak, B.; Karapinar, G.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Yetkin, E. A.; Yetkin, T.; Cakir, A.; Cankocak, K.; Sen, S.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Bundock, A.; Burton, D.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Dunne, P.; Elwood, A.; Futyan, D.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Nash, J.; Nikitenko, A.; Pela, J.; Penning, B.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Seez, C.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Leslie, D.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Jesus, O.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Piperov, S.; Sagir, S.; Spencer, E.; Syarif, R.; Breedon, R.; Breto, G.; Burns, D.; Calderon De La Barca Sanchez, M.; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Smith, J.; Squires, M.; Stolp, D.; Tripathi, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Saltzberg, D.; Schnaible, C.; Takasugi, E.; Valuev, V.; Weber, M.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Si, W.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Holzner, A.; Klein, D.; Krutelyov, V.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Welke, C.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Bunn, J.; Duarte, J.; Lawhorn, J. M.; Mott, A.; Newman, H. B.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Nicolas Kaufman, G.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Winn, D.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Cremonesi, M.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hare, D.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Wu, Y.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Das, S.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Low, J. F.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Shchutska, L.; Sperka, D.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Bein, S.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Prosper, H.; Santra, A.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Jung, K.; Sandoval Gonzalez, I. D.; Varelas, N.; Wang, H.; Wu, Z.; Zakaria, M.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Anderson, I.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Martin, C.; Osherson, M.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; Xin, Y.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Bruner, C.; Castle, J.; Forthomme, L.; Kenny, R. P.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Sanders, S.; Stringer, R.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Gomez, J. A.; Hadley, N. J.; Jabeen, S.; Kellogg, R. G.; Kolberg, T.; Kunkle, J.; Lu, Y.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Apyan, A.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Bierwagen, K.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Di Matteo, L.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Krajczar, K.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Varma, M.; Velicanu, D.; Veverka, J.; Wang, J.; Wang, T. W.; Wyslouch, B.; Yang, M.; Zhukova, V.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Finkel, A.; Gude, A.; Hansen, P.; Kalafut, S.; Kao, S. C.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bartek, R.; Bloom, K.; Claes, D. R.; Dominguez, A.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Malta Rodrigues, A.; Meier, F.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Kaisen, J.; Kharchilava, A.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wang, R.-J.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Kubik, A.; Kumar, A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Hughes, R.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Lange, D.; Luo, J.; Marlow, D.; Medvedeva, T.; Mei, K.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Svyatkovskiy, A.; Tully, C.; Malik, S.; Barker, A.; Barnes, V. E.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Schulte, J. F.; Shi, X.; Sun, J.; Wang, F.; Xie, W.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Betchart, B.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Agapitos, A.; Chou, J. P.; Contreras-Campana, E.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hidas, D.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Nash, K.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Juska, E.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Cowden, C.; Damgov, J.; De Guio, F.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Xia, F.; Clarke, C.; Harr, R.; Karchin, P. E.; Sturdy, J.; Belknap, D. A.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Ojalvo, I.; Perry, T.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.; CMS Collaboration

2017-10-01

Results are presented from a search for production of Higgs boson pairs (H H ) where one boson decays to a pair of b quarks and the other to a τ lepton pair. This work is based on proton-proton collision data collected by the CMS experiment at √{s }=8 TeV , corresponding to an integrated luminosity of 18.3 fb-1 . Resonant and nonresonant modes of H H production have been probed and no significant excess relative to the background-only hypotheses has been found in either mode. Upper limits on cross sections of the two H H production modes have been set. The results have been combined with previously published searches at √{s }=8 TeV , in decay modes to two photons and two b quarks, as well as to four b quarks, which also show no evidence for a signal. Limits from the combination have been set on resonant H H production by an unknown particle X in the mass range mX=300 GeV to mX=1000 GeV . For resonant production of spin 0 (spin 2) particles, the observed 95% CL upper limit is 1.13 pb (1.09 pb) at mX=300 GeV and to 21 fb (18 fb) at mX=1000 GeV . For nonresonant H H production, a limit of 43 times the rate predicted by the standard model has been set.

10 years of protein crystallography at AR-NW12A beamline

NASA Astrophysics Data System (ADS)

Chavas, L. M. G.; Yamada, Y.; Hiraki, M.; Igarashi, N.; Matsugaki, N.; Wakatsuki, S.

2013-03-01

The exponential growth of protein crystallography can be observed in the continuously increasing demand for synchrotron beam time, both from academic and industrial users. Nowadays, the screening of a profusion of sample crystals for more and more projects is being implemented by taking advantage of fully automated procedures at every level of the experiments. The insertion device AR-NW12A beamline is one of the five macromolecular crystallography (MX) beamlines at the Photon Factory (PF). Currently the oldest MX beamline operational at the High Energy Accelerator Research Organization (KEK), the end-station was launched in 2001 as part of an upgrade of the PF Advanced Ring. Since its commissioning, AR-NW12A has been operating as a high-throughput beamline, slowly evolving to a multipurpose end-station for MX experiments. The development of the beamline took place about a decade ago, in parallel with a drastic development of protein crystallography and more general synchrotron technology. To keep the beamline up-to-date and competitive with other MX stations in Japan and worldwide, new features have been constantly added, with the goal of user friendliness of the various beamline optics and other instruments. Here we describe the evolution of AR-NW12A for its tenth anniversary. We also discuss the plans for upgrades for AR-NW12A, the future objectives in terms of the beamline developments, and especially the strong desire to open the beamline to a larger user community.

Toward Improving the Type IV Cracking Resistance in Cr-Mo Steel Weld Through Thermo-Mechanical Processing

DOE PAGES

Shassere, Benjamin A.; Yamamoto, Yukinori; Babu, Sudarsanam Suresh

2016-02-23

Detailed microstructure characterization of Grade 91 (Modified 9Cr-1Mo, ASTM A387) steel subjected to a thermo-mechanical treatment (TMT) process was performed to rationalize the cross-weld creep properties. A series of thermo-mechanical processing in the austenite phase region, followed by isothermal aging at temperatures at 973 to 1173 K (700 to 900ºC) was applied to the Grade 91 steel to promote precipitation kinetics of MX (M: Nb and V, X: C and N) in the austenite matrix. Detailed characterization of the base metals after standard tempering confirmed the presence of fine MX dispersion within the tempered martensitic microstructure in steels processed at/andmore » above 1073 K (800 ºC). Relatively low volume fraction of M 23C 6 precipitates was observed after processing at 1073 K (800 ºC). The cross-weld creep strength after processing was increased with respect to the increase of MX dispersion, indicating that these MX precipitates maintained during weld thermal cycles in the fine grained heat affected zone (FGHAZ) region and thereby contribute to improved creep resistant of welds in comparison to the welds made with the standard “normalization and tempering” processes. Lastly, the steels processed in this specific processing condition showed improved cross-weld creep resistance and sufficient room-temperature toughness. The above data is also analysed based on existing theories of creep deformation based on dislocation climb mechanism.« less

Optimization of minoxidil microemulsions using fractional factorial design approach.

PubMed

Jaipakdee, Napaphak; Limpongsa, Ekapol; Pongjanyakul, Thaned

2016-01-01

The objective of this study was to apply fractional factorial and multi-response optimization designs using desirability function approach for developing topical microemulsions. Minoxidil (MX) was used as a model drug. Limonene was used as an oil phase. Based on solubility, Tween 20 and caprylocaproyl polyoxyl-8 glycerides were selected as surfactants, propylene glycol and ethanol were selected as co-solvent in aqueous phase. Experiments were performed according to a two-level fractional factorial design to evaluate the effects of independent variables: Tween 20 concentration in surfactant system (X1), surfactant concentration (X2), ethanol concentration in co-solvent system (X3), limonene concentration (X4) on MX solubility (Y1), permeation flux (Y2), lag time (Y3), deposition (Y4) of MX microemulsions. It was found that Y1 increased with increasing X3 and decreasing X2, X4; whereas Y2 increased with decreasing X1, X2 and increasing X3. While Y3 was not affected by these variables, Y4 increased with decreasing X1, X2. Three regression equations were obtained and calculated for predicted values of responses Y1, Y2 and Y4. The predicted values matched experimental values reasonably well with high determination coefficient. By using optimal desirability function, optimized microemulsion demonstrating the highest MX solubility, permeation flux and skin deposition was confirmed as low level of X1, X2 and X4 but high level of X3.

Toward Improving the Type IV Cracking Resistance in Cr-Mo Steel Weld Through Thermo-Mechanical Processing

NASA Astrophysics Data System (ADS)

Shassere, Benjamin A.; Yamamoto, Yukinori; Babu, Sudarsanam Suresh

2016-05-01

Detailed microstructure characterization of Grade 91 (Modified 9Cr-1Mo, ASTM A387) steel subjected to a thermo-mechanical treatment process was performed to rationalize the cross-weld creep properties. A series of thermo-mechanical processing in the austenite phase region, followed by isothermal aging at temperatures at 973 K to 1173 K (700 °C to 900 °C), was applied to the Grade 91 steel to promote precipitation kinetics of MX (M: Nb and V, X: C and N) in the austenite matrix. Detailed characterization of the base metals after standard tempering confirmed the presence of fine MX dispersion within the tempered martensitic microstructure in steels processed at/and above 1073 K (800 °C). Relatively low volume fraction of M23C6 precipitates was observed after processing at 1073 K (800 °C). The cross-weld creep strength after processing was increased with respect to the increase of MX dispersion, indicating that these MX precipitates maintained during weld thermal cycles in the fine-grained heat-affected zone region and thereby contribute to improved creep resistant of welds in comparison to the welds made with the standard "normalization and tempering" processes. The steels processed in this specific processing condition showed improved cross-weld creep resistance and sufficient room temperature toughness. The above data are also analyzed based on existing theories of creep deformation based on dislocation climb mechanism.

Effect of decursinol angelate on the pharmacokinetics of theophylline and its metabolites in rats.

PubMed

Chae, Jung-woo; An, Jung-hwa; Kang, Wonku; Ma, Jin yeul; Kwon, Kwang-il

2012-10-01

Herb-drug interactions represent a serious problem as herbal medicine is used extensively in the modern world. This study investigated the effects of decursinol angelate on the pharmacokinetics of theophylline, a typical substrate of the cytochrome P450 1A2 enzyme, in rats. After 3 days of decursinol angelate pretreatment, on the fourth day, rats were administered decursinol angelate and theophylline concomitantly. Blood theophylline and its major metabolite [1-methylxanthine (1-MX), 3-methylxanthine (3-MX), 1-methyluric acid (1-MU), and 1,3-dimethyluric acid (1,3-DMU)] levels were monitored by liquid chromatography-tandem mass spectroscopy. The results indicated that theophylline clearance significantly decreased and the area under the concentration-time curve (AUC) increased in decursinol angelate (25 mg/kg)-pretreated rats administered theophylline (10 mg/kg). The elimination half-life (t1/2) of theophylline was increased by 20%. In the presence of decursinol angelate (25 mg/kg), the pharmacokinetic parameters of three metabolites (1-MX, 1,3-DMU, and 1-MU) were significantly altered (half-life for 1-MU, and AUC24 h for 1-MX, 1,3-DMU, and 1-MU). Our results suggest that patients receiving CYP1A2-metabolized drugs, such as caffeine and theophylline, should be advised of the potential herb-drug interaction to reduce the risk of therapeutic failure or increased toxicity of conventional drug therapy. Copyright © 2012 Elsevier Ltd. All rights reserved.

NITRO MUSK ADDUCTS OF RAINBOW TROUT ...

EPA Pesticide Factsheets

Rainbow trout and other fish species can serve as 'sentinel' species for the assessment of ecological status and the presence of certain environmental contaminants. As such they act as bioindicators of exposure. Here we present seminal data regarding dose-response and toxicokinetics of trout hemoglobin adduct formation from exposure to nitro musks that are frequently used as fragrance ingredients in formulations of personal care products. Hemoglobin adducts serve as biomarkers of exposure of the sentinel species as we have shown in previous studies of hemoglobin adducts formed in trout and environmental carp exposed to musk xylene (MX) and musk ketone (MK). Gas chromatography-electron capture negative ion chemical ionization-mass spectrometry (GC-NICI-MS) employing selected ion monitoring is used to measure 4-amino-MX (4-AMX), 2-amino-MX (2-AMX), and 2-amino-MK (2-AMK) released by alkaline hydrolysis from the sulfinamide adducts of hemoglobin. Dose-response and toxicokinetics were investigated using this sensitive method for analysis of these metabolites. In the dose-response investigation, the concentrations of 4-AMX and 2-2AMX are observed to pass through a maximum at 0.10 mg/g. In the case of 2-AMK, the adduct concentration is almost the same at dosages in the range of 0.030 to 0.10 mg/g. For toxicokinetics, the concentration of the metabolites in the Hb reaches a maximum in the 3-day sample after administration of MX or MK. Further elimination of the metabo

Toward Improving the Type IV Cracking Resistance in Cr-Mo Steel Weld Through Thermo-Mechanical Processing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shassere, Benjamin A.; Yamamoto, Yukinori; Babu, Sudarsanam Suresh

Detailed microstructure characterization of Grade 91 (Modified 9Cr-1Mo, ASTM A387) steel subjected to a thermo-mechanical treatment (TMT) process was performed to rationalize the cross-weld creep properties. A series of thermo-mechanical processing in the austenite phase region, followed by isothermal aging at temperatures at 973 to 1173 K (700 to 900ºC) was applied to the Grade 91 steel to promote precipitation kinetics of MX (M: Nb and V, X: C and N) in the austenite matrix. Detailed characterization of the base metals after standard tempering confirmed the presence of fine MX dispersion within the tempered martensitic microstructure in steels processed at/andmore » above 1073 K (800 ºC). Relatively low volume fraction of M 23C 6 precipitates was observed after processing at 1073 K (800 ºC). The cross-weld creep strength after processing was increased with respect to the increase of MX dispersion, indicating that these MX precipitates maintained during weld thermal cycles in the fine grained heat affected zone (FGHAZ) region and thereby contribute to improved creep resistant of welds in comparison to the welds made with the standard “normalization and tempering” processes. Lastly, the steels processed in this specific processing condition showed improved cross-weld creep resistance and sufficient room-temperature toughness. The above data is also analysed based on existing theories of creep deformation based on dislocation climb mechanism.« less

Effect of solubility enhancement on nasal absorption of meloxicam.

PubMed

Horváth, Tamás; Ambrus, Rita; Völgyi, Gergely; Budai-Szűcs, Mária; Márki, Árpád; Sipos, Péter; Bartos, Csilla; Seres, Adrienn B; Sztojkov-Ivanov, Anita; Takács-Novák, Krisztina; Csányi, Erzsébet; Gáspár, Róbert; Szabó-Révész, Piroska

2016-12-01

Besides the opioids the standard management of the World Health Organization suggests NSAIDs (non-steroidal anti-inflammatory drugs) alone or in combination to enhance analgesia in malignant and non-malignant pain therapy. The applicability of NSAIDs in a nasal formulation is a new approach in pharmaceutical technology. In order to enhance the nasal absorption of meloxicam (MX) as an NSAID, its salt form, meloxicam potassium monohydrate (MXP), registered by Egis Plc., was investigated in comparison with MX. The physico-chemical properties of the drugs (structural analysis, solubility and dissolution rate) and the mucoadhesivity of nasal formulations were controlled. In vitro and in vivo studies were carried out to determine the nasal applicability of MXP as a drug candidate in pain therapy. It can be concluded that MX and MXP demonstrated the same equilibrium solubility at the pH5.60 of the nasal mucosa (0.017mg/ml); nonetheless, MXP indicated faster dissolution and a higher permeability through the synthetic membrane. The animal studies justified the short T max value (15min) and the high AUC of MXP, which is important in acute pain therapy. It can be assumed that the low mucoadhesivity of MXP spray did not increase the residence time in the nasal cavity, and the elimination from the nasal mucosa was therefore faster than in the case of MX. Further experiments are necessary to prove the therapeutic relevance of this MXP-containing innovative intranasal formulation. Copyright © 2016 Elsevier B.V. All rights reserved.

Non-monotonic course of protein solubility in aqueous polymer-salt solutions can be modeled using the sol-mxDLVO model.

PubMed

Herhut, Marcel; Brandenbusch, Christoph; Sadowski, Gabriele

2016-02-01

Protein purification is often performed using cost-intensive chromatographic steps. To discover economic alternatives (e.g., crystallization), knowledge on protein solubility as a function of temperature, pH, and additives in solution as well as their concentration is required. State-of-the-art models for predicting protein solubility almost exclusively consider aqueous salt systems, whereas "salting-in" and "salting-out" effects induced by the presence of an additional polymer are not considered. Thus, we developed the sol-mxDLVO model. Using this newly developed model, protein solubility in the presence of one salt and one polymer, especially the non-monotonic course of protein solubility, could be predicted. Systems considered included salts (NaCl, Na-p-Ts, (NH(4))(2) SO(4)) and the polymer polyethylene glycol (MW: 2000 g/mol, 12000 g/mol) and proteins lysozyme from chicken egg white (pH 4 to 5.5) and D-xylose ketol-isomerase (pH 7) at 298.15 K. The results show that by using the sol-mxDLVO model, protein solubility in polymer-salt solutions can be modeled in good agreement with the experimental data for both proteins considered. The sol-mxDLVO model can describe the non-monotonic course of protein solubility as a function of polymer concentration and salt concentration, previously not covered by state-of-the-art models. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Gynecomastia: a common indication for mammography in men of all age.

PubMed

Capasso, Raffaella; Sica, A; D'Amora, M; Mostardi, Maurizio; Martella, Ilenia; Totaro, Marilina; Della Casa, Giovanni; Vallara, Manuela; Pesce, Antonella; Gatta, G; Cappabianca, S

2016-07-28

Gynecomastia (GM) is the most frequent cause of male breast-related signs and symptoms and represents also the most common indication for mammography (MX) in men. In this article, our 7-year long experience with MX in men suffering from GM is reviewed, and the mammographic features of GM are presented. MXs performed in male patients at our institution from January 2009 to January 2016 were retrospectively reviewed and patients with mammographic features of GM were selected. Informed consent was waived by the local institutional review board given the retrospective nature of the study. Mammograms were performed in both cranio-caudal (CC) and medio-lateral-oblique (MLO) views according to diagnostic needs. Clinical and pathologic data were obtained by review of patient charts. 37 males (aged between 13-79 years, mean 59 years) referred for MX at our institution because of palpable lump (31/37; 83.8%), breast enlargement (33/37; 89.2%), tenderness or pain (25/37; 67.6%). Of the 37 patients evaluated, 32 (86.5%) had true GM while 5 (13.5%) had pseudoGM. The evaluation of GM can be complex but a stepwise approach that starts with careful history taking and physical examination may obviate the need for extensive work-up. In this context, MX has been shown to be an accurate diagnostic tool for detecting GM and should be the first imaging examination to be performed in all clinically suspicious lesions referred for imaging.

The coordination behaviour of ferrocene-based pyridylphosphine ligands towards Zn(II), Cd(II) and Hg(II).

PubMed

Siemeling, Ulrich; Klemann, Thorsten; Bruhn, Clemens; Schulz, Jiří; Štěpnička, Petr

2011-05-07

The reaction of Group 12 metal dihalides MX(2) with the P,N-ligands [Fe(C(5)H(4)-PPh(2))(C(5)H(4)-2-py)] (1) (2-py = pyrid-2-yl), [Fe(C(5)H(4)-PPh(2))(C(5)H(4)-CH(2)-2-py)] (2) and [Fe(C(5)H(4)-PPh(2))(C(5)H(4)-3-py)] (3) (3-py = pyrid-3-yl) was investigated. For a 1 : 1 molar ratio of MX(2) and the respective ligand, three structure types were found in the solid state, viz. chelate, cyclic dimer and chain-like coordination polymer. The M(II) coordination environment is distorted pseudo-tetrahedral in each case. The P-M-N angle is much larger in the chelates (≥119°) than in the ligand-bridged structures (≤109°). 1 prefers the formation of chelates [MX(2)(1-κ(2)N,P)]. 3 forms coordination polymers [MX(2)(μ-3)](n). With the more flexible 2 all three structure types can occur. Dynamic coordination equilibria were observed in solution for the molecular complexes obtained with 1 and 2. NMR data indicate that the N- and P-donor sites interact most strongly with Zn(II) and Hg(II), respectively. While the formation of bis(phosphine)mercury complexes (soft-soft) was easily achieved, no bis(pyridine)zinc complex (borderline-borderline) could be obtained, which is surprising in view of the HSAB principle.

Initial clinical laboratory experience in noninvasive prenatal testing for fetal aneuploidy from maternal plasma DNA samples.

PubMed

Futch, Tracy; Spinosa, John; Bhatt, Sucheta; de Feo, Eileen; Rava, Richard P; Sehnert, Amy J

2013-06-01

The aim of this study is to report the experience of noninvasive prenatal DNA testing using massively parallel sequencing in an accredited clinical laboratory. Laboratory information was examined for blood samples received for testing between February and November 2012 for chromosome 21 (Chr21), Chr18, and Chr13. Monosomy X (MX) testing was available from July 2012 for cystic hygroma indication. Outcomes were collected from providers on samples with positive results. There were 5974 samples tested, and results were issued within an average of 5.1 business days. Aneuploidy was detected in 284 (4.8%) samples (155 Chr21, 66 Chr18, 19 Chr13, 40 MX, and four double aneuploidy). Follow-ups are available for 245/284 (86%), and 77/284 (27.1%) are confirmed, including one double-aneuploidy case concordant with cytogenetics from maternal malignancy. Fourteen (0.2%) discordant (putative false-positive) results (one Chr21, six Chr18, three Chr13, three MX, and one Chr21/13) have been identified. Five (0.08%) false-negative cases are reported (two trisomy 21, two trisomy 18, and one MX). In 170 (2.8%) cases, the result for a single chromosome was indefinite. This report suggests that clinical testing of maternal cell-free DNA for fetal aneuploidy operates within performance parameters established in validation studies. Noninvasive prenatal testing is sensitive to biological contributions from placental and maternal sources. ©2013 Verinata Health, Inc. Prenatal Diagnosis published by John Wiley & Sons, Ltd.

"Antelope": a hybrid-logic model checker for branching-time Boolean GRN analysis

PubMed Central

2011-01-01

Background In Thomas' formalism for modeling gene regulatory networks (GRNs), branching time, where a state can have more than one possible future, plays a prominent role. By representing a certain degree of unpredictability, branching time can model several important phenomena, such as (a) asynchrony, (b) incompletely specified behavior, and (c) interaction with the environment. Introducing more than one possible future for a state, however, creates a difficulty for ordinary simulators, because infinitely many paths may appear, limiting ordinary simulators to statistical conclusions. Model checkers for branching time, by contrast, are able to prove properties in the presence of infinitely many paths. Results We have developed Antelope ("Analysis of Networks through TEmporal-LOgic sPEcifications", http://turing.iimas.unam.mx:8080/AntelopeWEB/), a model checker for analyzing and constructing Boolean GRNs. Currently, software systems for Boolean GRNs use branching time almost exclusively for asynchrony. Antelope, by contrast, also uses branching time for incompletely specified behavior and environment interaction. We show the usefulness of modeling these two phenomena in the development of a Boolean GRN of the Arabidopsis thaliana root stem cell niche. There are two obstacles to a direct approach when applying model checking to Boolean GRN analysis. First, ordinary model checkers normally only verify whether or not a given set of model states has a given property. In comparison, a model checker for Boolean GRNs is preferable if it reports the set of states having a desired property. Second, for efficiency, the expressiveness of many model checkers is limited, resulting in the inability to express some interesting properties of Boolean GRNs. Antelope tries to overcome these two drawbacks: Apart from reporting the set of all states having a given property, our model checker can express, at the expense of efficiency, some properties that ordinary model checkers (e.g., NuSMV) cannot. This additional expressiveness is achieved by employing a logic extending the standard Computation-Tree Logic (CTL) with hybrid-logic operators. Conclusions We illustrate the advantages of Antelope when (a) modeling incomplete networks and environment interaction, (b) exhibiting the set of all states having a given property, and (c) representing Boolean GRN properties with hybrid CTL. PMID:22192526

Multigenic Control of Measles Vaccine Immunity Mediated by Polymorphisms in Measles Receptor, Innate Pathway, and Cytokine Genes

PubMed Central

Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; O’Byrne, Megan; Jacobson, Robert M.; Pankratz, V. Shane; Poland, Gregory A.

2012-01-01

Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5,7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses. PMID:22265947

Blastic plasmacytoid dendritic cell neoplasms: clinico-immunohistochemical correlations in a series of 91 patients.

PubMed

Julia, Fanny; Dalle, Stephane; Duru, Gerard; Balme, Brigitte; Vergier, Béatrice; Ortonne, Nicolas; Vignon-Pennamen, Marie D; Costes-Martineau, Valérie; Lamant, Laurence; Dalac, Sophie; Delattre, Claire; Déchelotte, Pierre; Courville, Philippe; Carlotti, Agnès; De Muret, Anne; Fraitag, Sylvie; Levy, Annie; Mitchell, Andrew; Petrella, Tony

2014-05-01

Blastic plasmacytoid dendritic cell neoplasm is a rare clinicopathologic entity, characterized by strong skin tropism and a poor prognosis. The diagnosis is generally made by skin biopsy with appropriate immunohistochemical studies. To identify potential biological prognostic factors for blastic plasmacytoid dendritic cell neoplasm, we performed an extended clinico-immunohistochemical study on a series of 91 well-documented cases collected since 1995 by the French Study Group on Cutaneous Lymphomas. Skin biopsies were analyzed using a panel of 12 immunohistochemical markers (CD4, CD56, CD123, CD303, TCL1, CD68, CD2, CD7, TdT, Ki-67, S100, and MX-1). The results were correlated with survival. The 5 most characteristic markers of this entity (CD4, CD56, CD123, CD303, and TCL1) were expressed simultaneously in only 46% of patients. However, when 4 markers were expressed the diagnosis could still be reliably made without resorting to any additional stains. Expression of TdT and/or S100 correlated with varying degrees of maturation. Statistical survival analyses showed that CD303 expression and high proliferative index (Ki-67) were significantly associated with longer survival.

Focused Flow During Infiltration Into Ethanol-Contaminated Unsaturated Porous Media

NASA Astrophysics Data System (ADS)

Jazwiec, A.; Smith, J. E.

2017-12-01

The increasing commercial and industrial use of ethanol, e.g. in biofuels, has generated increased incidents of vadose zone contamination by way of ethanol spills and releases. This has increased the interest in better understanding behaviors of ethanol in unsaturated porous media and it's multiphase interactions in the vadose zone. This study uses highly controlled laboratory experiments in a 2-D (0.6mx0.6mx0.01m) flow cell to investigate water infiltration behaviors into ethanol-contaminated porous media. Ethanol and water were applied by either constant head or constant flux methods onto the surface of sands homogenously packed into the flow cell. The constant flux experiments at both low and high application rates were conducted using a rainulator with a row of hypodermic needles connected to a peristaltic pump. The constant head experiments were conducted using an 8cm diameter tension disk infiltrometer set to both low and high tensions. The presence of ethanol contamination generated solute-dependent capillarity induced focused flow (SCIFF) of water infiltration, which was primarily due to decreases in interfacial tensions at the air-liquid interfaces in the unsaturated sands as a function of ethanol concentration. SCIFF was clearly expressed as an unsaturated water flow phenomenon comprised of narrowly focused vertical flow fingers of water within the initially ethanol contaminated porous media. Using analyses of photos and video, comparisons were made between constant flux and constant head application methods. Further comparisons were made between low and high infiltration rates and the two sand textures used. A high degree of sensitivity to minor heterogeneity in relatively homogeneous sands was also observed. The results of this research have implications for rainfall infiltration into ethanol contaminated vadose zones expressing SCIFF, including implications for associated mass fluxes and the nature of flushing of ethanol from the unsaturated zone to groundwaters.

Physics-Based Stimulation for Night Vision Goggle Simulation

DTIC Science & Technology

2006-11-01

a CRT display system can produce darker black level than displays based on digital light processing (DLP) or liquid crystal technologies. It should...The general form of the bucket equation for any gun (color) is as follows: (3) n n n n r MnRp f MxR MnR ⎛ ⎞− = ⎜ ⎟−⎝ ⎠ Equation 3 General...simulate rendering approach, we began by testing the bucket rendering approach already utilized by SensorHost: (10) n n n n r MnRp f MxR MnR

Monterey Peninsula Water Supply Project. Supplemental Draft Environmental Impact Report/Statement II. Volume 2.

DTIC Science & Technology

1993-02-01

Fueled 7,634,0(X) 51 Geothermal 1,302,M(K) 9 Nuclear 2,160,(MX) 14 Total Thermal 11,096,(kM) 74 Hydroelectric 3,877,M(X) 26 Solar 0 0t Total Company...Nuclear 16,273,963 17 "Total Thermal 48,094,316 50 Hydroelectric 8,007,631 8 Solar 35 0 Total Company Generation 56,101,982 58 Helms Pumpback Energy...returnable beverage containers, prohibition of disposable diapers , and other measures to reduce the volume of the urban solid waste streams. Appeaidix 19-B

Orthodontic management of bilateral maxillary canine-first premolar transposition and bilateral agenesis of maxillary lateral incisors: a case report.

PubMed

Di Palma, Elena; Di Giuseppe, Biagio; Tepedino, Michele; Chimenti, Claudio

2015-01-01

Maxillary canine-first premolar transposition (Mx.C.P1) is an uncommon dental positional anomaly that may create many orthodontic problems from both esthetic and functional points of view. In this report we show the orthodontic management of a case of Mx.C.P1 associated with bilateral maxillary lateral incisor agenesis and unilateral mandibular second premolar agenesis The patient was treated with a multibracket appliance and the extraction of the lower premolar. treatment was completed without the need for any prosthetic replacement.

A MEK Inhibitor Abrogates Myeloproliferative Disease in Kras Mutant Mice

PubMed Central

Lyubynska, Natalya; Gorman, Matthew F.; Lauchle, Jennifer O.; Hong, Wan Xing; Akutagawa, Jon K.; Shannon, Kevin; Braun, Benjamin S.

2012-01-01

Chronic and juvenile myelomonocytic leukemias (CMML and JMML) are aggressive myeloproliferative neoplasms that are incurable with conventional chemotherapy. Mutations that deregulate Ras signaling play a central pathogenic role in both disorders, and Mx1-Cre, KrasLSL-G12D mice that express the Kras oncogene develop a fatal disease that closely mimics these two leukemias in humans. Activated Ras controls multiple downstream effectors, but the specific pathways that mediate the leukemogenic effects of hyperactive Ras are unknown. We used PD0325901, a highly selective pharmacological inhibitor of mitogen-activated protein kinase kinase (MEK), a downstream component of the Ras signaling network, to address how deregulated Raf/MEK/ERK signaling drives neoplasm formation in Mx1-Cre, KrasLSL-G12D mice. PD0325901 treatment induced a rapid and sustained reduction in leukocyte counts, enhanced erythropoiesis, prolonged mouse survival, and corrected the aberrant proliferation and differentiation of bone marrow progenitor cells. These responses were due to direct effects of PD0325901 on Kras mutant cells rather than to stimulation of normal hematopoietic cell proliferation. Consistent with the in vivo response, inhibition of MEK reversed the cytokine hypersensitivity characteristic of KrasG12D hematopoietic progenitor cells in vitro. Our data demonstrate that deregulated Raf/MEK/ERK signaling is integral to the growth of Kras-mediated myeloproliferative neoplasias, and further suggest that MEK inhibition could be a useful way to ameliorate functional hematologic abnormalities in patients with CMML and JMML. PMID:21451123

Pressure Autoregulation Measurement Techniques in Adult Traumatic Brain Injury, Part I: A Scoping Review of Intermittent/Semi-Intermittent Methods.

PubMed

Zeiler, Frederick A; Donnelly, Joseph; Calviello, Leanne; Menon, David K; Smielewski, Peter; Czosnyka, Marek

2017-12-01

The purpose of this study was to perform a systematic, scoping review of commonly described intermittent/semi-intermittent autoregulation measurement techniques in adult traumatic brain injury (TBI). Nine separate systematic reviews were conducted for each intermittent technique: computed tomographic perfusion (CTP)/Xenon-CT (Xe-CT), positron emission tomography (PET), magnetic resonance imaging (MRI), arteriovenous difference in oxygen (AVDO 2 ) technique, thigh cuff deflation technique (TCDT), transient hyperemic response test (THRT), orthostatic hypotension test (OHT), mean flow index (Mx), and transfer function autoregulation index (TF-ARI). MEDLINE ® , BIOSIS, EMBASE, Global Health, Scopus, Cochrane Library (inception to December 2016), and reference lists of relevant articles were searched. A two tier filter of references was conducted. The total number of articles utilizing each of the nine searched techniques for intermittent/semi-intermittent autoregulation techniques in adult TBI were: CTP/Xe-CT (10), PET (6), MRI (0), AVDO 2 (10), ARI-based TCDT (9), THRT (6), OHT (3), Mx (17), and TF-ARI (6). The premise behind all of the intermittent techniques is manipulation of systemic blood pressure/blood volume via either chemical (such as vasopressors) or mechanical (such as thigh cuffs or carotid compression) means. Exceptionally, Mx and TF-ARI are based on spontaneous fluctuations of cerebral perfusion pressure (CPP) or mean arterial pressure (MAP). The method for assessing the cerebral circulation during these manipulations varies, with both imaging-based techniques and TCD utilized. Despite the limited literature for intermittent/semi-intermittent techniques in adult TBI (minus Mx), it is important to acknowledge the availability of such tests. They have provided fundamental insight into human autoregulatory capacity, leading to the development of continuous and more commonly applied techniques in the intensive care unit (ICU). Numerous methods of intermittent/semi-intermittent pressure autoregulation assessment in adult TBI exist, including: CTP/Xe-CT, PET, AVDO 2 technique, TCDT-based ARI, THRT, OHT, Mx, and TF-ARI. MRI-based techniques in adult TBI are yet to be described, with the main focus of MRI techniques on metabolic-based cerebrovascular reactivity (CVR) and not pressure-based autoregulation.

The Mexican hydro-meteorological disasters and climate network (redesclim) as model on outreach decision makers on disaster public policy in Mexico.

NASA Astrophysics Data System (ADS)

Welsh-Rodriguez, C. M.; Rodriguez-Estevez, J. M., Sr.; Romo-Aguilar, M. D. L.; Brito-Castillo, L.; Salinas-Prieto, A.; Gonzalez-Sosa, E.; Pérez-Campuzano, E.

2017-12-01

REDESCLIM was designed and develop in 2011 due to a public call from The Science and Technology Mexican Council (CONACYT); CONACYT lead the activities for its organization and development among the academic community. REDESCLIM was created to enhance the capacity of response to hydro-meteorological disasters and climate events through an integrative effort of researchers, technologists, entrepreneurs, politicians and society. Brief summary of our objectives: 1) Understand the causes of disasters, to reduce risks to society and ecosystems 2) Support research and interdisciplinary assessment of the physical processes in natural and social phenomena to improve understanding of causes and impacts 3) Strengths collaboration with academic, government, private and other interdisciplinary networks from Mexico and other countries 4) Build human capacity and promote the development of skills 5) Recommend strategies for climate hazard prevention, mitigation and response, especially for hazard with the greatest impacts in Mexico, such as hurricanes, floods, drought, wild fires and other extremes events. We provide a continues communication channel on members research results to provide scientific information that could be used for different proposes, specificaly for decision makers who are dealing with ecological and hydro meteorological problems that can result in disasters, and provide a services menu based on the members scientific projects, publications, teaching courses, in order to impact public policy as final result. http://www.redesclim.org.mx. So far we have some basic results: Fiver national meetings (participants from 35 countries around the world), 7 Workshops and seminars (virtual and in-person), Climatic data platforms ( http://clicom.mex.cicese.mx, http://clicom-mex.cicese.mx/malla, http://atlasclimatico.unam.mx/REDESCLIM2/ ), climate change scenarios for the general public at http://escenarios.inecc.gob.mx, 14 seed projects, one model to hurricane simulation, one popular science journal, one popular science book. We are moving to: ¡ To influence public policy involving the government, private enterprise, academy and society. ¡ To promote the knowledge of natural phenomena. ¡ To reduce the risk of disasters against hydrometeorological and climatic phenomena in Mexico.

Estimation of the Magnetic Flux Emergence Rate in the Quiet Sun from Sunrise Data

NASA Astrophysics Data System (ADS)

Smitha, H. N.; Anusha, L. S.; Solanki, S. K.; Riethmüller, T. L.

2017-03-01

Small-scale internetwork (IN) features are thought to be the major source of fresh magnetic flux in the quiet Sun. During its first science flight in 2009, the balloon-borne observatory Sunrise captured images of the magnetic fields in the quiet Sun at a high spatial resolution. Using these data we measure the rate at which the IN features bring magnetic flux to the solar surface. In a previous paper it was found that the lowest magnetic flux in small-scale features detected using the Sunrise observations is 9 × 1014 Mx. This is nearly an order of magnitude smaller than the smallest fluxes of features detected in observations from the Hinode satellite. In this paper, we compute the flux emergence rate (FER) by accounting for such small fluxes, which was not possible before Sunrise. By tracking the features with fluxes in the range {10}15{--}{10}18 Mx, we measure an FER of 1100 {Mx} {{cm}}-2 {{day}}-1. The smaller features with fluxes ≤slant {10}16 Mx are found to be the dominant contributors to the solar magnetic flux. The FER found here is an order of magnitude higher than the rate from Hinode, obtained with a similar feature tracking technique. A wider comparison with the literature shows, however, that the exact technique of determining the rate of the appearance of new flux can lead to results that differ by up to two orders of magnitude, even when applied to similar data. The causes of this discrepancy are discussed and first qualitative explanations proposed.

The invasive alien plants threatened the balance of ecosystem in conservative area in Ontoloe Island, Flores-Indonesia

NASA Astrophysics Data System (ADS)

Antonius Mboka Segu Wake, Ignatius; Retnaningsih Soeprobowati, Tri; Jumari

2018-05-01

Invasive alien plants threaten to biodiversity, particularly in small island with high endemicity values such as Ontoloe Island, a tourist destination area of Riung Seventeen Island in Flores. The study aims to characterized the invasive plants have attacked the conservative area in Ontoloe Island. The method used by combining the line method and the plot method with three observation stations in utilization block and four observation station in protection block. Plot of 1mx1m was used for the observation of ground cover plants and seedling, 5mx5m for the observation in stake level, 10mx10m for the observation in pole level, 20mx20m for the observation in tree level. The data level of the plants obtained then analyzed with Important Value Index (IVI). Result showed that Lamtoro plants (Leuchaena leucocephala) is the invasive alien species which has the highest IVI in both of utilization block and protection block in each level of tree, stake, and pole. There are other invasive alien plants such as Tembeleken (Lantana camara) and Bidara (Zizipus mauritiana) dominated in stake level and Alang-alang (Imperata cylindrica) dominated in seedling level. All the native plants in Ontoloe Island will be threatened their existing because of the less control of invasive alien plants. Therefore, needs serious handling by the government in order to keep the balanced of the ecosystems in Ontoloe Island to be maintained especially to not deviated from management objectives area of Komodo Dragons conservation (Varanus komodoensis Ouwens, 1912).

FORMATION OF NITRO MUSK ADDUCTS OF RAINBOW ...

EPA Pesticide Factsheets

The high use of nitro musk xylene (MX) and musk ketone (MK) as fragrances, and their persistence and bioaccumulation potential make them ubiquitous environmental contaminants. The 4-amino-MX (AMX) and 2-amino-MK (AMK) metabolites have been detected in trout fish hemoglobin (Hb) samples by gas chromatography-ion trap-mass spectrometry (GC-MS). Twelve Hb samples prepared from rainbow trout that were exposed to MX and MK, over a period of 24 and 72 h, were analyzed. Amino metabolites were liberated by basic hydrolysis and extracted from the fish Hb into n-hexane. The extract was concentrated, analyzed, and spiked with a standard solution (80 pg/uL) of AMX or AMK and reanalyzed. Concentrations of AMX from 10 to 24.7 ng/g were detected in Hb from fish taken 24 and 72 h after MX exposure. At 24 and 72 h after MK exposure, the concentration of AMK was found to be 25.1 to 51, and 9.5 to 25.1 ng/g, respectively. Concentrations of AMK in Hb from two of the three trout were substantially lower after 72 h compared with 24 h exposure. The AMX and AMK metabolites were not detected in four control samples. Average recoveries exceeding 89 and 86% could be achieved for AMX and AMK, respectively, with a coefficient of variation (CV) around 5%. The research focused on in the subtasks is the development and application of state-of the-art technologies to meet the needs of the public, Office of Water, and ORD in the area of Water Quality. Located In the subtasks are the various r

Maternal Perception of Child Weight Among Mexicans in California and Mexico

PubMed Central

Rosas, Lisa G.; Harley, Kim G.; Guendelman, Sylvia; Fernald, Lia CH; Mejia, Fabiola

2009-01-01

The prevalence of childhood overweight is high in Mexican immigrant communities in the United States. Understanding mother’s perceptions of child weight in immigrants’ country of origin may help to understand this high prevalence. The goal of this study was to examine and compare mothers’ perception of weight in Mexico (MX) and in an immigrant community in California (CA). We assessed perceptions of child weight using a pictorial scale with 314 mothers of 5-year-old children in MX and 60 mothers of 5 year-old-children in CA. We compared maternal reports with children’s objectively measured weight. Using chi-square and Analysis of Variance, we investigated associations of maternal perception of and satisfaction with weight according to socio-demographic characteristics. Mothers were more likely to underestimate their children’s weight in CA than in MX. On average, CA mothers wanted their children to be smaller than they currently were and mothers in MX wanted their children to be bigger than they currently were. This differed by weight status in CA with mothers of normal weight and at-risk-for-overweight children wanting them to be bigger and mothers of overweight children wanting them to be smaller. In order for programs to be effective, mothers must be able to recognize their children as overweight and want to address it. Because underestimation of weight and a desire for a larger size is common in this population, programs to address overweight may be more effective if they focus on alternative benefits of weight control strategies, such as healthy child development. PMID:19911262

Comparative study to investigate the effect of meloxicam or minocycline HCl in situ gel system on local treatment of periodontal pockets.

PubMed

Kassem, Abeer Ahmed; Ismail, Fatma Ahmed; Naggar, Vivian Fahim; Aboulmagd, Elsayed

2014-08-01

In situ gelling formulations allow easy application to the target area. Gelation is induced by physiological stimuli at the site of application where the formula attains semisolid properties and exerts sustained drug release. In situ gelling formulations containing either 3% meloxicam (Mx) or 2% minocycline HCl (MH) were prepared for local application into the periodontal pockets. Gel formulations were based on the thermosensitive Pluronic(®) (Pl) and the pH-sensitive Carbopol(®) (C) polymers. C gels were prepared in combination with HPMC (H) to decrease its acidity. The total percent drug released from Pl formulae was 21.72% after 1 week for Mx and 85% after 3 days for MH. Their release kinetics data indicated anomalous non-Fickian behavior that could be controlled by both diffusion and chain relaxation. Addition of MH to C/H gels (1:2.5) resulted in liquefaction, followed by drug precipitation. Regarding C/H gel containing Mx, it showed a prolonged release rate up to 7 days with an initial burst effect; the kinetics data revealed Fickian-diffusion mechanism. The in vitro antibacterial activity studies for MH gel in Pl revealed that the drug released exceeded the minimum inhibitory concentration (MIC) of MH against Staphylococcus aureus ATCC 6538; placebo gel showed no effect on the microorganism. Clinical evaluation of Pl gels containing either Mx or MH showed significant improvement in chronic periodontitis patients, manifested by decrease in pocket depth and gingival index and increase in bone density.

A Facile Route to Metal Oxides/Single-Walled Carbon Nanotube Macrofilm Nanocomposites for Energy Storage

NASA Astrophysics Data System (ADS)

Cao, Zeyuan; Wei, Bingqing

2015-05-01

Nanocomposites consisting of transition-metal oxides and carbon nanomaterials with a desired size and structure are highly demanded for high performance energy storage devices. Here, a facile two-step and cost-efficient approach relying on directly thermal treatment of chemical-vapor-deposition products is developed as a general synthetic method to prepare a family of metal oxides (MxOy (M=Fe, Co, Ni))/single-walled carbon nanotube (SWNT) macrofilm nanocomposites. The MxOy nanoparticles obtained are of 3-17 nm in diameter and homogeneously anchor on the free-standing SWNT macrofilms. NiO/SWNT also exhibits a high specific capacitance of 400 F g-1 and fast charge-transfer Faradaic redox reactions to achieve asymmetric supercapacitors with a high power and energy density. All MxOy/SWNT nanocomposites could deliver a high capacity beyond 1000 mAh g-1 and show excellent cycling stability for lithium-ion batteries. The impressive results demonstrate the promise for energy storage devices and the general approach may pave the way to synthesize other functional nanocomposites.

The use of a mini-κ goniometer head in macromolecular crystallography diffraction experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brockhauser, Sandor; UJF–EMBL–CNRS UMI 3265, 6 Rue Jules Horowitz, 38043 Grenoble; Ravelli, Raimond B. G.

2013-07-01

Hardware and software solutions for MX data-collection strategies using the EMBL/ESRF miniaturized multi-axis goniometer head are presented. Most macromolecular crystallography (MX) diffraction experiments at synchrotrons use a single-axis goniometer. This markedly contrasts with small-molecule crystallography, in which the majority of the diffraction data are collected using multi-axis goniometers. A novel miniaturized κ-goniometer head, the MK3, has been developed to allow macromolecular crystals to be aligned. It is available on the majority of the structural biology beamlines at the ESRF, as well as elsewhere. In addition, the Strategy for the Alignment of Crystals (STAC) software package has been developed to facilitatemore » the use of the MK3 and other similar devices. Use of the MK3 and STAC is streamlined by their incorporation into online analysis tools such as EDNA. The current use of STAC and MK3 on the MX beamlines at the ESRF is discussed. It is shown that the alignment of macromolecular crystals can result in improved diffraction data quality compared with data obtained from randomly aligned crystals.« less

The Effect of Precipitate Evolution on Austenite Grain Growth in RAFM Steel.

PubMed

Yan, Biyu; Liu, Yongchang; Wang, Zejun; Liu, Chenxi; Si, Yonghong; Li, Huijun; Yu, Jianxing

2017-09-01

To study the effects of various types of precipitates and precipitate evolution behavior on austenite (size and phase fraction) in reduced activation ferritic/martensitic (RAFM) steel, RAFM steel was heated to various austenitizing temperatures. The microstructures of specimens were observed using optical microscopy (OM) and transmission electron microscopy (TEM). The results indicate that the M 23 C₆ and MX precipitates gradually coarsen and dissolve into the matrix as the austenitizing temperatures increase. The M 23 C₆ precipitates dissolve completely at 1100 °C, while the MX precipitates dissolve completely at 1200 °C. The evolution of two types of precipitate has a significant effect on the size of austenite. Based on the Zener pinning model, the effect of precipitate evolution on austenite grain size is quantified. It was found that the coarsening and dissolution of M 23 C₆ and MX precipitates leads to a decrease in pinning pressure on grain boundaries, facilitating the rapid growth of austenite grains. The austenite phase fraction is also affected by the coarsening and dissolution of precipitates.

Detection of nanoscale embedded layers using laboratory specular X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beekman, Matt, E-mail: matt.beekman@oit.edu; Rodriguez, Gabriel; Atkins, Ryan

Unusual specular X-ray diffraction patterns have been observed from certain thin film intergrowths of metal monochalcogenide (MX) and transition metal dichalcogenide (TX{sub 2}) structures. These patterns exhibit selective “splitting” or broadening of selected (00l) diffraction peaks, while other (00l) reflections remain relatively unaffected [Atkins et al., Chem. Mater. 24, 4594 (2012)]. Using a simplified optical model in the kinematic approximation, we illustrate that these peculiar and somewhat counterintuitive diffraction features can be understood in terms of additional layers of one of the intergrowth components, MX or TX{sub 2}, interleaved between otherwise “ideal” regions of MX-TX{sub 2} intergrowth. The interpretation ismore » in agreement with scanning transmission electron microscope imaging, which reveals the presence of such stacking “defects” in films prepared from non-ideal precursors. In principle, the effect can be employed as a simple, non-destructive laboratory probe to detect and characterize ultrathin layers of one material, e.g., 2-dimensional crystals, embedded between two slabs of a second material, effectively using the two slabs as a highly sensitive interferometer of their separation distance.« less

The Effect of Precipitate Evolution on Austenite Grain Growth in RAFM Steel

PubMed Central

Yan, Biyu; Liu, Yongchang; Wang, Zejun; Liu, Chenxi; Si, Yonghong; Li, Huijun; Yu, Jianxing

2017-01-01

To study the effects of various types of precipitates and precipitate evolution behavior on austenite (size and phase fraction) in reduced activation ferritic/martensitic (RAFM) steel, RAFM steel was heated to various austenitizing temperatures. The microstructures of specimens were observed using optical microscopy (OM) and transmission electron microscopy (TEM). The results indicate that the M23C6 and MX precipitates gradually coarsen and dissolve into the matrix as the austenitizing temperatures increase. The M23C6 precipitates dissolve completely at 1100 °C, while the MX precipitates dissolve completely at 1200 °C. The evolution of two types of precipitate has a significant effect on the size of austenite. Based on the Zener pinning model, the effect of precipitate evolution on austenite grain size is quantified. It was found that the coarsening and dissolution of M23C6 and MX precipitates leads to a decrease in pinning pressure on grain boundaries, facilitating the rapid growth of austenite grains. The austenite phase fraction is also affected by the coarsening and dissolution of precipitates. PMID:28862680

Monolayer group-III monochalcogenides by oxygen functionalization: a promising class of two-dimensional topological insulators

NASA Astrophysics Data System (ADS)

Zhou, Si; Liu, Cheng-Cheng; Zhao, Jijun; Yao, Yugui

2018-03-01

Monolayer group-III monochalcogenides (MX, M = Ga, In; X = S, Se, Te), an emerging category of two-dimensional (2D) semiconductors, hold great promise for electronics, optoelectronics and catalysts. By first-principles calculations, we show that the phonon dispersion and Raman spectra, as well as the electronic and topological properties of monolayer MX can be tuned by oxygen functionalization. Chemisorption of oxygen atoms on one side or both sides of the MX sheet narrows or even closes the band gap, enlarges work function, and significantly reduces the carrier effective mass. More excitingly, InS, InSe, and InTe monolayers with double-side oxygen functionalization are 2D topological insulators with sizeable bulk gap up to 0.21 eV. Their low-energy bands near the Fermi level are dominated by the px and py orbitals of atoms, allowing band engineering via in-plane strains. Our studies provide viable strategy for realizing quantum spin Hall effect in monolayer group-III monochalcogenides at room temperature, and utilizing these novel 2D materials for high-speed and dissipationless transport devices.

Measurement of the Inelastic Proton-Proton Cross Section at √{s }=13 TeV with the ATLAS Detector at the LHC

NASA Astrophysics Data System (ADS)

Aaboud, M.; Aad, G.; Abbott, B.; Abdallah, J.; Abdinov, O.; Abeloos, B.; Aben, R.; Abouzeid, O. S.; Abraham, N. L.; Abramowicz, H.; Abreu, H.; Abreu, R.; Abulaiti, Y.; Acharya, B. S.; Adamczyk, L.; Adams, D. L.; Adelman, J.; Adomeit, S.; Adye, T.; Affolder, A. A.; Agatonovic-Jovin, T.; Agricola, J.; Aguilar-Saavedra, J. A.; Ahlen, S. P.; Ahmadov, F.; Aielli, G.; Akerstedt, H.; Åkesson, T. P. A.; Akimov, A. V.; Alberghi, G. L.; Albert, J.; Albrand, S.; Alconada Verzini, M. J.; Aleksa, M.; Aleksandrov, I. N.; Alexa, C.; Alexander, G.; Alexopoulos, T.; Alhroob, M.; Ali, B.; Aliev, M.; Alimonti, G.; Alison, J.; Alkire, S. P.; Allbrooke, B. M. M.; Allen, B. W.; Allport, P. P.; Aloisio, A.; Alonso, A.; Alonso, F.; Alpigiani, C.; Alstaty, M.; Alvarez Gonzalez, B.; Álvarez Piqueras, D.; Alviggi, M. G.; Amadio, B. T.; Amako, K.; Amaral Coutinho, Y.; Amelung, C.; Amidei, D.; Amor Dos Santos, S. P.; Amorim, A.; Amoroso, S.; Amundsen, G.; Anastopoulos, C.; Ancu, L. S.; Andari, N.; Andeen, T.; Anders, C. F.; Anders, G.; Anders, J. K.; Anderson, K. J.; Andreazza, A.; Andrei, V.; Angelidakis, S.; Angelozzi, I.; Anger, P.; Angerami, A.; Anghinolfi, F.; Anisenkov, A. V.; Anjos, N.; Annovi, A.; Antel, C.; Antonelli, M.; Antonov, A.; Anulli, F.; Aoki, M.; Aperio Bella, L.; Arabidze, G.; Arai, Y.; Araque, J. P.; Arce, A. T. H.; Arduh, F. A.; Arguin, J.-F.; Argyropoulos, S.; Arik, M.; Armbruster, A. J.; Armitage, L. J.; Arnaez, O.; Arnold, H.; Arratia, M.; Arslan, O.; Artamonov, A.; Artoni, G.; Artz, S.; Asai, S.; Asbah, N.; Ashkenazi, A.; Åsman, B.; Asquith, L.; Assamagan, K.; Astalos, R.; Atkinson, M.; Atlay, N. B.; Augsten, K.; Avolio, G.; Axen, B.; Ayoub, M. K.; Azuelos, G.; Baak, M. A.; Baas, A. E.; Baca, M. J.; Bachacou, H.; Bachas, K.; Backes, M.; Backhaus, M.; Bagiacchi, P.; Bagnaia, P.; Bai, Y.; Baines, J. T.; Baker, O. K.; Baldin, E. M.; Balek, P.; Balestri, T.; Balli, F.; Balunas, W. K.; Banas, E.; Banerjee, Sw.; Bannoura, A. A. E.; Barak, L.; Barberio, E. L.; Barberis, D.; Barbero, M.; Barillari, T.; Barisits, M.-S.; Barklow, T.; Barlow, N.; Barnes, S. L.; Barnett, B. M.; Barnett, R. M.; Barnovska, Z.; Baroncelli, A.; Barone, G.; Barr, A. J.; Barranco Navarro, L.; Barreiro, F.; Barreiro Guimarães da Costa, J.; Bartoldus, R.; Barton, A. E.; Bartos, P.; Basalaev, A.; Bassalat, A.; Bates, R. L.; Batista, S. J.; Batley, J. R.; Battaglia, M.; Bauce, M.; Bauer, F.; Bawa, H. S.; Beacham, J. B.; Beattie, M. D.; Beau, T.; Beauchemin, P. H.; Bechtle, P.; Beck, H. P.; Becker, K.; Becker, M.; Beckingham, M.; Becot, C.; Beddall, A. J.; Beddall, A.; Bednyakov, V. A.; Bedognetti, M.; Bee, C. P.; Beemster, L. J.; Beermann, T. A.; Begel, M.; Behr, J. K.; Belanger-Champagne, C.; Bell, A. S.; Bella, G.; Bellagamba, L.; Bellerive, A.; Bellomo, M.; Belotskiy, K.; Beltramello, O.; Belyaev, N. L.; Benary, O.; Benchekroun, D.; Bender, M.; Bendtz, K.; Benekos, N.; Benhammou, Y.; Benhar Noccioli, E.; Benitez, J.; Benjamin, D. P.; Bensinger, J. R.; Bentvelsen, S.; Beresford, L.; Beretta, M.; Berge, D.; Bergeaas Kuutmann, E.; Berger, N.; Beringer, J.; Berlendis, S.; Bernard, N. R.; Bernius, C.; Bernlochner, F. U.; Berry, T.; Berta, P.; Bertella, C.; Bertoli, G.; Bertolucci, F.; Bertram, I. A.; Bertsche, C.; Bertsche, D.; Besjes, G. J.; Bessidskaia Bylund, O.; Bessner, M.; Besson, N.; Betancourt, C.; Bethani, A.; Bethke, S.; Bevan, A. J.; Bianchi, R. M.; Bianchini, L.; Bianco, M.; Biebel, O.; Biedermann, D.; Bielski, R.; Biesuz, N. V.; Biglietti, M.; Bilbao de Mendizabal, J.; Billoud, T. R. V.; Bilokon, H.; Bindi, M.; Binet, S.; Bingul, A.; Bini, C.; Biondi, S.; Bisanz, T.; Bjergaard, D. M.; Black, C. W.; Black, J. E.; Black, K. M.; Blackburn, D.; Blair, R. E.; Blanchard, J.-B.; Blazek, T.; Bloch, I.; Blocker, C.; Blum, W.; Blumenschein, U.; Blunier, S.; Bobbink, G. J.; Bobrovnikov, V. S.; Bocchetta, S. S.; Bocci, A.; Bock, C.; Boehler, M.; Boerner, D.; Bogaerts, J. A.; Bogavac, D.; Bogdanchikov, A. G.; Bohm, C.; Boisvert, V.; Bokan, P.; Bold, T.; Boldyrev, A. S.; Bomben, M.; Bona, M.; Boonekamp, M.; Borisov, A.; Borissov, G.; Bortfeldt, J.; Bortoletto, D.; Bortolotto, V.; Bos, K.; Boscherini, D.; Bosman, M.; Bossio Sola, J. D.; Boudreau, J.; Bouffard, J.; Bouhova-Thacker, E. V.; Boumediene, D.; Bourdarios, C.; Boutle, S. K.; Boveia, A.; Boyd, J.; Boyko, I. R.; Bracinik, J.; Brandt, A.; Brandt, G.; Brandt, O.; Bratzler, U.; Brau, B.; Brau, J. E.; Braun, H. M.; Breaden Madden, W. D.; Brendlinger, K.; Brennan, A. J.; Brenner, L.; Brenner, R.; Bressler, S.; Bristow, T. M.; Britton, D.; Britzger, D.; Brochu, F. M.; Brock, I.; Brock, R.; Brooijmans, G.; Brooks, T.; Brooks, W. K.; Brosamer, J.; Brost, E.; Broughton, J. H.; Bruckman de Renstrom, P. A.; Bruncko, D.; Bruneliere, R.; Bruni, A.; Bruni, G.; Bruni, L. S.; Brunt, Bh; Bruschi, M.; Bruscino, N.; Bryant, P.; Bryngemark, L.; Buanes, T.; Buat, Q.; Buchholz, P.; Buckley, A. G.; Budagov, I. A.; Buehrer, F.; Bugge, M. K.; Bulekov, O.; Bullock, D.; Burckhart, H.; Burdin, S.; Burgard, C. D.; Burghgrave, B.; Burka, K.; Burke, S.; Burmeister, I.; Burr, J. T. P.; Busato, E.; Büscher, D.; Büscher, V.; Bussey, P.; Butler, J. M.; Buttar, C. M.; Butterworth, J. M.; Butti, P.; Buttinger, W.; Buzatu, A.; Buzykaev, A. R.; Cabrera Urbán, S.; Caforio, D.; Cairo, V. M.; Cakir, O.; Calace, N.; Calafiura, P.; Calandri, A.; Calderini, G.; Calfayan, P.; Callea, G.; Caloba, L. P.; Calvente Lopez, S.; Calvet, D.; Calvet, S.; Calvet, T. P.; Camacho Toro, R.; Camarda, S.; Camarri, P.; Cameron, D.; Caminal Armadans, R.; Camincher, C.; Campana, S.; Campanelli, M.; Camplani, A.; Campoverde, A.; Canale, V.; Canepa, A.; Cano Bret, M.; Cantero, J.; Cantrill, R.; Cao, T.; Capeans Garrido, M. D. M.; Caprini, I.; Caprini, M.; Capua, M.; Caputo, R.; Carbone, R. M.; Cardarelli, R.; Cardillo, F.; Carli, I.; Carli, T.; Carlino, G.; Carminati, L.; Caron, S.; Carquin, E.; Carrillo-Montoya, G. D.; Carter, J. R.; Carvalho, J.; Casadei, D.; Casado, M. P.; Casolino, M.; Casper, D. W.; Castaneda-Miranda, E.; Castelijn, R.; Castelli, A.; Castillo Gimenez, V.; Castro, N. F.; Catinaccio, A.; Catmore, J. R.; Cattai, A.; Caudron, J.; Cavaliere, V.; Cavallaro, E.; Cavalli, D.; Cavalli-Sforza, M.; Cavasinni, V.; Ceradini, F.; Cerda Alberich, L.; Cerio, B. C.; Cerqueira, A. S.; Cerri, A.; Cerrito, L.; Cerutti, F.; Cerv, M.; Cervelli, A.; Cetin, S. A.; Chafaq, A.; Chakraborty, D.; Chan, S. K.; Chan, Y. L.; Chang, P.; Chapman, J. D.; Charlton, D. G.; Chatterjee, A.; Chau, C. C.; Chavez Barajas, C. A.; Che, S.; Cheatham, S.; Chegwidden, A.; Chekanov, S.; Chekulaev, S. V.; Chelkov, G. A.; Chelstowska, M. A.; Chen, C.; Chen, H.; Chen, K.; Chen, S.; Chen, S.; Chen, X.; Chen, Y.; Cheng, H. C.; Cheng, H. J.; Cheng, Y.; Cheplakov, A.; Cheremushkina, E.; Cherkaoui El Moursli, R.; Chernyatin, V.; Cheu, E.; Chevalier, L.; Chiarella, V.; Chiarelli, G.; Chiodini, G.; Chisholm, A. S.; Chitan, A.; Chizhov, M. V.; Choi, K.; Chomont, A. R.; Chouridou, S.; Chow, B. K. B.; Christodoulou, V.; Chromek-Burckhart, D.; Chudoba, J.; Chuinard, A. J.; Chwastowski, J. J.; Chytka, L.; Ciapetti, G.; Ciftci, A. K.; Cinca, D.; Cindro, V.; Cioara, I. A.; Ciocca, C.; Ciocio, A.; Cirotto, F.; Citron, Z. H.; Citterio, M.; Ciubancan, M.; Clark, A.; Clark, B. L.; Clark, M. R.; Clark, P. J.; Clarke, R. N.; Clement, C.; Coadou, Y.; Cobal, M.; Coccaro, A.; Cochran, J.; Colasurdo, L.; Cole, B.; Colijn, A. P.; Collot, J.; Colombo, T.; Compostella, G.; Conde Muiño, P.; Coniavitis, E.; Connell, S. H.; Connelly, I. A.; Consorti, V.; Constantinescu, S.; Conti, G.; Conventi, F.; Cooke, M.; Cooper, B. D.; Cooper-Sarkar, A. M.; Cormier, K. J. R.; Cornelissen, T.; Corradi, M.; Corriveau, F.; Corso-Radu, A.; Cortes-Gonzalez, A.; Cortiana, G.; Costa, G.; Costa, M. J.; Costanzo, D.; Cottin, G.; Cowan, G.; Cox, B. E.; Cranmer, K.; Crawley, S. J.; Cree, G.; Crépé-Renaudin, S.; Crescioli, F.; Cribbs, W. A.; Crispin Ortuzar, M.; Cristinziani, M.; Croft, V.; Crosetti, G.; Cueto, A.; Cuhadar Donszelmann, T.; Cummings, J.; Curatolo, M.; Cúth, J.; Czirr, H.; Czodrowski, P.; D'Amen, G.; D'Auria, S.; D'Onofrio, M.; da Cunha Sargedas de Sousa, M. J.; da Via, C.; Dabrowski, W.; Dado, T.; Dai, T.; Dale, O.; Dallaire, F.; Dallapiccola, C.; Dam, M.; Dandoy, J. R.; Dang, N. P.; Daniells, A. C.; Dann, N. S.; Danninger, M.; Dano Hoffmann, M.; Dao, V.; Darbo, G.; Darmora, S.; Dassoulas, J.; Dattagupta, A.; Davey, W.; David, C.; Davidek, T.; Davies, M.; Davison, P.; Dawe, E.; Dawson, I.; Daya-Ishmukhametova, R. K.; de, K.; de Asmundis, R.; de Benedetti, A.; de Castro, S.; de Cecco, S.; de Groot, N.; de Jong, P.; de la Torre, H.; de Lorenzi, F.; de Maria, A.; de Pedis, D.; de Salvo, A.; de Sanctis, U.; de Santo, A.; de Vivie de Regie, J. B.; Dearnaley, W. J.; Debbe, R.; Debenedetti, C.; Dedovich, D. V.; Dehghanian, N.; Deigaard, I.; Del Gaudio, M.; Del Peso, J.; Del Prete, T.; Delgove, D.; Deliot, F.; Delitzsch, C. M.; Dell'Acqua, A.; Dell'Asta, L.; Dell'Orso, M.; Della Pietra, M.; Della Volpe, D.; Delmastro, M.; Delsart, P. A.; Demarco, D. A.; Demers, S.; Demichev, M.; Demilly, A.; Denisov, S. P.; Denysiuk, D.; Derendarz, D.; Derkaoui, J. E.; Derue, F.; Dervan, P.; Desch, K.; Deterre, C.; Dette, K.; Deviveiros, P. O.; Dewhurst, A.; Dhaliwal, S.; di Ciaccio, A.; di Ciaccio, L.; di Clemente, W. K.; di Donato, C.; di Girolamo, A.; di Girolamo, B.; di Micco, B.; di Nardo, R.; di Simone, A.; di Sipio, R.; di Valentino, D.; Diaconu, C.; Diamond, M.; Dias, F. A.; Diaz, M. A.; Diehl, E. B.; Dietrich, J.; Diglio, S.; Dimitrievska, A.; Dingfelder, J.; Dita, P.; Dita, S.; Dittus, F.; Djama, F.; Djobava, T.; Djuvsland, J. I.; Do Vale, M. A. B.; Dobos, D.; Dobre, M.; Doglioni, C.; Dolejsi, J.; Dolezal, Z.; Donadelli, M.; Donati, S.; Dondero, P.; Donini, J.; Dopke, J.; Doria, A.; Dova, M. T.; Doyle, A. T.; Drechsler, E.; Dris, M.; Du, Y.; Duarte-Campderros, J.; Duchovni, E.; Duckeck, G.; Ducu, O. A.; Duda, D.; Dudarev, A.; Dudder, A. Chr.; Duffield, E. M.; Duflot, L.; Dührssen, M.; Dumancic, M.; Dunford, M.; Duran Yildiz, H.; Düren, M.; Durglishvili, A.; Duschinger, D.; Dutta, B.; Dyndal, M.; Eckardt, C.; Ecker, K. M.; Edgar, R. C.; Edwards, N. C.; Eifert, T.; Eigen, G.; Einsweiler, K.; Ekelof, T.; El Kacimi, M.; Ellajosyula, V.; Ellert, M.; Elles, S.; Ellinghaus, F.; Elliot, A. A.; Ellis, N.; Elmsheuser, J.; Elsing, M.; Emeliyanov, D.; Enari, Y.; Endner, O. C.; Ennis, J. S.; Erdmann, J.; Ereditato, A.; Ernis, G.; Ernst, J.; Ernst, M.; Errede, S.; Ertel, E.; Escalier, M.; Esch, H.; Escobar, C.; Esposito, B.; Etienvre, A. I.; Etzion, E.; Evans, H.; Ezhilov, A.; Fabbri, F.; Fabbri, L.; Facini, G.; Fakhrutdinov, R. M.; Falciano, S.; Falla, R. J.; Faltova, J.; Fang, Y.; Fanti, M.; Farbin, A.; Farilla, A.; Farina, C.; Farina, E. M.; Farooque, T.; Farrell, S.; Farrington, S. M.; Farthouat, P.; Fassi, F.; Fassnacht, P.; Fassouliotis, D.; Faucci Giannelli, M.; Favareto, A.; Fawcett, W. J.; Fayard, L.; Fedin, O. L.; Fedorko, W.; Feigl, S.; Feligioni, L.; Feng, C.; Feng, E. J.; Feng, H.; Fenyuk, A. B.; Feremenga, L.; Fernandez Martinez, P.; Fernandez Perez, S.; Ferrando, J.; Ferrari, A.; Ferrari, P.; Ferrari, R.; Ferreira de Lima, D. E.; Ferrer, A.; Ferrere, D.; Ferretti, C.; Ferretto Parodi, A.; Fiedler, F.; Filipčič, A.; Filipuzzi, M.; Filthaut, F.; Fincke-Keeler, M.; Finelli, K. D.; Fiolhais, M. C. N.; Fiorini, L.; Firan, A.; Fischer, A.; Fischer, C.; Fischer, J.; Fisher, W. C.; Flaschel, N.; Fleck, I.; Fleischmann, P.; Fletcher, G. T.; Fletcher, R. R. M.; Flick, T.; Floderus, A.; Flores Castillo, L. R.; Flowerdew, M. J.; Forcolin, G. T.; Formica, A.; Forti, A.; Foster, A. G.; Fournier, D.; Fox, H.; Fracchia, S.; Francavilla, P.; Franchini, M.; Francis, D.; Franconi, L.; Franklin, M.; Frate, M.; Fraternali, M.; Freeborn, D.; Fressard-Batraneanu, S. M.; Friedrich, F.; Froidevaux, D.; Frost, J. A.; Fukunaga, C.; Fullana Torregrosa, E.; Fusayasu, T.; Fuster, J.; Gabaldon, C.; Gabizon, O.; Gabrielli, A.; Gabrielli, A.; Gach, G. P.; Gadatsch, S.; Gadomski, S.; Gagliardi, G.; Gagnon, L. G.; Gagnon, P.; Galea, C.; Galhardo, B.; Gallas, E. J.; Gallop, B. J.; Gallus, P.; Galster, G.; Gan, K. K.; Gao, J.; Gao, Y.; Gao, Y. S.; Garay Walls, F. M.; García, C.; García Navarro, J. E.; Garcia-Sciveres, M.; Gardner, R. W.; Garelli, N.; Garonne, V.; Gascon Bravo, A.; Gasnikova, K.; Gatti, C.; Gaudiello, A.; Gaudio, G.; Gauthier, L.; Gavrilenko, I. L.; Gay, C.; Gaycken, G.; Gazis, E. N.; Gecse, Z.; Gee, C. N. P.; Geich-Gimbel, Ch.; Geisen, M.; Geisler, M. P.; Gemme, C.; Genest, M. H.; Geng, C.; Gentile, S.; Gentsos, C.; George, S.; Gerbaudo, D.; Gershon, A.; Ghasemi, S.; Ghazlane, H.; Ghneimat, M.; Giacobbe, B.; Giagu, S.; Giannetti, P.; Gibbard, B.; Gibson, S. M.; Gignac, M.; Gilchriese, M.; Gillam, T. P. S.; Gillberg, D.; Gilles, G.; Gingrich, D. M.; Giokaris, N.; Giordani, M. P.; Giorgi, F. M.; Giorgi, F. M.; Giraud, P. F.; Giromini, P.; Giugni, D.; Giuli, F.; Giuliani, C.; Giulini, M.; Gjelsten, B. K.; Gkaitatzis, S.; Gkialas, I.; Gkougkousis, E. L.; Gladilin, L. K.; Glasman, C.; Glatzer, J.; Glaysher, P. C. F.; Glazov, A.; Goblirsch-Kolb, M.; Godlewski, J.; Goldfarb, S.; Golling, T.; Golubkov, D.; Gomes, A.; Gonçalo, R.; Goncalves Pinto Firmino da Costa, J.; Gonella, G.; Gonella, L.; Gongadze, A.; González de La Hoz, S.; Gonzalez Parra, G.; Gonzalez-Sevilla, S.; Goossens, L.; Gorbounov, P. A.; Gordon, H. A.; Gorelov, I.; Gorini, B.; Gorini, E.; Gorišek, A.; Gornicki, E.; Goshaw, A. T.; Gössling, C.; Gostkin, M. I.; Goudet, C. R.; Goujdami, D.; Goussiou, A. G.; Govender, N.; Gozani, E.; Graber, L.; Grabowska-Bold, I.; Gradin, P. O. J.; Grafström, P.; Gramling, J.; Gramstad, E.; Grancagnolo, S.; Gratchev, V.; Gravila, P. M.; Gray, H. M.; Graziani, E.; Greenwood, Z. D.; Grefe, C.; Gregersen, K.; Gregor, I. M.; Grenier, P.; Grevtsov, K.; Griffiths, J.; Grillo, A. A.; Grimm, K.; Grinstein, S.; Gris, Ph.; Grivaz, J.-F.; Groh, S.; Grohs, J. P.; Gross, E.; Grosse-Knetter, J.; Grossi, G. C.; Grout, Z. J.; Guan, L.; Guan, W.; Guenther, J.; Guescini, F.; Guest, D.; Gueta, O.; Guido, E.; Guillemin, T.; Guindon, S.; Gul, U.; Gumpert, C.; Guo, J.; Guo, Y.; Gupta, R.; Gupta, S.; Gustavino, G.; Gutierrez, P.; Gutierrez Ortiz, N. G.; Gutschow, C.; Guyot, C.; Gwenlan, C.; Gwilliam, C. B.; Haas, A.; Haber, C.; Hadavand, H. K.; Haddad, N.; Hadef, A.; Hageböck, S.; Hajduk, Z.; Hakobyan, H.; Haleem, M.; Haley, J.; Halladjian, G.; Hallewell, G. D.; Hamacher, K.; Hamal, P.; Hamano, K.; Hamilton, A.; Hamity, G. N.; Hamnett, P. G.; Han, L.; Hanagaki, K.; Hanawa, K.; Hance, M.; Haney, B.; Hanisch, S.; Hanke, P.; Hanna, R.; Hansen, J. B.; Hansen, J. D.; Hansen, M. C.; Hansen, P. H.; Hara, K.; Hard, A. S.; Harenberg, T.; Hariri, F.; Harkusha, S.; Harrington, R. D.; Harrison, P. F.; Hartjes, F.; Hartmann, N. M.; Hasegawa, M.; Hasegawa, Y.; Hasib, A.; Hassani, S.; Haug, S.; Hauser, R.; Hauswald, L.; Havranek, M.; Hawkes, C. M.; Hawkings, R. J.; Hayakawa, D.; Hayden, D.; Hays, C. P.; Hays, J. M.; Hayward, H. S.; Haywood, S. J.; Head, S. J.; Heck, T.; Hedberg, V.; Heelan, L.; Heim, S.; Heim, T.; Heinemann, B.; Heinrich, J. J.; Heinrich, L.; Heinz, C.; Hejbal, J.; Helary, L.; Hellman, S.; Helsens, C.; Henderson, J.; Henderson, R. C. W.; Heng, Y.; Henkelmann, S.; Henriques Correia, A. M.; Henrot-Versille, S.; Herbert, G. H.; Herget, V.; Hernández Jiménez, Y.; Herten, G.; Hertenberger, R.; Hervas, L.; Hesketh, G. G.; Hessey, N. P.; Hetherly, J. W.; Hickling, R.; Higón-Rodriguez, E.; Hill, E.; Hill, J. C.; Hiller, K. H.; Hillier, S. J.; Hinchliffe, I.; Hines, E.; Hinman, R. R.; Hirose, M.; Hirschbuehl, D.; Hobbs, J.; Hod, N.; Hodgkinson, M. C.; Hodgson, P.; Hoecker, A.; Hoeferkamp, M. R.; Hoenig, F.; Hohn, D.; Holmes, T. R.; Homann, M.; Hong, T. M.; Hooberman, B. H.; Hopkins, W. H.; Horii, Y.; Horton, A. J.; Hostachy, J.-Y.; Hou, S.; Hoummada, A.; Howarth, J.; Hrabovsky, M.; Hristova, I.; Hrivnac, J.; Hryn'ova, T.; Hrynevich, A.; Hsu, C.; Hsu, P. J.; Hsu, S.-C.; Hu, D.; Hu, Q.; Hu, S.; Huang, Y.; Hubacek, Z.; Hubaut, F.; Huegging, F.; Huffman, T. B.; Hughes, E. W.; Hughes, G.; Huhtinen, M.; Huo, P.; Huseynov, N.; Huston, J.; Huth, J.; Iacobucci, G.; Iakovidis, G.; Ibragimov, I.; Iconomidou-Fayard, L.; Ideal, E.; Idrissi, Z.; Iengo, P.; Igonkina, O.; Iizawa, T.; Ikegami, Y.; Ikeno, M.; Ilchenko, Y.; Iliadis, D.; Ilic, N.; Ince, T.; Introzzi, G.; Ioannou, P.; Iodice, M.; Iordanidou, K.; Ippolito, V.; Ishijima, N.; Ishino, M.; Ishitsuka, M.; Ishmukhametov, R.; Issever, C.; Istin, S.; Ito, F.; Iturbe Ponce, J. M.; Iuppa, R.; Iwanski, W.; Iwasaki, H.; Izen, J. M.; Izzo, V.; Jabbar, S.; Jackson, B.; Jackson, P.; Jain, V.; Jakobi, K. B.; Jakobs, K.; Jakobsen, S.; Jakoubek, T.; Jamin, D. O.; Jana, D. K.; Jansen, E.; Jansky, R.; Janssen, J.; Janus, M.; Jarlskog, G.; Javadov, N.; Javå¯Rek, T.; Jeanneau, F.; Jeanty, L.; Jejelava, J.; Jeng, G.-Y.; Jennens, D.; Jenni, P.; Jeske, C.; Jézéquel, S.; Ji, H.; Jia, J.; Jiang, H.; Jiang, Y.; Jiggins, S.; Jimenez Pena, J.; Jin, S.; Jinaru, A.; Jinnouchi, O.; Jivan, H.; Johansson, P.; Johns, K. A.; Johnson, W. J.; Jon-And, K.; Jones, G.; Jones, R. W. L.; Jones, S.; Jones, T. J.; Jongmanns, J.; Jorge, P. M.; Jovicevic, J.; Ju, X.; Juste Rozas, A.; Köhler, M. K.; Kaczmarska, A.; Kado, M.; Kagan, H.; Kagan, M.; Kahn, S. J.; Kaji, T.; Kajomovitz, E.; Kalderon, C. W.; Kaluza, A.; Kama, S.; Kamenshchikov, A.; Kanaya, N.; Kaneti, S.; Kanjir, L.; Kantserov, V. A.; Kanzaki, J.; Kaplan, B.; Kaplan, L. S.; Kapliy, A.; Kar, D.; Karakostas, K.; Karamaoun, A.; Karastathis, N.; Kareem, M. J.; Karentzos, E.; Karnevskiy, M.; Karpov, S. N.; Karpova, Z. M.; Karthik, K.; Kartvelishvili, V.; Karyukhin, A. N.; Kasahara, K.; Kashif, L.; Kass, R. D.; Kastanas, A.; Kataoka, Y.; Kato, C.; Katre, A.; Katzy, J.; Kawagoe, K.; Kawamoto, T.; Kawamura, G.; Kazanin, V. F.; Keeler, R.; Kehoe, R.; Keller, J. S.; Kempster, J. J.; Kentaro, K.; Keoshkerian, H.; Kepka, O.; Kerševan, B. P.; Kersten, S.; Keyes, R. A.; Khader, M.; Khalil-Zada, F.; Khanov, A.; Kharlamov, A. G.; Khoo, T. J.; Khovanskiy, V.; Khramov, E.; Khubua, J.; Kido, S.; Kilby, C. R.; Kim, H. Y.; Kim, S. H.; Kim, Y. K.; Kimura, N.; Kind, O. M.; King, B. T.; King, M.; Kirk, J.; Kiryunin, A. E.; Kishimoto, T.; Kisielewska, D.; Kiss, F.; Kiuchi, K.; Kivernyk, O.; Kladiva, E.; Klein, M. H.; Klein, M.; Klein, U.; Kleinknecht, K.; Klimek, P.; Klimentov, A.; Klingenberg, R.; Klinger, J. A.; Klioutchnikova, T.; Kluge, E.-E.; Kluit, P.; Kluth, S.; Knapik, J.; Kneringer, E.; Knoops, E. B. F. G.; Knue, A.; Kobayashi, A.; Kobayashi, D.; Kobayashi, T.; Kobel, M.; Kocian, M.; Kodys, P.; Koehler, N. M.; Koffas, T.; Koffeman, E.; Koi, T.; Kolanoski, H.; Kolb, M.; Koletsou, I.; Komar, A. A.; Komori, Y.; Kondo, T.; Kondrashova, N.; Köneke, K.; König, A. C.; Kono, T.; Konoplich, R.; Konstantinidis, N.; Kopeliansky, R.; Koperny, S.; Köpke, L.; Kopp, A. K.; Korcyl, K.; Kordas, K.; Korn, A.; Korol, A. A.; Korolkov, I.; Korolkova, E. V.; Kortner, O.; Kortner, S.; Kosek, T.; Kostyukhin, V. V.; Kotwal, A.; Kourkoumeli-Charalampidi, A.; Kourkoumelis, C.; Kouskoura, V.; Kowalewska, A. B.; Kowalewski, R.; Kowalski, T. Z.; Kozakai, C.; Kozanecki, W.; Kozhin, A. S.; Kramarenko, V. A.; Kramberger, G.; Krasnopevtsev, D.; Krasny, M. W.; Krasznahorkay, A.; Kravchenko, A.; Kretz, M.; Kretzschmar, J.; Kreutzfeldt, K.; Krieger, P.; Krizka, K.; Kroeninger, K.; Kroha, H.; Kroll, J.; Kroseberg, J.; Krstic, J.; Kruchonak, U.; Krüger, H.; Krumnack, N.; Kruse, A.; Kruse, M. C.; Kruskal, M.; Kubota, T.; Kucuk, H.; Kuday, S.; Kuechler, J. T.; Kuehn, S.; Kugel, A.; Kuger, F.; Kuhl, A.; Kuhl, T.; Kukhtin, V.; Kukla, R.; Kulchitsky, Y.; Kuleshov, S.; Kuna, M.; Kunigo, T.; Kupco, A.; Kurashige, H.; Kurochkin, Y. A.; Kus, V.; Kuwertz, E. S.; Kuze, M.; Kvita, J.; Kwan, T.; Kyriazopoulos, D.; La Rosa, A.; La Rosa Navarro, J. L.; La Rotonda, L.; Lacasta, C.; Lacava, F.; Lacey, J.; Lacker, H.; Lacour, D.; Lacuesta, V. R.; Ladygin, E.; Lafaye, R.; Laforge, B.; Lagouri, T.; Lai, S.; Lammers, S.; Lampl, W.; Lançon, E.; Landgraf, U.; Landon, M. P. J.; Lanfermann, M. C.; Lang, V. S.; Lange, J. C.; Lankford, A. J.; Lanni, F.; Lantzsch, K.; Lanza, A.; Laplace, S.; Lapoire, C.; Laporte, J. F.; Lari, T.; Lasagni Manghi, F.; Lassnig, M.; Laurelli, P.; Lavrijsen, W.; Law, A. T.; Laycock, P.; Lazovich, T.; Lazzaroni, M.; Le, B.; Le Dortz, O.; Le Guirriec, E.; Le Quilleuc, E. P.; Leblanc, M.; Lecompte, T.; Ledroit-Guillon, F.; Lee, C. A.; Lee, S. C.; Lee, L.; Lefebvre, B.; Lefebvre, G.; Lefebvre, M.; Legger, F.; Leggett, C.; Lehan, A.; Lehmann Miotto, G.; Lei, X.; Leight, W. A.; Leisos, A.; Leister, A. G.; Leite, M. A. L.; Leitner, R.; Lellouch, D.; Lemmer, B.; Leney, K. J. C.; Lenz, T.; Lenzi, B.; Leone, R.; Leone, S.; Leonidopoulos, C.; Leontsinis, S.; Lerner, G.; Leroy, C.; Lesage, A. A. J.; Lester, C. G.; Levchenko, M.; Levêque, J.; Levin, D.; Levinson, L. J.; Levy, M.; Lewis, D.; Leyko, A. M.; Leyton, M.; Li, B.; Li, C.; Li, H.; Li, H. L.; Li, L.; Li, L.; Li, Q.; Li, S.; Li, X.; Li, Y.; Liang, Z.; Liberti, B.; Liblong, A.; Lichard, P.; Lie, K.; Liebal, J.; Liebig, W.; Limosani, A.; Lin, S. C.; Lin, T. H.; Lindquist, B. E.; Lionti, A. E.; Lipeles, E.; Lipniacka, A.; Lisovyi, M.; Liss, T. M.; Lister, A.; Litke, A. M.; Liu, B.; Liu, D.; Liu, H.; Liu, H.; Liu, J.; Liu, J. B.; Liu, K.; Liu, L.; Liu, M.; Liu, M.; Liu, Y. L.; Liu, Y.; Livan, M.; Lleres, A.; Llorente Merino, J.; Lloyd, S. L.; Lo Sterzo, F.; Lobodzinska, E.; Loch, P.; Lockman, W. S.; Loebinger, F. K.; Loevschall-Jensen, A. E.; Loew, K. M.; Loginov, A.; Lohse, T.; Lohwasser, K.; Lokajicek, M.; Long, B. A.; Long, J. D.; Long, R. E.; Longo, L.; Looper, K. A.; Lopes, L.; Lopez Mateos, D.; Lopez Paredes, B.; Lopez Paz, I.; Lopez Solis, A.; Lorenz, J.; Lorenzo Martinez, N.; Losada, M.; Lösel, P. J.; Lou, X.; Lounis, A.; Love, J.; Love, P. A.; Lu, H.; Lu, N.; Lubatti, H. J.; Luci, C.; Lucotte, A.; Luedtke, C.; Luehring, F.; Lukas, W.; Luminari, L.; Lundberg, O.; Lund-Jensen, B.; Luzi, P. M.; Lynn, D.; Lysak, R.; Lytken, E.; Lyubushkin, V.; Ma, H.; Ma, L. L.; Ma, Y.; Maccarrone, G.; Macchiolo, A.; MacDonald, C. M.; Maček, B.; Machado Miguens, J.; Madaffari, D.; Madar, R.; Maddocks, H. J.; Mader, W. F.; Madsen, A.; Maeda, J.; Maeland, S.; Maeno, T.; Maevskiy, A.; Magradze, E.; Mahlstedt, J.; Maiani, C.; Maidantchik, C.; Maier, A. A.; Maier, T.; Maio, A.; Majewski, S.; Makida, Y.; Makovec, N.; Malaescu, B.; Malecki, Pa.; Maleev, V. P.; Malek, F.; Mallik, U.; Malon, D.; Malone, C.; Maltezos, S.; Malyukov, S.; Mamuzic, J.; Mancini, G.; Mandelli, B.; Mandelli, L.; Mandić, I.; Maneira, J.; Manhaes de Andrade Filho, L.; Manjarres Ramos, J.; Mann, A.; Manousos, A.; Mansoulie, B.; Mansour, J. D.; Mantifel, R.; Mantoani, M.; Manzoni, S.; Mapelli, L.; Marceca, G.; March, L.; Marchiori, G.; Marcisovsky, M.; Marjanovic, M.; Marley, D. E.; Marroquim, F.; Marsden, S. P.; Marshall, Z.; Marti-Garcia, S.; Martin, B.; Martin, T. A.; Martin, V. J.; Martin Dit Latour, B.; Martinez, M.; Martinez Outschoorn, V. I.; Martin-Haugh, S.; Martoiu, V. S.; Martyniuk, A. C.; Marx, M.; Marzin, A.; Masetti, L.; Mashimo, T.; Mashinistov, R.; Masik, J.; Maslennikov, A. L.; Massa, I.; Massa, L.; Mastrandrea, P.; Mastroberardino, A.; Masubuchi, T.; Mättig, P.; Mattmann, J.; Maurer, J.; Maxfield, S. J.; Maximov, D. A.; Mazini, R.; Mazza, S. M.; Mc Fadden, N. C.; Mc Goldrick, G.; Mc Kee, S. P.; McCarn, A.; McCarthy, R. L.; McCarthy, T. G.; McClymont, L. I.; McDonald, E. F.; McFayden, J. A.; McHedlidze, G.; McMahon, S. J.; McPherson, R. A.; Medinnis, M.; Meehan, S.; Mehlhase, S.; Mehta, A.; Meier, K.; Meineck, C.; Meirose, B.; Melini, D.; Mellado Garcia, B. R.; Melo, M.; Meloni, F.; Mengarelli, A.; Menke, S.; Meoni, E.; Mergelmeyer, S.; Mermod, P.; Merola, L.; Meroni, C.; Merritt, F. S.; Messina, A.; Metcalfe, J.; Mete, A. S.; Meyer, C.; Meyer, C.; Meyer, J.-P.; Meyer, J.; Meyer Zu Theenhausen, H.; Miano, F.; Middleton, R. P.; Miglioranzi, S.; Mijović, L.; Mikenberg, G.; Mikestikova, M.; Mikuž, M.; Milesi, M.; Milic, A.; Miller, D. W.; Mills, C.; Milov, A.; Milstead, D. A.; Minaenko, A. A.; Minami, Y.; Minashvili, I. A.; Mincer, A. I.; Mindur, B.; Mineev, M.; Ming, Y.; Mir, L. M.; Mistry, K. P.; Mitani, T.; Mitrevski, J.; Mitsou, V. A.; Miucci, A.; Miyagawa, P. S.; Mjörnmark, J. U.; Moa, T.; Mochizuki, K.; Mohapatra, S.; Molander, S.; Moles-Valls, R.; Monden, R.; Mondragon, M. C.; Mönig, K.; Monk, J.; Monnier, E.; Montalbano, A.; Montejo Berlingen, J.; Monticelli, F.; Monzani, S.; Moore, R. W.; Morange, N.; Moreno, D.; Moreno Llácer, M.; Morettini, P.; Mori, D.; Mori, T.; Morii, M.; Morinaga, M.; Morisbak, V.; Moritz, S.; Morley, A. K.; Mornacchi, G.; Morris, J. D.; Mortensen, S. S.; Morvaj, L.; Mosidze, M.; Moss, J.; Motohashi, K.; Mount, R.; Mountricha, E.; Mouraviev, S. V.; Moyse, E. J. W.; Muanza, S.; Mudd, R. D.; Mueller, F.; Mueller, J.; Mueller, R. S. P.; Mueller, T.; Muenstermann, D.; Mullen, P.; Mullier, G. A.; Munoz Sanchez, F. J.; Murillo Quijada, J. A.; Murray, W. J.; Musheghyan, H.; Muškinja, M.; Myagkov, A. G.; Myska, M.; Nachman, B. P.; Nackenhorst, O.; Nagai, K.; Nagai, R.; Nagano, K.; Nagasaka, Y.; Nagata, K.; Nagel, M.; Nagy, E.; Nairz, A. M.; Nakahama, Y.; Nakamura, K.; Nakamura, T.; Nakano, I.; Namasivayam, H.; Naranjo Garcia, R. F.; Narayan, R.; Narrias Villar, D. I.; Naryshkin, I.; Naumann, T.; Navarro, G.; Nayyar, R.; Neal, H. A.; Nechaeva, P. Yu.; Neep, T. J.; Negri, A.; Negrini, M.; Nektarijevic, S.; Nellist, C.; Nelson, A.; Nemecek, S.; Nemethy, P.; Nepomuceno, A. A.; Nessi, M.; Neubauer, M. S.; Neumann, M.; Neves, R. M.; Nevski, P.; Newman, P. R.; Nguyen, D. H.; Nguyen Manh, T.; Nickerson, R. B.; Nicolaidou, R.; Nielsen, J.; Nikiforov, A.; Nikolaenko, V.; Nikolic-Audit, I.; Nikolopoulos, K.; Nilsen, J. K.; Nilsson, P.; Ninomiya, Y.; Nisati, A.; Nisius, R.; Nobe, T.; Nomachi, M.; Nomidis, I.; Nooney, T.; Norberg, S.; Nordberg, M.; Norjoharuddeen, N.; Novgorodova, O.; Nowak, S.; Nozaki, M.; Nozka, L.; Ntekas, K.; Nurse, E.; Nuti, F.; O'Grady, F.; O'Neil, D. C.; O'Rourke, A. A.; O'Shea, V.; Oakham, F. G.; Oberlack, H.; Obermann, T.; Ocariz, J.; Ochi, A.; Ochoa, I.; Ochoa-Ricoux, J. P.; Oda, S.; Odaka, S.; Ogren, H.; Oh, A.; Oh, S. H.; Ohm, C. C.; Ohman, H.; Oide, H.; Okawa, H.; Okumura, Y.; Okuyama, T.; Olariu, A.; Oleiro Seabra, L. F.; Olivares Pino, S. A.; Oliveira Damazio, D.; Olszewski, A.; Olszowska, J.; Onofre, A.; Onogi, K.; Onyisi, P. U. E.; Oreglia, M. J.; Oren, Y.; Orestano, D.; Orlando, N.; Orr, R. S.; Osculati, B.; Ospanov, R.; Otero Y Garzon, G.; Otono, H.; Ouchrif, M.; Ould-Saada, F.; Ouraou, A.; Oussoren, K. P.; Ouyang, Q.; Owen, M.; Owen, R. E.; Ozcan, V. E.; Ozturk, N.; Pachal, K.; Pacheco Pages, A.; Pacheco Rodriguez, L.; Padilla Aranda, C.; Pagáčová, M.; Pagan Griso, S.; Paige, F.; Pais, P.; Pajchel, K.; Palacino, G.; Palazzo, S.; Palestini, S.; Palka, M.; Pallin, D.; Panagiotopoulou, E. St.; Pandini, C. E.; Panduro Vazquez, J. G.; Pani, P.; Panitkin, S.; Pantea, D.; Paolozzi, L.; Papadopoulou, Th. D.; Papageorgiou, K.; Paramonov, A.; Paredes Hernandez, D.; Parker, A. J.; Parker, M. A.; Parker, K. A.; Parodi, F.; Parsons, J. A.; Parzefall, U.; Pascuzzi, V. R.; Pasqualucci, E.; Passaggio, S.; Pastore, Fr.; Pásztor, G.; Pataraia, S.; Pater, J. R.; Pauly, T.; Pearce, J.; Pearson, B.; Pedersen, L. E.; Pedersen, M.; Pedraza Lopez, S.; Pedro, R.; Peleganchuk, S. V.; Penc, O.; Peng, C.; Peng, H.; Penwell, J.; Peralva, B. S.; Perego, M. M.; Perepelitsa, D. V.; Perez Codina, E.; Perini, L.; Pernegger, H.; Perrella, S.; Peschke, R.; Peshekhonov, V. D.; Peters, K.; Peters, R. F. Y.; Petersen, B. A.; Petersen, T. C.; Petit, E.; Petridis, A.; Petridou, C.; Petroff, P.; Petrolo, E.; Petrov, M.; Petrucci, F.; Pettersson, N. E.; Peyaud, A.; Pezoa, R.; Phillips, P. W.; Piacquadio, G.; Pianori, E.; Picazio, A.; Piccaro, E.; Piccinini, M.; Pickering, M. A.; Piegaia, R.; Pilcher, J. E.; Pilkington, A. D.; Pin, A. W. J.; Pinamonti, M.; Pinfold, J. L.; Pingel, A.; Pires, S.; Pirumov, H.; Pitt, M.; Plazak, L.; Pleier, M.-A.; Pleskot, V.; Plotnikova, E.; Plucinski, P.; Pluth, D.; Poettgen, R.; Poggioli, L.; Pohl, D.; Polesello, G.; Poley, A.; Policicchio, A.; Polifka, R.; Polini, A.; Pollard, C. S.; Polychronakos, V.; Pommès, K.; Pontecorvo, L.; Pope, B. G.; Popeneciu, G. A.; Poppleton, A.; Pospisil, S.; Potamianos, K.; Potrap, I. N.; Potter, C. J.; Potter, C. T.; Poulard, G.; Poveda, J.; Pozdnyakov, V.; Pozo Astigarraga, M. E.; Pralavorio, P.; Pranko, A.; Prell, S.; Price, D.; Price, L. E.; Primavera, M.; Prince, S.; Prokofiev, K.; Prokoshin, F.; Protopopescu, S.; Proudfoot, J.; Przybycien, M.; Puddu, D.; Purohit, M.; Puzo, P.; Qian, J.; Qin, G.; Qin, Y.; Quadt, A.; Quayle, W. B.; Queitsch-Maitland, M.; Quilty, D.; Raddum, S.; Radeka, V.; Radescu, V.; Radhakrishnan, S. K.; Radloff, P.; Rados, P.; Ragusa, F.; Rahal, G.; Raine, J. A.; Rajagopalan, S.; Rammensee, M.; Rangel-Smith, C.; Ratti, M. G.; Rauscher, F.; Rave, S.; Ravenscroft, T.; Ravinovich, I.; Raymond, M.; Read, A. L.; Readioff, N. P.; Reale, M.; Rebuzzi, D. M.; Redelbach, A.; Redlinger, G.; Reece, R.; Reeves, K.; Rehnisch, L.; Reichert, J.; Reisin, H.; Rembser, C.; Ren, H.; Rescigno, M.; Resconi, S.; Rezanova, O. L.; Reznicek, P.; Rezvani, R.; Richter, R.; Richter, S.; Richter-Was, E.; Ricken, O.; Ridel, M.; Rieck, P.; Riegel, C. J.; Rieger, J.; Rifki, O.; Rijssenbeek, M.; Rimoldi, A.; Rimoldi, M.; Rinaldi, L.; Ristić, B.; Ritsch, E.; Riu, I.; Rizatdinova, F.; Rizvi, E.; Rizzi, C.; Robertson, S. H.; Robichaud-Veronneau, A.; Robinson, D.; Robinson, J. E. M.; Robson, A.; Roda, C.; Rodina, Y.; Rodriguez Perez, A.; Rodriguez Rodriguez, D.; Roe, S.; Rogan, C. S.; Røhne, O.; Romaniouk, A.; Romano, M.; Romano Saez, S. M.; Romero Adam, E.; Rompotis, N.; Ronzani, M.; Roos, L.; Ros, E.; Rosati, S.; Rosbach, K.; Rose, P.; Rosenthal, O.; Rosien, N.-A.; Rossetti, V.; Rossi, E.; Rossi, L. P.; Rosten, J. H. N.; Rosten, R.; Rotaru, M.; Roth, I.; Rothberg, J.; Rousseau, D.; Royon, C. R.; Rozanov, A.; Rozen, Y.; Ruan, X.; Rubbo, F.; Rudolph, M. S.; Rühr, F.; Ruiz-Martinez, A.; Rurikova, Z.; Rusakovich, N. A.; Ruschke, A.; Russell, H. L.; Rutherfoord, J. P.; Ruthmann, N.; Ryabov, Y. F.; Rybar, M.; Rybkin, G.; Ryu, S.; Ryzhov, A.; Rzehorz, G. F.; Saavedra, A. F.; Sabato, G.; Sacerdoti, S.; Sadrozinski, H. F.-W.; Sadykov, R.; Safai Tehrani, F.; Saha, P.; Sahinsoy, M.; Saimpert, M.; Saito, T.; Sakamoto, H.; Sakurai, Y.; Salamanna, G.; Salamon, A.; Salazar Loyola, J. E.; Salek, D.; Sales de Bruin, P. H.; Salihagic, D.; Salnikov, A.; Salt, J.; Salvatore, D.; Salvatore, F.; Salvucci, A.; Salzburger, A.; Sammel, D.; Sampsonidis, D.; Sanchez, A.; Sánchez, J.; Sanchez Martinez, V.; Sandaker, H.; Sandbach, R. L.; Sander, H. G.; Sandhoff, M.; Sandoval, C.; Sandstroem, R.; Sankey, D. P. C.; Sannino, M.; Sansoni, A.; Santoni, C.; Santonico, R.; Santos, H.; Santoyo Castillo, I.; Sapp, K.; Sapronov, A.; Saraiva, J. G.; Sarrazin, B.; Sasaki, O.; Sasaki, Y.; Sato, K.; Sauvage, G.; Sauvan, E.; Savage, G.; Savard, P.; Savic, N.; Sawyer, C.; Sawyer, L.; Saxon, J.; Sbarra, C.; Sbrizzi, A.; Scanlon, T.; Scannicchio, D. A.; Scarcella, M.; Scarfone, V.; Schaarschmidt, J.; Schacht, P.; Schachtner, B. M.; Schaefer, D.; Schaefer, L.; Schaefer, R.; Schaeffer, J.; Schaepe, S.; Schaetzel, S.; Schäfer, U.; Schaffer, A. C.; Schaile, D.; Schamberger, R. D.; Scharf, V.; Schegelsky, V. A.; Scheirich, D.; Schernau, M.; Schiavi, C.; Schier, S.; Schillo, C.; Schioppa, M.; Schlenker, S.; Schmidt-Sommerfeld, K. R.; Schmieden, K.; Schmitt, C.; Schmitt, S.; Schmitz, S.; Schneider, B.; Schnoor, U.; Schoeffel, L.; Schoening, A.; Schoenrock, B. D.; Schopf, E.; Schott, M.; Schovancova, J.; Schramm, S.; Schreyer, M.; Schuh, N.; Schulte, A.; Schultens, M. J.; Schultz-Coulon, H.-C.; Schulz, H.; Schumacher, M.; Schumm, B. A.; Schune, Ph.; Schwartzman, A.; Schwarz, T. A.; Schweiger, H.; Schwemling, Ph.; Schwienhorst, R.; Schwindling, J.; Schwindt, T.; Sciolla, G.; Scuri, F.; Scutti, F.; Searcy, J.; Seema, P.; Seidel, S. C.; Seiden, A.; Seifert, F.; Seixas, J. M.; Sekhniaidze, G.; Sekhon, K.; Sekula, S. J.; Seliverstov, D. M.; Semprini-Cesari, N.; Serfon, C.; Serin, L.; Serkin, L.; Sessa, M.; Seuster, R.; Severini, H.; Sfiligoj, T.; Sforza, F.; Sfyrla, A.; Shabalina, E.; Shaikh, N. W.; Shan, L. Y.; Shang, R.; Shank, J. T.; Shapiro, M.; Shatalov, P. B.; Shaw, K.; Shaw, S. M.; Shcherbakova, A.; Shehu, C. Y.; Sherwood, P.; Shi, L.; Shimizu, S.; Shimmin, C. O.; Shimojima, M.; Shiyakova, M.; Shmeleva, A.; Shoaleh Saadi, D.; Shochet, M. J.; Shojaii, S.; Shrestha, S.; Shulga, E.; Shupe, M. A.; Sicho, P.; Sickles, A. M.; Sidebo, P. E.; Sidiropoulou, O.; Sidorov, D.; Sidoti, A.; Siegert, F.; Sijacki, Dj.; Silva, J.; Silverstein, S. B.; Simak, V.; Simic, Lj.; Simion, S.; Simioni, E.; Simmons, B.; Simon, D.; Simon, M.; Sinervo, P.; Sinev, N. B.; Sioli, M.; Siragusa, G.; Sivoklokov, S. Yu.; Sjölin, J.; Skinner, M. B.; Skottowe, H. P.; Skubic, P.; Slater, M.; Slavicek, T.; Slawinska, M.; Sliwa, K.; Slovak, R.; Smakhtin, V.; Smart, B. H.; Smestad, L.; Smiesko, J.; Smirnov, S. Yu.; Smirnov, Y.; Smirnova, L. N.; Smirnova, O.; Smith, M. N. K.; Smith, R. W.; Smizanska, M.; Smolek, K.; Snesarev, A. A.; Snyder, S.; Sobie, R.; Socher, F.; Soffer, A.; Soh, D. A.; Sokhrannyi, G.; Solans Sanchez, C. A.; Solar, M.; Soldatov, E. Yu.; Soldevila, U.; Solodkov, A. A.; Soloshenko, A.; Solovyanov, O. V.; Solovyev, V.; Sommer, P.; Son, H.; Song, H. Y.; Sood, A.; Sopczak, A.; Sopko, V.; Sorin, V.; Sosa, D.; Sotiropoulou, C. L.; Soualah, R.; Soukharev, A. M.; South, D.; Sowden, B. C.; Spagnolo, S.; Spalla, M.; Spangenberg, M.; Spanò, F.; Sperlich, D.; Spettel, F.; Spighi, R.; Spigo, G.; Spiller, L. A.; Spousta, M.; St. Denis, R. D.; Stabile, A.; Stamen, R.; Stamm, S.; Stanecka, E.; Stanek, R. W.; Stanescu, C.; Stanescu-Bellu, M.; Stanitzki, M. M.; Stapnes, S.; Starchenko, E. A.; Stark, G. H.; Stark, J.; Staroba, P.; Starovoitov, P.; Stärz, S.; Staszewski, R.; Steinberg, P.; Stelzer, B.; Stelzer, H. J.; Stelzer-Chilton, O.; Stenzel, H.; Stewart, G. A.; Stillings, J. A.; Stockton, M. C.; Stoebe, M.; Stoicea, G.; Stolte, P.; Stonjek, S.; Stradling, A. R.; Straessner, A.; Stramaglia, M. E.; Strandberg, J.; Strandberg, S.; Strandlie, A.; Strauss, M.; Strizenec, P.; Ströhmer, R.; Strom, D. M.; Stroynowski, R.; Strubig, A.; Stucci, S. A.; Stugu, B.; Styles, N. A.; Su, D.; Su, J.; Suchek, S.; Sugaya, Y.; Suk, M.; Sulin, V. V.; Sultansoy, S.; Sumida, T.; Sun, S.; Sun, X.; Sundermann, J. E.; Suruliz, K.; Susinno, G.; Sutton, M. R.; Suzuki, S.; Svatos, M.; Swiatlowski, M.; Sykora, I.; Sykora, T.; Ta, D.; Taccini, C.; Tackmann, K.; Taenzer, J.; Taffard, A.; Tafirout, R.; Taiblum, N.; Takai, H.; Takashima, R.; Takeshita, T.; Takubo, Y.; Talby, M.; Talyshev, A. A.; Tan, K. G.; Tanaka, J.; Tanaka, M.; Tanaka, R.; Tanaka, S.; Tannenwald, B. B.; Tapia Araya, S.; Tapprogge, S.; Tarem, S.; Tartarelli, G. F.; Tas, P.; Tasevsky, M.; Tashiro, T.; Tassi, E.; Tavares Delgado, A.; Tayalati, Y.; Taylor, A. C.; Taylor, G. N.; Taylor, P. T. E.; Taylor, W.; Teischinger, F. A.; Teixeira-Dias, P.; Temming, K. K.; Temple, D.; Ten Kate, H.; Teng, P. K.; Teoh, J. J.; Tepel, F.; Terada, S.; Terashi, K.; Terron, J.; Terzo, S.; Testa, M.; Teuscher, R. J.; Theveneaux-Pelzer, T.; Thomas, J. P.; Thomas-Wilsker, J.; Thompson, E. N.; Thompson, P. D.; Thompson, A. S.; Thomsen, L. A.; Thomson, E.; Thomson, M.; Tibbetts, M. J.; Ticse Torres, R. E.; Tikhomirov, V. O.; Tikhonov, Yu. A.; Timoshenko, S.; Tipton, P.; Tisserant, S.; Todome, K.; Todorov, T.; Todorova-Nova, S.; Tojo, J.; Tokár, S.; Tokushuku, K.; Tolley, E.; Tomlinson, L.; Tomoto, M.; Tompkins, L.; Toms, K.; Tong, B.; Torrence, E.; Torres, H.; Torró Pastor, E.; Toth, J.; Touchard, F.; Tovey, D. R.; Trefzger, T.; Tricoli, A.; Trigger, I. M.; Trincaz-Duvoid, S.; Tripiana, M. F.; Trischuk, W.; Trocmé, B.; Trofymov, A.; Troncon, C.; Trottier-McDonald, M.; Trovatelli, M.; Truong, L.; Trzebinski, M.; Trzupek, A.; Tseng, J. C.-L.; Tsiareshka, P. V.; Tsipolitis, G.; Tsirintanis, N.; Tsiskaridze, S.; Tsiskaridze, V.; Tskhadadze, E. G.; Tsui, K. M.; Tsukerman, I. I.; Tsulaia, V.; Tsuno, S.; Tsybychev, D.; Tu, Y.; Tudorache, A.; Tudorache, V.; Tuna, A. N.; Tupputi, S. A.; Turchikhin, S.; Turecek, D.; Turgeman, D.; Turra, R.; Turvey, A. J.; Tuts, P. M.; Tyndel, M.; Ucchielli, G.; Ueda, I.; Ughetto, M.; Ukegawa, F.; Unal, G.; Undrus, A.; Unel, G.; Ungaro, F. C.; Unno, Y.; Unverdorben, C.; Urban, J.; Urquijo, P.; Urrejola, P.; Usai, G.; Usanova, A.; Vacavant, L.; Vacek, V.; Vachon, B.; Valderanis, C.; Valdes Santurio, E.; Valencic, N.; Valentinetti, S.; Valero, A.; Valery, L.; Valkar, S.; Valls Ferrer, J. A.; van den Wollenberg, W.; van der Deijl, P. C.; van der Graaf, H.; van Eldik, N.; van Gemmeren, P.; van Nieuwkoop, J.; van Vulpen, I.; van Woerden, M. C.; Vanadia, M.; Vandelli, W.; Vanguri, R.; Vaniachine, A.; Vankov, P.; Vardanyan, G.; Vari, R.; Varnes, E. W.; Varol, T.; Varouchas, D.; Vartapetian, A.; Varvell, K. E.; Vasquez, J. G.; Vazeille, F.; Vazquez Schroeder, T.; Veatch, J.; Veeraraghavan, V.; Veloce, L. M.; Veloso, F.; Veneziano, S.; Ventura, A.; Venturi, M.; Venturi, N.; Venturini, A.; Vercesi, V.; Verducci, M.; Verkerke, W.; Vermeulen, J. C.; Vest, A.; Vetterli, M. C.; Viazlo, O.; Vichou, I.; Vickey, T.; Vickey Boeriu, O. E.; Viehhauser, G. H. A.; Viel, S.; Vigani, L.; Villa, M.; Villaplana Perez, M.; Vilucchi, E.; Vincter, M. G.; Vinogradov, V. B.; Vittori, C.; Vivarelli, I.; Vlachos, S.; Vlasak, M.; Vogel, M.; Vokac, P.; Volpi, G.; Volpi, M.; von der Schmitt, H.; von Toerne, E.; Vorobel, V.; Vorobev, K.; Vos, M.; Voss, R.; Vossebeld, J. H.; Vranjes, N.; Vranjes Milosavljevic, M.; Vrba, V.; Vreeswijk, M.; Vuillermet, R.; Vukotic, I.; Vykydal, Z.; Wagner, P.; Wagner, W.; Wahlberg, H.; Wahrmund, S.; Wakabayashi, J.; Walder, J.; Walker, R.; Walkowiak, W.; Wallangen, V.; Wang, C.; Wang, C.; Wang, F.; Wang, H.; Wang, H.; Wang, J.; Wang, J.; Wang, K.; Wang, R.; Wang, S. M.; Wang, T.; Wang, T.; Wang, W.; Wang, X.; Wanotayaroj, C.; Warburton, A.; Ward, C. P.; Wardrope, D. R.; Washbrook, A.; Watkins, P. M.; Watson, A. T.; Watson, M. F.; Watts, G.; Watts, S.; Waugh, B. M.; Webb, S.; Weber, M. S.; Weber, S. W.; Webster, J. S.; Weidberg, A. R.; Weinert, B.; Weingarten, J.; Weiser, C.; Weits, H.; Wells, P. S.; Wenaus, T.; Wengler, T.; Wenig, S.; Wermes, N.; Werner, M.; Werner, M. D.; Werner, P.; Wessels, M.; Wetter, J.; Whalen, K.; Whallon, N. L.; Wharton, A. M.; White, A.; White, M. J.; White, R.; Whiteson, D.; Wickens, F. J.; Wiedenmann, W.; Wielers, M.; Wienemann, P.; Wiglesworth, C.; Wiik-Fuchs, L. A. M.; Wildauer, A.; Wilk, F.; Wilkens, H. G.; Williams, H. H.; Williams, S.; Willis, C.; Willocq, S.; Wilson, J. A.; Wingerter-Seez, I.; Winklmeier, F.; Winston, O. J.; Winter, B. T.; Wittgen, M.; Wittkowski, J.; Wolf, T. M. H.; Wolter, M. W.; Wolters, H.; Worm, S. D.; Wosiek, B. K.; Wotschack, J.; Woudstra, M. J.; Wozniak, K. W.; Wu, M.; Wu, M.; Wu, S. L.; Wu, X.; Wu, Y.; Wyatt, T. R.; Wynne, B. M.; Xella, S.; Xu, D.; Xu, L.; Yabsley, B.; Yacoob, S.; Yamaguchi, D.; Yamaguchi, Y.; Yamamoto, A.; Yamamoto, S.; Yamanaka, T.; Yamauchi, K.; Yamazaki, Y.; Yan, Z.; Yang, H.; Yang, H.; Yang, Y.; Yang, Z.; Yao, W.-M.; Yap, Y. C.; Yasu, Y.; Yatsenko, E.; Yau Wong, K. H.; Ye, J.; Ye, S.; Yeletskikh, I.; Yen, A. L.; Yildirim, E.; Yorita, K.; Yoshida, R.; Yoshihara, K.; Young, C.; Young, C. J. S.; Youssef, S.; Yu, D. R.; Yu, J.; Yu, J. M.; Yu, J.; Yuan, L.; Yuen, S. P. Y.; Yusuff, I.; Zabinski, B.; Zaidan, R.; Zaitsev, A. M.; Zakharchuk, N.; Zalieckas, J.; Zaman, A.; Zambito, S.; Zanello, L.; Zanzi, D.; Zeitnitz, C.; Zeman, M.; Zemla, A.; Zeng, J. C.; Zeng, Q.; Zengel, K.; Zenin, O.; Ženiš, T.; Zerwas, D.; Zhang, D.; Zhang, F.; Zhang, G.; Zhang, H.; Zhang, J.; Zhang, L.; Zhang, R.; Zhang, R.; Zhang, X.; Zhang, Z.; Zhao, X.; Zhao, Y.; Zhao, Z.; Zhemchugov, A.; Zhong, J.; Zhou, B.; Zhou, C.; Zhou, L.; Zhou, L.; Zhou, M.; Zhou, N.; Zhu, C. G.; Zhu, H.; Zhu, J.; Zhu, Y.; Zhuang, X.; Zhukov, K.; Zibell, A.; Zieminska, D.; Zimine, N. I.; Zimmermann, C.; Zimmermann, S.; Zinonos, Z.; Zinser, M.; Ziolkowski, M.; Živković, L.; Zobernig, G.; Zoccoli, A.; Zur Nedden, M.; Zwalinski, L.; Atlas Collaboration

2016-10-01

This Letter presents a measurement of the inelastic proton-proton cross section using 60 μb -1 of p p collisions at a center-of-mass energy √{s } of 13 TeV with the ATLAS detector at the LHC. Inelastic interactions are selected using rings of plastic scintillators in the forward region (2.07 <|η |<3.86 ) of the detector. A cross section of 68.1 ±1.4 mb is measured in the fiducial region ξ =MX2/s >10-6, where MX is the larger invariant mass of the two hadronic systems separated by the largest rapidity gap in the event. In this ξ range the scintillators are highly efficient. For diffractive events this corresponds to cases where at least one proton dissociates to a system with MX>13 GeV . The measured cross section is compared with a range of theoretical predictions. When extrapolated to the full phase space, a cross section of 78.1 ±2.9 mb is measured, consistent with the inelastic cross section increasing with center-of-mass energy.

Generic short-time propagation of sharp-boundaries wave packets

NASA Astrophysics Data System (ADS)

Granot, E.; Marchewka, A.

2005-11-01

A general solution to the "shutter" problem is presented. The propagation of an arbitrary initially bounded wave function is investigated, and the general solution for any such function is formulated. It is shown that the exact solution can be written as an expression that depends only on the values of the function (and its derivatives) at the boundaries. In particular, it is shown that at short times (t << 2mx2/hbar, where x is the distance to the boundaries) the wave function propagation depends only on the wave function's values (or its derivatives) at the boundaries of the region. Finally, we generalize these findings to a non-singular wave function (i.e., for wave packets with finite-width boundaries) and suggest an experimental verification.

Dexamethasone treatment decreases replication of viral hemorrhagic septicemia virus in Epithelioma papulosum cyprini cells.

PubMed

Kim, Min Sun; Lee, Su Jin; Choi, Seung Hyuk; Kang, Yue Jai; Kim, Ki Hong

2017-05-01

The expression of Mx1 in EPC cells after treatment with poly(I:C) or infection with viral hemorrhagic septicemia virus (VHSV) was significantly suppressed by treatment with dexamethasone. However, the titer of VHSV did not increase but instead decreased after dexamethasone treatment. This suggests that dexamethasone not only downregulates type I IFN but also affects certain factors that are necessary for VHSV replication. An important effect of HSP90 on replication of RNA viruses and downregulation of HSP90 by glucocorticoids have been reported. In this study, dexamethasone downregulated HSP90α expression in EPC cells that were stimulated with poly(I:C) or infected with VHSV. Furthermore, cells treated with an HSP90 inhibitor, geldanamycin, showed significantly decreased titers of VHSV, suggesting that HSP90 may be an important host component involved in VHSV replication, and HSP90 inhibition might be one of the causes for the observed reduction in viral titer caused by dexamethasone treatment.

Hydrogen storage of Mg1-xMxH2 (M = Ti, V, Fe) studied using first-principles calculations

NASA Astrophysics Data System (ADS)

Bhihi, M.; Lakhal, M.; Labrim, H.; Benyoussef, A.; A. El, Kenz; Mounkachi, O.; K. Hlil, E.

2012-09-01

In this work, the hydrogen storage properties of the Mg-based hydrides, i.e., Mg1-x Mx H2 (M = Ti, V, Fe, 0 <= x <= 0.1), are studied using the Korringa—Kohn—Rostoker (KKR) calculation with the coherent potential approximation (CPA). In particular, the nature and concentrations of the alloying elements and their effects are studied. Moreover, the material's stability and hydrogen storage thermodynamic properties are discussed. In particular, we find that the stability and the temperature of desorption decrease without significantly affecting the storage capacities.

MX Siting Investigation. Geotechnical Evaluation. Aggregate Resources Study, Whirlwind Valley, Utah.

DTIC Science & Technology

1980-06-06

Boulders The estimated percentage of boulders and and/or cobbles is based on an appraisal of the en - Cobbles, tire deposit. Cobbles have an average dia ...UNCLASSIFIED FN-TR- 3 ?-E N MEEOEEEE- -EE E-NE-- B~~~ 8 111___ ~ I 25 1.25 1.4I’* I1.6 MICROCOPY RESOLUI ION 1[1 ,1 LIIARI MX SITING INVESTIGATION...REPORT NUMBER 2. GOVT ACCESSION NO,. 3 . RECIPIENT’S CATALOG NUMBEREd --r,-’ 3 - e 4. TITLE (and Subttle) 5 LJSI" P Lt" - - " . TYPE OF REPORT & PERIOD

International Towing Tank Conference ITTC Symbols and Terminology List. Final Version 1996

DTIC Science & Technology

1997-05-13

law, no person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB...of water-plane aft of mWA midship 2 A AWF Area of water-plane forward mWF of midship 2 A AX Area of maximum transverse mX section 2 B B Beam or...design water line B BWL Maximum moulded breadth mWL at design water line B BX Breadth, moulded of mX maximum section area at design water line d,T T

Toxic interaction between fumonisin B1 and moniliformin for cardiac lesions in Japanese quail.

PubMed

Sharma, Deepa; Asrani, R K; Ledoux, D R; Rottinghaus, G E; Gupta, V K

2012-09-01

This study examined the effects of fumonisin B1 (FB1) and moniliformin (M) on the heart of Japanese quail (Coturnix coturnix japonica). Three hundred and ninety day-old Japanese quail were randomly divided into four groups: 1) FB1 alone (FX), 2) M alone (MX), 3) FB1 and M (FM), and 4) chick mash alone (CX). We used three pen replicates of 35 quail per pen in groups FX, MX, and FM and three pen replicates of 25 quail per pen in group CX. Gross and microscopic changes in the heart were studied in nine birds (three birds per replicate) from each group at weekly intervals up to 28 days postfeeding (DPF). Ultrastructural changes were studied in the heart of three birds (one bird per replicate) from each group at 21 DPF. Thinning of the heart was the only significant gross lesion in group FX. In contrast, mild-to-severe cardiomegaly was a significant finding in groups MX and FM throughout the study. Microscopically, thinning of cardiomyocytes was evident at 7 DPF in group FX. In addition to the hypertrophy of cardiomyocytes evident as early as 7 DPF, myocardial karyomegaly, nuclear hyperchromasia, and myofibril disarray exhibiting a wavy pattern were more pronounced at 28 DPF in group MX. Similar but more severe lesions were observed in the FM combination group that included myocardial hemorrhages, vacuolar changes, hypertrophy of cardiomyocytes, focal myocarditis, and loss of myofibrils cross-striations. Via transmission electron microscopy, the maximum effect of FB1 toxicity was observed on mitochondria. In addition to an increase in the number of mitochondria, the mitochondria seemed invariably swollen and pleomorphic, although the outer membrane was intact, and the membrane cristae were usually distinct. Myofibrils seemed thinner, without much disruption in their architecture. Large numbers of vacuolar bodies of irregular size, both in the sarcoplasm and in between the myofibrils, were conspicuous in group FX. In contrast to group FX, the increase in number of mitochondria resulted in widespread separation of muscle fibers in group MX. In addition, the mitochondria were swollen and varied from round to oval to slightly elongated and occasionally forked, and vacuolation was rarely noticed in group MX. In the FM combination group, a significant increase in the number of mitochondria caused muscle fibers to look much thinner and assume a wavy pattern. We conclude that the effect of M on the heart is exaggerated in the presence of FB1. Although the overall interactive effect of FB1 and M was less than additive, the interactive effects between the two toxins for cardiac lesions were greater than additive to synergistic up to the second week, raising serious concerns on early age exposure to a combination of these two mycotoxins.

RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond.

PubMed

Gama-Castro, Socorro; Salgado, Heladia; Santos-Zavaleta, Alberto; Ledezma-Tejeida, Daniela; Muñiz-Rascado, Luis; García-Sotelo, Jair Santiago; Alquicira-Hernández, Kevin; Martínez-Flores, Irma; Pannier, Lucia; Castro-Mondragón, Jaime Abraham; Medina-Rivera, Alejandra; Solano-Lira, Hilda; Bonavides-Martínez, César; Pérez-Rueda, Ernesto; Alquicira-Hernández, Shirley; Porrón-Sotelo, Liliana; López-Fuentes, Alejandra; Hernández-Koutoucheva, Anastasia; Del Moral-Chávez, Víctor; Rinaldi, Fabio; Collado-Vides, Julio

2016-01-04

RegulonDB (http://regulondb.ccg.unam.mx) is one of the most useful and important resources on bacterial gene regulation,as it integrates the scattered scientific knowledge of the best-characterized organism, Escherichia coli K-12, in a database that organizes large amounts of data. Its electronic format enables researchers to compare their results with the legacy of previous knowledge and supports bioinformatics tools and model building. Here, we summarize our progress with RegulonDB since our last Nucleic Acids Research publication describing RegulonDB, in 2013. In addition to maintaining curation up-to-date, we report a collection of 232 interactions with small RNAs affecting 192 genes, and the complete repertoire of 189 Elementary Genetic Sensory-Response units (GENSOR units), integrating the signal, regulatory interactions, and metabolic pathways they govern. These additions represent major progress to a higher level of understanding of regulated processes. We have updated the computationally predicted transcription factors, which total 304 (184 with experimental evidence and 120 from computational predictions); we updated our position-weight matrices and have included tools for clustering them in evolutionary families. We describe our semiautomatic strategy to accelerate curation, including datasets from high-throughput experiments, a novel coexpression distance to search for 'neighborhood' genes to known operons and regulons, and computational developments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Unraveling the effect of genes and environment in the transmission of parental antisocial behavior to children’s conduct disturbance, depression, and hyperactivity

PubMed Central

Silberg, Judy L.; Maes, Hermine; Eaves, Lindon J.

2011-01-01

Background A critical issue in devising effective interventions for the treatment of children’s behavioral and emotional problems rests upon identifying genuine family environmental factors that place children at risk. In most twin and family studies, environmental factors are confounded with both direct genetic risk from parents and the indirect effect of genes influencing parents’ ability to provide an optimal rearing environment. The present study was undertaken to determine whether parental psychopathology, specifically parental antisocial behavior (ASP), is a genuine environmental risk factor for juvenile conduct disturbance, depression, and hyperactivity, or whether the association between parental ASP and children’s behavioral and emotional problems can be explained as a secondary consequence of the intergenerational transmission of genetic factors Methods An extended Children of Twins design (E-COT) comprised of data collected on 2,674 adult female and male twins, their spouses, and 2,454 of their children was used to test whether genetic and/or family environmental factors best accounted for the association between parental antisocial behavior children’s behavioral problems. An age matched sample of 2,826 juvenile twin pairs from the Virginia Twin Study of Adolescent Behavioral Development (VTSABD) was also included to examine developmental differences in gene expression by partitioning child specific transmissible effects from those effects that persist into adulthood. The fit of alternative models was evaluated using the statistical program Mx Results We found distinct patterns of transmission between parental antisocial behavior and juvenile conduct, depression, and hyperactivity. Genetic and family environmental factors accounted for the resemblance between parents’ ASP and children’s conduct disturbance. Family environmental factors alone explained the association between child depression and parental ASP, and the impact of parental ASP on hyperactivity was entirely genetic. Conclusions These findings underscore differences in the contribution of genetic and environmental factors on the patterns of association between parental antisocial behavior and juvenile psychopathology, having important clinical implications for the prevention and amelioration of child behavioral and emotional problems. PMID:22141405

Unraveling the effect of genes and environment in the transmission of parental antisocial behavior to children's conduct disturbance, depression and hyperactivity.

PubMed

Silberg, Judy L; Maes, Hermine; Eaves, Lindon J

2012-06-01

  A critical issue in devising effective interventions for the treatment of children's behavioral and emotional problems identifying genuine family environmental factors that place children at risk. In most twin and family studies, environmental factors are confounded with both direct genetic risk from parents and the indirect effect of genes influencing parents' ability to provide an optimal rearing environment. The present study was undertaken to determine whether parental psychopathology, specifically parental antisocial behavior (ASP), is a genuine environmental risk factor for juvenile conduct disturbance, depression and hyperactivity, or whether the association between parental ASP and children's behavioral and emotional problems can be explained as a secondary consequence of the intergenerational transmission of genetic factors.   An extended children of twins design comprised of data collected on 2,674 adult female and male twins, their spouses, and 2,454 of their children was used to test whether genetic and/or family environmental factors best accounted for the association between parental antisocial behavior and children's behavioral problems. An age-matched sample of 2,826 juvenile twin pairs from the Virginia Twin Study of Adolescent Behavioral Development was also included to examine developmental differences in gene expression by partitioning child-specific transmissible effects from those effects that persist into adulthood. The fit of alternative models was evaluated using the statistical program Mx.   We found distinct patterns of transmission between parental antisocial behavior and juvenile conduct, depression and hyperactivity. Genetic and family environmental factors accounted for the resemblance between parents' ASP and children's conduct disturbance. Family environmental factors alone explained the association between child depression and parental ASP, and the impact of parental ASP on hyperactivity was entirely genetic.   These findings underscore differences in the contribution of genetic and environmental factors on the patterns of association between parental antisocial behavior and juvenile psychopathology, having important clinical implications for the prevention and amelioration of child behavioral and emotional problems. © 2011 The Authors. Journal of Child Psychology and Psychiatry © 2011 Association for Child and Adolescent Mental Health.

System Vaccinology for the Evaluation of Influenza Vaccine Safety by Multiplex Gene Detection of Novel Biomarkers in a Preclinical Study and Batch Release Test

PubMed Central

Mizukami, Takuo; Momose, Haruka; Kuramitsu, Madoka; Takizawa, Kazuya; Araki, Kumiko; Furuhata, Keiko; Ishii, Ken J.; Hamaguchi, Isao; Yamaguchi, Kazunari

2014-01-01

Vaccines are beneficial and universal tools to prevent infectious disease. Thus, safety of vaccines is strictly evaluated in the preclinical phase of trials and every vaccine batch must be tested by the National Control Laboratories according to the guidelines published by each country. Despite many vaccine production platforms and methods, animal testing for safety evaluation is unchanged thus far. We recently developed a systems biological approach to vaccine safety evaluation where identification of specific biomarkers in a rat pre-clinical study evaluated the safety of vaccines for pandemic H5N1 influenza including Irf7, Lgals9, Lgalsbp3, Cxcl11, Timp1, Tap2, Psmb9, Psme1, Tapbp, C2, Csf1, Mx2, Zbp1, Ifrd1, Trafd1, Cxcl9, β2m, Npc1, Ngfr and Ifi47. The current study evaluated whether these 20 biomarkers could evaluate the safety, batch-to-batch and manufacturer-to-manufacturer consistency of seasonal trivalent influenza vaccine using a multiplex gene detection system. When we evaluated the influenza HA vaccine (HAv) from four different manufactures, the biomarker analysis correlated to findings from conventional animal use tests, such as abnormal toxicity test. In addition, sensitivity of toxicity detection and differences in HAvs were higher and more accurate than with conventional methods. Despite a slight decrease in body weight caused by HAv from manufacturer B that was not statistically significant, our results suggest that HAv from manufacturer B is significantly different than the other HAvs tested with regard to Lgals3bp, Tapbp, Lgals9, Irf7 and C2 gene expression in rat lungs. Using the biomarkers confirmed in this study, we predicted batch-to-batch consistency and safety of influenza vaccines within 2 days compared with the conventional safety test, which takes longer. These biomarkers will facilitate the future development of new influenza vaccines and provide an opportunity to develop in vitro methods of evaluating batch-to-batch consistency and vaccine safety as an alternative to animal testing. PMID:25010690

Magnetic Flux Rope Identification and Characterization from Observationally Driven Solar Coronal Models

NASA Astrophysics Data System (ADS)

Lowder, Chris; Yeates, Anthony

2017-09-01

Formed through magnetic field shearing and reconnection in the solar corona, magnetic flux ropes are structures of twisted magnetic field, threaded along an axis. Their evolution and potential eruption are of great importance for space weather. Here we describe a new methodology for the automated detection of flux ropes in simulated magnetic fields, utilizing field-line helicity. Our Flux Rope Detection and Organization (FRoDO) code, which measures the magnetic flux and helicity content of pre-erupting flux ropes over time, as well as detecting eruptions, is publicly available. As a first demonstration, the code is applied to the output from a time-dependent magnetofrictional model, spanning 1996 June 15-2014 February 10. Over this period, 1561 erupting and 2099 non-erupting magnetic flux ropes are detected, tracked, and characterized. For this particular model data, erupting flux ropes have a mean net helicity magnitude of 2.66× {10}43 Mx2, while non-erupting flux ropes have a significantly lower mean of 4.04× {10}42 Mx2, although there is overlap between the two distributions. Similarly, the mean unsigned magnetic flux for erupting flux ropes is 4.04× {10}21 Mx, significantly higher than the mean value of 7.05× {10}20 Mx for non-erupting ropes. These values for erupting flux ropes are within the broad range expected from observational and theoretical estimates, although the eruption rate in this particular model is lower than that of observed coronal mass ejections. In the future, the FRoDO code will prove to be a valuable tool for assessing the performance of different non-potential coronal simulations and comparing them with observations.

Role of non-metallic atoms in enhancing the catalytic activity of nickel-based compounds for hydrogen evolution reaction† †Electronic supplementary information (ESI) available: Experimental details, structure and morphology characterization, electrochemical characterizations, supplementary figures and data. See DOI: 10.1039/c7sc04851c

PubMed Central

Zheng, Xingqun; Peng, Lishan; Yang, Na; Yang, Yanjun; Li, Jing; Wang, Jianchuan

2018-01-01

The transition-metal compounds (MX) have gained wide attention as hydrogen evolution reaction (HER) electrocatalysts; however, the interaction between the non-metallic atom (X) and the metal atom (M) in MX, and the role of X in the enhanced catalytic activity of MX, are still ambiguous. In this work, we constructed a simple model [X/Ni(100)] to decipher the contribution of X towards enhancing the catalytic activity of NiX, which allows us to accurately predict the trend in HER catalytic activity of NiX based on the easily accessible physico-chemical characteristics of X. Theoretical calculations showed that the electronegativity (χX) and the principle quantum number (nX) of X are two important descriptors for evaluating and predicting the HER catalytic activity of NiX catalysts effectively. X atoms in the VIA group can enhance the HER activity of X/Ni(100) more significantly than those in the second period due to the large χX or nX. At a relatively low X coverage, the S/Ni(100) possesses the best HER activity among all of the discussed X/Ni(100) models, and the optimum surface S : Ni atomic ratio is about 22–33%. Further experiments demonstrated that the Ni–Ni3S2 catalyst with a surface S : Ni atomic ratio of 28.9% exhibits the best catalytic activity and lowest charge transfer resistance. The trend in catalytic activity of NiX with differing X offers a new possible strategy to exploit MX materials and design new active catalysts rationally. PMID:29675227

Enzymatic and non-enzymatic comparison of two different industrial tomato (Solanum lycopersicum) varieties against drought stress.

PubMed

Çelik, Özge; Ayan, Alp; Atak, Çimen

2017-12-01

The aim of this study is to compare the tolerance mechanisms of two industrial tomato varieties (X5671R and 5MX12956) under drought stress. 14 days-old tomato seedlings were subjected to 7 days-long drought stress by withholding irrigation. The effects of stress were determined by enzymatic and non-enzymatic parameters. The physiological damages were evaluated via lipid peroxidation ratio, total protein content, relative water content, chlorophyll content and proline accumulation. Enzymatic responses were determined by biochemical analysis and electrophoresis of SOD, APX, POX and CAT enzymes. Relative water contents of X5671R and 5MX12956 varieties at 7th day of drought were decreased to 8.4 and 12.2%, respectively. Applied drought decreased all photosynthetic pigments of X5671R and 5MX12956 varieties during the treatment period significantly comparing to the Day 0 as the control. Total protein content, lipid peroxidation and proline accumulation presented increased values in both varieties in accordance with the increasing stress intensity. According to lipid peroxidation analysis, 5MX12956 tomato variety was found more drought sensitive than X5671R variety. Antioxidative enzyme activities showed increases in both varieties as a response to drought stress, although CAT and APX activities presented decrease on the 7th day of applied stress. 7 days long drought stress differentially altered POX, APX and SOD isozyme patterns. Same POX bands were observed in both varieties with different band intensities. However, main isozyme pattern differences were obtained for SOD and APX. APX1, Fe-SOD and Cu/Zn-SOD2 isozyme bands should be evaluated to define their main role in the tolerance mechanism of both tomato varieties.

STATISTICAL PROPERTIES OF SOLAR ACTIVE REGIONS OBTAINED FROM AN AUTOMATIC DETECTION SYSTEM AND THE COMPUTATIONAL BIASES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Jie; Wang Yuming; Liu Yang, E-mail: jzhang7@gmu.ed

We have developed a computational software system to automate the process of identifying solar active regions (ARs) and quantifying their physical properties based on high-resolution synoptic magnetograms constructed from Michelson Doppler Imager (MDI; on board the SOHO spacecraft) images from 1996 to 2008. The system, based on morphological analysis and intensity thresholding, has four functional modules: (1) intensity segmentation to obtain kernel pixels, (2) a morphological opening operation to erase small kernels, which effectively remove ephemeral regions and magnetic fragments in decayed ARs, (3) region growing to extend kernels to full AR size, and (4) the morphological closing operation tomore » merge/group regions with a small spatial gap. We calculate the basic physical parameters of the 1730 ARs identified by the auto system. The mean and maximum magnetic flux of individual ARs are 1.67 x 10{sup 22} Mx and 1.97 x 10{sup 23} Mx, while that per Carrington rotation are 1.83 x 10{sup 23} Mx and 6.96 x 10{sup 23} Mx, respectively. The frequency distributions of ARs with respect to both area size and magnetic flux follow a log-normal function. However, when we decrease the detection thresholds and thus increase the number of detected ARs, the frequency distribution largely follows a power-law function. We also find that the equatorward drifting motion of the AR bands with solar cycle can be described by a linear function superposed with intermittent reverse driftings. The average drifting speed over one solar cycle is 1{sup o}.83{+-}0{sup o}.04 yr{sup -1} or 0.708 {+-} 0.015 m s{sup -1}.« less

Evolution of electronic structure as a function of layer thickness in group-VIB transition metal dichalcogenides: emergence of localization prototypes.

PubMed

Zhang, Lijun; Zunger, Alex

2015-02-11

Layered group-VIB transition metal dichalcogenides (with the formula of MX2) are known to show a transition from an indirect band gap in the thick n-monolayer stack (MX2)n to a direct band gap at the n = 1 monolayer limit, thus converting the system into an optically active material suitable for a variety of optoelectronic applications. The origin of this transition has been attributed predominantly to quantum confinement effect at reduced n. Our analysis of the evolution of band-edge energies and wave functions as a function of n using ab initio density functional calculations including the long-range dispersion interaction reveals (i) the indirect-to-direct band gap transformation is triggered not only by (kinetic-energy controlled) quantum confinement but also by (potential-energy controlled) band repulsion and localization. On its own, neither of the two effects can explain by itself the energy evolution of the band-edge states relevant to the transformation; (ii) when n decreased, there emerge distinct regimes with characteristic localization prototypes of band-edge states deciding the optical response of the system. They are distinguished by the real-space direct/indirect in combination with momentum-space direct/indirect nature of electron and hole states and give rise to distinct types of charge distribution of the photoexcited carriers that control excitonic behaviors; (iii) the various regimes associated with different localization prototypes are predicted to change with modification of cations and anions in the complete MX2 (M = Cr, Mo, W and X = S, Se, Te) series. These results offer new insight into understanding the excitonic properties (e.g., binding energy, lifetime etc.) of multiple layered MX2 and their heterostructures.

Short-term complementary and alternative medicine on quality of life in women with fibromyalgia.

PubMed

Dias, Paulo Araujo; Guimarães, André Brito Bastos; Albuquerque, Andrea de Oliveira; de Oliveira, Karoline Lucas; Cavalcante, Maria Luzete Costa; Guimarães, Sergio Botelho

2016-01-01

Fibromyalgia (FMS) is a syndrome characterized by chronic widespread musculoskeletal pain, whose etiology is not completely understood. Different therapeutic approaches have been used with inconsistent results. This observation does not invalidate the continued search for alternative treatments aimed at improving quality of life (QoL) in FMS. This study compared three classical traditional Chinese medicine (TCM) therapies: acupuncture (AC), electroacupuncture (EAC) and moxibustion (MX) in the management of pain and promotion of QoL in FMS patients. A preliminary, group-assigned, comparative study enrolled 30 women, mean age (46.90±9.24) years (range 20-60 years), who met the 1990 American College of Rheumatology criteria for FMS diagnosis and a pain-pressure threshold (PPT) < 4 kg/cm(2). The study was conducted in a teaching tertiary-care medical institution from May 2010 through April 2012. AC, EAC and MX were delivered for 30 min, once a week, for 8 weeks, bilaterally at Neiguan (PC6), Hegu (LI4), Yanglingquan (GB34), Sanyinjiao (SP6) and Taichong (LR3) acupoints. Each week, immediately before treatment and after treatment, subjects were tested for PPTs, Wong-Baker Faces Pain Scale (WBFPS; for pain intensity) and Medical Outcomes Study 36-item Short Form Health Survey (SF-36: for QoL). There was no significant improvement in pain or reduction of tender points in any of the groups studied, at the end of the 8th session. Significant improvement of QoL was perceived in vitality (after AC treatment) and in mental health (after EAC and MX treatments). TCM therapies (AC, EAC and MX) promoted an improvement in the QoL in two areas (vitality and mental health) in FMS women. Further large-scale clinical trials are required to confirm this effect.

Force system generated by elastic archwires with vertical V bends: a three-dimensional analysis.

PubMed

Upadhyay, Madhur; Shah, Raja; Peterson, Donald; Asaki, Takafumi; Yadav, Sumit; Agarwal, Sachin

2017-04-01

Our previous understanding of V-bend mechanics is primarily from two-dimensional (2D) analysis of archwire bracket interactions in the second order. These analyses do not take into consideration the three-dimensional (3D) nature of orthodontic appliances involving the third order. To quantify the force system generated in a 3D two bracket set up involving the molar and incisors with vertical V-bends. Maxillary molar and incisor brackets were arranged in a dental arch form and attached to load cells capable of measuring forces and moments in all three planes (x, y, and z) of space. Symmetrical V-bends (right and left sides) were placed at 11 different locations along rectangular beta-titanium archwires of various sizes at an angle of 150degrees. Each wire was evaluated for the 11 bend positions. Specifically, the vertical forces (Fz) and anterio-posterior moments (Mx) were analysed. Descriptive statistics were used to interpret the results. With increasing archwire size, Fz and Mx increased at the two brackets (P < 0.05). The vertical forces were linear and symmetric in nature, increasing in magnitude as the bends moved closer to either bracket. The Mx curves were asymmetric and non-linear displaying higher magnitudes for molar bracket. As the bends were moved closer to either bracket a distinct flattening of the incisor Mx curve was noted, implying no change in its magnitude. This article provides critical information on V-bend mechanics involving second order and third order archwire-bracket interactions. A model for determining this force system is described that might allow for easier translation to actual clinical practice. © The Author 2016. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com

Measurement of diffractive dissociation cross sections in p p collisions at √{s }=7 TeV

NASA Astrophysics Data System (ADS)

Khachatryan, V.; Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Bergauer, T.; Dragicevic, M.; Erö, J.; Fabjan, C.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; Kiesenhofer, W.; Knünz, V.; Krammer, M.; Krätschmer, I.; Liko, D.; Mikulec, I.; Rabady, D.; Rahbaran, B.; Rohringer, H.; Schöfbeck, R.; Strauss, J.; Taurok, A.; Treberer-Treberspurg, W.; Waltenberger, W.; Wulz, C.-E.; Mossolov, V.; Shumeiko, N.; Suarez Gonzalez, J.; Alderweireldt, S.; Bansal, M.; Bansal, S.; Cornelis, T.; De Wolf, E. A.; Janssen, X.; Knutsson, A.; Luyckx, S.; Ochesanu, S.; Rougny, R.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Blekman, F.; Blyweert, S.; D'Hondt, J.; Daci, N.; Heracleous, N.; Keaveney, J.; Lowette, S.; Maes, M.; Olbrechts, A.; Python, Q.; Strom, D.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Onsem, G. P.; Villella, I.; Caillol, C.; Clerbaux, B.; De Lentdecker, G.; Dobur, D.; Favart, L.; Gay, A. P. R.; Grebenyuk, A.; Léonard, A.; Mohammadi, A.; Perniè, L.; Reis, T.; Seva, T.; Thomas, L.; Vander Velde, C.; Vanlaer, P.; Wang, J.; Zenoni, F.; Adler, V.; Beernaert, K.; Benucci, L.; Cimmino, A.; Costantini, S.; Crucy, S.; Dildick, S.; Fagot, A.; Garcia, G.; Mccartin, J.; Ocampo Rios, A. A.; Ryckbosch, D.; Salva Diblen, S.; Sigamani, M.; Strobbe, N.; Thyssen, F.; Tytgat, M.; Yazgan, E.; Zaganidis, N.; Basegmez, S.; Beluffi, C.; Bruno, G.; Castello, R.; Caudron, A.; Ceard, L.; Da Silveira, G. G.; Delaere, C.; du Pree, T.; Favart, D.; Forthomme, L.; Giammanco, A.; Hollar, J.; Jafari, A.; Jez, P.; Komm, M.; Lemaitre, V.; Nuttens, C.; Pagano, D.; Perrini, L.; Pin, A.; Piotrzkowski, K.; Popov, A.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Vizan Garcia, J. M.; Beliy, N.; Caebergs, T.; Daubie, E.; Hammad, G. H.; Aldá Júnior, W. L.; Alves, G. A.; Brito, L.; Correa Martins Junior, M.; Dos Reis Martins, T.; Mora Herrera, C.; Pol, M. E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Malbouisson, H.; Matos Figueiredo, D.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santaolalla, J.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Vilela Pereira, A.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Novaes, S. F.; Padula, Sandra S.; Aleksandrov, A.; Genchev, V.; Iaydjiev, P.; Marinov, A.; Piperov, S.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Tcholakov, V.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Hadjiiska, R.; Kozhuharov, V.; Litov, L.; Pavlov, B.; Petkov, P.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Du, R.; Jiang, C. H.; Plestina, R.; Tao, J.; Wang, Z.; Asawatangtrakuldee, C.; Ban, Y.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Zou, W.; Avila, C.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; Gomez Moreno, B.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Polic, D.; Puljak, I.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Kadija, K.; Luetic, J.; Mekterovic, D.; Sudic, L.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Bodlak, M.; Finger, M.; Finger, M.; Assran, Y.; Ellithi Kamel, A.; Mahmoud, M. A.; Radi, A.; Kadastik, M.; Murumaa, M.; Raidal, M.; Tiko, A.; Eerola, P.; Fedi, G.; Voutilainen, M.; Härkönen, J.; Karimäki, V.; Kinnunen, R.; Kortelainen, M. J.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Mäenpää, T.; Peltola, T.; Tuominen, E.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Locci, E.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Baffioni, S.; Beaudette, F.; Busson, P.; Charlot, C.; Dahms, T.; Dalchenko, M.; Dobrzynski, L.; Filipovic, N.; Florent, A.; Granier de Cassagnac, R.; Mastrolorenzo, L.; Miné, P.; Mironov, C.; Naranjo, I. N.; Nguyen, M.; Ochando, C.; Paganini, P.; Regnard, S.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Veelken, C.; Yilmaz, Y.; Zabi, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Chabert, E. C.; Collard, C.; Conte, E.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Goetzmann, C.; Le Bihan, A.-C.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Beaupere, N.; Boudoul, G.; Bouvier, E.; Brochet, S.; Carrillo Montoya, C. A.; Chasserat, J.; Chierici, R.; Contardo, D.; Depasse, P.; El Mamouni, H.; Fan, J.; Fay, J.; Gascon, S.; Gouzevitch, M.; Ille, B.; Kurca, T.; Lethuillier, M.; Mirabito, L.; Perries, S.; Ruiz Alvarez, J. D.; Sabes, D.; Sgandurra, L.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Xiao, H.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Bontenackels, M.; Edelhoff, M.; Feld, L.; Hindrichs, O.; Klein, K.; Ostapchuk, A.; Perieanu, A.; Raupach, F.; Sammet, J.; Schael, S.; Weber, H.; Wittmer, B.; Zhukov, V.; Ata, M.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Erdmann, M.; Fischer, R.; Güth, A.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Klingebiel, D.; Knutzen, S.; Kreuzer, P.; Merschmeyer, M.; Meyer, A.; Millet, P.; Olschewski, M.; Padeken, K.; Papacz, P.; Reithler, H.; Schmitz, S. A.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Weber, M.; Cherepanov, V.; Erdogan, Y.; Flügge, G.; Geenen, H.; Geisler, M.; Haj Ahmad, W.; Heister, A.; Hoehle, F.; Kargoll, B.; Kress, T.; Kuessel, Y.; Künsken, A.; Lingemann, J.; Nowack, A.; Nugent, I. M.; Perchalla, L.; Pooth, O.; Stahl, A.; Asin, I.; Bartosik, N.; Behr, J.; Behrenhoff, W.; Behrens, U.; Bell, A. J.; Bergholz, M.; Bethani, A.; Borras, K.; Burgmeier, A.; Cakir, A.; Calligaris, L.; Campbell, A.; Choudhury, S.; Costanza, F.; Diez Pardos, C.; Dooling, S.; Dorland, T.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Flucke, G.; Garay Garcia, J.; Geiser, A.; Gunnellini, P.; Hauk, J.; Hempel, M.; Horton, D.; Jung, H.; Kalogeropoulos, A.; Kasemann, M.; Katsas, P.; Kieseler, J.; Kleinwort, C.; Krücker, D.; Lange, W.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Lutz, B.; Mankel, R.; Marfin, I.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Naumann-Emme, S.; Nayak, A.; Novgorodova, O.; Ntomari, E.; Perrey, H.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Ribeiro Cipriano, P. M.; Roland, B.; Ron, E.; Sahin, M. Ö.; Salfeld-Nebgen, J.; Saxena, P.; Schmidt, R.; Schoerner-Sadenius, T.; Schröder, M.; Seitz, C.; Spannagel, S.; Vargas Trevino, A. D. R.; Walsh, R.; Wissing, C.; Aldaya Martin, M.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Erfle, J.; Garutti, E.; Goebel, K.; Görner, M.; Haller, J.; Hoffmann, M.; Höing, R. S.; Kirschenmann, H.; Klanner, R.; Kogler, R.; Lange, J.; Lapsien, T.; Lenz, T.; Marchesini, I.; Ott, J.; Peiffer, T.; Pietsch, N.; Poehlsen, J.; Poehlsen, T.; Rathjens, D.; Sander, C.; Schettler, H.; Schleper, P.; Schlieckau, E.; Schmidt, A.; Seidel, M.; Sola, V.; Stadie, H.; Steinbrück, G.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Barth, C.; Baus, C.; Berger, J.; Böser, C.; Butz, E.; Chwalek, T.; De Boer, W.; Descroix, A.; Dierlamm, A.; Feindt, M.; Frensch, F.; Giffels, M.; Hartmann, F.; Hauth, T.; Husemann, U.; Katkov, I.; Kornmayer, A.; Kuznetsova, E.; Lobelle Pardo, P.; Mozer, M. U.; Müller, Th.; Nürnberg, A.; Quast, G.; Rabbertz, K.; Ratnikov, F.; Röcker, S.; Simonis, H. J.; Stober, F. M.; Ulrich, R.; Wagner-Kuhr, J.; Wayand, S.; Weiler, T.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Markou, A.; Markou, C.; Psallidas, A.; Topsis-Giotis, I.; Agapitos, A.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Stiliaris, E.; Aslanoglou, X.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Bencze, G.; Hajdu, C.; Hidas, P.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Molnar, J.; Palinkas, J.; Szillasi, Z.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Swain, S. K.; Beri, S. B.; Bhatnagar, V.; Gupta, R.; Bhawandeep, U.; Kalsi, A. K.; Kaur, M.; Kumar, R.; Mittal, M.; Nishu, N.; Singh, J. B.; Kumar, Ashok; Kumar, Arun; Ahuja, S.; Bhardwaj, A.; Choudhary, B. C.; Kumar, A.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, V.; Banerjee, S.; Bhattacharya, S.; Chatterjee, K.; Dutta, S.; Gomber, B.; Jain, Sa.; Jain, Sh.; Khurana, R.; Modak, A.; Mukherjee, S.; Roy, D.; Sarkar, S.; Sharan, M.; Abdulsalam, A.; Dutta, D.; Kailas, S.; Kumar, V.; Mohanty, A. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Banerjee, S.; Bhowmik, S.; Chatterjee, R. M.; Dewanjee, R. K.; Dugad, S.; Ganguly, S.; Ghosh, S.; Guchait, M.; Gurtu, A.; Kole, G.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Mohanty, G. B.; Parida, B.; Sudhakar, K.; Wickramage, N.; Bakhshiansohi, H.; Behnamian, H.; Etesami, S. M.; Fahim, A.; Goldouzian, R.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Barbone, L.; Calabria, C.; Chhibra, S. S.; Colaleo, A.; Creanza, D.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Selvaggi, G.; Silvestris, L.; Singh, G.; Venditti, R.; Zito, G.; Abbiendi, G.; Benvenuti, A. C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Primavera, F.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Travaglini, R.; Albergo, S.; Cappello, G.; Chiorboli, M.; Costa, S.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Gallo, E.; Gonzi, S.; Gori, V.; Lenzi, P.; Meschini, M.; Paoletti, S.; Sguazzoni, G.; Tropiano, A.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Ferretti, R.; Ferro, F.; Lo Vetere, M.; Robutti, E.; Tosi, S.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Gerosa, R.; Ghezzi, A.; Govoni, P.; Lucchini, M. T.; Malvezzi, S.; Manzoni, R. A.; Martelli, A.; Marzocchi, B.; Menasce, D.; Moroni, L.; Paganoni, M.; Pedrini, D.; Ragazzi, S.; Redaelli, N.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Fabozzi, F.; Iorio, A. O. M.; Lista, L.; Meola, S.; Merola, M.; Paolucci, P.; Azzi, P.; Bacchetta, N.; Bisello, D.; Branca, A.; Dall'Osso, M.; Dorigo, T.; Galanti, M.; Gasparini, F.; Giubilato, P.; Gozzelino, A.; Kanishchev, K.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Montecassiano, F.; Passaseo, M.; Pazzini, J.; Pegoraro, M.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Torassa, E.; Tosi, M.; Triossi, A.; Zotto, P.; Zucchetta, A.; Zumerle, G.; Gabusi, M.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vitulo, P.; Biasini, M.; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Mantovani, G.; Menichelli, M.; Romeo, F.; Saha, A.; Santocchia, A.; Spiezia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Broccolo, G.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fiori, F.; Foà, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Moon, C. S.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Serban, A. T.; Spagnolo, P.; Squillacioti, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Vernieri, C.; Barone, L.; Cavallari, F.; D'imperio, G.; Del Re, D.; Diemoz, M.; Grassi, M.; Jorda, C.; Longo, E.; Margaroli, F.; Meridiani, P.; Micheli, F.; Nourbakhsh, S.; Organtini, G.; Paramatti, R.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Soffi, L.; Traczyk, P.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bellan, R.; Biino, C.; Cartiglia, N.; Casasso, S.; Costa, M.; Degano, A.; Demaria, N.; Finco, L.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Musich, M.; Obertino, M. M.; Ortona, G.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Potenza, A.; Romero, A.; Ruspa, M.; Sacchi, R.; Solano, A.; Staiano, A.; Tamponi, U.; Belforte, S.; Candelise, V.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Gobbo, B.; La Licata, C.; Marone, M.; Schizzi, A.; Umer, T.; Zanetti, A.; Chang, S.; Kropivnitskaya, A.; Nam, S. K.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Kong, D. J.; Lee, S.; Oh, Y. D.; Park, H.; Sakharov, A.; Son, D. C.; Kim, T. J.; Kim, J. Y.; Song, S.; Choi, S.; Gyun, D.; Hong, B.; Jo, M.; Kim, H.; Kim, Y.; Lee, B.; Lee, K. S.; Park, S. K.; Roh, Y.; Choi, M.; Kim, J. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Choi, Y. K.; Goh, J.; Kim, D.; Kwon, E.; Lee, J.; Seo, H.; Yu, I.; Juodagalvis, A.; Komaragiri, J. R.; Md Ali, M. A. B.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-de La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Vazquez Valencia, F.; Pedraza, I.; Salazar Ibarguen, H. A.; Casimiro Linares, E.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Reucroft, S.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khalid, S.; Khan, W. A.; Khurshid, T.; Shah, M. A.; Shoaib, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Brona, G.; Bunkowski, K.; Cwiok, M.; Dominik, W.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Wolszczak, W.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Lloret Iglesias, L.; Nguyen, F.; Rodrigues Antunes, J.; Seixas, J.; Varela, J.; Vischia, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Karjavin, V.; Konoplyanikov, V.; Korenkov, V.; Kozlov, G.; Lanev, A.; Malakhov, A.; Matveev, V.; Mitsyn, V. V.; Moisenz, P.; Palichik, V.; Perelygin, V.; Shmatov, S.; Smirnov, V.; Tikhonenko, E.; Zarubin, A.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Vorobyev, An.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Safronov, G.; Semenov, S.; Spiridonov, A.; Stolin, V.; Vlasov, E.; Zhokin, A.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Mesyats, G.; Rusakov, S. V.; Vinogradov, A.; Belyaev, A.; Boos, E.; Ershov, A.; Gribushin, A.; Khein, L.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Lukina, O.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Snigirev, A.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Tourtchanovitch, L.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Ekmedzic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Battilana, C.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Domínguez Vázquez, D.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Navarro De Martino, E.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; Albajar, C.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Brun, H.; Cuevas, J.; Fernandez Menendez, J.; Folgueras, S.; Gonzalez Caballero, I.; Brochero Cifuentes, J. A.; Cabrillo, I. J.; Calderon, A.; Duarte Campderros, J.; Fernandez, M.; Gomez, G.; Graziano, A.; Lopez Virto, A.; Marco, J.; Marco, R.; Martinez Rivero, C.; Matorras, F.; Munoz Sanchez, F. J.; Piedra Gomez, J.; Rodrigo, T.; Rodríguez-Marrero, A. Y.; Ruiz-Jimeno, A.; Scodellaro, L.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Bachtis, M.; Baillon, P.; Ball, A. H.; Barney, D.; Benaglia, A.; Bendavid, J.; Benhabib, L.; Benitez, J. F.; Bernet, C.; Bianchi, G.; Bloch, P.; Bocci, A.; Bonato, A.; Bondu, O.; Botta, C.; Breuker, H.; Camporesi, T.; Cerminara, G.; Colafranceschi, S.; D'Alfonso, M.; d'Enterria, D.; Dabrowski, A.; David, A.; De Guio, F.; De Roeck, A.; De Visscher, S.; Di Marco, E.; Dobson, M.; Dordevic, M.; Dorney, B.; Dupont-Sagorin, N.; Elliott-Peisert, A.; Eugster, J.; Franzoni, G.; Funk, W.; Gigi, D.; Gill, K.; Giordano, D.; Girone, M.; Glege, F.; Guida, R.; Gundacker, S.; Guthoff, M.; Hammer, J.; Hansen, M.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kousouris, K.; Krajczar, K.; Lecoq, P.; Lourenço, C.; Magini, N.; Malgeri, L.; Mannelli, M.; Marrouche, J.; Masetti, L.; Meijers, F.; Mersi, S.; Meschi, E.; Moortgat, F.; Morovic, S.; Mulders, M.; Musella, P.; Orsini, L.; Pape, L.; Perez, E.; Perrozzi, L.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Pimiä, M.; Piparo, D.; Plagge, M.; Racz, A.; Rolandi, G.; Rovere, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Sharma, A.; Siegrist, P.; Silva, P.; Simon, M.; Sphicas, P.; Spiga, D.; Steggemann, J.; Stieger, B.; Stoye, M.; Takahashi, Y.; Treille, D.; Tsirou, A.; Veres, G. I.; Vlimant, J. R.; Wardle, N.; Wöhri, H. K.; Wollny, H.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Renker, D.; Rohe, T.; Bachmair, F.; Bäni, L.; Bianchini, L.; Buchmann, M. A.; Casal, B.; Chanon, N.; Dissertori, G.; Dittmar, M.; Donegà, M.; Dünser, M.; Eller, P.; Grab, C.; Hits, D.; Hoss, J.; Lustermann, W.; Mangano, B.; Marini, A. C.; Martinez Ruiz del Arbol, P.; Masciovecchio, M.; Meister, D.; Mohr, N.; Nägeli, C.; Nessi-Tedaldi, F.; Pandolfi, F.; Pauss, F.; Peruzzi, M.; Quittnat, M.; Rebane, L.; Rossini, M.; Starodumov, A.; Takahashi, M.; Theofilatos, K.; Wallny, R.; Weber, H. A.; Amsler, C.; Canelli, M. F.; Chiochia, V.; De Cosa, A.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Lange, C.; Millan Mejias, B.; Ngadiuba, J.; Robmann, P.; Ronga, F. J.; Taroni, S.; Verzetti, M.; Yang, Y.; Cardaci, M.; Chen, K. H.; Ferro, C.; Kuo, C. M.; Lin, W.; Lu, Y. J.; Volpe, R.; Yu, S. S.; Chang, P.; Chang, Y. H.; Chang, Y. W.; Chao, Y.; Chen, K. F.; Chen, P. H.; Dietz, C.; Grundler, U.; Hou, W.-S.; Kao, K. Y.; Lei, Y. J.; Liu, Y. F.; Lu, R.-S.; Majumder, D.; Petrakou, E.; Tzeng, Y. M.; Wilken, R.; Asavapibhop, B.; Srimanobhas, N.; Suwonjandee, N.; Adiguzel, A.; Bakirci, M. N.; Cerci, S.; Dozen, C.; Dumanoglu, I.; Eskut, E.; Girgis, S.; Gokbulut, G.; Gurpinar, E.; Hos, I.; Kangal, E. E.; Kayis Topaksu, A.; Onengut, G.; Ozdemir, K.; Ozturk, S.; Polatoz, A.; Sunar Cerci, D.; Tali, B.; Topakli, H.; Vergili, M.; Akin, I. V.; Bilin, B.; Bilmis, S.; Gamsizkan, H.; Karapinar, G.; Ocalan, K.; Sekmen, S.; Surat, U. E.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Isildak, B.; Kaya, M.; Kaya, O.; Cankocak, K.; Vardarlı, F. I.; Levchuk, L.; Sorokin, P.; Brooke, J. J.; Clement, E.; Cussans, D.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Meng, Z.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Senkin, S.; Smith, V. J.; Williams, T.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Womersley, W. J.; Worm, S. D.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Burton, D.; Colling, D.; Cripps, N.; Cutajar, M.; Dauncey, P.; Davies, G.; Della Negra, M.; Dunne, P.; Ferguson, W.; Fulcher, J.; Futyan, D.; Gilbert, A.; Hall, G.; Iles, G.; Jarvis, M.; Karapostoli, G.; Kenzie, M.; Lane, R.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mathias, B.; Nash, J.; Nikitenko, A.; Pela, J.; Pesaresi, M.; Petridis, K.; Raymond, D. M.; Rogerson, S.; Rose, A.; Seez, C.; Sharp, P.; Tapper, A.; Vazquez Acosta, M.; Virdee, T.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Leggat, D.; Leslie, D.; Martin, W.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Dittmann, J.; Hatakeyama, K.; Kasmi, A.; Liu, H.; Scarborough, T.; Charaf, O.; Cooper, S. I.; Henderson, C.; Rumerio, P.; Avetisyan, A.; Bose, T.; Fantasia, C.; Lawson, P.; Richardson, C.; Rohlf, J.; St. John, J.; Sulak, L.; Alimena, J.; Berry, E.; Bhattacharya, S.; Christopher, G.; Cutts, D.; Demiragli, Z.; Dhingra, N.; Ferapontov, A.; Garabedian, A.; Heintz, U.; Kukartsev, G.; Laird, E.; Landsberg, G.; Luk, M.; Narain, M.; Segala, M.; Sinthuprasith, T.; Speer, T.; Swanson, J.; Breedon, R.; Breto, G.; Calderon De La Barca Sanchez, M.; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Gardner, M.; Ko, W.; Lander, R.; Miceli, T.; Mulhearn, M.; Pellett, D.; Pilot, J.; Ricci-Tam, F.; Searle, M.; Shalhout, S.; Smith, J.; Squires, M.; Stolp, D.; Tripathi, M.; Wilbur, S.; Yohay, R.; Cousins, R.; Everaerts, P.; Farrell, C.; Hauser, J.; Ignatenko, M.; Rakness, G.; Takasugi, E.; Valuev, V.; Weber, M.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Hanson, G.; Heilman, J.; Ivova Rikova, M.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Luthra, A.; Malberti, M.; Nguyen, H.; Olmedo Negrete, M.; Shrinivas, A.; Sumowidagdo, S.; Wimpenny, S.; Andrews, W.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; D'Agnolo, R. T.; Evans, D.; Holzner, A.; Kelley, R.; Klein, D.; Lebourgeois, M.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Palmer, C.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Sudano, E.; Tadel, M.; Tu, Y.; Vartak, A.; Welke, C.; Würthwein, F.; Yagil, A.; Barge, D.; Bradmiller-Feld, J.; Campagnari, C.; Danielson, T.; Dishaw, A.; Flowers, K.; Franco Sevilla, M.; Geffert, P.; George, C.; Golf, F.; Gouskos, L.; Incandela, J.; Justus, C.; Mccoll, N.; Richman, J.; Stuart, D.; To, W.; West, C.; Yoo, J.; Apresyan, A.; Bornheim, A.; Bunn, J.; Chen, Y.; Duarte, J.; Mott, A.; Newman, H. B.; Pena, C.; Rogan, C.; Spiropulu, M.; Timciuc, V.; Wilkinson, R.; Xie, S.; Zhu, R. Y.; Azzolini, V.; Calamba, A.; Carlson, B.; Ferguson, T.; Iiyama, Y.; Paulini, M.; Russ, J.; Vogel, H.; Vorobiev, I.; Cumalat, J. P.; Ford, W. T.; Gaz, A.; Luiggi Lopez, E.; Nauenberg, U.; Smith, J. G.; Stenson, K.; Ulmer, K. A.; Wagner, S. R.; Alexander, J.; Chatterjee, A.; Chu, J.; Dittmer, S.; Eggert, N.; Mirman, N.; Nicolas Kaufman, G.; Patterson, J. R.; Ryd, A.; Salvati, E.; Skinnari, L.; Sun, W.; Teo, W. D.; Thom, J.; Thompson, J.; Tucker, J.; Weng, Y.; Winstrom, L.; Wittich, P.; Winn, D.; Abdullin, S.; Albrow, M.; Anderson, J.; Apollinari, G.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gao, Y.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hanlon, J.; Hare, D.; Harris, R. M.; Hirschauer, J.; Hooberman, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Kaadze, K.; Klima, B.; Kreis, B.; Kwan, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, T.; Lykken, J.; Maeshima, K.; Marraffino, J. M.; Martinez Outschoorn, V. I.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mishra, K.; Mrenna, S.; Musienko, Y.; Nahn, S.; Newman-Holmes, C.; O'Dell, V.; Prokofyev, O.; Sexton-Kennedy, E.; Sharma, S.; Soha, A.; Spalding, W. J.; Spiegel, L.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vidal, R.; Whitbeck, A.; Whitmore, J.; Yang, F.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Carver, M.; Cheng, T.; Curry, D.; Das, S.; De Gruttola, M.; Di Giovanni, G. P.; Field, R. D.; Fisher, M.; Furic, I. K.; Hugon, J.; Konigsberg, J.; Korytov, A.; Kypreos, T.; Low, J. F.; Matchev, K.; Milenovic, P.; Mitselmakher, G.; Muniz, L.; Rinkevicius, A.; Shchutska, L.; Snowball, M.; Sperka, D.; Yelton, J.; Zakaria, M.; Hewamanage, S.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Adams, T.; Askew, A.; Bochenek, J.; Diamond, B.; Haas, J.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Prosper, H.; Veeraraghavan, V.; Weinberg, M.; Baarmand, M. M.; Hohlmann, M.; Kalakhety, H.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Bazterra, V. E.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Khalatyan, S.; Kurt, P.; Moon, D. H.; O'Brien, C.; Silkworth, C.; Turner, P.; Varelas, N.; Albayrak, E. A.; Bilki, B.; Clarida, W.; Dilsiz, K.; Duru, F.; Haytmyradov, M.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Rahmat, R.; Sen, S.; Tan, P.; Tiras, E.; Wetzel, J.; Yetkin, T.; Yi, K.; Barnett, B. A.; Blumenfeld, B.; Bolognesi, S.; Fehling, D.; Gritsan, A. V.; Maksimovic, P.; Martin, C.; Swartz, M.; Baringer, P.; Bean, A.; Benelli, G.; Bruner, C.; Kenny, R. P.; Malek, M.; Murray, M.; Noonan, D.; Sanders, S.; Sekaric, J.; Stringer, R.; Wang, Q.; Wood, J. S.; Barfuss, A. F.; Chakaberia, I.; Ivanov, A.; Khalil, S.; Makouski, M.; Maravin, Y.; Saini, L. K.; Shrestha, S.; Skhirtladze, N.; Svintradze, I.; Gronberg, J.; Lange, D.; Rebassoo, F.; Wright, D.; Baden, A.; Belloni, A.; Calvert, B.; Eno, S. C.; Gomez, J. A.; Hadley, N. J.; Kellogg, R. G.; Kolberg, T.; Lu, Y.; Marionneau, M.; Mignerey, A. C.; Pedro, K.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Apyan, A.; Barbieri, R.; Bauer, G.; Busza, W.; Cali, I. A.; Chan, M.; Di Matteo, L.; Dutta, V.; Gomez Ceballos, G.; Goncharov, M.; Gulhan, D.; Klute, M.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Ma, T.; Paus, C.; Ralph, D.; Roland, C.; Roland, G.; Stephans, G. S. F.; Stöckli, F.; Sumorok, K.; Velicanu, D.; Veverka, J.; Wyslouch, B.; Yang, M.; Zanetti, M.; Zhukova, V.; Dahmes, B.; Gude, A.; Kao, S. C.; Klapoetke, K.; Kubota, Y.; Mans, J.; Pastika, N.; Rusack, R.; Singovsky, A.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Bose, S.; Claes, D. R.; Dominguez, A.; Gonzalez Suarez, R.; Keller, J.; Knowlton, D.; Kravchenko, I.; Lazo-Flores, J.; Malik, S.; Meier, F.; Snow, G. R.; Zvada, M.; Dolen, J.; Godshalk, A.; Iashvili, I.; Kharchilava, A.; Kumar, A.; Rappoccio, S.; Alverson, G.; Barberis, E.; Baumgartel, D.; Chasco, M.; Haley, J.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Trocino, D.; Wang, R.-J.; Wood, D.; Zhang, J.; Hahn, K. A.; Kubik, A.; Mucia, N.; Odell, N.; Pollack, B.; Pozdnyakov, A.; Schmitt, M.; Stoynev, S.; Sung, K.; Velasco, M.; Won, S.; Brinkerhoff, A.; Chan, K. M.; Drozdetskiy, A.; Hildreth, M.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Luo, W.; Lynch, S.; Marinelli, N.; Pearson, T.; Planer, M.; Ruchti, R.; Valls, N.; Wayne, M.; Wolf, M.; Woodard, A.; Antonelli, L.; Brinson, J.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Hill, C.; Hughes, R.; Kotov, K.; Ling, T. Y.; Puigh, D.; Rodenburg, M.; Smith, G.; Winer, B. L.; Wolfe, H.; Wulsin, H. W.; Driga, O.; Elmer, P.; Hebda, P.; Hunt, A.; Koay, S. A.; Lujan, P.; Marlow, D.; Medvedeva, T.; Mooney, M.; Olsen, J.; Piroué, P.; Quan, X.; Saka, H.; Stickland, D.; Tully, C.; Werner, J. S.; Zuranski, A.; Brownson, E.; Mendez, H.; Ramirez Vargas, J. E.; Barnes, V. E.; Benedetti, D.; Bortoletto, D.; De Mattia, M.; Gutay, L.; Hu, Z.; Jha, M. K.; Jones, M.; Jung, K.; Kress, M.; Leonardo, N.; Lopes Pegna, D.; Maroussov, V.; Miller, D. H.; Neumeister, N.; Radburn-Smith, B. C.; Shi, X.; Shipsey, I.; Silvers, D.; Svyatkovskiy, A.; Wang, F.; Xie, W.; Xu, L.; Yoo, H. D.; Zablocki, J.; Zheng, Y.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Ecklund, K. M.; Geurts, F. J. M.; Li, W.; Michlin, B.; Padley, B. P.; Redjimi, R.; Roberts, J.; Zabel, J.; Betchart, B.; Bodek, A.; Covarelli, R.; de Barbaro, P.; Demina, R.; Eshaq, Y.; Ferbel, T.; Garcia-Bellido, A.; Goldenzweig, P.; Han, J.; Harel, A.; Khukhunaishvili, A.; Petrillo, G.; Vishnevskiy, D.; Ciesielski, R.; Demortier, L.; Goulianos, K.; Lungu, G.; Mesropian, C.; Arora, S.; Barker, A.; Chou, J. P.; Contreras-Campana, C.; Contreras-Campana, E.; Duggan, D.; Ferencek, D.; Gershtein, Y.; Gray, R.; Halkiadakis, E.; Hidas, D.; Kaplan, S.; Lath, A.; Panwalkar, S.; Park, M.; Patel, R.; Salur, S.; Schnetzer, S.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Rose, K.; Spanier, S.; York, A.; Bouhali, O.; Castaneda Hernandez, A.; Eusebi, R.; Flanagan, W.; Gilmore, J.; Kamon, T.; Khotilovich, V.; Krutelyov, V.; Montalvo, R.; Osipenkov, I.; Pakhotin, Y.; Perloff, A.; Roe, J.; Rose, A.; Safonov, A.; Sakuma, T.; Suarez, I.; Tatarinov, A.; Akchurin, N.; Cowden, C.; Damgov, J.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Kovitanggoon, K.; Kunori, S.; Lee, S. W.; Libeiro, T.; Volobouev, I.; Appelt, E.; Delannoy, A. G.; Greene, S.; Gurrola, A.; Johns, W.; Maguire, C.; Mao, Y.; Melo, A.; Sharma, M.; Sheldon, P.; Snook, B.; Tuo, S.; Velkovska, J.; Arenton, M. W.; Boutle, S.; Cox, B.; Francis, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Lin, C.; Neu, C.; Wood, J.; Clarke, C.; Harr, R.; Karchin, P. E.; Kottachchi Kankanamge Don, C.; Lamichhane, P.; Sturdy, J.; Belknap, D. A.; Carlsmith, D.; Cepeda, M.; Dasu, S.; Dodd, L.; Duric, S.; Friis, E.; Hall-Wilton, R.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Lazaridis, C.; Levine, A.; Loveless, R.; Mohapatra, A.; Ojalvo, I.; Perry, T.; Pierro, G. A.; Polese, G.; Ross, I.; Sarangi, T.; Savin, A.; Smith, W. H.; Taylor, D.; Verwilligen, P.; Vuosalo, C.; Woods, N.; CMS Collaboration

2015-07-01

Measurements of diffractive dissociation cross sections in p p collisions at √{s }=7 TeV are presented in kinematic regions defined by the masses MX and MY of the two final-state hadronic systems separated by the largest rapidity gap in the event. Differential cross sections are measured as a function of ξX=MX2/s in the region -5.5 3 , log10MX>1.1 , and log10MY>1.1 , a region dominated by DD. The cross sections integrated over these regions are found to be, respectively, 2.99 ±0.02 (stat)-0.29+0.32(syst) mb , 1.18 ±0.02 (stat) ±0.13 (syst) mb , and 0.58 ±0.01 (stat)-0.11+0.13(syst) mb , and are used to extract extrapolated total SD and DD cross sections. In addition, the inclusive differential cross section, d σ /d Δ ηF , for events with a pseudorapidity gap adjacent to the edge of the detector, is measured over Δ ηF=8.4 units of pseudorapidity. The results are compared to those of other experiments and to theoretical predictions and found compatible with slowly rising diffractive cross sections as a function of center-of-mass energy.

Correlation between skin color evaluation by skin color scale chart and narrowband reflectance spectrophotometer.

PubMed

Treesirichod, Arucha; Chansakulporn, Somboon; Wattanapan, Pattra

2014-07-01

Various methods are available for the evaluation of skin color. A skin color scale chart is a convenient and inexpensive tool. However, the correlation between a skin color scale chart and objective measurement has not been evaluated. To assess the correlation between skin color evaluation done by a skin color scale chart (Felix von Luschan skin color chart) and a narrowband reflectance spectrophotometer (Mexameter MX18). The participants were evaluated for skin color by using the Felix von Luschan skin color chart (range 1-36) and a narrowband reflectance spectrophotometer (Mexameter MX18) in which the results of the measurements were expressed as Erythema (E) and Melanin (M) indices. Skin color was measured on four different anatomical skin sites from each participant on the medial aspect of the volar and the dorsal regions of both forearms. A total of 208 records from 52 participants were established. The majority of participants (19.2%) were rated with the skin color scale at the number 16 (range 14-33). The mean M plus E, M, and E indices were 498.9 ± 143.9, 230.4 ± 74.4, and 268.5 ± 73.2, respectively. The correlation coefficient between the number on the skin color scale and each index: M plus E, M, and E indices were 0.90, 0.90, and 0.86, respectively, with a statistical significance of P < 0.001. Skin color evaluation using a skin color scale chart has shown a high correlation with skin color evaluation done by the narrowband reflectance spectrophotometer.

Correlation Between Skin Color Evaluation by Skin Color Scale Chart and Narrowband Reflectance Spectrophotometer

PubMed Central

Treesirichod, Arucha; Chansakulporn, Somboon; Wattanapan, Pattra

2014-01-01

Context: Various methods are available for the evaluation of skin color. A skin color scale chart is a convenient and inexpensive tool. However, the correlation between a skin color scale chart and objective measurement has not been evaluated. Aims: To assess the correlation between skin color evaluation done by a skin color scale chart (Felix von Luschan skin color chart) and a narrowband reflectance spectrophotometer (Mexameter MX18). Materials and Methods: The participants were evaluated for skin color by using the Felix von Luschan skin color chart (range 1-36) and a narrowband reflectance spectrophotometer (Mexameter MX18) in which the results of the measurements were expressed as Erythema (E) and Melanin (M) indices. Skin color was measured on four different anatomical skin sites from each participant on the medial aspect of the volar and the dorsal regions of both forearms. Results: A total of 208 records from 52 participants were established. The majority of participants (19.2%) were rated with the skin color scale at the number 16 (range 14-33). The mean M plus E, M, and E indices were 498.9 ± 143.9, 230.4 ± 74.4, and 268.5 ± 73.2, respectively. The correlation coefficient between the number on the skin color scale and each index: M plus E, M, and E indices were 0.90, 0.90, and 0.86, respectively, with a statistical significance of P < 0.001. Conclusions: Skin color evaluation using a skin color scale chart has shown a high correlation with skin color evaluation done by the narrowband reflectance spectrophotometer. PMID:25071249

GEM-TREND: a web tool for gene expression data mining toward relevant network discovery

PubMed Central

Feng, Chunlai; Araki, Michihiro; Kunimoto, Ryo; Tamon, Akiko; Makiguchi, Hiroki; Niijima, Satoshi; Tsujimoto, Gozoh; Okuno, Yasushi

2009-01-01

Background DNA microarray technology provides us with a first step toward the goal of uncovering gene functions on a genomic scale. In recent years, vast amounts of gene expression data have been collected, much of which are available in public databases, such as the Gene Expression Omnibus (GEO). To date, most researchers have been manually retrieving data from databases through web browsers using accession numbers (IDs) or keywords, but gene-expression patterns are not considered when retrieving such data. The Connectivity Map was recently introduced to compare gene expression data by introducing gene-expression signatures (represented by a set of genes with up- or down-regulated labels according to their biological states) and is available as a web tool for detecting similar gene-expression signatures from a limited data set (approximately 7,000 expression profiles representing 1,309 compounds). In order to support researchers to utilize the public gene expression data more effectively, we developed a web tool for finding similar gene expression data and generating its co-expression networks from a publicly available database. Results GEM-TREND, a web tool for searching gene expression data, allows users to search data from GEO using gene-expression signatures or gene expression ratio data as a query and retrieve gene expression data by comparing gene-expression pattern between the query and GEO gene expression data. The comparison methods are based on the nonparametric, rank-based pattern matching approach of Lamb et al. (Science 2006) with the additional calculation of statistical significance. The web tool was tested using gene expression ratio data randomly extracted from the GEO and with in-house microarray data, respectively. The results validated the ability of GEM-TREND to retrieve gene expression entries biologically related to a query from GEO. For further analysis, a network visualization interface is also provided, whereby genes and gene annotations are dynamically linked to external data repositories. Conclusion GEM-TREND was developed to retrieve gene expression data by comparing query gene-expression pattern with those of GEO gene expression data. It could be a very useful resource for finding similar gene expression profiles and constructing its gene co-expression networks from a publicly available database. GEM-TREND was designed to be user-friendly and is expected to support knowledge discovery. GEM-TREND is freely available at . PMID:19728865

GEM-TREND: a web tool for gene expression data mining toward relevant network discovery.

PubMed

Feng, Chunlai; Araki, Michihiro; Kunimoto, Ryo; Tamon, Akiko; Makiguchi, Hiroki; Niijima, Satoshi; Tsujimoto, Gozoh; Okuno, Yasushi

2009-09-03

DNA microarray technology provides us with a first step toward the goal of uncovering gene functions on a genomic scale. In recent years, vast amounts of gene expression data have been collected, much of which are available in public databases, such as the Gene Expression Omnibus (GEO). To date, most researchers have been manually retrieving data from databases through web browsers using accession numbers (IDs) or keywords, but gene-expression patterns are not considered when retrieving such data. The Connectivity Map was recently introduced to compare gene expression data by introducing gene-expression signatures (represented by a set of genes with up- or down-regulated labels according to their biological states) and is available as a web tool for detecting similar gene-expression signatures from a limited data set (approximately 7,000 expression profiles representing 1,309 compounds). In order to support researchers to utilize the public gene expression data more effectively, we developed a web tool for finding similar gene expression data and generating its co-expression networks from a publicly available database. GEM-TREND, a web tool for searching gene expression data, allows users to search data from GEO using gene-expression signatures or gene expression ratio data as a query and retrieve gene expression data by comparing gene-expression pattern between the query and GEO gene expression data. The comparison methods are based on the nonparametric, rank-based pattern matching approach of Lamb et al. (Science 2006) with the additional calculation of statistical significance. The web tool was tested using gene expression ratio data randomly extracted from the GEO and with in-house microarray data, respectively. The results validated the ability of GEM-TREND to retrieve gene expression entries biologically related to a query from GEO. For further analysis, a network visualization interface is also provided, whereby genes and gene annotations are dynamically linked to external data repositories. GEM-TREND was developed to retrieve gene expression data by comparing query gene-expression pattern with those of GEO gene expression data. It could be a very useful resource for finding similar gene expression profiles and constructing its gene co-expression networks from a publicly available database. GEM-TREND was designed to be user-friendly and is expected to support knowledge discovery. GEM-TREND is freely available at http://cgs.pharm.kyoto-u.ac.jp/services/network.

Neighboring Genes Show Correlated Evolution in Gene Expression

PubMed Central

Ghanbarian, Avazeh T.; Hurst, Laurence D.

2015-01-01

When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

Quality Control Test for Sequence-Phenotype Assignments

PubMed Central

Ortiz, Maria Teresa Lara; Rosario, Pablo Benjamín Leon; Luna-Nevarez, Pablo; Gamez, Alba Savin; Martínez-del Campo, Ana; Del Rio, Gabriel

2015-01-01

Relating a gene mutation to a phenotype is a common task in different disciplines such as protein biochemistry. In this endeavour, it is common to find false relationships arising from mutations introduced by cells that may be depurated using a phenotypic assay; yet, such phenotypic assays may introduce additional false relationships arising from experimental errors. Here we introduce the use of high-throughput DNA sequencers and statistical analysis aimed to identify incorrect DNA sequence-phenotype assignments and observed that 10–20% of these false assignments are expected in large screenings aimed to identify critical residues for protein function. We further show that this level of incorrect DNA sequence-phenotype assignments may significantly alter our understanding about the structure-function relationship of proteins. We have made available an implementation of our method at http://bis.ifc.unam.mx/en/software/chispas. PMID:25700273

BALBES: a molecular-replacement pipeline.

PubMed

Long, Fei; Vagin, Alexei A; Young, Paul; Murshudov, Garib N

2008-01-01

The number of macromolecular structures solved and deposited in the Protein Data Bank (PDB) is higher than 40 000. Using this information in macromolecular crystallography (MX) should in principle increase the efficiency of MX structure solution. This paper describes a molecular-replacement pipeline, BALBES, that makes extensive use of this repository. It uses a reorganized database taken from the PDB with multimeric as well as domain organization. A system manager written in Python controls the workflow of the process. Testing the current version of the pipeline using entries from the PDB has shown that this approach has huge potential and that around 75% of structures can be solved automatically without user intervention.

Measurement of the Inelastic Proton-Proton Cross Section at s = 13 TeV with the ATLAS Detector at the LHC

DOE PAGES

Aaboud, M.; Aad, G.; Abbott, B.; ...

2016-10-26

This Letter presents a measurement of the inelastic proton-proton cross section using 60 μb-1 of pp collisions at a center-of-mass energy s of 13 TeV with the ATLAS detector at the LHC. Inelastic interactions are selected using rings of plastic scintillators in the forward region (2.07 < |η| < 3.86) of the detector. A cross section of 68.1±1.4 mb is measured in the fiducial region ξ=MX2/s > 10-6, where MX is the larger invariant mass of the two hadronic systems separated by the largest rapidity gap in the event. In this ξ range the scintillators are highly efficient. For diffractivemore » events this corresponds to cases where at least one proton dissociates to a system with MX > 13 GeV. The measured cross section is compared with a range of theoretical predictions. When extrapolated to the full phase space, a cross section of 78.1±2.9 mb is measured, consistent with the inelastic cross section increasing with center-of-mass energy.« less

Mechanochemical synthesis, structure and properties of lead containing alkaline earth metal fluoride solid solutions MxPb1-xF2 (M = Ca, Sr, Ba)

NASA Astrophysics Data System (ADS)

Heise, M.; Scholz, G.; Düvel, A.; Heitjans, P.; Kemnitz, E.

2018-03-01

The paper deals with the mechanochemical synthesis of lead containing alkaline earth metal fluoride solid solutions MxPb1-xF2 (M = Ca, Sr, Ba) by high-energy ball milling. Several metal precursors and fluorinating agents were tested for synthesizing M0.5Pb0.5F2. Metal acetates and ammonium fluoride as precursors show the most promising results and were therefore used for the formation of MxPb1-xF2 with different metal cationic ratios. The characterization of the local fluorine coordination and the crystal structure was performed by 19F MAS NMR spectroscopy and X-ray diffraction. Additional calculations of 19F chemical shifts using the superposition model allow a deeper insight into the local structure of the compounds. The fluoride ion conductivity was followed by temperature dependent DC conductivity measurements. Significantly higher conductivities were found in comparison with those of the corresponding binary fluorides. The highest values were observed for samples with high lead content M0.25Pb0.75F2, bearing in mind the much higher conductivity of PbF2 compared to MF2.

GT3X+ accelerometer, Yamax pedometer and SC-StepMX pedometer step count accuracy in community-dwelling older adults.

PubMed

Webber, Sandra C; Magill, Sheila M; Schafer, Jenessa L; Wilson, Kaylie C S

2014-07-01

The purpose was to compare step count accuracy of an accelerometer (ActiGraph GT3X+), a mechanical pedometer (Yamax SW200), and a piezoelectric pedometer (SC-StepMX). Older adults (n = 13 with walking aids, n = 22 without; M = 81.5 years old, SD = 5.0) walked 100 m wearing the devices. Device-detected steps were compared with manually counted steps. We found no significant differences among monitors for those who walked without aids (p = .063). However, individuals who used walking aids exhibited slower gait speeds (M = 0.83 m/s, SD = 0.2) than non-walking aid users (M = 1.21 m/s, SD = 0.2, p < .001), and for them the SC-StepMX demonstrated a significantly lower percentage of error (Mdn = 1.0, interquartile range [IQR] = 0.5-2.0) than the other devices (Yamax SW200, Mdn = 68.9, IQR = 35.9-89.3; left GT3X+, Mdn = 52.0, IQR = 37.1-58.9; right GT3X+, Mdn = 51.0, IQR = 32.3-66.5; p < .05). These results support using a piezoelectric pedometer for measuring steps in older adults who use walking aids and who walk slowly.

Understanding the structural, electrical, and optical properties of monolayer h-phase RuO2 nanosheets: a combined experimental and computational study

NASA Astrophysics Data System (ADS)

Ko, Dong-Su; Lee, Woo-Jin; Sul, Soohwan; Jung, Changhoon; Yun, Dong-Jin; Kim, Hee-Goo; Son, Won-Joon; Chung, Jae Gwan; Jung, Doh Won; Kim, Se Yun; Kim, Jeongmin; Lee, Wooyoung; Kwak, Chan; Shin, Jai Kwang; Kim, Jung-Hwa; Roh, Jong Wook

2018-04-01

The structural, electrical, and optical properties of monolayer ruthenium oxide (RuO2) nanosheets (NSs) fabricated by chemical exfoliation of a layered three-dimensional form of K-intercalated RuO2 are studied systematically via experimental and computational methods. Monolayer RuO2 NS is identified as having a distorted h-MX2 structure. This is the first observation of a RuO2 NS structure that is unlike the t-MX2 structure of the RuO2 layers in the parent material and does not have hexagonal symmetry. The distorted h-MX2 RuO2 NSs are shown to have optical transparency superior to that of graphene, thereby predicting the feasibility of applying RuO2 NSs to flexible transparent electrodes. In addition, it is demonstrated that the semiconducting band structures of RuO2 NSs can be manipulated to be semi-metallic by adjusting the crystal structure, which is related to band-gap engineering. This finding indicates that RuO2 NSs can be used in a variety of applications, such as flexible transparent electrodes, atomic-layer devices, and optoelectronic devices.

Nouveaux supraconducteurs à haute température critique à base de mercure

NASA Astrophysics Data System (ADS)

Michel, C.; Hervieu, M.; Martin, C.; Maignan, A.; Pelloquin, D.; Goutenoire, F.; Huvé, M.; Raveau, B.

1994-11-01

Structural and superconducting properties of new cations substituted mercury based oxides are described. They are mainly characterized by [ Hg{1-x}MxOδ] infty monolayers, however a compound with doubled [ Hg{1-x}MxOδ] infty layer is described for the first time. Critical temperatures vary in a large range 0leqslant T_cleqslant 130 K, but they are lower than those of related to pure mercury oxides. The influence of annealings in various atmospheres upon T_c is discussed. Les caractéristiques structurales et supraconductrices de nouveaux oxydes à base de mercure, dans lesquels le mercure est partiellement remplacé par un autre cation, sont décrites. Dans la majorité des cas, ces oxydes sont caractérisés par une monocouche [ Hg{1-x}MxOδ] infty ; cependant, pour la première fois un composé contenant une double couche majoritaire en mercure est isolé. Les températures critiques varient dans un large domaine (0-130 K) mais restent inférieures à celles des oxydes parents ll tout mercure gg. L'influence des recuits sous des atmosphères diverses est discutée.

Clinical Evaluation of an Unsintered Hydroxyapatite/Poly-L-Lactide Osteoconductive Composite Device for the Internal Fixation of Maxillofacial Fractures

PubMed Central

Sukegawa, Shintaro; Kanno, Takahiro; Katase, Naoki; Shibata, Akane; Takahashi, Yuka; Furuki, Yoshihiko

2016-01-01

Introduction: OSTEOTRANS MX (Takiron Co, Ltd, Osaka, Japan) is a resorbable osteosynthetic material composed of an unsintered hydroxyapatite/poly-l-lactide composite, and its osteoconductive capacity has been documented. The authors here report their clinical experience using OSTEOTRANS MX. Methods: The authors treated 35 patients (19 men, 16 women; age, 14–88 years; mean ± standard deviation, 38.4 ± 19.9 years) with maxillofacial fractures. The authors used standard surgery to stabilize fractures in all patients, fitting resorbable plates (thickness, 1.0 or 1.4 mm) and screws (diameter, 2 mm) according to Arbeitsgemeinschaft für Osteosynthesefragen/Association (AO) for the Study of Internal Fixation guidelines. Results: All patients eventually achieved satisfactory healing with favorable restoration of form and function without foreign body reaction. Complications occurred in 3 patients—plate exposure in 2 and discomfort in 1. However, fracture sites healed in all patients. Scanning electron microscopy revealed that the devices bonded directly to the bone without interposition of nonmineralized tissue. Conclusion: OSTEOTRANS MX is a useful material with few complications. Its osteoconductive bioactivity is advantageous for the early functional improvement of maxillofacial fractures. PMID:27428913

Effect of halo-substituted aromatic salts on counterion binding constants obtained from cationic nanoparticle catalyzed reactions of piperidine and phenyl salicylate

NASA Astrophysics Data System (ADS)

Fagge, Ibrahim I.; Yusof, Nor Saadah M.; Zain, Sharifuddin Md; Khan, M. Niyaz

2017-12-01

Halo-substitutions at 3-position of benzene ring of the salts of aromatic carboxylate, MX, revealed the effect of two different halide ions (Br- and Cl-) on the counterion binding constants obtained from cationic nanoparticle catalyzed piperidinolysis of ionized phenyl salicylate (PhS-). The values of observed rate constant, kobs, determined at a constant total concentration of cetyltrimethylammonium bromide, [CTABr]T, piperidine, ([P]T), [PhS-]T, NaOH, and various concentration of MX (MX = 3-BrC6H4CO2Na and 3-ClC6H4CO2Na), were determined using UV-visible X spectrophotometric technique at 35 °C and 370 nm. The average value of nanoparticle binding constant, KXBr, for X- = 3-BrC6H4CO2- (RXBr = 57) was found to be about 2-fold larger than that for X- = 3-ClC6H4CO2- (RXBr = 30). These XX values were dependent of substituents 3-Br and 3-Cl, and independent of [CTABr]T. Both are related to the presence of different extent of viscoelastic worm-like nanoparticles formation in the [CTABr]T of 6 and 10 mM.

A highly sensitive magnetic biosensor for detection and quantification of anticancer drugs tagged to superparamagnetic nanoparticles

NASA Astrophysics Data System (ADS)

Devkota, J.; Wingo, J.; Mai, T. T. T.; Nguyen, X. P.; Huong, N. T.; Mukherjee, P.; Srikanth, H.; Phan, M. H.

2014-05-01

We report on a highly sensitive magnetic biosensor based on the magneto-reactance (MX) effect of a Co65Fe4Ni2Si15B14 amorphous ribbon with a nanohole-patterned surface for detection and quantification of anticancer drugs (Curcumin) tagged to superparamagnetic (Fe3O4) nanoparticles. Fe3O4 nanoparticles (mean size, ˜10 nm) were first coated with Alginate, and Curcumin was then tagged to the nanoparticles. The detection and quantification of Curcumin were assessed by the change in MX of the ribbon subject to varying concentrations of the Fe3O4 nanoparticles to which Curcumin was tagged. A high capacity of the MX-based biosensor in quantitative analysis of Curcumin-loaded Fe3O4 nanoparticles was achieved in the range of 0-50 ng/ml, beyond which the detection sensitivity of the sensor remained unchanged. The detection sensitivity of the biosensor reached an extremely high value of 30%, which is about 4-5 times higher than that of a magneto-impedance (MI) based biosensor. This biosensor is well suited for detection of low-concentration magnetic biomarkers in biological systems.

Variances in the projections, resulting from CLIMEX, Boosted Regression Trees and Random Forests techniques

NASA Astrophysics Data System (ADS)

Shabani, Farzin; Kumar, Lalit; Solhjouy-fard, Samaneh

2017-08-01

The aim of this study was to have a comparative investigation and evaluation of the capabilities of correlative and mechanistic modeling processes, applied to the projection of future distributions of date palm in novel environments and to establish a method of minimizing uncertainty in the projections of differing techniques. The location of this study on a global scale is in Middle Eastern Countries. We compared the mechanistic model CLIMEX (CL) with the correlative models MaxEnt (MX), Boosted Regression Trees (BRT), and Random Forests (RF) to project current and future distributions of date palm ( Phoenix dactylifera L.). The Global Climate Model (GCM), the CSIRO-Mk3.0 (CS) using the A2 emissions scenario, was selected for making projections. Both indigenous and alien distribution data of the species were utilized in the modeling process. The common areas predicted by MX, BRT, RF, and CL from the CS GCM were extracted and compared to ascertain projection uncertainty levels of each individual technique. The common areas identified by all four modeling techniques were used to produce a map indicating suitable and unsuitable areas for date palm cultivation for Middle Eastern countries, for the present and the year 2100. The four different modeling approaches predict fairly different distributions. Projections from CL were more conservative than from MX. The BRT and RF were the most conservative methods in terms of projections for the current time. The combination of the final CL and MX projections for the present and 2100 provide higher certainty concerning those areas that will become highly suitable for future date palm cultivation. According to the four models, cold, hot, and wet stress, with differences on a regional basis, appears to be the major restrictions on future date palm distribution. The results demonstrate variances in the projections, resulting from different techniques. The assessment and interpretation of model projections requires reservations, especially in correlative models such as MX, BRT, and RF. Intersections between different techniques may decrease uncertainty in future distribution projections. However, readers should not miss the fact that the uncertainties are mostly because the future GHG emission scenarios are unknowable with sufficient precision. Suggestions towards methodology and processing for improving projections are included.

Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

PubMed Central

Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

2013-01-01

The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

Neighboring Genes Show Correlated Evolution in Gene Expression.

PubMed

Ghanbarian, Avazeh T; Hurst, Laurence D

2015-07-01

When considering the evolution of a gene's expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Lack of Interferon and Proinflammatory Cyto/chemokines in Serologically Active Clinically Quiescent Systemic Lupus Erythematosus.

PubMed

Steiman, Amanda J; Gladman, Dafna D; Ibañez, Dominique; Noamani, Babak; Landolt-Marticorena, Carolina; Urowitz, Murray B; Wither, Joan E

2015-12-01

Serologically active clinically quiescent (SACQ) patients with systemic lupus erythematosus (SLE) remain clinically quiescent for prolonged periods despite anti-dsDNA antibodies and/or low complements, indicating the presence of immune complexes. The immune mechanisms leading to this quiescence are unknown. However, in addition to activating complement, immune complex uptake by various cells leads to the production of interferon (IFN)-α and other proinflammatory factors that are also involved in tissue damage. Here we investigate whether production of these factors is reduced in SACQ patients. The levels of 5 IFN-induced genes and 19 cyto/chemokines were measured in SACQ patients and were compared with those in serologically and clinically active (SACA) and serologically and clinically quiescent (SQCQ) patients. SACQ and SQCQ were defined as ≥ 2 years without clinical activity, with/without persistent serologic activity, respectively, and off corticosteroids/immunosuppressives. SACA was defined as disease activity compelling immunosuppression. Levels of OAS1, IFIT1, MX1, LY6E, and ISG15 were measured by quantitative real-time polymerase chain reaction (PCR) and a composite score (IFN-5) derived from this. Plasma cyto/chemokines were measured by Luminex assay. Nonparametric univariate and logistic regression analyses were conducted. There were no differences in gene expression or cyto/chemokine levels between SACQ and SQCQ patients. The SACQ IFN-5 score was significantly lower than that of SACA (p = 0.003) and was driven by SACQ status, not by autoantibody profile or disease duration. Levels of granulocyte-macrophage colony-stimulating factor, interleukin (IL) 6, IL-10, IFN-γ-inducible protein 10, monocyte chemoattractant protein 1, and tumor necrosis factor-α were significantly lower in SACQ than SACA. The levels of proinflammatory factors in SACQ mirror those of SQCQ patients, indicating reduced production of these factors despite the presence of immune complexes.

Experimental infection studies demonstrating Atlantic salmon as a host and reservoir of viral hemorrhagic septicemia virus type IVa with insights into pathology and host immunity.

PubMed

Lovy, J; Piesik, P; Hershberger, P K; Garver, K A

2013-09-27

In British Columbia, Canada (BC), aquaculture of finfish in ocean netpens has the potential for pathogen transmission between wild and farmed species due to the sharing of an aquatic environment. Viral hemorrhagic septicemia virus (VHSV) is enzootic in BC and causes serious disease in wild Pacific herring, Clupea pallasii, which often enter and remain in Atlantic salmon, Salmo salar, netpens. Isolation of VHSV from farmed Atlantic salmon has been previously documented, but the effects on the health of farmed salmon and the wild fish sharing the environment are unknown. To determine their susceptibility, Atlantic salmon were exposed to a pool of 9 isolates of VHSV obtained from farmed Atlantic salmon in BC by IP-injection or by waterborne exposure and cohabitation with diseased Pacific herring. Disease intensity was quantified by recording mortality, clinical signs, histopathological changes, cellular sites of viral replication, expression of interferon-related genes, and viral tissue titers. Disease ensued in Atlantic salmon after both VHSV exposure methods. Fish demonstrated gross disease signs including darkening of the dorsal skin, bilateral exophthalmia, light cutaneous hemorrhage, and lethargy. The virus replicated within endothelial cells causing endothelial cell necrosis and extensive hemorrhage in anterior kidney. Infected fish demonstrated a type I interferon response as seen by up-regulation of genes for IFNα, Mx, and ISG15. In a separate trial infected salmon transmitted the virus to sympatric Pacific herring. The results demonstrate that farmed Atlantic salmon can develop clinical VHS and virus can persist in the tissues for at least 10 weeks. Avoiding VHS epizootics in Atlantic salmon farms would limit the potential of VHS in farmed Atlantic salmon, the possibility for further host adaptation in this species, and virus spillback to sympatric wild fishes. Published by Elsevier B.V.

Accumulation of Ag and Cu in Amanita strobiliformis and characterization of its Cu and Ag uptake transporter genes AsCTR2 and AsCTR3.

PubMed

Beneš, Vojtěch; Hložková, Kateřina; Matěnová, Michaela; Borovička, Jan; Kotrba, Pavel

2016-04-01

Macrofungi can accumulate in their sporocarps remarkably high concentrations of Cu and Ag. We have previously demonstrated that the non-essential Ag is in the ectomycorrhizal, Ag-hyperaccumulating Amanita strobiliformis sequestered by 3.4-kDa metallothioneins (MTs) produced as AsMT1a, 1b and 1c isoforms. Here, we describe two populations of wild-grown A. strobiliformis sporocarps, which showed certain correlation between the concentrations of accumulated Ag (284 ± 64 and 67 ± 15 mg kg(-1)) and Cu (76 ± 13 and 30 ± 12 mg kg(-1)), suggesting that an overlap may exist in the cell biology of Ag and Cu in this species. Metal speciation analysis revealed that the intracellular Cu in the sporocarps of both populations was, like Ag, associated with the 3.4-kDa MTs. A search of A. strobiliformis transcriptome for sequences encoding proteins of the Cu transporter (CTR) family identified four AsCTR cDNAs, which were, like AsMT1s, confirmed in both populations. The predicted AsCTR proteins showed homology to vacuolar (AsCTR1 and AsCTR4) and plasma membrane (AsCTR2 and AsCTR3) CTRs. Heterologous expression of AsCTR2, AsCTR3 and their translational fusions with green fluorescent protein (GFP) in Cu uptake-deficient S. cerevisiae indicated that both AsCTRs are functional Cu and Ag uptake transporters: recombinant genes complemented growth defects and increased Cu and Ag uptake rates in yeasts and the GFP-tagged protein localized to the cell periphery. Site directed mutagenesis revealed the importance of the conserved-among-CTRs M-X3-M motif for the AsCTR2- and AsCTR3-mediated transport of both Cu and Ag. These results provide the first evidence that fungal CTRs can recognize Ag for transport.

Atlantic salmon populations reveal adaptive divergence of immune related genes - a duplicated genome under selection.

PubMed

Kjærner-Semb, Erik; Ayllon, Fernando; Furmanek, Tomasz; Wennevik, Vidar; Dahle, Geir; Niemelä, Eero; Ozerov, Mikhail; Vähä, Juha-Pekka; Glover, Kevin A; Rubin, Carl J; Wargelius, Anna; Edvardsen, Rolf B

2016-08-11

Populations of Atlantic salmon display highly significant genetic differences with unresolved molecular basis. These differences may result from separate postglacial colonization patterns, diversifying natural selection and adaptation, or a combination. Adaptation could be influenced or even facilitated by the recent whole genome duplication in the salmonid lineage which resulted in a partly tetraploid species with duplicated genes and regions. In order to elucidate the genes and genomic regions underlying the genetic differences, we conducted a genome wide association study using whole genome resequencing data from eight populations from Northern and Southern Norway. From a total of ~4.5 million sequencing-derived SNPs, more than 10 % showed significant differentiation between populations from these two regions and ten selective sweeps on chromosomes 5, 10, 11, 13-15, 21, 24 and 25 were identified. These comprised 59 genes, of which 15 had one or more differentiated missense mutation. Our analysis showed that most sweeps have paralogous regions in the partially tetraploid genome, each lacking the high number of significant SNPs found in the sweeps. The most significant sweep was found on Chr 25 and carried several missense mutations in the antiviral mx genes, suggesting that these populations have experienced differing viral pressures. Interestingly the second most significant sweep, found on Chr 5, contains two genes involved in the NF-KB pathway (nkap and nkrf), which is also a known pathogen target that controls a large number of processes in animals. Our results show that natural selection acting on immune related genes has contributed to genetic divergence between salmon populations in Norway. The differences between populations may have been facilitated by the plasticity of the salmon genome. The observed signatures of selection in duplicated genomic regions suggest that the recently duplicated genome has provided raw material for evolutionary adaptation.

Positive regulation of humoral and innate immune responses induced by inactivated Avian Influenza Virus vaccine in broiler chickens.

PubMed

Abdallah, Fatma; Hassanin, Ola

2015-12-01

Avian Influenza (AI) vaccines are widely used for mammals and birds in a trial to eliminate the Avian Influenza virus (AIV) infection from the world. However and up till now the virus is still existed via modulation of its antigenic structure to evade the pressure of host immune responses. For a complete understanding of the immune responses following AI vaccination in chickens, the modulations of the chickens humoral immune responses and interferon-alpha signaling pathway, as a fundamental part of the innate immune responses, were investigated. In our study, we measured the humoral immune response using hemagglutination-inhibition (HI) and enzyme-linked immunosorbent assay (ELISA) tests. In addition, chicken interferon-alpha pathway components was measured at RNA levels using Quantitative Real-time PCR (qRT-PCR) following one dose of inactivated H5N1 influenza vaccine at 14 days of age. In this study, the protective levels of humoral antibody responses were observed at 14, 21 and 28 days following immunization with inactivated (Re-1/H5N1) AI vaccine. In the chicken spleen cells, up regulation in the chicken interferon-alpha pathway components (MX1 & IRF7) was existed as early as 48 h post vaccination and remained until 28 days post vaccination at the endogenous state. However, after the recall with ex-vivo stimulation, the up regulation was more pronounced in the transcriptional factor (IRF7) compared to the antiviral gene (MX1) at 28 days post vaccination. So far, from our results it appears that the inactivated H5N1 vaccine can trigger the chicken interferon-alpha signaling pathway as well as it can elicit protective humoral antibody responses.

Application of community phylogenetic approaches to understand gene expression: differential exploration of venom gene space in predatory marine gastropods.

PubMed

Chang, Dan; Duda, Thomas F

2014-06-05

Predatory marine gastropods of the genus Conus exhibit substantial variation in venom composition both within and among species. Apart from mechanisms associated with extensive turnover of gene families and rapid evolution of genes that encode venom components ('conotoxins'), the evolution of distinct conotoxin expression patterns is an additional source of variation that may drive interspecific differences in the utilization of species' 'venom gene space'. To determine the evolution of expression patterns of venom genes of Conus species, we evaluated the expression of A-superfamily conotoxin genes of a set of closely related Conus species by comparing recovered transcripts of A-superfamily genes that were previously identified from the genomes of these species. We modified community phylogenetics approaches to incorporate phylogenetic history and disparity of genes and their expression profiles to determine patterns of venom gene space utilization. Less than half of the A-superfamily gene repertoire of these species is expressed, and only a few orthologous genes are coexpressed among species. Species exhibit substantially distinct expression strategies, with some expressing sets of closely related loci ('under-dispersed' expression of available genes) while others express sets of more disparate genes ('over-dispersed' expression). In addition, expressed genes show higher dN/dS values than either unexpressed or ancestral genes; this implies that expression exposes genes to selection and facilitates rapid evolution of these genes. Few recent lineage-specific gene duplicates are expressed simultaneously, suggesting that expression divergence among redundant gene copies may be established shortly after gene duplication. Our study demonstrates that venom gene space is explored differentially by Conus species, a process that effectively permits the independent and rapid evolution of venoms in these species.

Peripubertal viral-like challenge and social isolation mediate overlapping but distinct effects on behaviour and brain interferon regulatory factor 7 expression in the adult Wistar rat.

PubMed

Lukasz, Bartlomiej; O'Sullivan, Niamh C; Loscher, Jennifer S; Pickering, Mark; Regan, Ciaran M; Murphy, Keith J

2013-01-01

A range of adverse, early life environmental influences such as viral infection and social deprivation are thought to increase risk of psychiatric illness later in life. Here, we used peripheral administration of the viral infection mimic polyriboinosinic-polyribocytidylic acid (polyI:C) to compare the consequences of peripubertal infection and isolation rearing. Isolation rearing induced deficits in sensorimotor gating and recognition memory while no changes in social interaction or spatial learning were observed. PolyI:C injection during the peripubertal period markedly increased expression of interferon-stimulated genes (Ifit2, Prkr, Mx2 and Irf7) in the hippocampal dentate gyrus demonstrating that peripheral administration of the viral mimic in the adolescent animal does have direct effects in the brain. Peripubertal infection mimicry induced a similar but later emerging behavioural deficit in prepulse inhibition implying the existence of a peripubertal window of opportunity for viral-mediated cytokine increases to impact brain development and function. PolyI:C treatment also impaired novel object recognition but did not alter spatial reference memory or social interaction. Combining the polyI:C challenge with social isolation did not exacerbate the behavioural deficits seen with isolation rearing alone. Using Irf7 as a marker, peripubertal viral infection mimicry, isolation rearing and a combination of both were all seen to produce a long-lasting molecular imprint on the interferon-associated signalling pathway in the principal neuron population of the hippocampal dentate gyrus. The data suggest that the sensitivity of brain structure and function to disruption by viral infection extends into the peripubertal period. Moreover, augmented interferon signalling in hippocampus may represent a common molecular imprint of environmental insults associated with neuropsychiatric illnesses like schizophrenia. Copyright © 2012 Elsevier Inc. All rights reserved.

FARO server: Meta-analysis of gene expression by matching gene expression signatures to a compendium of public gene expression data.

PubMed

Manijak, Mieszko P; Nielsen, Henrik B

2011-06-11

Although, systematic analysis of gene annotation is a powerful tool for interpreting gene expression data, it sometimes is blurred by incomplete gene annotation, missing expression response of key genes and secondary gene expression responses. These shortcomings may be partially circumvented by instead matching gene expression signatures to signatures of other experiments. To facilitate this we present the Functional Association Response by Overlap (FARO) server, that match input signatures to a compendium of 242 gene expression signatures, extracted from more than 1700 Arabidopsis microarray experiments. Hereby we present a publicly available tool for robust characterization of Arabidopsis gene expression experiments which can point to similar experimental factors in other experiments. The server is available at http://www.cbs.dtu.dk/services/faro/.

Digital gene expression analysis of the zebra finch genome

PubMed Central

2010-01-01

Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates. PMID:20359325

A novel approach for human whole transcriptome analysis based on absolute gene expression of microarray data.

PubMed

Bikel, Shirley; Jacobo-Albavera, Leonor; Sánchez-Muñoz, Fausto; Cornejo-Granados, Fernanda; Canizales-Quinteros, Samuel; Soberón, Xavier; Sotelo-Mundo, Rogerio R; Del Río-Navarro, Blanca E; Mendoza-Vargas, Alfredo; Sánchez, Filiberto; Ochoa-Leyva, Adrian

2017-01-01

In spite of the emergence of RNA sequencing (RNA-seq), microarrays remain in widespread use for gene expression analysis in the clinic. There are over 767,000 RNA microarrays from human samples in public repositories, which are an invaluable resource for biomedical research and personalized medicine. The absolute gene expression analysis allows the transcriptome profiling of all expressed genes under a specific biological condition without the need of a reference sample. However, the background fluorescence represents a challenge to determine the absolute gene expression in microarrays. Given that the Y chromosome is absent in female subjects, we used it as a new approach for absolute gene expression analysis in which the fluorescence of the Y chromosome genes of female subjects was used as the background fluorescence for all the probes in the microarray. This fluorescence was used to establish an absolute gene expression threshold, allowing the differentiation between expressed and non-expressed genes in microarrays. We extracted the RNA from 16 children leukocyte samples (nine males and seven females, ages 6-10 years). An Affymetrix Gene Chip Human Gene 1.0 ST Array was carried out for each sample and the fluorescence of 124 genes of the Y chromosome was used to calculate the absolute gene expression threshold. After that, several expressed and non-expressed genes according to our absolute gene expression threshold were compared against the expression obtained using real-time quantitative polymerase chain reaction (RT-qPCR). From the 124 genes of the Y chromosome, three genes (DDX3Y, TXLNG2P and EIF1AY) that displayed significant differences between sexes were used to calculate the absolute gene expression threshold. Using this threshold, we selected 13 expressed and non-expressed genes and confirmed their expression level by RT-qPCR. Then, we selected the top 5% most expressed genes and found that several KEGG pathways were significantly enriched. Interestingly, these pathways were related to the typical functions of leukocytes cells, such as antigen processing and presentation and natural killer cell mediated cytotoxicity. We also applied this method to obtain the absolute gene expression threshold in already published microarray data of liver cells, where the top 5% expressed genes showed an enrichment of typical KEGG pathways for liver cells. Our results suggest that the three selected genes of the Y chromosome can be used to calculate an absolute gene expression threshold, allowing a transcriptome profiling of microarray data without the need of an additional reference experiment. Our approach based on the establishment of a threshold for absolute gene expression analysis will allow a new way to analyze thousands of microarrays from public databases. This allows the study of different human diseases without the need of having additional samples for relative expression experiments.

Differential gene expression analysis in glioblastoma cells and normal human brain cells based on GEO database.

PubMed

Wang, Anping; Zhang, Guibin

2017-11-01

The differentially expressed genes between glioblastoma (GBM) cells and normal human brain cells were investigated to performed pathway analysis and protein interaction network analysis for the differentially expressed genes. GSE12657 and GSE42656 gene chips, which contain gene expression profile of GBM were obtained from Gene Expression Omniub (GEO) database of National Center for Biotechnology Information (NCBI). The 'limma' data packet in 'R' software was used to analyze the differentially expressed genes in the two gene chips, and gene integration was performed using 'RobustRankAggreg' package. Finally, pheatmap software was used for heatmap analysis and Cytoscape, DAVID, STRING and KOBAS were used for protein-protein interaction, Gene Ontology (GO) and KEGG analyses. As results: i) 702 differentially expressed genes were identified in GSE12657, among those genes, 548 were significantly upregulated and 154 were significantly downregulated (p<0.01, fold-change >1), and 1,854 differentially expressed genes were identified in GSE42656, among the genes, 1,068 were significantly upregulated and 786 were significantly downregulated (p<0.01, fold-change >1). A total of 167 differentially expressed genes including 100 upregulated genes and 67 downregulated genes were identified after gene integration, and the genes showed significantly different expression levels in GBM compared with normal human brain cells (p<0.05). ii) Interactions between the protein products of 101 differentially expressed genes were identified using STRING and expression network was established. A key gene, called CALM3, was identified by Cytoscape software. iii) GO enrichment analysis showed that differentially expressed genes were mainly enriched in 'neurotransmitter:sodium symporter activity' and 'neurotransmitter transporter activity', which can affect the activity of neurotransmitter transportation. KEGG pathway analysis showed that the differentially expressed genes were mainly enriched in 'protein processing in endoplasmic reticulum', which can affect protein processing in endoplasmic reticulum. The results showed that: i) 167 differentially expressed genes were identified from two gene chips after integration; and ii) protein interaction network was established, and GO and KEGG pathway analyses were successfully performed to identify and annotate the key gene, which provide new insights for the studies on GBN at gene level.

Discovery and validation of a glioblastoma co-expressed gene module

PubMed Central

Dunwoodie, Leland J.; Poehlman, William L.; Ficklin, Stephen P.; Feltus, Frank Alexander

2018-01-01

Tumors exhibit complex patterns of aberrant gene expression. Using a knowledge-independent, noise-reducing gene co-expression network construction software called KINC, we created multiple RNAseq-based gene co-expression networks relevant to brain and glioblastoma biology. In this report, we describe the discovery and validation of a glioblastoma-specific gene module that contains 22 co-expressed genes. The genes are upregulated in glioblastoma relative to normal brain and lower grade glioma samples; they are also hypo-methylated in glioblastoma relative to lower grade glioma tumors. Among the proneural, neural, mesenchymal, and classical glioblastoma subtypes, these genes are most-highly expressed in the mesenchymal subtype. Furthermore, high expression of these genes is associated with decreased survival across each glioblastoma subtype. These genes are of interest to glioblastoma biology and our gene interaction discovery and validation workflow can be used to discover and validate co-expressed gene modules derived from any co-expression network. PMID:29541392

Discovery and validation of a glioblastoma co-expressed gene module.

PubMed

Dunwoodie, Leland J; Poehlman, William L; Ficklin, Stephen P; Feltus, Frank Alexander

2018-02-16

Tumors exhibit complex patterns of aberrant gene expression. Using a knowledge-independent, noise-reducing gene co-expression network construction software called KINC, we created multiple RNAseq-based gene co-expression networks relevant to brain and glioblastoma biology. In this report, we describe the discovery and validation of a glioblastoma-specific gene module that contains 22 co-expressed genes. The genes are upregulated in glioblastoma relative to normal brain and lower grade glioma samples; they are also hypo-methylated in glioblastoma relative to lower grade glioma tumors. Among the proneural, neural, mesenchymal, and classical glioblastoma subtypes, these genes are most-highly expressed in the mesenchymal subtype. Furthermore, high expression of these genes is associated with decreased survival across each glioblastoma subtype. These genes are of interest to glioblastoma biology and our gene interaction discovery and validation workflow can be used to discover and validate co-expressed gene modules derived from any co-expression network.

Effectiveness of different avian influenza (H5) vaccination regimens in layer chickens on the humoral immune response and interferon-alpha signalling immune marker.

PubMed

Hamad, Mustafa; Amen, Omar; Mahmoud, Mohamed; Hassanin, Ola; Saif-Edin, Mostafa

2018-06-01

Avian influenza (AI) vaccines are widely used to control and eliminate the ongoing avian influenza virus epidemic in Egypt. A strict vaccination policy with inactivated AI vaccines has been widely applied, however the virus still circulating, evolving and causing great negative impact to the poultry sector in Egypt. Therefore, an updated poultry vaccination policy using different vaccine technologies might be valuable as an innovative additional control strategy of AIV in Egypt. In the present study, the effectiveness of different avian influenza (AI) vaccination schedules was evaluated in 300 commercial layer chicks (ISA White) using either the oil-emulsion baculovirus-H5-prototype vaccine (baculovirus-H5 prototype) or turkey herpesvirus (HVT) vector vaccine containing the hemagglutinin (HA) gene from H5N1 strain (rHVT-H5), applied alone or in combination and in different settings. Vaccination with either two injections of the baculovirus-H5 prototype, a single injection of rHVT-H5 or priming with rHVT-H5 at 1 day old followed by boosting with the baculovirus-H5 prototype induced AI-HI protective antibody responses starting as early as 3 to 4 weeks of age and lasting up to the end of the rearing period (16 weeks). A single vaccination with the baculovirus-H5 prototype did not generate a protective antibody titre for the entire rearing period. Furthermore, the present study elucidated that vaccination once or twice with the baculovirus-H5 vaccine prototype activated the chicken interferon-alpha (Ch-IFN-alpha) signalling pathway via transduction of antiviral components, e.g., Mx1 and IRF7. Birds immunized once with rHVT-H5 at 1 day old did not show activation of the Mx1 and IRF7 transcripts; however, following boosting with the baculovirus-H5 prototype vaccine, up-regulation of Mx1 and IRF7 was observed. Based on our findings, it can be concluded that either reinforcement with two injections of the baculovirus-H5 prototype or prime-boost vaccination (rHVT-H5 at 1 day old followed by the baculovirus-H5 prototype vaccine at 8 days old) is a successful strategy to induce both innate and humoral immune responses and could be recommended for the layer production sector over the entire rearing period, especially in AI-endemic areas.

Rebmab200, a humanized monoclonal antibody targeting the sodium phosphate transporter NaPi2b displays strong immune mediated cytotoxicity against cancer: a novel reagent for targeted antibody therapy of cancer.

PubMed

Lopes dos Santos, Mariana; Yeda, Fernanda Perez; Tsuruta, Lilian Rumi; Horta, Bruno Brasil; Pimenta, Alécio A; Degaki, Theri Leica; Soares, Ibere C; Tuma, Maria Carolina; Okamoto, Oswaldo Keith; Alves, Venancio A F; Old, Lloyd J; Ritter, Gerd; Moro, Ana Maria

2013-01-01

NaPi2b, a sodium-dependent phosphate transporter, is highly expressed in ovarian carcinomas and is recognized by the murine monoclonal antibody MX35. The antibody had shown excellent targeting to ovarian cancer in several early phase clinical trials but being murine the antibody's full therapeutic potential could not be explored. To overcome this impediment we developed a humanized antibody version named Rebmab200, expressed in human PER.C6® cells and cloned by limiting dilution. In order to select a clone with high therapeutic potential clones were characterized using a series of physicochemical assays, flow cytometry, real-time surface plasmon resonance, glycosylation analyses, immunohistochemistry, antibody-dependent cell-mediated cytotoxicity, complement-dependent-cytotoxicity assays and quantitative PCR. Comparative analyses of Rebmab200 and MX35 monoclonal antibodies demonstrated that the two antibodies had similar specificity for NaPi2b by flow cytometry with a panel of 30 cell lines and maintained similar kinetic parameters. Robust and high producer cell clones potentially suitable for use in manufacturing were obtained. Rebmab200 antibodies were assessed by immunohistochemistry using a large panel of tissues including human carcinomas of ovarian, lung, kidney and breast origin. An assessment of its binding towards 33 normal human organs was performed as well. Rebmab200 showed selected strong reactivity with the tested tumor types but little or no reactivity with the normal tissues tested confirming its potential for targeted therapeutics strategies. The remarkable cytotoxicity shown by Rebmab200 in OVCAR-3 cells is a significant addition to the traits of stability and productivity displayed by the top clones of Rebmab200. Antibody-dependent cell-mediated toxicity functionality was confirmed in repeated assays using cancer cell lines derived from ovary, kidney and lung as targets. To explore use of this antibody in clinical trials, GMP production of Rebmab200 has been initiated. As the next step of development, Phase I clinical trials are now planned for translation of Rebmab200 into the clinic.

Rebmab200, a Humanized Monoclonal Antibody Targeting the Sodium Phosphate Transporter NaPi2b Displays Strong Immune Mediated Cytotoxicity against Cancer: A Novel Reagent for Targeted Antibody Therapy of Cancer

PubMed Central

dos Santos, Mariana Lopes; Yeda, Fernanda Perez; Tsuruta, Lilian Rumi; Horta, Bruno Brasil; Pimenta, Alécio A.; Degaki, Theri Leica; Soares, Ibere C.; Tuma, Maria Carolina; Okamoto, Oswaldo Keith; Alves, Venancio A. F.; Ritter, Gerd; Moro, Ana Maria

2013-01-01

NaPi2b, a sodium-dependent phosphate transporter, is highly expressed in ovarian carcinomas and is recognized by the murine monoclonal antibody MX35. The antibody had shown excellent targeting to ovarian cancer in several early phase clinical trials but being murine the antibody's full therapeutic potential could not be explored. To overcome this impediment we developed a humanized antibody version named Rebmab200, expressed in human PER.C6® cells and cloned by limiting dilution. In order to select a clone with high therapeutic potential clones were characterized using a series of physicochemical assays, flow cytometry, real-time surface plasmon resonance, glycosylation analyses, immunohistochemistry, antibody-dependent cell-mediated cytotoxicity, complement-dependent-cytotoxicity assays and quantitative PCR. Comparative analyses of Rebmab200 and MX35 monoclonal antibodies demonstrated that the two antibodies had similar specificity for NaPi2b by flow cytometry with a panel of 30 cell lines and maintained similar kinetic parameters. Robust and high producer cell clones potentially suitable for use in manufacturing were obtained. Rebmab200 antibodies were assessed by immunohistochemistry using a large panel of tissues including human carcinomas of ovarian, lung, kidney and breast origin. An assessment of its binding towards 33 normal human organs was performed as well. Rebmab200 showed selected strong reactivity with the tested tumor types but little or no reactivity with the normal tissues tested confirming its potential for targeted therapeutics strategies. The remarkable cytotoxicity shown by Rebmab200 in OVCAR-3 cells is a significant addition to the traits of stability and productivity displayed by the top clones of Rebmab200. Antibody-dependent cell-mediated toxicity functionality was confirmed in repeated assays using cancer cell lines derived from ovary, kidney and lung as targets. To explore use of this antibody in clinical trials, GMP production of Rebmab200 has been initiated. As the next step of development, Phase I clinical trials are now planned for translation of Rebmab200 into the clinic. PMID:23936189

Qualitative Results from a Flight Investigation to Determine Aileron Effectiveness of Two Rocket-Propelled 1/20-Scale Models of the MX -76 Missile

NASA Technical Reports Server (NTRS)

Stevens, Joseph E.

1955-01-01

Free-flight tests of two rocket-propelled l/20-scale models of the Bell MX-776 missile have been conducted to obtain measurements of the aileron deflection required to counteract the induced rolling moments caused by combined angles of attack and sideslip and thus to determine whether the ailerons provided were capable of controlling the model at the attitudes produced by the test conditions. Inability to obtain reasonably steady-state conditions and superimposed high-frequency oscillations in the data precluded any detailed analysis of the results obtained from the tests. For these reasons, the data presented are limited largely to qualitative results.

Analysis of DuPont and Kodak duplicating films and chemistries in a Fultron spray processor

NASA Technical Reports Server (NTRS)

Weinstein, M. S.

1972-01-01

A test program was conducted with duPont duplicating film type SR 112 and SCOLOR developer and Kodak duplicating film types 2430, 2422, and FE 2628 (SO-467) and MX-641 developer to determine sensitometric and image quality characteristics of these materials when used with a fultron spray processor. The test results show that the SCOLOR developer foams excessively in the fultron processor when used with or without the addition of an antifoaming agent. The Kodak type FE 2628 film with MX-641 chemistry had the longest linear Log E range at a 1.0 gamma. Sensitometric curves and granularity traces for all film process combinations tested are included.